#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
AGRN	375790	broad.mit.edu	37	1	978663	978663	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:978663G>C	ENST00000379370.2	+	8	1479	c.1429G>C	c.(1429-1431)Gcg>Ccg	p.A477P		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	477					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		TGCATTTGGGGCGACGTGTGC	0.662																																							uc001ack.1		NA																	0				central_nervous_system(2)|breast(1)	3						c.(1429-1431)GCG>CCG		agrin precursor							80.0	66.0	71.0					1																	978663		2197	4297	6494	SO:0001583	missense	375790				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton	g.chr1:978663G>C	XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.1429G>C	1.37:g.978663G>C	ENSP00000368678:p.Ala477Pro						p.A477P	NM_198576	NP_940978	O00468	AGRIN_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)	8	1479	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)	477					Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Missense_Mutation	SNP	ENST00000379370.2	37	c.1429G>C	CCDS30551.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.901763	0.52227	.	.	ENSG00000188157	ENST00000379370	T	0.75589	-0.95	4.63	4.63	0.57726	Follistatin-like, N-terminal (1);	0.000000	0.64402	D	0.000007	T	0.79839	0.4515	L	0.36672	1.1	0.58432	D	0.999998	D	0.76494	0.999	D	0.87578	0.998	T	0.81852	-0.0742	10	0.72032	D	0.01	-17.9491	13.3796	0.60761	0.0:0.0:0.842:0.158	.	477	O00468	AGRIN_HUMAN	P	477	ENSP00000368678:A477P	ENSP00000368678:A477P	A	+	1	0	AGRN	968526	1.000000	0.71417	0.577000	0.28562	0.003000	0.03518	9.082000	0.94059	2.126000	0.65437	0.655000	0.94253	GCG		0.662	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097990.2	NM_198576		4	14	0	0	0	0.009096	0	4	14				
SCNN1D	6339	broad.mit.edu	37	1	1221509	1221509	+	Silent	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:1221509G>T	ENST00000338555.2	+	4	1414	c.270G>T	c.(268-270)ctG>ctT	p.L90L	SCNN1D_ENST00000379116.5_Silent_p.L254L|SCNN1D_ENST00000400928.3_Silent_p.L90L|SCNN1D_ENST00000325425.8_Silent_p.L156L			P51172	SCNND_HUMAN	sodium channel, non-voltage-gated 1, delta subunit	90					ion transmembrane transport (GO:0034220)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ligand-gated sodium channel activity (GO:0015280)			lung(6)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)	Amiloride(DB00594)|Triamterene(DB00384)	CCTGGGGGCTGCTGTCCCTGG	0.682																																							uc001adu.1		NA																	0					0						c.(268-270)CTG>CTT		sodium channel, nonvoltage-gated 1, delta							25.0	27.0	26.0					1																	1221509		2181	4283	6464	SO:0001819	synonymous_variant	6339							g.chr1:1221509G>T	U38254	CCDS44037.1, CCDS44037.2	1p36.3-p36.2	2012-02-28	2012-02-28		ENSG00000162572	ENSG00000162572		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10601	protein-coding gene	gene with protein product		601328	"""sodium channel, nonvoltage-gated 1, delta"", ""sodium channel, non-voltage-gated 1, delta"""			8661065	Standard	NM_001130413		Approved	ENaCdelta, dNaCh	uc001adt.1	P51172	OTTHUMG00000002081	ENST00000338555.2:c.270G>T	1.37:g.1221509G>T						SCNN1D_uc001adt.1_Silent_p.L254L|SCNN1D_uc001adw.2_Silent_p.L156L|SCNN1D_uc001adx.2_5'UTR|SCNN1D_uc001adv.2_Silent_p.L90L	p.L90L	NM_002978	NP_002969				Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)	6	894	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)						A9Z1X6|B1PS44|Q08AQ3|Q09HT0|Q5T7L3|Q8NA24	Silent	SNP	ENST00000338555.2	37	c.270G>T																																																																																					0.682	SCNN1D-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000005802.2	NM_002978		7	12	1	0	0.00198382	0.001984	0.00205467	7	12				
MXRA8	54587	broad.mit.edu	37	1	1290159	1290159	+	Silent	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:1290159G>C	ENST00000309212.6	-	5	882	c.852C>G	c.(850-852)cgC>cgG	p.R284R	MXRA8_ENST00000445648.2_Silent_p.R284R|MXRA8_ENST00000342753.4_Silent_p.R183R|MXRA8_ENST00000477278.2_Silent_p.R275R	NM_001282582.1|NM_032348.2	NP_001269511.1|NP_115724.1	Q9BRK3	MXRA8_HUMAN	matrix-remodelling associated 8	284	Ig-like V-type 2.				establishment of glial blood-brain barrier (GO:0060857)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(3)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GGAAGACGCGGCGTTCGTGCA	0.711																																							uc001aew.2		NA																	0					0						c.(850-852)CGC>CGG		matrix-remodelling associated 8 precursor							23.0	28.0	26.0					1																	1290159		2194	4294	6488	SO:0001819	synonymous_variant	54587					integral to membrane		g.chr1:1290159G>C	BC006213	CCDS24.1, CCDS59950.1, CCDS59951.1, CCDS59952.1	1p36.33	2013-01-11			ENSG00000162576	ENSG00000162576		"""Immunoglobulin superfamily / V-set domain containing"""	7542	protein-coding gene	gene with protein product	"""limitrin"""					14603461	Standard	XM_005244758		Approved	DKFZp586E2023	uc001aew.3	Q9BRK3	OTTHUMG00000002973	ENST00000309212.6:c.852C>G	1.37:g.1290159G>C						MXRA8_uc001aex.3_Silent_p.R284R|MXRA8_uc001aey.3_Silent_p.R284R|MXRA8_uc010nyl.1_Silent_p.R284R|MXRA8_uc001aez.2_Silent_p.R183R|MXRA8_uc001afa.2_Silent_p.R275R	p.R284R	NM_032348	NP_115724	Q9BRK3	MXRA8_HUMAN		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)	5	883	-	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	284			Ig-like V-type 2.|Extracellular (Potential).		B3KTR6|B4DE34|Q5TA39|Q96KC3	Silent	SNP	ENST00000309212.6	37	c.852C>G	CCDS24.1																																																																																				0.711	MXRA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008282.2	NM_032348		4	24	0	0	0	0.009096	0	4	24				
PLCH2	9651	broad.mit.edu	37	1	2436043	2436043	+	Silent	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:2436043C>A	ENST00000419816.2	+	22	3916	c.3642C>A	c.(3640-3642)ccC>ccA	p.P1214P	PLCH2_ENST00000378488.3_Silent_p.P1178P|PLCH2_ENST00000378486.3_Silent_p.P1214P|PLCH2_ENST00000449969.1_3'UTR			O75038	PLCH2_HUMAN	phospholipase C, eta 2	1214					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		AGCGGCCTCCCATACCTGACG	0.687																																							uc001aji.1		NA																	0				central_nervous_system(3)|ovary(1)|skin(1)	5						c.(3640-3642)CCC>CCA		phospholipase C, eta 2							47.0	55.0	52.0					1																	2436043		1992	4148	6140	SO:0001819	synonymous_variant	9651				intracellular signal transduction|lipid catabolic process	cytoplasm|plasma membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr1:2436043C>A	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.3642C>A	1.37:g.2436043C>A						PLCH2_uc010nyz.1_3'UTR|PLCH2_uc009vle.1_Silent_p.P966P|PLCH2_uc001ajj.1_3'UTR|PLCH2_uc001ajk.1_3'UTR|PLCH2_uc001ajl.1_Silent_p.P66P	p.P1214P	NM_014638	NP_055453	O75038	PLCH2_HUMAN		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)	22	3916	+	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)	1214					A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Silent	SNP	ENST00000419816.2	37	c.3642C>A		.	.	.	.	.	.	.	.	.	.	C	0.044	-1.274232	0.01421	.	.	ENSG00000149527	ENST00000419816	.	.	.	4.12	-8.23	0.01033	.	16.370700	0.00166	N	0.000000	T	0.17916	0.0430	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.08371	-1.0725	6	0.26408	T	0.33	.	2.6686	0.05061	0.0932:0.2384:0.2244:0.444	.	.	.	.	Q	509	.	ENSP00000389803:P509Q	P	+	2	0	PLCH2	2425903	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.367000	0.00128	-1.728000	0.01366	-0.258000	0.10820	CCA		0.687	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638		22	46	1	0	7.41877e-09	0.012319	8.2472e-09	22	46				
KIF1B	23095	broad.mit.edu	37	1	10327466	10327466	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:10327466G>C	ENST00000377086.1	+	6	660	c.458G>C	c.(457-459)aGa>aCa	p.R153T	KIF1B_ENST00000377093.4_Missense_Mutation_p.R153T|KIF1B_ENST00000263934.6_Missense_Mutation_p.R153T|KIF1B_ENST00000377081.1_Missense_Mutation_p.R153T|KIF1B_ENST00000377083.1_Missense_Mutation_p.R153T			O60333	KIF1B_HUMAN	kinesin family member 1B	153	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TACTGTGAAAGAGTACGAGAT	0.433																																							uc001aqx.3		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(457-459)AGA>ACA		kinesin family member 1B isoform b							87.0	80.0	83.0					1																	10327466		2203	4300	6503	SO:0001583	missense	23095				anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding	g.chr1:10327466G>C	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.458G>C	1.37:g.10327466G>C	ENSP00000366290:p.Arg153Thr					KIF1B_uc001aqv.3_Missense_Mutation_p.R153T|KIF1B_uc001aqw.3_Missense_Mutation_p.R153T|KIF1B_uc001aqy.2_Missense_Mutation_p.R153T|KIF1B_uc001aqz.2_Missense_Mutation_p.R153T|KIF1B_uc001ara.2_Missense_Mutation_p.R153T|KIF1B_uc001arb.2_Missense_Mutation_p.R153T|KIF1B_uc009vmt.2_RNA	p.R153T	NM_015074	NP_055889	O60333	KIF1B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)	6	660	+	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)	153			Kinesin-motor.		A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37	c.458G>C		.	.	.	.	.	.	.	.	.	.	G	32	5.121359	0.94385	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377093;ENST00000377086;ENST00000377083;ENST00000377081	T;T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84;-0.84	5.62	5.62	0.85841	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	T	0.81819	0.4903	L	0.33710	1.025	0.80722	D	1	D;D;D;D;P;D;D	0.76494	0.999;0.999;0.999;0.999;0.641;0.985;0.995	D;D;D;D;B;D;D	0.91635	0.987;0.987;0.996;0.999;0.283;0.955;0.965	T	0.83007	-0.0174	10	0.87932	D	0	.	20.0172	0.97481	0.0:0.0:1.0:0.0	.	153;153;153;153;153;153;153	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2;O60333-3	.;.;.;.;KIF1B_HUMAN;.;.	T	153	ENSP00000263934:R153T;ENSP00000366297:R153T;ENSP00000366290:R153T;ENSP00000366287:R153T;ENSP00000366284:R153T	ENSP00000263934:R153T	R	+	2	0	KIF1B	10250053	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.813000	0.99286	2.814000	0.96858	0.585000	0.79938	AGA		0.433	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1			4	50	0	0	0	0.001168	0	4	50				
RSC1A1	6248	broad.mit.edu	37	1	15987288	15987288	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:15987288G>C	ENST00000345034.1	+	1	925	c.925G>C	c.(925-927)Gat>Cat	p.D309H	DDI2_ENST00000480945.1_3'UTR	NM_006511.1	NP_006502.1	Q92681	RSCA1_HUMAN	regulatory solute carrier protein, family 1, member 1	309					intestinal absorption (GO:0050892)|negative regulation of transport (GO:0051051)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	brush border (GO:0005903)|cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel inhibitor activity (GO:0008200)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)	11		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00276)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TTCCACTCAGGATTTACAGCC	0.393																																							uc010obn.1		NA																	0				ovary(1)	1						c.(925-927)GAT>CAT		regulatory solute carrier protein, family 1,							71.0	70.0	70.0					1																	15987288		2203	4300	6503	SO:0001583	missense	6248				negative regulation of transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transport	cell junction|Golgi apparatus|nucleus	ion channel inhibitor activity	g.chr1:15987288G>C	BN000122, X82877	CCDS161.1	1p36.1	1998-08-25			ENSG00000215695	ENSG00000215695			10458	protein-coding gene	gene with protein product		601966					Standard	NM_006511		Approved	RS1	uc010obn.2	Q92681	OTTHUMG00000067830	ENST00000345034.1:c.925G>C	1.37:g.15987288G>C	ENSP00000341963:p.Asp309His						p.D309H	NM_006511	NP_006502	Q92681	RSCA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	1	925	+		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00276)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)	309					B2RBP5	Missense_Mutation	SNP	ENST00000345034.1	37	c.925G>C	CCDS161.1	.	.	.	.	.	.	.	.	.	.	G	13.87	2.367140	0.41902	.	.	ENSG00000215695	ENST00000345034	T	0.35236	1.32	5.61	3.6	0.41247	.	0.538288	0.15572	N	0.255411	T	0.40498	0.1119	L	0.27053	0.805	0.24354	N	0.994906	D	0.69078	0.997	P	0.61003	0.882	T	0.13845	-1.0494	10	0.72032	D	0.01	-26.2455	9.1592	0.37012	0.1879:0.0:0.8121:0.0	.	309	Q92681	RSCA1_HUMAN	H	309	ENSP00000341963:D309H	ENSP00000341963:D309H	D	+	1	0	RSC1A1	15859875	0.979000	0.34478	1.000000	0.80357	0.382000	0.30200	1.773000	0.38563	1.240000	0.43803	0.561000	0.74099	GAT		0.393	RSC1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145500.1	NM_006511		12	51	0	0	0	0.010729	0	12	51				
NBPF1	55672	broad.mit.edu	37	1	16895712	16895712	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:16895712C>G	ENST00000430580.2	-	23	3357	c.2470G>C	c.(2470-2472)Gag>Cag	p.E824Q	NBPF1_ENST00000287968.8_3'UTR|NBPF1_ENST00000432949.1_Intron|NBPF1_ENST00000420031.2_3'UTR	NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	824	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.|Poly-Glu.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		ACTTCCTCCTCTTCAGACTCC	0.478																																							uc009vos.1		NA																	0					0						c.(2470-2472)GAG>CAG		hypothetical protein LOC55672							37.0	35.0	35.0					1																	16895712		1468	3234	4702	SO:0001583	missense	55672					cytoplasm		g.chr1:16895712C>G	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.2470G>C	1.37:g.16895712C>G	ENSP00000474456:p.Glu824Gln					NBPF1_uc009vot.1_Missense_Mutation_p.E282Q|NBPF1_uc001ayz.1_Missense_Mutation_p.E282Q|NBPF1_uc010oce.1_Missense_Mutation_p.E553Q	p.E824Q	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)	23	3358	-			824			NBPF 4.|Poly-Glu.		Q8N4E8|Q9C0H0	Missense_Mutation	SNP	ENST00000430580.2	37	c.2470G>C																																																																																					0.478	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000106436.3	NM_017940		8	195	0	0	0	0.001855	0	8	195				
MST1L	11223	broad.mit.edu	37	1	17087593	17087593	+	RNA	SNP	C	C	T	rs12145944	byFrequency	TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:17087593C>T	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										ATGGCGAGCGCTGCCCTGCAG	0.577																																							uc010ock.1		NA																	0					0						c.(70-72)CAG>CAA		SubName: Full=Hepatocyte growth factor-like protein homolog;																																						11223							g.chr1:17087593C>T	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17087593C>T						CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'Flank	p.Q24Q	NR_002729						2	72	-								B7WPB1|Q13209	Silent	SNP	ENST00000455405.2	37	c.72G>A																																																																																					0.577	MST1L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000400328.1	NM_001271733		3	28	0	0	0	0.004672	0	3	28				
HSPG2	3339	broad.mit.edu	37	1	22205522	22205522	+	Silent	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:22205522C>A	ENST00000374695.3	-	18	2515	c.2436G>T	c.(2434-2436)cgG>cgT	p.R812R		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	812	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	AAGGGCAGGGCCGGCAGGAAG	0.617																																							uc001bfj.2		NA																	0				ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9						c.(2434-2436)CGG>CGT		heparan sulfate proteoglycan 2 precursor	Becaplermin(DB00102)|Palifermin(DB00039)						49.0	51.0	50.0					1																	22205522		2203	4300	6503	SO:0001819	synonymous_variant	3339				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding	g.chr1:22205522C>A	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.2436G>T	1.37:g.22205522C>A						HSPG2_uc009vqd.2_Silent_p.R813R	p.R812R	NM_005529	NP_005520	P98160	PGBM_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	18	2476	-		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	812			Laminin EGF-like 2.		Q16287|Q5SZI3|Q9H3V5	Silent	SNP	ENST00000374695.3	37	c.2436G>T	CCDS30625.1																																																																																				0.617	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529		14	13	1	0	6.72482e-11	0.003163	7.64132e-11	14	13				
CNKSR1	10256	broad.mit.edu	37	1	26514740	26514740	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:26514740C>G	ENST00000374253.5	+	17	1530	c.1491C>G	c.(1489-1491)ctC>ctG	p.L497L	CNKSR1_ENST00000361530.6_Silent_p.L490L|CNKSR1_ENST00000531191.1_Silent_p.L232L|CATSPER4_ENST00000456354.2_5'Flank	NM_006314.2	NP_006305.2	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras 1	497	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				Ras protein signal transduction (GO:0007265)|Rho protein signal transduction (GO:0007266)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|plasma membrane (GO:0005886)	protein binding, bridging (GO:0030674)	p.L490L(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	28		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		TGCGTCATCTCATTACCTGCA	0.582																																					NSCLC(180;1396 2109 28270 30756 34275)	NSCLC(180;1396 2109 28270 30756 34275)	uc001bln.3		NA																	1	Substitution - coding silent(1)		breast(1)	lung(1)|kidney(1)	2						c.(1489-1491)CTC>CTG		connector enhancer of kinase suppressor of Ras							98.0	94.0	95.0					1																	26514740		2203	4300	6503	SO:0001819	synonymous_variant	10256				Rho protein signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cell cortex|cell-cell junction	protein binding, bridging	g.chr1:26514740C>G	AF100153	CCDS276.1, CCDS72732.1	1p35.3	2013-01-10			ENSG00000142675	ENSG00000142675		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19700	protein-coding gene	gene with protein product		603272				9814705	Standard	NM_006314		Approved	CNK1, KSR, CNK	uc001blm.4	Q969H4	OTTHUMG00000007541	ENST00000374253.5:c.1491C>G	1.37:g.26514740C>G						CNKSR1_uc001blm.3_Silent_p.L490L|CNKSR1_uc009vsd.2_Silent_p.L232L|CNKSR1_uc009vse.2_Silent_p.L232L|CNKSR1_uc001blo.2_Silent_p.L232L|CATSPER4_uc010oey.1_5'Flank|CATSPER4_uc010oez.1_5'Flank|CATSPER4_uc009vsf.2_5'Flank	p.L497L	NM_006314	NP_006305	Q969H4	CNKR1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)	17	1549	+		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)	497			PH.		B1AMW9|O95381	Silent	SNP	ENST00000374253.5	37	c.1491C>G																																																																																					0.582	CNKSR1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000089943.2	NM_006314		6	46	0	0	0	0.001984	0	6	46				
FGR	2268	broad.mit.edu	37	1	27942117	27942117	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:27942117C>T	ENST00000374005.3	-	9	1134	c.846G>A	c.(844-846)tgG>tgA	p.W282*	FGR_ENST00000374004.1_Nonsense_Mutation_p.W282*|FGR_ENST00000545953.1_Nonsense_Mutation_p.W216*|FGR_ENST00000399173.1_Nonsense_Mutation_p.W282*	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	282	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		TGCTGCCGTTCCACGTGCCTG	0.687																																							uc001boj.2		NA																	0				skin(2)	2						c.(844-846)TGG>TGA		proto-oncogene tyrosine-protein kinase FGR							58.0	48.0	51.0					1																	27942117		2203	4300	6503	SO:0001587	stop_gained	2268				platelet activation|response to virus	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr1:27942117C>T	BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.846G>A	1.37:g.27942117C>T	ENSP00000363117:p.Trp282*					FGR_uc001boi.2_5'UTR|FGR_uc001bok.2_Nonsense_Mutation_p.W282*|FGR_uc001bol.2_Nonsense_Mutation_p.W282*|FGR_uc001bom.2_Nonsense_Mutation_p.W282*	p.W282*	NM_005248	NP_005239	P09769	FGR_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)	7	992	-		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	282			Protein kinase.		D3DPL7|Q9UIQ3	Nonsense_Mutation	SNP	ENST00000374005.3	37	c.846G>A	CCDS305.1	.	.	.	.	.	.	.	.	.	.	C	37	6.184704	0.97357	.	.	ENSG00000000938	ENST00000374005;ENST00000545953;ENST00000399173;ENST00000374004;ENST00000374003;ENST00000457296	.	.	.	5.03	5.03	0.67393	.	0.000000	0.56097	D	0.000030	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.3171	0.87227	0.0:1.0:0.0:0.0	.	.	.	.	X	282;216;282;282;282;282	.	ENSP00000363115:W282X	W	-	3	0	FGR	27814704	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.694000	0.84235	2.508000	0.84585	0.491000	0.48974	TGG		0.687	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009772.1	NM_005248		5	21	0	0	0	0.001168	0	5	21				
PTPRU	10076	broad.mit.edu	37	1	29639188	29639188	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:29639188C>G	ENST00000345512.3	+	23	3356	c.3227C>G	c.(3226-3228)cCt>cGt	p.P1076R	PTPRU_ENST00000428026.2_Missense_Mutation_p.P1063R|PTPRU_ENST00000356870.3_Missense_Mutation_p.P1072R|PTPRU_ENST00000460170.2_Missense_Mutation_p.P1072R|PTPRU_ENST00000415600.2_3'UTR|PTPRU_ENST00000323874.8_Missense_Mutation_p.P1072R|PTPRU_ENST00000373779.3_Missense_Mutation_p.P1066R	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	1076	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		TCCACCCCACCTGATGCCGGG	0.642																																							uc001bru.2		NA																	0				large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7						c.(3226-3228)CCT>CGT		protein tyrosine phosphatase, receptor type, U							23.0	23.0	23.0					1																	29639188		2202	4298	6500	SO:0001583	missense	10076				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr1:29639188C>G	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.3227C>G	1.37:g.29639188C>G	ENSP00000334941:p.Pro1076Arg					PTPRU_uc001brv.2_Missense_Mutation_p.P1072R|PTPRU_uc001brw.2_Missense_Mutation_p.P1066R|PTPRU_uc009vtq.2_Missense_Mutation_p.P1072R|PTPRU_uc009vtr.2_Missense_Mutation_p.P1063R	p.P1076R	NM_005704	NP_005695	Q92729	PTPRU_HUMAN		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)	23	3337	+		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)	1076			Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).		A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	ENST00000345512.3	37	c.3227C>G	CCDS334.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.538634	0.85917	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53	4.36	4.36	0.52297	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.066355	0.64402	D	0.000008	T	0.52709	0.1751	M	0.69823	2.125	0.80722	D	1	D;D;D;D;D	0.71674	0.998;0.998;0.998;0.998;0.998	P;P;P;D;D	0.66351	0.906;0.906;0.906;0.943;0.943	T	0.53802	-0.8387	9	.	.	.	.	16.421	0.83758	0.0:1.0:0.0:0.0	.	1063;1072;1066;1072;1076	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	R	1076;1066;1072;1072;1063;1072	ENSP00000334941:P1076R;ENSP00000362884:P1066R;ENSP00000349333:P1072R;ENSP00000314987:P1072R;ENSP00000392332:P1063R;ENSP00000432906:P1072R	.	P	+	2	0	PTPRU	29511775	1.000000	0.71417	0.935000	0.37517	0.959000	0.62525	5.892000	0.69790	2.424000	0.82194	0.655000	0.94253	CCT		0.642	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1			3	28	0	0	0	0.004672	0	3	28				
SH3D21	79729	broad.mit.edu	37	1	36785389	36785389	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:36785389G>A	ENST00000426732.2	+	13	1062	c.777G>A	c.(775-777)aaG>aaA	p.K259K	EVA1B_ENST00000490466.1_5'Flank|SH3D21_ENST00000453908.2_Silent_p.K375K|SH3D21_ENST00000312808.4_Silent_p.K21K|SH3D21_ENST00000505871.1_Silent_p.K264K			A4FU49	SH321_HUMAN	SH3 domain containing 21	259						extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(6)|lung(4)|pancreas(1)	12						CCAGCTCCAAGAAGATCCCGG	0.632																																							uc010oia.1		NA																	0					0						c.(1123-1125)AAG>AAA		SH3 domain-containing protein C1orf113 isoform							38.0	49.0	46.0					1																	36785389		2203	4300	6503	SO:0001819	synonymous_variant	79729							g.chr1:36785389G>A	AK056459	CCDS30674.1, CCDS30674.2	1p34.3	2011-02-21	2011-02-21	2011-02-21	ENSG00000214193	ENSG00000214193			26236	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 113"""	C1orf113		12477932	Standard	NM_024676		Approved	FLJ22938	uc010oia.1	A4FU49	OTTHUMG00000007868	ENST00000426732.2:c.777G>A	1.37:g.36785389G>A						C1orf113_uc010oib.1_Silent_p.K264K|C1orf113_uc010oic.1_RNA|C1orf113_uc009vuz.1_Silent_p.K21K	p.K375K	NM_001162530	NP_001156002	A4FU49	SH321_HUMAN			14	1153	+		Myeloproliferative disorder(586;0.0393)	259					B4DLI6|D3DPS6|J3KQM5|Q5VTK7|Q86XZ6|Q8N445|Q96DN4|Q9H5W5	Silent	SNP	ENST00000426732.2	37	c.1125G>A																																																																																					0.632	SH3D21-202	KNOWN	basic	protein_coding	protein_coding		NM_024676		7	32	0	0	0	0.001984	0	7	32				
RIMKLA	284716	broad.mit.edu	37	1	42880471	42880471	+	Silent	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:42880471A>G	ENST00000431473.3	+	5	1131	c.1002A>G	c.(1000-1002)ggA>ggG	p.G334G		NM_173642.3	NP_775913.2	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family member A	334					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)			NS(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	13						CAGCTCAGGGAGTTGCAGAGA	0.552																																							uc001chi.2		NA																	0					0						c.(1000-1002)GGA>GGG		ribosomal modification protein rimK-like family							83.0	76.0	78.0					1																	42880471		2203	4300	6503	SO:0001819	synonymous_variant	284716				protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding	g.chr1:42880471A>G	BC039737	CCDS466.2	1p34.2	2011-09-21	2008-10-13	2008-10-13	ENSG00000177181	ENSG00000177181	6.3.2.N6		28725	protein-coding gene	gene with protein product	"""N-acetylaspartylglutamate synthetase II"""		"""family with sequence similarity 80, member A"""	FAM80A		20657015, 21454531	Standard	NM_173642		Approved	MGC47816, RP11-157D18.1, NAAGS-II	uc001chi.2	Q8IXN7	OTTHUMG00000007335	ENST00000431473.3:c.1002A>G	1.37:g.42880471A>G							p.G334G	NM_173642	NP_775913	Q8IXN7	RIMKA_HUMAN			5	1140	+			334					Q5VUS5	Silent	SNP	ENST00000431473.3	37	c.1002A>G	CCDS466.2																																																																																				0.552	RIMKLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019174.3	NM_173642		12	41	0	0	0	0.001855	0	12	41				
SZT2	23334	broad.mit.edu	37	1	43906216	43906216	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:43906216C>G	ENST00000562955.1	+	51	7132	c.7132C>G	c.(7132-7134)Cca>Gca	p.P2378A	SZT2_ENST00000372442.1_Missense_Mutation_p.P1536A	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	2435					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						GCCTGTGACTCCACCCAGCAA	0.592																																							uc001cjk.1		NA																	0					0						c.(4606-4608)CCA>GCA		hypothetical protein LOC23334							80.0	78.0	79.0					1																	43906216		2203	4300	6503	SO:0001583	missense	23334					peroxisome		g.chr1:43906216C>G	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.7132C>G	1.37:g.43906216C>G	ENSP00000457168:p.Pro2378Ala						p.P1536A	NM_015284	NP_056099	Q5T011	SZT2_HUMAN			37	5068	+	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)	2435					A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	37	c.4606C>G	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	C	20.6	4.019095	0.75275	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.69477	0.3115	L	0.43152	1.355	0.36643	D	0.876971	D	0.89917	1.0	D	0.85130	0.997	T	0.68394	-0.5420	9	0.27082	T	0.32	.	18.7731	0.91900	0.0:1.0:0.0:0.0	.	2378	Q5T011-5	.	A	1536	.	ENSP00000361519:P1536A	P	+	1	0	SZT2	43678803	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.956000	0.63645	2.675000	0.91044	0.655000	0.94253	CCA		0.592	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284		21	66	0	0	0	0.010504	0	21	66				
RAD54L	8438	broad.mit.edu	37	1	46736385	46736385	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:46736385A>T	ENST00000371975.4	+	10	1771	c.1097A>T	c.(1096-1098)gAc>gTc	p.D366V	RAD54L_ENST00000442598.1_Missense_Mutation_p.D366V|RAD54L_ENST00000473251.1_3'UTR	NM_003579.3	NP_003570.2	Q92698	RAD54_HUMAN	RAD54-like (S. cerevisiae)	366					chromosome organization (GO:0051276)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	25	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)		AAGGGTCGAGACGCTGCTGCT	0.473								Direct reversal of damage;Homologous recombination																															uc009vye.2		NA																	0				ovary(2)|skin(1)	3						c.(1096-1098)GAC>GTC	Direct_reversal_of_damage|Homologous_recombination	RAD54-like protein							114.0	105.0	108.0					1																	46736385		2203	4300	6503	SO:0001583	missense	8438				meiosis	nucleus	ATP binding|DNA binding|helicase activity	g.chr1:46736385A>T	X97795	CCDS532.1	1p32	2008-02-05	2001-11-28		ENSG00000085999	ENSG00000085999			9826	protein-coding gene	gene with protein product		603615	"""RAD54 (S.cerevisiae)-like"""			8805304	Standard	NM_003579		Approved	hHR54, hRAD54, RAD54A	uc009vye.2	Q92698	OTTHUMG00000007772	ENST00000371975.4:c.1097A>T	1.37:g.46736385A>T	ENSP00000361043:p.Asp366Val					RAD54L_uc001cpl.2_Missense_Mutation_p.D366V|RAD54L_uc001cpm.1_Missense_Mutation_p.D186V	p.D366V	NM_001142548	NP_001136020	Q92698	RAD54_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)	11	1211	+	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)	366					Q5TE31|Q6IUY3	Missense_Mutation	SNP	ENST00000371975.4	37	c.1097A>T	CCDS532.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.773773	0.90108	.	.	ENSG00000085999	ENST00000442598;ENST00000371975;ENST00000535499	D;D	0.92647	-3.08;-3.08	5.56	5.56	0.83823	SNF2-related (1);	0.046733	0.85682	D	0.000000	D	0.96716	0.8928	M	0.92367	3.3	0.80722	D	1	P;D	0.65815	0.875;0.995	P;D	0.64877	0.638;0.93	D	0.97575	1.0107	10	0.72032	D	0.01	-17.7992	15.7189	0.77691	1.0:0.0:0.0:0.0	.	186;366	G3V1N0;Q92698	.;RAD54_HUMAN	V	366;366;186	ENSP00000396113:D366V;ENSP00000361043:D366V	ENSP00000361043:D366V	D	+	2	0	RAD54L	46508972	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.121000	0.94375	2.113000	0.64589	0.460000	0.39030	GAC		0.473	RAD54L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021272.1	NM_003579		9	43	0	0	0	0.004482	0	9	43				
OMA1	115209	broad.mit.edu	37	1	59004832	59004832	+	Silent	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:59004832A>G	ENST00000371226.3	-	2	248	c.135T>C	c.(133-135)caT>caC	p.H45H	OMA1_ENST00000467063.1_Intron|OMA1_ENST00000358603.2_Silent_p.H45H|DAB1_ENST00000485760.1_Intron	NM_145243.3	NP_660286.1	Q96E52	OMA1_HUMAN	OMA1 zinc metallopeptidase	45					cristae formation (GO:0042407)|diet induced thermogenesis (GO:0002024)|energy homeostasis (GO:0097009)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrial protein processing (GO:0034982)|negative regulation of mitochondrial fusion (GO:0010637)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(1)|large_intestine(6)|liver(2)|lung(6)|prostate(1)|skin(1)	18	all_cancers(7;6.54e-05)					TATTTACTATATGGTTAACTT	0.368																																							uc001cyy.2		NA																	0				large_intestine(1)	1						c.(133-135)CAT>CAC		OMA1 homolog, zinc metallopeptidase precursor							106.0	109.0	108.0					1																	59004832		2203	4300	6503	SO:0001819	synonymous_variant	115209				proteolysis	integral to membrane|mitochondrial membrane	metal ion binding|metalloendopeptidase activity	g.chr1:59004832A>G	AK091101	CCDS608.1	1p32.2-p32.1	2013-05-03	2013-05-03		ENSG00000162600	ENSG00000162600			29661	protein-coding gene	gene with protein product	"""overlapping activity with M-AAA protease"", ""zinc metallopeptidase OMA1"""		"""OMA1 zinc metallopeptidase homolog (S. cerevisiae)"""			12477932	Standard	NM_145243		Approved	MPRP-1, YKR087C, ZMPOMA1, FLJ33782	uc001cyy.3	Q96E52	OTTHUMG00000010068	ENST00000371226.3:c.135T>C	1.37:g.59004832A>G						DAB1_uc001cyt.1_Intron|OMA1_uc001cyx.1_Silent_p.H45H|OMA1_uc009vzz.2_Silent_p.H45H	p.H45H	NM_145243	NP_660286	Q96E52	OMA1_HUMAN			2	223	-	all_cancers(7;6.54e-05)		45					D3DQ54|Q5T3G6|Q5T3G7|Q5T3G8|Q5T3G9|Q5T3H0|Q8NBB3	Silent	SNP	ENST00000371226.3	37	c.135T>C	CCDS608.1																																																																																				0.368	OMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027819.1	NM_145243		40	72	0	0	0	0.01441	0	40	72				
EFCAB7	84455	broad.mit.edu	37	1	64021097	64021097	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:64021097G>A	ENST00000371088.4	+	9	1371	c.1125G>A	c.(1123-1125)agG>agA	p.R375R	EFCAB7_ENST00000461039.1_3'UTR	NM_032437.2	NP_115813.2	A8K855	EFCB7_HUMAN	EF-hand calcium binding domain 7	375			R -> K (in dbSNP:rs2273367). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005}.				calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	19						CTGGCTGTAGGCTGAGGAAAA	0.353																																							uc001dbf.2		NA																	0					0						c.(1123-1125)AGG>AGA		EF-hand calcium binding domain 7							137.0	135.0	136.0					1																	64021097		2203	4300	6503	SO:0001819	synonymous_variant	84455						calcium ion binding	g.chr1:64021097G>A	BC015814	CCDS30737.1	1p31.3	2013-01-10			ENSG00000203965	ENSG00000203965		"""EF-hand domain containing"""	29379	protein-coding gene	gene with protein product						11347906	Standard	NM_032437		Approved	KIAA1799, RP4-534K7.1	uc001dbf.3	A8K855	OTTHUMG00000008983	ENST00000371088.4:c.1125G>A	1.37:g.64021097G>A							p.R375R	NM_032437	NP_115813	A8K855	EFCB7_HUMAN			9	1419	+			375					Q658P0|Q96B95|Q96JM6	Silent	SNP	ENST00000371088.4	37	c.1125G>A	CCDS30737.1																																																																																				0.353	EFCAB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024910.1	NM_032437		24	70	0	0	0	0.003954	0	24	70				
NEGR1	257194	broad.mit.edu	37	1	71873215	71873215	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:71873215C>T	ENST00000357731.5	-	7	1218	c.979G>A	c.(979-981)Gat>Aat	p.D327N	NEGR1_ENST00000434200.1_Missense_Mutation_p.D281N|ZRANB2-AS2_ENST00000587066.1_RNA|ZRANB2-AS2_ENST00000430605.1_RNA|ZRANB2-AS2_ENST00000586006.1_RNA|ZRANB2-AS2_ENST00000587306.1_RNA|ZRANB2-AS2_ENST00000608579.1_RNA|ZRANB2-AS2_ENST00000585499.1_RNA|ZRANB2-AS2_ENST00000585415.1_RNA|NEGR1_ENST00000306821.3_Missense_Mutation_p.D199N|ZRANB2-AS2_ENST00000590186.1_RNA	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	327					feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		AAAAGAACATCAGCGCTCCCG	0.403																																							uc001dfw.2		NA																	0				ovary(1)	1						c.(979-981)GAT>AAT		neuronal growth regulator 1 precursor							83.0	82.0	82.0					1																	71873215		2203	4299	6502	SO:0001583	missense	257194				cell adhesion	anchored to membrane|plasma membrane		g.chr1:71873215C>T	AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.979G>A	1.37:g.71873215C>T	ENSP00000350364:p.Asp327Asn					NEGR1_uc001dfv.2_Missense_Mutation_p.D199N|NEGR1_uc010oqs.1_Missense_Mutation_p.D283N	p.D327N	NM_173808	NP_776169	Q7Z3B1	NEGR1_HUMAN		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)	7	1079	-		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)	327					Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	ENST00000357731.5	37	c.979G>A	CCDS661.1	.	.	.	.	.	.	.	.	.	.	C	9.232	1.036007	0.19590	.	.	ENSG00000172260	ENST00000357731;ENST00000306821;ENST00000434200	T;T;T	0.72282	0.67;0.82;-0.64	5.85	4.91	0.64330	.	0.387563	0.26995	N	0.021454	T	0.31136	0.0787	N	0.08118	0	0.26064	N	0.981314	B;B	0.06786	0.001;0.0	B;B	0.14023	0.01;0.001	T	0.10941	-1.0608	10	0.19147	T	0.46	-0.4235	15.8614	0.79026	0.1405:0.8595:0.0:0.0	.	281;327	B4DI94;Q7Z3B1	.;NEGR1_HUMAN	N	327;199;281	ENSP00000350364:D327N;ENSP00000305938:D199N;ENSP00000413294:D281N	ENSP00000305938:D199N	D	-	1	0	NEGR1	71645803	1.000000	0.71417	0.099000	0.21106	0.978000	0.69477	3.386000	0.52492	1.415000	0.47037	0.655000	0.94253	GAT		0.403	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026722.4	NM_173808		10	36	0	0	0	0.010729	0	10	36				
ERICH3	127254	broad.mit.edu	37	1	75107038	75107038	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:75107038C>A	ENST00000326665.5	-	5	639	c.421G>T	c.(421-423)Gga>Tga	p.G141*		NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		141										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CTGGAATGTCCTTCATCAACC	0.423																																							uc001dgg.2		NA																	0				ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						c.(421-423)GGA>TGA		hypothetical protein LOC127254							159.0	140.0	146.0					1																	75107038		2203	4300	6503	SO:0001587	stop_gained	127254							g.chr1:75107038C>A																												ENST00000326665.5:c.421G>T	1.37:g.75107038C>A	ENSP00000322609:p.Gly141*						p.G141*	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN			5	640	-			141					Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Nonsense_Mutation	SNP	ENST00000326665.5	37	c.421G>T	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.555490	0.86231	.	.	ENSG00000178965	ENST00000326665	.	.	.	5.41	1.51	0.23008	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-7.6216	7.515	0.27596	0.0:0.6538:0.0:0.3462	.	.	.	.	X	141	.	ENSP00000322609:G141X	G	-	1	0	C1orf173	74879626	1.000000	0.71417	0.997000	0.53966	0.128000	0.20619	1.997000	0.40786	0.098000	0.17522	-0.259000	0.10710	GGA		0.423	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1			18	66	1	0	8.00594e-06	0.007413	8.59897e-06	18	66				
IFI44	10561	broad.mit.edu	37	1	79115896	79115896	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:79115896C>T	ENST00000370747.4	+	2	101	c.16C>T	c.(16-18)Cgt>Tgt	p.R6C	IFI44_ENST00000495254.1_Intron|IFI44_ENST00000545124.1_Intron	NM_006417.4	NP_006408.3	Q8TCB0	IFI44_HUMAN	interferon-induced protein 44	6					response to virus (GO:0009615)	cytoplasm (GO:0005737)				central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21						AGTGACAACTCGTTTGACATG	0.348																																							uc001dip.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(16-18)CGT>TGT		interferon-induced, hepatitis C-associated							93.0	87.0	89.0					1																	79115896		2203	4300	6503	SO:0001583	missense	10561				response to virus	cytoplasm		g.chr1:79115896C>T	D28915	CCDS688.1	1p31.1	2013-03-14			ENSG00000137965	ENSG00000137965			16938	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 5"""	610468				7925411	Standard	NM_006417		Approved	MTAP44, p44, TLDC5	uc001dip.4	Q8TCB0	OTTHUMG00000009723	ENST00000370747.4:c.16C>T	1.37:g.79115896C>T	ENSP00000359783:p.Arg6Cys					IFI44_uc010orr.1_Missense_Mutation_p.R6C|IFI44_uc010ors.1_Intron	p.R6C	NM_006417	NP_006408	Q8TCB0	IFI44_HUMAN			2	140	+			6					B7ZAG3|D3DQ80|Q14496	Missense_Mutation	SNP	ENST00000370747.4	37	c.16C>T	CCDS688.1	.	.	.	.	.	.	.	.	.	.	C	1.584	-0.530800	0.04112	.	.	ENSG00000137965	ENST00000370747	T	0.10099	2.91	3.09	-3.99	0.04069	.	1.172060	0.06202	N	0.683470	T	0.01800	0.0057	L	0.33245	0.995	0.09310	N	1	B;B	0.30104	0.268;0.035	B;B	0.16289	0.015;0.003	T	0.42258	-0.9462	10	0.37606	T	0.19	0.2256	4.5559	0.12136	0.163:0.3005:0.0:0.5366	.	6;6	B7ZB11;Q8TCB0	.;IFI44_HUMAN	C	6	ENSP00000359783:R6C	ENSP00000359783:R6C	R	+	1	0	IFI44	78888484	0.002000	0.14202	0.016000	0.15963	0.011000	0.07611	-1.412000	0.02476	-0.989000	0.03485	0.460000	0.39030	CGT		0.348	IFI44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026825.1	NM_006417		17	51	0	0	0	0.00499	0	17	51				
PRKACB	5567	broad.mit.edu	37	1	84700929	84700929	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:84700929G>C	ENST00000370689.2	+	10	1261	c.997G>C	c.(997-999)Gaa>Caa	p.E333Q	PRKACB_ENST00000394838.2_Missense_Mutation_p.E340Q|PRKACB_ENST00000370685.3_Missense_Mutation_p.E380Q|PRKACB_ENST00000394839.2_Missense_Mutation_p.E303Q|PRKACB_ENST00000370682.3_Missense_Mutation_p.E337Q	NM_001242862.1|NM_002731.2	NP_001229791.1|NP_002722.1	P22694	KAPCB_HUMAN	protein kinase, cAMP-dependent, catalytic, beta	333	AGC-kinase C-terminal.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of protein processing (GO:0070613)|response to clozapine (GO:0097338)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|magnesium ion binding (GO:0000287)|ubiquitin protein ligase binding (GO:0031625)	p.E340K(1)|p.E333K(1)|p.E380K(1)		breast(1)|endometrium(2)|kidney(1)|lung(11)|ovary(1)	16				all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)		TGACTATGAAGAAGAAGATAT	0.368																																							uc001djj.2		NA																	3	Substitution - Missense(3)		lung(3)	lung(2)|ovary(1)	3						c.(997-999)GAA>CAA		cAMP-dependent protein kinase catalytic subunit							80.0	82.0	82.0					1																	84700929		2203	4300	6503	SO:0001583	missense	5567				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|regulation of insulin secretion|synaptic transmission|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|centrosome|cytosol|nucleoplasm|plasma membrane	ATP binding|cAMP-dependent protein kinase activity|magnesium ion binding|protein binding	g.chr1:84700929G>C	BC035058	CCDS691.1, CCDS692.1, CCDS693.1, CCDS55610.1, CCDS55611.1, CCDS72812.1, CCDS72813.1, CCDS72814.1, CCDS72815.1, CCDS72816.1	1p36.1	2012-10-02			ENSG00000142875	ENSG00000142875	2.7.11.1		9381	protein-coding gene	gene with protein product		176892					Standard	XM_005271016		Approved	PKACb	uc001djl.3	P22694	OTTHUMG00000009975	ENST00000370689.2:c.997G>C	1.37:g.84700929G>C	ENSP00000359723:p.Glu333Gln					PRKACB_uc001djl.2_Missense_Mutation_p.E380Q|PRKACB_uc010ort.1_Missense_Mutation_p.E340Q|PRKACB_uc001djn.2_Missense_Mutation_p.E337Q|PRKACB_uc010oru.1_Missense_Mutation_p.E321Q|PRKACB_uc001djp.2_Missense_Mutation_p.E339Q|PRKACB_uc001djq.2_Missense_Mutation_p.E303Q|PRKACB_uc010orv.1_Missense_Mutation_p.E320Q	p.E333Q	NM_002731	NP_002722	P22694	KAPCB_HUMAN		all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)	10	1261	+			333			AGC-kinase C-terminal.		B1APG4|B4DKB0|B4E2Q1|Q14VH1|Q59GC0|Q5BNE9|Q5BNF0|Q5BNF1|Q5BNF2|Q5BNF3|Q5CZ92|Q5T1K3|Q7Z3M1|Q8IYR5|Q8IZQ0|Q96B09	Missense_Mutation	SNP	ENST00000370689.2	37	c.997G>C	CCDS691.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.495167	0.85069	.	.	ENSG00000142875	ENST00000370689;ENST00000370685;ENST00000394838;ENST00000370682;ENST00000370679;ENST00000394839;ENST00000370681	T;T;T;T;T	0.08102	3.13;3.13;3.13;3.13;3.13	6.17	6.17	0.99709	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.28732	0.0712	M	0.85299	2.745	0.80722	D	1	P;B;B;B;B;B;P;P	0.52316	0.952;0.064;0.023;0.439;0.038;0.016;0.489;0.952	D;B;B;B;B;B;B;D	0.66084	0.941;0.05;0.02;0.191;0.044;0.086;0.19;0.941	T	0.01232	-1.1411	10	0.66056	D	0.02	-20.1145	20.8794	0.99867	0.0:0.0:1.0:0.0	.	333;321;340;303;339;337;380;333	B2RB89;P22694-3;B4DKB0;B1APG4;P22694-6;P22694-7;P22694-2;P22694	.;.;.;.;.;.;.;KAPCB_HUMAN	Q	333;380;340;337;339;303;295	ENSP00000359723:E333Q;ENSP00000359719:E380Q;ENSP00000378314:E340Q;ENSP00000359716:E337Q;ENSP00000378315:E303Q	ENSP00000359713:E339Q	E	+	1	0	PRKACB	84473517	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	GAA		0.368	PRKACB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027641.1	NM_182948		15	55	0	0	0	0.007413	0	15	55				
AMY2A	279	broad.mit.edu	37	1	104160583	104160583	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:104160583C>A	ENST00000414303.2	+	2	240	c.176C>A	c.(175-177)cCa>cAa	p.P59Q		NM_000699.2	NP_000690.1	P04746	AMYP_HUMAN	amylase, alpha 2A (pancreatic)	59					carbohydrate catabolic process (GO:0016052)|carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|calcium ion binding (GO:0005509)|chloride ion binding (GO:0031404)			endometrium(3)|kidney(1)|large_intestine(5)|liver(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Icodextrin(DB00702)|Miglitol(DB00491)	TAGGTCTCTCCACCAAATGAA	0.328																																							uc001dut.2		NA																	0				ovary(1)|skin(1)	2						c.(175-177)CCA>CAA		pancreatic amylase alpha 2A precursor	Acarbose(DB00284)|Bentiromide(DB00522)|Icodextrin(DB00702)|Miglitol(DB00491)|Pancrelipase(DB00085)						148.0	135.0	139.0					1																	104160583		2201	4278	6479	SO:0001583	missense	279				carbohydrate catabolic process|polysaccharide digestion	extracellular space	alpha-amylase activity|calcium ion binding|chloride ion binding	g.chr1:104160583C>A	BC007060	CCDS783.1	1p21.1	2012-10-02	2007-05-03		ENSG00000243480	ENSG00000243480	3.2.1.1		477	protein-coding gene	gene with protein product		104650	"""amylase, alpha 2A; pancreatic"""	AMY2		3260028	Standard	NM_000699		Approved		uc001dut.3	P04746	OTTHUMG00000011023	ENST00000414303.2:c.176C>A	1.37:g.104160583C>A	ENSP00000397582:p.Pro59Gln					AMY2A_uc010ouq.1_Missense_Mutation_p.P59Q	p.P59Q	NM_000699	NP_000690	P04746	AMYP_HUMAN		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	2	240	+		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)	59					B9EJG1|Q9UBH3	Missense_Mutation	SNP	ENST00000414303.2	37	c.176C>A	CCDS783.1	.	.	.	.	.	.	.	.	.	.	c	16.23	3.064924	0.55432	.	.	ENSG00000243480	ENST00000414303;ENST00000393932	D	0.99519	-6.07	3.37	3.37	0.38596	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.051068	0.85682	D	0.000000	D	0.99764	0.9904	H	0.98818	4.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96781	0.9575	10	0.87932	D	0	.	14.8519	0.70303	0.0:1.0:0.0:0.0	.	59;59	B9EJG1;P04746	.;AMYP_HUMAN	Q	59	ENSP00000397582:P59Q	ENSP00000377509:P59Q	P	+	2	0	AMY2A	103962106	1.000000	0.71417	1.000000	0.80357	0.461000	0.32589	7.359000	0.79477	1.868000	0.54150	0.455000	0.32223	CCA		0.328	AMY2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030315.1	NM_000699		28	104	1	0	1.7881e-09	0.008361	2.00785e-09	28	104				
CELSR2	1952	broad.mit.edu	37	1	109812675	109812675	+	Missense_Mutation	SNP	G	G	A	rs200447722	byFrequency	TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:109812675G>A	ENST00000271332.3	+	23	7289	c.7228G>A	c.(7228-7230)Ggc>Agc	p.G2410S		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2410					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CAACCAACACGGCATCCGACG	0.577													G|||	2	0.000399361	0.0008	0.0	5008	,	,		19431	0.0		0.001	False		,,,				2504	0.0				NSCLC(158;1285 2011 34800 34852 42084)	NSCLC(158;1285 2011 34800 34852 42084)	uc001dxa.3		NA																	0				ovary(4)|lung(3)|skin(1)	8						c.(7228-7230)GGC>AGC		cadherin EGF LAG seven-pass G-type receptor 2							189.0	173.0	178.0					1																	109812675		2203	4300	6503	SO:0001583	missense	1952				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding	g.chr1:109812675G>A	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7228G>A	1.37:g.109812675G>A	ENSP00000271332:p.Gly2410Ser						p.G2410S	NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)	23	7289	+		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)	2410			Cytoplasmic (Potential).		Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	c.7228G>A	CCDS796.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	4.013	-0.000287	0.07819	.	.	ENSG00000143126	ENST00000271332	T	0.41400	1.0	3.78	3.78	0.43462	GPCR, family 2-like (1);	.	.	.	.	T	0.03695	0.0105	N	0.00783	-1.19	0.33790	D	0.625304	B	0.16166	0.016	B	0.19148	0.024	T	0.40021	-0.9585	9	0.02654	T	1	.	7.3884	0.26895	0.1989:0.0:0.8011:0.0	.	2410	Q9HCU4	CELR2_HUMAN	S	2410	ENSP00000271332:G2410S	ENSP00000271332:G2410S	G	+	1	0	CELSR2	109614198	0.995000	0.38212	0.995000	0.50966	0.961000	0.63080	2.735000	0.47377	2.103000	0.63969	0.561000	0.74099	GGC		0.577	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408		18	64	0	0	0	0.00499	0	18	64				
AMPD2	271	broad.mit.edu	37	1	110168300	110168300	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:110168300C>A	ENST00000256578.3	+	3	761	c.401C>A	c.(400-402)tCa>tAa	p.S134*	AMPD2_ENST00000393688.3_Nonsense_Mutation_p.S15*|AMPD2_ENST00000528454.1_Nonsense_Mutation_p.S16*|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000526301.1_3'UTR|AMPD2_ENST00000358729.4_Nonsense_Mutation_p.S59*|AMPD2_ENST00000342115.4_Nonsense_Mutation_p.S53*|AMPD2_ENST00000528667.1_Nonsense_Mutation_p.S134*	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	134					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		TTCACCCGCTCACTGGCTGAG	0.667																																							uc009wfh.1		NA																	0				ovary(2)|breast(1)	3						c.(400-402)TCA>TAA		adenosine monophosphate deaminase 2 (isoform L)							48.0	56.0	53.0					1																	110168300		2203	4300	6503	SO:0001587	stop_gained	271				purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding	g.chr1:110168300C>A	S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.401C>A	1.37:g.110168300C>A	ENSP00000256578:p.Ser134*					AMPD2_uc009wfg.1_RNA|AMPD2_uc001dyb.1_Nonsense_Mutation_p.S53*|AMPD2_uc001dyc.1_Nonsense_Mutation_p.S134*|AMPD2_uc010ovr.1_Nonsense_Mutation_p.S59*|AMPD2_uc010ovs.1_Nonsense_Mutation_p.S16*|AMPD2_uc001dyd.1_Nonsense_Mutation_p.S15*	p.S134*	NM_004037	NP_004028	Q01433	AMPD2_HUMAN		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)	4	943	+		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)	134					B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Nonsense_Mutation	SNP	ENST00000256578.3	37	c.401C>A	CCDS805.1	.	.	.	.	.	.	.	.	.	.	C	39	7.428590	0.98279	.	.	ENSG00000116337	ENST00000531734;ENST00000342115;ENST00000528667;ENST00000531203;ENST00000256578;ENST00000358729;ENST00000527846;ENST00000528454;ENST00000393688	.	.	.	4.84	4.84	0.62591	.	0.358258	0.28171	N	0.016324	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.6853	16.8712	0.86041	0.0:1.0:0.0:0.0	.	.	.	.	X	53;53;134;16;134;59;101;16;15	.	ENSP00000256578:S134X	S	+	2	0	AMPD2	109969823	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	4.487000	0.60293	2.506000	0.84524	0.462000	0.41574	TCA		0.667	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1			5	38	1	0	0.000602214	0.000602	0.000629588	5	38				
PDE4DIP	9659	broad.mit.edu	37	1	144866706	144866706	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:144866706C>G	ENST00000369354.3	-	34	5725	c.5536G>C	c.(5536-5538)Gag>Cag	p.E1846Q	PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.E1982Q|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.E1931Q|RP4-791M13.4_ENST00000532137.1_RNA|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.E1846Q|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.E1740Q			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1846					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CCAAGATGCTCTTCCAGCAGG	0.597			T	PDGFRB	MPD																																		uc001elw.3		NA		Dom	yes		1	1q12	9659	T	phosphodiesterase 4D interacting protein (myomegalin)			L	PDGFRB		MPD		0				ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5						c.(5536-5538)GAG>CAG		phosphodiesterase 4D interacting protein isoform							88.0	90.0	90.0					1																	144866706		2203	4296	6499	SO:0001583	missense	9659				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding	g.chr1:144866706C>G	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.5536G>C	1.37:g.144866706C>G	ENSP00000358360:p.Glu1846Gln					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.E1740Q|PDE4DIP_uc001elv.3_Missense_Mutation_p.E853Q|PDE4DIP_uc001ema.2_Missense_Mutation_p.E33Q	p.E1846Q	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN		Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)	34	5827	-			1846			Potential.		A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	c.5536G>C	CCDS30824.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.0|24.0	4.476697|4.476697	0.84640|0.84640	.|.	.|.	ENSG00000178104|ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359|ENST00000530130	T;T;T;T;T|.	0.04706|.	3.57;3.79;3.78;3.89;3.84|.	5.13|5.13	4.19|4.19	0.49359|0.49359	.|.	.|.	.|.	.|.	.|.	T|T	0.68622|0.68622	0.3021|0.3021	M|M	0.81112|0.81112	2.525|2.525	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.998|.	D;D|.	0.77557|.	0.964;0.99|.	T|T	0.69800|0.69800	-0.5047|-0.5047	9|5	0.87932|.	D|.	0|.	.|.	11.8828|11.8828	0.52586|0.52586	0.0:0.9125:0.0:0.0875|0.0:0.9125:0.0:0.0875	.|.	1740;1846|.	Q5VU43-3;Q5VU43|.	.;MYOME_HUMAN|.	Q|N	1740;1846;1846;1931;1982|2	ENSP00000327209:E1740Q;ENSP00000358360:E1846Q;ENSP00000358363:E1846Q;ENSP00000435654:E1931Q;ENSP00000358366:E1982Q|.	ENSP00000327209:E1740Q|.	E|K	-|-	1|3	0|2	PDE4DIP|PDE4DIP	143578063|143578063	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.995000|0.995000	0.86356|0.86356	6.833000|6.833000	0.75334|0.75334	2.672000|2.672000	0.90937|0.90937	0.650000|0.650000	0.86243|0.86243	GAG|AAG		0.597	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359		5	108	0	0	0	0.000602	0	5	108				
SEC22B	9554	broad.mit.edu	37	1	145109656	145109656	+	RNA	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:145109656G>T	ENST00000453618.1	+	0	645							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											TGCCCACTGTGTCCCGACCCT	0.418																																							uc001eml.1		NA																	0					0						c.(316-318)GTG>GTT		SEC22 vesicle trafficking protein homolog B							627.0	624.0	625.0					1																	145109656		1992	4179	6171			9554				ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|melanosome	protein binding	g.chr1:145109656G>T	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145109656G>T						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron	p.V106V	NM_004892	NP_004883	O75396	SC22B_HUMAN			5	458	+			106			Longin.|Cytoplasmic (Potential).		A8K1G0	Silent	SNP	ENST00000453618.1	37	c.318G>T																																																																																					0.418	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000038523.5	NM_004892		32	774	1	0	2.75727e-19	0.004878	3.3137e-19	32	774				
PRUNE	58497	broad.mit.edu	37	1	151006440	151006440	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:151006440C>T	ENST00000271620.3	+	8	1248	c.1092C>T	c.(1090-1092)gaC>gaT	p.D364D	PRUNE_ENST00000368935.1_Silent_p.D79D|PRUNE_ENST00000368937.1_Silent_p.D129D|PRUNE_ENST00000368934.1_Silent_p.D129D|PRUNE_ENST00000271619.8_Silent_p.D152D|BNIPL_ENST00000295294.7_5'Flank|BNIPL_ENST00000368931.3_5'Flank|PRUNE_ENST00000368936.1_Silent_p.D182D	NM_021222.1	NP_067045.1	Q86TP1	PRUNE_HUMAN	prune exopolyphosphatase	364						cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CATATTTTGACTCCATGAAGA	0.527																																							uc001ewh.1		NA																	0				ovary(1)	1						c.(1090-1092)GAC>GAT		prune							111.0	103.0	106.0					1																	151006440		2203	4300	6503	SO:0001819	synonymous_variant	58497					cytoplasm|focal adhesion|nucleus	inorganic diphosphatase activity|manganese ion binding|protein binding	g.chr1:151006440C>T	U67085	CCDS977.1	1q21.2	2013-04-29	2013-04-29		ENSG00000143363	ENSG00000143363	3.6.1.11		13420	protein-coding gene	gene with protein product			"""prune homolog (Drosophila)"""			10602478, 11687967, 18700747	Standard	NM_021222		Approved	DRES-17, HTCD37	uc001ewh.1	Q86TP1	OTTHUMG00000035062	ENST00000271620.3:c.1092C>T	1.37:g.151006440C>T						PRUNE_uc001ewi.1_Silent_p.D182D|PRUNE_uc010pco.1_Silent_p.D132D|PRUNE_uc001ewj.1_Silent_p.D79D|PRUNE_uc001ewk.1_Silent_p.D129D|BNIPL_uc009wmi.2_5'Flank|BNIPL_uc001ewl.2_5'Flank	p.D364D	NM_021222	NP_067045	Q86TP1	PRUNE_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)		8	1228	+	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		364					B2RCH8|B4DFL7|Q5SZF9|Q659E5|Q6P4E0|Q8N654|Q96JU5|Q9C071|Q9C072|Q9UIV0	Silent	SNP	ENST00000271620.3	37	c.1092C>T	CCDS977.1																																																																																				0.527	PRUNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084885.1	NM_021222		11	157	0	0	0	0.008291	0	11	157				
PIP5K1A	8394	broad.mit.edu	37	1	151214946	151214946	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:151214946C>G	ENST00000368888.4	+	14	1965	c.1543C>G	c.(1543-1545)Cag>Gag	p.Q515E	PIP5K1A_ENST00000409426.1_Missense_Mutation_p.Q503E|PIP5K1A_ENST00000441902.2_Missense_Mutation_p.Q475E|PIP5K1A_ENST00000414290.2_Intron|PIP5K1A_ENST00000368890.4_Missense_Mutation_p.Q453E	NM_001135638.1	NP_001129110.1	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, alpha	515					actin cytoskeleton reorganization (GO:0031532)|activation of Rac GTPase activity (GO:0032863)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|fibroblast migration (GO:0010761)|focal adhesion assembly (GO:0048041)|glycerophospholipid metabolic process (GO:0006650)|keratinocyte differentiation (GO:0030216)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|protein targeting to plasma membrane (GO:0072661)|ruffle assembly (GO:0097178)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|kinase binding (GO:0019900)			breast(1)|central_nervous_system(1)|ovary(1)|skin(1)|stomach(1)	5	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			TGTTTTACCTCAGACTCCACC	0.453																																					Pancreas(80;36 1443 2325 16095 21302)	Pancreas(80;36 1443 2325 16095 21302)	uc001exj.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(1543-1545)CAG>GAG		phosphatidylinositol-4-phosphate 5-kinase, type							91.0	87.0	88.0					1																	151214946		2203	4300	6503	SO:0001583	missense	8394				phospholipid biosynthetic process|signal transduction	endomembrane system|Golgi stack|lamellipodium|nuclear speck	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|kinase binding	g.chr1:151214946C>G	U78575	CCDS990.1, CCDS44219.1, CCDS44220.1, CCDS44221.1	1q21.3	2010-04-08			ENSG00000143398	ENSG00000143398			8994	protein-coding gene	gene with protein product		603275				8955136, 10828584	Standard	NM_003557		Approved		uc001exj.3	Q99755	OTTHUMG00000012351	ENST00000368888.4:c.1543C>G	1.37:g.151214946C>G	ENSP00000357883:p.Gln515Glu					PIP5K1A_uc001exi.2_Missense_Mutation_p.Q502E|PIP5K1A_uc010pcu.1_Missense_Mutation_p.Q475E|PIP5K1A_uc001exk.2_Missense_Mutation_p.Q453E|PIP5K1A_uc010pcv.1_Intron	p.Q515E	NM_001135638	NP_001129110	Q99755	PI51A_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)		14	1995	+	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		515					A8K4Q0|B4DIN0|Q99754|Q99756	Missense_Mutation	SNP	ENST00000368888.4	37	c.1543C>G	CCDS44219.1	.	.	.	.	.	.	.	.	.	.	C	15.37	2.814415	0.50527	.	.	ENSG00000143398	ENST00000349792;ENST00000409426;ENST00000441902;ENST00000368890;ENST00000368888	T;T;T;T;T	0.33865	1.76;1.76;1.49;1.39;1.76	4.33	4.33	0.51752	.	0.141721	0.44285	D	0.000463	T	0.21631	0.0521	M	0.69823	2.125	0.80722	D	1	P;P;B;P	0.38395	0.481;0.571;0.227;0.629	B;B;B;B	0.33960	0.164;0.173;0.101;0.173	T	0.05162	-1.0902	10	0.18710	T	0.47	.	14.7089	0.69211	0.0:1.0:0.0:0.0	.	475;453;515;502	Q99755-4;Q99755-2;Q99755;Q99755-3	.;.;PI51A_HUMAN;.	E	502;503;475;453;515	ENSP00000271663:Q502E;ENSP00000386432:Q503E;ENSP00000415648:Q475E;ENSP00000357885:Q453E;ENSP00000357883:Q515E	ENSP00000271663:Q502E	Q	+	1	0	PIP5K1A	149481570	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.158000	0.42329	2.419000	0.82065	0.655000	0.94253	CAG		0.453	PIP5K1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034425.2	NM_003557		10	132	0	0	0	0.006214	0	10	132				
TCHH	7062	broad.mit.edu	37	1	152080014	152080014	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:152080014C>G	ENST00000368804.1	-	2	5678	c.5679G>C	c.(5677-5679)caG>caC	p.Q1893H		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1893	23 X 26 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGCGGTGCCTCTGTTCCTCCT	0.567																																							uc001ezp.2		NA																	0				ovary(3)|kidney(1)|central_nervous_system(1)	5						c.(5677-5679)CAG>CAC		trichohyalin							160.0	162.0	161.0					1																	152080014		2011	4162	6173	SO:0001583	missense	7062				keratinization	cytoskeleton	calcium ion binding	g.chr1:152080014C>G	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.5679G>C	1.37:g.152080014C>G	ENSP00000357794:p.Gln1893His					TCHH_uc009wne.1_Missense_Mutation_p.Q1893H	p.Q1893H	NM_007113	NP_009044	Q07283	TRHY_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		2	5679	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		1893			23 X 26 AA approximate tandem repeats.		Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	c.5679G>C	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	c	7.421	0.636774	0.14386	.	.	ENSG00000159450	ENST00000368804	T	0.14391	2.51	4.7	1.74	0.24563	.	.	.	.	.	T	0.15739	0.0379	L	0.59436	1.845	0.09310	N	1	D	0.89917	1.0	D	0.71184	0.972	T	0.04522	-1.0945	9	0.66056	D	0.02	-14.7058	8.4732	0.32997	0.0:0.7277:0.0:0.2723	.	1893	Q07283	TRHY_HUMAN	H	1893	ENSP00000357794:Q1893H	ENSP00000357794:Q1893H	Q	-	3	2	TCHH	150346638	0.042000	0.20092	0.308000	0.25141	0.080000	0.17528	0.782000	0.26788	0.414000	0.25790	0.306000	0.20318	CAG		0.567	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113		7	170	0	0	0	0.00308	0	7	170				
ILF2	3608	broad.mit.edu	37	1	153642698	153642698	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:153642698C>G	ENST00000361891.4	-	2	139	c.14G>C	c.(13-15)aGa>aCa	p.R5T	ILF2_ENST00000368681.1_Missense_Mutation_p.R5T	NM_001267809.1|NM_004515.3	NP_001254738.1|NP_004506.2	Q12905	ILF2_HUMAN	interleukin enhancer binding factor 2	5					immune response (GO:0006955)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|transferase activity (GO:0016740)			cervix(1)|kidney(1)|lung(4)|skin(1)	7	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			ACCACGGCCTCTGTCACCCCT	0.512																																							uc001fcr.2		NA																	0					0						c.(13-15)AGA>ACA		interleukin enhancer binding factor 2							102.0	106.0	104.0					1																	153642698		2203	4300	6503	SO:0001583	missense	3608				immune response|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|ribonucleoprotein complex	ATP binding|DNA binding|double-stranded RNA binding|protein binding|transferase activity	g.chr1:153642698C>G	U10323	CCDS1050.1, CCDS72919.1	1q21.3	2012-12-04	2012-12-04		ENSG00000143621	ENSG00000143621			6037	protein-coding gene	gene with protein product		603181	"""interleukin enhancer binding factor 2, 45kD"", ""interleukin enhancer binding factor 2, 45kDa"""			7519613	Standard	NM_004515		Approved	NF45	uc001fcr.4	Q12905	OTTHUMG00000037087	ENST00000361891.4:c.14G>C	1.37:g.153642698C>G	ENSP00000355011:p.Arg5Thr					ILF2_uc010pdy.1_5'UTR|ILF2_uc009wok.2_Missense_Mutation_p.R5T|ILF2_uc009wol.1_5'UTR	p.R5T	NM_004515	NP_004506	Q12905	ILF2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		2	95	-	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		5					A6NDB0|B2R8G7|Q5SR10|Q5SR11|Q7L7R3|Q9BWD4|Q9P1N0	Missense_Mutation	SNP	ENST00000361891.4	37	c.14G>C	CCDS1050.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676369	0.67928	.	.	ENSG00000143621	ENST00000361891;ENST00000368681	T	0.56611	0.45	4.5	4.5	0.54988	.	0.051246	0.85682	D	0.000000	T	0.59770	0.2218	M	0.78456	2.415	0.80722	D	1	P;P	0.51449	0.945;0.909	P;P	0.54965	0.765;0.587	T	0.65179	-0.6231	10	0.56958	D	0.05	-9.329	14.7432	0.69472	0.0:1.0:0.0:0.0	.	5;5	F4ZW62;Q12905	.;ILF2_HUMAN	T	5	ENSP00000355011:R5T	ENSP00000355011:R5T	R	-	2	0	ILF2	151909322	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.567000	0.67378	2.333000	0.79357	0.561000	0.74099	AGA		0.512	ILF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090040.1	NM_004515		16	168	0	0	0	0.008871	0	16	168				
GBA	2629	broad.mit.edu	37	1	155210461	155210461	+	Silent	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:155210461G>C	ENST00000327247.5	-	3	307	c.75C>G	c.(73-75)ctC>ctG	p.L25L	GBA_ENST00000368373.3_Silent_p.L25L|GBA_ENST00000428024.3_Intron|GBA_ENST00000493842.1_5'UTR|GBA_ENST00000427500.3_Silent_p.L25L|GBA_ENST00000536770.1_Silent_p.L25L	NM_001005741.2|NM_001005742.2	NP_001005741.1|NP_001005742.1	P04062	GLCM_HUMAN	glucosidase, beta, acid	25					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glucosylceramide catabolic process (GO:0006680)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of MAP kinase activity (GO:0043407)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of water loss via skin (GO:0033561)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to pH (GO:0009268)|response to testosterone (GO:0033574)|response to thyroid hormone (GO:0097066)|skin morphogenesis (GO:0043589)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)|termination of signal transduction (GO:0023021)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)	glucosylceramidase activity (GO:0004348)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	26	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Velaglucerase alfa(DB06720)	GCAATCCTGTGAGGCTGCCAG	0.542									Gaucher disease type I																														uc001fjh.2		NA																	0				ovary(1)|skin(1)	2						c.(73-75)CTC>CTG		glucocerebrosidase precursor	Alglucerase(DB00088)|Imiglucerase(DB00053)						177.0	164.0	169.0					1																	155210461		2203	4300	6503	SO:0001819	synonymous_variant	2629	Gaucher_disease_type_I	Familial Cancer Database	glucocerebrosidase insufficiency	carbohydrate metabolic process|cell death|cellular response to tumor necrosis factor|ceramide biosynthetic process|glucosylceramide catabolic process|lysosome organization|negative regulation of interleukin-6 production|negative regulation of MAP kinase activity|positive regulation of protein dephosphorylation|sphingosine biosynthetic process|termination of signal transduction	lysosomal lumen|lysosomal membrane	cation binding|glucosylceramidase activity|receptor binding	g.chr1:155210461G>C	M19285	CCDS1102.1, CCDS53373.1, CCDS53374.1	1q22	2010-01-19	2010-01-19		ENSG00000177628	ENSG00000177628	3.2.1.21		4177	protein-coding gene	gene with protein product		606463	"""glucosylceramidase"", ""glucosidase, beta; acid (includes glucosylceramidase)"""	GLUC		3359914	Standard	NM_001005742		Approved	GBA1	uc001fjl.3	P04062	OTTHUMG00000035841	ENST00000327247.5:c.75C>G	1.37:g.155210461G>C						RAG1AP1_uc010pey.1_Intron|GBA_uc010pfw.1_Silent_p.L25L|GBA_uc010pfx.1_Silent_p.L25L|GBA_uc001fji.2_Silent_p.L25L|GBA_uc001fjj.2_Silent_p.L25L|GBA_uc001fjk.2_Silent_p.L25L|GBA_uc001fjl.2_Silent_p.L25L|GBA_uc010pfy.1_Intron|GBA_uc009wqk.1_5'UTR	p.L25L	NM_000157	NP_000148	P04062	GLCM_HUMAN	Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		2	225	-	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		25					A8K796|B7Z5G2|B7Z6S1|J3KQG4|J3KQK9|Q16545|Q4VX22|Q6I9R6|Q9UMJ8	Silent	SNP	ENST00000327247.5	37	c.75C>G	CCDS1102.1																																																																																				0.542	GBA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087204.1	NM_000157		28	352	0	0	0	0.009535	0	28	352				
SYT11	23208	broad.mit.edu	37	1	155851236	155851236	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:155851236G>A	ENST00000368324.4	+	4	1486	c.1233G>A	c.(1231-1233)tgG>tgA	p.W411*	SYT11_ENST00000539162.1_Nonsense_Mutation_p.W104*	NM_152280.4	NP_689493.3	Q9BT88	SYT11_HUMAN	synaptotagmin XI	411					negative regulation of neurotransmitter secretion (GO:0046929)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(1)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			CTGAACACTGGAGAGAGGTCT	0.587																																							uc001fmg.2		NA																	0				ovary(1)|skin(1)	2						c.(1231-1233)TGG>TGA		synaptotagmin XI							73.0	80.0	77.0					1																	155851236		2203	4300	6503	SO:0001587	stop_gained	23208					cell junction|synaptic vesicle membrane	protein binding|transporter activity	g.chr1:155851236G>A	D38522	CCDS1122.1	1q22	2013-01-21			ENSG00000132718	ENSG00000132718		"""Synaptotagmins"""	19239	protein-coding gene	gene with protein product		608741				11543631	Standard	NM_152280		Approved	KIAA0080, MGC10881, MGC17226, DKFZp781D015	uc001fmg.3	Q9BT88	OTTHUMG00000014105	ENST00000368324.4:c.1233G>A	1.37:g.155851236G>A	ENSP00000357307:p.Trp411*					SYT11_uc010pgq.1_Nonsense_Mutation_p.W104*	p.W411*	NM_152280	NP_689493	Q9BT88	SYT11_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;0.000162)		4	1496	+	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		411			Cytoplasmic (Potential).		Q14998|Q5W0D4|Q68CT5|Q8IXU3|Q96SU2	Nonsense_Mutation	SNP	ENST00000368324.4	37	c.1233G>A	CCDS1122.1	.	.	.	.	.	.	.	.	.	.	G	36	5.629410	0.96671	.	.	ENSG00000132718	ENST00000368324;ENST00000539162	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.6819	0.91549	0.0:0.0:1.0:0.0	.	.	.	.	X	411;104	.	ENSP00000357307:W411X	W	+	3	0	SYT11	154117860	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.657000	0.98554	2.748000	0.94277	0.655000	0.94253	TGG		0.587	SYT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039597.1	NM_152280		8	192	0	0	0	0.00308	0	8	192				
C1orf85	112770	broad.mit.edu	37	1	156264242	156264242	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:156264242C>G	ENST00000362007.1	-	3	519	c.493G>C	c.(493-495)Gat>Cat	p.D165H	C1orf85_ENST00000482579.1_5'Flank	NM_001256604.1|NM_001256609.1|NM_144580.2	NP_001243533.1|NP_001243538.1|NP_653181.1	Q8WWB7	NCUG1_HUMAN	chromosome 1 open reading frame 85	165					intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(2)|skin(3)	14	Hepatocellular(266;0.158)					GTGGCAGGATCCAATGAATCA	0.532																																							uc001foh.2		NA																	0				ovary(2)	2						c.(493-495)GAT>CAT		kidney predominant protein NCU-G1 precursor							112.0	100.0	104.0					1																	156264242		2203	4300	6503	SO:0001583	missense	112770				positive regulation of transcription from RNA polymerase II promoter	cytosol|integral to membrane|lysosomal membrane|nucleus	ligand-dependent nuclear receptor activity|protein binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	g.chr1:156264242C>G	BC011575	CCDS1139.1, CCDS72947.1, CCDS72948.1, CCDS72949.1	1q22	2014-08-07			ENSG00000198715	ENSG00000198715			29436	protein-coding gene	gene with protein product	"""kidney lysosomal membrane protein"""					12975309, 18021396, 19489740	Standard	NM_144580		Approved	MGC31963, NCU-G1	uc001foh.4	Q8WWB7	OTTHUMG00000019789	ENST00000362007.1:c.493G>C	1.37:g.156264242C>G	ENSP00000354553:p.Asp165His					C1orf85_uc001fof.3_5'Flank|C1orf85_uc001fog.1_Intron|C1orf85_uc001foi.2_Missense_Mutation_p.D165H|C1orf85_uc009wrx.2_Intron|C1orf85_uc001foj.2_Missense_Mutation_p.D79H	p.D165H	NM_144580	NP_653181	Q8WWB7	NCUG1_HUMAN			3	506	-	Hepatocellular(266;0.158)		165			Lumenal (Potential).		A6NH16|B4DJN4|Q5SZX4|Q6UX96|Q8IV07|Q96F65	Missense_Mutation	SNP	ENST00000362007.1	37	c.493G>C	CCDS1139.1	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704614	0.68615	.	.	ENSG00000198715	ENST00000362007;ENST00000368264	T;T	0.25085	1.82;1.82	5.52	4.59	0.56863	.	0.267922	0.36932	N	0.002326	T	0.24586	0.0596	M	0.69823	2.125	0.37053	D	0.897713	D;P	0.58970	0.984;0.904	P;P	0.53006	0.715;0.572	T	0.15954	-1.0419	10	0.72032	D	0.01	6.6626	6.9824	0.24709	0.1746:0.7386:0.0:0.0868	.	84;165	Q8WWB7-2;Q8WWB7	.;NCUG1_HUMAN	H	165;79	ENSP00000354553:D165H;ENSP00000357247:D79H	ENSP00000354553:D165H	D	-	1	0	C1orf85	154530866	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	2.089000	0.41672	1.294000	0.44707	0.448000	0.29417	GAT		0.532	C1orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052108.1	NM_144580		11	96	0	0	0	0.010729	0	11	96				
NES	10763	broad.mit.edu	37	1	156640601	156640601	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:156640601C>T	ENST00000368223.3	-	4	3511	c.3379G>A	c.(3379-3381)Gag>Aag	p.E1127K		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1127	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCCAAACTCTCCTCTTCCAGG	0.642																																							uc001fpq.2		NA																	0				ovary(6)	6						c.(3379-3381)GAG>AAG		nestin							59.0	60.0	59.0					1																	156640601		2203	4300	6503	SO:0001583	missense	10763				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity	g.chr1:156640601C>T	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.3379G>A	1.37:g.156640601C>T	ENSP00000357206:p.Glu1127Lys						p.E1127K	NM_006617	NP_006608	P48681	NEST_HUMAN			4	3512	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		1127			Tail.		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	37	c.3379G>A	CCDS1151.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188208	0.78789	.	.	ENSG00000132688	ENST00000368223	D	0.86769	-2.17	5.1	5.1	0.69264	.	0.505771	0.14801	N	0.297604	T	0.80454	0.4626	L	0.59436	1.845	0.09310	N	1	P	0.37781	0.608	B	0.39660	0.306	T	0.77021	-0.2742	10	0.72032	D	0.01	.	12.9133	0.58192	0.0:0.8364:0.1636:0.0	.	1127	P48681	NEST_HUMAN	K	1127	ENSP00000357206:E1127K	ENSP00000357206:E1127K	E	-	1	0	NES	154907225	0.000000	0.05858	0.107000	0.21349	0.464000	0.32679	0.402000	0.20965	2.367000	0.80283	0.557000	0.71058	GAG		0.642	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617		13	119	0	0	0	0.00245	0	13	119				
ARHGEF11	9826	broad.mit.edu	37	1	156909582	156909582	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:156909582G>A	ENST00000361409.2	-	36	4476	c.3734C>T	c.(3733-3735)tCt>tTt	p.S1245F	ARHGEF11_ENST00000368194.3_Missense_Mutation_p.S1285F|ARHGEF11_ENST00000315174.8_Missense_Mutation_p.S661F|ARHGEF11_ENST00000487682.1_5'UTR	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1245					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCAGGGGTGAGAGGTGACGCT	0.652																																							uc001fqo.2		NA																	0				ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9						c.(3733-3735)TCT>TTT		Rho guanine nucleotide exchange factor (GEF) 11							57.0	63.0	61.0					1																	156909582		2203	4300	6503	SO:0001583	missense	9826				actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr1:156909582G>A	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.3734C>T	1.37:g.156909582G>A	ENSP00000354644:p.Ser1245Phe					ARHGEF11_uc010phu.1_Missense_Mutation_p.S661F|ARHGEF11_uc001fqn.2_Missense_Mutation_p.S1285F	p.S1245F	NM_014784	NP_055599	O15085	ARHGB_HUMAN			36	4774	-	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		1245					D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	ENST00000361409.2	37	c.3734C>T	CCDS1162.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.000347	0.35320	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	T;T;T	0.68765	-0.35;-0.34;-0.26	4.41	3.48	0.39840	.	0.151517	0.31210	N	0.008049	T	0.44008	0.1273	L	0.27053	0.805	0.38444	D	0.946782	P;P;P	0.50943	0.94;0.694;0.797	P;B;P	0.50617	0.646;0.346;0.447	T	0.41395	-0.9511	10	0.33940	T	0.23	-5.4917	7.4523	0.27246	0.0:0.1849:0.6239:0.1912	.	661;1245;1285	F8W8P9;O15085;O15085-2	.;ARHGB_HUMAN;.	F	1285;1245;661	ENSP00000357177:S1285F;ENSP00000354644:S1245F;ENSP00000313470:S661F	ENSP00000313470:S661F	S	-	2	0	ARHGEF11	155176206	0.286000	0.24305	0.998000	0.56505	0.541000	0.35023	0.541000	0.23207	1.022000	0.39626	0.561000	0.74099	TCT		0.652	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236		8	98	0	0	0	0.00308	0	8	98				
CD1D	912	broad.mit.edu	37	1	158151368	158151368	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:158151368C>T	ENST00000368171.3	+	3	684	c.185C>T	c.(184-186)tCg>tTg	p.S62L		NM_001766.3	NP_001757.1	P15813	CD1D_HUMAN	CD1d molecule	62					antigen processing and presentation, endogenous lipid antigen via MHC class Ib (GO:0048006)|detection of bacterium (GO:0016045)|heterotypic cell-cell adhesion (GO:0034113)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of T cell proliferation (GO:0042102)|T cell selection (GO:0045058)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	beta-2-microglobulin binding (GO:0030881)|cell adhesion molecule binding (GO:0050839)|exogenous lipid antigen binding (GO:0030884)|histone binding (GO:0042393)|lipid antigen binding (GO:0030882)|receptor activity (GO:0004872)			endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(1)|prostate(3)|urinary_tract(2)	30	all_hematologic(112;0.0378)					AGCAACGACTCGGACACCGTC	0.622																																							uc001frr.2		NA																	0				ovary(1)	1						c.(184-186)TCG>TTG		CD1D antigen precursor							81.0	89.0	86.0					1																	158151368		2203	4300	6503	SO:0001583	missense	912				antigen processing and presentation, endogenous lipid antigen via MHC class Ib|detection of bacterium|innate immune response|interspecies interaction between organisms|positive regulation of innate immune response|T cell selection	endosome membrane|integral to plasma membrane|lysosomal membrane	beta-2-microglobulin binding|exogenous lipid antigen binding|histone binding	g.chr1:158151368C>T	BC027926	CCDS1173.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158473	ENSG00000158473		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1637	protein-coding gene	gene with protein product		188410	"""CD1D antigen, d polypeptide"", ""CD1d antigen"""			2463622	Standard	NM_001766		Approved		uc001frr.3	P15813	OTTHUMG00000022436	ENST00000368171.3:c.185C>T	1.37:g.158151368C>T	ENSP00000357153:p.Ser62Leu					CD1D_uc009wsr.1_Missense_Mutation_p.S62L|CD1D_uc009wss.2_Missense_Mutation_p.S62L|CD1D_uc009wst.1_5'UTR	p.S62L	NM_001766	NP_001757	P15813	CD1D_HUMAN			3	684	+	all_hematologic(112;0.0378)		62			Extracellular (Potential).		D3DVD5|Q5W0J3|Q9UMM3|Q9Y5M4	Missense_Mutation	SNP	ENST00000368171.3	37	c.185C>T	CCDS1173.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.854534	0.32791	.	.	ENSG00000158473	ENST00000368171	T	0.17370	2.28	4.44	3.51	0.40186	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.000000	0.40064	N	0.001196	T	0.05410	0.0143	M	0.69823	2.125	0.09310	N	1	P	0.50943	0.94	B	0.22601	0.04	T	0.20009	-1.0288	10	0.42905	T	0.14	-6.9547	10.4511	0.44522	0.0:0.802:0.198:0.0	.	62	P15813	CD1D_HUMAN	L	62	ENSP00000357153:S62L	ENSP00000357153:S62L	S	+	2	0	CD1D	156417992	0.003000	0.15002	0.003000	0.11579	0.002000	0.02628	1.809000	0.38922	1.184000	0.42957	0.655000	0.94253	TCG		0.622	CD1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058340.1	NM_001766		21	232	0	0	0	0.014323	0	21	232				
OR10X1	128367	broad.mit.edu	37	1	158548974	158548974	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:158548974G>T	ENST00000368150.1	-	1	715	c.716C>A	c.(715-717)tCt>tAt	p.S239Y		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					GAGGACAGTAGAAATAATGAA	0.468																																							uc010pin.1		NA																	0				ovary(1)	1						c.(715-717)TCT>TAT		olfactory receptor, family 10, subfamily X,							121.0	120.0	121.0					1																	158548974		2203	4300	6503	SO:0001583	missense	128367				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158548974G>T	BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.716C>A	1.37:g.158548974G>T	ENSP00000357132:p.Ser239Tyr						p.S239Y	NM_001004477	NP_001004477	Q8NGY0	O10X1_HUMAN			1	716	-	all_hematologic(112;0.0378)		239			Cytoplasmic (Potential).		Q6IFR8	Missense_Mutation	SNP	ENST00000368150.1	37	c.716C>A	CCDS30900.1	.	.	.	.	.	.	.	.	.	.	G	8.979	0.974799	0.18736	.	.	ENSG00000186400	ENST00000368150	T	0.36699	1.24	4.8	3.85	0.44370	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000188	T	0.40546	0.1121	M	0.63208	1.945	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.08472	-1.0720	10	0.51188	T	0.08	.	8.4355	0.32784	0.0872:0.1585:0.7543:0.0	.	239	Q8NGY0	O10X1_HUMAN	Y	239	ENSP00000357132:S239Y	ENSP00000357132:S239Y	S	-	2	0	OR10X1	156815598	0.000000	0.05858	0.665000	0.29768	0.010000	0.07245	0.116000	0.15561	2.473000	0.83533	0.563000	0.77884	TCT		0.468	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051850.2	NM_001004477		71	60	1	0	1.48005e-37	0.01441	1.87323e-37	71	60				
OR10Z1	128368	broad.mit.edu	37	1	158576567	158576567	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:158576567C>T	ENST00000361284.1	+	1	339	c.339C>T	c.(337-339)ttC>ttT	p.F113F		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					CTAACTGCTTCCTTCTGGCTG	0.557																																							uc010pio.1		NA																	0				pancreas(1)|skin(1)	2						c.(337-339)TTC>TTT		olfactory receptor, family 10, subfamily Z,							122.0	128.0	126.0					1																	158576567		2203	4299	6502	SO:0001819	synonymous_variant	128368				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158576567C>T	AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.339C>T	1.37:g.158576567C>T							p.F113F	NM_001004478	NP_001004478	Q8NGY1	O10Z1_HUMAN			1	339	+	all_hematologic(112;0.0378)		113			Helical; Name=3; (Potential).		Q5VYL0|Q6IFR7	Silent	SNP	ENST00000361284.1	37	c.339C>T	CCDS30901.1																																																																																				0.557	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051853.1	NM_001004478		28	215	0	0	0	0.007291	0	28	215				
FCER1A	2205	broad.mit.edu	37	1	159273941	159273941	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:159273941G>C	ENST00000368115.1	+	4	399	c.300G>C	c.(298-300)gaG>gaC	p.E100D	FCER1A_ENST00000368114.1_Missense_Mutation_p.E67D	NM_002001.3	NP_001992.1	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide	100	Ig-like 1.				activation of JUN kinase activity (GO:0007257)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leukotriene biosynthetic process (GO:0019370)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of type I hypersensitivity (GO:0001812)|serotonin secretion (GO:0001820)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	IgE receptor activity (GO:0019767)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(19)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	AAGTTAATGAGAGTGAACCTG	0.403																																							uc001ftq.2		NA																	0				lung(2)|skin(2)|prostate(1)	5						c.(298-300)GAG>GAC		Fc fragment of IgE, high affinity I, receptor	Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)						79.0	78.0	78.0					1																	159273941		2203	4300	6503	SO:0001583	missense	2205					integral to plasma membrane		g.chr1:159273941G>C	BC015195	CCDS1184.1	1q23	2013-01-11			ENSG00000179639	ENSG00000179639		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3609	protein-coding gene	gene with protein product		147140		FCE1A		8245459	Standard	NM_002001		Approved		uc001ftq.3	P12319	OTTHUMG00000037176	ENST00000368115.1:c.300G>C	1.37:g.159273941G>C	ENSP00000357097:p.Glu100Asp						p.E100D	NM_002001	NP_001992	P12319	FCERA_HUMAN			4	399	+	all_hematologic(112;0.0429)		100			Extracellular (Potential).|Ig-like 1.			Missense_Mutation	SNP	ENST00000368115.1	37	c.300G>C	CCDS1184.1	.	.	.	.	.	.	.	.	.	.	G	1.660	-0.511688	0.04200	.	.	ENSG00000179639	ENST00000368115;ENST00000368114	T;T	0.07688	3.17;3.17	4.7	-2.27	0.06846	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.01061	0.0035	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48068	-0.9067	9	0.15066	T	0.55	.	6.873	0.24131	0.2395:0.3716:0.3888:0.0	.	100	P12319	FCERA_HUMAN	D	100;67	ENSP00000357097:E100D;ENSP00000357096:E67D	ENSP00000357096:E67D	E	+	3	2	FCER1A	157540565	0.003000	0.15002	0.000000	0.03702	0.003000	0.03518	-0.397000	0.07269	-0.553000	0.06158	-1.255000	0.01485	GAG		0.403	FCER1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090328.2	NM_002001		7	151	0	0	0	0.010729	0	7	151				
SLAMF9	89886	broad.mit.edu	37	1	159921487	159921487	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:159921487C>G	ENST00000368093.3	-	4	950	c.834G>C	c.(832-834)ttG>ttC	p.L278F	SLAMF9_ENST00000368092.3_Missense_Mutation_p.L187F|SLAMF9_ENST00000466773.1_5'UTR	NM_033438.3	NP_254273.2	Q96A28	SLAF9_HUMAN	SLAM family member 9	278						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CCTCCTTCCTCAATTTCATTC	0.512																																							uc001fus.2		NA																	0				ovary(1)	1						c.(832-834)TTG>TTC		SLAM family member 9 isoform 1							136.0	122.0	127.0					1																	159921487		2203	4300	6503	SO:0001583	missense	89886					integral to membrane		g.chr1:159921487C>G	AY034613	CCDS1191.1, CCDS53392.1	1q23.1	2013-01-11			ENSG00000162723	ENSG00000162723		"""Immunoglobulin superfamily / V-set domain containing"""	18430	protein-coding gene	gene with protein product		608589				11685473	Standard	NM_033438		Approved	CD2F-10, CD84-H1, SF2001	uc001fus.3	Q96A28	OTTHUMG00000024074	ENST00000368093.3:c.834G>C	1.37:g.159921487C>G	ENSP00000357072:p.Leu278Phe					SLAMF9_uc009wtd.2_Missense_Mutation_p.L187F|SLAMF9_uc001fut.2_3'UTR	p.L278F	NM_033438	NP_254273	Q96A28	SLAF9_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		4	951	-	all_hematologic(112;0.093)		278			Cytoplasmic (Potential).		Q5JRQ9|Q5JRR0|Q6UWG1	Missense_Mutation	SNP	ENST00000368093.3	37	c.834G>C	CCDS1191.1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.135996	0.37728	.	.	ENSG00000162723	ENST00000368093;ENST00000368092	T;T	0.58210	2.94;0.35	5.04	3.14	0.36123	.	0.754351	0.11463	N	0.561541	T	0.51736	0.1692	M	0.64997	1.995	0.23616	N	0.997284	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.36456	-0.9747	9	.	.	.	-1.643	5.9722	0.19359	0.2007:0.7035:0.0:0.0957	.	187;278	Q96A28-2;Q96A28	.;SLAF9_HUMAN	F	278;187	ENSP00000357072:L278F;ENSP00000357071:L187F	.	L	-	3	2	SLAMF9	158188111	0.958000	0.32768	0.840000	0.33206	0.142000	0.21351	0.669000	0.25142	0.687000	0.31509	-0.140000	0.14226	TTG		0.512	SLAMF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060630.1	NM_033438		19	157	0	0	0	0.012319	0	19	157				
SLAMF9	89886	broad.mit.edu	37	1	159922201	159922201	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:159922201C>A	ENST00000368093.3	-	3	631	c.515G>T	c.(514-516)cGg>cTg	p.R172L	SLAMF9_ENST00000368092.3_Intron|SLAMF9_ENST00000466773.1_5'UTR	NM_033438.3	NP_254273.2	Q96A28	SLAF9_HUMAN	SLAM family member 9	172	Ig-like C2-type.					integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCTATCCCCCCGGGAGAGCCA	0.577																																							uc001fus.2		NA																	0				ovary(1)	1						c.(514-516)CGG>CTG		SLAM family member 9 isoform 1							136.0	131.0	133.0					1																	159922201		2203	4300	6503	SO:0001583	missense	89886					integral to membrane		g.chr1:159922201C>A	AY034613	CCDS1191.1, CCDS53392.1	1q23.1	2013-01-11			ENSG00000162723	ENSG00000162723		"""Immunoglobulin superfamily / V-set domain containing"""	18430	protein-coding gene	gene with protein product		608589				11685473	Standard	NM_033438		Approved	CD2F-10, CD84-H1, SF2001	uc001fus.3	Q96A28	OTTHUMG00000024074	ENST00000368093.3:c.515G>T	1.37:g.159922201C>A	ENSP00000357072:p.Arg172Leu					SLAMF9_uc009wtd.2_Intron|SLAMF9_uc001fut.2_Intron	p.R172L	NM_033438	NP_254273	Q96A28	SLAF9_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		3	632	-	all_hematologic(112;0.093)		172			Ig-like C2-type.|Extracellular (Potential).		Q5JRQ9|Q5JRR0|Q6UWG1	Missense_Mutation	SNP	ENST00000368093.3	37	c.515G>T	CCDS1191.1	.	.	.	.	.	.	.	.	.	.	C	6.790	0.514685	0.12944	.	.	ENSG00000162723	ENST00000368093	T	0.39056	1.1	4.89	-9.68	0.00528	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.836270	0.00868	N	0.001998	T	0.04634	0.0126	N	0.05574	-0.02	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.06917	-1.0800	9	.	.	.	-0.0602	3.7449	0.08544	0.4214:0.2098:0.2914:0.0775	.	172	Q96A28	SLAF9_HUMAN	L	172	ENSP00000357072:R172L	.	R	-	2	0	SLAMF9	158188825	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-2.408000	0.01042	-2.579000	0.00463	-0.810000	0.03169	CGG		0.577	SLAMF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060630.1	NM_033438		126	115	1	0	1.05089e-66	0.01441	1.33259e-66	126	115				
PPOX	5498	broad.mit.edu	37	1	161140875	161140875	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:161140875G>C	ENST00000367999.4	+	13	1609	c.1343G>C	c.(1342-1344)gGa>gCa	p.G448A	PPOX_ENST00000535223.1_Intron|PPOX_ENST00000352210.5_Missense_Mutation_p.G448A|PPOX_ENST00000495483.1_Intron|PPOX_ENST00000544598.1_Missense_Mutation_p.G156A|PPOX_ENST00000432542.2_Intron|B4GALT3_ENST00000470882.1_5'Flank	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	448			G -> R (in VP; abolishes enzyme activity; impairs protein folding and/or stability). {ECO:0000269|PubMed:11074242}.		heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			ACTCTGGCTGGAGCCTCCTAT	0.532																																							uc001fyj.2		NA																	0				ovary(1)	1						c.(1342-1344)GGA>GCA		protoporphyrinogen oxidase							105.0	112.0	110.0					1																	161140875		2203	4300	6503	SO:0001583	missense	5498	Porphyria_Variegata			heme biosynthetic process	intrinsic to mitochondrial inner membrane|mitochondrial intermembrane space	flavin adenine dinucleotide binding|oxygen-dependent protoporphyrinogen oxidase activity	g.chr1:161140875G>C	BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.1343G>C	1.37:g.161140875G>C	ENSP00000356978:p.Gly448Ala					PPOX_uc001fyn.2_Missense_Mutation_p.G156A|PPOX_uc001fyg.2_Missense_Mutation_p.G448A|PPOX_uc001fyl.2_Missense_Mutation_p.G414A|PPOX_uc001fym.2_RNA|PPOX_uc001fyk.2_Missense_Mutation_p.G286A|PPOX_uc001fyh.2_Missense_Mutation_p.G286A|PPOX_uc010pkg.1_Missense_Mutation_p.G286A|PPOX_uc009wuc.1_Missense_Mutation_p.G249A|PPOX_uc010pkh.1_Intron|PPOX_uc001fyi.2_Intron	p.G448A	NM_001122764	NP_001116236	P50336	PPOX_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00275)		13	1633	+	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		448					D3DVG0|Q5VTW8	Missense_Mutation	SNP	ENST00000367999.4	37	c.1343G>C	CCDS1221.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.46|19.46	3.832588|3.832588	0.71258|0.71258	.|.	.|.	ENSG00000143224|ENSG00000143224	ENST00000537523|ENST00000352210;ENST00000367999;ENST00000544598;ENST00000435935	.|D;D;D	.|0.99909	.|-7.85;-7.85;-7.85	4.98|4.98	4.98|4.98	0.66077|0.66077	.|Amine oxidase (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99921|0.99921	0.9963|0.9963	M|M	0.88181|0.88181	2.935|2.935	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|1.0;0.999;1.0;1.0	D|D	0.95853|0.95853	0.8876|0.8876	5|10	.|0.87932	.|D	.|0	-34.0678|-34.0678	17.2009|17.2009	0.86906|0.86906	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|415;156;119;448	.|B4DY76;F5GZT7;Q96SE3;P50336	.|.;.;.;PPOX_HUMAN	Q|A	201|448;448;156;415	.|ENSP00000343943:G448A;ENSP00000356978:G448A;ENSP00000444216:G156A	.|ENSP00000343943:G448A	E|G	+|+	1|2	0|0	PPOX|PPOX	159407499|159407499	1.000000|1.000000	0.71417|0.71417	0.977000|0.977000	0.42913|0.42913	0.954000|0.954000	0.61252|0.61252	7.757000|7.757000	0.85209|0.85209	2.582000|2.582000	0.87167|0.87167	0.650000|0.650000	0.86243|0.86243	GAG|GGA		0.532	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082993.1	NM_000309		11	258	0	0	0	0.010729	0	11	258				
C1orf192	257177	broad.mit.edu	37	1	161334856	161334856	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:161334856G>C	ENST00000367974.1	-	5	438	c.433C>G	c.(433-435)Cca>Gca	p.P145A	RP11-122G18.5_ENST00000437833.2_lincRNA	NM_001013625.2	NP_001013647.2	Q5VTH2	CA192_HUMAN	chromosome 1 open reading frame 192	145										endometrium(1)|large_intestine(3)|lung(5)|prostate(1)	10	all_cancers(52;4.64e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			GGGGAGCTTGGAATTATGGTT	0.488																																							uc001gal.2		NA																	0					0						c.(433-435)CCA>GCA		hypothetical protein LOC257177							314.0	285.0	295.0					1																	161334856		2203	4300	6503	SO:0001583	missense	257177							g.chr1:161334856G>C		CCDS30921.1	1q23.3	2014-02-21			ENSG00000188931	ENSG00000188931			32325	protein-coding gene	gene with protein product							Standard	NM_001013625		Approved	Flattop, Fltp	uc001gal.4	Q5VTH2	OTTHUMG00000034462	ENST00000367974.1:c.433C>G	1.37:g.161334856G>C	ENSP00000356951:p.Pro145Ala						p.P145A	NM_001013625	NP_001013647	Q5VTH2	CA192_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00376)		5	439	-	all_cancers(52;4.64e-17)|all_hematologic(112;0.093)		145						Missense_Mutation	SNP	ENST00000367974.1	37	c.433C>G	CCDS30921.1	.	.	.	.	.	.	.	.	.	.	G	14.55	2.569729	0.45798	.	.	ENSG00000188931	ENST00000367974	.	.	.	4.5	4.5	0.54988	.	0.091999	0.45126	D	0.000384	T	0.44787	0.1310	L	0.54323	1.7	0.33792	D	0.625566	D	0.56035	0.974	P	0.49012	0.598	T	0.53063	-0.8491	8	0.59425	D	0.04	-9.8985	12.8821	0.58022	0.0:0.0:1.0:0.0	.	145	Q5VTH2	CA192_HUMAN	A	145	.	ENSP00000356951:P145A	P	-	1	0	C1orf192	159601480	0.925000	0.31364	0.972000	0.41901	0.453000	0.32348	2.444000	0.44890	2.467000	0.83353	0.655000	0.94253	CCA		0.488	C1orf192-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083309.1	NM_001013625		21	140	0	0	0	0.008871	0	21	140				
CCDC181	57821	broad.mit.edu	37	1	169394108	169394108	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:169394108C>G	ENST00000367806.3	-	2	210	c.58G>C	c.(58-60)Gaa>Caa	p.E20Q	CCDC181_ENST00000545005.1_Missense_Mutation_p.E20Q|CCDC181_ENST00000491570.1_5'UTR|CCDC181_ENST00000367805.3_Missense_Mutation_p.E20Q	NM_021179.1	NP_067002.1	Q5TID7	CC181_HUMAN	coiled-coil domain containing 181	20						nucleus (GO:0005634)											AGGTCCTTTTCAAAGTCATCT	0.279																																							uc001gga.1		NA																	0					0						c.(58-60)GAA>CAA		hypothetical protein LOC57821							153.0	145.0	147.0					1																	169394108		2201	4298	6499	SO:0001583	missense	57821							g.chr1:169394108C>G	AL049687	CCDS1279.1, CCDS72979.1	1q24	2013-03-14	2013-03-14	2013-03-14	ENSG00000117477	ENSG00000117477			28051	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 114"""	C1orf114			Standard	XM_005245381		Approved	FLJ25846	uc001gfz.1	Q5TID7	OTTHUMG00000035448	ENST00000367806.3:c.58G>C	1.37:g.169394108C>G	ENSP00000356780:p.Glu20Gln					C1orf114_uc001gfz.1_Missense_Mutation_p.E20Q|C1orf114_uc009wvq.1_Missense_Mutation_p.E20Q|C1orf114_uc001ggb.2_Missense_Mutation_p.E20Q|C1orf114_uc001ggc.1_Missense_Mutation_p.E20Q	p.E20Q	NM_021179	NP_067002	Q5TID7	CA114_HUMAN			2	226	-	all_hematologic(923;0.208)		20					O60780|Q53FD5|Q5TID9|Q8TC48	Missense_Mutation	SNP	ENST00000367806.3	37	c.58G>C		.	.	.	.	.	.	.	.	.	.	C	25.4	4.635884	0.87760	.	.	ENSG00000117477	ENST00000367805;ENST00000367806;ENST00000545005;ENST00000456107	T;T;T;T	0.57273	0.41;0.41;0.41;0.55	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.69513	0.3119	M	0.74881	2.28	0.40564	D	0.981231	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.73000	-0.4120	9	0.87932	D	0	-23.3642	18.8942	0.92417	0.0:1.0:0.0:0.0	.	20;20;20	Q5TID7-2;Q5TID7;Q5TID7-3	.;CA114_HUMAN;.	Q	20	ENSP00000356779:E20Q;ENSP00000356780:E20Q;ENSP00000442297:E20Q;ENSP00000411000:E20Q	ENSP00000356779:E20Q	E	-	1	0	C1orf114	167660732	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.085000	0.71343	2.558000	0.86282	0.561000	0.74099	GAA		0.279	CCDC181-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086099.1	NM_021179		9	75	0	0	0	0.006214	0	9	75				
SELP	6403	broad.mit.edu	37	1	169581480	169581480	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:169581480C>T	ENST00000263686.6	-	6	973	c.936G>A	c.(934-936)tgG>tgA	p.W312*	SELP_ENST00000458599.2_Nonsense_Mutation_p.W312*|SELP_ENST00000367794.2_Nonsense_Mutation_p.W312*|SELP_ENST00000367791.2_Nonsense_Mutation_p.W312*|SELP_ENST00000367788.2_Intron|SELP_ENST00000367793.2_Intron|SELP_ENST00000367786.2_Nonsense_Mutation_p.W312*|SELP_ENST00000367792.2_Nonsense_Mutation_p.W312*	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	312	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	CTGGGGCTGTCCATACCCCCG	0.488																																							uc001ggi.3		NA																	0				ovary(2)|skin(2)	4						c.(934-936)TGG>TGA		selectin P precursor	Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)						133.0	106.0	115.0					1																	169581480		2203	4300	6503	SO:0001587	stop_gained	6403				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding	g.chr1:169581480C>T	BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.936G>A	1.37:g.169581480C>T	ENSP00000263686:p.Trp312*					SELP_uc001ggh.2_Nonsense_Mutation_p.W147*|SELP_uc009wvr.2_Nonsense_Mutation_p.W312*	p.W312*	NM_003005	NP_002996	P16109	LYAM3_HUMAN			6	1001	-	all_hematologic(923;0.208)		312			Extracellular (Potential).|Sushi 2.		Q5R344|Q8IVD1	Nonsense_Mutation	SNP	ENST00000263686.6	37	c.936G>A	CCDS1282.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.855177|5.855177	0.97030|0.97030	.|.	.|.	ENSG00000174175|ENSG00000174175	ENST00000446728|ENST00000367795;ENST00000367790;ENST00000426706;ENST00000367789;ENST00000263686;ENST00000544572;ENST00000367794;ENST00000367792;ENST00000367791;ENST00000367786;ENST00000458599	.|.	.|.	.|.	4.97|4.97	4.04|4.04	0.47022|0.47022	.|.	.|0.000000	.|0.41001	.|D	.|0.000966	T|.	0.14527|.	0.0351|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.08868|.	-1.0701|.	3|.	.|0.02654	.|T	.|1	.|.	12.5242|12.5242	0.56077|0.56077	0.0:0.9166:0.0:0.0834|0.0:0.9166:0.0:0.0834	.|.	.|.	.|.	.|.	N|X	312|312;312;311;312;312;312;312;312;312;312;297	.|.	.|ENSP00000263686:W312X	D|W	-|-	1|3	0|0	SELP|SELP	167848104|167848104	1.000000|1.000000	0.71417|0.71417	0.013000|0.013000	0.15412|0.15412	0.736000|0.736000	0.42039|0.42039	2.863000|2.863000	0.48396|0.48396	1.053000|1.053000	0.40415|0.40415	0.650000|0.650000	0.86243|0.86243	GAC|TGG		0.488	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083916.4	NM_003005		13	108	0	0	0	0.004007	0	13	108				
PRRC2C	23215	broad.mit.edu	37	1	171544252	171544252	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:171544252A>G	ENST00000338920.4	+	25	7171	c.6934A>G	c.(6934-6936)Aca>Gca	p.T2312A	PRRC2C_ENST00000392078.3_Missense_Mutation_p.T2314A|PRRC2C_ENST00000426496.2_Missense_Mutation_p.T2247A|PRRC2C_ENST00000367742.3_Missense_Mutation_p.T2314A	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2312					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										AGTCACTCCTACAGCATCACT	0.388																																							uc010pmg.1		NA																	0					0						c.(6934-6936)ACA>GCA		HBxAg transactivated protein 2							127.0	119.0	121.0					1																	171544252		2203	4300	6503	SO:0001583	missense	23215						protein C-terminus binding	g.chr1:171544252A>G	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.6934A>G	1.37:g.171544252A>G	ENSP00000343629:p.Thr2312Ala					BAT2L2_uc010pmh.1_Missense_Mutation_p.T1224A|BAT2L2_uc010pmi.1_Missense_Mutation_p.T149A	p.T2312A	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN			25	7200	+			2312					Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	37	c.6934A>G	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	A	16.81	3.225500	0.58668	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080;ENST00000412837	T;T;T;T	0.02140	4.43;4.46;4.45;4.45	5.45	5.45	0.79879	.	0.000000	0.48286	D	0.000189	T	0.02970	0.0088	L	0.50333	1.59	0.47862	D	0.999539	P	0.50528	0.936	P	0.50405	0.64	T	0.51639	-0.8680	10	0.66056	D	0.02	.	15.5052	0.75731	1.0:0.0:0.0:0.0	.	2312	Q9Y520-4	.	A	2314;2266;2247;2314;2312;2069;149	ENSP00000375928:T2314A;ENSP00000410219:T2247A;ENSP00000356716:T2314A;ENSP00000343629:T2312A	ENSP00000343629:T2312A	T	+	1	0	PRRC2C	169810876	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	8.962000	0.93254	2.064000	0.61679	0.482000	0.46254	ACA		0.388	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172		3	34	0	0	0	0.009096	0	3	34				
PRRC2C	23215	broad.mit.edu	37	1	171544259	171544259	+	Nonsense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:171544259C>G	ENST00000338920.4	+	25	7178	c.6941C>G	c.(6940-6942)tCa>tGa	p.S2314*	PRRC2C_ENST00000392078.3_Nonsense_Mutation_p.S2316*|PRRC2C_ENST00000426496.2_Nonsense_Mutation_p.S2249*|PRRC2C_ENST00000367742.3_Nonsense_Mutation_p.S2316*	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2314					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										CCTACAGCATCACTATCAGGT	0.388																																							uc010pmg.1		NA																	0					0						c.(6940-6942)TCA>TGA		HBxAg transactivated protein 2							121.0	114.0	116.0					1																	171544259		2203	4300	6503	SO:0001587	stop_gained	23215						protein C-terminus binding	g.chr1:171544259C>G	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.6941C>G	1.37:g.171544259C>G	ENSP00000343629:p.Ser2314*					BAT2L2_uc010pmh.1_Nonsense_Mutation_p.S1226*|BAT2L2_uc010pmi.1_Nonsense_Mutation_p.S151*	p.S2314*	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN			25	7207	+			2314					Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Nonsense_Mutation	SNP	ENST00000338920.4	37	c.6941C>G	CCDS1296.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	49|49	15.745869|15.745869	0.99844|0.99844	.|.	.|.	ENSG00000117523|ENSG00000117523	ENST00000495585|ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080;ENST00000412837	.|.	.|.	.|.	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	.|0.000000	.|0.38548	.|N	.|0.001642	T|.	0.78848|.	0.4348|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.81077|.	-0.1096|.	3|.	.|0.87932	.|D	.|0	.|.	19.5325|19.5325	0.95235|0.95235	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	D|X	797|2316;2268;2249;2316;2314;2071;151	.|.	.|ENSP00000343629:S2314X	H|S	+|+	1|2	0|0	PRRC2C|PRRC2C	169810883|169810883	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.895000|0.895000	0.52256|0.52256	7.487000|7.487000	0.81328|0.81328	2.613000|2.613000	0.88420|0.88420	0.591000|0.591000	0.81541|0.81541	CAC|TCA		0.388	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172		3	33	0	0	0	0.009096	0	3	33				
SLC9C2	284525	broad.mit.edu	37	1	173526632	173526632	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:173526632C>A	ENST00000367714.3	-	10	1484	c.1062G>T	c.(1060-1062)ttG>ttT	p.L354F	RP3-436N22.3_ENST00000431459.1_RNA|SLC9C2_ENST00000466087.1_5'UTR|SLC9C2_ENST00000536496.1_Missense_Mutation_p.L252F	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	354					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										GGCTCACTAACAAAATAGTAA	0.308																																							uc001giz.2		NA																	0				ovary(2)	2						c.(1060-1062)TTG>TTT		solute carrier family 9, member 11							99.0	107.0	104.0					1																	173526632		2203	4300	6503	SO:0001583	missense	284525				sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity	g.chr1:173526632C>A	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.1062G>T	1.37:g.173526632C>A	ENSP00000356687:p.Leu354Phe					SLC9A11_uc009wwe.2_5'UTR|SLC9A11_uc010pmq.1_RNA	p.L354F	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN			10	1485	-			354			Helical; (Potential).		Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	37	c.1062G>T	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	C	10.93	1.489343	0.26686	.	.	ENSG00000162753	ENST00000367714;ENST00000536496	T;T	0.15017	2.46;2.46	5.57	-3.11	0.05299	Cation/H+ exchanger (1);	1.420960	0.04715	N	0.418229	T	0.03136	0.0092	L	0.42245	1.32	0.09310	N	1	B	0.18461	0.028	B	0.22386	0.039	T	0.38714	-0.9648	10	0.15499	T	0.54	-2.0828	1.3686	0.02206	0.4263:0.2182:0.1986:0.1569	.	354	Q5TAH2	S9A11_HUMAN	F	354;252	ENSP00000356687:L354F;ENSP00000445437:L252F	ENSP00000356687:L354F	L	-	3	2	SLC9A11	171793255	0.001000	0.12720	0.000000	0.03702	0.675000	0.39556	-0.564000	0.05936	-1.014000	0.03379	0.591000	0.81541	TTG		0.308	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527		23	157	1	0	2.39556e-15	0.00278	2.83808e-15	23	157				
GPR52	9293	broad.mit.edu	37	1	174418080	174418080	+	Silent	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:174418080G>C	ENST00000367685.2	+	1	869	c.831G>C	c.(829-831)ctG>ctC	p.L277L	RABGAP1L_ENST00000357444.6_Intron|RABGAP1L_ENST00000367689.3_Intron|RABGAP1L_ENST00000251507.4_Intron	NM_005684.4	NP_005675.3	Q9Y2T5	GPR52_HUMAN	G protein-coupled receptor 52	277					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(3)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|prostate(1)|skin(2)	20						TTTATATGCTGTGGCTCCCCT	0.438																																					Ovarian(92;924 1390 1930 16467 40583)	Ovarian(92;924 1390 1930 16467 40583)	uc001gka.1		NA																	0				skin(1)	1						c.(829-831)CTG>CTC		G protein-coupled receptor 52							107.0	110.0	109.0					1																	174418080		2203	4300	6503	SO:0001819	synonymous_variant	9293					integral to plasma membrane	G-protein coupled receptor activity	g.chr1:174418080G>C	AF096784	CCDS30941.1	1q24	2012-08-21			ENSG00000203737	ENSG00000203737		"""GPCR / Class A : Orphans"""	4508	protein-coding gene	gene with protein product		604106				9931487	Standard	NM_005684		Approved		uc001gka.1	Q9Y2T5	OTTHUMG00000034901	ENST00000367685.2:c.831G>C	1.37:g.174418080G>C						RABGAP1L_uc001gjw.2_Intron|RABGAP1L_uc001gjx.2_Intron|RABGAP1L_uc001gjy.2_Intron|RABGAP1L_uc001gjz.2_Intron|uc010pmu.1_RNA	p.L277L	NM_005684	NP_005675	Q9Y2T5	GPR52_HUMAN			1	869	+			277			Helical; Name=6; (Potential).		O75654|Q4VBL6|Q6ISM0	Silent	SNP	ENST00000367685.2	37	c.831G>C	CCDS30941.1																																																																																				0.438	GPR52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084511.1	NM_005684		16	127	0	0	0	0.004007	0	16	127				
TNN	63923	broad.mit.edu	37	1	175046812	175046812	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:175046812C>T	ENST00000239462.4	+	2	371	c.258C>T	c.(256-258)ttC>ttT	p.F86F		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	86					axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ACATCATCTTCAGGCACAACA	0.612																																							uc001gkl.1		NA																	0				large_intestine(5)|ovary(3)|central_nervous_system(1)	9						c.(256-258)TTC>TTT		tenascin N precursor							63.0	54.0	57.0					1																	175046812		2203	4300	6503	SO:0001819	synonymous_variant	63923				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix		g.chr1:175046812C>T	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.258C>T	1.37:g.175046812C>T						TNN_uc010pmx.1_Silent_p.F86F	p.F86F	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)	2	371	+		Breast(1374;0.000962)	86					B9EGP3|Q5R360	Silent	SNP	ENST00000239462.4	37	c.258C>T	CCDS30943.1																																																																																				0.612	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		9	41	0	0	0	0.004482	0	9	41				
DHX9	1660	broad.mit.edu	37	1	182850485	182850485	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:182850485A>T	ENST00000367549.3	+	23	2821	c.2711A>T	c.(2710-2712)cAt>cTt	p.H904L	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	904					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						GGCTATATCCATCGAAATTTT	0.448																																					Colon(69;210 1162 3697 13559 39565)	Colon(69;210 1162 3697 13559 39565)	uc001gpr.2		NA																	0				ovary(2)	2						c.(2710-2712)CAT>CTT		DEAH (Asp-Glu-Ala-His) box polypeptide 9							136.0	130.0	132.0					1																	182850485		1889	4114	6003	SO:0001583	missense	1660				CRD-mediated mRNA stabilization|nuclear mRNA splicing, via spliceosome	centrosome|CRD-mediated mRNA stability complex|nucleolus|nucleoplasm|ribonucleoprotein complex	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|double-stranded RNA binding|protein binding	g.chr1:182850485A>T	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.2711A>T	1.37:g.182850485A>T	ENSP00000356520:p.His904Leu					DHX9_uc001gps.2_Missense_Mutation_p.H690L|DHX9_uc001gpt.2_Missense_Mutation_p.H183L|DHX9_uc009wyd.2_5'UTR	p.H904L	NM_001357	NP_001348	Q08211	DHX9_HUMAN			23	2874	+			904					B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	c.2711A>T	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.795944	0.90453	.	.	ENSG00000135829	ENST00000367549	T	0.28895	1.59	5.76	5.76	0.90799	Helicase-associated domain (2);	0.000000	0.85682	D	0.000000	T	0.64249	0.2581	H	0.94847	3.59	0.58432	D	0.999999	P;D	0.55385	0.943;0.971	P;P	0.60012	0.739;0.867	T	0.75445	-0.3315	10	0.72032	D	0.01	.	15.765	0.78120	1.0:0.0:0.0:0.0	.	183;904	B3KU66;Q08211	.;DHX9_HUMAN	L	904	ENSP00000356520:H904L	ENSP00000356520:H904L	H	+	2	0	DHX9	181117108	1.000000	0.71417	0.987000	0.45799	0.967000	0.64934	8.596000	0.90844	2.186000	0.69663	0.533000	0.62120	CAT		0.448	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588		8	163	0	0	0	0.004482	0	8	163				
KCNT2	343450	broad.mit.edu	37	1	196395074	196395074	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:196395074C>A	ENST00000294725.9	-	11	1944	c.1029G>T	c.(1027-1029)caG>caT	p.Q343H	KCNT2_ENST00000367433.5_Missense_Mutation_p.Q343H|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000609185.1_Missense_Mutation_p.Q343H|KCNT2_ENST00000451324.2_Intron|KCNT2_ENST00000367431.4_Missense_Mutation_p.Q343H			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	343					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.Q343H(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						CCCTTCGAACCTGTACATCCA	0.373																																							uc001gtd.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(5)|breast(1)|skin(1)	7						c.(1027-1029)CAG>CAT		potassium channel, subfamily T, member 2							138.0	122.0	128.0					1																	196395074		2203	4300	6503	SO:0001583	missense	343450					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr1:196395074C>A	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.1029G>T	1.37:g.196395074C>A	ENSP00000294725:p.Gln343His					KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Missense_Mutation_p.Q343H|KCNT2_uc001gtf.1_Missense_Mutation_p.Q343H|KCNT2_uc001gtg.1_Intron|KCNT2_uc009wyu.2_Missense_Mutation_p.Q343H|KCNT2_uc009wyv.1_Missense_Mutation_p.Q318H	p.Q343H	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN			11	1089	-			343			Cytoplasmic (Potential).		Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	37	c.1029G>T	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.505290	0.64410	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000535608;ENST00000294725	T;T;T	0.70399	-0.48;-0.48;-0.48	5.64	-2.84	0.05751	NAD(P)-binding domain (1);	0.000000	0.64402	D	0.000008	T	0.72938	0.3523	L	0.50333	1.59	0.80722	D	1	D;D;P;D	0.60575	0.987;0.988;0.933;0.987	P;P;P;P	0.60117	0.663;0.869;0.77;0.663	T	0.73613	-0.3927	10	0.66056	D	0.02	-18.4525	12.3646	0.55222	0.0:0.6124:0.0:0.3876	.	343;343;343;343	A9LNM6;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	H	343;343;164;343	ENSP00000356403:Q343H;ENSP00000356401:Q343H;ENSP00000294725:Q343H	ENSP00000294725:Q343H	Q	-	3	2	KCNT2	194661697	0.633000	0.27181	0.993000	0.49108	0.962000	0.63368	-0.117000	0.10708	-0.310000	0.08766	-0.247000	0.11927	CAG		0.373	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503		16	73	1	0	6.49762e-13	0.006122	7.55037e-13	16	73				
CFHR2	3080	broad.mit.edu	37	1	196881996	196881996	+	Intron	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:196881996C>G	ENST00000367421.3	+	2	135				CFHR4_ENST00000608469.1_Missense_Mutation_p.S57C|CFHR4_ENST00000367418.2_Missense_Mutation_p.S128C|CFHR4_ENST00000251424.4_Missense_Mutation_p.S128C|CFHR4_ENST00000367416.2_Missense_Mutation_p.S374C			P36980	FHR2_HUMAN	complement factor H-related 2							extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						GATGGAAATTCTTCAGGTTCA	0.303																																							uc001gto.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(382-384)TCT>TGT		complement factor H-related 4 precursor							119.0	125.0	123.0					1																	196881996		2200	4296	6496	SO:0001627	intron_variant	10877					extracellular region	lipid transporter activity	g.chr1:196881996C>G	X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367421.3:c.59-36589C>G	1.37:g.196881996C>G						CFHR4_uc009wyy.2_Missense_Mutation_p.S374C|CFHR4_uc001gtp.2_Missense_Mutation_p.S375C	p.S128C	NM_006684	NP_006675	Q92496	FHR4_HUMAN			3	452	+			128			Sushi 2.		Q14310|Q5T9T1	Missense_Mutation	SNP	ENST00000367421.3	37	c.383C>G		.	.	.	.	.	.	.	.	.	.	C	13.91	2.379271	0.42207	.	.	ENSG00000134365	ENST00000367416;ENST00000367418;ENST00000251424;ENST00000538553	T;T;T	0.52983	0.64;0.64;0.64	2.11	2.11	0.27256	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.57051	0.2027	L	0.46157	1.445	0.09310	N	1	D;D;D	0.89917	0.979;1.0;0.999	P;D;D	0.78314	0.827;0.991;0.971	T	0.37079	-0.9721	9	0.59425	D	0.04	.	7.7439	0.28858	0.0:1.0:0.0:0.0	.	374;375;128	C9J7J7;Q5DVJ7;Q92496	.;.;FHR4_HUMAN	C	374;128;128;128	ENSP00000356386:S374C;ENSP00000356388:S128C;ENSP00000251424:S128C	ENSP00000251424:S128C	S	+	2	0	CFHR4	195148619	0.000000	0.05858	0.003000	0.11579	0.421000	0.31385	0.225000	0.17757	1.476000	0.48215	0.205000	0.17691	TCT		0.303	CFHR2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005666		21	141	0	0	0	0.00278	0	21	141				
KIF21B	23046	broad.mit.edu	37	1	200965360	200965360	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:200965360C>T	ENST00000422435.2	-	15	2557	c.2241G>A	c.(2239-2241)aaG>aaA	p.K747K	KIF21B_ENST00000332129.2_Silent_p.K747K|KIF21B_ENST00000461742.2_Silent_p.K747K|KIF21B_ENST00000360529.5_Silent_p.K747K	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	747					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						CGGCCTGTAGCTTCTTCAGCT	0.607																																							uc001gvs.1		NA																	0				ovary(3)|skin(3)	6						c.(2239-2241)AAG>AAA		kinesin family member 21B							185.0	171.0	175.0					1																	200965360		2203	4300	6503	SO:0001819	synonymous_variant	23046				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr1:200965360C>T	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.2241G>A	1.37:g.200965360C>T						KIF21B_uc001gvr.1_Silent_p.K747K|KIF21B_uc009wzl.1_Silent_p.K747K|KIF21B_uc010ppn.1_Silent_p.K747K	p.K747K	NM_017596	NP_060066	O75037	KI21B_HUMAN			15	2558	-			747			Potential.		B2RP62|B7ZMI0|Q5T4J3	Silent	SNP	ENST00000422435.2	37	c.2241G>A	CCDS58056.1																																																																																				0.607	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332		16	269	0	0	0	0.007413	0	16	269				
TNNI1	7135	broad.mit.edu	37	1	201383732	201383732	+	Missense_Mutation	SNP	C	C	T	rs199605300		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:201383732C>T	ENST00000361379.4	-	5	195	c.103G>A	c.(103-105)Gag>Aag	p.E35K	TNNI1_ENST00000555948.1_Missense_Mutation_p.E35K|TNNI1_ENST00000367312.1_Missense_Mutation_p.E35K|TNNI1_ENST00000336092.4_Missense_Mutation_p.E35K	NM_003281.3	NP_003272.3	P19237	TNNI1_HUMAN	troponin I type 1 (skeletal, slow)	35	Involved in binding TNC.				muscle filament sliding (GO:0030049)|regulation of striated muscle contraction (GO:0006942)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytosol (GO:0005829)|troponin complex (GO:0005861)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	8						TCGCGCTCCTCGTGCTCCTGC	0.662																																							uc010ppq.1		NA																	0					0						c.(103-105)GAG>AAG		troponin I, skeletal, slow		C	LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	56.0	52.0	54.0		103	3.0	0.9	1		54	0,8600		0,0,4300	no	missense	TNNI1	NM_003281.3	56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	35/188	201383732	1,13005	2203	4300	6503	SO:0001583	missense	7135				muscle filament sliding|regulation of striated muscle contraction	cytosol|troponin complex	actin binding|tropomyosin binding	g.chr1:201383732C>T	BC012600	CCDS1411.1	1q31.3	2008-02-05	2005-09-12		ENSG00000159173	ENSG00000159173			11945	protein-coding gene	gene with protein product		191042	"""troponin I, skeletal, slow"""			2365354, 8144655	Standard	NM_003281		Approved		uc021phd.1	P19237	OTTHUMG00000035736	ENST00000361379.4:c.103G>A	1.37:g.201383732C>T	ENSP00000354488:p.Glu35Lys					TNNI1_uc001gwo.1_RNA|TNNI1_uc001gwp.2_Missense_Mutation_p.E14K	p.E35K	NM_003281	NP_003272	P19237	TNNI1_HUMAN			5	196	-			35			Involved in binding TNC.		A6NEH3|A8MSJ0|Q659A5|Q6FGS7|Q6FGW1|Q6ICU2|Q86T57|Q96DT9	Missense_Mutation	SNP	ENST00000361379.4	37	c.103G>A	CCDS1411.1	.	.	.	.	.	.	.	.	.	.	C	9.182	1.023898	0.19433	2.27E-4	0.0	ENSG00000159173	ENST00000358712;ENST00000361379;ENST00000336092;ENST00000413495;ENST00000555948;ENST00000367312;ENST00000555340;ENST00000556362	D;D;D;D;D;D	0.95035	-3.59;-3.59;-3.59;-3.59;-3.59;-3.59	5.05	2.99	0.34606	.	0.464676	0.21746	N	0.069751	D	0.86644	0.5982	N	0.25825	0.765	0.27488	N	0.952361	B	0.25955	0.138	B	0.16722	0.016	T	0.75105	-0.3435	10	0.22706	T	0.39	-22.0459	5.6942	0.17847	0.1449:0.6382:0.1401:0.0769	.	35	P19237	TNNI1_HUMAN	K	35;35;35;35;35;35;14;35	ENSP00000354488:E35K;ENSP00000337022:E35K;ENSP00000451307:E35K;ENSP00000356281:E35K;ENSP00000451660:E14K;ENSP00000451776:E35K	ENSP00000337022:E35K	E	-	1	0	TNNI1	199650355	0.492000	0.26027	0.950000	0.38849	0.591000	0.36615	1.478000	0.35442	1.065000	0.40693	0.655000	0.94253	GAG		0.662	TNNI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087001.1	NM_003281		13	46	0	0	0	0.001855	0	13	46				
ATP2B4	493	broad.mit.edu	37	1	203682343	203682343	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:203682343G>A	ENST00000357681.5	+	14	3385	c.2262G>A	c.(2260-2262)gcG>gcA	p.A754A	ATP2B4_ENST00000341360.2_Silent_p.A754A|ATP2B4_ENST00000367219.3_Silent_p.A742A|ATP2B4_ENST00000367218.3_Silent_p.A754A|ATP2B4_ENST00000391954.2_Silent_p.A754A	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	754					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GGGTCCTGGCGCGATCTTCTC	0.542																																							uc001gzw.2		NA																	0				ovary(2)|skin(1)	3						c.(2260-2262)GCG>GCA		plasma membrane calcium ATPase 4 isoform 4b							189.0	175.0	180.0					1																	203682343		2203	4300	6503	SO:0001819	synonymous_variant	493				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding	g.chr1:203682343G>A	M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.2262G>A	1.37:g.203682343G>A						ATP2B4_uc001gzv.2_Silent_p.A754A|ATP2B4_uc009xaq.2_Silent_p.A754A	p.A754A	NM_001684	NP_001675	P23634	AT2B4_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)		14	3146	+	all_cancers(21;0.071)|all_epithelial(62;0.228)		754			Cytoplasmic (Potential).		B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Silent	SNP	ENST00000357681.5	37	c.2262G>A	CCDS1440.1																																																																																				0.542	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087462.1	NM_001001396		20	158	0	0	0	0.010504	0	20	158				
LAX1	54900	broad.mit.edu	37	1	203740522	203740522	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:203740522T>C	ENST00000442561.2	+	3	617	c.227T>C	c.(226-228)gTc>gCc	p.V76A	LAX1_ENST00000367215.1_3'UTR|LAX1_ENST00000367217.5_Missense_Mutation_p.V60A	NM_017773.3	NP_060243.2	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1	76					antigen receptor-mediated signaling pathway (GO:0050851)|B cell activation (GO:0042113)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)			central_nervous_system(2)|endometrium(3)|large_intestine(2)|lung(13)|prostate(1)|stomach(1)|urinary_tract(2)	24	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CGAGTTACCGTCATGCCCTTG	0.493																																							uc001haa.2		NA																	0				central_nervous_system(2)	2						c.(226-228)GTC>GCC		lymphocyte transmembrane adaptor 1 isoform a							257.0	249.0	252.0					1																	203740522		2203	4300	6503	SO:0001583	missense	54900				B cell activation|immune response|inactivation of MAPK activity|intracellular signal transduction|negative regulation of T cell activation	Golgi apparatus|integral to membrane|plasma membrane	protein kinase binding|SH2 domain binding	g.chr1:203740522T>C	AK000347	CCDS1441.2, CCDS44297.1	1q32.1	2008-02-05			ENSG00000122188	ENSG00000122188			26005	protein-coding gene	gene with protein product	"""LAT-like membrane associated protein"", ""linker for activation of x cells"""					12359715	Standard	NM_017773		Approved	LAX, FLJ20340	uc001haa.3	Q8IWV1	OTTHUMG00000035908	ENST00000442561.2:c.227T>C	1.37:g.203740522T>C	ENSP00000406970:p.Val76Ala					LAX1_uc010pql.1_Missense_Mutation_p.V60A|LAX1_uc001hab.2_5'UTR	p.V76A	NM_017773	NP_060243	Q8IWV1	LAX1_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.109)		3	637	+	all_cancers(21;0.0915)		76			Cytoplasmic (Potential).		B7Z744|J3KP69|Q6NSZ6|Q9NXB4	Missense_Mutation	SNP	ENST00000442561.2	37	c.227T>C	CCDS1441.2	.	.	.	.	.	.	.	.	.	.	T	5.222	0.226447	0.09916	.	.	ENSG00000122188	ENST00000442561;ENST00000367217	.	.	.	5.33	-10.7	0.00240	.	2.378330	0.01739	N	0.029305	T	0.29588	0.0738	L	0.46157	1.445	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.12156	0.007;0.007	T	0.19451	-1.0305	9	0.62326	D	0.03	1.2977	3.4174	0.07381	0.1979:0.4431:0.1566:0.2023	.	60;76	B7Z744;Q8IWV1	.;LAX1_HUMAN	A	76;60	.	ENSP00000356186:V60A	V	+	2	0	LAX1	202007145	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-1.419000	0.02460	-2.997000	0.00277	-0.912000	0.02778	GTC		0.493	LAX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087468.3	NM_017773		26	337	0	0	0	0.005443	0	26	337				
SRGAP2	23380	broad.mit.edu	37	1	206628307	206628307	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:206628307G>A	ENST00000414007.1	+	17	2024	c.2024G>A	c.(2023-2025)aGa>aAa	p.R675K	SRGAP2_ENST00000471256.1_3'UTR|SRGAP2_ENST00000419187.2_Missense_Mutation_p.R120K			O75044	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	815	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin filament severing (GO:0051014)|axon guidance (GO:0007411)|dendritic spine development (GO:0060996)|extension of a leading process involved in cell motility in cerebral cortex radial glia guided migration (GO:0021816)|filopodium assembly (GO:0046847)|lamellipodium assembly involved in ameboidal cell migration (GO:0003363)|negative regulation of neuron migration (GO:2001223)|neuron projection morphogenesis (GO:0048812)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine head (GO:0044327)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein homodimerization activity (GO:0042803)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			NS(1)|breast(1)|kidney(1)|lung(1)	4	Breast(84;0.137)					GTGACAGCCAGAGCGGGGGCC	0.537																																							uc001hdy.2		NA																	0					0						c.(2182-2184)AGA>AAA		SLIT-ROBO Rho GTPase activating protein 2							80.0	91.0	88.0					1																	206628307		1935	4133	6068	SO:0001583	missense	23380				axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding	g.chr1:206628307G>A	AB007925	CCDS73017.1	1q32.1	2014-08-13	2004-11-12	2004-11-12	ENSG00000163486	ENSG00000266028		"""Rho GTPase activating proteins"""	19751	protein-coding gene	gene with protein product		606524	"""formin binding protein 2"""	FNBP2		15046868, 11672528	Standard	XM_005277510		Approved	KIAA0456, ARHGAP34, SRGAP2A	uc001hdy.3	O75044	OTTHUMG00000184381	ENST00000414007.1:c.2024G>A	1.37:g.206628307G>A	ENSP00000390898:p.Arg675Lys					SRGAP2_uc001hdx.2_Missense_Mutation_p.R728K|SRGAP2_uc010pru.1_Missense_Mutation_p.R651K	p.R728K	NM_015326	NP_056141	O75044	FNBP2_HUMAN			18	2516	+	Breast(84;0.137)		815						Missense_Mutation	SNP	ENST00000414007.1	37	c.2183G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.30|17.30	3.354876|3.354876	0.61293|0.61293	.|.	.|.	ENSG00000163486|ENSG00000163486	ENST00000426388|ENST00000414007;ENST00000419187;ENST00000439126	.|T;T;T	.|0.33438	.|3.15;1.41;2.74	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.37156|0.37156	0.0993|0.0993	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.01706|0.01706	-1.1291|-1.1291	3|6	.|0.12766	.|T	.|0.61	.|.	19.2934|19.2934	0.94112|0.94112	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	K|K	98|675;120;429	.|ENSP00000390898:R675K;ENSP00000397990:R120K;ENSP00000403036:R429K	.|ENSP00000390898:R675K	E|R	+|+	1|2	0|0	SRGAP2|SRGAP2	204694930|204694930	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.175000|9.175000	0.94831|0.94831	2.808000|2.808000	0.96608|0.96608	0.655000|0.655000	0.94253|0.94253	GAG|AGA		0.537	SRGAP2-201	KNOWN	basic	protein_coding	protein_coding		NM_015326		19	93	0	0	0	0.007413	0	19	93				
SYT14	255928	broad.mit.edu	37	1	210267810	210267810	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:210267810A>T	ENST00000472886.1	+	5	600	c.586A>T	c.(586-588)Aac>Tac	p.N196Y	SYT14_ENST00000367015.1_Missense_Mutation_p.N158Y|SYT14_ENST00000399639.2_Missense_Mutation_p.N196Y|SYT14_ENST00000534859.1_Missense_Mutation_p.N196Y|SYT14_ENST00000422431.1_Missense_Mutation_p.N241Y|SYT14_ENST00000271745.7_3'UTR|SYT14_ENST00000367019.1_Missense_Mutation_p.N196Y|SYT14_ENST00000537238.1_Missense_Mutation_p.N158Y			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	196					cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)			endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		CCACTGCAGCAACAGTCCAAG	0.423																																							uc009xcv.2		NA																	0				ovary(1)|skin(1)	2						c.(586-588)AAC>TAC		synaptotagmin XIV isoform 4							116.0	110.0	112.0					1																	210267810		2203	4300	6503	SO:0001583	missense	255928					integral to membrane		g.chr1:210267810A>T	AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.586A>T	1.37:g.210267810A>T	ENSP00000418901:p.Asn196Tyr					SYT14_uc001hhs.3_Missense_Mutation_p.N241Y|SYT14_uc001hht.3_Missense_Mutation_p.N196Y|SYT14_uc001hhu.3_RNA|SYT14_uc010psn.1_Missense_Mutation_p.N241Y|SYT14_uc010pso.1_Missense_Mutation_p.N158Y	p.N196Y	NM_153262	NP_694994	Q8NB59	SYT14_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.085)	5	658	+			196			Cytoplasmic (Potential).		B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Missense_Mutation	SNP	ENST00000472886.1	37	c.586A>T	CCDS31014.1	.	.	.	.	.	.	.	.	.	.	A	18.12	3.553652	0.65425	.	.	ENSG00000143469	ENST00000422431;ENST00000534859;ENST00000399639;ENST00000537238;ENST00000367019;ENST00000472886;ENST00000367015	T;T;T;T;T;T;T	0.18502	3.35;3.22;2.21;3.48;3.22;3.48;3.48	5.62	5.62	0.85841	.	0.224179	0.46442	D	0.000283	T	0.20129	0.0484	L	0.36672	1.1	0.43326	D	0.995352	P;P;P;D	0.53312	0.824;0.893;0.924;0.959	B;B;P;P	0.47981	0.308;0.308;0.563;0.505	T	0.00896	-1.1523	10	0.39692	T	0.17	-11.1199	14.3668	0.66810	1.0:0.0:0.0:0.0	.	224;196;196;241	A1L3Y1;Q8NB59;Q8NB59-6;F5H426	.;SYT14_HUMAN;.;.	Y	241;196;196;158;196;196;158	ENSP00000389039:N241Y;ENSP00000442891:N196Y;ENSP00000445837:N196Y;ENSP00000437423:N158Y;ENSP00000355986:N196Y;ENSP00000418901:N196Y;ENSP00000355982:N158Y	ENSP00000355982:N158Y	N	+	1	0	SYT14	208334433	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.584000	0.60971	2.140000	0.66376	0.482000	0.46254	AAC		0.423	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089124.1	NM_153262		15	67	0	0	0	0.00499	0	15	67				
KCNH1	3756	broad.mit.edu	37	1	211192440	211192440	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:211192440G>A	ENST00000271751.4	-	6	744	c.717C>T	c.(715-717)gtC>gtT	p.V239V	KCNH1_ENST00000367007.4_Silent_p.V239V			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	239					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TTTTGAAGGAGACATTATAAG	0.418																																							uc001hib.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(715-717)GTC>GTT		potassium voltage-gated channel, subfamily H,							101.0	95.0	97.0					1																	211192440		2203	4300	6503	SO:0001819	synonymous_variant	3756				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity	g.chr1:211192440G>A	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.717C>T	1.37:g.211192440G>A						KCNH1_uc001hic.2_Silent_p.V239V	p.V239V	NM_172362	NP_758872	O95259	KCNH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)	6	887	-			239			Helical; Name=Segment S1; (Potential).		B1AQ26|O76035|Q14CL3	Silent	SNP	ENST00000271751.4	37	c.717C>T	CCDS1496.1																																																																																				0.418	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238		11	63	0	0	0	0.010729	0	11	63				
SLC30A10	55532	broad.mit.edu	37	1	220101607	220101607	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:220101607T>C	ENST00000366926.3	-	1	337	c.176A>G	c.(175-177)tAc>tGc	p.Y59C	SLC30A10_ENST00000536446.1_Intron|SLC30A10_ENST00000536992.1_Missense_Mutation_p.Y59C	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	59					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		CCGGGCGATGTAGCCGGCGCT	0.701																																					Colon(76;360 1614 43677 51136)	Colon(76;360 1614 43677 51136)	uc001hlw.2		NA																	0					0						c.(175-177)TAC>TGC		solute carrier family 30 (zinc transporter),							18.0	23.0	21.0					1																	220101607		2184	4281	6465	SO:0001583	missense	55532				zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity	g.chr1:220101607T>C	AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.176A>G	1.37:g.220101607T>C	ENSP00000355893:p.Tyr59Cys					SLC30A10_uc001hlu.1_Intron|SLC30A10_uc001hlx.2_5'UTR	p.Y59C	NM_018713	NP_061183	Q6XR72	ZNT10_HUMAN		GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)	1	387	-			59			Helical; (Potential).		Q49AL9|Q9NPW0	Missense_Mutation	SNP	ENST00000366926.3	37	c.176A>G	CCDS31026.1	.	.	.	.	.	.	.	.	.	.	T	17.97	3.519167	0.64634	.	.	ENSG00000196660	ENST00000366926;ENST00000536992	T;T	0.64260	-0.09;-0.09	3.83	-0.5	0.12012	.	1.223500	0.05675	N	0.589397	T	0.66877	0.2834	L	0.57536	1.79	0.32461	N	0.544132	D	0.65815	0.995	P	0.60236	0.871	T	0.62676	-0.6804	9	.	.	.	-6.9534	0.633	0.00798	0.3127:0.1229:0.1596:0.4048	.	59	Q6XR72	ZNT10_HUMAN	C	59	ENSP00000355893:Y59C;ENSP00000440627:Y59C	.	Y	-	2	0	SLC30A10	218168230	0.006000	0.16342	0.916000	0.36221	0.985000	0.73830	-0.079000	0.11357	0.114000	0.18032	0.402000	0.26972	TAC		0.701	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357709.1	NM_018713		3	6	0	0	0	0.004672	0	3	6				
OBSCN	84033	broad.mit.edu	37	1	228560439	228560439	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:228560439C>T	ENST00000422127.1	+	94	22004	c.21960C>T	c.(21958-21960)ttC>ttT	p.F7320F	OBSCN_ENST00000570156.2_Silent_p.F8277F|OBSCN_ENST00000366707.4_Silent_p.F4954F	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	7320					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ACCTCCCATTCGAGTTTATGA	0.602																																							uc009xez.1		NA																	0				stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(21958-21960)TTC>TTT		obscurin, cytoskeletal calmodulin and							33.0	34.0	34.0					1																	228560439		2019	4174	6193	SO:0001819	synonymous_variant	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228560439C>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.21960C>T	1.37:g.228560439C>T						OBSCN_uc001hsr.1_Silent_p.F1949F	p.F7320F	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN			94	22004	+		Prostate(94;0.0405)	7320					Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	c.21960C>T	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	14.20	2.465740	0.43839	.	.	ENSG00000154358	ENST00000441106	.	.	.	5.31	-7.48	0.01360	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6987	0.77521	0.0:0.1939:0.0:0.8061	.	.	.	.	X	1937	.	.	R	+	1	2	OBSCN	226627062	0.148000	0.22702	0.097000	0.21041	0.823000	0.46562	-0.789000	0.04609	-1.629000	0.01546	-0.333000	0.08304	CGA		0.602	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		3	24	0	0	0	0.009096	0	3	24				
URB2	9816	broad.mit.edu	37	1	229773396	229773396	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:229773396C>G	ENST00000258243.2	+	4	3172	c.3036C>G	c.(3034-3036)ctC>ctG	p.L1012L		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	1012						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						TGCAGATGCTCATCCAAATGA	0.448																																							uc001hts.1		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(3034-3036)CTC>CTG		URB2 ribosome biogenesis 2 homolog							77.0	76.0	76.0					1																	229773396		2203	4300	6503	SO:0001819	synonymous_variant	9816					nucleolus		g.chr1:229773396C>G	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.3036C>G	1.37:g.229773396C>G						URB2_uc009xfd.1_Silent_p.L1012L	p.L1012L	NM_014777	NP_055592	Q14146	URB2_HUMAN			4	3172	+			1012					Q5VYC9	Silent	SNP	ENST00000258243.2	37	c.3036C>G	CCDS31052.1																																																																																				0.448	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777		11	60	0	0	0	0.010729	0	11	60				
MTR	4548	broad.mit.edu	37	1	237057700	237057700	+	Nonsense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:237057700C>G	ENST00000366577.5	+	30	3642	c.3248C>G	c.(3247-3249)tCa>tGa	p.S1083*	MTR_ENST00000470570.1_3'UTR|MTR_ENST00000535889.1_Nonsense_Mutation_p.S1032*	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	1083	AdoMet activation. {ECO:0000255|PROSITE- ProRule:PRU00346}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	TACTGCCTCTCAGACTTCATC	0.572																																							uc001hyi.3		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(3247-3249)TCA>TGA		5-methyltetrahydrofolate-homocysteine	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)						137.0	113.0	121.0					1																	237057700		2203	4300	6503	SO:0001587	stop_gained	4548				nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding	g.chr1:237057700C>G	U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.3248C>G	1.37:g.237057700C>G	ENSP00000355536:p.Ser1083*					MTR_uc010pxw.1_Nonsense_Mutation_p.S676*|MTR_uc010pxx.1_Nonsense_Mutation_p.S1032*|MTR_uc010pxy.1_Nonsense_Mutation_p.S937*	p.S1083*	NM_000254	NP_000245	Q99707	METH_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	30	3671	+	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	1083			AdoMet activation.		A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Nonsense_Mutation	SNP	ENST00000366577.5	37	c.3248C>G	CCDS1614.1	.	.	.	.	.	.	.	.	.	.	C	36	5.806358	0.96967	.	.	ENSG00000116984	ENST00000417743;ENST00000366577;ENST00000535889;ENST00000366576	.	.	.	5.47	5.47	0.80525	.	0.273464	0.36303	N	0.002661	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-1.5279	19.6907	0.95999	0.0:1.0:0.0:0.0	.	.	.	.	X	937;1083;1032;637	.	ENSP00000355535:S637X	S	+	2	0	MTR	235124323	1.000000	0.71417	0.054000	0.19295	0.031000	0.12232	6.989000	0.76219	2.732000	0.93576	0.655000	0.94253	TCA		0.572	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	NM_000254		8	77	0	0	0	0.006214	0	8	77				
RYR2	6262	broad.mit.edu	37	1	237660045	237660045	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:237660045C>G	ENST00000366574.2	+	20	2513	c.2196C>G	c.(2194-2196)ctC>ctG	p.L732L	RYR2_ENST00000360064.6_Silent_p.L730L|RYR2_ENST00000542537.1_Silent_p.L716L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	732	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCCTTCATCTCTGGTCAGGTA	0.473																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(2194-2196)CTC>CTG		cardiac muscle ryanodine receptor							151.0	156.0	155.0					1																	237660045		1964	4160	6124	SO:0001819	synonymous_variant	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237660045C>G	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2196C>G	1.37:g.237660045C>G							p.L732L	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		20	2316	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	732			Cytoplasmic (By similarity).|B30.2/SPRY 1.		Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	c.2196C>G	CCDS55691.1																																																																																				0.473	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		25	155	0	0	0	0.005443	0	25	155				
RYR2	6262	broad.mit.edu	37	1	237711840	237711840	+	Missense_Mutation	SNP	G	G	T	rs376931962		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:237711840G>T	ENST00000366574.2	+	26	3333	c.3016G>T	c.(3016-3018)Gtg>Ttg	p.V1006L	RYR2_ENST00000360064.6_Missense_Mutation_p.V1004L|RYR2_ENST00000542537.1_Missense_Mutation_p.V990L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1006	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGCACATAATGTGTGGGCGCG	0.488																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(3016-3018)GTG>TTG		cardiac muscle ryanodine receptor							66.0	63.0	64.0					1																	237711840		1934	4143	6077	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237711840G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3016G>T	1.37:g.237711840G>T	ENSP00000355533:p.Val1006Leu						p.V1006L	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		26	3136	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	1006			Cytoplasmic (By similarity).|2.|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.3016G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.263386	0.80358	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.91464	-2.85;-2.85;-2.85	5.73	5.73	0.89815	Ryanodine receptor Ryr (1);	0.000000	0.56097	D	0.000028	D	0.88239	0.6383	L	0.45352	1.415	0.80722	D	1	B	0.21381	0.055	B	0.17433	0.018	T	0.82661	-0.0347	10	0.36615	T	0.2	.	20.2699	0.98469	0.0:0.0:1.0:0.0	.	1006	Q92736	RYR2_HUMAN	L	1006;1004;990	ENSP00000355533:V1006L;ENSP00000353174:V1004L;ENSP00000443798:V990L	ENSP00000353174:V1004L	V	+	1	0	RYR2	235778463	1.000000	0.71417	0.979000	0.43373	0.657000	0.38888	9.643000	0.98464	2.854000	0.98071	0.655000	0.94253	GTG		0.488	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		12	30	1	0	5.50884e-06	0.013537	5.92644e-06	12	30				
RYR2	6262	broad.mit.edu	37	1	237801676	237801676	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:237801676G>T	ENST00000366574.2	+	45	7129	c.6812G>T	c.(6811-6813)gGt>gTt	p.G2271V	RYR2_ENST00000360064.6_Missense_Mutation_p.G2269V|RYR2_ENST00000542537.1_Missense_Mutation_p.G2255V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2271	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TATTTGGCTGGTTGTGGACTG	0.403																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(6811-6813)GGT>GTT		cardiac muscle ryanodine receptor							253.0	244.0	247.0					1																	237801676		1920	4136	6056	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237801676G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.6812G>T	1.37:g.237801676G>T	ENSP00000355533:p.Gly2271Val						p.G2271V	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		45	6932	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	2271			Cytoplasmic (By similarity).|4 X approximate repeats.		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.6812G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.291027	0.80914	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.95307	-3.67;-3.67;-3.67	5.31	5.31	0.75309	Intracellular calcium-release channel (1);	0.000000	0.64402	D	0.000004	D	0.95516	0.8543	L	0.36672	1.1	0.80722	D	1	D	0.69078	0.997	D	0.67900	0.954	D	0.95257	0.8365	10	0.46703	T	0.11	-13.9872	19.348	0.94373	0.0:0.0:1.0:0.0	.	2271	Q92736	RYR2_HUMAN	V	2271;2269;2255	ENSP00000355533:G2271V;ENSP00000353174:G2269V;ENSP00000443798:G2255V	ENSP00000353174:G2269V	G	+	2	0	RYR2	235868299	1.000000	0.71417	0.999000	0.59377	0.790000	0.44656	9.813000	0.99286	2.627000	0.88993	0.561000	0.74099	GGT		0.403	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		36	101	1	0	4.3181e-19	0.013726	5.18017e-19	36	101				
OR2G3	81469	broad.mit.edu	37	1	247768923	247768923	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:247768923C>T	ENST00000320002.2	+	1	68	c.36C>T	c.(34-36)ttC>ttT	p.F12F	RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA|RNU6-691P_ENST00000516585.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	12						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TAATGGATTTCATCCTTCTAG	0.468																																							uc010pyz.1		NA																	0				central_nervous_system(1)	1						c.(34-36)TTC>TTT		olfactory receptor, family 2, subfamily G,							160.0	164.0	162.0					1																	247768923		2203	4300	6503	SO:0001819	synonymous_variant	81469				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247768923C>T	BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.36C>T	1.37:g.247768923C>T							p.F12F	NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	36	+	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		12			Extracellular (Potential).		B2RN64|Q5JQT1|Q6IF45	Silent	SNP	ENST00000320002.2	37	c.36C>T	CCDS31093.1																																																																																				0.468	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097624.1			12	76	0	0	0	0.001855	0	12	76				
OR14A16	284532	broad.mit.edu	37	1	247979009	247979009	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:247979009G>T	ENST00000357627.1	-	1	22	c.23C>A	c.(22-24)aCt>aAt	p.T8N		NM_001001966.1	NP_001001966.1	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A, member 16	8						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(32)|skin(2)|stomach(1)	45						GATAAATTCAGTCACGATTGT	0.338																																					Ovarian(112;180 1586 15073 21914 33526)	Ovarian(112;180 1586 15073 21914 33526)	uc001idm.1		NA																	0					0						c.(22-24)ACT>AAT		olfactory receptor, family 14, subfamily A,							45.0	47.0	46.0					1																	247979009		2200	4299	6499	SO:0001583	missense	284532				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247979009G>T	BK004366	CCDS31097.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000196772	ENSG00000196772		"""GPCR / Class A : Olfactory receptors"""	15022	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AT, member 1"""	OR5AT1			Standard	NM_001001966		Approved		uc001idm.1	Q8NHC5	OTTHUMG00000040199	ENST00000357627.1:c.23C>A	1.37:g.247979009G>T	ENSP00000350248:p.Thr8Asn						p.T8N	NM_001001966	NP_001001966	Q8NHC5	O14AG_HUMAN			1	23	-			8			Extracellular (Potential).		Q6IF96	Missense_Mutation	SNP	ENST00000357627.1	37	c.23C>A	CCDS31097.1	.	.	.	.	.	.	.	.	.	.	G	14.30	2.493754	0.44352	.	.	ENSG00000196772	ENST00000357627	T	0.02177	4.41	3.61	-3.25	0.05079	.	0.560341	0.14532	U	0.313804	T	0.06781	0.0173	M	0.76170	2.325	0.09310	N	1	P	0.50443	0.935	P	0.57548	0.823	T	0.02075	-1.1218	10	0.66056	D	0.02	.	8.1073	0.30894	0.241:0.5307:0.2283:0.0	.	8	Q8NHC5	O14AG_HUMAN	N	8	ENSP00000350248:T8N	ENSP00000350248:T8N	T	-	2	0	OR14A16	246045632	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-0.462000	0.06704	-0.758000	0.04690	0.596000	0.82720	ACT		0.338	OR14A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096856.1	NM_001001966		4	42	1	0	0.00024832	0.009096	0.000260834	4	42				
OR2T12	127064	broad.mit.edu	37	1	248458293	248458293	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:248458293G>A	ENST00000317996.1	-	1	587	c.588C>T	c.(586-588)gcC>gcT	p.A196A		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			AGATGTACATGGCGTTTTCGA	0.537																																							uc010pzj.1		NA																	0				skin(2)|ovary(1)	3						c.(586-588)GCC>GCT		olfactory receptor, family 2, subfamily T,							72.0	56.0	61.0					1																	248458293		2201	4295	6496	SO:0001819	synonymous_variant	127064				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248458293G>A	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.588C>T	1.37:g.248458293G>A							p.A196A	NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0201)		1	588	-	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		196			Helical; Name=5; (Potential).			Silent	SNP	ENST00000317996.1	37	c.588C>T	CCDS31110.1																																																																																				0.537	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692		14	95	0	0	0	0.001855	0	14	95				
FBXO18	84893	broad.mit.edu	37	10	5948241	5948241	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:5948241G>T	ENST00000362091.4	+	3	514	c.399G>T	c.(397-399)caG>caT	p.Q133H	FBXO18_ENST00000470089.1_3'UTR|FBXO18_ENST00000397269.3_5'UTR|FBXO18_ENST00000379999.5_Missense_Mutation_p.Q184H	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	133					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						AGAGTAACCAGGCTACCGGGA	0.622																																							uc001iis.2		NA																	0				ovary(2)|skin(1)	3						c.(397-399)CAG>CAT		F-box only protein, helicase, 18 isoform 2							30.0	35.0	34.0					10																	5948241		2203	4300	6503	SO:0001583	missense	84893				DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding	g.chr10:5948241G>T	AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.399G>T	10.37:g.5948241G>T	ENSP00000355415:p.Gln133His					FBXO18_uc001iir.2_Missense_Mutation_p.Q59H|FBXO18_uc009xig.2_Missense_Mutation_p.Q59H|FBXO18_uc001iit.2_Missense_Mutation_p.Q184H	p.Q133H	NM_178150	NP_835363	Q8NFZ0	FBX18_HUMAN			3	494	+			133					Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	ENST00000362091.4	37	c.399G>T	CCDS7072.1	.	.	.	.	.	.	.	.	.	.	G	5.980	0.364727	0.11296	.	.	ENSG00000134452	ENST00000362091;ENST00000379999	.	.	.	5.39	-3.73	0.04398	.	0.625479	0.16005	N	0.234137	T	0.25975	0.0633	L	0.34521	1.04	0.09310	N	0.999991	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.001	T	0.12734	-1.0536	9	0.54805	T	0.06	-0.8678	7.8673	0.29545	0.3247:0.1348:0.5406:0.0	.	184;133;59	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	H	133;184	.	ENSP00000355415:Q133H	Q	+	3	2	FBXO18	5988247	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.757000	0.04772	-0.741000	0.04797	-0.119000	0.15052	CAG		0.622	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807		9	26	1	0	2.74318e-10	0.006214	3.10119e-10	9	26				
KIN	22944	broad.mit.edu	37	10	7822262	7822262	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:7822262C>T	ENST00000379562.4	-	3	265	c.218G>A	c.(217-219)cGa>cAa	p.R73Q	KIN_ENST00000535925.1_Missense_Mutation_p.R73Q|KIN_ENST00000543003.1_5'UTR	NM_012311.3	NP_036443.1			Kin17 DNA and RNA binding protein											endometrium(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|skin(2)	19						AAAGTCATTTCGGAATTCCCT	0.299																																							uc001ijt.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(217-219)CGA>CAA		HsKin17 protein							73.0	75.0	74.0					10																	7822262		2203	4300	6503	SO:0001583	missense	22944				DNA recombination|DNA repair|DNA replication|interspecies interaction between organisms|mRNA processing	cytoplasm|nuclear matrix	double-stranded DNA binding|RNA binding|zinc ion binding	g.chr10:7822262C>T	AJ005273	CCDS7080.1	10p15-p14	2014-07-15	2014-07-15		ENSG00000151657	ENSG00000151657			6327	protein-coding gene	gene with protein product		601720	"""antigenic determinant of recA protein (mouse) homolog"", ""KIN, antigenic determinant of recA protein homolog (mouse)"""			1923796, 24140279	Standard	NM_012311		Approved	KIN17, Rts2	uc001ijt.3	O60870	OTTHUMG00000017634	ENST00000379562.4:c.218G>A	10.37:g.7822262C>T	ENSP00000368881:p.Arg73Gln					KIN_uc010qaz.1_RNA|KIN_uc009xip.2_Missense_Mutation_p.R73Q|KIN_uc010qba.1_5'UTR	p.R73Q	NM_012311	NP_036443	O60870	KIN17_HUMAN			3	266	-			73						Missense_Mutation	SNP	ENST00000379562.4	37	c.218G>A	CCDS7080.1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.730498	0.48939	.	.	ENSG00000151657	ENST00000535925;ENST00000379562	.	.	.	5.78	5.78	0.91487	DNA/RNA-binding protein Kin17, conserved domain (1);	0.063541	0.64402	D	0.000005	T	0.27900	0.0687	N	0.04090	-0.28	0.80722	D	1	B;D	0.52996	0.096;0.957	B;B	0.41374	0.008;0.355	T	0.12760	-1.0535	9	0.18276	T	0.48	-8.7787	18.1929	0.89813	0.0:1.0:0.0:0.0	.	73;73	B4DX32;O60870	.;KIN17_HUMAN	Q	73	.	ENSP00000368881:R73Q	R	-	2	0	KIN	7862268	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.870000	0.48451	2.749000	0.94314	0.655000	0.94253	CGA		0.299	KIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046683.2	NM_012311		6	54	0	0	0	0.001984	0	6	54				
ANKRD30A	91074	broad.mit.edu	37	10	37505151	37505151	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:37505151G>T	ENST00000602533.1	+	32	2843	c.2744G>T	c.(2743-2745)tGt>tTt	p.C915F	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.C915F|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.C1034F			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	971					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GTTCATTCTTGTGAAAGAGCA	0.333																																							uc001iza.1		NA																	0				ovary(7)|breast(1)|skin(1)	9						c.(2743-2745)TGT>TTT		ankyrin repeat domain 30A							63.0	59.0	61.0					10																	37505151		1804	4068	5872	SO:0001583	missense	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37505151G>T	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2744G>T	10.37:g.37505151G>T	ENSP00000473551:p.Cys915Phe						p.C915F	NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN			32	2843	+			971					Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37	c.2744G>T		.	.	.	.	.	.	.	.	.	.	g	0.006	-2.099979	0.00360	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.05319	3.46;3.46	2.63	0.0982	0.14497	.	.	.	.	.	T	0.05731	0.0150	L	0.60455	1.87	0.09310	N	1	B	0.18741	0.03	B	0.11329	0.006	T	0.46857	-0.9161	9	0.15499	T	0.54	.	2.6733	0.05074	0.6244:0.0:0.1505:0.2251	.	971	Q9BXX3	AN30A_HUMAN	F	915;1034	ENSP00000354432:C915F;ENSP00000363792:C1034F	ENSP00000354432:C915F	C	+	2	0	ANKRD30A	37545157	1.000000	0.71417	0.000000	0.03702	0.010000	0.07245	2.329000	0.43876	-0.235000	0.09767	0.313000	0.20887	TGT		0.333	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997		22	36	1	0	5.35356e-11	0.00278	6.10397e-11	22	36				
BMS1	9790	broad.mit.edu	37	10	43326498	43326498	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:43326498G>C	ENST00000374518.5	+	23	3866	c.3803G>C	c.(3802-3804)aGa>aCa	p.R1268T	RNU6-885P_ENST00000516607.1_RNA	NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	1268					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						AAGGAAAGAAGAAACCAGAAG	0.537																																							uc001jaj.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(3802-3804)AGA>ACA		BMS1-like, ribosome assembly protein							35.0	25.0	28.0					10																	43326498		2203	4300	6503	SO:0001583	missense	9790				ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity	g.chr10:43326498G>C	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.3803G>C	10.37:g.43326498G>C	ENSP00000363642:p.Arg1268Thr						p.R1268T	NM_014753	NP_055568	Q14692	BMS1_HUMAN			23	4161	+			1268					Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	c.3803G>C	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	G	13.43	2.235317	0.39498	.	.	ENSG00000165733	ENST00000374518	T	0.08720	3.06	5.16	-0.684	0.11331	.	0.312733	0.34133	N	0.004234	T	0.07548	0.0190	L	0.56124	1.755	0.23030	N	0.998404	B	0.31383	0.321	B	0.29353	0.101	T	0.28427	-1.0044	10	0.32370	T	0.25	.	8.9964	0.36055	0.7593:0.0:0.2407:0.0	.	1268	Q14692	BMS1_HUMAN	T	1268	ENSP00000363642:R1268T	ENSP00000363642:R1268T	R	+	2	0	BMS1	42646504	1.000000	0.71417	0.011000	0.14972	0.981000	0.71138	3.031000	0.49728	-0.028000	0.13850	0.462000	0.41574	AGA		0.537	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753		3	12	0	0	0	0.009096	0	3	12				
Unknown	0	broad.mit.edu	37	10	45611486	45611486	+	IGR	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:45611486C>T								RSU1P2 (8050 upstream) : RP11-445N18.7 (31355 downstream)																							TTCTTCAGTTCTGCTGTGTTT	0.448																																							uc001jbz.2		NA																	0					0						c.e4-1		Homo sapiens cDNA FLJ32851 fis, clone TESTI2003432.																																				SO:0001628	intergenic_variant	100133308							g.chr10:45611486C>T																													10.37:g.45611486C>T						LOC100133308_uc009xmq.1_RNA								4		-									Splice_Site	SNP		37	c.265_splice																																																																																				0	0.448									6	29	0	0	0	0.001168	0	6	29				
CCDC6	8030	broad.mit.edu	37	10	61666021	61666021	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:61666021G>A	ENST00000263102.6	-	1	393	c.162C>T	c.(160-162)ttC>ttT	p.F54F		NM_005436.4	NP_005427.2	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	54						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	structural constituent of cytoskeleton (GO:0005200)		CCDC6/RET(4)	breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|stomach(1)	18				Kidney(211;0.0597)		CCTCCAGGCGGAACGGCGAGA	0.667			T	RET	NSCLC																																		uc001jks.3		NA		Dom	yes		10	10q21	8030		coiled-coil domain containing 6			E					0				ovary(3)|breast(1)	4						c.(160-162)TTC>TTT		coiled-coil domain containing 6							97.0	98.0	98.0					10																	61666021		2203	4300	6503	SO:0001819	synonymous_variant	8030					cytoplasm|cytoskeleton	SH3 domain binding|structural constituent of cytoskeleton	g.chr10:61666021G>A	S72869	CCDS7257.1	10q21.2	2006-11-09	2004-01-20		ENSG00000108091	ENSG00000108091			18782	protein-coding gene	gene with protein product	"""DNA segment, single copy, probe pH4 (transforming sequence, thyroid-1"""	601985	"""DNA segment on chromosome 10 (unique) 170"""	TST1, D10S170		8058316, 6745938	Standard	NM_005436		Approved	PTC, TPC, H4	uc001jks.4	Q16204	OTTHUMG00000018284	ENST00000263102.6:c.162C>T	10.37:g.61666021G>A							p.F54F	NM_005436	NP_005427	Q16204	CCDC6_HUMAN		Kidney(211;0.0597)	1	798	-			54			Potential.		Q15250|Q6GSG7	Silent	SNP	ENST00000263102.6	37	c.162C>T	CCDS7257.1																																																																																				0.667	CCDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048176.2	NM_005436		45	62	0	0	0	0.01441	0	45	62				
EGR2	1959	broad.mit.edu	37	10	64573000	64573000	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:64573000G>A	ENST00000242480.3	-	2	1723	c.1398C>T	c.(1396-1398)ctC>ctT	p.L466L	EGR2_ENST00000439032.1_Silent_p.L466L|EGR2_ENST00000411732.1_Silent_p.L416L|EGR2_ENST00000493899.2_5'Flank	NM_000399.3|NM_001136177.1	NP_000390.2|NP_001129649.1	P11161	EGR2_HUMAN	early growth response 2	466					brain development (GO:0007420)|brain segmentation (GO:0035284)|cell death (GO:0008219)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|facial nerve structural organization (GO:0021612)|fat cell differentiation (GO:0045444)|learning or memory (GO:0007611)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein sumoylation (GO:0016925)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ossification (GO:0030278)|response to insulin (GO:0032868)|rhombomere 3 formation (GO:0021660)|rhombomere 5 formation (GO:0021666)|rhythmic behavior (GO:0007622)|Schwann cell differentiation (GO:0014037)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	36	Prostate(12;0.0297)|all_hematologic(501;0.228)					AGCAAGGGGCGAGCGGCCCTC	0.652																																							uc010qim.1		NA																	0				ovary(2)	2						c.(1396-1398)CTC>CTT		early growth response 2 protein isoform a							78.0	83.0	81.0					10																	64573000		2203	4300	6503	SO:0001819	synonymous_variant	1959				fat cell differentiation|protein export from nucleus|transcription from RNA polymerase II promoter	cytoplasm|nucleus	chromatin binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|ubiquitin protein ligase binding|zinc ion binding	g.chr10:64573000G>A	BC035625	CCDS7267.1, CCDS44409.1	10q21.1	2014-09-17	2009-04-23		ENSG00000122877	ENSG00000122877		"""Zinc fingers, C2H2-type"""	3239	protein-coding gene	gene with protein product	"""Krox-20 homolog, Drosophila"""	129010	"""early growth response 2 (Krox-20 homolog, Drosophila)"""	KROX20			Standard	NM_000399		Approved		uc001jmi.3	P11161	OTTHUMG00000018308	ENST00000242480.3:c.1398C>T	10.37:g.64573000G>A						EGR2_uc010qin.1_Silent_p.L416L|EGR2_uc001jmi.2_Silent_p.L466L|EGR2_uc010qio.1_Silent_p.L479L|EGR2_uc009xph.2_Silent_p.L466L	p.L466L	NM_001136177	NP_001129649	P11161	EGR2_HUMAN			3	1552	-	Prostate(12;0.0297)|all_hematologic(501;0.228)		466					B2R724|B3KRD7|Q68CZ5|Q8IV26|Q9UNA6	Silent	SNP	ENST00000242480.3	37	c.1398C>T	CCDS7267.1																																																																																				0.652	EGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048245.2	NM_000399		17	73	0	0	0	0.00499	0	17	73				
LRRTM3	347731	broad.mit.edu	37	10	68857373	68857373	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:68857373T>A	ENST00000361320.4	+	3	2143	c.1565T>A	c.(1564-1566)tTt>tAt	p.F522Y	CTNNA3_ENST00000433211.2_Intron|CTNNA3_ENST00000373744.4_Intron|LRRTM3_ENST00000485868.1_3'UTR	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	522					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						GTGTCAACCTTTCTGGCATAC	0.398																																							uc001jmz.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(1564-1566)TTT>TAT		leucine rich repeat transmembrane neuronal 3							140.0	128.0	132.0					10																	68857373		2203	4299	6502	SO:0001583	missense	347731					integral to membrane		g.chr10:68857373T>A	BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.1565T>A	10.37:g.68857373T>A	ENSP00000355187:p.Phe522Tyr					CTNNA3_uc009xpn.1_Intron|CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron	p.F522Y	NM_178011	NP_821079	Q86VH5	LRRT3_HUMAN			3	2115	+			522			Cytoplasmic (Potential).		A8K2A3|Q2NKX7|Q6N0A3	Missense_Mutation	SNP	ENST00000361320.4	37	c.1565T>A	CCDS7270.1	.	.	.	.	.	.	.	.	.	.	T	7.035	0.561474	0.13498	.	.	ENSG00000198739	ENST00000361320;ENST00000373722	T	0.75260	-0.92	5.92	5.92	0.95590	.	0.000000	0.50627	D	0.000112	T	0.47284	0.1437	N	0.02539	-0.55	0.35584	D	0.806512	B	0.09022	0.002	B	0.06405	0.002	T	0.53690	-0.8403	10	0.06757	T	0.87	.	13.9014	0.63806	0.0:0.0:0.0:1.0	.	522	Q86VH5	LRRT3_HUMAN	Y	522	ENSP00000355187:F522Y	ENSP00000355187:F522Y	F	+	2	0	LRRTM3	68527379	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.505000	0.66981	2.277000	0.76020	0.528000	0.53228	TTT		0.398	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048277.2	NM_178011		5	68	0	0	0	0.000602	0	5	68				
CHCHD1	118487	broad.mit.edu	37	10	75542100	75542100	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:75542100G>C	ENST00000372833.5	+	2	157	c.144G>C	c.(142-144)gaG>gaC	p.E48D	CHCHD1_ENST00000372837.3_Missense_Mutation_p.E48D	NM_203298.2	NP_976043.1	Q96BP2	CHCH1_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 1	48	CHCH.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)	1	Prostate(51;0.0112)					GCATCACGGAGATGTCGGTGA	0.602																																							uc001jvc.3		NA																	0					0						c.(142-144)GAG>GAC		coiled-coil-helix-coiled-coil-helix domain							65.0	67.0	66.0					10																	75542100		2203	4300	6503	SO:0001583	missense	118487					nucleus		g.chr10:75542100G>C	AK098720	CCDS7334.1	10q22.3	2014-02-12	2004-01-19		ENSG00000172586	ENSG00000172586		"""Coiled-coil-helix-coiled-coil-helix domain containing"""	23518	protein-coding gene	gene with protein product		608842	"""chromosome 10 open reading frame 34"""	C10orf34			Standard	NM_203298		Approved	FLJ25854	uc001jvc.4	Q96BP2	OTTHUMG00000018475	ENST00000372833.5:c.144G>C	10.37:g.75542100G>C	ENSP00000361923:p.Glu48Asp					CHCHD1_uc001jvb.2_Missense_Mutation_p.E48D	p.E48D	NM_203298	NP_976043	Q96BP2	CHCH1_HUMAN			2	170	+	Prostate(51;0.0112)		48			CHCH.			Missense_Mutation	SNP	ENST00000372833.5	37	c.144G>C	CCDS7334.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.428143	0.83667	.	.	ENSG00000172586	ENST00000372837;ENST00000372833	D;D	0.85171	-1.95;-1.95	5.52	4.62	0.57501	CHCH (1);	0.000000	0.85682	D	0.000000	D	0.90800	0.7111	M	0.75615	2.305	0.58432	D	0.999997	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.997	D	0.90981	0.4827	10	0.87932	D	0	-31.5605	9.7778	0.40630	0.1606:0.0:0.8394:0.0	.	48;48	Q96BP2;A6NJX6	CHCH1_HUMAN;.	D	48	ENSP00000361928:E48D;ENSP00000361923:E48D	ENSP00000361923:E48D	E	+	3	2	CHCHD1	75212106	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	2.404000	0.44539	1.325000	0.45301	0.655000	0.94253	GAG		0.602	CHCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048676.1	XM_058325		16	41	0	0	0	0.004007	0	16	41				
HPSE2	60495	broad.mit.edu	37	10	100481571	100481571	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:100481571G>A	ENST00000370552.3	-	5	858	c.799C>T	c.(799-801)Cgg>Tgg	p.R267W	HPSE2_ENST00000370549.1_Missense_Mutation_p.R209W|HPSE2_ENST00000370546.1_Missense_Mutation_p.R267W|HPSE2_ENST00000404542.1_Missense_Mutation_p.R155W	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	267					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)	p.R267W(4)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		TGCATGGTCCGATAGTTATTT	0.473																																							uc001kpn.1		NA																	4	Substitution - Missense(4)		large_intestine(2)|NS(2)	ovary(1)	1						c.(799-801)CGG>TGG		heparanase 2							77.0	68.0	71.0					10																	100481571		2203	4300	6503	SO:0001583	missense	60495				carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity	g.chr10:100481571G>A	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.799C>T	10.37:g.100481571G>A	ENSP00000359583:p.Arg267Trp					HPSE2_uc009xwc.1_Missense_Mutation_p.R257W|HPSE2_uc001kpo.1_Missense_Mutation_p.R199W|HPSE2_uc009xwd.1_Missense_Mutation_p.R145W	p.R267W	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN		Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)	5	859	-			267					Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	ENST00000370552.3	37	c.799C>T	CCDS7477.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.370845	0.82573	.	.	ENSG00000172987	ENST00000370552;ENST00000370549;ENST00000370546;ENST00000404542	T;T;T;T	0.45668	0.89;0.92;1.46;0.9	5.44	5.44	0.79542	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.57799	0.2078	L	0.38531	1.155	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.989;0.997;0.998	T	0.57929	-0.7726	10	0.59425	D	0.04	-9.5594	19.6357	0.95731	0.0:0.0:1.0:0.0	.	155;267;209;267	Q8WWQ2-4;Q8WWQ2-2;Q8WWQ2-3;Q8WWQ2	.;.;.;HPSE2_HUMAN	W	267;209;267;155	ENSP00000359583:R267W;ENSP00000359580:R209W;ENSP00000359577:R267W;ENSP00000384384:R155W	ENSP00000359577:R267W	R	-	1	2	HPSE2	100471561	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.016000	0.76393	2.706000	0.92434	0.551000	0.68910	CGG		0.473	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828		24	67	0	0	0	0.004656	0	24	67				
BTRC	8945	broad.mit.edu	37	10	103292112	103292112	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:103292112G>C	ENST00000370187.3	+	8	1019	c.901G>C	c.(901-903)Gaa>Caa	p.E301Q	BTRC_ENST00000393441.4_Missense_Mutation_p.E260Q|BTRC_ENST00000408038.2_Missense_Mutation_p.E265Q	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	301					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		CTGCCGAAGTGAAACAAGCAA	0.393																																							uc001kta.2		NA																	0				ovary(1)	1						c.(901-903)GAA>CAA		beta-transducin repeat containing protein							147.0	148.0	148.0					10																	103292112		2203	4300	6503	SO:0001583	missense	8945				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex		g.chr10:103292112G>C	Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.901G>C	10.37:g.103292112G>C	ENSP00000359206:p.Glu301Gln					BTRC_uc001ktb.2_Missense_Mutation_p.E265Q|BTRC_uc001ktc.2_Missense_Mutation_p.E275Q	p.E301Q	NM_033637	NP_378663	Q9Y297	FBW1A_HUMAN		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)	8	1014	+		Colorectal(252;0.234)	301			WD 1.		B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	ENST00000370187.3	37	c.901G>C	CCDS7512.1	.	.	.	.	.	.	.	.	.	.	G	17.73	3.460939	0.63513	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000408038	T;T;T	0.36157	1.27;1.27;2.21	5.96	5.96	0.96718	WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.45617	0.1351	N	0.25426	0.745	0.80722	D	1	B;B;P	0.50819	0.212;0.177;0.939	B;B;P	0.58391	0.135;0.056;0.838	T	0.09640	-1.0665	10	0.29301	T	0.29	-16.9727	20.4008	0.98991	0.0:0.0:1.0:0.0	.	275;265;301	B7Z3H4;Q9Y297-2;Q9Y297	.;.;FBW1A_HUMAN	Q	301;260;265	ENSP00000359206:E301Q;ENSP00000377088:E260Q;ENSP00000385339:E265Q	ENSP00000359206:E301Q	E	+	1	0	BTRC	103282102	1.000000	0.71417	1.000000	0.80357	0.441000	0.31987	9.869000	0.99810	2.826000	0.97356	0.655000	0.94253	GAA		0.393	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637		15	98	0	0	0	0.003163	0	15	98				
CFAP43	80217	broad.mit.edu	37	10	105947204	105947204	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:105947204G>C	ENST00000278064.2	-	14	1852	c.1527C>G	c.(1525-1527)atC>atG	p.I509M	WDR96_ENST00000428666.1_Missense_Mutation_p.I579M|WDR96_ENST00000357060.3_Missense_Mutation_p.I578M																NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ACTTATGAATGATTTCATCTT	0.373																																							uc001kxw.2		NA																	0					0						c.(1732-1734)ATC>ATG		hypothetical protein LOC80217							110.0	103.0	105.0					10																	105947204		2203	4300	6503	SO:0001583	missense	80217							g.chr10:105947204G>C																												ENST00000278064.2:c.1527C>G	10.37:g.105947204G>C	ENSP00000278064:p.Ile509Met					C10orf79_uc009xxq.2_5'Flank|C10orf79_uc001kxx.3_Missense_Mutation_p.I579M	p.I578M	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)	14	1850	-		Colorectal(252;0.178)	578						Missense_Mutation	SNP	ENST00000278064.2	37	c.1734C>G		.	.	.	.	.	.	.	.	.	.	G	2.235	-0.375251	0.05034	.	.	ENSG00000197748	ENST00000357060;ENST00000428666;ENST00000278064	T;T;T	0.15017	2.46;2.46;2.48	5.92	-2.39	0.06602	WD40 repeat-like-containing domain (1);	1.491560	0.04103	N	0.313227	T	0.08313	0.0207	N	0.08118	0	0.09310	N	1	B;B	0.15930	0.015;0.001	B;B	0.13407	0.009;0.009	T	0.30736	-0.9968	10	0.31617	T	0.26	.	4.9615	0.14068	0.0645:0.3066:0.2121:0.4169	.	579;578	B4DHB6;Q8NDM7	.;WDR96_HUMAN	M	578;579;509	ENSP00000349568:I578M;ENSP00000400289:I579M;ENSP00000278064:I509M	ENSP00000278064:I509M	I	-	3	3	WDR96	105937194	0.104000	0.21937	0.001000	0.08648	0.165000	0.22458	-0.320000	0.08028	-0.788000	0.04504	-0.169000	0.13324	ATC		0.373	WDR96-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050200.1			11	48	0	0	0	0.013537	0	11	48				
SMC3	9126	broad.mit.edu	37	10	112341740	112341740	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:112341740C>G	ENST00000361804.4	+	9	733	c.607C>G	c.(607-609)Cta>Gta	p.L203V	SMC3_ENST00000462899.1_3'UTR	NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	203					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		ATTACATACTCTAGAGGAAGA	0.378																																							uc001kze.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(607-609)CTA>GTA		structural maintenance of chromosomes 3							100.0	107.0	104.0					10																	112341740		2203	4300	6503	SO:0001583	missense	9126				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity	g.chr10:112341740C>G	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.607C>G	10.37:g.112341740C>G	ENSP00000354720:p.Leu203Val						p.L203V	NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)	9	733	+		Breast(234;0.0848)|Lung NSC(174;0.238)	203			Potential.		A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	37	c.607C>G	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	c	18.66	3.671423	0.67814	.	.	ENSG00000108055	ENST00000361804	D	0.91996	-2.95	5.51	0.926	0.19430	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.96169	0.8751	M	0.93720	3.45	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.94652	0.7840	10	0.87932	D	0	.	8.7593	0.34665	0.0:0.6808:0.0:0.3192	.	203	Q9UQE7	SMC3_HUMAN	V	203	ENSP00000354720:L203V	ENSP00000354720:L203V	L	+	1	2	SMC3	112331730	0.854000	0.29725	0.998000	0.56505	0.979000	0.70002	1.539000	0.36104	0.167000	0.19631	-0.374000	0.07098	CTA		0.378	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445		22	96	0	0	0	0.014323	0	22	96				
TDRD1	56165	broad.mit.edu	37	10	115970636	115970636	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:115970636C>T	ENST00000369280.1	+	13	2030	c.1570C>T	c.(1570-1572)Cag>Tag	p.Q524*	TDRD1_ENST00000422662.1_Nonsense_Mutation_p.Q185*|TDRD1_ENST00000251864.2_Nonsense_Mutation_p.Q524*|TDRD1_ENST00000369282.1_Nonsense_Mutation_p.Q524*|TDRD1_ENST00000369281.2_Nonsense_Mutation_p.Q524*			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	524					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		TGCTGAACTTCAGGCATCCCT	0.393																																							uc001lbg.1		NA																	0					0						c.(1570-1572)CAG>TAG		tudor domain containing 1							127.0	111.0	116.0					10																	115970636		2203	4300	6503	SO:0001587	stop_gained	56165				DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding	g.chr10:115970636C>T	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.1570C>T	10.37:g.115970636C>T	ENSP00000358286:p.Gln524*					TDRD1_uc001lbf.2_Nonsense_Mutation_p.Q515*|TDRD1_uc001lbh.1_Nonsense_Mutation_p.Q515*|TDRD1_uc001lbi.1_Nonsense_Mutation_p.Q515*|TDRD1_uc010qsc.1_Nonsense_Mutation_p.Q185*|TDRD1_uc001lbj.2_Nonsense_Mutation_p.Q233*	p.Q524*	NM_198795	NP_942090	Q9BXT4	TDRD1_HUMAN		Epithelial(162;0.0343)|all cancers(201;0.0754)	13	1723	+		Colorectal(252;0.172)|Breast(234;0.188)	524					A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Nonsense_Mutation	SNP	ENST00000369280.1	37	c.1570C>T		.	.	.	.	.	.	.	.	.	.	C	38	7.054319	0.98032	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000422662;ENST00000369280	.	.	.	5.9	5.9	0.94986	.	0.000000	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	-10.22	15.5602	0.76237	0.0:0.8634:0.1366:0.0	.	.	.	.	X	524;524;524;185;524	.	ENSP00000251864:Q524X	Q	+	1	0	TDRD1	115960626	1.000000	0.71417	0.988000	0.46212	0.813000	0.45954	2.583000	0.46094	2.786000	0.95864	0.563000	0.77884	CAG		0.393	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2			12	55	0	0	0	0.001855	0	12	55				
ATRNL1	26033	broad.mit.edu	37	10	116889092	116889092	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:116889092C>G	ENST00000355044.3	+	5	750	c.624C>G	c.(622-624)atC>atG	p.I208M	ATRNL1_ENST00000529665.1_3'UTR|ATRNL1_ENST00000527407.1_Missense_Mutation_p.I208M	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	208	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.|EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TTTACAGAATCAATTCTTGTC	0.303																																							uc001lcg.2		NA																	0				ovary(5)|lung(1)|central_nervous_system(1)	7						c.(622-624)ATC>ATG		attractin-like 1 precursor							82.0	80.0	81.0					10																	116889092		2203	4300	6503	SO:0001583	missense	26033					integral to membrane	sugar binding	g.chr10:116889092C>G	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.624C>G	10.37:g.116889092C>G	ENSP00000347152:p.Ile208Met					ATRNL1_uc001lce.2_RNA|ATRNL1_uc001lcf.2_Missense_Mutation_p.I208M|ATRNL1_uc009xyq.2_Missense_Mutation_p.I208M	p.I208M	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)	5	1010	+		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)	208			CUB.|EGF-like 2.|Extracellular (Potential).		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	37	c.624C>G	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.883291	0.51908	.	.	ENSG00000107518	ENST00000526946;ENST00000355044	T;T	0.52295	0.67;0.67	5.47	4.46	0.54185	CUB (3);Epidermal growth factor-like, type 3 (1);	0.087716	0.85682	D	0.000000	T	0.39572	0.1083	L	0.39397	1.21	0.80722	D	1	P;P;P	0.48911	0.702;0.917;0.891	B;P;B	0.49226	0.12;0.603;0.367	T	0.32929	-0.9888	10	0.34782	T	0.22	-15.8731	2.3978	0.04394	0.3092:0.4972:0.0:0.1936	.	141;208;208	E9PL90;Q5VV63;Q5VV63-2	.;ATRN1_HUMAN;.	M	141;208	ENSP00000431423:I141M;ENSP00000347152:I208M	ENSP00000347152:I208M	I	+	3	3	ATRNL1	116879082	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.929000	0.28844	2.580000	0.87095	0.467000	0.42956	ATC		0.303	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349		6	48	0	0	0	0.00308	0	6	48				
PNLIPRP3	119548	broad.mit.edu	37	10	118236285	118236285	+	Silent	SNP	T	T	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:118236285T>C	ENST00000369230.3	+	11	1440	c.1294T>C	c.(1294-1296)Ttg>Ctg	p.L432L		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	432	PLAT.				lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		TCAGAATAAGTTGGGAGCAGA	0.308																																							uc001lcl.3		NA																	0				ovary(1)	1						c.(1294-1296)TTG>CTG		pancreatic lipase-related protein 3 precursor							95.0	99.0	98.0					10																	118236285		2203	4300	6503	SO:0001819	synonymous_variant	119548				lipid catabolic process	extracellular region	triglyceride lipase activity	g.chr10:118236285T>C	BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.1294T>C	10.37:g.118236285T>C							p.L432L	NM_001011709	NP_001011709	Q17RR3	LIPR3_HUMAN		all cancers(201;0.0131)	11	1395	+			432			PLAT.			Silent	SNP	ENST00000369230.3	37	c.1294T>C	CCDS31292.1																																																																																				0.308	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050520.1	XM_058404		27	33	0	0	0	0.005443	0	27	33				
INPP5F	22876	broad.mit.edu	37	10	121541266	121541266	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:121541266C>G	ENST00000361976.2	+	3	464	c.298C>G	c.(298-300)Cag>Gag	p.Q100E	INPP5F_ENST00000369081.1_Missense_Mutation_p.Q4E|INPP5F_ENST00000369083.3_Missense_Mutation_p.Q100E	NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	0	PH.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		AATGGAACCTCAGGATCTTGA	0.398																																							uc001leo.2		NA																	0				ovary(2)	2						c.(298-300)CAG>GAG		inositol polyphosphate-5-phosphatase F							73.0	72.0	72.0					10																	121541266		2203	4300	6503	SO:0001583	missense	22876						phosphoric ester hydrolase activity	g.chr10:121541266C>G	AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.298C>G	10.37:g.121541266C>G	ENSP00000354519:p.Gln100Glu					INPP5F_uc001len.3_Missense_Mutation_p.Q100E	p.Q100E	NM_014937	NP_055752	Q9Y2H2	SAC2_HUMAN		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)	3	464	+		Lung NSC(174;0.109)|all_lung(145;0.142)	100					A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000361976.2	37	c.298C>G	CCDS7616.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.100387	0.76983	.	.	ENSG00000198825	ENST00000361976;ENST00000369083;ENST00000369081	T;T	0.56103	0.48;0.48	5.98	5.98	0.97165	Synaptojanin, N-terminal (1);	0.057542	0.64402	D	0.000001	T	0.64746	0.2626	L	0.58428	1.81	0.80722	D	1	D;D	0.58620	0.983;0.979	P;P	0.57620	0.824;0.73	T	0.54860	-0.8230	10	0.13470	T	0.59	-3.9745	20.4434	0.99119	0.0:1.0:0.0:0.0	.	100;100	Q9Y2H2;Q9Y2H2-3	SAC2_HUMAN;.	E	100;100;4	ENSP00000354519:Q100E;ENSP00000358079:Q100E	ENSP00000354519:Q100E	Q	+	1	0	INPP5F	121531256	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.232000	0.78116	2.838000	0.97847	0.655000	0.94253	CAG		0.398	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050679.1	NM_014937		14	40	0	0	0	0.00245	0	14	40				
DMBT1	1755	broad.mit.edu	37	10	124348479	124348479	+	Silent	SNP	C	C	G	rs200439469	byFrequency	TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:124348479C>G	ENST00000338354.3	+	17	1909	c.1803C>G	c.(1801-1803)gcC>gcG	p.A601A	DMBT1_ENST00000368955.3_Silent_p.A591A|DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000344338.3_Silent_p.A591A|DMBT1_ENST00000330163.4_Intron|DMBT1_ENST00000368956.2_Intron|DMBT1_ENST00000368909.3_Silent_p.A601A			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	601					defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CCAGTTTGGCCCTGAGGCTGG	0.542																																					Ovarian(182;93 2026 18125 22222 38972)	Ovarian(182;93 2026 18125 22222 38972)	uc001lgk.1		NA																	0				central_nervous_system(7)	7						c.(1801-1803)GCC>GCG		deleted in malignant brain tumors 1 isoform b							364.0	264.0	297.0					10																	124348479		1970	4105	6075	SO:0001819	synonymous_variant	1755				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding	g.chr10:124348479C>G		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.1803C>G	10.37:g.124348479C>G						DMBT1_uc001lgl.1_Silent_p.A591A|DMBT1_uc001lgm.1_Intron|DMBT1_uc009xzz.1_Silent_p.A601A|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yaa.1_Intron	p.A601A	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN			17	1909	+		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)	601					A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Silent	SNP	ENST00000338354.3	37	c.1803C>G																																																																																					0.542	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406		62	227	0	0	0	0.01441	0	62	227				
SYCE1	93426	broad.mit.edu	37	10	135369180	135369180	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:135369180C>T	ENST00000343131.5	-	11	855	c.751G>A	c.(751-753)Gag>Aag	p.E251K	SYCE1_ENST00000368517.3_Missense_Mutation_p.E215K|SPRN_ENST00000541506.1_Intron|SYCE1_ENST00000432597.2_Missense_Mutation_p.E215K	NM_001143764.1	NP_001137236.1	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1	251					synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|stomach(3)|urinary_tract(1)	19		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		AGGAGCTCCTCAGCCTTCCTG	0.652																																							uc001lno.2		NA																	0				ovary(1)	1						c.(751-753)GAG>AAG		synaptonemal complex central element protein 1							31.0	33.0	33.0					10																	135369180		2203	4300	6503	SO:0001583	missense	93426				cell division	central element		g.chr10:135369180C>T	AY027808	CCDS7687.1, CCDS44500.1, CCDS44501.1	10q26.3	2009-03-12	2005-09-27	2005-09-27	ENSG00000171772	ENSG00000171772			28852	protein-coding gene	gene with protein product	"""cancer/testis antigen 76"""	611486	"""chromosome 10 open reading frame 94"""	C10orf94		11829491	Standard	NM_130784		Approved	bA108K14.6, CT76	uc001lno.2	Q8N0S2	OTTHUMG00000019321	ENST00000343131.5:c.751G>A	10.37:g.135369180C>T	ENSP00000341282:p.Glu251Lys					CYP2E1_uc001lnl.1_3'UTR|SYCE1_uc001lnm.2_Missense_Mutation_p.E123K|SYCE1_uc009ybn.2_Missense_Mutation_p.E251K|SYCE1_uc001lnn.2_Missense_Mutation_p.E215K	p.E251K	NM_001143764	NP_001137236	Q8N0S2	SYCE1_HUMAN		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	11	856	-		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)	251			Potential.		B2RC80|Q9BWU3|Q9BWU4	Missense_Mutation	SNP	ENST00000343131.5	37	c.751G>A	CCDS44501.1	.	.	.	.	.	.	.	.	.	.	C	12.36	1.913213	0.33815	.	.	ENSG00000171772	ENST00000303903;ENST00000432597;ENST00000368517;ENST00000343131	T;T;T;T	0.51817	1.49;0.69;0.69;3.11	4.28	2.42	0.29668	.	0.382346	0.24710	N	0.036237	T	0.36552	0.0971	L	0.50333	1.59	0.25349	N	0.988881	B;B;B	0.32829	0.206;0.386;0.253	B;B;B	0.31101	0.059;0.124;0.054	T	0.18147	-1.0346	10	0.12103	T	0.63	0.9187	11.7742	0.51977	0.0:0.7497:0.2503:0.0	.	123;251;215	Q8N0S2-3;Q8N0S2;Q8N0S2-2	.;SYCE1_HUMAN;.	K	251;215;215;251	ENSP00000303978:E251K;ENSP00000411779:E215K;ENSP00000357503:E215K;ENSP00000341282:E251K	ENSP00000303978:E251K	E	-	1	0	SYCE1	135219170	0.841000	0.29509	0.972000	0.41901	0.660000	0.38997	0.495000	0.22483	0.744000	0.32741	0.655000	0.94253	GAG		0.652	SYCE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_201564		8	48	0	0	0	0.00308	0	8	48				
MUC6	4588	broad.mit.edu	37	11	1025347	1025347	+	Silent	SNP	C	C	T	rs371296189		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:1025347C>T	ENST00000421673.2	-	23	2870	c.2820G>A	c.(2818-2820)gcG>gcA	p.A940A		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	940	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGTTTCTGTCCGCCAGCACCA	0.682																																							uc001lsw.2		NA																	0				ovary(1)	1						c.(2818-2820)GCG>GCA		mucin 6, gastric		C		2,4074		0,2,2036	44.0	52.0	49.0		2820	-3.9	0.1	11		49	0,8384		0,0,4192	no	coding-synonymous	MUC6	NM_005961.2		0,2,6228	TT,TC,CC		0.0,0.0491,0.0161		940/2440	1025347	2,12458	2038	4192	6230	SO:0001819	synonymous_variant	4588				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent	g.chr11:1025347C>T	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.2820G>A	11.37:g.1025347C>T							p.A940A	NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	23	2871	-		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	940			VWFD 3.		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	c.2820G>A	CCDS44513.1																																																																																				0.682	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540		12	43	0	0	0	0.010729	0	12	43				
HBD	3045	broad.mit.edu	37	11	5254244	5254244	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:5254244G>C	ENST00000380299.3	-	3	608	c.394C>G	c.(394-396)Cag>Gag	p.Q132E	HBD_ENST00000292901.3_Intron	NM_000519.3	NP_000510.1	P02042	HBD_HUMAN	hemoglobin, delta	132					blood coagulation (GO:0007596)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	16		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCACCTTCTGATAGGCAGCC	0.522																																							uc001maf.1		NA																	0				ovary(1)	1						c.(394-396)CAG>GAG		delta globin							153.0	132.0	139.0					11																	5254244		2201	4298	6499	SO:0001583	missense	3045				blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity	g.chr11:5254244G>C	AY034468	CCDS31376.1	11p15.5	2012-10-02			ENSG00000223609	ENSG00000223609			4829	protein-coding gene	gene with protein product		142000				2649166	Standard	NM_000519		Approved		uc001maf.1	P02042	OTTHUMG00000066674	ENST00000380299.3:c.394C>G	11.37:g.5254244G>C	ENSP00000369654:p.Gln132Glu						p.Q132E	NM_000519	NP_000510	P02042	HBD_HUMAN		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)	3	589	-		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)	132					Q3Y5H3|Q8WXT7	Missense_Mutation	SNP	ENST00000380299.3	37	c.394C>G	CCDS31376.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	13.21|13.21	2.169962|2.169962	0.38315|0.38315	.|.	.|.	ENSG00000223609|ENSG00000223609	ENST00000417377|ENST00000380299	D|D	0.88509|0.93426	-2.39|-3.22	4.8|4.8	3.87|3.87	0.44632|0.44632	.|Globin-like (1);Globin, structural domain (1);	.|.	.|.	.|.	.|.	D|D	0.91676|0.91676	0.7369|0.7369	M|M	0.64997|0.64997	1.995|1.995	0.45777|0.45777	D|D	0.998668|0.998668	.|B	.|0.22211	.|0.066	.|B	.|0.28465	.|0.09	D|D	0.89950|0.89950	0.4079|0.4079	7|9	0.87932|0.66056	D|D	0|0.02	.|.	11.4166|11.4166	0.49956|0.49956	0.0:0.1811:0.8189:0.0|0.0:0.1811:0.8189:0.0	.|.	.|132	.|P02042	.|HBD_HUMAN	M|E	57|132	ENSP00000414741:I57M|ENSP00000369654:Q132E	ENSP00000414741:I57M|ENSP00000369654:Q132E	I|Q	-|-	3|1	3|0	HBD|HBD	5210820|5210820	1.000000|1.000000	0.71417|0.71417	0.737000|0.737000	0.30932|0.30932	0.737000|0.737000	0.42083|0.42083	3.944000|3.944000	0.56629|0.56629	1.346000|1.346000	0.45694|0.45694	0.650000|0.650000	0.86243|0.86243	ATC|CAG		0.522	HBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142970.1	NM_000519		16	79	0	0	0	0.003163	0	16	79				
OR52N5	390075	broad.mit.edu	37	11	5799669	5799669	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:5799669G>A	ENST00000317093.2	-	1	228	c.196C>T	c.(196-198)Ccg>Tcg	p.P66S	TRIM5_ENST00000380027.1_Intron	NM_001001922.2	NP_001001922.2	Q8NH56	O52N5_HUMAN	olfactory receptor, family 52, subfamily N, member 5	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|liver(1)|lung(17)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		AAATACATCGGATGATGTAAG	0.453																																							uc010qzn.1		NA																	0				skin(2)	2						c.(196-198)CCG>TCG		olfactory receptor, family 52, subfamily N,							133.0	124.0	127.0					11																	5799669		2125	4086	6211	SO:0001583	missense	390075				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5799669G>A	AB065535	CCDS31397.1	11p15.4	2012-08-09			ENSG00000181009	ENSG00000181009		"""GPCR / Class A : Olfactory receptors"""	15231	protein-coding gene	gene with protein product							Standard	NM_001001922		Approved	OR52N5Q	uc010qzn.2	Q8NH56	OTTHUMG00000168799	ENST00000317093.2:c.196C>T	11.37:g.5799669G>A	ENSP00000322866:p.Pro66Ser					TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	p.P66S	NM_001001922	NP_001001922	Q8NH56	O52N5_HUMAN		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)	1	196	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	66			Helical; Name=2; (Potential).		B9EH12|Q6IFG2	Missense_Mutation	SNP	ENST00000317093.2	37	c.196C>T	CCDS31397.1	.	.	.	.	.	.	.	.	.	.	G	11.88	1.769312	0.31320	.	.	ENSG00000181009	ENST00000317093	T	0.25414	1.8	3.44	2.51	0.30379	GPCR, rhodopsin-like superfamily (1);	0.000000	0.30940	U	0.008561	T	0.59742	0.2216	H	0.96048	3.76	0.38024	D	0.934937	D	0.89917	1.0	D	0.97110	1.0	T	0.70185	-0.4941	10	0.66056	D	0.02	.	9.6007	0.39603	0.1083:0.0:0.8917:0.0	.	66	Q8NH56	O52N5_HUMAN	S	66	ENSP00000322866:P66S	ENSP00000322866:P66S	P	-	1	0	OR52N5	5756245	1.000000	0.71417	0.172000	0.22920	0.068000	0.16541	3.723000	0.54955	0.777000	0.33496	0.174000	0.16983	CCG		0.453	OR52N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401141.1	NM_001001922		13	83	0	0	0	0.001855	0	13	83				
TRIM3	10612	broad.mit.edu	37	11	6472225	6472225	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:6472225G>C	ENST00000525074.1	-	9	2161	c.1767C>G	c.(1765-1767)atC>atG	p.I589M	TRIM3_ENST00000536344.1_Missense_Mutation_p.I470M|TRIM3_ENST00000359518.3_Missense_Mutation_p.I589M|TRIM3_ENST00000537602.1_Missense_Mutation_p.I511M|TRIM3_ENST00000345851.3_Missense_Mutation_p.I589M	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	589					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CGACCACAATGATATGTCCAT	0.552																																					Melanoma(6;5 510 1540 25169 29084)	Melanoma(6;5 510 1540 25169 29084)	uc001mdh.2		NA																	0				central_nervous_system(2)|large_intestine(1)|ovary(1)|skin(1)	5						c.(1765-1767)ATC>ATG		tripartite motif-containing 3							73.0	68.0	70.0					11																	6472225		2201	4296	6497	SO:0001583	missense	10612				nervous system development|protein transport	early endosome	protein C-terminus binding|zinc ion binding	g.chr11:6472225G>C	AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.1767C>G	11.37:g.6472225G>C	ENSP00000433102:p.Ile589Met					TRIM3_uc001mdi.2_Missense_Mutation_p.I589M|TRIM3_uc010raj.1_Missense_Mutation_p.I470M|TRIM3_uc009yfd.2_Missense_Mutation_p.I589M|TRIM3_uc010rak.1_Missense_Mutation_p.I589M	p.I589M	NM_006458	NP_006449	O75382	TRIM3_HUMAN		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)	10	2154	-		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)	589			NHL 3.		B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Missense_Mutation	SNP	ENST00000525074.1	37	c.1767C>G	CCDS7764.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787985	0.70337	.	.	ENSG00000110171	ENST00000530899;ENST00000525074;ENST00000545029;ENST00000345851;ENST00000336043;ENST00000537602;ENST00000359518;ENST00000536344	T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04	5.25	4.33	0.51752	Six-bladed beta-propeller, TolB-like (1);	0.050671	0.85682	D	0.000000	D	0.88262	0.6389	M	0.86502	2.82	0.58432	D	0.999995	D;D	0.57571	0.975;0.98	D;D	0.66847	0.912;0.947	D	0.89361	0.3668	10	0.49607	T	0.09	-20.9606	14.0396	0.64667	0.0:0.0:0.8477:0.1523	.	470;589	F5H2Q8;O75382	.;TRIM3_HUMAN	M	589;589;589;589;578;511;589;470	ENSP00000433102:I589M;ENSP00000340797:I589M;ENSP00000441091:I511M;ENSP00000352508:I589M;ENSP00000445460:I470M	ENSP00000337094:I578M	I	-	3	3	TRIM3	6428801	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.190000	0.50973	1.422000	0.47177	-0.311000	0.09066	ATC		0.552	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384224.2	NM_006458		4	54	0	0	0	0.000602	0	4	54				
PPFIBP2	8495	broad.mit.edu	37	11	7674426	7674426	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:7674426G>C	ENST00000299492.4	+	24	2996	c.2608G>C	c.(2608-2610)Gac>Cac	p.D870H	PPFIBP2_ENST00000528883.1_Missense_Mutation_p.D758H|PPFIBP2_ENST00000530181.1_Missense_Mutation_p.D727H|PPFIBP2_ENST00000533792.1_Missense_Mutation_p.D712H|PPFIBP2_ENST00000530582.1_3'UTR	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	870					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GGATGGGCTGGACCAGGTGGG	0.572																																							uc001mfj.3		NA																	0				ovary(2)|breast(2)	4						c.(2608-2610)GAC>CAC		PTPRF interacting protein, binding protein 2							105.0	77.0	86.0					11																	7674426		2201	4296	6497	SO:0001583	missense	8495				cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding	g.chr11:7674426G>C	AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.2608G>C	11.37:g.7674426G>C	ENSP00000299492:p.Asp870His					PPFIBP2_uc001mfk.1_Intron|PPFIBP2_uc010rbc.1_Missense_Mutation_p.D804H|PPFIBP2_uc010rbe.1_Missense_Mutation_p.D758H|PPFIBP2_uc001mfl.3_Missense_Mutation_p.D727H|PPFIBP2_uc009yfj.1_Missense_Mutation_p.D514H	p.D870H	NM_003621	NP_003612	Q8ND30	LIPB2_HUMAN		Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)	24	2996	+			870					B7Z433|E9PK77|O75337|Q8WW26	Missense_Mutation	SNP	ENST00000299492.4	37	c.2608G>C	CCDS31419.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	23.6|23.6|23.6	4.439338|4.439338|4.439338	0.83885|0.83885|0.83885	.|.|.	.|.|.	ENSG00000166387|ENSG00000166387|ENSG00000166387	ENST00000541115|ENST00000299492;ENST00000537211;ENST00000533792;ENST00000528883;ENST00000530181|ENST00000534552	.|T;T;T;T|.	.|0.35605|.	.|1.73;1.31;1.72;1.3|.	6.03|6.03|6.03	6.03|6.03|6.03	0.97812|0.97812|0.97812	.|.|.	.|0.077098|.	.|0.56097|.	.|D|.	.|0.000038|.	.|T|T	.|0.72285|0.72285	.|0.3441|0.3441	L|L|L	0.56769|0.56769|0.56769	1.78|1.78|1.78	0.49582|0.49582|0.49582	D|D|D	0.999804|0.999804|0.999804	.|P;P;P;P;P|.	.|0.51351|.	.|0.943;0.93;0.93;0.93;0.944|.	.|P;P;P;P;P|.	.|0.50231|.	.|0.547;0.635;0.635;0.635;0.564|.	.|T|T	.|0.67910|0.67910	.|-0.5548|-0.5548	.|10|5	.|0.51188|.	.|T|.	.|0.08|.	.|-25.2582|-25.2582	18.0507|18.0507|18.0507	0.89347|0.89347|0.89347	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|758;758;712;727;870|.	.|E9PK77;B7Z433;E9PP16;E9PMU1;Q8ND30|.	.|.;.;.;.;LIPB2_HUMAN|.	.|H|A	-1|870;211;712;758;727|101	.|ENSP00000299492:D870H;ENSP00000436498:D712H;ENSP00000435469:D758H;ENSP00000437321:D727H|.	.|ENSP00000299492:D870H|.	.|D|G	+|+|+	.|1|2	.|0|0	PPFIBP2|PPFIBP2|PPFIBP2	7631002|7631002|7631002	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	7.051000|7.051000|7.051000	0.76627|0.76627|0.76627	2.861000|2.861000|2.861000	0.98227|0.98227|0.98227	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	.|GAC|GGA		0.572	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385345.2	NM_003621		9	53	0	0	0	0.006214	0	9	53				
C11orf16	56673	broad.mit.edu	37	11	8943023	8943023	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:8943023T>C	ENST00000326053.5	-	6	1350	c.1244A>G	c.(1243-1245)cAc>cGc	p.H415R	C11orf16_ENST00000525780.1_Intron	NM_020643.2	NP_065694.2	Q9NQ32	CK016_HUMAN	chromosome 11 open reading frame 16	415										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	22				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		CTGCTGTTTGTGATCCTTTTC	0.468																																							uc001mhb.3		NA																	0				upper_aerodigestive_tract(1)|pancreas(1)	2						c.(1243-1245)CAC>CGC		hypothetical protein LOC56673							160.0	145.0	150.0					11																	8943023		2201	4296	6497	SO:0001583	missense	56673							g.chr11:8943023T>C	AJ400877	CCDS7794.1	11p15.3	2008-06-25			ENSG00000176029	ENSG00000176029			1169	protein-coding gene	gene with protein product						11528127	Standard	NM_020643		Approved		uc001mhb.4	Q9NQ32	OTTHUMG00000165654	ENST00000326053.5:c.1244A>G	11.37:g.8943023T>C	ENSP00000318999:p.His415Arg					C11orf16_uc001mhc.3_Intron	p.H415R	NM_020643	NP_065694	Q9NQ32	CK016_HUMAN		Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)	6	1368	-			415					Q53FB2|Q8N6Y9	Missense_Mutation	SNP	ENST00000326053.5	37	c.1244A>G	CCDS7794.1	.	.	.	.	.	.	.	.	.	.	T	7.426	0.637780	0.14386	.	.	ENSG00000176029	ENST00000326053	T	0.30714	1.52	3.93	-1.37	0.09056	.	1.649760	0.03398	N	0.202924	T	0.13329	0.0323	N	0.08118	0	0.09310	N	1	B	0.25169	0.119	B	0.21546	0.035	T	0.13072	-1.0523	10	0.09843	T	0.71	-5.914	4.0967	0.09995	0.0:0.2038:0.3559:0.4403	.	415	Q9NQ32	CK016_HUMAN	R	415	ENSP00000318999:H415R	ENSP00000318999:H415R	H	-	2	0	C11orf16	8899599	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.341000	0.07811	-0.245000	0.09625	0.528000	0.53228	CAC		0.468	C11orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385626.1	NM_020643		49	75	0	0	0	0.01441	0	49	75				
SBF2	81846	broad.mit.edu	37	11	9810801	9810801	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:9810801C>G	ENST00000256190.8	-	35	4924	c.4787G>C	c.(4786-4788)tGg>tCg	p.W1596S	SBF2-AS1_ENST00000534671.1_RNA|SBF2-AS1_ENST00000526617.1_RNA|SBF2-AS1_ENST00000525636.1_RNA|SBF2-AS1_ENST00000499953.2_RNA|SBF2-AS1_ENST00000498905.2_RNA	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	1596					cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		TAGCATCATCCAGTCATAGGA	0.517																																							uc001mib.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(4786-4788)TGG>TCG		SET binding factor 2							111.0	115.0	114.0					11																	9810801		2201	4294	6495	SO:0001583	missense	81846				myelination	cytoplasm|membrane	phosphatase activity|protein binding	g.chr11:9810801C>G	AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.4787G>C	11.37:g.9810801C>G	ENSP00000256190:p.Trp1596Ser					uc001mhz.1_Intron|SBF2_uc001mid.2_Missense_Mutation_p.W240S|SBF2_uc001mic.2_5'Flank|uc001mie.3_Intron	p.W1596S	NM_030962	NP_112224	Q86WG5	MTMRD_HUMAN		all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)	35	4925	-			1596					Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	ENST00000256190.8	37	c.4787G>C	CCDS31427.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.849323	0.91277	.	.	ENSG00000133812	ENST00000256190	D	0.85258	-1.96	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.92237	0.7538	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.88896	0.3349	10	0.21540	T	0.41	.	20.2618	0.98447	0.0:1.0:0.0:0.0	.	1596	Q86WG5	MTMRD_HUMAN	S	1596	ENSP00000256190:W1596S	ENSP00000256190:W1596S	W	-	2	0	SBF2	9767377	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.793000	0.96121	0.655000	0.94253	TGG		0.517	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962		11	90	0	0	0	0.013537	0	11	90				
MICAL2	9645	broad.mit.edu	37	11	12247773	12247773	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:12247773G>C	ENST00000256194.4	+	14	2032	c.1744G>C	c.(1744-1746)Gat>Cat	p.D582H	MICAL2_ENST00000342902.5_Missense_Mutation_p.D582H|MICAL2_ENST00000527546.1_Missense_Mutation_p.D582H|MICAL2_ENST00000537344.1_Missense_Mutation_p.D582H|MICAL2_ENST00000379612.3_Missense_Mutation_p.D582H	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	582	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		GCTCGCATTTGATGTGGCCGA	0.507																																							uc001mjz.2		NA																	0				upper_aerodigestive_tract(2)	2						c.(1744-1746)GAT>CAT		microtubule associated monoxygenase, calponin							136.0	132.0	133.0					11																	12247773		2201	4294	6495	SO:0001583	missense	9645					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding	g.chr11:12247773G>C	AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.1744G>C	11.37:g.12247773G>C	ENSP00000256194:p.Asp582His					MICAL2_uc010rch.1_Missense_Mutation_p.D582H|MICAL2_uc001mka.2_Missense_Mutation_p.D582H|MICAL2_uc010rci.1_Missense_Mutation_p.D582H|MICAL2_uc001mkb.2_Missense_Mutation_p.D582H|MICAL2_uc001mkc.2_Missense_Mutation_p.D582H|MICAL2_uc001mkd.2_Missense_Mutation_p.D411H|MICAL2_uc010rcj.1_5'UTR	p.D582H	NM_014632	NP_055447	O94851	MICA2_HUMAN		Epithelial(150;0.00552)	14	2032	+			582			CH.		B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	ENST00000256194.4	37	c.1744G>C	CCDS7809.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.566960	0.86439	.	.	ENSG00000133816	ENST00000537344;ENST00000544073;ENST00000256194;ENST00000527546;ENST00000342902;ENST00000379612	T;T;T;T;T	0.61859	0.07;0.07;0.07;0.07;0.07	5.28	5.28	0.74379	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	T	0.79094	0.4388	M	0.82823	2.61	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.998;1.0;0.997	T	0.82376	-0.0488	10	0.87932	D	0	.	18.526	0.90973	0.0:0.0:1.0:0.0	.	582;582;582;582;582	G3XAC8;B7Z849;Q5KTR3;Q5KTR4;O94851	.;.;.;.;MICA2_HUMAN	H	582;115;582;582;582;582	ENSP00000441689:D582H;ENSP00000256194:D582H;ENSP00000433965:D582H;ENSP00000344894:D582H;ENSP00000368932:D582H	ENSP00000256194:D582H	D	+	1	0	MICAL2	12204349	1.000000	0.71417	0.998000	0.56505	0.837000	0.47467	9.869000	0.99810	2.466000	0.83321	0.563000	0.77884	GAT		0.507	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1	NM_014632		10	68	0	0	0	0.008291	0	10	68				
TMEM86A	144110	broad.mit.edu	37	11	18723357	18723357	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:18723357C>T	ENST00000280734.2	+	3	620	c.524C>T	c.(523-525)aCa>aTa	p.T175I		NM_153347.1	NP_699178.1	Q8N2M4	TM86A_HUMAN	transmembrane protein 86A	175						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|skin(2)	11						TGGCGCTGGACAGAGCTGGCA	0.602																																							uc001moz.1		NA																	0				ovary(1)	1						c.(523-525)ACA>ATA		transmembrane protein 86A							79.0	70.0	73.0					11																	18723357		2199	4293	6492	SO:0001583	missense	144110					integral to membrane		g.chr11:18723357C>T	BC035692	CCDS7844.1	11p15.1	2005-10-28				ENSG00000151117			26890	protein-coding gene	gene with protein product							Standard	NM_153347		Approved	FLJ90119	uc001moz.1	Q8N2M4		ENST00000280734.2:c.524C>T	11.37:g.18723357C>T	ENSP00000280734:p.Thr175Ile						p.T175I	NM_153347	NP_699178	Q8N2M4	TM86A_HUMAN			3	607	+			175			Helical; (Potential).		Q96AJ0	Missense_Mutation	SNP	ENST00000280734.2	37	c.524C>T	CCDS7844.1	.	.	.	.	.	.	.	.	.	.	C	19.95	3.921952	0.73213	.	.	ENSG00000151117	ENST00000535380;ENST00000280734	T	0.21543	2.0	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.51092	0.1654	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.48937	-0.8990	9	.	.	.	-12.9101	19.428	0.94751	0.0:1.0:0.0:0.0	.	175	Q8N2M4	TM86A_HUMAN	I	175	ENSP00000280734:T175I	.	T	+	2	0	TMEM86A	18679933	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.474000	0.81024	2.824000	0.97209	0.655000	0.94253	ACA		0.602	TMEM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387812.1	NM_153347		13	24	0	0	0	0.001855	0	13	24				
NELL1	4745	broad.mit.edu	37	11	21594939	21594939	+	Missense_Mutation	SNP	C	C	A	rs562222454		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:21594939C>A	ENST00000357134.5	+	19	2518	c.2366C>A	c.(2365-2367)aCa>aAa	p.T789K	NELL1_ENST00000532434.1_Missense_Mutation_p.T742K|NELL1_ENST00000529218.1_3'UTR|NELL1_ENST00000325319.5_Missense_Mutation_p.T732K|NELL1_ENST00000298925.5_Missense_Mutation_p.T817K	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	789					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						TCTCCCTGCACAACCTGTAAA	0.468																																							uc001mqe.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(2365-2367)ACA>AAA		nel-like 1 isoform 1 precursor							149.0	132.0	138.0					11																	21594939		2203	4300	6503	SO:0001583	missense	4745				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity	g.chr11:21594939C>A	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.2366C>A	11.37:g.21594939C>A	ENSP00000349654:p.Thr789Lys					NELL1_uc001mqf.2_Missense_Mutation_p.T742K|NELL1_uc009yid.2_Missense_Mutation_p.T817K|NELL1_uc010rdo.1_Missense_Mutation_p.T732K|NELL1_uc010rdp.1_Missense_Mutation_p.T502K|NELL1_uc001mqh.2_Missense_Mutation_p.T334K	p.T789K	NM_006157	NP_006148	Q92832	NELL1_HUMAN			19	2519	+			789			VWFC 5.		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	c.2366C>A	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	c	20.9	4.071900	0.76301	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.80566	-1.39;-1.33;-1.28;-1.28	5.71	4.8	0.61643	.	0.000000	0.85682	D	0.000000	D	0.88676	0.6501	M	0.74881	2.28	0.44966	D	0.997989	P;P;D;D;P	0.89917	0.675;0.546;0.961;1.0;0.546	B;B;P;D;B	0.81914	0.329;0.261;0.617;0.995;0.177	D	0.88730	0.3236	10	0.45353	T	0.12	-10.9439	14.8824	0.70542	0.0:0.931:0.0:0.069	.	732;817;334;742;789	F5H6I3;B3KXR2;Q8N9Z6;Q92832-2;Q92832	.;.;.;.;NELL1_HUMAN	K	817;789;732;742	ENSP00000298925:T817K;ENSP00000349654:T789K;ENSP00000317837:T732K;ENSP00000437170:T742K	ENSP00000298925:T817K	T	+	2	0	NELL1	21551515	1.000000	0.71417	0.998000	0.56505	0.793000	0.44817	7.485000	0.81204	1.423000	0.47198	0.550000	0.68814	ACA		0.468	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		29	71	1	0	3.73148e-12	0.007291	4.29861e-12	29	71				
MUC15	143662	broad.mit.edu	37	11	26582638	26582638	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:26582638T>A	ENST00000455601.2	-	4	1097	c.979A>T	c.(979-981)Ata>Tta	p.I327L	ANO3_ENST00000525139.1_Intron|MUC15_ENST00000527569.1_Missense_Mutation_p.I304L|ANO3_ENST00000256737.3_Intron|MUC15_ENST00000529533.1_Missense_Mutation_p.I354L|ANO3_ENST00000529242.1_Intron|MUC15_ENST00000436318.2_Missense_Mutation_p.I354L|ANO3_ENST00000531568.1_Intron|MUC15_ENST00000281268.8_Missense_Mutation_p.I304L|ANO3_ENST00000537978.1_Intron	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated	327					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						AGTGGAGGTATGTCATCCATA	0.388																																							uc001mqx.2		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(979-981)ATA>TTA		mucin 15 isoform b							197.0	178.0	185.0					11																	26582638		2203	4300	6503	SO:0001583	missense	143662					extracellular region|integral to membrane|plasma membrane		g.chr11:26582638T>A	AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.979A>T	11.37:g.26582638T>A	ENSP00000397339:p.Ile327Leu					ANO3_uc010rdr.1_Intron|ANO3_uc001mqt.3_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron|MUC15_uc001mqw.2_Missense_Mutation_p.I354L|MUC15_uc001mqy.2_Missense_Mutation_p.I304L	p.I327L	NM_145650	NP_663625	Q8N387	MUC15_HUMAN			4	1245	-			327			Cytoplasmic (Potential).		B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Missense_Mutation	SNP	ENST00000455601.2	37	c.979A>T	CCDS7859.1	.	.	.	.	.	.	.	.	.	.	T	17.64	3.439120	0.63067	.	.	ENSG00000169550	ENST00000455601;ENST00000436318;ENST00000281268;ENST00000529533;ENST00000527569	T;T;T;T;T	0.27104	1.72;1.69;1.72;1.69;1.72	5.33	4.13	0.48395	.	0.000000	0.50627	D	0.000108	T	0.34890	0.0913	L	0.32530	0.975	0.26286	N	0.978207	D;P;P	0.71674	0.998;0.518;0.518	D;B;P	0.78314	0.991;0.422;0.593	T	0.05194	-1.0900	10	0.66056	D	0.02	-17.8136	7.9274	0.29883	0.1325:0.0:0.1365:0.731	.	304;327;354	F8W945;Q8N387;E9PII6	.;MUC15_HUMAN;.	L	327;354;304;354;304	ENSP00000397339:I327L;ENSP00000416753:I354L;ENSP00000281268:I304L;ENSP00000431983:I354L;ENSP00000431945:I304L	ENSP00000281268:I304L	I	-	1	0	MUC15	26539214	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	1.065000	0.30592	2.142000	0.66516	0.482000	0.46254	ATA		0.388	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387866.1	NM_145650		16	55	0	0	0	0.010504	0	16	55				
BBOX1	8424	broad.mit.edu	37	11	27114762	27114762	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:27114762G>A	ENST00000529202.1	+	4	721	c.382G>A	c.(382-384)Gaa>Aaa	p.E128K	RP11-1L12.3_ENST00000526061.1_RNA|RP11-1L12.3_ENST00000530430.1_RNA|RP11-1L12.3_ENST00000525302.1_RNA|BBOX1_ENST00000525090.1_Missense_Mutation_p.E128K|BBOX1_ENST00000263182.3_Missense_Mutation_p.E128K|BBOX1_ENST00000528583.1_Missense_Mutation_p.E128K|BBOX1_ENST00000527505.1_Intron			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	128					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	TTTGGATTTTGAAGATGTTTT	0.408																																							uc001mre.1		NA																	0				ovary(1)	1						c.(382-384)GAA>AAA		gamma-butyrobetaine dioxygenase	Succinic acid(DB00139)|Vitamin C(DB00126)						73.0	73.0	73.0					11																	27114762		2202	4298	6500	SO:0001583	missense	8424				carnitine biosynthetic process	actin cytoskeleton|cytosol|intracellular membrane-bounded organelle	gamma-butyrobetaine dioxygenase activity|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr11:27114762G>A	AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.382G>A	11.37:g.27114762G>A	ENSP00000435781:p.Glu128Lys					BBOX1_uc009yih.1_Missense_Mutation_p.E128K|BBOX1_uc001mrg.1_Missense_Mutation_p.E128K	p.E128K	NM_003986	NP_003977	O75936	BODG_HUMAN			5	750	+			128					B2R8L7|D3DQZ1|Q6IBJ2	Missense_Mutation	SNP	ENST00000529202.1	37	c.382G>A	CCDS7862.1	.	.	.	.	.	.	.	.	.	.	G	16.16	3.044333	0.55110	.	.	ENSG00000129151	ENST00000529202;ENST00000263182;ENST00000528583;ENST00000525090	D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58	5.5	4.58	0.56647	.	0.258585	0.43747	D	0.000524	T	0.73410	0.3583	L	0.41236	1.265	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.65619	-0.6124	10	0.14656	T	0.56	.	11.3317	0.49479	0.0872:0.0:0.9128:0.0	.	128	O75936	BODG_HUMAN	K	128	ENSP00000435781:E128K;ENSP00000263182:E128K;ENSP00000434918:E128K;ENSP00000433772:E128K	ENSP00000263182:E128K	E	+	1	0	BBOX1	27071338	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.050000	0.64251	2.576000	0.86940	0.650000	0.86243	GAA		0.408	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387946.1	NM_003986		9	40	0	0	0	0.004482	0	9	40				
BBOX1	8424	broad.mit.edu	37	11	27141314	27141315	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:27141314_27141315CC>AT	ENST00000529202.1	+	6	1097_1098	c.758_759CC>AT	c.(757-759)tCC>tAT	p.S253Y	RP11-1L12.3_ENST00000526061.1_RNA|RP11-1L12.3_ENST00000530430.1_RNA|RP11-1L12.3_ENST00000525302.1_RNA|BBOX1_ENST00000525090.1_Missense_Mutation_p.S253Y|BBOX1_ENST00000263182.3_Missense_Mutation_p.S253Y|BBOX1_ENST00000528583.1_Missense_Mutation_p.S253Y|BBOX1_ENST00000527505.1_3'UTR			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	253					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	CAGATTTTGTCCTCTACCTTTG	0.332																																							uc001mre.1		NA																	0				ovary(1)	1						c.(757-759)TCC>TAT		gamma-butyrobetaine dioxygenase	Succinic acid(DB00139)|Vitamin C(DB00126)																																			SO:0001583	missense	8424				carnitine biosynthetic process	actin cytoskeleton|cytosol|intracellular membrane-bounded organelle	gamma-butyrobetaine dioxygenase activity|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr11:27141314_27141315CC>AT	AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	Exception_encountered	11.37:g.27141314_27141315delinsAT	ENSP00000435781:p.Ser253Tyr					BBOX1_uc009yih.1_Missense_Mutation_p.S253Y|BBOX1_uc001mrg.1_Missense_Mutation_p.S253Y	p.S253Y	NM_003986	NP_003977	O75936	BODG_HUMAN			7	1126_1127	+			253					B2R8L7|D3DQZ1|Q6IBJ2	Missense_Mutation	DNP	ENST00000529202.1	37	c.758_759CC>AT	CCDS7862.1																																																																																				0.332	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387946.1	NM_003986		13	42	0	0	0	0.004672	0	13	42				
LGR4	55366	broad.mit.edu	37	11	27393196	27393196	+	Silent	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:27393196A>G	ENST00000379214.4	-	17	1988	c.1545T>C	c.(1543-1545)caT>caC	p.H515H	LGR4_ENST00000389858.4_Silent_p.H491H	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	515					bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						TTATTTGACTATGTTCTTCAT	0.333																																							uc001mrj.3		NA																	0				ovary(1)	1						c.(1543-1545)CAT>CAC		leucine-rich repeat-containing G protein-coupled							177.0	158.0	164.0					11																	27393196		2202	4299	6501	SO:0001819	synonymous_variant	55366					integral to membrane|plasma membrane	protein-hormone receptor activity	g.chr11:27393196A>G	AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.1545T>C	11.37:g.27393196A>G						LGR4_uc001mrk.3_Silent_p.H491H	p.H515H	NM_018490	NP_060960	Q9BXB1	LGR4_HUMAN			17	2030	-			515			Extracellular (Potential).		A6NCH3|G5E9B3|Q8N537|Q9NYD1	Silent	SNP	ENST00000379214.4	37	c.1545T>C	CCDS31449.1																																																																																				0.333	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257467.1	NM_018490		11	72	0	0	0	0.010729	0	11	72				
TRIM44	54765	broad.mit.edu	37	11	35827924	35827924	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:35827924G>A	ENST00000299413.5	+	5	1331	c.1024G>A	c.(1024-1026)Gag>Aag	p.E342K	TRIM44_ENST00000532066.1_3'UTR	NM_017583.4	NP_060053.2	Q96DX7	TRI44_HUMAN	tripartite motif containing 44	342						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_lung(20;0.0317)|Lung NSC(22;0.0661)|all_epithelial(35;0.115)	all_hematologic(20;0.107)				CAGTGAAGAAGAGGACACATG	0.473																																							uc001mwi.2		NA																	0				skin(1)	1						c.(1024-1026)GAG>AAG		DIPB protein							241.0	210.0	220.0					11																	35827924		2202	4298	6500	SO:0001583	missense	54765					intracellular	protein binding|zinc ion binding	g.chr11:35827924G>A	BC024031	CCDS31461.1	11p13	2011-04-20	2011-01-25		ENSG00000166326	ENSG00000166326		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19016	protein-coding gene	gene with protein product		612298	"""tripartite motif-containing 44"""				Standard	NM_017583		Approved	DIPB, MC7	uc001mwi.2	Q96DX7	OTTHUMG00000166312	ENST00000299413.5:c.1024G>A	11.37:g.35827924G>A	ENSP00000299413:p.Glu342Lys						p.E342K	NM_017583	NP_060053	Q96DX7	TRI44_HUMAN			5	1331	+	all_lung(20;0.0317)|Lung NSC(22;0.0661)|all_epithelial(35;0.115)	all_hematologic(20;0.107)	342					D3DR14|Q96QY2|Q9UGK0	Missense_Mutation	SNP	ENST00000299413.5	37	c.1024G>A	CCDS31461.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.821130	0.50633	.	.	ENSG00000166326	ENST00000299413	T	0.33438	1.41	5.45	2.51	0.30379	.	.	.	.	.	T	0.14227	0.0344	N	0.08118	0	0.27534	N	0.951008	B	0.28900	0.227	B	0.22152	0.038	T	0.15607	-1.0431	9	0.87932	D	0	-21.2761	5.5793	0.17241	0.1693:0.0:0.6745:0.1562	.	342	Q96DX7	TRI44_HUMAN	K	342	ENSP00000299413:E342K	ENSP00000299413:E342K	E	+	1	0	TRIM44	35784500	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.933000	0.40153	0.662000	0.31006	0.655000	0.94253	GAG		0.473	TRIM44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389081.1	NM_017583		19	83	0	0	0	0.010504	0	19	83				
RAG2	5897	broad.mit.edu	37	11	36614707	36614707	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:36614707C>A	ENST00000311485.3	-	2	1173	c.1012G>T	c.(1012-1014)Gtt>Ttt	p.V338F	C11orf74_ENST00000446510.2_5'Flank|RAG2_ENST00000528428.1_5'Flank|C11orf74_ENST00000334307.5_5'Flank|C11orf74_ENST00000534635.1_5'Flank|C11orf74_ENST00000347206.4_5'Flank	NM_000536.3|NM_001243785.1|NM_001243786.1	NP_000527.2|NP_001230714.1|NP_001230715.1	P55895	RAG2_HUMAN	recombination activating gene 2	338					B cell differentiation (GO:0030183)|chromatin modification (GO:0016568)|pre-B cell allelic exclusion (GO:0002331)|T cell differentiation in thymus (GO:0033077)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	32	all_lung(20;0.226)	all_hematologic(20;0.00756)				TCTGAAACAACTTGTTTATTG	0.383									Familial Hemophagocytic Lymphohistiocytosis																														uc001mwv.3		NA																	0				skin(3)|ovary(1)|pancreas(1)	5						c.(1012-1014)GTT>TTT		recombination activating gene 2							203.0	199.0	200.0					11																	36614707		2202	4298	6500	SO:0001583	missense	5897	Familial_Hemophagocytic_Lymphohistiocytosis	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	chromatin modification|pre-B cell allelic exclusion|somatic diversification of immunoglobulins|T cell differentiation in thymus|V(D)J recombination	nucleus	chromatin binding|DNA binding|endonuclease activity|methylated histone residue binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-4,5-bisphosphate binding|zinc ion binding	g.chr11:36614707C>A	AF080577	CCDS7903.1	11p13	2014-09-17				ENSG00000175097			9832	protein-coding gene	gene with protein product		179616				1283330	Standard	NM_000536		Approved		uc001mwv.4	P55895		ENST00000311485.3:c.1012G>T	11.37:g.36614707C>A	ENSP00000308620:p.Val338Phe					C11orf74_uc010rfd.1_5'Flank|C11orf74_uc001mww.1_5'Flank|C11orf74_uc001mwx.1_5'Flank|C11orf74_uc001mwy.1_5'Flank|C11orf74_uc001mwz.1_5'Flank|C11orf74_uc010rfe.1_5'Flank	p.V338F	NM_000536	NP_000527	P55895	RAG2_HUMAN			2	1200	-	all_lung(20;0.226)	all_hematologic(20;0.00756)	338					A8K9E9|Q8TBL4	Missense_Mutation	SNP	ENST00000311485.3	37	c.1012G>T	CCDS7903.1	.	.	.	.	.	.	.	.	.	.	C	8.201	0.798181	0.16397	.	.	ENSG00000175097	ENST00000311485	D	0.90133	-2.62	5.4	1.99	0.26369	.	0.827669	0.10957	N	0.615427	T	0.79516	0.4459	N	0.12182	0.205	0.09310	N	1	B	0.29590	0.25	B	0.32677	0.15	T	0.69866	-0.5029	10	0.54805	T	0.06	-0.3304	1.8147	0.03098	0.1162:0.3755:0.2166:0.2917	.	338	P55895	RAG2_HUMAN	F	338	ENSP00000308620:V338F	ENSP00000308620:V338F	V	-	1	0	RAG2	36571283	0.001000	0.12720	0.846000	0.33378	0.666000	0.39218	-0.166000	0.09954	0.625000	0.30304	0.650000	0.86243	GTT		0.383	RAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389536.1	NM_000536		34	149	1	0	1.99505e-19	0.012213	2.40199e-19	34	149				
LRRC4C	57689	broad.mit.edu	37	11	40136944	40136944	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:40136944T>A	ENST00000278198.2	-	2	2862	c.899A>T	c.(898-900)cAc>cTc	p.H300L	LRRC4C_ENST00000530763.1_Missense_Mutation_p.H300L|LRRC4C_ENST00000528697.1_Missense_Mutation_p.H300L|LRRC4C_ENST00000527150.1_Missense_Mutation_p.H300L			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	300					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				CCAAGGGTTGTGATGTAAATG	0.478																																							uc001mxa.1		NA																	0				ovary(4)|skin(3)|central_nervous_system(1)	8						c.(898-900)CAC>CTC		netrin-G1 ligand precursor							176.0	145.0	156.0					11																	40136944		2203	4300	6503	SO:0001583	missense	57689				regulation of axonogenesis	integral to membrane	protein binding	g.chr11:40136944T>A	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.899A>T	11.37:g.40136944T>A	ENSP00000278198:p.His300Leu					LRRC4C_uc001mxc.1_Missense_Mutation_p.H296L|LRRC4C_uc001mxd.1_Missense_Mutation_p.H296L|LRRC4C_uc001mxb.1_Missense_Mutation_p.H296L	p.H300L	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN			2	2863	-		all_lung(304;0.0575)|Lung NSC(402;0.138)	300					A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	37	c.899A>T	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	T	16.02	3.003924	0.54254	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.59364	0.27;0.27;0.27;0.27	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.60932	0.2307	M	0.83384	2.64	0.80722	D	1	D	0.54772	0.968	B	0.42422	0.387	T	0.63967	-0.6517	10	0.17369	T	0.5	.	15.2446	0.73497	0.0:0.0:0.0:1.0	.	300	Q9HCJ2	LRC4C_HUMAN	L	300	ENSP00000278198:H300L;ENSP00000436976:H300L;ENSP00000437132:H300L;ENSP00000434761:H300L	ENSP00000278198:H300L	H	-	2	0	LRRC4C	40093520	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.040000	0.89188	2.202000	0.70862	0.528000	0.53228	CAC		0.478	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		31	53	0	0	0	0.010818	0	31	53				
DGKZ	8525	broad.mit.edu	37	11	46397681	46397681	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:46397681G>C	ENST00000454345.1	+	23	2766	c.2641G>C	c.(2641-2643)Gag>Cag	p.E881Q	DGKZ_ENST00000528615.1_Missense_Mutation_p.E471Q|DGKZ_ENST00000532868.2_Missense_Mutation_p.E697Q|DGKZ_ENST00000343674.6_Missense_Mutation_p.E709Q|DGKZ_ENST00000456247.2_Missense_Mutation_p.E692Q|MIR4688_ENST00000577966.1_RNA|DGKZ_ENST00000421244.2_Missense_Mutation_p.E693Q|DGKZ_ENST00000395574.3_Missense_Mutation_p.E659Q|DGKZ_ENST00000543978.1_Intron|DGKZ_ENST00000318201.8_Missense_Mutation_p.E670Q|DGKZ_ENST00000527911.1_Missense_Mutation_p.E693Q	NM_001105540.1	NP_001099010.1	Q13574	DGKZ_HUMAN	diacylglycerol kinase, zeta	881					blood coagulation (GO:0007596)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of Ras protein signal transduction (GO:0046580)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|enzyme inhibitor activity (GO:0004857)|lipid kinase activity (GO:0001727)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein C-terminus binding (GO:0008022)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|pancreas(1)|prostate(1)|skin(1)	25				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		TGCCCACATTGAGAGACTCCA	0.657																																							uc001ncn.1		NA																	0				pancreas(1)|central_nervous_system(1)|skin(1)	3						c.(2641-2643)GAG>CAG		diacylglycerol kinase zeta isoform 4							53.0	58.0	56.0					11																	46397681		2202	4299	6501	SO:0001583	missense	8525				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding	g.chr11:46397681G>C	U51477	CCDS7918.1, CCDS41640.1, CCDS44579.1, CCDS44580.1, CCDS55757.1, CCDS55758.1, CCDS55759.1, CCDS44579.2	11p11.2	2010-11-24	2010-11-24		ENSG00000149091	ENSG00000149091	2.7.1.107		2857	protein-coding gene	gene with protein product		601441	"""diacylglycerol kinase, zeta 104kDa"""			8626588	Standard	NM_003646		Approved	DAGK5, hDGKzeta, DGK-ZETA, DAGK6	uc001ncn.1	Q13574	OTTHUMG00000166437	ENST00000454345.1:c.2641G>C	11.37:g.46397681G>C	ENSP00000412178:p.Glu881Gln					DGKZ_uc001nch.1_Missense_Mutation_p.E709Q|DGKZ_uc010rgq.1_Missense_Mutation_p.E636Q|DGKZ_uc001ncj.1_Missense_Mutation_p.E659Q|DGKZ_uc010rgr.1_Missense_Mutation_p.E658Q|DGKZ_uc001nck.1_Missense_Mutation_p.E471Q|DGKZ_uc001ncl.2_Missense_Mutation_p.E693Q|DGKZ_uc001ncm.2_Missense_Mutation_p.E692Q|DGKZ_uc009yky.1_Missense_Mutation_p.E693Q|DGKZ_uc010rgs.1_Missense_Mutation_p.E670Q	p.E881Q	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN		GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)	23	2766	+			881					B7Z2M9|B7Z6M3|E9PPW4|F6UCU9|G3V0F6|J3KNJ6|O00542|Q6ZVG7|Q8IVW9	Missense_Mutation	SNP	ENST00000454345.1	37	c.2641G>C	CCDS41640.1	.	.	.	.	.	.	.	.	.	.	G	9.466	1.094351	0.20471	.	.	ENSG00000149091	ENST00000343674;ENST00000528615;ENST00000395574;ENST00000532868;ENST00000527911;ENST00000456247;ENST00000421244;ENST00000318201;ENST00000454345	T;T;T;T;T;T;T;T;T	0.26067	2.33;2.52;2.52;2.58;3.51;2.35;2.41;2.51;1.76	4.87	4.87	0.63330	.	0.108239	0.64402	D	0.000009	T	0.24044	0.0582	L	0.34521	1.04	0.58432	D	0.999998	B;B;B;B;B;B;B;B;B	0.17268	0.005;0.005;0.021;0.012;0.014;0.02;0.02;0.005;0.012	B;B;B;B;B;B;B;B;B	0.24848	0.009;0.009;0.016;0.056;0.017;0.021;0.043;0.019;0.027	T	0.03673	-1.1014	10	0.28530	T	0.3	.	18.3886	0.90474	0.0:0.0:1.0:0.0	.	670;658;636;693;881;692;693;659;709	B7Z2M9;B7Z6M3;B7Z8F6;E9PPW4;Q13574;Q13574-2;G3V0F6;A8MVN1;Q6ZVG7	.;.;.;.;DGKZ_HUMAN;.;.;.;.	Q	709;471;659;658;693;692;693;670;881	ENSP00000343065:E709Q;ENSP00000434719:E471Q;ENSP00000378941:E659Q;ENSP00000436273:E658Q;ENSP00000436291:E693Q;ENSP00000395684:E692Q;ENSP00000391021:E693Q;ENSP00000320340:E670Q;ENSP00000412178:E881Q	ENSP00000320340:E670Q	E	+	1	0	DGKZ	46354257	1.000000	0.71417	0.944000	0.38274	0.136000	0.21042	6.033000	0.70925	2.427000	0.82271	0.462000	0.41574	GAG		0.657	DGKZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389772.1	NM_001105540		11	61	0	0	0	0.010729	0	11	61				
FNBP4	23360	broad.mit.edu	37	11	47746106	47746106	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:47746106C>T	ENST00000263773.5	-	13	2245	c.2233G>A	c.(2233-2235)Gag>Aag	p.E745K	Y_RNA_ENST00000363220.1_RNA|snoU13_ENST00000516638.1_RNA	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	745						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						TCACTTCCCTCATCCTCCATC	0.567																																							uc009ylv.2		NA																	0				ovary(1)	1						c.(2233-2235)GAG>AAG		formin binding protein 4							138.0	139.0	138.0					11																	47746106		1932	4115	6047	SO:0001583	missense	23360							g.chr11:47746106C>T	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.2233G>A	11.37:g.47746106C>T	ENSP00000263773:p.Glu745Lys					FNBP4_uc001ngi.2_Missense_Mutation_p.E59K|FNBP4_uc001ngj.2_Missense_Mutation_p.E652K|FNBP4_uc001ngl.2_RNA	p.E745K	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN			13	2386	-			745					Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	ENST00000263773.5	37	c.2233G>A	CCDS41644.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394738	0.83011	.	.	ENSG00000109920	ENST00000263773	T	0.56941	0.43	5.25	5.25	0.73442	.	0.161489	0.56097	D	0.000039	T	0.60314	0.2259	M	0.63843	1.955	0.48511	D	0.999663	D	0.60575	0.988	P	0.52343	0.696	T	0.63919	-0.6528	10	0.66056	D	0.02	-14.5637	12.5483	0.56212	0.0:0.9234:0.0:0.0766	.	745	Q8N3X1	FNBP4_HUMAN	K	745	ENSP00000263773:E745K	ENSP00000263773:E745K	E	-	1	0	FNBP4	47702682	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.040000	0.57333	2.634000	0.89283	0.561000	0.74099	GAG		0.567	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3			21	103	0	0	0	0.012319	0	21	103				
OR10AG1	282770	broad.mit.edu	37	11	55735853	55735853	+	Silent	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:55735853G>T	ENST00000312345.2	-	1	137	c.87C>A	c.(85-87)atC>atA	p.I29I		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					TGCACATCAGGATCATCAAAT	0.333																																							uc010rit.1		NA																	0				skin(2)	2						c.(85-87)ATC>ATA		olfactory receptor, family 10, subfamily AG,							42.0	48.0	46.0					11																	55735853		2195	4292	6487	SO:0001819	synonymous_variant	282770				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55735853G>T	AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.87C>A	11.37:g.55735853G>T							p.I29I	NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN			1	87	-	Esophageal squamous(21;0.0137)		29			Helical; Name=1; (Potential).		B2RNH4|Q6IEU3	Silent	SNP	ENST00000312345.2	37	c.87C>A	CCDS31514.1																																																																																				0.333	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391531.1	NM_001005491		30	34	1	0	2.12542e-12	0.00632	2.45694e-12	30	34				
OR5J2	282775	broad.mit.edu	37	11	55944604	55944604	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:55944604C>A	ENST00000312298.1	+	1	511	c.511C>A	c.(511-513)Cta>Ata	p.L171I		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	171						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					CTTTTGTAGGCTAAATGCTGT	0.438																																							uc010rjb.1		NA																	0				ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4						c.(511-513)CTA>ATA		olfactory receptor, family 5, subfamily J,							170.0	146.0	154.0					11																	55944604		2201	4296	6497	SO:0001583	missense	282775				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55944604C>A	AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.511C>A	11.37:g.55944604C>A	ENSP00000310788:p.Leu171Ile						p.L171I	NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN			1	511	+	Esophageal squamous(21;0.00693)		171			Extracellular (Potential).		Q6IEU5	Missense_Mutation	SNP	ENST00000312298.1	37	c.511C>A	CCDS31522.1	.	.	.	.	.	.	.	.	.	.	C	12.76	2.033115	0.35893	.	.	ENSG00000174957	ENST00000312298	T	0.36340	1.26	4.73	-2.23	0.06930	GPCR, rhodopsin-like superfamily (1);	0.603575	0.15120	N	0.279458	T	0.19805	0.0476	L	0.31476	0.935	0.09310	N	1	P	0.36577	0.558	B	0.35971	0.215	T	0.13229	-1.0517	10	0.72032	D	0.01	.	3.0353	0.06119	0.1105:0.4308:0.1093:0.3494	.	171	Q8NH18	OR5J2_HUMAN	I	171	ENSP00000310788:L171I	ENSP00000310788:L171I	L	+	1	2	OR5J2	55701180	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-0.737000	0.04877	-0.186000	0.10533	-0.247000	0.11927	CTA		0.438	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391544.1	NM_001005492		17	41	1	0	1.45105e-14	0.006122	1.70396e-14	17	41				
GIF	2694	broad.mit.edu	37	11	59604819	59604819	+	Silent	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:59604819G>C	ENST00000257248.2	-	6	746	c.699C>G	c.(697-699)ctC>ctG	p.L233L	GIF_ENST00000541311.1_Silent_p.L208L	NM_005142.2	NP_005133.2	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	233					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|lysosomal lumen (GO:0043202)|microvillus (GO:0005902)	cobalamin binding (GO:0031419)			large_intestine(4)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	17					Cyanocobalamin(DB00115)	GTGTTACAGAGAGAGCCTGGG	0.413																																					NSCLC(53;1139 1245 16872 38474 42853)	NSCLC(53;1139 1245 16872 38474 42853)	uc001noi.2		NA																	0				ovary(1)|liver(1)	2						c.(697-699)CTC>CTG		gastric intrinsic factor (vitamin B synthesis)							121.0	113.0	116.0					11																	59604819		2201	4295	6496	SO:0001819	synonymous_variant	2694				cobalamin metabolic process|cobalamin transport|cobalt ion transport	apical plasma membrane|endosome|extracellular space|microvillus	cobalamin binding	g.chr11:59604819G>C	X76562	CCDS7977.1	11q12.1	2013-09-20			ENSG00000134812	ENSG00000134812			4268	protein-coding gene	gene with protein product		609342				2071148	Standard	NM_005142		Approved	TCN3, IF, IFMH, INF	uc001noi.3	P27352	OTTHUMG00000167399	ENST00000257248.2:c.699C>G	11.37:g.59604819G>C							p.L233L	NM_005142	NP_005133	P27352	IF_HUMAN			6	747	-			233					B2RAN8|B4DVZ1	Silent	SNP	ENST00000257248.2	37	c.699C>G	CCDS7977.1																																																																																				0.413	GIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394497.1	NM_005142		5	16	0	0	0	0.000602	0	5	16				
MS4A6A	64231	broad.mit.edu	37	11	59940556	59940556	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:59940556A>G	ENST00000530839.1	-	7	1088	c.596T>C	c.(595-597)cTa>cCa	p.L199P	MS4A6A_ENST00000323961.3_Missense_Mutation_p.L199P|MS4A6A_ENST00000420732.2_Silent_p.P164P|MS4A6A_ENST00000426738.2_Missense_Mutation_p.L154P|MS4A6A_ENST00000412309.2_Missense_Mutation_p.L227P|MS4A6A_ENST00000533023.1_Silent_p.P100P|MS4A6A_ENST00000528851.1_Missense_Mutation_p.L199P|MS4A6A_ENST00000529054.1_Missense_Mutation_p.L227P	NM_152852.2	NP_690591.1	Q9H2W1	M4A6A_HUMAN	membrane-spanning 4-domains, subfamily A, member 6A	199						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GAGCACAGCTAGGCAGAATTC	0.488																																							uc001nor.2		NA																	0					0						c.(595-597)CTA>CCA		membrane-spanning 4-domains, subfamily A, member							170.0	154.0	159.0					11																	59940556		2201	4295	6496	SO:0001583	missense	64231					integral to membrane	receptor activity	g.chr11:59940556A>G	AB013104	CCDS7981.1, CCDS44615.1, CCDS44616.1, CCDS58134.1	11q12.1	2008-03-25			ENSG00000110077	ENSG00000110077			13375	protein-coding gene	gene with protein product		606548		MS4A6		11245982, 11401424	Standard	NM_152852		Approved	CD20L3	uc010rla.2	Q9H2W1	OTTHUMG00000167241	ENST00000530839.1:c.596T>C	11.37:g.59940556A>G	ENSP00000436979:p.Leu199Pro					MS4A6A_uc001noq.2_Silent_p.P164P|MS4A6A_uc001nos.3_Missense_Mutation_p.L227P|MS4A6A_uc009ymv.2_Missense_Mutation_p.L199P|MS4A6A_uc001not.2_Missense_Mutation_p.L199P|MS4A6A_uc010rla.1_Missense_Mutation_p.L227P|MS4A6A_uc010rlb.1_Missense_Mutation_p.L154P	p.L199P	NM_152852	NP_690591	Q9H2W1	M4A6A_HUMAN			6	834	-			199			Helical; (Potential).		A8K755|F8W9K1|Q7Z4E8|Q8TBV7|Q8TEZ4|Q8TEZ5|Q96PG6|Q9H2L1|Q9H2N3|Q9H3V1|Q9HC76	Missense_Mutation	SNP	ENST00000530839.1	37	c.596T>C	CCDS7981.1	.	.	.	.	.	.	.	.	.	.	A	15.43	2.832476	0.50845	.	.	ENSG00000110077	ENST00000323961;ENST00000528851;ENST00000530839;ENST00000533989;ENST00000529054;ENST00000426738;ENST00000412309	T;T;T;T;T;T	0.03094	4.05;4.05;4.05;4.05;4.05;4.05	4.51	4.51	0.55191	.	0.694439	0.13042	N	0.418457	T	0.14399	0.0348	.	.	.	0.21915	N	0.999474	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.995;0.992;0.995;0.995	T	0.05683	-1.0870	9	0.59425	D	0.04	.	10.3854	0.44136	1.0:0.0:0.0:0.0	.	154;227;227;199	E7EMT7;F8W9K1;E9PSA9;Q9H2W1	.;.;.;M4A6A_HUMAN	P	199;199;199;99;227;154;227	ENSP00000315878:L199P;ENSP00000431901:L199P;ENSP00000436979:L199P;ENSP00000435844:L227P;ENSP00000392770:L154P;ENSP00000403212:L227P	ENSP00000315878:L199P	L	-	2	0	MS4A6A	59697132	0.006000	0.16342	0.007000	0.13788	0.013000	0.08279	2.252000	0.43196	2.024000	0.59613	0.533000	0.62120	CTA		0.488	MS4A6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393848.1			26	80	0	0	0	0.009535	0	26	80				
AHNAK	79026	broad.mit.edu	37	11	62299280	62299280	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:62299280C>A	ENST00000378024.4	-	5	2883	c.2609G>T	c.(2608-2610)gGc>gTc	p.G870V	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	870					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CCAGTCTGGGCCTTGAACCTC	0.478																																							uc001ntl.2		NA																	0				ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19						c.(2608-2610)GGC>GTC		AHNAK nucleoprotein isoform 1							221.0	231.0	227.0					11																	62299280		2202	4299	6501	SO:0001583	missense	79026				nervous system development	nucleus	protein binding	g.chr11:62299280C>A	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.2609G>T	11.37:g.62299280C>A	ENSP00000367263:p.Gly870Val					AHNAK_uc001ntk.1_Intron	p.G870V	NM_001620	NP_001611	Q09666	AHNK_HUMAN			5	2909	-		Melanoma(852;0.155)	870					A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	c.2609G>T	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	c	14.73	2.623505	0.46840	.	.	ENSG00000124942	ENST00000378024	T	0.05081	3.5	5.46	5.46	0.80206	.	0.160231	0.29417	N	0.012202	T	0.33556	0.0867	H	0.96015	3.755	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.39418	-0.9615	10	0.23302	T	0.38	-11.9765	11.5506	0.50719	0.0:0.9168:0.0:0.0832	.	870	Q09666	AHNK_HUMAN	V	870	ENSP00000367263:G870V	ENSP00000367263:G870V	G	-	2	0	AHNAK	62055856	0.067000	0.21026	0.484000	0.27391	0.522000	0.34438	2.091000	0.41691	2.580000	0.87095	0.455000	0.32223	GGC		0.478	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060		64	174	1	0	2.36135e-34	0.01441	2.97174e-34	64	174				
ROM1	6094	broad.mit.edu	37	11	62381824	62381824	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:62381824C>A	ENST00000278833.3	+	2	1226	c.685C>A	c.(685-687)Cgt>Agt	p.R229S	ROM1_ENST00000534093.1_Silent_p.T19T|EML3_ENST00000394773.2_5'Flank|EML3_ENST00000494176.2_5'Flank|EML3_ENST00000529309.1_5'Flank|EML3_ENST00000278845.4_5'Flank	NM_000327.3	NP_000318	Q03395	ROM1_HUMAN	retinal outer segment membrane protein 1	229			R -> H (in dbSNP:rs150168119). {ECO:0000269|PubMed:7904211}.		camera-type eye photoreceptor cell differentiation (GO:0060219)|cell adhesion (GO:0007155)|regulation of gene expression (GO:0010468)|retina vasculature development in camera-type eye (GO:0061298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	8						CCTGCAAAACCGTCTTTCAGA	0.587																																							uc001ntv.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(685-687)CGT>AGT		retinal outer segment membrane protein 1							125.0	119.0	121.0					11																	62381824		2202	4299	6501	SO:0001583	missense	6094				cell adhesion|visual perception	integral to plasma membrane		g.chr11:62381824C>A	L07894	CCDS8024.1	11q13	2013-02-14				ENSG00000149489		"""Tetraspanins"""	10254	protein-coding gene	gene with protein product		180721				8504299	Standard	NM_000327		Approved	TSPAN23, ROM	uc001ntv.3	Q03395		ENST00000278833.3:c.685C>A	11.37:g.62381824C>A	ENSP00000278833:p.Arg229Ser					EML3_uc001ntr.1_5'Flank|EML3_uc001nts.1_5'Flank|EML3_uc001ntt.1_5'Flank|EML3_uc001ntu.1_5'Flank|EML3_uc010rly.1_5'Flank	p.R229S	NM_000327	NP_000318	Q03395	ROM1_HUMAN			2	1226	+			229		R -> H.	Lumenal (Potential).		B2R978	Missense_Mutation	SNP	ENST00000278833.3	37	c.685C>A	CCDS8024.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.458164	0.43634	.	.	ENSG00000149489	ENST00000278833	T	0.02812	4.15	5.38	4.45	0.53987	Tetraspanin, EC2 domain (1);	0.558556	0.18804	N	0.130720	T	0.02688	0.0081	N	0.14661	0.345	0.29403	N	0.861798	B	0.28760	0.221	B	0.29785	0.107	T	0.29243	-1.0018	10	0.49607	T	0.09	-12.8718	13.738	0.62829	0.0:0.8442:0.1558:0.0	.	229	Q03395	ROM1_HUMAN	S	229	ENSP00000278833:R229S	ENSP00000278833:R229S	R	+	1	0	ROM1	62138400	0.585000	0.26774	0.612000	0.29024	0.601000	0.36947	2.902000	0.48703	1.229000	0.43630	0.462000	0.41574	CGT		0.587	ROM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394929.1	NM_000327		19	69	1	0	7.07596e-05	0.006122	7.49153e-05	19	69				
GANAB	23193	broad.mit.edu	37	11	62397071	62397071	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:62397071G>A	ENST00000356638.3	-	15	1839	c.1823C>T	c.(1822-1824)tCc>tTc	p.S608F	GANAB_ENST00000534779.1_Missense_Mutation_p.S516F|GANAB_ENST00000540933.1_Missense_Mutation_p.S511F|GANAB_ENST00000346178.4_Missense_Mutation_p.S630F	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	608					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	AAAGCGCTGGGAGCCAGCGAA	0.602																																					Melanoma(23;1005 1074 15747 18937)	Melanoma(23;1005 1074 15747 18937)	uc001nub.2		NA																	0				ovary(3)|central_nervous_system(1)|skin(1)	5						c.(1822-1824)TCC>TTC		neutral alpha-glucosidase AB isoform 2							36.0	35.0	35.0					11																	62397071		2202	4299	6501	SO:0001583	missense	23193				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|Golgi apparatus|melanosome	carbohydrate binding|glucan 1,3-alpha-glucosidase activity|protein binding	g.chr11:62397071G>A	AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.1823C>T	11.37:g.62397071G>A	ENSP00000349053:p.Ser608Phe					GANAB_uc001ntz.2_5'Flank|GANAB_uc001nua.2_Missense_Mutation_p.S630F|GANAB_uc001nuc.2_Missense_Mutation_p.S511F|GANAB_uc010rma.1_Missense_Mutation_p.S516F|GANAB_uc010rmb.1_Missense_Mutation_p.S494F	p.S608F	NM_198334	NP_938148	Q14697	GANAB_HUMAN			15	1856	-			608					A6NC20|Q8WTS9|Q9P0X0	Missense_Mutation	SNP	ENST00000356638.3	37	c.1823C>T	CCDS8026.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.106948	0.77096	.	.	ENSG00000089597	ENST00000346178;ENST00000356638;ENST00000534779;ENST00000540933	D;D;D;D	0.92647	-3.08;-3.08;-3.08;-3.08	5.31	5.31	0.75309	Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.97848	0.9293	H	0.98754	4.32	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;0.991	D;D;D;D	0.79108	0.992;0.992;0.971;0.95	D	0.98956	1.0796	10	0.87932	D	0	-27.527	16.5211	0.84317	0.0:0.0:1.0:0.0	.	494;516;608;630	B4DIW2;E9PKU7;Q14697;Q14697-2	.;.;GANAB_HUMAN;.	F	630;608;516;511	ENSP00000340466:S630F;ENSP00000349053:S608F;ENSP00000435306:S516F;ENSP00000442962:S511F	ENSP00000340466:S630F	S	-	2	0	GANAB	62153647	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	9.606000	0.98325	2.779000	0.95612	0.655000	0.94253	TCC		0.602	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395689.1	NM_198334		7	26	0	0	0	0.004482	0	7	26				
TIGD3	220359	broad.mit.edu	37	11	65124466	65124466	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:65124466T>A	ENST00000309880.5	+	2	1394	c.1187T>A	c.(1186-1188)gTg>gAg	p.V396E		NM_145719.2	NP_663771.1	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	396						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(3)|large_intestine(1)|lung(9)|prostate(2)|skin(2)	17						TCCCGCTTTGTGGACCTGGAG	0.622																																							uc001odo.3		NA																	0					0						c.(1186-1188)GTG>GAG		tigger transposable element derived 3							93.0	92.0	92.0					11																	65124466		2201	4297	6498	SO:0001583	missense	220359				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding	g.chr11:65124466T>A		CCDS8101.1	11q13.1	2008-07-21				ENSG00000173825			18334	protein-coding gene	gene with protein product							Standard	NM_145719		Approved		uc001odo.4	Q6B0B8		ENST00000309880.5:c.1187T>A	11.37:g.65124466T>A	ENSP00000308354:p.Val396Glu						p.V396E	NM_145719	NP_663771	Q6B0B8	TIGD3_HUMAN			2	1350	+			396						Missense_Mutation	SNP	ENST00000309880.5	37	c.1187T>A	CCDS8101.1	.	.	.	.	.	.	.	.	.	.	T	2.198	-0.383575	0.04966	.	.	ENSG00000173825	ENST00000309880	T	0.12147	2.71	3.83	3.83	0.44106	.	.	.	.	.	T	0.17874	0.0429	L	0.29908	0.895	0.34302	D	0.684431	D	0.71674	0.998	D	0.73708	0.981	T	0.02901	-1.1096	9	0.02654	T	1	-18.7069	9.5982	0.39587	0.0:0.0:0.0:1.0	.	396	Q6B0B8	TIGD3_HUMAN	E	396	ENSP00000308354:V396E	ENSP00000308354:V396E	V	+	2	0	TIGD3	64881042	0.975000	0.34042	1.000000	0.80357	0.163000	0.22366	2.027000	0.41078	1.706000	0.51276	0.374000	0.22700	GTG		0.622	TIGD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387310.1	NM_145719		18	71	0	0	0	0.007413	0	18	71				
TIGD3	220359	broad.mit.edu	37	11	65124468	65124468	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:65124468G>A	ENST00000309880.5	+	2	1396	c.1189G>A	c.(1189-1191)Gac>Aac	p.D397N		NM_145719.2	NP_663771.1	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	397						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(3)|large_intestine(1)|lung(9)|prostate(2)|skin(2)	17						CCGCTTTGTGGACCTGGAGGG	0.622																																							uc001odo.3		NA																	0					0						c.(1189-1191)GAC>AAC		tigger transposable element derived 3							94.0	93.0	94.0					11																	65124468		2201	4297	6498	SO:0001583	missense	220359				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding	g.chr11:65124468G>A		CCDS8101.1	11q13.1	2008-07-21				ENSG00000173825			18334	protein-coding gene	gene with protein product							Standard	NM_145719		Approved		uc001odo.4	Q6B0B8		ENST00000309880.5:c.1189G>A	11.37:g.65124468G>A	ENSP00000308354:p.Asp397Asn						p.D397N	NM_145719	NP_663771	Q6B0B8	TIGD3_HUMAN			2	1352	+			397						Missense_Mutation	SNP	ENST00000309880.5	37	c.1189G>A	CCDS8101.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.055131	0.55325	.	.	ENSG00000173825	ENST00000309880	T	0.17370	2.28	3.83	3.83	0.44106	.	.	.	.	.	T	0.28532	0.0706	L	0.29908	0.895	0.31125	N	0.708428	D	0.63880	0.993	D	0.72338	0.977	T	0.09314	-1.0680	9	0.72032	D	0.01	-23.1975	11.9974	0.53212	0.0:0.0:1.0:0.0	.	397	Q6B0B8	TIGD3_HUMAN	N	397	ENSP00000308354:D397N	ENSP00000308354:D397N	D	+	1	0	TIGD3	64881044	1.000000	0.71417	1.000000	0.80357	0.168000	0.22595	4.254000	0.58798	2.100000	0.63781	0.456000	0.33151	GAC		0.622	TIGD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387310.1	NM_145719		19	71	0	0	0	0.007413	0	19	71				
SCYL1	57410	broad.mit.edu	37	11	65293487	65293487	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:65293487G>C	ENST00000270176.5	+	3	425	c.348G>C	c.(346-348)gaG>gaC	p.E116D	SCYL1_ENST00000527009.1_5'UTR|SCYL1_ENST00000279270.6_Missense_Mutation_p.E116D|SCYL1_ENST00000420247.2_Missense_Mutation_p.E116D|SCYL1_ENST00000533862.1_Missense_Mutation_p.E116D|SCYL1_ENST00000525364.1_Missense_Mutation_p.E116D|SCYL1_ENST00000524944.1_Missense_Mutation_p.E116D	NM_020680.3	NP_065731.3	Q96KG9	NTKL_HUMAN	SCY1-like 1 (S. cerevisiae)	116	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|protein tyrosine kinase activity (GO:0004713)			ovary(1)|skin(1)	2						AGGAGCTGGAGATCTCCTGGG	0.607																																							uc001oea.1		NA																	0				skin(1)	1						c.(346-348)GAG>GAC		SCY1-like 1 isoform A							58.0	66.0	63.0					11																	65293487		1989	4146	6135	SO:0001583	missense	57410				regulation of transcription, DNA-dependent|retrograde vesicle-mediated transport, Golgi to ER|transcription, DNA-dependent	cis-Golgi network|COPI vesicle coat|ER-Golgi intermediate compartment|microtubule organizing center|nucleus	ATP binding|DNA binding|protein tyrosine kinase activity	g.chr11:65293487G>C	AF225424	CCDS41672.1, CCDS44646.1	11q11-q12	2008-07-21	2002-11-26	2002-11-29	ENSG00000142186	ENSG00000142186			14372	protein-coding gene	gene with protein product	"""teratoma-associated tyrosine kinase"", ""telomerase transcriptional elements-interacting factor"", ""telomerase regulation-associated protein"""	607982	"""N-terminal kinase-like"""	NTKL		11118629	Standard	NM_020680		Approved	HT019, P105, GKLP, NKTL, TAPK, TRAP, TEIF, MGC78454	uc001oea.1	Q96KG9	OTTHUMG00000166325	ENST00000270176.5:c.348G>C	11.37:g.65293487G>C	ENSP00000270176:p.Glu116Asp					SCYL1_uc009yqk.2_Missense_Mutation_p.E116D|SCYL1_uc001oeb.1_Missense_Mutation_p.E116D|SCYL1_uc001oec.1_Missense_Mutation_p.E116D|SCYL1_uc001oed.1_5'UTR	p.E116D	NM_020680	NP_065731	Q96KG9	NTKL_HUMAN			3	425	+			116			Protein kinase.		A6NJF1|Q96G50|Q96KG8|Q96KH1|Q9HAW5|Q9HBL3|Q9NR53	Missense_Mutation	SNP	ENST00000270176.5	37	c.348G>C	CCDS41672.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.330054	0.41297	.	.	ENSG00000142186	ENST00000270176;ENST00000525364;ENST00000420247;ENST00000533862;ENST00000527630;ENST00000349495;ENST00000279270;ENST00000524944;ENST00000417543	T;T;T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25	4.31	4.31	0.51392	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.051706	0.85682	D	0.000000	T	0.76695	0.4023	M	0.78285	2.405	0.58432	D	0.999991	B;B;B;D	0.58970	0.071;0.041;0.094;0.984	B;B;B;P	0.55871	0.089;0.054;0.113;0.786	T	0.77765	-0.2465	10	0.38643	T	0.18	-16.0172	14.3254	0.66515	0.0:0.0:1.0:0.0	.	116;116;116;116	E9PS17;Q96KG9-6;Q96KG9-2;Q96KG9	.;.;.;NTKL_HUMAN	D	116	ENSP00000270176:E116D;ENSP00000431635:E116D;ENSP00000408192:E116D;ENSP00000437254:E116D;ENSP00000433450:E116D;ENSP00000279270:E116D;ENSP00000432175:E116D	ENSP00000270176:E116D	E	+	3	2	SCYL1	65050063	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.866000	0.48420	2.220000	0.72140	0.549000	0.68633	GAG		0.607	SCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389159.2	NM_020680		9	91	0	0	0	0.006214	0	9	91				
KCNK7	10089	broad.mit.edu	37	11	65360568	65360568	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:65360568C>T	ENST00000340313.4	-	3	1055	c.832G>A	c.(832-834)Gag>Aag	p.E278K	KCNK7_ENST00000394217.2_3'UTR|KCNK7_ENST00000342202.4_3'UTR|KCNK7_ENST00000394216.2_3'UTR|AP001362.1_ENST00000597463.1_5'Flank	NM_033347.1	NP_203133.1	Q9Y2U2	KCNK7_HUMAN	potassium channel, subfamily K, member 7	278					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|liver(1)|lung(1)	3						CCTTGGTCCTCAGCAGTCACA	0.627																																							uc001oes.2		NA																	0					0						c.(832-834)GAG>AAG		potassium channel, subfamily K, member 7 isoform							55.0	50.0	52.0					11																	65360568		2200	4296	6496	SO:0001583	missense	10089					integral to membrane	potassium channel activity|voltage-gated ion channel activity	g.chr11:65360568C>T	AF110522	CCDS8106.1, CCDS31608.1, CCDS41673.1	11q13	2012-03-07			ENSG00000173338	ENSG00000173338		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6282	protein-coding gene	gene with protein product		603940				10206991, 11256078, 16382106	Standard	NM_033347		Approved	K2p7.1	uc001oes.3	Q9Y2U2	OTTHUMG00000166528	ENST00000340313.4:c.832G>A	11.37:g.65360568C>T	ENSP00000344820:p.Glu278Lys					KCNK7_uc001oeq.2_3'UTR|KCNK7_uc001oer.2_3'UTR|KCNK7_uc001oeu.2_3'UTR	p.E278K	NM_033347	NP_203133	Q9Y2U2	KCNK7_HUMAN			3	1056	-			278			Cytoplasmic (Potential).		Q3SYI2|Q9Y2U3|Q9Y2U4	Missense_Mutation	SNP	ENST00000340313.4	37	c.832G>A	CCDS31608.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.424336	0.43020	.	.	ENSG00000173338	ENST00000340313	T	0.11385	2.78	4.87	4.87	0.63330	.	0.000000	0.44483	D	0.000459	T	0.11452	0.0279	L	0.34521	1.04	0.29561	N	0.85061	P	0.40000	0.698	B	0.41036	0.346	T	0.03296	-1.1051	10	0.72032	D	0.01	.	13.4907	0.61393	0.0:1.0:0.0:0.0	.	278	Q9Y2U2	KCNK7_HUMAN	K	278	ENSP00000344820:E278K	ENSP00000344820:E278K	E	-	1	0	KCNK7	65117144	0.982000	0.34865	0.378000	0.26068	0.062000	0.15995	2.647000	0.46639	2.256000	0.74724	0.561000	0.74099	GAG		0.627	KCNK7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390206.1	NM_005714		4	20	0	0	0	0.009096	0	4	20				
FIBP	9158	broad.mit.edu	37	11	65655442	65655442	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:65655442G>T	ENST00000338369.2	-	2	359	c.247C>A	c.(247-249)Cag>Aag	p.Q83K	FIBP_ENST00000426652.2_5'UTR|FIBP_ENST00000533045.1_Missense_Mutation_p.Q80K|CCDC85B_ENST00000312579.2_5'Flank|FIBP_ENST00000357519.4_Missense_Mutation_p.Q83K	NM_198897.1	NP_942600.1	O43427	FIBP_HUMAN	fibroblast growth factor (acidic) intracellular binding protein	83					fibroblast growth factor receptor signaling pathway (GO:0008543)|platelet aggregation (GO:0070527)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	fibroblast growth factor binding (GO:0017134)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	10				READ - Rectum adenocarcinoma(159;0.166)		GGCGGAATCTGGAAGATGAGC	0.597																																							uc001ogd.2		NA																	0				ovary(1)	1						c.(247-249)CAG>AAG		FGF intracellular binding protein isoform a							33.0	35.0	34.0					11																	65655442		2201	4296	6497	SO:0001583	missense	9158				fibroblast growth factor receptor signaling pathway	endomembrane system|membrane|microsome|mitochondrion|nucleus	fibroblast growth factor binding	g.chr11:65655442G>T	AF010187	CCDS8118.1, CCDS8119.1	11q13.1	2006-06-15			ENSG00000172500	ENSG00000172500			3705	protein-coding gene	gene with protein product		608296				9806903	Standard	NM_004214		Approved	FGFIBP	uc001ogd.3	O43427	OTTHUMG00000166846	ENST00000338369.2:c.247C>A	11.37:g.65655442G>T	ENSP00000344572:p.Gln83Lys					FIBP_uc009yqu.2_Missense_Mutation_p.Q80K|FIBP_uc001oge.2_Missense_Mutation_p.Q83K|FIBP_uc010roq.1_Missense_Mutation_p.Q83K|FIBP_uc010ror.1_Missense_Mutation_p.Q83K|CCDC85B_uc001ogf.2_5'Flank	p.Q83K	NM_198897	NP_942600	O43427	FIBP_HUMAN		READ - Rectum adenocarcinoma(159;0.166)	2	368	-			83					A8K0J7|Q27Q85|Q6IBQ3|Q9HD65	Missense_Mutation	SNP	ENST00000338369.2	37	c.247C>A	CCDS8119.1	.	.	.	.	.	.	.	.	.	.	G	32	5.178609	0.94846	.	.	ENSG00000172500	ENST00000338369;ENST00000357519;ENST00000533045	T;T;T	0.32023	1.47;1.47;1.47	4.15	4.15	0.48705	.	0.000000	0.85682	D	0.000000	T	0.57888	0.2084	M	0.82823	2.61	0.80722	D	1	D;D;D;D;D	0.69078	0.997;0.991;0.963;0.996;0.997	D;D;D;D;D	0.83275	0.992;0.982;0.973;0.993;0.996	T	0.65096	-0.6251	10	0.72032	D	0.01	-18.2385	14.301	0.66352	0.0:0.0:1.0:0.0	.	83;83;80;83;83	B4DF10;B4DR95;E9PSD3;O43427-2;O43427	.;.;.;.;FIBP_HUMAN	K	83;83;80	ENSP00000344572:Q83K;ENSP00000350124:Q83K;ENSP00000434043:Q80K	ENSP00000344572:Q83K	Q	-	1	0	FIBP	65412018	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.496000	0.90485	2.297000	0.77311	0.561000	0.74099	CAG		0.597	FIBP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000391575.2	NM_198897		7	25	1	0	0.000442599	0.006214	0.000463444	7	25				
FCHSD2	9873	broad.mit.edu	37	11	72554227	72554227	+	Silent	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:72554227G>C	ENST00000409418.4	-	16	2057	c.1674C>G	c.(1672-1674)ctC>ctG	p.L558L	ATG16L2_ENST00000534905.1_3'UTR|FCHSD2_ENST00000409853.1_Silent_p.L502L|FCHSD2_ENST00000458644.2_Silent_p.L422L|FCHSD2_ENST00000311172.7_Silent_p.L502L|FCHSD2_ENST00000409263.1_5'UTR|FCHSD2_ENST00000409314.1_Silent_p.L582L	NM_014824.2	NP_055639.2	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2	558										endometrium(2)|large_intestine(11)|lung(5)|ovary(2)|prostate(1)|skin(1)	22			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			TGCCTGAAACGAGTTCTGCTT	0.522																																							uc009ytl.2		NA																	0				ovary(1)	1						c.(1672-1674)CTC>CTG		FCH and double SH3 domains 2							100.0	85.0	90.0					11																	72554227		2200	4293	6493	SO:0001819	synonymous_variant	9873						protein binding	g.chr11:72554227G>C	AB018312	CCDS8218.2	11q13.3	2008-02-05	2004-04-14	2004-04-16	ENSG00000137478	ENSG00000137478			29114	protein-coding gene	gene with protein product			"""SH3 multiple domains 3"""	SH3MD3		9872452, 15067381	Standard	NM_014824		Approved	KIAA0769	uc009ytl.3	O94868	OTTHUMG00000153082	ENST00000409418.4:c.1674C>G	11.37:g.72554227G>C						FCHSD2_uc010rrg.1_Silent_p.L422L|FCHSD2_uc001oth.3_Silent_p.L502L|FCHSD2_uc001oti.2_Silent_p.L517L|ATG16L2_uc009ytj.1_3'UTR	p.L558L	NM_014824	NP_055639	O94868	FCSD2_HUMAN	BRCA - Breast invasive adenocarcinoma(5;3.3e-05)		16	1895	-			558					B4DNI3|Q7L8J9|Q8WVM2|Q96FV7|Q9UF77	Silent	SNP	ENST00000409418.4	37	c.1674C>G	CCDS8218.2																																																																																				0.522	FCHSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329429.2	NM_014824		6	46	0	0	0	0.001168	0	6	46				
ME3	10873	broad.mit.edu	37	11	86270746	86270746	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:86270746C>G	ENST00000393324.3	-	2	556	c.303G>C	c.(301-303)caG>caC	p.Q101H	RP11-317J19.1_ENST00000524610.1_RNA|ME3_ENST00000359636.2_Missense_Mutation_p.Q101H|ME3_ENST00000323418.6_Missense_Mutation_p.Q39H|ME3_ENST00000543262.1_Missense_Mutation_p.Q101H	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	101					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				CCAGGTCACTCTGCTGCCGCT	0.532																																							uc001pbz.2		NA																	0				ovary(1)	1						c.(301-303)CAG>CAC		mitochondrial malic enzyme 3 precursor	NADH(DB00157)						131.0	125.0	127.0					11																	86270746		2202	4299	6501	SO:0001583	missense	10873				aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding	g.chr11:86270746C>G	X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.303G>C	11.37:g.86270746C>G	ENSP00000376998:p.Gln101His					ME3_uc001pca.2_Missense_Mutation_p.Q101H|ME3_uc009yvk.2_Missense_Mutation_p.Q101H|ME3_uc010rtr.1_RNA	p.Q101H	NM_001014811	NP_001014811	Q16798	MAON_HUMAN			2	557	-		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)	101					B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	37	c.303G>C	CCDS8277.1	.	.	.	.	.	.	.	.	.	.	C	12.45	1.942279	0.34283	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826;ENST00000545395;ENST00000323418;ENST00000530335	T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54	5.25	3.32	0.38043	Malic enzyme, N-terminal (1);	0.410166	0.27358	N	0.019727	T	0.18257	0.0438	L	0.37850	1.14	0.31631	N	0.6491	B	0.02656	0.0	B	0.06405	0.002	T	0.09465	-1.0673	9	.	.	.	.	2.4531	0.04523	0.1161:0.3849:0.3163:0.1827	.	101	Q16798	MAON_HUMAN	H	101;101;101;101;39;39;101	ENSP00000352657:Q101H;ENSP00000440246:Q101H;ENSP00000376998:Q101H;ENSP00000431182:Q101H;ENSP00000315255:Q39H;ENSP00000434690:Q101H	.	Q	-	3	2	ME3	85948394	0.994000	0.37717	1.000000	0.80357	0.975000	0.68041	0.277000	0.18734	1.213000	0.43380	-0.150000	0.13652	CAG		0.532	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2			31	145	0	0	0	0.003271	0	31	145				
TYR	7299	broad.mit.edu	37	11	88911360	88911360	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:88911360G>T	ENST00000263321.5	+	1	741	c.239G>T	c.(238-240)tGg>tTg	p.W80L	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	80			W -> R (in OCA1A).		cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	CGGGAGTCGTGGCCTTCCGTC	0.517																																							uc001pcs.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(238-240)TGG>TTG		tyrosinase precursor	Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)						48.0	44.0	45.0					11																	88911360		2201	4299	6500	SO:0001583	missense	7299	Oculocutaneous_Albinism			eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity	g.chr11:88911360G>T	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.239G>T	11.37:g.88911360G>T	ENSP00000263321:p.Trp80Leu						p.W80L	NM_000372	NP_000363	P14679	TYRO_HUMAN			1	321	+		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)	80		W -> R (in OCA1A).	Lumenal, melanosome (Potential).		Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	ENST00000263321.5	37	c.239G>T	CCDS8284.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.446384	0.84101	.	.	ENSG00000077498	ENST00000263321	D	0.85013	-1.93	6.07	6.07	0.98685	Uncharacterised domain, di-copper centre (2);	0.100260	0.85682	D	0.000000	D	0.95297	0.8474	H	0.95645	3.7	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95663	0.8717	9	.	.	.	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	80	P14679	TYRO_HUMAN	L	80	ENSP00000263321:W80L	.	W	+	2	0	TYR	88551008	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	9.357000	0.97099	2.885000	0.99019	0.655000	0.94253	TGG		0.517	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372		36	11	1	0	6.84511e-11	0.003271	7.76478e-11	36	11				
DYNC2H1	79659	broad.mit.edu	37	11	102980339	102980339	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:102980339C>T	ENST00000375735.2	+	1	180	c.36C>T	c.(34-36)ttC>ttT	p.F12F	DYNC2H1_ENST00000398093.3_Silent_p.F12F|DYNC2H1_ENST00000334267.7_Silent_p.F12F	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	12	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GGAAGCTCTTCATCTTCACTA	0.517																																							uc001pho.2		NA																	0					0						c.(34-36)TTC>TTT		dynein, cytoplasmic 2, heavy chain 1							62.0	58.0	60.0					11																	102980339		1879	4111	5990	SO:0001819	synonymous_variant	79659				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity	g.chr11:102980339C>T	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.36C>T	11.37:g.102980339C>T						DYNC2H1_uc001phn.1_Silent_p.F12F|DYNC2H1_uc009yxe.1_Silent_p.F12F	p.F12F	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)	1	180	+		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)	12			Stem (By similarity).		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent	SNP	ENST00000375735.2	37	c.36C>T	CCDS53701.1																																																																																				0.517	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652		7	49	0	0	0	0.004482	0	7	49				
CUL5	8065	broad.mit.edu	37	11	107965677	107965677	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:107965677G>T	ENST00000393094.2	+	15	2322	c.1706G>T	c.(1705-1707)aGa>aTa	p.R569I		NM_003478.3	NP_003469.2	Q93034	CUL5_HUMAN	cullin 5	569					calcium ion transmembrane transport (GO:0070588)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cytosolic calcium ion homeostasis (GO:0051480)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|response to osmotic stress (GO:0006970)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul5-RING ubiquitin ligase complex (GO:0031466)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|receptor activity (GO:0004872)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		CATAGTGGTAGAAAATTACAT	0.373																																							uc001pjv.2		NA																	0				ovary(1)	1						c.(1705-1707)AGA>ATA		Vasopressin-activated calcium-mobilizing							72.0	74.0	73.0					11																	107965677		2200	4298	6498	SO:0001583	missense	8065				cell cycle arrest|cell proliferation|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process|viral reproduction	cullin-RING ubiquitin ligase complex|cytosol	calcium channel activity|receptor activity|ubiquitin protein ligase binding	g.chr11:107965677G>T	X81882	CCDS31668.1	11q22.3	2011-05-24			ENSG00000166266	ENSG00000166266			2556	protein-coding gene	gene with protein product		601741				8681378, 9037604	Standard	XM_005271682		Approved	VACM-1	uc001pjv.3	Q93034	OTTHUMG00000166369	ENST00000393094.2:c.1706G>T	11.37:g.107965677G>T	ENSP00000376808:p.Arg569Ile					CUL5_uc001pju.2_RNA	p.R569I	NM_003478	NP_003469	Q93034	CUL5_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)	15	2373	+		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	569					A8K960|O14766|Q9BZC6	Missense_Mutation	SNP	ENST00000393094.2	37	c.1706G>T	CCDS31668.1	.	.	.	.	.	.	.	.	.	.	G	32	5.135502	0.94517	.	.	ENSG00000166266	ENST00000393094	D	0.87887	-2.31	5.66	5.66	0.87406	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	D	0.95265	0.8464	M	0.91300	3.195	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95540	0.8611	10	0.87932	D	0	-17.0527	20.0961	0.97843	0.0:0.0:1.0:0.0	.	569	Q93034	CUL5_HUMAN	I	569	ENSP00000376808:R569I	ENSP00000376808:R569I	R	+	2	0	CUL5	107470887	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.416000	0.97383	2.813000	0.96785	0.655000	0.94253	AGA		0.373	CUL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389429.1			6	66	1	0	1.06961e-07	0.00308	1.17728e-07	6	66				
EXPH5	23086	broad.mit.edu	37	11	108385075	108385075	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:108385075C>G	ENST00000265843.4	-	6	1269	c.1159G>C	c.(1159-1161)Gag>Cag	p.E387Q	EXPH5_ENST00000524840.1_5'UTR|EXPH5_ENST00000525344.1_Missense_Mutation_p.E380Q|EXPH5_ENST00000443411.1_Missense_Mutation_p.E199Q|EXPH5_ENST00000428840.1_Missense_Mutation_p.E311Q	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	387					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		CTCAGGAACTCTTCCTGGTTC	0.453																																							uc001pkk.2		NA																	0				skin(3)|ovary(2)	5						c.(1159-1161)GAG>CAG		exophilin 5 isoform a							175.0	178.0	177.0					11																	108385075		2201	4298	6499	SO:0001583	missense	23086				intracellular protein transport		Rab GTPase binding	g.chr11:108385075C>G		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.1159G>C	11.37:g.108385075C>G	ENSP00000265843:p.Glu387Gln					EXPH5_uc010rvy.1_Missense_Mutation_p.E199Q|EXPH5_uc010rvz.1_Missense_Mutation_p.E231Q|EXPH5_uc010rwa.1_Missense_Mutation_p.E311Q	p.E387Q	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)	6	1270	-		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)	387					Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	37	c.1159G>C	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	C	11.21	1.571826	0.28003	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000439956;ENST00000526312;ENST00000533052	T;T;T;T;T;T	0.06768	3.83;3.75;3.6;3.83;3.64;3.26	5.66	4.75	0.60458	.	0.207947	0.33534	N	0.004805	T	0.21387	0.0515	M	0.71581	2.175	0.09310	N	1	D	0.76494	0.999	P	0.62298	0.9	T	0.08166	-1.0735	10	0.72032	D	0.01	-4.3501	7.287	0.26344	0.0:0.7163:0.0:0.2837	.	387	Q8NEV8	EXPH5_HUMAN	Q	387;311;199;380;231;311;199	ENSP00000265843:E387Q;ENSP00000391966:E311Q;ENSP00000411390:E199Q;ENSP00000432546:E380Q;ENSP00000432683:E311Q;ENSP00000446434:E199Q	ENSP00000265843:E387Q	E	-	1	0	EXPH5	107890285	0.000000	0.05858	0.533000	0.28001	0.029000	0.11900	0.894000	0.28350	1.395000	0.46643	0.491000	0.48974	GAG		0.453	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065		12	244	0	0	0	0.00245	0	12	244				
FEZ1	9638	broad.mit.edu	37	11	125359520	125359520	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:125359520C>T	ENST00000278919.3	-	2	388	c.154G>A	c.(154-156)Gaa>Aaa	p.E52K	FEZ1_ENST00000366139.3_Missense_Mutation_p.E52K|FEZ1_ENST00000524435.1_Missense_Mutation_p.E52K	NM_005103.4	NP_005094.1	Q99689	FEZ1_HUMAN	fasciculation and elongation protein zeta 1 (zygin I)	52					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|establishment of mitochondrion localization (GO:0051654)|nervous system development (GO:0007399)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|transport (GO:0006810)	axon (GO:0030424)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	24	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		CTGATTATTTCGGAAGAAAAA	0.507																																					Melanoma(180;509 2033 10762 15939 24711)	Melanoma(180;509 2033 10762 15939 24711)	uc001qbx.2		NA																	0				central_nervous_system(3)|ovary(1)	4						c.(154-156)GAA>AAA		zygin 1 isoform 1							67.0	73.0	71.0					11																	125359520		2201	4299	6500	SO:0001583	missense	9638				axon guidance|cell adhesion|transport	microtubule|plasma membrane		g.chr11:125359520C>T	U60060	CCDS31716.1, CCDS44758.1	11q24.2	2005-09-29			ENSG00000149557	ENSG00000149557			3659	protein-coding gene	gene with protein product		604825				9096408, 15843383	Standard	NM_005103		Approved		uc001qbx.3	Q99689	OTTHUMG00000165886	ENST00000278919.3:c.154G>A	11.37:g.125359520C>T	ENSP00000278919:p.Glu52Lys					FEZ1_uc010sbc.1_Missense_Mutation_p.E52K|FEZ1_uc001qby.1_Missense_Mutation_p.E52K	p.E52K	NM_005103	NP_005094	Q99689	FEZ1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)	2	306	-	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	52					O00679|O00728|Q6IBI7	Missense_Mutation	SNP	ENST00000278919.3	37	c.154G>A	CCDS31716.1	.	.	.	.	.	.	.	.	.	.	C	36	5.711249	0.96821	.	.	ENSG00000149557	ENST00000278919;ENST00000529053;ENST00000366139;ENST00000524435;ENST00000527534	T	0.37058	1.22	5.76	5.76	0.90799	.	0.194363	0.52532	D	0.000065	T	0.49012	0.1532	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.68483	0.958;0.89	T	0.28364	-1.0046	10	0.31617	T	0.26	-33.3703	19.5568	0.95354	0.0:1.0:0.0:0.0	.	52;52	B4DKG5;Q99689	.;FEZ1_HUMAN	K	52	ENSP00000278919:E52K	ENSP00000278919:E52K	E	-	1	0	FEZ1	124864730	1.000000	0.71417	0.984000	0.44739	0.945000	0.59286	7.670000	0.83925	2.722000	0.93159	0.650000	0.86243	GAA		0.507	FEZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386875.1	NM_005103		5	58	0	0	0	0.000602	0	5	58				
STT3A	3703	broad.mit.edu	37	11	125483032	125483032	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:125483032T>A	ENST00000529196.1	+	14	1720	c.1514T>A	c.(1513-1515)tTc>tAc	p.F505Y	STT3A_ENST00000531491.1_Missense_Mutation_p.F413Y|STT3A_ENST00000392708.4_Missense_Mutation_p.F505Y			P46977	STT3A_HUMAN	STT3A, subunit of the oligosaccharyltransferase complex (catalytic)	505					cellular protein metabolic process (GO:0044267)|co-translational protein modification (GO:0043686)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			NS(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	33	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		TTTGATGACTTCCGAGAAGCA	0.483																																							uc001qcd.2		NA																	0					0						c.(1513-1515)TTC>TAC		integral membrane protein 1							139.0	132.0	134.0					11																	125483032		2201	4299	6500	SO:0001583	missense	3703				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity	g.chr11:125483032T>A	BC020965	CCDS8458.1, CCDS60998.1	11q23.3	2013-03-06	2013-03-06	2006-02-07	ENSG00000134910	ENSG00000134910	2.4.99.18		6172	protein-coding gene	gene with protein product	"""dolichyl-diphosphooligosaccharide protein glycotransferase"""	601134	"""integral membrane protein 1"", ""STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)"", ""STT3A, cataylic subunit of the oligosaccharyltransferase complex"""	ITM1		8941377, 8634329, 10234787	Standard	NM_152713		Approved	TMC, MGC9042, STT3-A	uc001qcd.2	P46977	OTTHUMG00000165852	ENST00000529196.1:c.1514T>A	11.37:g.125483032T>A	ENSP00000436962:p.Phe505Tyr					STT3A_uc001qce.2_Missense_Mutation_p.F505Y|STT3A_uc010sbg.1_Missense_Mutation_p.F413Y|STT3A_uc009zbn.2_Missense_Mutation_p.F227Y	p.F505Y	NM_152713	NP_689926	P46977	STT3A_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)	13	1624	+	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)	505			Lumenal (Potential).		B4DJ24|E9PNQ1|Q86XU9|Q8TE35|Q8WUB4	Missense_Mutation	SNP	ENST00000529196.1	37	c.1514T>A	CCDS8458.1	.	.	.	.	.	.	.	.	.	.	T	17.67	3.448150	0.63178	.	.	ENSG00000134910	ENST00000392708;ENST00000529196;ENST00000531491	D;D;D	0.89875	-2.58;-2.58;-2.58	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.84334	0.5449	L	0.39566	1.225	0.80722	D	1	B;B	0.27316	0.089;0.175	B;B	0.29785	0.041;0.107	T	0.80096	-0.1525	10	0.10902	T	0.67	-23.2347	15.934	0.79688	0.0:0.0:0.0:1.0	.	413;505	B4DJ24;P46977	.;STT3A_HUMAN	Y	505;505;413	ENSP00000376472:F505Y;ENSP00000436962:F505Y;ENSP00000432820:F413Y	ENSP00000376472:F505Y	F	+	2	0	STT3A	124988242	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	8.040000	0.89188	2.237000	0.73441	0.460000	0.39030	TTC		0.483	STT3A-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386691.1	NM_152713		39	33	0	0	0	0.011902	0	39	33				
PATE1	160065	broad.mit.edu	37	11	125618573	125618573	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:125618573A>G	ENST00000305738.5	+	5	338	c.326A>G	c.(325-327)tAt>tGt	p.Y109C	PATE1_ENST00000437148.2_Missense_Mutation_p.Y97C	NM_138294.2	NP_612151.1	Q8WXA2	PATE1_HUMAN	prostate and testis expressed 1	109						extracellular region (GO:0005576)				large_intestine(1)|lung(5)	6						TGGAGTGTCTATTTGGTGAAC	0.468																																							uc001qct.2		NA																	0					0						c.(325-327)TAT>TGT		expressed in prostate and testis precursor							190.0	158.0	169.0					11																	125618573		2201	4299	6500	SO:0001583	missense	160065					extracellular region		g.chr11:125618573A>G	AF462605	CCDS8464.1	11q24.2	2008-12-17				ENSG00000171053		"""PATE family"""	24664	protein-coding gene	gene with protein product	"""expressed in prostate and testis"""	606861				11880645, 15798027	Standard	NM_138294		Approved	PATE	uc001qct.3	Q8WXA2		ENST00000305738.5:c.326A>G	11.37:g.125618573A>G	ENSP00000307164:p.Tyr109Cys					PATE1_uc009zbr.2_Missense_Mutation_p.Y97C	p.Y109C	NM_138294	NP_612151	Q8WXA2	PATE1_HUMAN			5	338	+			109					Q3KNX2	Missense_Mutation	SNP	ENST00000305738.5	37	c.326A>G	CCDS8464.1	.	.	.	.	.	.	.	.	.	.	A	11.05	1.523594	0.27299	.	.	ENSG00000171053	ENST00000305738;ENST00000437148	T;T	0.30448	1.53;1.53	4.07	2.89	0.33648	.	0.213623	0.23838	N	0.044074	T	0.42471	0.1204	L	0.46157	1.445	0.18873	N	0.999984	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.10870	-1.0611	10	0.66056	D	0.02	-0.5621	6.6026	0.22708	0.7874:0.0:0.0:0.2126	.	97;109	Q8WXA2-2;Q8WXA2	.;PATE1_HUMAN	C	109;97	ENSP00000307164:Y109C;ENSP00000396056:Y97C	ENSP00000307164:Y109C	Y	+	2	0	PATE1	125123783	0.635000	0.27199	0.133000	0.22050	0.296000	0.27459	3.099000	0.50267	0.846000	0.35142	0.528000	0.53228	TAT		0.468	PATE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386726.2	NM_138294		28	35	0	0	0	0.008361	0	28	35				
FLI1	2313	broad.mit.edu	37	11	128628062	128628062	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:128628062G>A	ENST00000527786.2	+	2	560	c.71G>A	c.(70-72)gGa>gAa	p.G24E	FLI1_ENST00000534087.2_5'UTR|FLI1_ENST00000525560.1_5'UTR|FLI1_ENST00000344954.6_5'UTR	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	24					blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		TCAGCGTACGGAGCGGCAGCC	0.627			T	EWSR1	Ewing sarcoma																																		uc010sbu.1		NA		Dom	yes		11	11q24	2313	T	Friend leukemia virus integration 1			M	EWSR1		Ewing sarcoma	EWSR1/FLI1(2266)	0				bone(2210)|soft_tissue(48)|autonomic_ganglia(4)|central_nervous_system(4)|lung(3)|ovary(2)|pancreas(2)	2273						c.(70-72)GGA>GAA		Friend leukemia virus integration 1							33.0	39.0	37.0					11																	128628062		2160	4259	6419	SO:0001583	missense	2313				hemostasis|organ morphogenesis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:128628062G>A	M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.71G>A	11.37:g.128628062G>A	ENSP00000433488:p.Gly24Glu					FLI1_uc010sbt.1_5'UTR|FLI1_uc010sbv.1_5'UTR|FLI1_uc009zci.2_5'UTR|FLI1_uc001qen.2_5'UTR	p.G24E	NM_002017	NP_002008	Q01543	FLI1_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)	2	412	+	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)	24					B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Missense_Mutation	SNP	ENST00000527786.2	37	c.71G>A	CCDS44768.1	.	.	.	.	.	.	.	.	.	.	G	19.64	3.865170	0.71949	.	.	ENSG00000151702	ENST00000429175	T	0.14893	2.47	5.41	5.41	0.78517	.	0.294018	0.36519	N	0.002549	T	0.17662	0.0424	L	0.39898	1.24	0.80722	D	1	P	0.41420	0.749	B	0.36186	0.219	T	0.01791	-1.1273	10	0.66056	D	0.02	.	19.1886	0.93654	0.0:0.0:1.0:0.0	.	24	Q01543	FLI1_HUMAN	E	24	ENSP00000399985:G24E	ENSP00000399985:G24E	G	+	2	0	FLI1	128133272	1.000000	0.71417	0.998000	0.56505	0.514000	0.34195	6.945000	0.75947	2.520000	0.84964	0.561000	0.74099	GGA		0.627	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386226.2	NM_002017		4	6	0	0	0	0.009096	0	4	6				
PRDM10	56980	broad.mit.edu	37	11	129814802	129814802	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:129814802G>A	ENST00000360871.3	-	6	857	c.626C>T	c.(625-627)cCc>cTc	p.P209L	PRDM10_ENST00000423662.2_Missense_Mutation_p.P123L|PRDM10_ENST00000358825.5_Missense_Mutation_p.P209L|PRDM10_ENST00000526082.1_Missense_Mutation_p.P123L|PRDM10_ENST00000528746.1_Missense_Mutation_p.P183L|PRDM10_ENST00000304538.6_Missense_Mutation_p.P123L	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	209	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		GAGCACCAGGGGGAGGCTCGC	0.667																																							uc001qfm.2		NA																	0				pancreas(1)	1						c.(625-627)CCC>CTC		PR domain containing 10 isoform 1							41.0	44.0	43.0					11																	129814802		2201	4297	6498	SO:0001583	missense	56980				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr11:129814802G>A	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.626C>T	11.37:g.129814802G>A	ENSP00000354118:p.Pro209Leu					PRDM10_uc001qfj.2_Missense_Mutation_p.P123L|PRDM10_uc001qfk.2_Missense_Mutation_p.P123L|PRDM10_uc001qfl.2_Missense_Mutation_p.P123L|PRDM10_uc010sbx.1_Missense_Mutation_p.P123L|PRDM10_uc001qfn.2_Missense_Mutation_p.P209L|PRDM10_uc009zct.1_Missense_Mutation_p.P241L	p.P209L	NM_020228	NP_064613	Q9NQV6	PRD10_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)	6	858	-	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	209			SET.		B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	ENST00000360871.3	37	c.626C>T	CCDS8484.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.937291	0.92458	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082	T;T;T;T;T;T	0.57752	0.38;0.38;0.38;0.38;0.38;0.38	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.76350	0.3975	M	0.82823	2.61	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.998;0.999;0.999;0.998;0.999;0.999;0.999	T	0.79769	-0.1664	10	0.87932	D	0	-25.8713	19.3089	0.94177	0.0:0.0:1.0:0.0	.	123;209;209;209;123;123;123	B7ZL72;Q9NQV6-4;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;.;PRD10_HUMAN;.;.;.	L	209;123;209;123;183;123	ENSP00000351686:P209L;ENSP00000302669:P123L;ENSP00000354118:P209L;ENSP00000398431:P123L;ENSP00000431262:P183L;ENSP00000432237:P123L	ENSP00000302669:P123L	P	-	2	0	PRDM10	129320012	1.000000	0.71417	0.996000	0.52242	0.599000	0.36880	9.420000	0.97426	2.631000	0.89168	0.650000	0.86243	CCC		0.667	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437		17	20	0	0	0	0.007413	0	17	20				
KDM5A	5927	broad.mit.edu	37	12	427406	427406	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:427406G>A	ENST00000399788.2	-	19	3125	c.2763C>T	c.(2761-2763)gtC>gtT	p.V921V	KDM5A_ENST00000382815.4_Silent_p.V921V	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	921					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						GCTTCTTCATGACATCCAAAG	0.498			T	NUP98	AML																																		uc001qif.1		NA		Dom	yes		12	12p11	5927	T 	"""lysine (K)-specific demethylase 5A, JARID1A"""			L	NUP98		AML		0				skin(2)|ovary(1)	3						c.(2761-2763)GTC>GTT		retinoblastoma binding protein 2 isoform 1							148.0	144.0	145.0					12																	427406		1943	4156	6099	SO:0001819	synonymous_variant	5927				chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr12:427406G>A		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.2763C>T	12.37:g.427406G>A						KDM5A_uc001qie.1_Silent_p.V921V|KDM5A_uc010sdn.1_Silent_p.V880V	p.V921V	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN			19	3126	-			921					A8MV76|Q4LE72|Q86XZ1	Silent	SNP	ENST00000399788.2	37	c.2763C>T	CCDS41736.1																																																																																				0.498	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1	NM_005056		21	125	0	0	0	0.014323	0	21	125				
WNK1	65125	broad.mit.edu	37	12	989170	989170	+	Silent	SNP	A	A	G	rs555482187		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:989170A>G	ENST00000315939.6	+	11	3448	c.2805A>G	c.(2803-2805)ccA>ccG	p.P935P	WNK1_ENST00000535572.1_Intron|WNK1_ENST00000530271.2_Silent_p.P1433P|WNK1_ENST00000537687.1_Intron|WNK1_ENST00000340908.4_Silent_p.P528P	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	935					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CTGAGGTTCCACTTTCCTCTG	0.478													A|||	1	0.000199681	0.0	0.0014	5008	,	,		21177	0.0		0.0	False		,,,				2504	0.0				Colon(19;451 567 6672 12618 28860)	Colon(19;451 567 6672 12618 28860)	uc001qio.3		NA																	0				stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23						c.(2803-2805)CCA>CCG		WNK lysine deficient protein kinase 1							72.0	68.0	69.0					12																	989170		2203	4300	6503	SO:0001819	synonymous_variant	65125				intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity	g.chr12:989170A>G	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.2805A>G	12.37:g.989170A>G						WNK1_uc001qip.3_Intron|WNK1_uc001qir.3_Intron	p.P935P	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)		11	3312	+	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		935					A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Silent	SNP	ENST00000315939.6	37	c.2805A>G	CCDS8506.1																																																																																				0.478	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979		13	47	0	0	0	0.00245	0	13	47				
MAGOHB	55110	broad.mit.edu	37	12	10766091	10766091	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:10766091C>A	ENST00000320756.2	-	1	131	c.41G>T	c.(40-42)gGg>gTg	p.G14V	MAGOHB_ENST00000539554.1_Intron|MAGOHB_ENST00000381881.2_Missense_Mutation_p.G14V	NM_018048.3	NP_060518.1	Q96A72	MGN2_HUMAN	mago-nashi homolog B (Drosophila)	14					mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|large_intestine(2)	4						GCCCTTGTGCCCTACGTAGTA	0.612																																							uc001qyq.1		NA																	0				breast(1)	1						c.(40-42)GGG>GTG		mago-nashi homolog B							108.0	103.0	105.0					12																	10766091		2203	4300	6503	SO:0001583	missense	55110				mRNA processing|mRNA transport|RNA splicing	nucleus	RNA binding	g.chr12:10766091C>A		CCDS8628.1	12p13.2	2014-02-12	2008-01-24		ENSG00000111196	ENSG00000111196			25504	protein-coding gene	gene with protein product							Standard	NM_018048		Approved	FLJ10292, MGN2	uc001qyq.2	Q96A72	OTTHUMG00000168407	ENST00000320756.2:c.41G>T	12.37:g.10766091C>A	ENSP00000319240:p.Gly14Val					MAGOHB_uc001qyr.1_RNA	p.G14V	NM_018048	NP_060518	Q96A72	MGN2_HUMAN			1	93	-			14						Missense_Mutation	SNP	ENST00000320756.2	37	c.41G>T	CCDS8628.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812862	0.90707	.	.	ENSG00000111196	ENST00000320756;ENST00000381881	.	.	.	4.01	4.01	0.46588	.	0.080287	0.50627	U	0.000107	D	0.86686	0.5992	H	0.96111	3.77	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.90581	0.4529	9	0.87932	D	0	.	14.4335	0.67266	0.0:1.0:0.0:0.0	.	14	Q96A72	MGN2_HUMAN	V	14	.	ENSP00000319240:G14V	G	-	2	0	MAGOHB	10657358	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.515000	0.73751	2.515000	0.84797	0.655000	0.94253	GGG		0.612	MAGOHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399616.1	NM_018048		45	67	1	0	1.61863e-15	0.01441	1.92104e-15	45	67				
YBX3	8531	broad.mit.edu	37	12	10865907	10865907	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:10865907C>T	ENST00000228251.4	-	5	676	c.476G>A	c.(475-477)gGc>gAc	p.G159D	YBX3_ENST00000279550.7_Missense_Mutation_p.G159D	NM_003651.4	NP_003642.3	P16989	YBOX3_HUMAN	Y box binding protein 3	159					3'-UTR-mediated mRNA stabilization (GO:0070935)|cellular hyperosmotic response (GO:0071474)|cellular response to tumor necrosis factor (GO:0071356)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of necroptotic process (GO:0060546)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytoplasmic translation (GO:2000767)|positive regulation of organ growth (GO:0046622)|response to cold (GO:0009409)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|tight junction (GO:0005923)	double-stranded DNA binding (GO:0003690)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|Rho GTPase binding (GO:0017048)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)										TCCATCCGGGCCAGTCACATT	0.502																																							uc001qyt.2		NA																	0				ovary(2)|lung(1)|large_intestine(1)	4						c.(475-477)GGC>GAC		cold shock domain protein A isoform a							83.0	90.0	88.0					12																	10865907		2203	4300	6503	SO:0001583	missense	8531				negative regulation of transcription from RNA polymerase II promoter|response to cold	cytoplasm|nucleus	double-stranded DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity	g.chr12:10865907C>T	L29064	CCDS8630.1, CCDS44831.1	12p13.1	2013-03-13	2013-03-13	2013-03-13	ENSG00000060138	ENSG00000060138			2428	protein-coding gene	gene with protein product	"""cold-shock domain containing A1"""	603437	"""cold shock domain protein A"""	CSDA		2977358, 8710501	Standard	NM_003651		Approved	dbpA, ZONAB, CSDA1	uc001qyt.3	P16989	OTTHUMG00000168409	ENST00000228251.4:c.476G>A	12.37:g.10865907C>T	ENSP00000228251:p.Gly159Asp					CSDA_uc001qyu.2_Missense_Mutation_p.G159D	p.G159D	NM_003651	NP_003642	P16989	DBPA_HUMAN			5	719	-	Glioma(1;0.155)		159					B2RBW6|Q14121|Q969N6|Q96B76	Missense_Mutation	SNP	ENST00000228251.4	37	c.476G>A	CCDS8630.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.939321	0.92526	.	.	ENSG00000060138	ENST00000279550;ENST00000228251	T;T	0.38401	1.17;1.14	5.49	5.49	0.81192	Cold shock protein (1);Nucleic acid-binding, OB-fold-like (1);Cold-shock protein, DNA-binding (1);	0.000000	0.64402	D	0.000002	T	0.67097	0.2857	M	0.88640	2.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.73183	-0.4063	10	0.66056	D	0.02	.	16.8488	0.85988	0.0:1.0:0.0:0.0	.	159;159	P16989-2;P16989	.;DBPA_HUMAN	D	159	ENSP00000279550:G159D;ENSP00000228251:G159D	ENSP00000228251:G159D	G	-	2	0	CSDA	10757174	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.558000	0.73942	2.569000	0.86673	0.491000	0.48974	GGC		0.502	YBX3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399628.1	NM_003651		50	77	0	0	0	0.01441	0	50	77				
GRIN2B	2904	broad.mit.edu	37	12	13720004	13720004	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:13720004C>A	ENST00000609686.1	-	12	2762	c.2553G>T	c.(2551-2553)atG>atT	p.M851I		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	851					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AACAGACACCCATAAAGCAAT	0.498																																							uc001rbt.2		NA																	0				central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12						c.(2551-2553)ATG>ATT		N-methyl-D-aspartate receptor subunit 2B	Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						107.0	89.0	95.0					12																	13720004		2203	4300	6503	SO:0001583	missense	2904				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr12:13720004C>A		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.2553G>T	12.37:g.13720004C>A	ENSP00000477455:p.Met851Ile						p.M851I	NM_000834	NP_000825	Q13224	NMDE2_HUMAN			12	2732	-			851			Cytoplasmic (Potential).		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	c.2553G>T	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188329	0.78789	.	.	ENSG00000150086	ENST00000279593	T	0.11385	2.78	5.76	5.76	0.90799	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.21550	0.0519	L	0.50333	1.59	0.80722	D	1	P	0.38729	0.644	P	0.46758	0.526	T	0.00124	-1.2024	10	0.51188	T	0.08	.	19.9631	0.97258	0.0:1.0:0.0:0.0	.	851	Q13224	NMDE2_HUMAN	I	851	ENSP00000279593:M851I	ENSP00000279593:M851I	M	-	3	0	GRIN2B	13611271	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.237000	0.51344	2.723000	0.93209	0.650000	0.86243	ATG		0.498	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			19	42	1	0	1.67942e-08	0.006122	1.86384e-08	19	42				
ARHGDIB	397	broad.mit.edu	37	12	15095518	15095518	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:15095518C>T	ENST00000228945.4	-	6	688	c.544G>A	c.(544-546)Gac>Aac	p.D182N	ARHGDIB_ENST00000541644.1_Missense_Mutation_p.D182N|ARHGDIB_ENST00000541546.1_Missense_Mutation_p.D182N|ARHGDIB_ENST00000539131.1_5'UTR	NM_001175.4	NP_001166.3	P52566	GDIR2_HUMAN	Rho GDP dissociation inhibitor (GDI) beta	182					actin cytoskeleton organization (GO:0030036)|cellular component movement (GO:0006928)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of cell adhesion (GO:0007162)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)|Rho GDP-dissociation inhibitor activity (GO:0005094)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	15						TCTTGCTTGTCATCGTCGGTG	0.562																																							uc001rcq.1		NA																	0					0						c.(544-546)GAC>AAC		Rho GDP dissociation inhibitor (GDI) beta							263.0	197.0	219.0					12																	15095518		2203	4300	6503	SO:0001583	missense	397				actin cytoskeleton organization|cellular component movement|immune response|multicellular organismal development|negative regulation of cell adhesion|regulation of small GTPase mediated signal transduction|Rho protein signal transduction	cytoplasmic membrane-bounded vesicle|cytoskeleton|cytosol	GTPase activator activity|Rho GDP-dissociation inhibitor activity	g.chr12:15095518C>T	L07916	CCDS8671.1	12p12.3	2014-01-30				ENSG00000111348		"""Endogenous ligands"""	679	protein-coding gene	gene with protein product		602843		RAP1GN1, GDIA2, GDID4		8434008, 8356058	Standard	NM_001175		Approved	Ly-GDI, RhoGDI2	uc001rcq.1	P52566		ENST00000228945.4:c.544G>A	12.37:g.15095518C>T	ENSP00000228945:p.Asp182Asn					ARHGDIB_uc001rcp.1_RNA	p.D182N	NM_001175	NP_001166	P52566	GDIR2_HUMAN			6	648	-			182					B5BU79	Missense_Mutation	SNP	ENST00000228945.4	37	c.544G>A	CCDS8671.1	.	.	.	.	.	.	.	.	.	.	C	33	5.212685	0.95069	.	.	ENSG00000111348	ENST00000228945;ENST00000541644;ENST00000541546	.	.	.	4.73	4.73	0.59995	Immunoglobulin E-set (1);	0.000000	0.85682	D	0.000000	D	0.86301	0.5900	H	0.94423	3.535	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89538	0.3790	9	0.62326	D	0.03	-28.3948	15.6549	0.77126	0.0:1.0:0.0:0.0	.	182	P52566	GDIR2_HUMAN	N	182	.	ENSP00000228945:D182N	D	-	1	0	ARHGDIB	14986785	1.000000	0.71417	0.986000	0.45419	0.982000	0.71751	7.247000	0.78257	2.630000	0.89119	0.650000	0.86243	GAC		0.562	ARHGDIB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400871.1	NM_001175		20	115	0	0	0	0.012319	0	20	115				
PTPRO	5800	broad.mit.edu	37	12	15637097	15637097	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:15637097C>T	ENST00000281171.4	+	2	595	c.265C>T	c.(265-267)Cat>Tat	p.H89Y	PTPRO_ENST00000543886.1_Missense_Mutation_p.H89Y|PTPRO_ENST00000348962.2_Missense_Mutation_p.H89Y	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	89	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				GGCCAGTTATCATGGCCTTTA	0.373																																							uc001rcv.1		NA																	0				skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9						c.(265-267)CAT>TAT		receptor-type protein tyrosine phosphatase O							86.0	87.0	87.0					12																	15637097		2203	4300	6503	SO:0001583	missense	5800					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr12:15637097C>T	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.265C>T	12.37:g.15637097C>T	ENSP00000281171:p.His89Tyr					PTPRO_uc001rcw.1_Missense_Mutation_p.H89Y|PTPRO_uc001rcu.1_Missense_Mutation_p.H89Y	p.H89Y	NM_030667	NP_109592	Q16827	PTPRO_HUMAN			2	439	+		Hepatocellular(102;0.244)	89			Fibronectin type-III 1.|Extracellular (Potential).		A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	ENST00000281171.4	37	c.265C>T	CCDS8675.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.993031	0.74703	.	.	ENSG00000151490	ENST00000281171;ENST00000543886;ENST00000348962	T;T	0.10668	2.97;2.85	5.48	4.59	0.56863	Fibronectin, type III (1);	0.000000	0.53938	D	0.000058	T	0.21347	0.0514	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.981	D;D;D	0.85130	0.997;0.994;0.954	T	0.00749	-1.1582	10	0.72032	D	0.01	.	13.6839	0.62504	0.0:0.9261:0.0:0.0739	.	89;89;89	Q16827-2;Q16827;Q8IYG3	.;PTPRO_HUMAN;.	Y	89	ENSP00000281171:H89Y;ENSP00000343434:H89Y	ENSP00000281171:H89Y	H	+	1	0	PTPRO	15528364	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.075000	0.57584	2.573000	0.86826	0.655000	0.94253	CAT		0.373	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401079.1			9	50	0	0	0	0.006214	0	9	50				
PTPRO	5800	broad.mit.edu	37	12	15637110	15637110	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:15637110A>T	ENST00000281171.4	+	2	608	c.278A>T	c.(277-279)tAt>tTt	p.Y93F	PTPRO_ENST00000543886.1_Missense_Mutation_p.Y93F|PTPRO_ENST00000348962.2_Missense_Mutation_p.Y93F	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	93	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				GGCCTTTATTATATAATCACT	0.373																																							uc001rcv.1		NA																	0				skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9						c.(277-279)TAT>TTT		receptor-type protein tyrosine phosphatase O							82.0	83.0	83.0					12																	15637110		2203	4300	6503	SO:0001583	missense	5800					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr12:15637110A>T	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.278A>T	12.37:g.15637110A>T	ENSP00000281171:p.Tyr93Phe					PTPRO_uc001rcw.1_Missense_Mutation_p.Y93F|PTPRO_uc001rcu.1_Missense_Mutation_p.Y93F	p.Y93F	NM_030667	NP_109592	Q16827	PTPRO_HUMAN			2	452	+		Hepatocellular(102;0.244)	93			Fibronectin type-III 1.|Extracellular (Potential).		A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	ENST00000281171.4	37	c.278A>T	CCDS8675.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.503358	0.85176	.	.	ENSG00000151490	ENST00000281171;ENST00000543886;ENST00000348962	T;T	0.10668	2.95;2.85	5.48	5.48	0.80851	Fibronectin, type III (1);	0.000000	0.47093	D	0.000260	T	0.22975	0.0555	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.993	D;D;D	0.83275	0.996;0.991;0.956	T	0.01375	-1.1371	10	0.59425	D	0.04	.	15.5822	0.76452	1.0:0.0:0.0:0.0	.	93;93;93	Q16827-2;Q16827;Q8IYG3	.;PTPRO_HUMAN;.	F	93	ENSP00000281171:Y93F;ENSP00000343434:Y93F	ENSP00000281171:Y93F	Y	+	2	0	PTPRO	15528377	1.000000	0.71417	0.955000	0.39395	0.996000	0.88848	6.772000	0.75001	2.080000	0.62538	0.533000	0.62120	TAT		0.373	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401079.1			9	39	0	0	0	0.006214	0	9	39				
RERGL	79785	broad.mit.edu	37	12	18234245	18234245	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:18234245G>A	ENST00000229002.2	-	6	704	c.498C>T	c.(496-498)atC>atT	p.I166I	RERGL_ENST00000541632.1_5'Flank|RERGL_ENST00000538724.1_Silent_p.I165I	NM_024730.2	NP_079006.1	Q9H628	RERGL_HUMAN	RERG/RAS-like	166	Small GTPase-like.				GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			endometrium(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	17						TGATAATTCTGATAAACATCA	0.418																																							uc001rdq.2		NA																	0					0						c.(496-498)ATC>ATT		RERG/RAS-like							118.0	110.0	113.0					12																	18234245		2203	4300	6503	SO:0001819	synonymous_variant	79785				signal transduction	membrane	GTP binding|GTPase activity	g.chr12:18234245G>A	AK026308	CCDS8679.1, CCDS66332.1	12p12.3	2014-08-12			ENSG00000111404	ENSG00000111404			26213	protein-coding gene	gene with protein product						24127187	Standard	NM_001286201		Approved	FLJ22655	uc001rdq.3	Q9H628	OTTHUMG00000168820	ENST00000229002.2:c.498C>T	12.37:g.18234245G>A						RERGL_uc001rdr.2_Silent_p.I165I	p.I166I	NM_024730	NP_079006	Q9H628	RERGL_HUMAN			6	692	-			166			Small GTPase-like.			Silent	SNP	ENST00000229002.2	37	c.498C>T	CCDS8679.1																																																																																				0.418	RERGL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401198.1	NM_024730		11	60	0	0	0	0.010729	0	11	60				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000311936.3_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000556131.1_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		7	18	1	0	1.12685e-05	0.004482	1.20838e-05	7	18				
BICD1	636	broad.mit.edu	37	12	32481160	32481160	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:32481160G>A	ENST00000281474.5	+	5	1874	c.1771G>A	c.(1771-1773)Gaa>Aaa	p.E591K	BICD1_ENST00000548411.1_Missense_Mutation_p.E591K	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	591					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			GGCCAGCAAAGAACCAAGTCC	0.498																																							uc001rku.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(1771-1773)GAA>AAA		bicaudal D homolog 1 isoform 1							199.0	186.0	191.0					12																	32481160		2203	4300	6503	SO:0001583	missense	636				anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton	g.chr12:32481160G>A	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.1771G>A	12.37:g.32481160G>A	ENSP00000281474:p.Glu591Lys					BICD1_uc001rkv.2_Missense_Mutation_p.E591K|BICD1_uc010skd.1_RNA	p.E591K	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	OV - Ovarian serous cystadenocarcinoma(6;0.0201)		5	1852	+	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		591					A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	37	c.1771G>A	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	G	13.87	2.364675	0.41902	.	.	ENSG00000151746	ENST00000548411;ENST00000281474	T;T	0.40756	1.02;1.02	5.2	5.2	0.72013	.	0.344557	0.30611	N	0.009243	T	0.27663	0.0680	N	0.11427	0.14	0.80722	D	1	B;P	0.44090	0.206;0.826	B;B	0.39217	0.085;0.294	T	0.09164	-1.0687	10	0.33940	T	0.23	.	18.7402	0.91770	0.0:0.0:1.0:0.0	.	591;591	F8W113;Q96G01	.;BICD1_HUMAN	K	591	ENSP00000446793:E591K;ENSP00000281474:E591K	ENSP00000281474:E591K	E	+	1	0	BICD1	32372427	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.137000	0.58010	2.415000	0.81967	0.655000	0.94253	GAA		0.498	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714		11	76	0	0	0	0.008291	0	11	76				
ADAMTS20	80070	broad.mit.edu	37	12	43826425	43826426	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:43826425_43826426CC>AT	ENST00000389420.3	-	20	2908_2909	c.2909_2910GG>AT	c.(2908-2910)tGG>tAT	p.W970Y	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.W970Y|ADAMTS20_ENST00000395541.2_Missense_Mutation_p.W124Y	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	970	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CTGAATAATGCCATCTTGTGAA	0.371																																							uc010skx.1		NA																	0				central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19						c.(2908-2910)TGG>TAT		a disintegrin-like and metalloprotease with																																				SO:0001583	missense	80070					proteinaceous extracellular matrix	zinc ion binding	g.chr12:43826425_43826426CC>AT	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.2909_2910delinsAT	12.37:g.43826425_43826426delinsAT	ENSP00000374071:p.Trp970Tyr					ADAMTS20_uc001rno.1_Missense_Mutation_p.W124Y|ADAMTS20_uc001rnp.1_Missense_Mutation_p.W124Y	p.W970Y	NM_025003	NP_079279	P59510	ATS20_HUMAN		GBM - Glioblastoma multiforme(48;0.0473)	20	2909_2910	-	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)	970			TSP type-1 4.		A6NNC9|J3QT00	Missense_Mutation	DNP	ENST00000389420.3	37	c.2909_2910GG>AT	CCDS31778.2																																																																																				0.371	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003		16	21	0	0	0	0.004672	0	16	21				
POU6F1	5463	broad.mit.edu	37	12	51584196	51584196	+	Missense_Mutation	SNP	T	T	C	rs200557831		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:51584196T>C	ENST00000389243.4	-	11	1679	c.740A>G	c.(739-741)gAg>gGg	p.E247G	POU6F1_ENST00000333640.10_Missense_Mutation_p.E247G|POU6F1_ENST00000550824.1_Missense_Mutation_p.E247G			Q14863	PO6F1_HUMAN	POU class 6 homeobox 1	247					brain development (GO:0007420)|heart development (GO:0007507)|muscle organ development (GO:0007517)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	11						ATTGAGAGCCTCTATGGCCTG	0.572																																							uc001rxy.2		NA																	0				ovary(1)	1						c.(739-741)GAG>GGG		POU class 6 homeobox 1							116.0	115.0	115.0					12																	51584196		2203	4300	6503	SO:0001583	missense	5463				brain development|heart development|muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity	g.chr12:51584196T>C	AL832881	CCDS31803.1	12q13.13	2011-06-20	2007-07-13			ENSG00000184271		"""Homeoboxes / POU class"""	9224	protein-coding gene	gene with protein product			"""POU domain, class 6, transcription factor 1"""			7908264	Standard	NM_002702		Approved	BRN5, MPOU, TCFB1	uc001rxz.3	Q14863		ENST00000389243.4:c.740A>G	12.37:g.51584196T>C	ENSP00000373895:p.Glu247Gly					POU6F1_uc001rxz.2_Missense_Mutation_p.E247G|POU6F1_uc001rya.2_Missense_Mutation_p.E247G	p.E247G	NM_002702	NP_002693	Q14863	PO6F1_HUMAN			5	932	-			247			Homeobox.		Q15944|Q6DK47|Q7Z7P6	Missense_Mutation	SNP	ENST00000389243.4	37	c.740A>G	CCDS31803.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.363335	0.82353	.	.	ENSG00000184271	ENST00000389243;ENST00000333640;ENST00000550824	D;D;D	0.96651	-4.08;-4.08;-4.08	5.43	4.26	0.50523	Homeodomain-related (1);Homeobox (3);POU (1);Homeodomain-like (1);	0.046816	0.85682	D	0.000000	D	0.96259	0.8780	L	0.48218	1.51	0.80722	D	1	D	0.55605	0.972	D	0.70487	0.969	D	0.93562	0.6896	10	0.15499	T	0.54	.	10.8329	0.46671	0.1418:0.0:0.0:0.8582	.	247	Q14863	PO6F1_HUMAN	G	247	ENSP00000373895:E247G;ENSP00000330190:E247G;ENSP00000448389:E247G	ENSP00000330190:E247G	E	-	2	0	POU6F1	49870463	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.199000	0.72112	0.870000	0.35726	0.459000	0.35465	GAG		0.572	POU6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405126.1	NM_002702		6	120	0	0	0	0.001168	0	6	120				
KRT80	144501	broad.mit.edu	37	12	52574327	52574327	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:52574327G>A	ENST00000394815.2	-	4	733	c.636C>T	c.(634-636)ttC>ttT	p.F212F	KRT80_ENST00000313234.5_Silent_p.F212F	NM_182507.2	NP_872313.2	Q6KB66	K2C80_HUMAN	keratin 80	212	Coil 1B.|Rod.					cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(2)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.108)		TCAACTCCACGAAGCTCTCCA	0.547																																					GBM(178;2309 2916 15678 35873)	GBM(178;2309 2916 15678 35873)	uc001rzx.2		NA																	0					0						c.(634-636)TTC>TTT		keratin 80 isoform a							158.0	161.0	160.0					12																	52574327		2203	4300	6503	SO:0001819	synonymous_variant	144501					keratin filament	structural molecule activity	g.chr12:52574327G>A	BX537567	CCDS8821.2, CCDS41784.1	12q13.13	2013-01-16			ENSG00000167767	ENSG00000167767		"""-"", ""Intermediate filaments type II, keratins (basic)"""	27056	protein-coding gene	gene with protein product		611161				16831889	Standard	NM_001081492		Approved	KB20	uc001rzx.3	Q6KB66	OTTHUMG00000150193	ENST00000394815.2:c.636C>T	12.37:g.52574327G>A						KRT80_uc001rzw.2_Silent_p.F247F|KRT80_uc001rzy.2_Silent_p.F212F	p.F212F	NM_182507	NP_872313	Q6KB66	K2C80_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.108)	4	734	-			212			Coil 1B.|Rod.		Q6P1A5|Q7Z3Q0	Silent	SNP	ENST00000394815.2	37	c.636C>T	CCDS8821.2																																																																																				0.547	KRT80-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316757.1	NM_182507		26	105	0	0	0	0.004656	0	26	105				
KRT75	9119	broad.mit.edu	37	12	52824329	52824329	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:52824329G>C	ENST00000252245.5	-	5	1251	c.1031C>G	c.(1030-1032)aCc>aGc	p.T344S	RP11-1020M18.10_ENST00000548135.1_RNA	NM_004693.2	NP_004684.2	O95678	K2C75_HUMAN	keratin 75	344	Coil 2.|Rod.				hematopoietic progenitor cell differentiation (GO:0002244)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(10)|prostate(1)|skin(1)	28				BRCA - Breast invasive adenocarcinoma(357;0.192)		GCTCACCTTGGTCTGGTACCA	0.542																																							uc001saj.2		NA																	0					0						c.(1030-1032)ACC>AGC		keratin 75							157.0	145.0	149.0					12																	52824329		2203	4300	6503	SO:0001583	missense	9119					keratin filament	structural molecule activity	g.chr12:52824329G>C	Y19212	CCDS8827.1	12q13.13	2013-06-25			ENSG00000170454	ENSG00000170454		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24431	protein-coding gene	gene with protein product		609025				9856802, 10692104, 16831889	Standard	NM_004693		Approved	K6HF	uc001saj.2	O95678	OTTHUMG00000169592	ENST00000252245.5:c.1031C>G	12.37:g.52824329G>C	ENSP00000252245:p.Thr344Ser						p.T344S	NM_004693	NP_004684	O95678	K2C75_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.192)	5	1053	-			344			Coil 2.|Rod.		B4DQU4|Q9NSA9	Missense_Mutation	SNP	ENST00000252245.5	37	c.1031C>G	CCDS8827.1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.447272	0.43429	.	.	ENSG00000170454	ENST00000252245	T	0.77489	-1.1	5.73	5.73	0.89815	Prefoldin (1);Filament (1);	0.000000	0.56097	D	0.000033	T	0.65144	0.2663	N	0.10760	0.04	0.27931	N	0.937882	B	0.23854	0.092	B	0.35607	0.206	T	0.54549	-0.8277	10	0.19147	T	0.46	.	16.1801	0.81892	0.0:0.1331:0.8669:0.0	.	344	O95678	K2C75_HUMAN	S	344	ENSP00000252245:T344S	ENSP00000252245:T344S	T	-	2	0	KRT75	51110596	0.822000	0.29219	1.000000	0.80357	0.995000	0.86356	0.012000	0.13287	2.706000	0.92434	0.655000	0.94253	ACC		0.542	KRT75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404968.1	NM_004693		51	71	0	0	0	0.01441	0	51	71				
TENC1	23371	broad.mit.edu	37	12	53457028	53457028	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:53457028G>A	ENST00000314250.6	+	26	4269	c.3979G>A	c.(3979-3981)Gac>Aac	p.D1327N	TENC1_ENST00000552570.1_Missense_Mutation_p.D1325N|TENC1_ENST00000314276.3_Missense_Mutation_p.D1337N|TENC1_ENST00000549700.1_Missense_Mutation_p.D1262N|TENC1_ENST00000451358.1_Missense_Mutation_p.D1317N|TENC1_ENST00000379902.3_Missense_Mutation_p.D1203N|TENC1_ENST00000546602.1_Missense_Mutation_p.D1230N	NM_170754.2	NP_736610.2	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase (tensin 2)	1327					cellular homeostasis (GO:0019725)|collagen metabolic process (GO:0032963)|intracellular signal transduction (GO:0035556)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|response to muscle activity (GO:0014850)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(19)|ovary(1)|pancreas(1)|stomach(3)	34						TACACTGACGGACAACCAAAG	0.582																																							uc001sbp.2		NA																	0				ovary(1)|pancreas(1)	2						c.(3979-3981)GAC>AAC		tensin like C1 domain containing phosphatase							82.0	84.0	84.0					12																	53457028		2203	4300	6503	SO:0001583	missense	23371				intracellular signal transduction|negative regulation of cell proliferation	focal adhesion	metal ion binding|phosphoprotein phosphatase activity|protein binding	g.chr12:53457028G>A	AF518729	CCDS8842.1, CCDS8843.1, CCDS8844.1	12q13.13	2013-02-14	2004-03-05			ENSG00000111077		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	19737	protein-coding gene	gene with protein product	"""tensin 2"""	607717	"""tensin like C1 domain-containing phosphatase"""				Standard	NM_015319		Approved	KIAA1075, C1-TEN, TNS2	uc001sbp.3	Q63HR2	OTTHUMG00000169730	ENST00000314250.6:c.3979G>A	12.37:g.53457028G>A	ENSP00000319684:p.Asp1327Asn					TENC1_uc001sbl.2_Missense_Mutation_p.D1203N|TENC1_uc001sbn.2_Missense_Mutation_p.D1337N|TENC1_uc001sbq.2_Missense_Mutation_p.D725N|TENC1_uc001sbr.2_RNA|TENC1_uc009zmr.2_Missense_Mutation_p.D820N|TENC1_uc001sbs.2_Missense_Mutation_p.D146N	p.D1327N	NM_170754	NP_736610	Q63HR2	TENC1_HUMAN			26	4114	+			1327					A2VDF2|A2VDF3|A2VDI8|A5PKY4|Q2NL80|Q76MW6|Q7Z5T9|Q8NFF9|Q8NFG0|Q96P25|Q9NT29|Q9UPS7	Missense_Mutation	SNP	ENST00000314250.6	37	c.3979G>A	CCDS8843.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743579	0.89663	.	.	ENSG00000111077	ENST00000379902;ENST00000314276;ENST00000314250;ENST00000451358;ENST00000443113;ENST00000546602;ENST00000552570;ENST00000549700	T;T;T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.32;-0.32;-0.32	3.91	3.91	0.45181	Phosphotyrosine interaction domain (1);Pleckstrin homology-type (1);Tensin phosphotyrosine-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.82848	0.5126	M	0.87381	2.88	0.53005	D	0.999968	B;B;D;B;P	0.76494	0.196;0.221;0.999;0.263;0.495	P;B;D;P;P	0.87578	0.589;0.392;0.998;0.486;0.557	D	0.86314	0.1688	10	0.87932	D	0	.	13.8078	0.63243	0.0:0.0:1.0:0.0	.	1325;1327;1230;1327;1337	Q63HR2-6;A7E2A6;Q63HR2-2;Q63HR2;Q63HR2-4	.;.;.;TENC1_HUMAN;.	N	1203;1337;1327;1317;699;1230;1325;1262	ENSP00000369232:D1203N;ENSP00000319756:D1337N;ENSP00000319684:D1327N;ENSP00000393362:D1317N;ENSP00000449363:D1230N;ENSP00000447021:D1325N;ENSP00000449361:D1262N	ENSP00000319684:D1327N	D	+	1	0	TENC1	51743295	1.000000	0.71417	0.998000	0.56505	0.938000	0.57974	9.541000	0.98083	2.200000	0.70718	0.511000	0.50034	GAC		0.582	TENC1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405779.1	NM_170754		18	55	0	0	0	0.008871	0	18	55				
MFSD5	84975	broad.mit.edu	37	12	53647661	53647661	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:53647661C>T	ENST00000329548.4	+	2	1233	c.1042C>T	c.(1042-1044)Cta>Tta	p.L348L	MFSD5_ENST00000534842.1_Silent_p.L455L	NM_032889.4	NP_116278.3	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing 5	348					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(3)|urinary_tract(1)	16						CATAGCCTTTCTACTTATTGA	0.507																																							uc001sci.1		NA																	0				skin(2)|ovary(1)	3						c.(1042-1044)CTA>TTA		major facilitator superfamily domain containing							125.0	121.0	122.0					12																	53647661		2203	4300	6503	SO:0001819	synonymous_variant	84975				transport	integral to membrane		g.chr12:53647661C>T	AK097576	CCDS8851.1, CCDS53796.1	12q13.13	2012-03-09			ENSG00000182544	ENSG00000182544			28156	protein-coding gene	gene with protein product							Standard	NM_032889		Approved	MGC11308	uc001sch.2	Q6N075	OTTHUMG00000170028	ENST00000329548.4:c.1042C>T	12.37:g.53647661C>T						MFSD5_uc001sch.1_Silent_p.L455L	p.L348L	NM_032889	NP_116278	Q6N075	MFSD5_HUMAN			2	1233	+			348			Helical; (Potential).		G3V1N7|Q6NW04|Q8N7W8|Q8NCK0|Q96IA5	Silent	SNP	ENST00000329548.4	37	c.1042C>T	CCDS8851.1																																																																																				0.507	MFSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406896.1	NM_032889		18	83	0	0	0	0.007413	0	18	83				
GLI1	2735	broad.mit.edu	37	12	57863408	57863408	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:57863408C>G	ENST00000228682.2	+	11	1594	c.1503C>G	c.(1501-1503)ctC>ctG	p.L501L	GLI1_ENST00000543426.1_Silent_p.L373L|GLI1_ENST00000546141.1_Silent_p.L460L	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	501					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)	p.L501L(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			TTGAGAACCTCAGGCTGGACC	0.617																																					Pancreas(157;841 1936 10503 41495 50368)	Pancreas(157;841 1936 10503 41495 50368)	uc001snx.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(4)|ovary(4)|breast(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)|pancreas(1)	15						c.(1501-1503)CTC>CTG		GLI family zinc finger 1 isoform 1							78.0	72.0	74.0					12																	57863408		2203	4300	6503	SO:0001819	synonymous_variant	2735				epidermal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|osteoblast differentiation|positive regulation of DNA replication|positive regulation of smoothened signaling pathway|positive regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	transcription regulatory region DNA binding|zinc ion binding	g.chr12:57863408C>G		CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.1503C>G	12.37:g.57863408C>G						GLI1_uc009zpq.2_Silent_p.L373L	p.L501L	NM_005269	NP_005260	P08151	GLI1_HUMAN	GBM - Glioblastoma multiforme(3;3.99e-32)		11	1581	+			501					D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Silent	SNP	ENST00000228682.2	37	c.1503C>G	CCDS8940.1																																																																																				0.617	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1	NM_005269		19	58	0	0	0	0.008871	0	19	58				
NAV3	89795	broad.mit.edu	37	12	78452786	78452786	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:78452786G>C	ENST00000397909.2	+	12	2700	c.2527G>C	c.(2527-2529)Gat>Cat	p.D843H	NAV3_ENST00000536525.2_Missense_Mutation_p.D843H|RP11-136F16.1_ENST00000549103.1_RNA|NAV3_ENST00000228327.6_Missense_Mutation_p.D843H|NAV3_ENST00000266692.7_Missense_Mutation_p.D843H			Q8IVL0	NAV3_HUMAN	neuron navigator 3	843						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GTACATGACAGATGGAGGACT	0.388										HNSCC(70;0.22)																													uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(2527-2529)GAT>CAT		neuron navigator 3							77.0	74.0	75.0					12																	78452786		1865	4103	5968	SO:0001583	missense	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78452786G>C	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2527G>C	12.37:g.78452786G>C	ENSP00000381007:p.Asp843His	HNSCC(70;0.22)				NAV3_uc001syo.2_Missense_Mutation_p.D843H|NAV3_uc010sub.1_Missense_Mutation_p.D343H	p.D843H	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN			12	2700	+			843					Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37	c.2527G>C		.	.	.	.	.	.	.	.	.	.	G	24.9	4.586467	0.86851	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T	0.38887	1.27;1.26;1.28;1.11	5.82	5.82	0.92795	.	0.000000	0.41396	U	0.000892	T	0.65228	0.2671	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.982;0.98;0.998	T	0.65467	-0.6161	10	0.87932	D	0	-21.226	20.1142	0.97922	0.0:0.0:1.0:0.0	.	843;843;843	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	H	843	ENSP00000446132:D843H;ENSP00000381007:D843H;ENSP00000228327:D843H;ENSP00000266692:D843H	ENSP00000228327:D843H	D	+	1	0	NAV3	76976917	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.902000	0.92568	2.765000	0.95021	0.650000	0.86243	GAT		0.388	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		15	34	0	0	0	0.00499	0	15	34				
NAV3	89795	broad.mit.edu	37	12	78562540	78562540	+	Silent	SNP	T	T	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:78562540T>A	ENST00000397909.2	+	24	5048	c.4875T>A	c.(4873-4875)tcT>tcA	p.S1625S	NAV3_ENST00000536525.2_Silent_p.S1625S|NAV3_ENST00000228327.6_Silent_p.S1625S|NAV3_ENST00000266692.7_Silent_p.S1448S			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1625						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CACAGGAATCTGAACTTATAG	0.403										HNSCC(70;0.22)																													uc001syp.2		NA																	0				large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						c.(4873-4875)TCT>TCA		neuron navigator 3							67.0	67.0	67.0					12																	78562540		1800	4083	5883	SO:0001819	synonymous_variant	89795					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	g.chr12:78562540T>A	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.4875T>A	12.37:g.78562540T>A		HNSCC(70;0.22)				NAV3_uc001syo.2_Silent_p.S1625S|NAV3_uc010sub.1_Silent_p.S1111S|NAV3_uc009zsf.2_Silent_p.S456S	p.S1625S	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN			24	5048	+			1625			Potential.		Q8NFW7|Q9Y2E7	Silent	SNP	ENST00000397909.2	37	c.4875T>A		.	.	.	.	.	.	.	.	.	.	T	10.06	1.248012	0.22880	.	.	ENSG00000067798	ENST00000552895	.	.	.	5.41	4.23	0.50019	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.1303	7.4667	0.27326	0.133:0.0:0.2731:0.5939	.	.	.	.	R	520	.	.	X	+	1	0	NAV3	77086671	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	0.851000	0.27751	0.962000	0.38057	0.528000	0.53228	TGA		0.403	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383		21	47	0	0	0	0.012319	0	21	47				
GALNT4	8693	broad.mit.edu	37	12	89917428	89917428	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:89917428C>G	ENST00000529983.2	-	1	1155	c.899G>C	c.(898-900)aGa>aCa	p.R300T	POC1B-GALNT4_ENST00000547474.1_Missense_Mutation_p.K41N|POC1B_ENST00000549035.1_Intron|POC1B_ENST00000313546.3_Intron|POC1B_ENST00000549504.1_Intron|POC1B-GALNT4_ENST00000548729.1_Missense_Mutation_p.R297T|RP11-734K2.4_ENST00000605233.1_RNA|POC1B_ENST00000393179.4_Intron|POC1B_ENST00000541909.1_Intron|GALNT4_ENST00000413530.1_Missense_Mutation_p.R128T	NM_003774.4	NP_003765.2	Q8N4A0	GALT4_HUMAN	polypeptide N-acetylgalactosaminyltransferase 4	300					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(4)|kidney(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)	14						GGGGTCAATTCTTGATATCCG	0.468																																							uc001tbd.2		NA																	0					0						c.(898-900)AGA>ACA		polypeptide N-acetylgalactosaminyltransferase 4							98.0	98.0	98.0					12																	89917428		1950	4150	6100	SO:0001583	missense	8693				carbohydrate metabolic process	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr12:89917428C>G	Y08564	CCDS53817.1	12q21.33	2014-03-13	2014-03-13		ENSG00000257594	ENSG00000257594	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4126	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 4"""	603565	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)"""			9804815	Standard	NM_003774		Approved	GalNAc-T4	uc001tbd.3	Q8N4A0	OTTHUMG00000166292	ENST00000529983.2:c.899G>C	12.37:g.89917428C>G	ENSP00000436604:p.Arg300Thr					POC1B_uc001tba.2_Intron|POC1B_uc001tbb.2_Intron|POC1B_uc001tbc.2_Intron|POC1B_uc010sun.1_Intron|GALNT4_uc001tbe.2_Missense_Mutation_p.R297T|GALNT4_uc010suo.1_5'UTR	p.R300T	NM_003774	NP_003765	Q8N4A0	GALT4_HUMAN			1	1108	-			300			Lumenal (Potential).		B2R775|B4DMX6|O00208	Missense_Mutation	SNP	ENST00000529983.2	37	c.899G>C	CCDS53817.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.89|10.89	1.477917|1.477917	0.26511|0.26511	.|.	.|.	ENSG00000259075|ENSG00000259075;ENSG00000259075;ENSG00000257594	ENST00000547474|ENST00000548729;ENST00000413530;ENST00000529983	.|T;T;T	.|0.59502	.|0.26;0.26;0.26	5.85|5.85	5.85|5.85	0.93711|0.93711	.|Glycosyl transferase, family 2 (1);	.|.	.|.	.|.	.|.	T|T	0.49490|0.49490	0.1560|0.1560	L|L	0.27975|0.27975	0.815|0.815	0.28198|0.28198	N|N	0.927468|0.927468	.|B;B	.|0.30146	.|0.228;0.27	.|B;B	.|0.38156	.|0.236;0.266	T|T	0.48570|0.48570	-0.9024|-0.9024	6|9	0.87932|0.41790	D|T	0|0.15	.|.	10.4144|10.4144	0.44314|0.44314	0.0:0.9081:0.0:0.0919|0.0:0.9081:0.0:0.0919	.|.	.|297;300	.|F8VUJ3;Q8N4A0	.|.;GALT4_HUMAN	N|T	41|297;128;300	.|ENSP00000447852:R297T;ENSP00000389686:R128T;ENSP00000436604:R300T	ENSP00000447754:K41N|ENSP00000436604:R300T	K|R	-|-	3|2	2|0	RP11-1109F11.4|GALNT4;RP11-1109F11.4	88441559|88441559	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.989000|0.989000	0.77384|0.77384	3.188000|3.188000	0.50958|0.50958	2.768000|2.768000	0.95171|0.95171	0.655000|0.655000	0.94253|0.94253	AAG|AGA		0.468	GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388973.2	NM_003774		18	73	0	0	0	0.007413	0	18	73				
HAL	3034	broad.mit.edu	37	12	96389479	96389479	+	Silent	SNP	G	G	C	rs376287928		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:96389479G>C	ENST00000261208.3	-	2	578	c.210C>G	c.(208-210)ctC>ctG	p.L70L	HAL_ENST00000541929.1_5'UTR|HAL_ENST00000538703.1_Silent_p.L70L|RP11-256L6.3_ENST00000551849.1_RNA	NM_002108.3	NP_002099.1	P42357	HUTH_HUMAN	histidine ammonia-lyase	70					biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	histidine ammonia-lyase activity (GO:0004397)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	34					L-Histidine(DB00117)	GGGCCACCTCGAGCCGGTCCT	0.622																																					NSCLC(169;943 2815 23563 30031)	NSCLC(169;943 2815 23563 30031)	uc001tem.1		NA																	0				ovary(2)|skin(1)	3						c.(208-210)CTC>CTG		histidine ammonia-lyase	L-Histidine(DB00117)						59.0	53.0	55.0					12																	96389479		2203	4299	6502	SO:0001819	synonymous_variant	3034				biosynthetic process|histidine catabolic process	cytosol	histidine ammonia-lyase activity	g.chr12:96389479G>C		CCDS9058.1, CCDS58264.1, CCDS58265.1	12q22-q24.1	1991-07-12				ENSG00000084110	4.3.1.3		4806	protein-coding gene	gene with protein product		609457		HIS			Standard	NM_002108		Approved		uc001tem.2	P42357	OTTHUMG00000170354	ENST00000261208.3:c.210C>G	12.37:g.96389479G>C						HAL_uc009zti.1_RNA|HAL_uc010suw.1_5'UTR|HAL_uc010sux.1_Silent_p.L70L	p.L70L	NM_002108	NP_002099	P42357	HUTH_HUMAN			2	507	-			70					B4DQC1|B4E0V8|F5GXF2|F5H1U5|Q4VB92|Q4VB93	Silent	SNP	ENST00000261208.3	37	c.210C>G	CCDS9058.1																																																																																				0.622	HAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408644.1			22	27	0	0	0	0.00333	0	22	27				
ACAD10	80724	broad.mit.edu	37	12	112153654	112153654	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:112153654G>A	ENST00000313698.4	+	7	1035	c.880G>A	c.(880-882)Ggg>Agg	p.G294R	ACAD10_ENST00000392636.2_5'UTR|ACAD10_ENST00000549590.1_Missense_Mutation_p.G294R|ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000455480.2_Missense_Mutation_p.G325R	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	294						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						GTTTGATCACGGGCAGTCAAA	0.473																																							uc001tsq.2		NA																	0				ovary(2)	2						c.(880-882)GGG>AGG		acyl-Coenzyme A dehydrogenase family, member 10							154.0	148.0	150.0					12																	112153654		2203	4300	6503	SO:0001583	missense	80724						acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups	g.chr12:112153654G>A	AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.880G>A	12.37:g.112153654G>A	ENSP00000325137:p.Gly294Arg					ACAD10_uc001tso.3_Intron|ACAD10_uc001tsp.2_Missense_Mutation_p.G294R|ACAD10_uc009zvx.2_Missense_Mutation_p.G325R|ACAD10_uc001tsr.2_Missense_Mutation_p.G32R|ACAD10_uc001tss.1_RNA	p.G294R	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN			7	1080	+			294					G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	ENST00000313698.4	37	c.880G>A	CCDS31903.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.175239	0.78564	.	.	ENSG00000111271	ENST00000413681;ENST00000549590;ENST00000455480;ENST00000313698;ENST00000552706;ENST00000507683	T;T;T	0.74106	-0.81;-0.81;-0.81	5.24	4.35	0.52113	Aminoglycoside phosphotransferase (1);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.91516	0.7321	H	0.98965	4.385	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.933;1.0;1.0;1.0	D	0.94356	0.7583	10	0.87932	D	0	.	13.8813	0.63684	0.0753:0.0:0.9247:0.0	.	325;32;294;294	G3XAJ0;F8W0Q4;Q6JQN1;Q6JQN1-2	.;.;ACD10_HUMAN;.	R	294;294;325;294;32;32	ENSP00000446959:G294R;ENSP00000389813:G325R;ENSP00000325137:G294R	ENSP00000325137:G294R	G	+	1	0	ACAD10	110638037	1.000000	0.71417	0.949000	0.38748	0.923000	0.55619	4.774000	0.62339	1.331000	0.45412	0.655000	0.94253	GGG		0.473	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1	NM_025247		38	103	0	0	0	0.006999	0	38	103				
RASAL1	8437	broad.mit.edu	37	12	113565663	113565663	+	Silent	SNP	G	G	A	rs61759864	byFrequency	TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:113565663G>A	ENST00000261729.5	-	5	567	c.252C>T	c.(250-252)atC>atT	p.I84I	RASAL1_ENST00000546530.1_Silent_p.I84I|RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000548055.1_Silent_p.I84I|RASAL1_ENST00000446861.3_Silent_p.I84I			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	84	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						AGATCTTGCCGATGATGTCGT	0.662													G|||	18	0.00359425	0.0	0.0	5008	,	,		15192	0.0		0.001	False		,,,				2504	0.0174						uc001tum.1		NA																	0				ovary(2)|skin(2)	4						c.(250-252)ATC>ATT		RAS protein activator like 1		G	,,	0,4406		0,0,2203	70.0	64.0	66.0		252,252,252	-5.9	0.9	12	dbSNP_129	66	6,8594	5.0+/-18.6	0,6,4294	no	coding-synonymous,coding-synonymous,coding-synonymous	RASAL1	NM_001193520.1,NM_001193521.1,NM_004658.2	,,	0,6,6497	AA,AG,GG		0.0698,0.0,0.0461	,,	84/807,84/777,84/805	113565663	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	8437				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	metal ion binding|phospholipid binding|Ras GTPase activator activity	g.chr12:113565663G>A	AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.252C>T	12.37:g.113565663G>A						RASAL1_uc010syp.1_Silent_p.I84I|RASAL1_uc001tul.2_Silent_p.I84I|RASAL1_uc001tun.1_Silent_p.I84I|RASAL1_uc010syq.1_Silent_p.I84I|RASAL1_uc001tuo.3_Silent_p.I84I|RASAL1_uc010syr.1_Silent_p.I84I	p.I84I	NM_004658	NP_004649	O95294	RASL1_HUMAN			5	545	-			84			C2 1.		B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Silent	SNP	ENST00000261729.5	37	c.252C>T	CCDS9165.1																																																																																				0.662	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658		7	77	0	0	0	0.001984	0	7	77				
ORAI1	84876	broad.mit.edu	37	12	122064796	122064796	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:122064796C>G	ENST00000330079.7	+	1	342	c.149C>G	c.(148-150)tCc>tGc	p.S50C		NM_032790.3	NP_116179	Q96D31	CRCM1_HUMAN	ORAI calcium release-activated calcium modulator 1	48					blood coagulation (GO:0007596)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|regulation of calcium ion transport (GO:0051924)|store-operated calcium entry (GO:0002115)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|store-operated calcium channel activity (GO:0015279)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	11	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000415)|Epithelial(86;0.00148)		ccgccgccgtccgccgtcacc	0.741																																							uc010szz.1		NA																	0					0						c.(142-144)TCC>TGC		calcium release-activated calcium channel							16.0	17.0	16.0					12																	122064796		1834	4052	5886	SO:0001583	missense	84876				platelet activation|positive regulation of calcium ion transport	integral to plasma membrane	protein binding|store-operated calcium channel activity	g.chr12:122064796C>G	AK027372		12q24.31	2014-09-17	2007-08-14	2007-08-14	ENSG00000182500	ENSG00000276045		"""ORAI calcium release-activated calcium modulators"""	25896	protein-coding gene	gene with protein product	"""calcium release-activated calcium modulator 1"""	610277	"""transmembrane protein 142A"""	TMEM142A		16582901	Standard	NM_032790		Approved	FLJ14466, CRACM1	uc021rff.1	Q96D31		ENST00000330079.7:c.149C>G	12.37:g.122064796C>G	ENSP00000328216:p.Ser50Cys						p.S48C	NM_032790	NP_116179	Q96D31	CRCM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000415)|Epithelial(86;0.00148)	2	336	+	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)		48			Cytoplasmic (Potential).		Q3MHV3|Q6DHX2|Q96BP7|Q96K71	Missense_Mutation	SNP	ENST00000330079.7	37	c.143C>G	CCDS41851.1	.	.	.	.	.	.	.	.	.	.	C	12.68	2.010093	0.35415	.	.	ENSG00000182500	ENST00000330079	T	0.32272	1.46	3.9	2.98	0.34508	.	14.678300	0.01382	N	0.012955	T	0.19406	0.0466	N	0.08118	0	0.19945	N	0.999941	B	0.20164	0.042	B	0.21917	0.037	T	0.20672	-1.0268	10	0.59425	D	0.04	-10.355	4.8023	0.13303	0.3846:0.5111:0.0:0.1043	.	48	Q96D31	CRCM1_HUMAN	C	50	ENSP00000328216:S50C	ENSP00000328216:S50C	S	+	2	0	ORAI1	120549179	0.186000	0.23225	0.873000	0.34254	0.508000	0.34012	1.249000	0.32839	0.922000	0.37019	0.195000	0.17529	TCC		0.741	ORAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402151.1	NM_032790		5	16	0	0	0	0.000602	0	5	16				
WDR66	144406	broad.mit.edu	37	12	122396299	122396299	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:122396299C>T	ENST00000288912.4	+	12	2706	c.1852C>T	c.(1852-1854)Caa>Taa	p.Q618*	WDR66_ENST00000397454.2_Nonsense_Mutation_p.Q618*	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	618							calcium ion binding (GO:0005509)	p.Q618*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		CCACCCATATCAACCCCTCAT	0.463																																					Esophageal Squamous(85;849 1794 49757 52143)	Esophageal Squamous(85;849 1794 49757 52143)	uc009zxk.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)|skin(1)	2						c.(1852-1854)CAA>TAA		WD repeat domain 66							182.0	180.0	181.0					12																	122396299		1920	4137	6057	SO:0001587	stop_gained	144406						calcium ion binding	g.chr12:122396299C>T	AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.1852C>T	12.37:g.122396299C>T	ENSP00000288912:p.Gln618*						p.Q618*	NM_144668	NP_653269	Q8TBY9	WDR66_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)	12	1994	+	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)		618			WD 6.		C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Nonsense_Mutation	SNP	ENST00000288912.4	37	c.1852C>T	CCDS41853.1	.	.	.	.	.	.	.	.	.	.	C	37	6.027428	0.97216	.	.	ENSG00000158023	ENST00000288912;ENST00000397454	.	.	.	5.27	4.29	0.51040	.	0.233607	0.44688	D	0.000426	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	8.879	0.35363	0.2066:0.5749:0.2185:0.0	.	.	.	.	X	618	.	ENSP00000288912:Q618X	Q	+	1	0	WDR66	120880682	0.929000	0.31497	0.818000	0.32626	0.849000	0.48306	1.885000	0.39678	2.434000	0.82447	0.561000	0.74099	CAA		0.463	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401700.1	NM_144668		30	122	0	0	0	0.008361	0	30	122				
MLXIP	22877	broad.mit.edu	37	12	122623049	122623049	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:122623049G>A	ENST00000319080.7	+	14	2467	c.2335G>A	c.(2335-2337)Gag>Aag	p.E779K	MLXIP_ENST00000538698.1_Missense_Mutation_p.E386K					MLX interacting protein											NS(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		GATGCAGGAGGAGGCCCGGCG	0.627																																					Esophageal Squamous(105;787 1493 16200 18566 52466)	Esophageal Squamous(105;787 1493 16200 18566 52466)	uc001ubq.2		NA																	0				ovary(2)	2						c.(2335-2337)GAG>AAG		MLX interacting protein							33.0	41.0	38.0					12																	122623049		2188	4278	6466	SO:0001583	missense	22877				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial outer membrane|nucleus	DNA binding	g.chr12:122623049G>A	AB020674	CCDS73540.1	12q21.31	2013-05-21				ENSG00000175727		"""Basic helix-loop-helix proteins"""	17055	protein-coding gene	gene with protein product		608090				10048485, 11073985	Standard	XM_006719290		Approved	MONDOA, KIAA0867, MIR, bHLHe36	uc001ubq.3	Q9HAP2		ENST00000319080.7:c.2335G>A	12.37:g.122623049G>A	ENSP00000312834:p.Glu779Lys					MLXIP_uc001ubt.2_Missense_Mutation_p.E386K	p.E779K	NM_014938	NP_055753	Q9HAP2	MLXIP_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)	14	2335	+	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)	779			Leucine-zipper.			Missense_Mutation	SNP	ENST00000319080.7	37	c.2335G>A		.	.	.	.	.	.	.	.	.	.	G	35	5.575701	0.96553	.	.	ENSG00000175727	ENST00000319080;ENST00000538698;ENST00000366272	D;D;D	0.98512	-4.97;-4.97;-4.97	5.03	5.03	0.67393	Helix-loop-helix DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.98883	0.9622	.	.	.	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	D	0.99521	1.0958	9	0.46703	T	0.11	-27.9999	18.3685	0.90399	0.0:0.0:1.0:0.0	.	779	Q9HAP2	MLXIP_HUMAN	K	779;386;250	ENSP00000312834:E779K;ENSP00000440769:E386K;ENSP00000445891:E250K	ENSP00000312834:E779K	E	+	1	0	MLXIP	121189002	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.630000	0.98420	2.329000	0.79093	0.561000	0.74099	GAG		0.627	MLXIP-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401718.2	NM_014938		8	21	0	0	0	0.00308	0	8	21				
VPS37B	79720	broad.mit.edu	37	12	123380591	123380591	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:123380591C>T	ENST00000267202.2	-	1	400	c.19G>A	c.(19-21)Gaa>Aaa	p.E7K		NM_024667.2	NP_078943.1	Q9H9H4	VP37B_HUMAN	vacuolar protein sorting 37 homolog B (S. cerevisiae)	7					endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)				breast(1)|central_nervous_system(1)|large_intestine(1)|skin(1)|urinary_tract(1)	5	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.08e-05)|Epithelial(86;0.000197)|BRCA - Breast invasive adenocarcinoma(302;0.205)		AACCGGGCTTCGCTCCCGGCG	0.736																																							uc001udl.2		NA																	0					0						c.(19-21)GAA>AAA		vacuolar protein sorting 37B							26.0	29.0	28.0					12																	123380591		2192	4289	6481	SO:0001583	missense	79720				cellular membrane organization|endosome transport|protein transport	late endosome membrane		g.chr12:123380591C>T	AK022812	CCDS9239.1	12q24.31	2008-02-05	2006-04-04		ENSG00000139722	ENSG00000139722			25754	protein-coding gene	gene with protein product		610037	"""vacuolar protein sorting 37B (yeast)"""			15218037	Standard	NM_024667		Approved	FLJ12750	uc001udl.3	Q9H9H4	OTTHUMG00000168767	ENST00000267202.2:c.19G>A	12.37:g.123380591C>T	ENSP00000267202:p.Glu7Lys						p.E7K	NM_024667	NP_078943	Q9H9H4	VP37B_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;5.08e-05)|Epithelial(86;0.000197)|BRCA - Breast invasive adenocarcinoma(302;0.205)	1	122	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		7						Missense_Mutation	SNP	ENST00000267202.2	37	c.19G>A	CCDS9239.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.532056	0.64972	.	.	ENSG00000139722	ENST00000267202;ENST00000535765	T;T	0.55234	0.53;0.53	3.3	3.3	0.37823	.	0.528135	0.18524	N	0.138676	T	0.48642	0.1511	N	0.19112	0.55	0.38627	D	0.951289	D	0.76494	0.999	D	0.68621	0.959	T	0.39820	-0.9595	10	0.06236	T	0.91	-12.6574	10.3574	0.43972	0.0:1.0:0.0:0.0	.	7	Q9H9H4	VP37B_HUMAN	K	7	ENSP00000267202:E7K;ENSP00000446075:E7K	ENSP00000267202:E7K	E	-	1	0	VPS37B	121946544	1.000000	0.71417	0.998000	0.56505	0.801000	0.45260	1.717000	0.37991	2.133000	0.65898	0.655000	0.94253	GAA		0.736	VPS37B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400946.1	NM_024667		4	51	0	0	0	0.009096	0	4	51				
DNAH10	196385	broad.mit.edu	37	12	124330325	124330325	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:124330325C>T	ENST00000409039.3	+	30	5210	c.5185C>T	c.(5185-5187)Ccg>Tcg	p.P1729S		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1729	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CATCACCATGCCGCTAAGCAA	0.463																																							uc001uft.3		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(5185-5187)CCG>TCG		dynein, axonemal, heavy chain 10							123.0	130.0	128.0					12																	124330325		2041	4188	6229	SO:0001583	missense	196385				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr12:124330325C>T	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.5185C>T	12.37:g.124330325C>T	ENSP00000386770:p.Pro1729Ser						p.P1729S	NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	30	5210	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		1729			Stem (By similarity).		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	c.5185C>T	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	1.629	-0.519597	0.04171	.	.	ENSG00000197653	ENST00000409039	T	0.20738	2.05	5.77	-3.8	0.04307	.	0.256964	0.32134	U	0.006540	T	0.11965	0.0291	L	0.48260	1.515	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.13019	-1.0525	10	0.39692	T	0.17	.	1.5303	0.02534	0.2015:0.4007:0.0979:0.2999	.	1729	Q8IVF4	DYH10_HUMAN	S	1729	ENSP00000386770:P1729S	ENSP00000386770:P1729S	P	+	1	0	DNAH10	122896278	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	0.536000	0.23129	-1.240000	0.02529	-0.258000	0.10820	CCG		0.463	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			23	42	0	0	0	0.00278	0	23	42				
TMEM132D	121256	broad.mit.edu	37	12	129559035	129559035	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:129559035G>A	ENST00000422113.2	-	9	3011	c.2685C>T	c.(2683-2685)ccC>ccT	p.P895P	TMEM132D_ENST00000389441.4_Silent_p.P433P	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	895					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CATTGCTTCTGGGGAGGTCCA	0.517																																							uc009zyl.1		NA																	0				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14						c.(2683-2685)CCC>CCT		transmembrane protein 132D precursor							100.0	91.0	94.0					12																	129559035		2203	4300	6503	SO:0001819	synonymous_variant	121256					integral to membrane		g.chr12:129559035G>A	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2685C>T	12.37:g.129559035G>A						TMEM132D_uc001uia.2_Silent_p.P433P	p.P895P	NM_133448	NP_597705	Q14C87	T132D_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)	9	3013	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	895			Extracellular (Potential).		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	ENST00000422113.2	37	c.2685C>T	CCDS9266.1																																																																																				0.517	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		17	62	0	0	0	0.007413	0	17	62				
TMEM132D	121256	broad.mit.edu	37	12	130184802	130184802	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:130184802C>T	ENST00000422113.2	-	2	847	c.521G>A	c.(520-522)cGa>cAa	p.R174Q	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	174					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TCGGGTCTCTCGGAAAGCAAA	0.682																																							uc009zyl.1		NA																	0				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14						c.(520-522)CGA>CAA		transmembrane protein 132D precursor							16.0	18.0	18.0					12																	130184802		2200	4299	6499	SO:0001583	missense	121256					integral to membrane		g.chr12:130184802C>T	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.521G>A	12.37:g.130184802C>T	ENSP00000408581:p.Arg174Gln						p.R174Q	NM_133448	NP_597705	Q14C87	T132D_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)	2	849	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)	174			Extracellular (Potential).		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	c.521G>A	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.629498	0.87660	.	.	ENSG00000151952	ENST00000422113	T	0.12774	2.65	5.33	5.33	0.75918	.	0.000000	0.53938	D	0.000057	T	0.24431	0.0592	M	0.82056	2.57	0.33629	D	0.605743	P	0.52463	0.953	B	0.42282	0.382	T	0.47368	-0.9123	9	.	.	.	-29.175	19.0288	0.92946	0.0:1.0:0.0:0.0	.	174	Q14C87	T132D_HUMAN	Q	174	ENSP00000408581:R174Q	.	R	-	2	0	TMEM132D	128750755	0.999000	0.42202	0.961000	0.40146	0.961000	0.63080	3.805000	0.55575	2.472000	0.83506	0.555000	0.69702	CGA		0.682	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448		4	18	0	0	0	0.009096	0	4	18				
PIWIL1	9271	broad.mit.edu	37	12	130842061	130842061	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:130842061G>A	ENST00000245255.3	+	14	1900	c.1628G>A	c.(1627-1629)aGa>aAa	p.R543K		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	543	RNA-binding. {ECO:0000250}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		GCCTACTTAAGAGTCTTACAG	0.423																																							uc001uik.2		NA																	0				ovary(2)	2						c.(1627-1629)AGA>AAA		piwi-like 1							149.0	131.0	137.0					12																	130842061		2203	4300	6503	SO:0001583	missense	9271				gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding	g.chr12:130842061G>A	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.1628G>A	12.37:g.130842061G>A	ENSP00000245255:p.Arg543Lys					PIWIL1_uc001uij.1_Missense_Mutation_p.R543K	p.R543K	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)	14	1718	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		543			RNA-binding (By similarity).		A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	ENST00000245255.3	37	c.1628G>A	CCDS9268.1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.060174	0.55432	.	.	ENSG00000125207	ENST00000245255	T	0.13089	2.62	5.59	5.59	0.84812	Ribonuclease H-like (1);	0.094405	0.64402	D	0.000003	T	0.11537	0.0281	L	0.35854	1.095	0.43994	D	0.996693	B;B	0.26975	0.02;0.165	B;B	0.24155	0.007;0.051	T	0.11591	-1.0581	10	0.27785	T	0.31	-10.9573	11.9674	0.53044	0.0788:0.0:0.9212:0.0	.	543;543	Q96J94;Q96J94-2	PIWL1_HUMAN;.	K	543	ENSP00000245255:R543K	ENSP00000245255:R543K	R	+	2	0	PIWIL1	129408014	0.986000	0.35501	0.823000	0.32752	0.970000	0.65996	3.711000	0.54868	2.619000	0.88677	0.655000	0.94253	AGA		0.423	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1			18	62	0	0	0	0.014323	0	18	62				
GOLGA3	2802	broad.mit.edu	37	12	133365817	133365817	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr12:133365817C>T	ENST00000450791.2	-	12	2790	c.2607G>A	c.(2605-2607)ctG>ctA	p.L869L	GOLGA3_ENST00000456883.2_Silent_p.L869L|GOLGA3_ENST00000545875.1_Silent_p.L869L|GOLGA3_ENST00000204726.3_Silent_p.L869L|GOLGA3_ENST00000537452.1_Silent_p.L869L			Q08378	GOGA3_HUMAN	golgin A3	869					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		TGGTGGCTTTCAGCTCACTGA	0.657																																							uc001ukz.1		NA																	0				ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(2605-2607)CTG>CTA		Golgi autoantigen, golgin subfamily a, 3							48.0	42.0	44.0					12																	133365817		2202	4299	6501	SO:0001819	synonymous_variant	2802				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity	g.chr12:133365817C>T	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.2607G>A	12.37:g.133365817C>T						GOLGA3_uc001ula.1_Silent_p.L869L|GOLGA3_uc001ulb.2_Silent_p.L869L	p.L869L	NM_005895	NP_005886	Q08378	GOGA3_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)	13	3166	-	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)	869			Potential.		A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Silent	SNP	ENST00000450791.2	37	c.2607G>A	CCDS9281.1																																																																																				0.657	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895		11	42	0	0	0	0.010729	0	11	42				
BRCA2	675	broad.mit.edu	37	13	32968918	32968918	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr13:32968918C>A	ENST00000380152.3	+	25	9582	c.9349C>A	c.(9349-9351)Cat>Aat	p.H3117N	BRCA2_ENST00000544455.1_Missense_Mutation_p.H3117N			P51587	BRCA2_HUMAN	breast cancer 2, early onset	3117					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TATTAAGCCTCATATGTTAAT	0.398			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	uc001uub.1		NA	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	D|Mis|N|F|S	familial breast/ovarian cancer gene 2			"""L, E"""		breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)	breast|ovarian|pancreatic		0				ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64						c.(9349-9351)CAT>AAT	Direct_reversal_of_damage|Homologous_recombination	breast cancer 2, early onset							96.0	89.0	92.0					13																	32968918		2203	4300	6503	SO:0001583	missense	675	FanconAnemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding	g.chr13:32968918C>A	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.9349C>A	13.37:g.32968918C>A	ENSP00000369497:p.His3117Asn	TCGA Ovarian(8;0.087)					p.H3117N	NM_000059	NP_000050	P51587	BRCA2_HUMAN		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)	25	9576	+		Lung SC(185;0.0262)	3117					O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	c.9349C>A	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	C	9.538	1.112579	0.20795	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.80824	-1.42;-1.42	5.89	3.16	0.36331	Nucleic acid-binding, OB-fold-like (1);BRCA2, oligonucleotide/oligosaccharide-binding 3 (1);	0.609701	0.18482	N	0.139905	T	0.77363	0.4119	M	0.63428	1.95	0.09310	N	1	P	0.38677	0.642	B	0.43360	0.417	T	0.62723	-0.6794	10	0.19590	T	0.45	.	7.4831	0.27417	0.0:0.5934:0.0:0.4066	.	3117	P51587	BRCA2_HUMAN	N	3117	ENSP00000369497:H3117N;ENSP00000439902:H3117N	ENSP00000369497:H3117N	H	+	1	0	BRCA2	31866918	0.000000	0.05858	0.001000	0.08648	0.787000	0.44495	0.316000	0.19469	0.360000	0.24265	0.557000	0.71058	CAT		0.398	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059		7	28	1	0	2.7689e-08	0.001984	3.06278e-08	7	28				
INTS6	26512	broad.mit.edu	37	13	51963515	51963515	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr13:51963515C>A	ENST00000311234.4	-	6	1151	c.679G>T	c.(679-681)Gta>Tta	p.V227L	INTS6_ENST00000425000.1_5'UTR|INTS6_ENST00000497989.1_Missense_Mutation_p.V49L|INTS6_ENST00000420668.2_Missense_Mutation_p.K165N|INTS6_ENST00000463928.1_Missense_Mutation_p.V227L|INTS6_ENST00000398119.2_Missense_Mutation_p.V214L	NM_012141.2	NP_036273.1	Q9UL03	INT6_HUMAN	integrator complex subunit 6	227	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				signal transduction (GO:0007165)|snRNA processing (GO:0016180)	actin cytoskeleton (GO:0015629)|integrator complex (GO:0032039)|nucleus (GO:0005634)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		CCACTTTGTACTTTCTGCACC	0.383																																							uc001vfk.2		NA																	0				ovary(1)|lung(1)	2						c.(679-681)GTA>TTA		integrator complex subunit 6 isoform a							163.0	161.0	162.0					13																	51963515		2203	4300	6503	SO:0001583	missense	26512				snRNA processing	actin cytoskeleton|integrator complex	protein binding|transmembrane receptor activity	g.chr13:51963515C>A	AF097645	CCDS9428.1, CCDS41890.1, CCDS45048.1	13q14.3	2010-08-20	2006-03-15	2006-03-15	ENSG00000102786	ENSG00000102786		"""DEAD-boxes"""	14879	protein-coding gene	gene with protein product		604331	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26"""	DDX26		10467397, 16239144	Standard	XM_005266340		Approved	DICE1, HDB, Notchl2, DBI-1, DDX26A, INT6	uc001vfk.3	Q9UL03	OTTHUMG00000016945	ENST00000311234.4:c.679G>T	13.37:g.51963515C>A	ENSP00000310260:p.Val227Leu					INTS6_uc001vfj.2_Missense_Mutation_p.V214L|INTS6_uc001vfl.2_Missense_Mutation_p.V49L	p.V227L	NM_012141	NP_036273	Q9UL03	INT6_HUMAN		GBM - Glioblastoma multiforme(99;7.7e-08)	6	1293	-		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)	227			VWFA.		Q0P664|Q6PJP4|Q9UFK0|Q9Y5M9	Missense_Mutation	SNP	ENST00000311234.4	37	c.679G>T	CCDS9428.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.92|12.92	2.082868|2.082868	0.36758|0.36758	.|.	.|.	ENSG00000102786|ENSG00000102786	ENST00000420668|ENST00000311234;ENST00000398119;ENST00000497989	.|.	.|.	.|.	5.33|5.33	5.33|5.33	0.75918|0.75918	.|von Willebrand factor, type A (1);	.|0.059494	.|0.64402	.|D	.|0.000002	T|T	0.32882|0.32882	0.0844|0.0844	N|N	0.21508|0.21508	0.67|0.67	0.80722|0.80722	D|D	1|1	.|P	.|0.50943	.|0.94	.|B	.|0.42555	.|0.391	T|T	0.04128|0.04128	-1.0975|-1.0975	6|9	0.35671|0.19147	T|T	0.21|0.46	-13.1564|-13.1564	11.8069|11.8069	0.52161|0.52161	0.0:0.9194:0.0:0.0806|0.0:0.9194:0.0:0.0806	.|.	.|227	.|Q9UL03	.|INT6_HUMAN	N|L	165|227;214;49	.|.	ENSP00000388585:K165N|ENSP00000310260:V227L	K|V	-|-	3|1	2|0	INTS6|INTS6	50861516|50861516	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	3.692000|3.692000	0.54727|0.54727	2.652000|2.652000	0.90054|0.90054	0.563000|0.563000	0.77884|0.77884	AAG|GTA		0.383	INTS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045023.1	NM_012141		39	111	1	0	1.97e-11	0.010771	2.25771e-11	39	111				
PCDH9	5101	broad.mit.edu	37	13	67802282	67802282	+	Silent	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr13:67802282G>C	ENST00000377865.2	-	1	425	c.291C>G	c.(289-291)ctC>ctG	p.L97L	PCDH9_ENST00000544246.1_Silent_p.L97L|PCDH9_ENST00000456367.1_Silent_p.L97L|PCDH9_ENST00000377861.3_Silent_p.L97L|PCDH9_ENST00000328454.5_Silent_p.L97L			Q9HC56	PCDH9_HUMAN	protocadherin 9	97	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		CGCCAGCACAGAGTTTTTCTC	0.438																																							uc001vik.2		NA																	0				ovary(4)|pancreas(1)|skin(1)	6						c.(289-291)CTC>CTG		protocadherin 9 isoform 1 precursor							54.0	51.0	52.0					13																	67802282		2203	4300	6503	SO:0001819	synonymous_variant	5101				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr13:67802282G>C	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.291C>G	13.37:g.67802282G>C						PCDH9_uc001vil.2_Silent_p.L97L|PCDH9_uc010thl.1_Silent_p.L97L|PCDH9_uc001vin.3_Silent_p.L97L	p.L97L	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN		GBM - Glioblastoma multiforme(99;0.00819)	2	983	-		Hepatocellular(98;0.0906)|Breast(118;0.107)	97			Extracellular (Potential).|Cadherin 1.		A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Silent	SNP	ENST00000377865.2	37	c.291C>G	CCDS9444.1																																																																																				0.438	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487		12	44	0	0	0	0.001855	0	12	44				
KLF5	688	broad.mit.edu	37	13	73636220	73636220	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr13:73636220C>G	ENST00000377687.4	+	2	1019	c.483C>G	c.(481-483)atC>atG	p.I161M	KLF5_ENST00000477333.1_3'UTR|KLF5_ENST00000539231.1_Missense_Mutation_p.I70M	NM_001730.3	NP_001721.2	Q13887	KLF5_HUMAN	Kruppel-like factor 5 (intestinal)	161					angiogenesis (GO:0001525)|cellular response to organic cyclic compound (GO:0071407)|cellular response to peptide (GO:1901653)|intestinal epithelial cell development (GO:0060576)|microvillus assembly (GO:0030033)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of microvillus assembly (GO:0032534)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		TAACACACATCAAGACAGAAC	0.527																																							uc001vje.2		NA																	0				large_intestine(1)|ovary(1)|pancreas(1)	3						c.(481-483)ATC>ATG		Kruppel-like factor 5							129.0	111.0	117.0					13																	73636220		2203	4300	6503	SO:0001583	missense	688				transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding	g.chr13:73636220C>G	D14520	CCDS9448.1, CCDS66562.1	13q21.3	2013-01-08			ENSG00000102554	ENSG00000102554		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6349	protein-coding gene	gene with protein product		602903		BTEB2		8479902, 9973612	Standard	NM_001730		Approved	IKLF, CKLF	uc001vje.3	Q13887	OTTHUMG00000017074	ENST00000377687.4:c.483C>G	13.37:g.73636220C>G	ENSP00000366915:p.Ile161Met					KLF5_uc001vjd.2_Missense_Mutation_p.I70M	p.I161M	NM_001730	NP_001721	Q13887	KLF5_HUMAN		GBM - Glioblastoma multiforme(99;0.0011)	2	807	+		Prostate(6;0.00187)|Breast(118;0.0735)	161					L0R3U5|L0R4T9|Q9UHP8	Missense_Mutation	SNP	ENST00000377687.4	37	c.483C>G	CCDS9448.1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.662147	0.67700	.	.	ENSG00000102554	ENST00000539231;ENST00000377687;ENST00000545883	T;T	0.15834	2.67;2.39	5.95	5.09	0.68999	.	0.044743	0.85682	D	0.000000	T	0.40719	0.1128	M	0.65498	2.005	0.58432	D	0.999994	D	0.76494	0.999	D	0.68765	0.96	T	0.34104	-0.9842	10	0.72032	D	0.01	.	16.3935	0.83548	0.1327:0.8673:0.0:0.0	.	161	Q13887	KLF5_HUMAN	M	70;161;141	ENSP00000440407:I70M;ENSP00000366915:I161M	ENSP00000366915:I161M	I	+	3	3	KLF5	72534221	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	1.766000	0.38491	1.468000	0.48064	0.563000	0.77884	ATC		0.527	KLF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045263.1			8	91	0	0	0	0.00308	0	8	91				
ITGBL1	9358	broad.mit.edu	37	13	102250648	102250648	+	Splice_Site	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr13:102250648G>T	ENST00000376180.3	+	7	1233	c.1014G>T	c.(1012-1014)agG>agT	p.R338S	ITGBL1_ENST00000545560.2_Splice_Site_p.R197S|ITGBL1_ENST00000376162.3_Splice_Site_p.R245S	NM_001271756.1|NM_004791.1	NP_001258685.1|NP_004782.1	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat domains)	338	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)				breast(1)|large_intestine(6)|lung(16)|ovary(1)|prostate(4)|skin(3)	31	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GCTCTGGGAGGGGTAAGTGAG	0.498																																							uc001vpb.2		NA																	0				ovary(1)|skin(1)	2						c.(1012-1014)AGG>AGT		integrin, beta-like 1 (with EGF-like repeat							91.0	73.0	79.0					13																	102250648		2203	4300	6503	SO:0001630	splice_region_variant	9358				cell-matrix adhesion|integrin-mediated signaling pathway	extracellular region|integrin complex	binding|receptor activity	g.chr13:102250648G>T	AF072752	CCDS9499.1, CCDS61361.1, CCDS61362.1, CCDS73594.1	13q33	2008-07-18			ENSG00000198542	ENSG00000198542			6164	protein-coding gene	gene with protein product	"""ten integrin EGF-like repeat domains protein"", ""ITGBL1, integrin beta-like 1"""	604234				10051402	Standard	NM_004791		Approved	TIED, OSCP	uc001vpb.4	O95965	OTTHUMG00000017296	ENST00000376180.3:c.1015+1G>T	13.37:g.102250648G>T						ITGBL1_uc010agb.2_Missense_Mutation_p.R289S|ITGBL1_uc001vpc.3_Missense_Mutation_p.R197S	p.R338S	NM_004791	NP_004782	O95965	ITGBL_HUMAN			7	1233	+	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		338			VII.|Cysteine-rich tandem repeats.		A8K5M5|B3KTP1|B4DQ02|Q8N172|Q9NPR0	Missense_Mutation	SNP	ENST00000376180.3	37	c.1014G>T	CCDS9499.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.436731	0.83885	.	.	ENSG00000198542	ENST00000376180;ENST00000537118;ENST00000539955;ENST00000545560;ENST00000376162	D;D;D	0.97642	-4.47;-4.47;-4.47	5.42	4.45	0.53987	EGF, extracellular (1);	0.000000	0.85682	D	0.000000	D	0.98112	0.9377	M	0.91612	3.225	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.965	D	0.97620	1.0135	10	0.52906	T	0.07	.	3.5236	0.07751	0.3634:0.0:0.6365:0.0	.	197;338	B3KTP1;O95965	.;ITGBL_HUMAN	S	338;246;197;197;245	ENSP00000365351:R338S;ENSP00000439903:R197S;ENSP00000365332:R245S	ENSP00000365332:R245S	R	+	3	2	ITGBL1	101048649	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.249000	0.58766	2.528000	0.85240	0.655000	0.94253	AGG		0.498	ITGBL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045669.2	NM_004791	Missense_Mutation	14	15	1	0	4.3838e-07	0.001855	4.78559e-07	14	15				
IRS2	8660	broad.mit.edu	37	13	110435157	110435157	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr13:110435157T>G	ENST00000375856.3	-	1	3758	c.3244A>C	c.(3244-3246)Acc>Ccc	p.T1082P		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	1082					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			TGCGGCGGGGTGGCGGCCACA	0.701																																					Melanoma(100;613 2409 40847)	Melanoma(100;613 2409 40847)	uc001vqv.2		NA																	0				large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|skin(1)|ovary(1)|kidney(1)	8						c.(3244-3246)ACC>CCC		insulin receptor substrate 2							7.0	8.0	8.0					13																	110435157		2060	4165	6225	SO:0001583	missense	8660				fibroblast growth factor receptor signaling pathway|glucose metabolic process|insulin receptor signaling pathway|lipid homeostasis|negative regulation of B cell apoptosis|negative regulation of kinase activity|negative regulation of plasma membrane long-chain fatty acid transport|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of B cell proliferation|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|response to glucose stimulus	cytosol|plasma membrane	insulin receptor binding|signal transducer activity	g.chr13:110435157T>G	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.3244A>C	13.37:g.110435157T>G	ENSP00000365016:p.Thr1082Pro						p.T1082P	NM_003749	NP_003740	Q9Y4H2	IRS2_HUMAN	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)		1	3758	-	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	1082					Q96RR2|Q9BZG0|Q9Y6I5	Missense_Mutation	SNP	ENST00000375856.3	37	c.3244A>C	CCDS9510.1	.	.	.	.	.	.	.	.	.	.	T	12.22	1.872728	0.33069	.	.	ENSG00000185950	ENST00000375856	T	0.50277	0.75	3.92	3.92	0.45320	.	0.580066	0.16961	U	0.192503	T	0.42944	0.1225	L	0.60455	1.87	0.37636	D	0.921841	B	0.12630	0.006	B	0.13407	0.009	T	0.50118	-0.8865	10	0.62326	D	0.03	-28.9797	8.6035	0.33758	0.0:0.0922:0.0:0.9078	.	1082	Q9Y4H2	IRS2_HUMAN	P	1082	ENSP00000365016:T1082P	ENSP00000365016:T1082P	T	-	1	0	IRS2	109233158	0.999000	0.42202	1.000000	0.80357	0.574000	0.36063	1.794000	0.38774	1.658000	0.50742	0.524000	0.50904	ACC		0.701	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045755.1	NM_003749		3	4	0	0	0	0.001984	0	3	4				
OR11G2	390439	broad.mit.edu	37	14	20665870	20665870	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:20665870G>C	ENST00000357366.3	+	1	376	c.376G>C	c.(376-378)Gac>Cac	p.D126H		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		CTTCCTCTCTGACACCAAGAT	0.498																																							uc010tlb.1		NA																	0				ovary(1)|skin(1)	2						c.(376-378)GAC>CAC		olfactory receptor, family 11, subfamily G,							75.0	65.0	68.0					14																	20665870		2203	4300	6503	SO:0001583	missense	390439				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20665870G>C		CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.376G>C	14.37:g.20665870G>C	ENSP00000349930:p.Asp126His						p.D126H	NM_001005503	NP_001005503	Q8NGC1	O11G2_HUMAN	Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)	1	376	+	all_cancers(95;0.00108)		126			Extracellular (Potential).		Q6IF09|Q96R33	Missense_Mutation	SNP	ENST00000357366.3	37	c.376G>C	CCDS32032.1	.	.	.	.	.	.	.	.	.	.	g	11.55	1.673390	0.29693	.	.	ENSG00000196832	ENST00000357366	T	0.01347	4.99	4.67	3.69	0.42338	GPCR, rhodopsin-like superfamily (1);	0.653970	0.13335	N	0.395625	T	0.02230	0.0069	N	0.11724	0.165	0.25095	N	0.990828	P	0.48016	0.904	P	0.54924	0.764	T	0.57294	-0.7836	10	0.49607	T	0.09	.	11.8774	0.52554	0.101:0.0:0.899:0.0	.	126	Q8NGC1	O11G2_HUMAN	H	126	ENSP00000349930:D126H	ENSP00000349930:D126H	D	+	1	0	OR11G2	19735710	0.032000	0.19561	1.000000	0.80357	0.974000	0.67602	2.139000	0.42149	2.414000	0.81942	0.650000	0.86243	GAC		0.498	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395722.1			12	49	0	0	0	0.010729	0	12	49				
OR4E2	26686	broad.mit.edu	37	14	22133623	22133623	+	Silent	SNP	T	T	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:22133623T>C	ENST00000408935.1	+	1	327	c.327T>C	c.(325-327)tgT>tgC	p.C109C		NM_001001912.1	NP_001001912.1	Q8NGC2	OR4E2_HUMAN	olfactory receptor, family 4, subfamily E, member 2	109						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0137)		TCTTTGCCTGTGCCGAGATCT	0.453																																							uc010tmd.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(325-327)TGT>TGC		olfactory receptor, family 4, subfamily E,							233.0	215.0	221.0					14																	22133623		2041	4209	6250	SO:0001819	synonymous_variant	26686				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:22133623T>C		CCDS41916.1	14q11.2	2013-09-23			ENSG00000221977	ENSG00000221977		"""GPCR / Class A : Olfactory receptors"""	8297	protein-coding gene	gene with protein product							Standard	NM_001001912		Approved		uc010tmd.2	Q8NGC2	OTTHUMG00000168979	ENST00000408935.1:c.327T>C	14.37:g.22133623T>C							p.C109C	NM_001001912	NP_001001912	Q8NGC2	OR4E2_HUMAN		GBM - Glioblastoma multiforme(265;0.0137)	1	327	+	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)	109			Helical; Name=3; (Potential).		Q6IET6|Q96R62	Silent	SNP	ENST00000408935.1	37	c.327T>C	CCDS41916.1																																																																																				0.453	OR4E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401874.1			8	211	0	0	0	0.00308	0	8	211				
EFS	10278	broad.mit.edu	37	14	23828666	23828666	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:23828666G>T	ENST00000216733.3	-	4	1628	c.1021C>A	c.(1021-1023)Cca>Aca	p.P341T	EFS_ENST00000429593.2_Missense_Mutation_p.P172T|EFS_ENST00000351354.3_Missense_Mutation_p.P248T|RP11-124D2.3_ENST00000554010.1_RNA	NM_005864.2	NP_005855.1	O43281	EFS_HUMAN	embryonal Fyn-associated substrate	341	Pro-rich.				cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)	16	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		AGGCGGGGTGGGGGTGGGGGC	0.701																																							uc001wjo.2		NA																	0				large_intestine(1)	1						c.(1021-1023)CCA>ACA		embryonal Fyn-associated substrate isoform 1							31.0	32.0	32.0					14																	23828666		1965	3856	5821	SO:0001583	missense	10278				cell adhesion|intracellular signal transduction	cytoplasm	SH3 domain binding	g.chr14:23828666G>T	AB001466	CCDS9595.1, CCDS9596.1, CCDS61404.1	14q11.2-q12	2011-04-13			ENSG00000100842	ENSG00000100842		"""Cas scaffolding proteins"""	16898	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 3"""	609906				9349509	Standard	NM_005864		Approved	EFS2, EFS1, HEFS, SIN, CASS3	uc001wjo.4	O43281	OTTHUMG00000028741	ENST00000216733.3:c.1021C>A	14.37:g.23828666G>T	ENSP00000216733:p.Pro341Thr					EFS_uc001wjp.2_Missense_Mutation_p.P248T|EFS_uc010tnm.1_Missense_Mutation_p.P172T	p.P341T	NM_005864	NP_005855	O43281	EFS_HUMAN		GBM - Glioblastoma multiforme(265;0.00649)	4	1629	-	all_cancers(95;7.12e-06)		341			SH3-binding (Potential).|Pro-rich.		B2RAJ7|B4DJ56|E9PGU2|O43282	Missense_Mutation	SNP	ENST00000216733.3	37	c.1021C>A	CCDS9595.1	.	.	.	.	.	.	.	.	.	.	G	16.89	3.248238	0.59103	.	.	ENSG00000100842	ENST00000216733;ENST00000351354;ENST00000429593	T;T;T	0.69175	-0.38;0.38;0.53	4.91	4.91	0.64330	.	0.463226	0.21392	N	0.075281	T	0.74397	0.3711	L	0.32530	0.975	0.51012	D	0.999909	D;D;P	0.89917	1.0;0.992;0.877	D;P;B	0.83275	0.996;0.755;0.255	T	0.74592	-0.3614	10	0.46703	T	0.11	-9.4156	17.0344	0.86470	0.0:0.0:1.0:0.0	.	172;248;341	B4DJ56;O43281-2;O43281	.;.;EFS_HUMAN	T	341;248;172	ENSP00000216733:P341T;ENSP00000340607:P248T;ENSP00000416684:P172T	ENSP00000216733:P341T	P	-	1	0	EFS	22898506	1.000000	0.71417	0.998000	0.56505	0.841000	0.47740	5.424000	0.66464	2.557000	0.86248	0.655000	0.94253	CCA		0.701	EFS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071770.2			35	20	1	0	6.05902e-23	0.003755	7.42898e-23	35	20				
BNIP3P1	319138	broad.mit.edu	37	14	28733949	28733949	+	RNA	SNP	T	T	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:28733949T>A	ENST00000550043.1	+	0	354									BCL2/adenovirus E1B 19kDa interacting protein 3 pseudogene 1																		GAGTTCTCACTGTGACAGCCC	0.478																																							uc001wqd.2		NA																	0					NA						c.(190-192)TGT>AGT		SubName: Full=cDNA FLJ60537, highly similar to BCL2/adenovirus E1B 19 kDa protein-interacting protein 3;																																						0							g.chr14:28733949T>A			14q12	2014-02-04	2011-03-18	2011-03-18	ENSG00000197358	ENSG00000197358			19922	pseudogene	pseudogene			"""BCL2/adenovirus E1B 19kDa interacting protein 3 pseudogene"""	BNIP3P			Standard	NG_002516		Approved				OTTHUMG00000170378		14.37:g.28733949T>A							p.C64S							1	330	+									Missense_Mutation	SNP	ENST00000550043.1	37	c.190T>A																																																																																					0.478	BNIP3P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000408770.1			40	29	0	0	0	0.011902	0	40	29				
HECTD1	25831	broad.mit.edu	37	14	31597041	31597041	+	Nonsense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:31597041G>C	ENST00000399332.1	-	26	5419	c.4931C>G	c.(4930-4932)tCa>tGa	p.S1644*	HECTD1_ENST00000553700.1_Nonsense_Mutation_p.S1644*	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1644	Ser-rich.				neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		ACTGGAAGTTGATGTGAGGCT	0.363																																							uc001wrc.1		NA																	0				ovary(3)|large_intestine(1)|lung(1)	5						c.(4930-4932)TCA>TGA		HECT domain containing 1							153.0	141.0	145.0					14																	31597041		1923	4138	6061	SO:0001587	stop_gained	25831				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity	g.chr14:31597041G>C	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.4931C>G	14.37:g.31597041G>C	ENSP00000382269:p.Ser1644*					HECTD1_uc001wrb.1_Translation_Start_Site|HECTD1_uc001wrd.1_Nonsense_Mutation_p.S1112*	p.S1644*	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)	26	5420	-	Hepatocellular(127;0.0877)|Breast(36;0.176)		1644			Ser-rich.		D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Nonsense_Mutation	SNP	ENST00000399332.1	37	c.4931C>G	CCDS41939.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.21|18.21	3.573701|3.573701	0.65765|0.65765	.|.	.|.	ENSG00000092148|ENSG00000092148	ENST00000554882|ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957	.|.	.|.	.|.	6.04|6.04	6.04|6.04	0.98038|0.98038	.|.	.|0.000000	.|0.64402	.|U	.|0.000003	T|.	0.82125|.	0.4969|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.81747|.	-0.0791|.	3|.	.|0.56958	.|D	.|0.05	-9.9497|-9.9497	20.5792|20.5792	0.99380|0.99380	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	E|X	12|1644;1646;1644;1071	.|.	.|ENSP00000261312:S1646X	Q|S	-|-	1|2	0|0	HECTD1|HECTD1	30666792|30666792	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	9.845000|9.845000	0.99498|0.99498	2.873000|2.873000	0.98535|0.98535	0.561000|0.561000	0.74099|0.74099	CAA|TCA		0.363	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1			34	146	0	0	0	0.006999	0	34	146				
ARHGAP5	394	broad.mit.edu	37	14	32624150	32624150	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:32624150T>C	ENST00000345122.3	+	7	4820	c.4505T>C	c.(4504-4506)aTa>aCa	p.I1502T	ARHGAP5_ENST00000433497.1_Missense_Mutation_p.I241T|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.I1501T|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.I1501T|ARHGAP5_ENST00000396582.2_Missense_Mutation_p.I237T|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.I1502T	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	1502					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		CTTGGTATTATATGAGTAGGA	0.433																																					NSCLC(9;77 350 3443 29227 41353)	NSCLC(9;77 350 3443 29227 41353)	uc001wrl.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(4504-4506)ATA>ACA		Rho GTPase activating protein 5 isoform b							40.0	37.0	38.0					14																	32624150		2203	4290	6493	SO:0001583	missense	394				cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding	g.chr14:32624150T>C	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.4505T>C	14.37:g.32624150T>C	ENSP00000371897:p.Ile1502Thr					ARHGAP5_uc001wrm.2_Missense_Mutation_p.I1501T|ARHGAP5_uc001wrn.2_Missense_Mutation_p.I1502T|ARHGAP5_uc001wro.2_Missense_Mutation_p.I241T|ARHGAP5_uc001wrp.2_Missense_Mutation_p.I237T	p.I1502T	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)	7	4744	+	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		1502					A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	ENST00000345122.3	37	c.4505T>C	CCDS32062.1	.	.	.	.	.	.	.	.	.	.	T	15.97	2.991046	0.54041	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000396582;ENST00000345122;ENST00000432921;ENST00000433497	T;T;T;T;T;T	0.09911	2.93;2.93;3.42;2.93;2.93;2.93	5.0	5.0	0.66597	.	0.000000	0.64402	D	0.000002	T	0.08358	0.0208	N	0.14661	0.345	0.36262	D	0.854582	P;P;B	0.40476	0.718;0.557;0.421	B;B;B	0.38616	0.277;0.158;0.076	T	0.26395	-1.0104	10	0.87932	D	0	.	15.0426	0.71803	0.0:0.0:0.0:1.0	.	237;1501;1502	Q13017-3;Q13017-2;Q13017	.;.;RHG05_HUMAN	T	1501;1502;237;1502;1501;241	ENSP00000452222:I1501T;ENSP00000441692:I1502T;ENSP00000379827:I237T;ENSP00000371897:I1502T;ENSP00000393307:I1501T;ENSP00000407395:I241T	ENSP00000371897:I1502T	I	+	2	0	ARHGAP5	31693901	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.995000	0.70631	2.028000	0.59812	0.524000	0.50904	ATA		0.433	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055		61	52	0	0	0	0.01441	0	61	52				
PAX9	5083	broad.mit.edu	37	14	37132112	37132112	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:37132112C>A	ENST00000361487.6	+	2	240	c.15C>A	c.(13-15)ttC>ttA	p.F5L	PAX9_ENST00000554201.1_5'UTR|PAX9_ENST00000402703.2_Missense_Mutation_p.F5L			P55771	PAX9_HUMAN	paired box 9	5	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				cellular response to growth factor stimulus (GO:0071363)|endoderm development (GO:0007492)|face morphogenesis (GO:0060325)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|regulation of odontogenesis (GO:0042481)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.F5F(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(3)	12	Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.218)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.00998)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0181)		AGCCAGCCTTCGGGGAGGTGA	0.662																																							uc001wty.3		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(13-15)TTC>TTA		paired box 9							41.0	45.0	44.0					14																	37132112		2195	4283	6478	SO:0001583	missense	5083				multicellular organismal development|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding	g.chr14:37132112C>A	AJ238381	CCDS9662.1	14q13.3	2007-07-12	2007-07-12		ENSG00000198807	ENSG00000198807		"""Paired boxes"""	8623	protein-coding gene	gene with protein product		167416	"""paired box gene 9"""			7981748	Standard	NM_006194		Approved		uc001wty.4	P55771	OTTHUMG00000140251	ENST00000361487.6:c.15C>A	14.37:g.37132112C>A	ENSP00000355245:p.Phe5Leu						p.F5L	NM_006194	NP_006185	P55771	PAX9_HUMAN	Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.00998)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0181)	3	732	+	Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.218)		5			Paired.		Q99582|Q9UQR4	Missense_Mutation	SNP	ENST00000361487.6	37	c.15C>A	CCDS9662.1	.	.	.	.	.	.	.	.	.	.	C	18.74	3.688482	0.68271	.	.	ENSG00000198807	ENST00000402703;ENST00000361487	D;D	0.99292	-5.7;-5.7	4.89	0.658	0.17855	Paired box protein, N-terminal (3);Homeodomain-like (1);	0.090271	0.85682	D	0.000000	D	0.97676	0.9238	N	0.03608	-0.345	0.53688	D	0.999974	D	0.69078	0.997	D	0.79784	0.993	D	0.95633	0.8691	10	0.59425	D	0.04	.	11.9443	0.52920	0.0:0.8052:0.0:0.1948	.	5	P55771	PAX9_HUMAN	L	5	ENSP00000384817:F5L;ENSP00000355245:F5L	ENSP00000355245:F5L	F	+	3	2	PAX9	36201863	0.925000	0.31364	0.997000	0.53966	0.989000	0.77384	0.069000	0.14552	-0.184000	0.10567	0.555000	0.69702	TTC		0.662	PAX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276733.2			20	127	1	0	1.55795e-14	0.012319	1.82627e-14	20	127				
FOXA1	3169	broad.mit.edu	37	14	38060627	38060627	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:38060627G>A	ENST00000250448.2	-	2	1423	c.1362C>T	c.(1360-1362)gcC>gcT	p.A454A	FOXA1_ENST00000540786.1_Silent_p.A421A|FOXA1_ENST00000545425.2_5'UTR	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	454					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		CCGGCTCCAGGGCTGAGGGCT	0.617																																							uc001wuf.2		NA																	0					0						c.(1360-1362)GCC>GCT		forkhead box A1							59.0	64.0	63.0					14																	38060627		2203	4300	6503	SO:0001819	synonymous_variant	3169				chromatin remodeling|embryo development|epithelial cell maturation involved in prostate gland development|epithelial tube branching involved in lung morphogenesis|epithelial-mesenchymal signaling involved in prostate gland development|glucose homeostasis|lung epithelial cell differentiation|negative regulation of survival gene product expression|neuron fate specification|pattern specification process|positive regulation of estrogen receptor signaling pathway|positive regulation of mitotic cell cycle|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|prostate gland epithelium morphogenesis|prostate gland stromal morphogenesis|response to estradiol stimulus|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding	g.chr14:38060627G>A	U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.1362C>T	14.37:g.38060627G>A						FOXA1_uc010tpz.1_Silent_p.A421A	p.A454A	NM_004496	NP_004487	P55317	FOXA1_HUMAN	Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)	2	1674	-	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		454					B2R9H6|B7ZAP5|Q9H2A0	Silent	SNP	ENST00000250448.2	37	c.1362C>T	CCDS9665.1																																																																																				0.617	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276735.1			14	128	0	0	0	0.003163	0	14	128				
FAM179B	23116	broad.mit.edu	37	14	45431916	45431916	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:45431916C>G	ENST00000361577.3	+	1	506	c.292C>G	c.(292-294)Cgg>Ggg	p.R98G	KLHL28_ENST00000355081.2_5'Flank|FAM179B_ENST00000361462.2_Missense_Mutation_p.R98G|KLHL28_ENST00000553817.1_5'Flank|KLHL28_ENST00000396128.4_5'Flank|FAM179B_ENST00000382233.2_Missense_Mutation_p.R98G	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	98										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						AGAGGACACTCGGCTCCTTCA	0.642																																							uc001wvv.2		NA																	0				skin(2)|upper_aerodigestive_tract(1)	3						c.(292-294)CGG>GGG		hypothetical protein LOC23116							54.0	56.0	55.0					14																	45431916		2203	4300	6503	SO:0001583	missense	23116						binding	g.chr14:45431916C>G	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.292C>G	14.37:g.45431916C>G	ENSP00000355045:p.Arg98Gly					FAM179B_uc001wvw.2_Missense_Mutation_p.R98G|FAM179B_uc010anc.2_RNA|KLHL28_uc001wvq.2_5'Flank|KLHL28_uc001wvr.2_5'Flank|FAM179B_uc010anb.1_Missense_Mutation_p.R98G|FAM179B_uc001wvu.2_Missense_Mutation_p.R98G	p.R98G	NM_015091	NP_055906	Q9Y4F4	F179B_HUMAN			1	501	+			98					Q68D66|Q6PG27	Missense_Mutation	SNP	ENST00000361577.3	37	c.292C>G	CCDS9681.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.651781	0.47362	.	.	ENSG00000198718	ENST00000429476;ENST00000361577;ENST00000361462;ENST00000382233	T;T;T	0.51817	0.69;0.69;0.69	4.88	2.99	0.34606	.	0.000000	0.42294	D	0.000739	T	0.50905	0.1643	N	0.24115	0.695	0.29593	N	0.848288	D;D;D;D	0.69078	0.997;0.997;0.997;0.997	D;D;D;D	0.75484	0.986;0.986;0.986;0.986	T	0.50276	-0.8847	10	0.87932	D	0	-7.9742	9.8668	0.41148	0.3729:0.6271:0.0:0.0	.	98;98;98;98	Q9Y4F4-3;G3XAE9;Q9Y4F4;Q9Y4F4-2	.;.;F179B_HUMAN;.	G	98	ENSP00000355045:R98G;ENSP00000354917:R98G;ENSP00000371668:R98G	ENSP00000354917:R98G	R	+	1	2	FAM179B	44501666	1.000000	0.71417	0.984000	0.44739	0.933000	0.57130	1.926000	0.40084	0.603000	0.29913	0.655000	0.94253	CGG		0.642	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781		7	116	0	0	0	0.001984	0	7	116				
TRIM9	114088	broad.mit.edu	37	14	51467560	51467560	+	Splice_Site	SNP	T	T	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:51467560T>C	ENST00000298355.3	-	6	2428		c.e6-2		TRIM9_ENST00000338969.5_Intron|TRIM9_ENST00000360392.4_Splice_Site	NM_015163.5	NP_055978.4	Q9C026	TRIM9_HUMAN	tripartite motif containing 9						negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of SNARE complex assembly (GO:0035544)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|synaptic vesicle (GO:0008021)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_epithelial(31;0.00418)|Breast(41;0.148)					GAGAGGAAGCTAAACAGAAAT	0.473																																							uc001wyx.3		NA																	0				skin(2)|lung(1)	3						c.e6-1		tripartite motif protein 9 isoform 1							122.0	116.0	118.0					14																	51467560		2203	4300	6503	SO:0001630	splice_region_variant	114088				proteasomal ubiquitin-dependent protein catabolic process	cell junction|cytoskeleton|dendrite|synaptic vesicle	protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr14:51467560T>C	AF220036	CCDS9703.1, CCDS45105.1	14q21.3	2013-02-11	2011-01-25		ENSG00000100505	ENSG00000100505		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16288	protein-coding gene	gene with protein product		606555	"""tripartite motif-containing 9"""			11331580, 11524423	Standard	NM_015163		Approved	SPRING, RNF91	uc001wyx.4	Q9C026	OTTHUMG00000140291	ENST00000298355.3:c.1307-2A>G	14.37:g.51467560T>C						TRIM9_uc001wyy.2_Intron|TRIM9_uc001wyz.3_Splice_Site_p.A436_splice	p.A436_splice	NM_015163	NP_055978	Q9C026	TRIM9_HUMAN			6	2072	-	all_epithelial(31;0.00418)|Breast(41;0.148)							D3DSB7|D3DSB8|Q92557|Q96D24|Q96NI4|Q9C025|Q9C027	Splice_Site	SNP	ENST00000298355.3	37	c.1307_splice	CCDS9703.1	.	.	.	.	.	.	.	.	.	.	T	18.47	3.631544	0.67015	.	.	ENSG00000100505	ENST00000298355;ENST00000360392	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0275	0.71680	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRIM9	50537310	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.621000	0.61233	2.149000	0.67028	0.482000	0.46254	.		0.473	TRIM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276874.1	NM_015163	Intron	7	56	0	0	0	0.004482	0	7	56				
FBXO34	55030	broad.mit.edu	37	14	55817174	55817174	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:55817174G>A	ENST00000313833.4	+	2	311	c.66G>A	c.(64-66)acG>acA	p.T22T	FBXO34_ENST00000555087.1_3'UTR|FBXO34_ENST00000440021.1_Silent_p.T22T	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	22										breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						GCAGGGAAACGCAGAGAACTC	0.448																																							uc001xbu.2		NA																	0				ovary(2)|lung(2)|skin(1)	5						c.(64-66)ACG>ACA		F-box only protein 34							82.0	77.0	79.0					14																	55817174		2203	4300	6503	SO:0001819	synonymous_variant	55030							g.chr14:55817174G>A	AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.66G>A	14.37:g.55817174G>A						FBXO34_uc001xbv.2_5'Flank|FBXO34_uc010aoo.2_Silent_p.T22T	p.T22T	NM_017943	NP_060413	Q9NWN3	FBX34_HUMAN			2	311	+			22					Q2VPB5|Q4VBP5|Q86TY4	Silent	SNP	ENST00000313833.4	37	c.66G>A	CCDS32086.1																																																																																				0.448	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411322.1			6	64	0	0	0	0.001168	0	6	64				
ZFYVE26	23503	broad.mit.edu	37	14	68273273	68273273	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:68273273C>G	ENST00000347230.4	-	6	1144	c.1006G>C	c.(1006-1008)Gag>Cag	p.E336Q	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.E336Q	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	336					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		AGAATCTGCTCGAGGAAGTGT	0.498																																							uc001xka.2		NA																	0				ovary(9)|breast(2)	11						c.(1006-1008)GAG>CAG		zinc finger, FYVE domain containing 26							103.0	96.0	98.0					14																	68273273		2203	4300	6503	SO:0001583	missense	23503				cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding	g.chr14:68273273C>G	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.1006G>C	14.37:g.68273273C>G	ENSP00000251119:p.Glu336Gln					ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Missense_Mutation_p.E336Q|ZFYVE26_uc010tta.1_Missense_Mutation_p.E336Q	p.E336Q	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN		all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)	6	1145	-			336					B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	c.1006G>C	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	C	30	5.050427	0.93740	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.65364	0.05;-0.15	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.79627	0.4478	M	0.66939	2.045	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.79978	-0.1575	10	0.87932	D	0	-21.5084	20.2187	0.98312	0.0:1.0:0.0:0.0	.	336;336;336	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	Q	336;315;336	ENSP00000251119:E336Q;ENSP00000450603:E336Q	ENSP00000251119:E336Q	E	-	1	0	ZFYVE26	67343026	1.000000	0.71417	0.969000	0.41365	0.891000	0.51852	7.245000	0.78237	2.780000	0.95670	0.655000	0.94253	GAG		0.498	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346		15	31	0	0	0	0.00245	0	15	31				
ESRRB	2103	broad.mit.edu	37	14	76906018	76906018	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:76906018G>T	ENST00000509242.1	+	3	420	c.322G>T	c.(322-324)Gac>Tac	p.D108Y	ESRRB_ENST00000380887.2_Missense_Mutation_p.D108Y|ESRRB_ENST00000556177.1_Missense_Mutation_p.D108Y|ESRRB_ENST00000261532.7_Missense_Mutation_p.D108Y|ESRRB_ENST00000507951.1_3'UTR	NM_004452.3	NP_004443.3	O95718	ERR2_HUMAN	estrogen-related receptor beta	108					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|trophectodermal cell proliferation (GO:0001834)|trophectodermal cellular morphogenesis (GO:0001831)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(234;0.0213)		CGTGTGCGGGGACATTGCCTC	0.617																																							uc001xsq.1		NA																	0				ovary(1)|skin(1)	2						c.(322-324)GAC>TAC		estrogen-related receptor beta							59.0	54.0	55.0					14																	76906018		2203	4300	6503	SO:0001583	missense	2103					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding	g.chr14:76906018G>T	X51417	CCDS9850.1, CCDS9850.2	14q24.3	2013-01-16				ENSG00000119715		"""Nuclear hormone receptors"""	3473	protein-coding gene	gene with protein product		602167	"""deafness, autosomal recessive 35"""	ESRL2, DFNB35		3267207, 9344655, 18179891	Standard	NM_004452		Approved	ERR2, ERRbeta, NR3B2, ERRb	uc001xsr.3	O95718		ENST00000509242.1:c.322G>T	14.37:g.76906018G>T	ENSP00000422488:p.Asp108Tyr					ESRRB_uc001xsr.2_Missense_Mutation_p.D108Y|ESRRB_uc001xso.2_RNA	p.D108Y	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0213)	2	389	+			108					A2VDJ2|B6ZGU4|Q5F0P7|Q5F0P8|Q9HCB4	Missense_Mutation	SNP	ENST00000509242.1	37	c.322G>T	CCDS9850.2	.	.	.	.	.	.	.	.	.	.	G	26.0	4.693882	0.88735	.	.	ENSG00000119715	ENST00000512784;ENST00000509242;ENST00000556177;ENST00000380887;ENST00000261532	D;D;D;D;D	0.98474	-4.95;-4.95;-4.95;-4.95;-4.95	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	D	0.99221	0.9729	M	0.92219	3.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99215	1.0877	10	0.87932	D	0	.	18.5543	0.91077	0.0:0.0:1.0:0.0	.	108;113	Q5F0P7;E7EWD9	.;.	Y	113;108;108;108;108	ENSP00000424992:D113Y;ENSP00000422488:D108Y;ENSP00000451658:D108Y;ENSP00000370270:D108Y;ENSP00000261532:D108Y	ENSP00000261532:D108Y	D	+	1	0	ESRRB	75975771	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.818000	0.99354	2.377000	0.81083	0.655000	0.94253	GAC		0.617	ESRRB-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360663.1			25	9	1	0	1.64293e-13	0.00333	1.91245e-13	25	9				
ALKBH1	8846	broad.mit.edu	37	14	78161119	78161119	+	Missense_Mutation	SNP	C	C	G	rs371958188		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:78161119C>G	ENST00000216489.3	-	3	432	c.417G>C	c.(415-417)gaG>gaC	p.E139D	ALKBH1_ENST00000554097.1_5'UTR	NM_006020.2	NP_006011.2	Q13686	ALKB1_HUMAN	alkB, alkylation repair homolog 1 (E. coli)	139					developmental growth (GO:0048589)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|in utero embryonic development (GO:0001701)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|oxidative demethylation (GO:0070989)|placenta development (GO:0001890)|RNA repair (GO:0042245)	mitochondrion (GO:0005739)|nuclear euchromatin (GO:0005719)	chemoattractant activity (GO:0042056)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)			endometrium(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		GATCTTGGGTCTCTTCTTTAG	0.428																																							uc001xuc.1		NA																	0				ovary(1)|skin(1)	2						c.(415-417)GAG>GAC		alkylated DNA repair protein alkB homolog		C	ASP/GLU	1,4405	2.1+/-5.4	0,1,2202	203.0	198.0	200.0		417	3.3	1.0	14		200	0,8600		0,0,4300	no	missense	ALKBH1	NM_006020.2	45	0,1,6502	GG,GC,CC		0.0,0.0227,0.0077	benign	139/390	78161119	1,13005	2203	4300	6503	SO:0001583	missense	8846				DNA dealkylation involved in DNA repair|DNA demethylation|oxidative demethylation|RNA repair	mitochondrion	DNA-(apurinic or apyrimidinic site) lyase activity|ferrous iron binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr14:78161119C>G	X91992	CCDS32127.1	14q24	2014-07-23	2006-02-09	2006-02-09	ENSG00000100601	ENSG00000100601		"""Alkylation repair homologs"""	17911	protein-coding gene	gene with protein product		605345	"""alkB, alkylation repair homolog (E. coli)"""	ALKBH		8600462	Standard	XM_005268165		Approved	hABH, alkB, ABH	uc001xuc.1	Q13686	OTTHUMG00000171542	ENST00000216489.3:c.417G>C	14.37:g.78161119C>G	ENSP00000216489:p.Glu139Asp					ALKBH1_uc001xud.1_Intron	p.E139D	NM_006020	NP_006011	Q13686	ALKB1_HUMAN	Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)	3	426	-			139					Q8TAU1|Q9ULA7	Missense_Mutation	SNP	ENST00000216489.3	37	c.417G>C	CCDS32127.1	.	.	.	.	.	.	.	.	.	.	C	10.45	1.354062	0.24512	2.27E-4	0.0	ENSG00000100601	ENST00000216489	T	0.32988	1.43	6.17	3.31	0.37934	.	0.320182	0.37577	N	0.002037	T	0.18299	0.0439	L	0.33792	1.035	0.35091	D	0.764318	B	0.15719	0.014	B	0.17098	0.017	T	0.18999	-1.0319	10	0.13108	T	0.6	-29.1934	5.2617	0.15578	0.1312:0.5943:0.0:0.2745	.	139	Q13686	ALKB1_HUMAN	D	139	ENSP00000216489:E139D	ENSP00000216489:E139D	E	-	3	2	ALKBH1	77230872	0.964000	0.33143	0.993000	0.49108	0.988000	0.76386	0.090000	0.15025	0.438000	0.26450	-0.123000	0.14984	GAG		0.428	ALKBH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414037.1	NM_006020		38	165	0	0	0	0.007835	0	38	165				
DIO2	1734	broad.mit.edu	37	14	80669079	80669079	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:80669079C>A	ENST00000557010.1	-	4	1160	c.775G>T	c.(775-777)Gag>Tag	p.E259*	DIO2_ENST00000557125.1_3'UTR|DIO2_ENST00000438257.4_Nonsense_Mutation_p.E259*|DIO2_ENST00000422005.3_3'UTR|DIO2_ENST00000555750.1_Nonsense_Mutation_p.E295*	NM_000793.5|NM_001242502.1|NM_001242503.1	NP_000784.2|NP_001229431.1|NP_001229432.1	Q92813	IOD2_HUMAN	deiodinase, iodothyronine, type II	259					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|selenocysteine incorporation (GO:0001514)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|thyroid hormone metabolic process (GO:0042403)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	selenium binding (GO:0008430)|thyroxine 5'-deiodinase activity (GO:0004800)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(14)|skin(1)|stomach(1)	25				BRCA - Breast invasive adenocarcinoma(234;0.0281)		AAATTCTTCTCCAGCCAATGC	0.398																																							uc010tvq.1		NA																	0				central_nervous_system(1)	1						c.(775-777)GAG>TAG		deiodinase, iodothyronine, type II isoform a							58.0	56.0	56.0					14																	80669079		1845	4096	5941	SO:0001587	stop_gained	1734				hormone biosynthetic process|selenocysteine incorporation|thyroid hormone generation	integral to membrane|plasma membrane	thyroxine 5'-deiodinase activity|ubiquitin protein ligase binding	g.chr14:80669079C>A	AF007144	CCDS45146.1, CCDS55934.1	14q24.2-q24.3	2014-05-02			ENSG00000211448	ENSG00000211448	1.97.1.10		2884	protein-coding gene	gene with protein product	"""thyroxine deiodinase, type II"", ""deiodonase-2"", ""deiodinase-2"""	601413				8755651, 10343107	Standard	NM_001007023		Approved	TXDI2, SelY	uc021rxb.1	Q92813	OTTHUMG00000171443	ENST00000557010.1:c.775G>T	14.37:g.80669079C>A	ENSP00000451419:p.Glu259*					DIO2_uc010tvp.1_Nonsense_Mutation_p.E295*|DIO2_uc001xut.2_RNA|DIO2_uc010asx.2_3'UTR|DIO2_uc010tvr.1_Nonsense_Mutation_p.E259*|DIO2_uc010asy.2_3'UTR	p.E259*	NM_000793	NP_000784	Q92813	IOD2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0281)	4	1177	-			259					B9EGK0|G3V315|Q6B0A3|Q9HCP8|Q9P1W4|Q9UDZ1	Nonsense_Mutation	SNP	ENST00000557010.1	37	c.775G>T	CCDS45146.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.748642	0.89753	.	.	ENSG00000211448	ENST00000438257;ENST00000557010;ENST00000555750	.	.	.	5.77	5.77	0.91146	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.9785	0.97317	0.0:1.0:0.0:0.0	.	.	.	.	X	259;259;295	.	ENSP00000405854:E259X	E	-	1	0	DIO2	79738832	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	2.724000	0.93272	0.650000	0.86243	GAG		0.398	DIO2-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000413428.2			15	10	1	0	8.60227e-14	0.004007	1.0031e-13	15	10				
BTBD7	55727	broad.mit.edu	37	14	93720129	93720129	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:93720129C>G	ENST00000334746.5	-	7	1923	c.1616G>C	c.(1615-1617)aGa>aCa	p.R539T	BTBD7_ENST00000393170.2_Missense_Mutation_p.R113T|BTBD7_ENST00000554565.1_Missense_Mutation_p.R188T	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	539					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		AATCAAGCCTCTTTTCATCta	0.289																																							uc001ybo.2		NA																	0				pancreas(1)	1						c.(1615-1617)AGA>ACA		BTB (POZ) domain containing 7 isoform 1							77.0	73.0	74.0					14																	93720129		2203	4300	6503	SO:0001583	missense	55727							g.chr14:93720129C>G	AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.1616G>C	14.37:g.93720129C>G	ENSP00000335615:p.Arg539Thr					BTBD7_uc010aur.2_Missense_Mutation_p.R64T|BTBD7_uc010two.1_Missense_Mutation_p.R359T|BTBD7_uc001ybp.2_Missense_Mutation_p.R188T	p.R539T	NM_001002860	NP_001002860	Q9P203	BTBD7_HUMAN		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)	7	1942	-		all_cancers(154;0.08)	539					A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Missense_Mutation	SNP	ENST00000334746.5	37	c.1616G>C	CCDS32146.1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.509208	0.44660	.	.	ENSG00000011114	ENST00000334746;ENST00000554565;ENST00000553975;ENST00000393170	T;T	0.61980	0.4;0.06	5.75	4.87	0.63330	.	0.085766	0.85682	D	0.000000	T	0.78861	0.4350	M	0.79123	2.44	0.80722	D	1	D;D;P	0.89917	1.0;0.977;0.455	D;P;B	0.74674	0.984;0.787;0.149	T	0.82118	-0.0615	10	0.87932	D	0	.	14.816	0.70034	0.0:0.9309:0.0:0.0691	.	113;188;539	E7ERI4;Q9P203-5;Q9P203	.;.;BTBD7_HUMAN	T	539;188;154;113	ENSP00000335615:R539T;ENSP00000451010:R188T	ENSP00000335615:R539T	R	-	2	0	BTBD7	92789882	1.000000	0.71417	1.000000	0.80357	0.086000	0.17979	7.463000	0.80869	1.432000	0.47375	-0.145000	0.13849	AGA		0.289	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412701.1	NM_001002860		8	41	0	0	0	0.00308	0	8	41				
OTUD7A	161725	broad.mit.edu	37	15	31776389	31776389	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr15:31776389T>A	ENST00000307050.4	-	11	1981	c.1889A>T	c.(1888-1890)cAg>cTg	p.Q630L	OTUD7A_ENST00000382902.1_Missense_Mutation_p.Q637L	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	630					protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		GCGCTCCCCCTGCATGGCGGC	0.682																																							uc001zfq.2		NA																	0				pancreas(1)|skin(1)	2						c.(1888-1890)CAG>CTG		OTU domain containing 7A							17.0	18.0	17.0					15																	31776389		2198	4289	6487	SO:0001583	missense	161725					cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding	g.chr15:31776389T>A	AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.1889A>T	15.37:g.31776389T>A	ENSP00000305926:p.Gln630Leu					OTUD7A_uc001zfr.2_Missense_Mutation_p.Q637L	p.Q630L	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)	11	1982	-		all_lung(180;1.6e-09)	630					Q8IWK5	Missense_Mutation	SNP	ENST00000307050.4	37	c.1889A>T	CCDS10026.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.195086	0.78902	.	.	ENSG00000169918	ENST00000307050;ENST00000382902	T;T	0.37058	1.23;1.22	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.39226	0.1070	L	0.47190	1.495	0.43936	D	0.996592	P;P	0.41848	0.763;0.651	P;B	0.44811	0.461;0.272	T	0.37911	-0.9685	10	0.87932	D	0	-27.7191	14.0325	0.64624	0.0:0.0:0.0:1.0	.	637;630	Q8TE49-2;Q8TE49	.;OTU7A_HUMAN	L	630;637	ENSP00000305926:Q630L;ENSP00000372358:Q637L	ENSP00000305926:Q630L	Q	-	2	0	OTUD7A	29563681	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.221000	0.78016	1.693000	0.51124	0.459000	0.35465	CAG		0.682	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251393.2	NM_130901		4	10	0	0	0	0.009096	0	4	10				
ARHGAP11A	9824	broad.mit.edu	37	15	32917434	32917434	+	Silent	SNP	A	A	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr15:32917434A>T	ENST00000361627.3	+	5	1427	c.705A>T	c.(703-705)gcA>gcT	p.A235A	ARHGAP11A_ENST00000543522.1_Silent_p.A46A|ARHGAP11A_ENST00000565905.1_Silent_p.A46A|ARHGAP11A_ENST00000567348.1_Silent_p.A235A|ARHGAP11A_ENST00000563864.1_Silent_p.A235A	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	235	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		TCGATTATGCATCAGATATTG	0.343																																					Colon(45;757 1134 30003 36652)	Colon(45;757 1134 30003 36652)	uc001zgy.1		NA																	0				skin(3)|breast(2)|urinary_tract(1)	6						c.(703-705)GCA>GCT		Rho GTPase activating protein 11A isoform 1							54.0	51.0	52.0					15																	32917434		2201	4298	6499	SO:0001819	synonymous_variant	9824				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr15:32917434A>T	D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.705A>T	15.37:g.32917434A>T						ARHGAP11A_uc010ubw.1_Silent_p.A46A|ARHGAP11A_uc001zgw.2_Silent_p.A235A|ARHGAP11A_uc001zgx.2_Silent_p.A235A|ARHGAP11A_uc010ubx.1_Silent_p.A46A	p.A235A	NM_014783	NP_055598	Q6P4F7	RHGBA_HUMAN		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	5	1427	+		all_lung(180;1.3e-11)	235			Rho-GAP.		B4DZN9|Q6PI96|Q9Y3S6	Silent	SNP	ENST00000361627.3	37	c.705A>T	CCDS10028.1																																																																																				0.343	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251417.1	NM_014783		8	19	0	0	0	0.00308	0	8	19				
RYR3	6263	broad.mit.edu	37	15	34018589	34018589	+	Silent	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr15:34018589C>A	ENST00000389232.4	+	46	6985	c.6915C>A	c.(6913-6915)ctC>ctA	p.L2305L	RYR3_ENST00000415757.3_Silent_p.L2305L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2305	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TCTTCCAGCTCATCCAGACAG	0.547																																							uc001zhi.2		NA																	0				ovary(5)|central_nervous_system(4)|lung(1)	10						c.(6913-6915)CTC>CTA		ryanodine receptor 3							43.0	45.0	44.0					15																	34018589		2012	4189	6201	SO:0001819	synonymous_variant	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:34018589C>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.6915C>A	15.37:g.34018589C>A						RYR3_uc010bar.2_Silent_p.L2305L	p.L2305L	NM_001036	NP_001027	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	46	6985	+		all_lung(180;7.18e-09)	2305			4 X approximate repeats.|Cytoplasmic (By similarity).		O15175|Q15412	Silent	SNP	ENST00000389232.4	37	c.6915C>A	CCDS45210.1																																																																																				0.547	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			6	12	1	0	0.00198382	0.001984	0.00205467	6	12				
PLCB2	5330	broad.mit.edu	37	15	40589781	40589781	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr15:40589781C>G	ENST00000260402.3	-	13	1513	c.1264G>C	c.(1264-1266)Gag>Cag	p.E422Q	PLCB2_ENST00000557821.1_Missense_Mutation_p.E422Q|PLCB2_ENST00000456256.2_Missense_Mutation_p.E422Q	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	422	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		CGGCAATACTCAGCCATCTTA	0.577																																							uc001zld.2		NA																	0				ovary(3)|breast(3)|kidney(1)|pancreas(1)	8						c.(1264-1266)GAG>CAG		phospholipase C, beta 2							47.0	48.0	48.0					15																	40589781		1919	4148	6067	SO:0001583	missense	5330				activation of phospholipase C activity|intracellular signal transduction|lipid catabolic process|phospholipid metabolic process|synaptic transmission	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr15:40589781C>G		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.1264G>C	15.37:g.40589781C>G	ENSP00000260402:p.Glu422Gln					PLCB2_uc010bbo.2_Missense_Mutation_p.E422Q|PLCB2_uc010ucm.1_Missense_Mutation_p.E422Q	p.E422Q	NM_004573	NP_004564	Q00722	PLCB2_HUMAN		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)	13	1565	-		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)	422			PI-PLC X-box.		A8K6J2|B9EGH5	Missense_Mutation	SNP	ENST00000260402.3	37	c.1264G>C	CCDS42020.1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.600445	0.66332	.	.	ENSG00000137841	ENST00000260402;ENST00000456256	T;T	0.64803	-0.12;-0.12	5.0	5.0	0.66597	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.100051	0.64402	D	0.000002	T	0.49167	0.1541	N	0.12746	0.255	0.80722	D	1	P;B;B	0.47604	0.898;0.049;0.183	B;B;B	0.42738	0.396;0.056;0.121	T	0.54516	-0.8282	10	0.42905	T	0.14	.	18.8532	0.92241	0.0:1.0:0.0:0.0	.	422;422;422	B9EGH5;Q00722-2;Q00722	.;.;PLCB2_HUMAN	Q	422	ENSP00000260402:E422Q;ENSP00000411991:E422Q	ENSP00000260402:E422Q	E	-	1	0	PLCB2	38377073	1.000000	0.71417	0.993000	0.49108	0.971000	0.66376	4.390000	0.59646	2.769000	0.95229	0.655000	0.94253	GAG		0.577	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1			10	26	0	0	0	0.006214	0	10	26				
PLA2G4F	255189	broad.mit.edu	37	15	42434260	42434260	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr15:42434260C>T	ENST00000382396.4	-	20	2558	c.2472G>A	c.(2470-2472)ctG>ctA	p.L824L	PLA2G4F_ENST00000397272.3_Silent_p.L826L			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	824	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		CCACGTTGTTCAGGACGTTGT	0.597																																							uc001zoz.2		NA																	0				ovary(4)	4						c.(2470-2472)CTG>CTA		phospholipase A2, group IVF							79.0	73.0	75.0					15																	42434260		2203	4299	6502	SO:0001819	synonymous_variant	255189				phospholipid catabolic process	cytosol|lysosomal membrane	metal ion binding|phospholipase A2 activity	g.chr15:42434260C>T		CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.2472G>A	15.37:g.42434260C>T						PLA2G4F_uc010bcq.2_Silent_p.L121L|PLA2G4F_uc001zoy.2_Silent_p.L456L|PLA2G4F_uc010bcr.2_Silent_p.L575L|PLA2G4F_uc001zpa.2_Silent_p.L575L|PLA2G4F_uc010bcs.2_Silent_p.L611L	p.L824L	NM_213600	NP_998765	Q68DD2	PA24F_HUMAN		GBM - Glioblastoma multiforme(94;8.97e-07)	20	2535	-		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)	824			PLA2c.		Q6ZMC8	Silent	SNP	ENST00000382396.4	37	c.2472G>A	CCDS32204.1																																																																																				0.597	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1	NM_213600		12	36	0	0	0	0.013537	0	12	36				
TP53BP1	7158	broad.mit.edu	37	15	43701917	43701917	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr15:43701917G>C	ENST00000263801.3	-	25	5565	c.5313C>G	c.(5311-5313)ttC>ttG	p.F1771L	TP53BP1_ENST00000382044.4_Missense_Mutation_p.F1776L|TP53BP1_ENST00000450115.2_Missense_Mutation_p.F1774L|TP53BP1_ENST00000382039.3_Missense_Mutation_p.F1726L	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1771	BRCT 1. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		ACTGCTTGTTGAAAGGAGGAA	0.363								Other conserved DNA damage response genes																															uc001zrs.2		NA																	0				ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7						c.(5311-5313)TTC>TTG	Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	tumor protein p53 binding protein 1 isoform 3							38.0	36.0	37.0					15																	43701917		2201	4298	6499	SO:0001583	missense	7158				double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity	g.chr15:43701917G>C	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.5313C>G	15.37:g.43701917G>C	ENSP00000263801:p.Phe1771Leu					TP53BP1_uc010udp.1_Missense_Mutation_p.F1769L|TP53BP1_uc001zrq.3_Missense_Mutation_p.F1774L|TP53BP1_uc001zrr.3_Missense_Mutation_p.F1776L|TP53BP1_uc001zrp.2_Missense_Mutation_p.F188L	p.F1771L	NM_005657	NP_005648	Q12888	TP53B_HUMAN		GBM - Glioblastoma multiforme(94;1.59e-06)	25	5461	-		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)	1771			BRCT 1.		F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	ENST00000263801.3	37	c.5313C>G	CCDS10096.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.79|15.79	2.938192|2.938192	0.52972|0.52972	.|.	.|.	ENSG00000067369|ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115|ENST00000434595	D;D;D;D|.	0.86230|.	-2.09;-2.09;-2.09;-2.09|.	5.43|5.43	5.43|5.43	0.79202|0.79202	BRCT (3);|.	0.056324|.	0.64402|.	D|.	0.000001|.	T|.	0.44095|.	0.1277|.	N|N	0.24115|0.24115	0.695|0.695	0.37499|0.37499	D|D	0.916686|0.916686	B;P;P|.	0.42785|.	0.451;0.79;0.587|.	B;P;B|.	0.47915|.	0.112;0.561;0.225|.	T|.	0.42766|.	-0.9432|.	10|.	0.39692|.	T|.	0.17|.	-10.949|-10.949	10.2169|10.2169	0.43173|0.43173	0.1521:0.0:0.8479:0.0|0.1521:0.0:0.8479:0.0	.|.	1771;1776;1774|.	Q12888;Q12888-2;F8VY86|.	TP53B_HUMAN;.;.|.	L|X	1771;1776;1726;1774|96	ENSP00000263801:F1771L;ENSP00000371475:F1776L;ENSP00000371470:F1726L;ENSP00000393497:F1774L|.	ENSP00000263801:F1771L|.	F|S	-|-	3|2	2|0	TP53BP1|TP53BP1	41489209|41489209	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	1.206000|1.206000	0.32321|0.32321	2.722000|2.722000	0.93159|0.93159	0.655000|0.655000	0.94253|0.94253	TTC|TCA		0.363	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3			4	11	0	0	0	0.009096	0	4	11				
SLC12A1	6557	broad.mit.edu	37	15	48551426	48551426	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr15:48551426C>A	ENST00000558405.1	+	16	2086	c.2072C>A	c.(2071-2073)cCc>cAc	p.P691H	SLC12A1_ENST00000396577.3_Missense_Mutation_p.P691H|SLC12A1_ENST00000380993.3_Missense_Mutation_p.P691H			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	691					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	ACAGGGGGACCCATGACAAGA	0.493																																							uc001zwn.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2071-2073)CCC>CAC		sodium potassium chloride cotransporter 2	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)						180.0	158.0	165.0					15																	48551426		2198	4297	6495	SO:0001583	missense	6557				potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity	g.chr15:48551426C>A		CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.2072C>A	15.37:g.48551426C>A	ENSP00000453409:p.Pro691His					SLC12A1_uc010uew.1_Missense_Mutation_p.P497H|SLC12A1_uc010bem.2_Missense_Mutation_p.P691H|SLC12A1_uc001zwq.3_Missense_Mutation_p.P462H|SLC12A1_uc001zwr.3_Missense_Mutation_p.P418H	p.P691H	NM_000338	NP_000329	Q13621	S12A1_HUMAN		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	17	2288	+		all_lung(180;0.00219)	691					A8JYA2|E9PDW4	Missense_Mutation	SNP	ENST00000558405.1	37	c.2072C>A	CCDS10129.2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.344974	0.82022	.	.	ENSG00000074803	ENST00000428362;ENST00000380993;ENST00000396577;ENST00000546071	D;D	0.87729	-2.29;-2.28	5.48	5.48	0.80851	.	0.157425	0.64402	D	0.000020	D	0.94515	0.8234	M	0.87827	2.91	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.74023	0.931;0.982	D	0.94878	0.8036	10	0.87932	D	0	.	19.7049	0.96069	0.0:1.0:0.0:0.0	.	691;691	E9PDW4;Q13621	.;S12A1_HUMAN	H	504;691;691;85	ENSP00000370381:P691H;ENSP00000379822:P691H	ENSP00000370381:P691H	P	+	2	0	SLC12A1	46338718	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.849000	0.62882	2.731000	0.93534	0.555000	0.69702	CCC		0.493	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417131.1			22	83	1	0	4.26978e-12	0.00333	4.90179e-12	22	83				
SCG3	29106	broad.mit.edu	37	15	51975452	51975452	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr15:51975452A>T	ENST00000220478.3	+	4	621	c.218A>T	c.(217-219)gAt>gTt	p.D73V	SCG3_ENST00000542355.2_5'UTR	NM_013243.3	NP_037375.2	Q8WXD2	SCG3_HUMAN	secretogranin III	73					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				all cancers(107;0.00488)		TCTTTTGTTGATAACTTGAAC	0.363																																							uc002abh.2		NA																	0				ovary(1)	1						c.(217-219)GAT>GTT		secretogranin III isoform 1 precursor							153.0	166.0	161.0					15																	51975452		2195	4293	6488	SO:0001583	missense	29106				platelet activation|platelet degranulation	extracellular region|stored secretory granule		g.chr15:51975452A>T	AF078851	CCDS10142.1, CCDS53947.1	15q21.2	2013-09-23			ENSG00000104112	ENSG00000104112			13707	protein-coding gene	gene with protein product		611796				2053134, 8825061	Standard	NM_013243		Approved	SGIII, FLJ90833	uc002abh.3	Q8WXD2	OTTHUMG00000131748	ENST00000220478.3:c.218A>T	15.37:g.51975452A>T	ENSP00000220478:p.Asp73Val					SCG3_uc010ufz.1_5'UTR	p.D73V	NM_013243	NP_037375	Q8WXD2	SCG3_HUMAN		all cancers(107;0.00488)	4	626	+			73					A8K2B0|B3KQP6|B4DK99|F5H3R8|Q96C83|Q96GE8|Q9Y6G7	Missense_Mutation	SNP	ENST00000220478.3	37	c.218A>T	CCDS10142.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.550272	0.86127	.	.	ENSG00000104112	ENST00000220478	T	0.28255	1.62	5.93	5.93	0.95920	.	0.093996	0.64402	D	0.000001	T	0.46132	0.1377	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	T	0.44467	-0.9326	10	0.87932	D	0	-2.9084	16.3797	0.83452	1.0:0.0:0.0:0.0	.	73	Q8WXD2	SCG3_HUMAN	V	73	ENSP00000220478:D73V	ENSP00000220478:D73V	D	+	2	0	SCG3	49762744	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.161000	0.71868	2.271000	0.75665	0.533000	0.62120	GAT		0.363	SCG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254670.2	NM_013243		65	102	0	0	0	0.01441	0	65	102				
PARP6	56965	broad.mit.edu	37	15	72554009	72554009	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr15:72554009C>G	ENST00000569795.1	-	9	1122	c.435G>C	c.(433-435)ctG>ctC	p.L145L	PARP6_ENST00000287196.9_Silent_p.L145L|PARP6_ENST00000260376.7_Silent_p.L145L|PARP6_ENST00000413097.2_5'UTR			Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6	145							NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	18						AATCATTGCTCAGATGTTTCC	0.458																																							uc002auc.2		NA																	0					0						c.(433-435)CTG>CTC		poly (ADP-ribose) polymerase family, member 6							331.0	312.0	318.0					15																	72554009		1932	4151	6083	SO:0001819	synonymous_variant	56965						NAD+ ADP-ribosyltransferase activity	g.chr15:72554009C>G	AL390093	CCDS10241.2	15q22	2010-02-16			ENSG00000137817	ENSG00000137817		"""Poly (ADP-ribose) polymerases"""	26921	protein-coding gene	gene with protein product						15273990	Standard	XM_005254557		Approved	pART17	uc002auc.3	Q2NL67	OTTHUMG00000133443	ENST00000569795.1:c.435G>C	15.37:g.72554009C>G						PARP6_uc002aua.2_Silent_p.L10L|PARP6_uc002aub.2_RNA|PARP6_uc002aud.3_RNA|PARP6_uc002auf.1_Silent_p.L145L	p.L145L	NM_020214	NP_064599	Q2NL67	PARP6_HUMAN			8	894	-			145					Q9H7C5|Q9H9X6|Q9HAF3|Q9NPS6|Q9UFG4	Silent	SNP	ENST00000569795.1	37	c.435G>C	CCDS10241.2																																																																																				0.458	PARP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257315.2	NM_020214		51	224	0	0	0	0.01441	0	51	224				
SIN3A	25942	broad.mit.edu	37	15	75687143	75687143	+	Missense_Mutation	SNP	C	C	T	rs151089140		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr15:75687143C>T	ENST00000394947.3	-	14	2469	c.2155G>A	c.(2155-2157)Gaa>Aaa	p.E719K	SIN3A_ENST00000394949.4_Missense_Mutation_p.E719K|SIN3A_ENST00000360439.4_Missense_Mutation_p.E719K	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						TCATTTTGTTCTCGCCATACT	0.438																																							uc002bai.2		NA																	0				skin(3)|ovary(1)|lung(1)	5						c.(2155-2157)GAA>AAA		transcriptional co-repressor Sin3A							218.0	204.0	209.0					15																	75687143		2197	4294	6491	SO:0001583	missense	25942				blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding	g.chr15:75687143C>T	AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.2155G>A	15.37:g.75687143C>T	ENSP00000378402:p.Glu719Lys					SIN3A_uc002baj.2_Missense_Mutation_p.E719K|SIN3A_uc010uml.1_Missense_Mutation_p.E719K	p.E719K	NM_015477	NP_056292	Q96ST3	SIN3A_HUMAN			14	2414	-			719			Interactions with HDAC1 and ARID4B.|Interaction with NCOR1 (By similarity).			Missense_Mutation	SNP	ENST00000394947.3	37	c.2155G>A	CCDS10279.1	.	.	.	.	.	.	.	.	.	.	C	36	5.969548	0.97156	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.54479	0.57;0.57;0.57	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.79287	0.4420	M	0.91768	3.24	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.82271	-0.0540	10	0.59425	D	0.04	-26.3876	19.218	0.93785	0.0:1.0:0.0:0.0	.	719	Q96ST3	SIN3A_HUMAN	K	719	ENSP00000378402:E719K;ENSP00000378403:E719K;ENSP00000353622:E719K	ENSP00000353622:E719K	E	-	1	0	SIN3A	73474196	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.771000	0.85420	2.859000	0.98148	0.591000	0.81541	GAA		0.438	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477		19	123	0	0	0	0.010504	0	19	123				
CSPG4	1464	broad.mit.edu	37	15	75968709	75968709	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr15:75968709C>A	ENST00000308508.5	-	10	6243	c.6151G>T	c.(6151-6153)Gca>Tca	p.A2051S	AC105020.1_ENST00000435356.1_5'Flank|CTD-2026K11.1_ENST00000569467.1_RNA	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	2051	Cysteine-containing.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GGCCCACCTGCCCACACATGC	0.647																																							uc002baw.2		NA																	0				ovary(2)|pancreas(1)	3						c.(6151-6153)GCA>TCA		chondroitin sulfate proteoglycan 4 precursor							52.0	42.0	45.0					15																	75968709		2196	4294	6490	SO:0001583	missense	1464				angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity	g.chr15:75968709C>A	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.6151G>T	15.37:g.75968709C>A	ENSP00000312506:p.Ala2051Ser						p.A2051S	NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN			10	6244	-			2051			Extracellular (Potential).|CSPG 15.|Cysteine-containing.|Neurite growth inhibition (By similarity).		D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	c.6151G>T	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.740108	0.00675	.	.	ENSG00000173546	ENST00000308508;ENST00000537176	T	0.17528	2.27	4.62	-0.819	0.10829	.	0.616036	0.14911	N	0.291255	T	0.07369	0.0186	N	0.17800	0.525	0.09310	N	1	B	0.20887	0.049	B	0.16722	0.016	T	0.41662	-0.9496	10	0.06891	T	0.86	.	5.6919	0.17835	0.0:0.5089:0.2587:0.2325	.	2051	Q6UVK1	CSPG4_HUMAN	S	2051;83	ENSP00000312506:A2051S	ENSP00000312506:A2051S	A	-	1	0	CSPG4	73755764	0.000000	0.05858	0.002000	0.10522	0.030000	0.12068	0.084000	0.14891	-0.332000	0.08489	-1.036000	0.02392	GCA		0.647	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897		6	26	1	0	0.00116845	0.001168	0.00121774	6	26				
ACSBG1	23205	broad.mit.edu	37	15	78526821	78526821	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr15:78526821C>T	ENST00000258873.4	-	1	228	c.23G>A	c.(22-24)gGa>gAa	p.G8E	ACSBG1_ENST00000558828.1_Intron|ACSBG1_ENST00000541759.1_5'UTR|ACSBG1_ENST00000560817.1_Intron	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	8					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						GCAGCCGTATCCAGCTCCAGA	0.597																																							uc002bdh.2		NA																	0				ovary(1)	1						c.(22-24)GGA>GAA		lipidosin							110.0	119.0	116.0					15																	78526821		2196	4293	6489	SO:0001583	missense	23205				long-chain fatty acid metabolic process|myelination|very long-chain fatty acid metabolic process	cytoplasmic membrane-bounded vesicle|endoplasmic reticulum|microsome	ATP binding|long-chain fatty acid-CoA ligase activity|very long-chain fatty acid-CoA ligase activity	g.chr15:78526821C>T	AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.23G>A	15.37:g.78526821C>T	ENSP00000258873:p.Gly8Glu					ACSBG1_uc010umw.1_Missense_Mutation_p.G8E|ACSBG1_uc010umx.1_5'UTR|ACSBG1_uc010umy.1_5'UTR	p.G8E	NM_015162	NP_055977	Q96GR2	ACBG1_HUMAN			1	79	-			8					B2RB61|O75126|Q76N27|Q9HC26	Missense_Mutation	SNP	ENST00000258873.4	37	c.23G>A	CCDS10298.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.070724	0.76301	.	.	ENSG00000103740	ENST00000258873	T	0.35421	1.31	4.61	3.67	0.42095	.	0.189148	0.26003	N	0.026924	T	0.31827	0.0809	L	0.36672	1.1	0.25489	N	0.987664	D;D	0.54047	0.964;0.964	P;P	0.47673	0.554;0.554	T	0.16808	-1.0390	10	0.87932	D	0	-11.8615	7.9592	0.30062	0.0:0.8888:0.0:0.1112	.	8;8	B7Z2Y6;Q96GR2	.;ACBG1_HUMAN	E	8	ENSP00000258873:G8E	ENSP00000258873:G8E	G	-	2	0	ACSBG1	76313876	0.001000	0.12720	0.385000	0.26158	0.622000	0.37654	0.774000	0.26675	2.257000	0.74773	0.462000	0.41574	GGA		0.597	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289802.2	NM_015162		69	118	0	0	0	0.01441	0	69	118				
CHRNB4	1143	broad.mit.edu	37	15	78921577	78921577	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr15:78921577G>T	ENST00000261751.3	-	5	1181	c.1070C>A	c.(1069-1071)gCc>gAc	p.A357D	CHRNB4_ENST00000560511.1_5'Flank|CHRNB4_ENST00000412074.2_Intron|RP11-335K5.2_ENST00000559120.1_RNA	NM_000750.3	NP_000741.1	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4 (neuronal)	357					action potential (GO:0001508)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|regulation of neurotransmitter secretion (GO:0046928)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			endometrium(7)|kidney(1)|lung(13)|prostate(1)	22					Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)	GAAGGCTCTGGCCGGGCTGCT	0.637																																							uc002bed.1		NA																	0					0						c.(1069-1071)GCC>GAC		cholinergic receptor, nicotinic, beta 4							43.0	46.0	45.0					15																	78921577		2196	4292	6488	SO:0001583	missense	1143				regulation of neurotransmitter secretion|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity	g.chr15:78921577G>T	U48861	CCDS10306.1, CCDS58392.1	15q24	2012-02-11	2012-02-07		ENSG00000117971	ENSG00000117971		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1964	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 4 (neuronal)"""	118509	"""cholinergic receptor, nicotinic, beta polypeptide 4"""			2004777	Standard	NM_000750		Approved		uc002bed.1	P30926	OTTHUMG00000143860	ENST00000261751.3:c.1070C>A	15.37:g.78921577G>T	ENSP00000261751:p.Ala357Asp					CHRNB4_uc002bee.1_Intron|CHRNB4_uc010blh.1_Missense_Mutation_p.A175D	p.A357D	NM_000750	NP_000741	P30926	ACHB4_HUMAN			5	1182	-			357			Cytoplasmic (Potential).		A4FTX5|E9PHE8|Q16607|Q4VBA5|Q8WXC8|Q9BQR4	Missense_Mutation	SNP	ENST00000261751.3	37	c.1070C>A	CCDS10306.1	.	.	.	.	.	.	.	.	.	.	G	0.046	-1.266416	0.01433	.	.	ENSG00000117971	ENST00000261751	D	0.85556	-2.0	5.29	0.992	0.19819	Neurotransmitter-gated ion-channel transmembrane domain (2);	.	.	.	.	T	0.65719	0.2718	N	0.05574	-0.02	0.18873	N	0.999982	B	0.02656	0.0	B	0.06405	0.002	T	0.49597	-0.8923	9	0.11485	T	0.65	.	7.1291	0.25490	0.1477:0.2601:0.5922:0.0	.	357	P30926	ACHB4_HUMAN	D	357	ENSP00000261751:A357D	ENSP00000261751:A357D	A	-	2	0	CHRNB4	76708632	0.337000	0.24766	0.003000	0.11579	0.047000	0.14425	2.191000	0.42640	0.212000	0.20703	-0.175000	0.13238	GCC		0.637	CHRNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290108.1			15	20	1	0	1.15088e-07	0.004007	1.26464e-07	15	20				
AKAP13	11214	broad.mit.edu	37	15	86122855	86122855	+	Missense_Mutation	SNP	C	C	G	rs201778847		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr15:86122855C>G	ENST00000394518.2	+	7	1651	c.1556C>G	c.(1555-1557)tCt>tGt	p.S519C	AKAP13_ENST00000361243.2_Missense_Mutation_p.S519C|RP11-815J21.2_ENST00000561409.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	519					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GCTGGAGCCTCTGACGTGCAC	0.483																																					Melanoma(94;603 1453 3280 32295 32951)	Melanoma(94;603 1453 3280 32295 32951)	uc002blv.1		NA																	0				central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						c.(1555-1557)TCT>TGT		A-kinase anchor protein 13 isoform 2							71.0	78.0	76.0					15																	86122855		2202	4299	6501	SO:0001583	missense	11214				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr15:86122855C>G	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.1556C>G	15.37:g.86122855C>G	ENSP00000378026:p.Ser519Cys					AKAP13_uc002blt.1_Missense_Mutation_p.S519C|AKAP13_uc002blu.1_Missense_Mutation_p.S519C	p.S519C	NM_007200	NP_009131	Q12802	AKP13_HUMAN			7	1726	+			519					Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	c.1556C>G	CCDS32319.1	6	0.0027472527472527475	2	0.0040650406504065045	2	0.0055248618784530384	1	0.0017482517482517483	1	0.0013192612137203166	C	15.26	2.779307	0.49891	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.10860	2.83;2.84	5.46	3.46	0.39613	.	.	.	.	.	T	0.05502	0.0145	L	0.27053	0.805	0.09310	N	0.999994	B;B	0.17038	0.012;0.02	B;B	0.14023	0.005;0.01	T	0.29058	-1.0024	9	0.29301	T	0.29	.	9.4758	0.38871	0.1595:0.6858:0.1546:0.0	.	519;519	Q12802;Q12802-2	AKP13_HUMAN;.	C	519;519;518;518	ENSP00000354718:S519C;ENSP00000378026:S519C	ENSP00000354718:S519C	S	+	2	0	AKAP13	83923859	0.206000	0.23470	0.006000	0.13384	0.051000	0.14879	1.013000	0.29937	1.427000	0.47276	0.655000	0.94253	TCT		0.483	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200		9	54	0	0	0	0.004482	0	9	54				
PLIN1	5346	broad.mit.edu	37	15	90213226	90213226	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr15:90213226C>G	ENST00000300055.5	-	5	748	c.583G>C	c.(583-585)Gac>Cac	p.D195H	PLIN1_ENST00000430628.2_Missense_Mutation_p.D195H	NM_002666.4	NP_002657.3	O60240	PLIN1_HUMAN	perilipin 1	195					lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)	lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(2)	13						TCTTCCTTGTCTGGAGGGAGG	0.602																																							uc010upx.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(583-585)GAC>CAC		perilipin 1							20.0	20.0	20.0					15																	90213226		2200	4298	6498	SO:0001583	missense	5346				triglyceride catabolic process	lipid particle	lipid binding	g.chr15:90213226C>G	AB005293	CCDS10353.1	15q26	2009-08-12	2009-08-12	2009-08-12	ENSG00000166819	ENSG00000166819		"""Perilipins"""	9076	protein-coding gene	gene with protein product		170290	"""perilipin"""	PLIN		9521880, 19638644	Standard	NM_002666		Approved		uc010upx.1	O60240	OTTHUMG00000149813	ENST00000300055.5:c.583G>C	15.37:g.90213226C>G	ENSP00000300055:p.Asp195His					PLIN1_uc002boh.2_Missense_Mutation_p.D195H	p.D195H	NM_001145311	NP_001138783	O60240	PLIN1_HUMAN			5	693	-			195					Q8N5Y6	Missense_Mutation	SNP	ENST00000300055.5	37	c.583G>C	CCDS10353.1	.	.	.	.	.	.	.	.	.	.	C	7.730	0.699003	0.15106	.	.	ENSG00000166819	ENST00000300055;ENST00000430628	T;T	0.05513	3.43;3.43	4.68	1.59	0.23543	.	1.250500	0.05490	N	0.556453	T	0.09202	0.0227	L	0.29908	0.895	0.09310	N	1	P	0.47545	0.897	P	0.48571	0.582	T	0.40831	-0.9542	10	0.59425	D	0.04	-3.4784	8.3449	0.32266	0.0:0.688:0.1412:0.1708	.	195	O60240	PLIN1_HUMAN	H	195	ENSP00000300055:D195H;ENSP00000402167:D195H	ENSP00000300055:D195H	D	-	1	0	PLIN1	88014230	0.053000	0.20554	0.039000	0.18376	0.120000	0.20174	0.610000	0.24253	0.598000	0.29829	0.305000	0.20034	GAC		0.602	PLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313424.2	NM_002666		7	12	0	0	0	0.00308	0	7	12				
ST8SIA2	8128	broad.mit.edu	37	15	93007521	93007521	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr15:93007521C>A	ENST00000268164.3	+	6	1271	c.1034C>A	c.(1033-1035)cCg>cAg	p.P345Q	ST8SIA2_ENST00000539113.1_Missense_Mutation_p.P324Q	NM_006011.3	NP_006002.1	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2	345					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	early endosome (GO:0005769)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|recycling endosome (GO:0055037)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			endometrium(2)|large_intestine(6)|lung(9)|skin(2)|urinary_tract(1)	20	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			CAGGCCAGCCCGCATACCATG	0.572																																							uc002bra.2		NA																	0					0						c.(1033-1035)CCG>CAG		ST8 alpha-N-acetyl-neuraminide							93.0	86.0	88.0					15																	93007521		2198	4298	6496	SO:0001583	missense	8128				axon guidance|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity	g.chr15:93007521C>A	U33551	CCDS10372.1	15q26	2013-03-01	2003-01-14	2005-02-07	ENSG00000140557	ENSG00000140557		"""Sialyltransferases"""	10870	protein-coding gene	gene with protein product		602546	"""sialyltransferase 8 (alpha-2, 8-sialytransferase) B"""	SIAT8B		7559389	Standard	NM_006011		Approved	STX, ST8SIA-II, HsT19690	uc002bra.3	Q92186	OTTHUMG00000149843	ENST00000268164.3:c.1034C>A	15.37:g.93007521C>A	ENSP00000268164:p.Pro345Gln					ST8SIA2_uc002brb.2_Missense_Mutation_p.P324Q	p.P345Q	NM_006011	NP_006002	Q92186	SIA8B_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)		6	1189	+	Lung NSC(78;0.0893)|all_lung(78;0.125)		345			Lumenal (Potential).		Q4VAZ0|Q92470|Q92746	Missense_Mutation	SNP	ENST00000268164.3	37	c.1034C>A	CCDS10372.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.288126	0.80803	.	.	ENSG00000140557	ENST00000268164;ENST00000539113;ENST00000555434	T;T;T	0.28069	1.63;1.63;1.63	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.56587	0.1995	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.79108	0.985;0.992	T	0.46005	-0.9222	10	0.29301	T	0.29	-28.9097	20.063	0.97692	0.0:1.0:0.0:0.0	.	324;345	C6G488;Q92186	.;SIA8B_HUMAN	Q	345;324;302	ENSP00000268164:P345Q;ENSP00000437382:P324Q;ENSP00000450851:P302Q	ENSP00000268164:P345Q	P	+	2	0	ST8SIA2	90808525	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	7.605000	0.82844	2.741000	0.93983	0.650000	0.86243	CCG		0.572	ST8SIA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313526.1	NM_006011		30	60	1	0	0.00209593	0.010818	0.00216742	30	60				
RAB11FIP3	9727	broad.mit.edu	37	16	532599	532599	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr16:532599G>A	ENST00000262305.4	+	4	1366	c.978G>A	c.(976-978)gaG>gaA	p.E326E	RAB11FIP3_ENST00000457159.1_Silent_p.E326E|RAB11FIP3_ENST00000450428.1_Silent_p.E30E	NM_014700.3	NP_055515.1	O75154	RFIP3_HUMAN	RAB11 family interacting protein 3 (class II)	326					cytokinesis (GO:0000910)|endocytic recycling (GO:0032456)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|endosome (GO:0005768)|intercellular bridge (GO:0045171)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(3)|lung(5)|upper_aerodigestive_tract(1)	12		Hepatocellular(16;0.0218)				TCACGGACGAGGACACCAGCA	0.652																																					Melanoma(160;2366 2595 4474 8099)	Melanoma(160;2366 2595 4474 8099)	uc002chf.2		NA																	0					0						c.(976-978)GAG>GAA		rab11-family interacting protein 3 isoform 1							89.0	71.0	77.0					16																	532599		2202	4300	6502	SO:0001819	synonymous_variant	9727				cell cycle|cytokinesis|endocytic recycling|protein transport	centrosome|cleavage furrow|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding	g.chr16:532599G>A	AB014565	CCDS32351.1, CCDS45364.1	16p13.3	2013-01-10			ENSG00000090565	ENSG00000090565		"""EF-hand domain containing"""	17224	protein-coding gene	gene with protein product		608738				9734811, 11481332	Standard	NM_014700		Approved	KIAA0665, Rab11-FIP3, eferin	uc002chf.3	O75154	OTTHUMG00000047843	ENST00000262305.4:c.978G>A	16.37:g.532599G>A						RAB11FIP3_uc010uuf.1_Silent_p.E30E|RAB11FIP3_uc010uug.1_Silent_p.E16E	p.E326E	NM_014700	NP_055515	O75154	RFIP3_HUMAN			4	1317	+		Hepatocellular(16;0.0218)	326					B0QYI8|B0QYT8|B1AHQ0|B4DEI7|B4DZR6|Q4VXV7|Q7Z5E9|Q9H155|Q9H1G0|Q9NUI0	Silent	SNP	ENST00000262305.4	37	c.978G>A	CCDS32351.1																																																																																				0.652	RAB11FIP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109066.4	NM_014700		8	47	0	0	0	0.00308	0	8	47				
CCNF	899	broad.mit.edu	37	16	2481210	2481210	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr16:2481210C>G	ENST00000397066.4	+	2	184	c.96C>G	c.(94-96)atC>atG	p.I32M		NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	32	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				ACCTGACCATCTTGAGTCTCC	0.478																																							uc002cqd.1		NA																	0				central_nervous_system(1)|kidney(1)	2						c.(94-96)ATC>ATG		cyclin F							126.0	121.0	122.0					16																	2481210		2198	4300	6498	SO:0001583	missense	899				cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding	g.chr16:2481210C>G	Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.96C>G	16.37:g.2481210C>G	ENSP00000380256:p.Ile32Met					CCNF_uc002cqe.1_Translation_Start_Site	p.I32M	NM_001761	NP_001752	P41002	CCNF_HUMAN			2	184	+		Ovarian(90;0.17)	32			F-box.		B2R8H3|Q96EG9	Missense_Mutation	SNP	ENST00000397066.4	37	c.96C>G	CCDS10467.1	.	.	.	.	.	.	.	.	.	.	C	14.66	2.603117	0.46423	.	.	ENSG00000162063	ENST00000397066	T	0.27557	1.66	4.96	3.95	0.45737	F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	0.154756	0.46145	D	0.000315	T	0.22360	0.0539	N	0.14661	0.345	0.34383	D	0.693306	P	0.49307	0.922	P	0.46758	0.526	T	0.27706	-1.0066	10	0.66056	D	0.02	-26.7161	9.9988	0.41916	0.1506:0.7028:0.1465:0.0	.	32	P41002	CCNF_HUMAN	M	32	ENSP00000380256:I32M	ENSP00000380256:I32M	I	+	3	3	CCNF	2421211	0.983000	0.35010	0.997000	0.53966	0.997000	0.91878	0.891000	0.28309	2.465000	0.83290	0.655000	0.94253	ATC		0.478	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250801.1	NM_001761		11	81	0	0	0	0.010729	0	11	81				
RBFOX1	54715	broad.mit.edu	37	16	7645563	7645563	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr16:7645563G>A	ENST00000550418.1	+	8	1469	c.481G>A	c.(481-483)Gta>Ata	p.V161I	RBFOX1_ENST00000547372.1_Missense_Mutation_p.V204I|RBFOX1_ENST00000311745.5_Missense_Mutation_p.V181I|RBFOX1_ENST00000547338.1_Missense_Mutation_p.V161I|RBFOX1_ENST00000340209.4_Missense_Mutation_p.V166I|RBFOX1_ENST00000553186.1_Missense_Mutation_p.V161I|RBFOX1_ENST00000355637.4_Missense_Mutation_p.V181I|RBFOX1_ENST00000436368.2_Missense_Mutation_p.V181I|RBFOX1_ENST00000552089.1_Missense_Mutation_p.V178I|RBFOX1_ENST00000422070.4_Missense_Mutation_p.V204I|RBFOX1_ENST00000535565.2_Intron	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	161	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						ATTTGGTTTCGTAACTTTCGA	0.443																																					Ovarian(157;934 2567 15163 39509)		uc002cys.2		NA																	0					0						c.(481-483)GTA>ATA		ataxin 2-binding protein 1 isoform 4							166.0	145.0	152.0					16																	7645563		2197	4300	6497	SO:0001583	missense	54715				mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding	g.chr16:7645563G>A	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.481G>A	16.37:g.7645563G>A	ENSP00000450031:p.Val161Ile					A2BP1_uc010buf.1_Missense_Mutation_p.V161I|A2BP1_uc002cyr.1_Missense_Mutation_p.V160I|A2BP1_uc002cyt.2_Missense_Mutation_p.V161I|A2BP1_uc010uxz.1_Missense_Mutation_p.V204I|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Missense_Mutation_p.V161I|A2BP1_uc010uyb.1_Missense_Mutation_p.V161I|A2BP1_uc002cyw.2_Missense_Mutation_p.V181I|A2BP1_uc002cyy.2_Missense_Mutation_p.V181I|A2BP1_uc002cyx.2_Missense_Mutation_p.V181I|A2BP1_uc010uyc.1_Missense_Mutation_p.V181I	p.V161I	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)	8	1469	+		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)	161			RRM.		Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	ENST00000550418.1	37	c.481G>A	CCDS55983.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.587766	0.86851	.	.	ENSG00000078328	ENST00000547605;ENST00000550418;ENST00000553186;ENST00000547372;ENST00000422070;ENST00000552089;ENST00000551752;ENST00000547338;ENST00000436368;ENST00000311745;ENST00000355637;ENST00000352951;ENST00000340209	T;T;T;T;T;T;T;T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45;1.45;1.45;1.45;1.45;1.45;1.45;1.45	5.86	5.86	0.93980	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.54367	0.1854	L	0.60012	1.86	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.987;0.976;1.0;0.997;0.992;0.985;0.999;0.997	P;P;D;D;D;P;D;D	0.80764	0.878;0.844;0.994;0.951;0.952;0.811;0.955;0.925	T	0.41305	-0.9516	10	0.39692	T	0.17	-7.005	20.1951	0.98241	0.0:0.0:1.0:0.0	.	181;204;181;181;181;161;161;204	F8WAC5;B7Z1U7;Q9NWB1-2;Q9NWB1-4;Q9NWB1-5;Q9NWB1-3;Q9NWB1;F8VZG9	.;.;.;.;.;.;RFOX1_HUMAN;.	I	160;161;161;204;204;178;161;161;181;181;181;181;166	ENSP00000450402:V160I;ENSP00000450031:V161I;ENSP00000447753:V161I;ENSP00000446842:V204I;ENSP00000391269:V204I;ENSP00000448496:V178I;ENSP00000447281:V161I;ENSP00000447717:V161I;ENSP00000402745:V181I;ENSP00000309117:V181I;ENSP00000347855:V181I;ENSP00000344196:V166I	ENSP00000309117:V181I	V	+	1	0	RBFOX1	7585564	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.780000	0.95670	0.585000	0.79938	GTA		0.443	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891		30	163	0	0	0	0.010818	0	30	163				
OTOA	146183	broad.mit.edu	37	16	21709155	21709155	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr16:21709155C>T	ENST00000286149.4	+	9	800	c.799C>T	c.(799-801)Cac>Tac	p.H267Y	OTOA_ENST00000388956.4_Missense_Mutation_p.H188Y|OTOA_ENST00000388958.3_Missense_Mutation_p.H267Y			Q7RTW8	OTOAN_HUMAN	otoancorin	267					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		ATACATGGTTCACCTATCGTT	0.343																																							uc002djh.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(799-801)CAC>TAC		otoancorin isoform 1							168.0	168.0	168.0					16																	21709155		2199	4300	6499	SO:0001583	missense	146183				sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix		g.chr16:21709155C>T	AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.799C>T	16.37:g.21709155C>T	ENSP00000286149:p.His267Tyr					uc002diq.3_Intron|OTOA_uc010vbj.1_Missense_Mutation_p.H188Y	p.H267Y	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN		GBM - Glioblastoma multiforme(48;0.0414)	9	800	+			267					A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Missense_Mutation	SNP	ENST00000286149.4	37	c.799C>T		.	.	.	.	.	.	.	.	.	.	C	22.6	4.314908	0.81358	.	.	ENSG00000155719	ENST00000388958;ENST00000286149;ENST00000388956	T;T;T	0.12774	2.65;2.65;2.65	5.62	5.62	0.85841	.	0.138996	0.50627	D	0.000108	T	0.36635	0.0974	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.01215	-1.1416	10	0.37606	T	0.19	-15.8156	17.1627	0.86808	0.0:1.0:0.0:0.0	.	188;267	B3KWU3;E9PF51	.;.	Y	267;267;188	ENSP00000373610:H267Y;ENSP00000286149:H267Y;ENSP00000373608:H188Y	ENSP00000286149:H267Y	H	+	1	0	OTOA	21616656	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.253000	0.65452	2.642000	0.89623	0.655000	0.94253	CAC		0.343	OTOA-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000430021.1			12	78	0	0	0	0.010729	0	12	78				
KIAA0556	23247	broad.mit.edu	37	16	27772844	27772844	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr16:27772844A>G	ENST00000261588.4	+	19	3761	c.3742A>G	c.(3742-3744)Atc>Gtc	p.I1248V		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	1248						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						CCTGCACCAGATCTCTGCTTC	0.577																																							uc002dow.2		NA																	0				ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						c.(3742-3744)ATC>GTC		hypothetical protein LOC23247							67.0	66.0	66.0					16																	27772844		2197	4300	6497	SO:0001583	missense	23247							g.chr16:27772844A>G	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.3742A>G	16.37:g.27772844A>G	ENSP00000261588:p.Ile1248Val						p.I1248V	NM_015202	NP_056017	O60303	K0556_HUMAN			19	3766	+			1248					A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	c.3742A>G	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	A	10.75	1.437776	0.25900	.	.	ENSG00000047578	ENST00000261588	T	0.15017	2.46	4.56	-0.843	0.10744	.	0.420309	0.27866	N	0.017539	T	0.10809	0.0264	L	0.38692	1.165	0.25639	N	0.986227	B	0.26935	0.164	B	0.26202	0.067	T	0.15378	-1.0439	10	0.51188	T	0.08	-15.0087	5.0327	0.14419	0.2859:0.5166:0.0773:0.1202	.	1248	O60303	K0556_HUMAN	V	1248	ENSP00000261588:I1248V	ENSP00000261588:I1248V	I	+	1	0	KIAA0556	27680345	0.989000	0.36119	0.955000	0.39395	0.389000	0.30415	0.416000	0.21198	-0.511000	0.06514	0.459000	0.35465	ATC		0.577	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202		17	35	0	0	0	0.006122	0	17	35				
APOBR	55911	broad.mit.edu	37	16	28507384	28507384	+	Missense_Mutation	SNP	C	C	T	rs560675961		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr16:28507384C>T	ENST00000431282.1	+	2	1032	c.1022C>T	c.(1021-1023)tCa>tTa	p.S341L	CLN3_ENST00000569430.1_5'Flank|APOBR_ENST00000328423.5_Missense_Mutation_p.S341L|CLN3_ENST00000567160.1_5'Flank|APOBR_ENST00000564831.1_Missense_Mutation_p.S341L			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	341	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						GGGATAGCCTCAGGCGGGGAG	0.721													C|||	1	0.000199681	0.0	0.0	5008	,	,		12111	0.0		0.0	False		,,,				2504	0.001						uc002dqb.1		NA																	0					0						c.(1021-1023)TCA>TTA		apolipoprotein B48 receptor							11.0	13.0	13.0					16																	28507384		1844	3976	5820	SO:0001583	missense	55911				cholesterol metabolic process|lipid transport	chylomicron|low-density lipoprotein particle|plasma membrane|very-low-density lipoprotein particle		g.chr16:28507384C>T	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.1022C>T	16.37:g.28507384C>T	ENSP00000416094:p.Ser341Leu					uc010vct.1_Intron|APOB48R_uc010byg.1_5'UTR	p.S341L	NM_018690	NP_061160	Q0VD83	APOBR_HUMAN			2	1032	+			341			Glu-rich.		H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	ENST00000431282.1	37	c.1022C>T		.	.	.	.	.	.	.	.	.	.	C	9.295	1.051666	0.19827	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.61274	0.12;0.12	2.18	-0.962	0.10333	.	.	.	.	.	T	0.32971	0.0847	N	0.14661	0.345	0.09310	N	1	B	0.16603	0.018	B	0.13407	0.009	T	0.17349	-1.0372	9	0.25751	T	0.34	.	5.1019	0.14764	0.2281:0.546:0.2259:0.0	.	332	Q9NS13	.	L	341	ENSP00000327669:S341L;ENSP00000416094:S341L	ENSP00000327669:S341L	S	+	2	0	APOBR	28414885	0.000000	0.05858	0.002000	0.10522	0.020000	0.10135	-0.260000	0.08708	0.150000	0.19136	0.448000	0.29417	TCA		0.721	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_182804		3	15	0	0	0	0.004672	0	3	15				
TGFB1I1	7041	broad.mit.edu	37	16	31488304	31488304	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr16:31488304C>G	ENST00000394863.3	+	10	1222	c.1092C>G	c.(1090-1092)ctC>ctG	p.L364L	TGFB1I1_ENST00000361773.3_Silent_p.L347L|TGFB1I1_ENST00000567607.1_Silent_p.L347L|TGFB1I1_ENST00000394858.2_Silent_p.L347L	NM_001042454.2	NP_001035919.1	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced transcript 1	364	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				androgen receptor signaling pathway (GO:0030521)|cell adhesion (GO:0007155)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|response to heat (GO:0009408)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|I-SMAD binding (GO:0070411)|Roundabout binding (GO:0048495)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(8)|upper_aerodigestive_tract(1)	9						TCAGCGCGCTCTGGCACCCGG	0.716																																							uc002ecd.1		NA																	0					0						c.(1090-1092)CTC>CTG		transforming growth factor beta 1 induced							7.0	8.0	7.0					16																	31488304		2172	4215	6387	SO:0001819	synonymous_variant	7041				androgen receptor signaling pathway|cell adhesion|negative regulation of cell proliferation|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor beta receptor signaling pathway|transcription from RNA polymerase II promoter|ubiquitin-dependent SMAD protein catabolic process|Wnt receptor signaling pathway	cytoplasm|cytoskeleton|focal adhesion|nuclear matrix	androgen receptor binding|I-SMAD binding|Roundabout binding|transcription coactivator activity|zinc ion binding	g.chr16:31488304C>G	AB007836	CCDS10713.1, CCDS42156.1	16p11	2008-02-05			ENSG00000140682	ENSG00000140682			11767	protein-coding gene	gene with protein product		602353				9422762, 10075738	Standard	NM_015927		Approved	Hic-5, TSC-5, ARA55, HIC-5	uc002ecd.2	O43294	OTTHUMG00000132467	ENST00000394863.3:c.1092C>G	16.37:g.31488304C>G						TGFB1I1_uc002ece.1_Silent_p.L347L|TGFB1I1_uc010caq.1_Silent_p.L203L	p.L364L	NM_001042454	NP_001035919	O43294	TGFI1_HUMAN			10	1118	+			364			LIM zinc-binding 3.		B2R8D5|Q9BPW3|Q9Y2V5	Silent	SNP	ENST00000394863.3	37	c.1092C>G	CCDS42156.1																																																																																				0.716	TGFB1I1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255630.3			3	8	0	0	0	0.004672	0	3	8				
AHSP	51327	broad.mit.edu	37	16	31539514	31539514	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr16:31539514C>G	ENST00000302312.4	+	2	157	c.54C>G	c.(52-54)ttC>ttG	p.F18L	AHSP_ENST00000569954.1_3'UTR	NM_016633.2	NP_057717.1	Q9NZD4	AHSP_HUMAN	alpha hemoglobin stabilizing protein	18					hemoglobin metabolic process (GO:0020027)|hemopoiesis (GO:0030097)|protein folding (GO:0006457)|protein stabilization (GO:0050821)	hemoglobin complex (GO:0005833)	hemoglobin binding (GO:0030492)|unfolded protein binding (GO:0051082)			lung(2)	2						TGAAGGAGTTCAGCGTTCTGC	0.498																																							uc002ecj.2		NA																	0					0						c.(52-54)TTC>TTG		erythroid associated factor							107.0	103.0	104.0					16																	31539514		2197	4300	6497	SO:0001583	missense	51327				hemoglobin metabolic process|hemopoiesis|protein folding|protein stabilization	hemoglobin complex	hemoglobin binding|unfolded protein binding	g.chr16:31539514C>G	AF208865	CCDS10716.1	16p11.1	2009-10-07	2009-10-07	2009-10-07	ENSG00000169877	ENSG00000169877			18075	protein-coding gene	gene with protein product	"""alpha hemoglobin stabilising protein"""	605821	"""erythroid associated factor"""	ERAF		11231637, 12066189	Standard	XM_005255352		Approved	EDRF	uc002ecj.3	Q9NZD4	OTTHUMG00000132461	ENST00000302312.4:c.54C>G	16.37:g.31539514C>G	ENSP00000307199:p.Phe18Leu						p.F18L	NM_016633	NP_057717	Q9NZD4	AHSP_HUMAN			2	139	+			18					Q8TD01	Missense_Mutation	SNP	ENST00000302312.4	37	c.54C>G	CCDS10716.1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.056049	0.36277	.	.	ENSG00000169877	ENST00000302312	T	0.71934	-0.61	5.47	0.494	0.16884	.	0.330688	0.26275	N	0.025305	T	0.70316	0.3210	L	0.36672	1.1	0.09310	N	1	D	0.57257	0.979	P	0.61132	0.884	T	0.63102	-0.6712	10	0.87932	D	0	.	8.5267	0.33309	0.0:0.1803:0.0:0.8197	.	18	Q9NZD4	AHSP_HUMAN	L	18	ENSP00000307199:F18L	ENSP00000307199:F18L	F	+	3	2	AHSP	31447015	0.020000	0.18652	0.060000	0.19600	0.003000	0.03518	-0.444000	0.06854	-0.192000	0.10432	-0.484000	0.04775	TTC		0.498	AHSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255624.1	NM_016633		12	73	0	0	0	0.010729	0	12	73				
AMFR	267	broad.mit.edu	37	16	56423102	56423102	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr16:56423102A>C	ENST00000290649.5	-	9	1481	c.1271T>G	c.(1270-1272)tTc>tGc	p.F424C		NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase	424					aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						CTAACCATCGAAATGGAAGAA	0.418																																					Pancreas(2;144 323 39528)	Pancreas(2;144 323 39528)	uc002eiy.2		NA																	0				breast(2)	2						c.(1270-1272)TTC>TGC		autocrine motility factor receptor							140.0	134.0	136.0					16																	56423102		2198	4300	6498	SO:0001583	missense	267				endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|protein oligomerization|protein polyubiquitination	integral to endoplasmic reticulum membrane|integral to membrane of membrane fraction	protein binding|protein binding|receptor activity|ubiquitin-protein ligase activity|zinc ion binding	g.chr16:56423102A>C	L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.1271T>G	16.37:g.56423102A>C	ENSP00000290649:p.Phe424Cys					AMFR_uc002eix.2_Intron	p.F424C	NM_001144	NP_001135	Q9UKV5	AMFR2_HUMAN			9	1476	-			424					P26442|Q8IZ70	Missense_Mutation	SNP	ENST00000290649.5	37	c.1271T>G	CCDS10758.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.517190	0.85495	.	.	ENSG00000159461	ENST00000290649	T	0.19938	2.11	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.49558	0.1564	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.52034	-0.8629	10	0.66056	D	0.02	-24.5443	16.371	0.83361	1.0:0.0:0.0:0.0	.	424	Q9UKV5	AMFR2_HUMAN	C	424	ENSP00000290649:F424C	ENSP00000290649:F424C	F	-	2	0	AMFR	54980603	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	9.307000	0.96226	2.267000	0.75376	0.477000	0.44152	TTC		0.418	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256978.2			9	52	0	0	0	0.008291	0	9	52				
USB1	79650	broad.mit.edu	37	16	58051280	58051280	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr16:58051280C>G	ENST00000539737.2	+	4	571	c.492C>G	c.(490-492)ttC>ttG	p.F164L	USB1_ENST00000565662.1_3'UTR|USB1_ENST00000561743.1_Missense_Mutation_p.F131L|USB1_ENST00000219281.3_Missense_Mutation_p.F182L	NM_001195302.1	NP_001182231.1			U6 snRNA biogenesis 1																		ATGCCCAGTTCCTGGACCTGG	0.522																																							uc002emz.2		NA																	0					0						c.(544-546)TTC>TTG		hypothetical protein LOC79650							166.0	144.0	151.0					16																	58051280		2198	4300	6498	SO:0001583	missense	79650							g.chr16:58051280C>G	AK023216	CCDS10791.1, CCDS55997.1, CCDS55998.1	16q13	2014-09-17	2012-08-21	2012-08-21	ENSG00000103005	ENSG00000103005			25792	protein-coding gene	gene with protein product	"""HVSL motif containing 1"", ""poikiloderma with neutropenia"", ""U six biogenesis 1"", ""mutated in poikiloderma with neutropenia protein 1"""	613276	"""chromosome 16 open reading frame 57"""	C16orf57		20004881, 20503306, 22899009	Standard	NM_024598		Approved	FLJ13154, HVSL1, Mpn1	uc002emz.3	Q9BQ65	OTTHUMG00000133456	ENST00000539737.2:c.492C>G	16.37:g.58051280C>G	ENSP00000446143:p.Phe164Leu					C16orf57_uc010vib.1_Missense_Mutation_p.F164L	p.F182L	NM_024598	NP_078874	Q9BQ65	CP057_HUMAN			5	629	+			182						Missense_Mutation	SNP	ENST00000539737.2	37	c.546C>G	CCDS55998.1	.	.	.	.	.	.	.	.	.	.	C	7.274	0.607742	0.14002	.	.	ENSG00000103005	ENST00000219281;ENST00000543731;ENST00000539737	T;T	0.29917	1.55;1.55	5.24	5.24	0.73138	.	0.194039	0.44285	N	0.000477	T	0.11665	0.0284	N	0.02842	-0.48	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.13845	-1.0494	10	0.02654	T	1	-6.1415	12.4394	0.55617	0.0:0.8176:0.1824:0.0	.	164;182	B4DZW5;Q9BQ65	.;CP057_HUMAN	L	182;130;164	ENSP00000219281:F182L;ENSP00000446143:F164L	ENSP00000219281:F182L	F	+	3	2	C16orf57	56608781	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.242000	0.43106	2.456000	0.83038	0.650000	0.86243	TTC		0.522	USB1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000429947.1	NM_024598		5	66	0	0	0	0.000602	0	5	66				
CDH8	1006	broad.mit.edu	37	16	61761011	61761011	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr16:61761011C>A	ENST00000577390.1	-	9	2477	c.1523G>T	c.(1522-1524)gGa>gTa	p.G508V	CDH8_ENST00000584337.1_Missense_Mutation_p.G508V|CDH8_ENST00000299345.6_Missense_Mutation_p.G508V|CDH8_ENST00000577730.1_Missense_Mutation_p.G508V	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	508	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GCCGGGTTTTCCATTTTCACA	0.378																																							uc002eog.1		NA																	0				ovary(6)|skin(2)|breast(1)	9						c.(1522-1524)GGA>GTA		cadherin 8, type 2 preproprotein							137.0	134.0	135.0					16																	61761011		2203	4299	6502	SO:0001583	missense	1006				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr16:61761011C>A	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1523G>T	16.37:g.61761011C>A	ENSP00000462701:p.Gly508Val					CDH8_uc002eoh.2_Missense_Mutation_p.G277V	p.G508V	NM_001796	NP_001787	P55286	CADH8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)	9	1775	-		Ovarian(137;0.0799)|Melanoma(118;0.16)	508			Extracellular (Potential).|Cadherin 5.		B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	c.1523G>T	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.612374	0.66672	.	.	ENSG00000150394	ENST00000299345	T	0.01725	4.67	5.45	5.45	0.79879	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.01765	0.0056	N	0.05487	-0.04	0.80722	D	1	B;B	0.27286	0.174;0.03	B;B	0.25987	0.028;0.065	T	0.67122	-0.5750	10	0.59425	D	0.04	.	19.6531	0.95825	0.0:1.0:0.0:0.0	.	324;508	Q3LID3;P55286	.;CADH8_HUMAN	V	508	ENSP00000299345:G508V	ENSP00000299345:G508V	G	-	2	0	CDH8	60318512	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.149000	0.77396	2.715000	0.92844	0.650000	0.86243	GGA		0.378	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796		34	66	1	0	3.21399e-22	0.004878	3.9048e-22	34	66				
FHOD1	29109	broad.mit.edu	37	16	67281227	67281227	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr16:67281227G>C	ENST00000258201.4	-	1	334	c.87C>G	c.(85-87)ttC>ttG	p.F29L	SLC9A5_ENST00000299798.11_5'Flank	NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	29					positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		TGGCACATGCGAAGGGGTCGG	0.721																																							uc002esl.2		NA																	0				breast(2)|ovary(1)	3						c.(85-87)TTC>TTG		formin homology 2 domain containing 1							47.0	45.0	46.0					16																	67281227		2198	4300	6498	SO:0001583	missense	29109				actin cytoskeleton organization	cytoplasm|cytoskeleton|nucleus	actin binding	g.chr16:67281227G>C	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.87C>G	16.37:g.67281227G>C	ENSP00000258201:p.Phe29Leu					FHOD1_uc010ced.2_5'UTR|FHOD1_uc010vjh.1_5'UTR|SLC9A5_uc002esm.2_5'Flank|SLC9A5_uc010cee.2_5'Flank|SLC9A5_uc010vji.1_5'Flank	p.F29L	NM_013241	NP_037373	Q9Y613	FHOD1_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)	1	199	-		Ovarian(137;0.0563)	29					Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	ENST00000258201.4	37	c.87C>G	CCDS10834.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.341892	0.81911	.	.	ENSG00000135723	ENST00000258201	T	0.29142	1.58	5.63	0.361	0.16107	.	0.000000	0.85682	D	0.000000	T	0.20333	0.0489	L	0.56340	1.77	0.80722	D	1	P	0.46784	0.884	B	0.32533	0.147	T	0.04041	-1.0982	10	0.39692	T	0.17	.	8.8207	0.35025	0.4425:0.0:0.5575:0.0	.	29	Q9Y613	FHOD1_HUMAN	L	29	ENSP00000258201:F29L	ENSP00000258201:F29L	F	-	3	2	FHOD1	65838728	0.952000	0.32445	0.800000	0.32199	0.964000	0.63967	1.530000	0.36007	-0.131000	0.11578	-0.258000	0.10820	TTC		0.721	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2			15	18	0	0	0	0.00499	0	15	18				
SF3B3	23450	broad.mit.edu	37	16	70566441	70566441	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr16:70566441C>G	ENST00000302516.5	+	5	841	c.630C>G	c.(628-630)ttC>ttG	p.F210L	SNORD111B_ENST00000408587.1_RNA	NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	210					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				CACTTACTTTCTATGAGCTAG	0.413																																							uc002ezf.2		NA																	0				ovary(1)	1						c.(628-630)TTC>TTG		splicing factor 3b, subunit 3							174.0	153.0	160.0					16																	70566441		2198	4300	6498	SO:0001583	missense	23450				protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding	g.chr16:70566441C>G	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.630C>G	16.37:g.70566441C>G	ENSP00000305790:p.Phe210Leu						p.F210L	NM_012426	NP_036558	Q15393	SF3B3_HUMAN			5	841	+		Ovarian(137;0.0694)	210					Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	ENST00000302516.5	37	c.630C>G	CCDS10894.1	.	.	.	.	.	.	.	.	.	.	C	15.29	2.789800	0.50102	.	.	ENSG00000189091	ENST00000302516;ENST00000310750	T	0.33438	1.41	5.26	4.31	0.51392	.	0.047518	0.85682	D	0.000000	T	0.30008	0.0751	M	0.65498	2.005	0.58432	D	0.999999	B	0.15141	0.012	B	0.24006	0.05	T	0.10613	-1.0622	10	0.33141	T	0.24	.	6.8979	0.24267	0.0:0.6979:0.0:0.3021	.	210	Q15393	SF3B3_HUMAN	L	210	ENSP00000305790:F210L	ENSP00000305790:F210L	F	+	3	2	SF3B3	69123942	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	1.126000	0.31344	1.352000	0.45808	-0.444000	0.05651	TTC		0.413	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426		10	92	0	0	0	0.008291	0	10	92				
IRF8	3394	broad.mit.edu	37	16	85936694	85936695	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr16:85936694_85936695GG>TT	ENST00000268638.5	+	2	495_496	c.73_74GG>TT	c.(73-75)GGa>TTa	p.G25L	IRF8_ENST00000563180.1_Missense_Mutation_p.G25L	NM_002163.2	NP_002154.1	Q02556	IRF8_HUMAN	interferon regulatory factor 8	25					cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	24		Prostate(104;0.0771)				CATGTATCCAGGACTGATTTGG	0.49																																							uc002fjh.2		NA																	0				breast(2)|ovary(1)	3						c.(73-75)GGA>TTA		interferon regulatory factor 8																																				SO:0001583	missense	3394				interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	g.chr16:85936694_85936695GG>TT	M91196	CCDS10956.1	16q24.1	2014-09-17	2004-11-12	2004-11-12	ENSG00000140968	ENSG00000140968			5358	protein-coding gene	gene with protein product		601565	"""interferon consensus sequence binding protein 1"""	ICSBP1		1460054, 11997525	Standard	NM_002163		Approved	IRF-8, ICSBP	uc002fjh.3	Q02556	OTTHUMG00000137648	Exception_encountered	16.37:g.85936694_85936695delinsTT	ENSP00000268638:p.Gly25Leu					IRF8_uc002fji.2_Missense_Mutation_p.G25L	p.G25L	NM_002163	NP_002154	Q02556	IRF8_HUMAN			2	130_131	+		Prostate(104;0.0771)	25			IRF tryptophan pentad repeat.		A0AV82	Missense_Mutation	DNP	ENST00000268638.5	37	c.73_74GG>TT	CCDS10956.1																																																																																				0.490	IRF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269100.2	NM_002163		33	66	0	0	0	0.004672	0	33	66				
ACSF3	197322	broad.mit.edu	37	16	89180750	89180750	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr16:89180750G>A	ENST00000317447.4	+	6	1358	c.981G>A	c.(979-981)ctG>ctA	p.L327L	ACSF3_ENST00000406948.3_Silent_p.L327L|ACSF3_ENST00000378345.4_Silent_p.L62L|CTD-2555A7.3_ENST00000562782.1_RNA	NM_001127214.2|NM_001243279.1|NM_001284316.1|NM_174917.3	NP_001120686.1|NP_001230208.1|NP_001271245.1|NP_777577.2	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3	327					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|malonate catabolic process (GO:0090410)	mitochondrion (GO:0005739)	acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)|malonyl-CoA synthetase activity (GO:0090409)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(9)|prostate(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(80;0.0281)		CGCGTAGGCTGATGGTCTCAG	0.627																																							uc002fmp.2		NA																	0					0						c.(979-981)CTG>CTA		acyl-CoA synthetase family member 3 precursor							125.0	94.0	105.0					16																	89180750		2198	4300	6498	SO:0001819	synonymous_variant	197322				fatty acid metabolic process	mitochondrion	acid-thiol ligase activity|ATP binding	g.chr16:89180750G>A	AK075499	CCDS10974.1, CCDS73926.1	16q24.3	2013-01-15			ENSG00000176715	ENSG00000176715		"""Acyl-CoA synthetase family"""	27288	protein-coding gene	gene with protein product	"""malonyl-CoA synthetase"""	614245				17762044, 21846720	Standard	XM_005256293		Approved		uc010cig.2	Q4G176	OTTHUMG00000138044	ENST00000317447.4:c.981G>A	16.37:g.89180750G>A						ACSF3_uc010cig.1_Silent_p.L327L|ACSF3_uc010cih.1_Silent_p.L62L|ACSF3_uc002fmq.1_Intron|ACSF3_uc010cii.1_RNA|ACSF3_uc002fmr.1_Silent_p.L62L	p.L327L	NM_174917	NP_777577	Q4G176	ACSF3_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0281)	6	1321	+			327					A8K4J8|C9JQL6|Q6INA0|Q8N2F7	Silent	SNP	ENST00000317447.4	37	c.981G>A	CCDS10974.1	.	.	.	.	.	.	.	.	.	.	g	3.298	-0.143394	0.06669	.	.	ENSG00000176715	ENST00000543676	.	.	.	5.02	-2.71	0.05986	.	.	.	.	.	T	0.51126	0.1656	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47586	-0.9106	4	.	.	.	-11.7292	7.485	0.27427	0.3366:0.2133:0.4501:0.0	.	.	.	.	N	75	.	.	D	+	1	0	ACSF3	87708251	1.000000	0.71417	0.966000	0.40874	0.033000	0.12548	0.800000	0.27042	-0.237000	0.09739	-1.400000	0.01143	GAT		0.627	ACSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269919.1	NM_174917		16	51	0	0	0	0.00499	0	16	51				
P2RX5	5026	broad.mit.edu	37	17	3592883	3592883	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:3592883G>A	ENST00000225328.5	-	7	1054	c.656C>T	c.(655-657)tCa>tTa	p.S219L	P2RX5_ENST00000551178.1_Missense_Mutation_p.S194L|P2RX5_ENST00000552276.1_Missense_Mutation_p.S218L|P2RX5_ENST00000547178.1_Missense_Mutation_p.S218L|P2RX5-TAX1BP3_ENST00000550383.1_Missense_Mutation_p.S219L|P2RX5_ENST00000345901.3_Missense_Mutation_p.S195L|P2RX5_ENST00000550772.1_Intron|P2RX5_ENST00000435558.1_Missense_Mutation_p.S219L|P2RX5_ENST00000552050.1_Missense_Mutation_p.S159L	NM_001204519.1|NM_002561.3	NP_001191448.1|NP_002552.2	Q93086	P2RX5_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 5	219					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transport (GO:0006810)	integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|ion channel activity (GO:0005216)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	11						AAAGTGGCATGATTTCAGGAA	0.567																																							uc002fwi.2		NA																	0					0						c.(655-657)TCA>TTA		purinergic receptor P2X5 isoform A							243.0	188.0	207.0					17																	3592883		2203	4300	6503	SO:0001583	missense	5026				nervous system development|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling	integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity	g.chr17:3592883G>A	AF016709	CCDS11034.1, CCDS11035.1, CCDS56014.1, CCDS56015.1	17p13.3	2012-01-17			ENSG00000083454	ENSG00000083454		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8536	protein-coding gene	gene with protein product		602836				9414125	Standard	NM_002561		Approved	P2X5	uc002fwi.3	Q93086	OTTHUMG00000090700	ENST00000225328.5:c.656C>T	17.37:g.3592883G>A	ENSP00000225328:p.Ser219Leu					P2RX5_uc002fwd.2_RNA|P2RX5_uc002fwh.1_Missense_Mutation_p.S218L|P2RX5_uc010vrx.1_Missense_Mutation_p.S159L|P2RX5_uc002fwj.2_Missense_Mutation_p.S194L|P2RX5_uc002fwk.2_Missense_Mutation_p.S218L|P2RX5_uc002fwl.2_Missense_Mutation_p.S195L	p.S219L	NM_002561	NP_002552	Q93086	P2RX5_HUMAN			7	940	-			219			Extracellular (Potential).		G5E981|O43450|O75540|Q308M5|Q59F38|Q8IXW4|Q93087|Q9NZV0	Missense_Mutation	SNP	ENST00000225328.5	37	c.656C>T	CCDS11034.1	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121509	0.37436	.	.	ENSG00000083454	ENST00000435558;ENST00000551178;ENST00000547178;ENST00000225328;ENST00000345901;ENST00000552050	T;T;T;T;T;T	0.04603	3.59;3.59;3.59;3.59;3.59;3.59	5.44	3.46	0.39613	.	0.635367	0.16652	N	0.205184	T	0.10208	0.0250	L	0.61036	1.89	0.24834	N	0.992507	P;P;P;P;B;B	0.40534	0.72;0.58;0.58;0.58;0.434;0.38	P;B;B;B;B;B	0.47118	0.538;0.311;0.373;0.311;0.403;0.281	T	0.09465	-1.0673	10	0.27785	T	0.31	-4.8436	11.5605	0.50774	0.1451:0.0:0.8549:0.0	.	159;195;218;194;219;219	B4DEG2;G5E981;Q93086-1;Q93086-2;Q93086;Q93086-4	.;.;.;.;P2RX5_HUMAN;.	L	219;194;218;219;195;159	ENSP00000415370:S219L;ENSP00000447545:S194L;ENSP00000448355:S218L;ENSP00000225328:S219L;ENSP00000342161:S195L;ENSP00000450006:S159L	ENSP00000225328:S219L	S	-	2	0	P2RX5	3539632	0.004000	0.15560	0.629000	0.29254	0.298000	0.27526	0.188000	0.17018	0.799000	0.34018	-0.150000	0.13652	TCA		0.567	P2RX5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207388.3	NM_002561, NM_175080, NM_175081		22	86	0	0	0	0.005443	0	22	86				
ITGAE	3682	broad.mit.edu	37	17	3661042	3661042	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:3661042G>C	ENST00000263087.4	-	9	1076	c.978C>G	c.(976-978)atC>atG	p.I326M		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	326	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		TGGGGGAGTTGATGACTGTCG	0.582																																					NSCLC(182;635 2928 8995 38788)	NSCLC(182;635 2928 8995 38788)	uc002fwo.3		NA																	0				large_intestine(2)|breast(1)|pancreas(1)	4						c.(976-978)ATC>ATG		integrin, alpha E precursor							221.0	211.0	214.0					17																	3661042		2203	4300	6503	SO:0001583	missense	3682				cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity	g.chr17:3661042G>C	L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.978C>G	17.37:g.3661042G>C	ENSP00000263087:p.Ile326Met						p.I326M	NM_002208	NP_002199	P38570	ITAE_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)	9	1077	-			326			VWFA.|Extracellular (Potential).		Q17RS6|Q9NZU9	Missense_Mutation	SNP	ENST00000263087.4	37	c.978C>G	CCDS32531.1	.	.	.	.	.	.	.	.	.	.	G	11.24	1.580602	0.28180	.	.	ENSG00000083457	ENST00000263087	T	0.78707	-1.2	5.56	4.53	0.55603	von Willebrand factor, type A (3);	.	.	.	.	T	0.73713	0.3622	L	0.43598	1.365	0.36209	D	0.851254	P	0.39094	0.659	B	0.42882	0.401	T	0.78871	-0.2033	9	0.49607	T	0.09	.	12.3694	0.55246	0.0:0.2808:0.7192:0.0	.	326	P38570	ITAE_HUMAN	M	326	ENSP00000263087:I326M	ENSP00000263087:I326M	I	-	3	3	ITGAE	3607791	0.999000	0.42202	1.000000	0.80357	0.163000	0.22366	1.325000	0.33724	2.787000	0.95880	0.514000	0.50259	ATC		0.582	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438169.1	NM_002208		45	153	0	0	0	0.01441	0	45	153				
GP1BA	2811	broad.mit.edu	37	17	4835987	4835987	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:4835987G>C	ENST00000329125.5	+	2	163	c.88G>C	c.(88-90)Gaa>Caa	p.E30Q		NM_000173.5	NP_000164.5	P07359	GP1BA_HUMAN	glycoprotein Ib (platelet), alpha polypeptide	30	LRRNT.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|fibrinolysis (GO:0042730)|platelet activation (GO:0030168)|regulation of blood coagulation (GO:0030193)|thrombin receptor signaling pathway (GO:0070493)	anchored component of external side of plasma membrane (GO:0031362)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(5)|stomach(1)|urinary_tract(1)	20						CAGCCACCTAGAAGTGAACTG	0.577																																							uc010vsq.1		NA																	0					0						c.(88-90)GAA>CAA		platelet glycoprotein Ib alpha polypeptide							130.0	133.0	132.0					17																	4835987		2161	4264	6425	SO:0001583	missense	2811							g.chr17:4835987G>C		CCDS54068.1	17p13.2	2014-09-17			ENSG00000185245	ENSG00000185245		"""CD molecules"""	4439	protein-coding gene	gene with protein product		606672		GP1B		3353370	Standard	NM_000173		Approved	CD42b	uc021tnz.1	P07359	OTTHUMG00000177946	ENST00000329125.5:c.88G>C	17.37:g.4835987G>C	ENSP00000329380:p.Glu30Gln					uc002fzn.1_RNA	p.E30Q	NM_000173	NP_000164	P07359	GP1BA_HUMAN			2	163	+			30					E7ES66|Q14441|Q16469|Q8N1F3|Q8NG39|Q9HDC7|Q9UEK1|Q9UQS4	Missense_Mutation	SNP	ENST00000329125.5	37	c.88G>C	CCDS54068.1	.	.	.	.	.	.	.	.	.	.	G	12.94	2.089820	0.36855	.	.	ENSG00000185245	ENST00000329125;ENST00000438881	D	0.96522	-4.04	4.39	1.08	0.20341	.	0.515573	0.14563	N	0.311942	D	0.95258	0.8462	M	0.83012	2.62	0.09310	N	1	P	0.35011	0.48	B	0.39771	0.309	D	0.90541	0.4502	10	0.72032	D	0.01	1.1854	4.0519	0.09800	0.0933:0.1588:0.5841:0.1638	.	30	A5CKE2	.	Q	30	ENSP00000329380:E30Q	ENSP00000329380:E30Q	E	+	1	0	GP1BA	4776767	0.332000	0.24722	0.006000	0.13384	0.750000	0.42670	1.249000	0.32839	-0.033000	0.13736	0.305000	0.20034	GAA		0.577	GP1BA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439889.1			22	92	0	0	0	0.00333	0	22	92				
AIPL1	23746	broad.mit.edu	37	17	6329120	6329120	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:6329120C>G	ENST00000381129.3	-	6	895	c.815G>C	c.(814-816)cGg>cCg	p.R272P	AIPL1_ENST00000574506.1_Missense_Mutation_p.R260P|AIPL1_ENST00000575265.1_3'UTR|AIPL1_ENST00000250087.5_Missense_Mutation_p.R209P|AIPL1_ENST00000576776.1_Missense_Mutation_p.R248P|AIPL1_ENST00000576307.1_Missense_Mutation_p.R212P|AIPL1_ENST00000570466.1_Missense_Mutation_p.R250P	NM_001033055.1|NM_014336.3	NP_001028227.1|NP_055151.3	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting protein-like 1	272					negative regulation of apoptotic process (GO:0043066)|phototransduction, visible light (GO:0007603)|protein farnesylation (GO:0018343)|protein folding (GO:0006457)|regulation of cGMP metabolic process (GO:0030823)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)	farnesylated protein binding (GO:0001918)|unfolded protein binding (GO:0051082)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	12				COAD - Colon adenocarcinoma(228;0.141)		TGCGTGAGCCCGGGCACGCAC	0.667																																							uc002gcp.2		NA																	0					0						c.(814-816)CGG>CCG		aryl hydrocarbon receptor interacting							28.0	28.0	28.0					17																	6329120		2203	4300	6503	SO:0001583	missense	23746				protein farnesylation|protein folding|visual perception	cytoplasm|nucleus	farnesylated protein binding|unfolded protein binding	g.chr17:6329120C>G	AF148864	CCDS11075.1, CCDS32539.1, CCDS32540.1, CCDS67130.1, CCDS67131.1, CCDS67132.1, CCDS67133.1	17p13.1	2013-01-08	2001-11-29		ENSG00000129221	ENSG00000129221			359	protein-coding gene	gene with protein product		604392	"""aryl hydrocarbon receptor-interacting protein-like 1"""	LCA4		10615133, 14555765, 15365173	Standard	NM_001285402		Approved		uc002gcp.3	Q9NZN9	OTTHUMG00000102043	ENST00000381129.3:c.815G>C	17.37:g.6329120C>G	ENSP00000370521:p.Arg272Pro					AIPL1_uc002gcq.2_Missense_Mutation_p.R212P|AIPL1_uc002gcr.2_Missense_Mutation_p.R209P|AIPL1_uc010clk.2_Missense_Mutation_p.R250P|AIPL1_uc010cll.2_Missense_Mutation_p.R248P|AIPL1_uc002gcs.2_3'UTR	p.R272P	NM_014336	NP_055151	Q9NZN9	AIPL1_HUMAN		COAD - Colon adenocarcinoma(228;0.141)	6	910	-			272			TPR 3.		D3DTM4|Q659W3|Q659W4|Q6ZZB6|Q8N6A0|Q9H873|Q9NS10	Missense_Mutation	SNP	ENST00000381129.3	37	c.815G>C	CCDS11075.1	.	.	.	.	.	.	.	.	.	.	C	15.77	2.930558	0.52866	.	.	ENSG00000129221	ENST00000381129;ENST00000381128;ENST00000250087;ENST00000444243	D;D	0.88818	-2.43;-2.43	4.9	2.86	0.33363	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.053068	0.64402	D	0.000001	D	0.90438	0.7006	L	0.60455	1.87	0.80722	D	1	D;D;D;D;D	0.76494	0.995;0.977;0.999;0.999;0.997	P;P;D;D;D	0.67900	0.879;0.856;0.923;0.938;0.954	D	0.87612	0.2504	10	0.62326	D	0.03	-27.6543	4.3115	0.10972	0.1828:0.6271:0.0:0.1901	.	248;250;209;212;272	Q659W3;Q659W4;Q9NZN9-3;Q9NZN9-2;Q9NZN9	.;.;.;.;AIPL1_HUMAN	P	272;212;209;272	ENSP00000370521:R272P;ENSP00000250087:R209P	ENSP00000250087:R209P	R	-	2	0	AIPL1	6269844	1.000000	0.71417	0.995000	0.50966	0.529000	0.34654	5.674000	0.68117	0.463000	0.27118	0.462000	0.41574	CGG		0.667	AIPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219828.3	NM_014336		4	19	0	0	0	0.000602	0	4	19				
ACADVL	37	broad.mit.edu	37	17	7126511	7126511	+	Missense_Mutation	SNP	C	C	G	rs561591640		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:7126511C>G	ENST00000356839.5	+	11	1316	c.1137C>G	c.(1135-1137)atC>atG	p.I379M	ACADVL_ENST00000350303.5_Missense_Mutation_p.I357M|ACADVL_ENST00000543245.2_Missense_Mutation_p.I402M|MIR324_ENST00000362183.1_RNA	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain	379	Catalytic.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						TTGGGCTGATCCAGGAGAAGC	0.557																																							uc002gev.2		NA																	0				ovary(3)	3						c.(1135-1137)ATC>ATG		acyl-Coenzyme A dehydrogenase, very long chain							147.0	147.0	147.0					17																	7126511		2203	4300	6503	SO:0001583	missense	37				energy derivation by oxidation of organic compounds|fatty acid beta-oxidation using acyl-CoA dehydrogenase|negative regulation of fatty acid biosynthetic process|negative regulation of fatty acid oxidation|regulation of cholesterol metabolic process|temperature homeostasis	mitochondrial inner membrane|mitochondrial nucleoid	long-chain-acyl-CoA dehydrogenase activity	g.chr17:7126511C>G	BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.1137C>G	17.37:g.7126511C>G	ENSP00000349297:p.Ile379Met					ACADVL_uc010vtp.1_Missense_Mutation_p.I389M|ACADVL_uc010vtq.1_3'UTR|ACADVL_uc002gew.2_Missense_Mutation_p.I357M|ACADVL_uc002gex.2_Missense_Mutation_p.I303M	p.I379M	NM_000018	NP_000009	P49748	ACADV_HUMAN			11	1288	+			379			Catalytic.		B4DEB6|F5H2A9|O76056|Q8WUL0	Missense_Mutation	SNP	ENST00000356839.5	37	c.1137C>G	CCDS11090.1	.	.	.	.	.	.	.	.	.	.	C	16.73	3.203357	0.58234	.	.	ENSG00000072778	ENST00000543245;ENST00000356839;ENST00000350303;ENST00000322910;ENST00000542255	D;D	0.96856	-4.15;-4.15	5.62	2.54	0.30619	Acyl-CoA dehydrogenase/oxidase C-terminal (2);Acyl-CoA oxidase/dehydrogenase, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.97579	0.9207	M	0.83774	2.66	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.996	D	0.96946	0.9691	10	0.72032	D	0.01	.	9.0136	0.36157	0.0:0.7559:0.0:0.2441	.	402;357;379	F5H2A9;P49748-2;P49748	.;.;ACADV_HUMAN	M	402;425;357;379;425	ENSP00000438689:I402M;ENSP00000344152:I357M	ENSP00000325395:I379M	I	+	3	3	ACADVL	7067235	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.951000	0.29135	0.733000	0.32492	0.655000	0.94253	ATC		0.557	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220001.5	NM_000018		4	67	0	0	0	0.000602	0	4	67				
CHD3	1107	broad.mit.edu	37	17	7794291	7794291	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:7794291C>G	ENST00000330494.7	+	4	568	c.418C>G	c.(418-420)Ctg>Gtg	p.L140V	CHD3_ENST00000380358.4_Missense_Mutation_p.L199V|CHD3_ENST00000358181.4_Missense_Mutation_p.L140V	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	140					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				AACTCTGCTTCTGACCTGGGG	0.562																																							uc002gje.2		NA																	0				breast(1)	1						c.(418-420)CTG>GTG		chromodomain helicase DNA binding protein 3							150.0	134.0	139.0					17																	7794291		2203	4300	6503	SO:0001583	missense	1107				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|zinc ion binding	g.chr17:7794291C>G	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.418C>G	17.37:g.7794291C>G	ENSP00000332628:p.Leu140Val					CHD3_uc002gjd.2_Missense_Mutation_p.L199V|CHD3_uc002gjf.2_Missense_Mutation_p.L140V|CHD3_uc002gjg.1_5'UTR	p.L140V	NM_001005273	NP_001005273	Q12873	CHD3_HUMAN			4	568	+		Prostate(122;0.202)	140					D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	37	c.418C>G	CCDS32554.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.30|10.30	1.312749|1.312749	0.23908|0.23908	.|.	.|.	ENSG00000170004|ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494|ENST00000452447	T;D;D|.	0.89415|.	-0.74;-2.51;-2.51|.	4.54|4.54	4.54|4.54	0.55810|0.55810	.|.	0.000000|.	0.36409|.	N|.	0.002605|.	T|T	0.30759|0.30759	0.0775|0.0775	N|N	0.22421|0.22421	0.69|0.69	0.29107|0.29107	N|N	0.881095|0.881095	B;B;B|.	0.22800|.	0.073;0.075;0.023|.	B;B;B|.	0.25291|.	0.059;0.027;0.01|.	T|T	0.14254|0.14254	-1.0479|-1.0479	10|5	0.34782|.	T|.	0.22|.	-11.0357|-11.0357	7.7056|7.7056	0.28648|0.28648	0.2298:0.6185:0.1517:0.0|0.2298:0.6185:0.1517:0.0	.|.	140;140;199|.	Q12873-2;Q12873;E9PG89|.	.;CHD3_HUMAN;.|.	V|C	199;140;140|14	ENSP00000369716:L199V;ENSP00000350907:L140V;ENSP00000332628:L140V|.	ENSP00000332628:L140V|.	L|S	+|+	1|2	2|0	CHD3|CHD3	7735016|7735016	0.055000|0.055000	0.20627|0.20627	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	0.625000|0.625000	0.24477|0.24477	2.349000|2.349000	0.79799|0.79799	0.557000|0.557000	0.71058|0.71058	CTG|TCT		0.562	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	NM_001005273		27	91	0	0	0	0.009535	0	27	91				
MYH13	8735	broad.mit.edu	37	17	10265786	10265786	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:10265786A>T	ENST00000418404.3	-	3	402	c.239T>A	c.(238-240)aTg>aAg	p.M80K	MYH13_ENST00000252172.4_Missense_Mutation_p.M80K			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	80					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						GGGAGGGTTCATGGGGAAGAC	0.488																																							uc002gmk.1		NA																	0				ovary(4)|skin(2)	6						c.(238-240)ATG>AAG		myosin, heavy polypeptide 13, skeletal muscle							269.0	247.0	254.0					17																	10265786		2203	4300	6503	SO:0001583	missense	8735				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10265786A>T	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.239T>A	17.37:g.10265786A>T	ENSP00000404570:p.Met80Lys						p.M80K	NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN			4	329	-			80			Myosin head-like.		O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	c.239T>A	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	A	14.83	2.652377	0.47362	.	.	ENSG00000006788	ENST00000252172	T	0.71934	-0.61	4.48	4.48	0.54585	Myosin head, motor domain (1);	.	.	.	.	T	0.74053	0.3666	M	0.69823	2.125	0.42755	D	0.993783	B	0.25955	0.138	B	0.36719	0.231	T	0.76449	-0.2955	9	0.66056	D	0.02	.	14.2298	0.65885	1.0:0.0:0.0:0.0	.	80	Q9UKX3	MYH13_HUMAN	K	80	ENSP00000252172:M80K	ENSP00000252172:M80K	M	-	2	0	MYH13	10206511	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.993000	0.40747	2.013000	0.59113	0.377000	0.23210	ATG		0.488	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		23	87	0	0	0	0.005443	0	23	87				
DNAH9	1770	broad.mit.edu	37	17	11757715	11757715	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:11757715G>T	ENST00000262442.4	+	50	9971	c.9903G>T	c.(9901-9903)gaG>gaT	p.E3301D	DNAH9_ENST00000454412.2_Missense_Mutation_p.E3301D	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3301	Stalk. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CTGCCCAGGAGAAGCTGGCTG	0.547																																							uc002gne.2		NA																	0				skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(9901-9903)GAG>GAT		dynein, axonemal, heavy chain 9 isoform 2							42.0	44.0	43.0					17																	11757715		2203	4300	6503	SO:0001583	missense	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11757715G>T	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.9903G>T	17.37:g.11757715G>T	ENSP00000262442:p.Glu3301Asp					DNAH9_uc010coo.2_Missense_Mutation_p.E2595D	p.E3301D	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	50	9971	+		Breast(5;0.0122)|all_epithelial(5;0.131)	3301			Stalk (By similarity).|Potential.		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	c.9903G>T	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	G	10.44	1.350556	0.24512	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.75367	-0.93;-0.93	5.44	3.35	0.38373	Dynein heavy chain, coiled coil stalk (1);	0.335650	0.32819	N	0.005604	T	0.54759	0.1878	L	0.28054	0.825	0.80722	D	1	B	0.14012	0.009	B	0.25405	0.06	T	0.42447	-0.9451	10	0.15499	T	0.54	.	3.6057	0.08042	0.3139:0.2154:0.4707:0.0	.	3301	Q9NYC9	DYH9_HUMAN	D	3301;3301;1883	ENSP00000262442:E3301D;ENSP00000414874:E3301D	ENSP00000262442:E3301D	E	+	3	2	DNAH9	11698440	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	1.074000	0.30703	1.532000	0.49169	0.655000	0.94253	GAG		0.547	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		14	18	1	0	6.72482e-11	0.003163	7.64132e-11	14	18				
SLC47A1	55244	broad.mit.edu	37	17	19470431	19470431	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:19470431G>A	ENST00000270570.4	+	14	1285	c.1199G>A	c.(1198-1200)aGg>aAg	p.R400K	SLC47A1_ENST00000575023.1_Intron|SLC47A1_ENST00000571335.1_Missense_Mutation_p.R205K|SLC47A1_ENST00000436810.2_Missense_Mutation_p.R377K|SLC47A1_ENST00000395585.1_Missense_Mutation_p.R400K|RP11-1113L8.1_ENST00000574267.1_RNA|SLC47A1_ENST00000457293.1_Missense_Mutation_p.R400K	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	400					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	GGTGTTCTGAGGGGGAGTGGA	0.527																																							uc002gvy.1		NA																	0					0						c.(1198-1200)AGG>AAG		solute carrier family 47, member 1							317.0	257.0	277.0					17																	19470431		2203	4300	6503	SO:0001583	missense	55244					integral to membrane|plasma membrane	drug:hydrogen antiporter activity	g.chr17:19470431G>A		CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.1199G>A	17.37:g.19470431G>A	ENSP00000270570:p.Arg400Lys					SLC47A1_uc002gvx.2_Missense_Mutation_p.R400K|SLC47A1_uc010vyz.1_Missense_Mutation_p.R377K|SLC47A1_uc010cqp.1_Intron|SLC47A1_uc010cqq.1_Missense_Mutation_p.R205K|SLC47A1_uc010vza.1_Missense_Mutation_p.R112K|SLC47A1_uc010vzb.1_Missense_Mutation_p.R134K|SLC47A1_uc010vzc.1_Missense_Mutation_p.R72K	p.R400K	NM_018242	NP_060712	Q96FL8	S47A1_HUMAN			14	1285	+	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)		400			Cytoplasmic (Potential).		Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Missense_Mutation	SNP	ENST00000270570.4	37	c.1199G>A	CCDS11209.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.201152	0.79015	.	.	ENSG00000142494	ENST00000436810;ENST00000270570;ENST00000457293;ENST00000395585;ENST00000455670;ENST00000424755	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	5.25	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.66636	0.2809	H	0.94264	3.515	0.80722	D	1	P;D;B;P;D	0.64830	0.926;0.994;0.41;0.859;0.994	P;D;B;P;D	0.64237	0.759;0.923;0.326;0.759;0.919	T	0.75425	-0.3322	10	0.59425	D	0.04	-2.7075	12.4828	0.55854	0.0818:0.0:0.9182:0.0	.	134;377;134;400;400	E7ENC3;E7EX57;B4DDH5;Q96FL8;Q96FL8-3	.;.;.;S47A1_HUMAN;.	K	377;400;400;400;134;112	ENSP00000407155:R377K;ENSP00000270570:R400K;ENSP00000415586:R400K;ENSP00000378951:R400K	ENSP00000270570:R400K	R	+	2	0	SLC47A1	19411023	1.000000	0.71417	0.217000	0.23759	0.738000	0.42128	7.471000	0.80985	1.214000	0.43395	0.655000	0.94253	AGG		0.527	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132250.1	NM_018242		8	196	0	0	0	0.004482	0	8	196				
SPECC1	92521	broad.mit.edu	37	17	20108581	20108581	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:20108581G>T	ENST00000261503.5	+	4	1270	c.1219G>T	c.(1219-1221)Gaa>Taa	p.E407*	SPECC1_ENST00000584527.1_5'Flank|SPECC1_ENST00000395525.3_Nonsense_Mutation_p.E326*|SPECC1_ENST00000395530.2_Nonsense_Mutation_p.E326*|SPECC1_ENST00000536879.1_Intron|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395522.2_Nonsense_Mutation_p.E326*|SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000395527.4_Nonsense_Mutation_p.E407*|SPECC1_ENST00000395529.3_Nonsense_Mutation_p.E407*	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	407					cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		AATGGTACAGGAATTGACAGC	0.418																																							uc002gwq.2		NA																	0					0						c.(1219-1221)GAA>TAA		spectrin domain with coiled-coils 1 NSP5b3b							61.0	65.0	64.0					17																	20108581		2203	4299	6502	SO:0001587	stop_gained	92521					nucleus		g.chr17:20108581G>T	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.1219G>T	17.37:g.20108581G>T	ENSP00000261503:p.Glu407*					CYTSB_uc010cqx.2_Nonsense_Mutation_p.E407*|CYTSB_uc002gwr.2_Nonsense_Mutation_p.E407*|CYTSB_uc002gws.2_Nonsense_Mutation_p.E407*|CYTSB_uc002gwv.2_Nonsense_Mutation_p.E326*|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gww.2_Nonsense_Mutation_p.E183*|CYTSB_uc002gwt.2_Nonsense_Mutation_p.E326*|CYTSB_uc002gwu.2_Nonsense_Mutation_p.E326*	p.E407*	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN			4	1364	+			407					B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Nonsense_Mutation	SNP	ENST00000261503.5	37	c.1219G>T	CCDS32590.1	.	.	.	.	.	.	.	.	.	.	G	36	5.923489	0.97110	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529;ENST00000395522;ENST00000395527;ENST00000395525	.	.	.	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-25.2035	16.4239	0.83808	0.0:0.0:1.0:0.0	.	.	.	.	X	407;407;407;326;326;326	.	ENSP00000261503:E407X	E	+	1	0	SPECC1	20049173	1.000000	0.71417	0.998000	0.56505	0.684000	0.39900	9.414000	0.97362	2.549000	0.85964	0.655000	0.94253	GAA		0.418	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904		14	53	1	0	0.00244969	0.00245	0.00252933	14	53				
SPECC1	92521	broad.mit.edu	37	17	20108588	20108588	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:20108588C>T	ENST00000261503.5	+	4	1277	c.1226C>T	c.(1225-1227)aCa>aTa	p.T409I	SPECC1_ENST00000584527.1_5'Flank|SPECC1_ENST00000395525.3_Missense_Mutation_p.T328I|SPECC1_ENST00000395530.2_Missense_Mutation_p.T328I|SPECC1_ENST00000536879.1_Intron|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395522.2_Missense_Mutation_p.T328I|SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000395527.4_Missense_Mutation_p.T409I|SPECC1_ENST00000395529.3_Missense_Mutation_p.T409I	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	409					cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		CAGGAATTGACAGCTGAAAAT	0.413																																							uc002gwq.2		NA																	0					0						c.(1225-1227)ACA>ATA		spectrin domain with coiled-coils 1 NSP5b3b							61.0	64.0	63.0					17																	20108588		2203	4299	6502	SO:0001583	missense	92521					nucleus		g.chr17:20108588C>T	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.1226C>T	17.37:g.20108588C>T	ENSP00000261503:p.Thr409Ile					CYTSB_uc010cqx.2_Missense_Mutation_p.T409I|CYTSB_uc002gwr.2_Missense_Mutation_p.T409I|CYTSB_uc002gws.2_Missense_Mutation_p.T409I|CYTSB_uc002gwv.2_Missense_Mutation_p.T328I|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gww.2_Missense_Mutation_p.T185I|CYTSB_uc002gwt.2_Missense_Mutation_p.T328I|CYTSB_uc002gwu.2_Missense_Mutation_p.T328I	p.T409I	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN			4	1371	+			409					B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	ENST00000261503.5	37	c.1226C>T	CCDS32590.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.961054	0.74016	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529;ENST00000395522;ENST00000395527;ENST00000395525	T;T;T;T	0.06608	3.28;3.28;3.28;3.28	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.25938	0.0632	M	0.73598	2.24	0.80722	D	1	D;D;D;D;D	0.89917	0.997;1.0;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.922;0.999;0.999;0.999;0.961	T	0.00475	-1.1717	10	0.72032	D	0.01	-20.9437	16.4239	0.83808	0.0:1.0:0.0:0.0	.	409;328;328;409;409	A8MV89;Q5M775-4;Q5M775-3;Q5M775-2;Q5M775	.;.;.;.;CYTSB_HUMAN	I	409;409;409;328;328;328	ENSP00000261503:T409I;ENSP00000378900:T409I;ENSP00000378893:T328I;ENSP00000378896:T328I	ENSP00000261503:T409I	T	+	2	0	SPECC1	20049180	1.000000	0.71417	0.987000	0.45799	0.832000	0.47134	5.631000	0.67812	2.549000	0.85964	0.655000	0.94253	ACA		0.413	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904		14	54	0	0	0	0.00245	0	14	54				
RHOT1	55288	broad.mit.edu	37	17	30526552	30526552	+	Silent	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:30526552A>G	ENST00000333942.6	+	13	1322	c.1083A>G	c.(1081-1083)ggA>ggG	p.G361G	RHOT1_ENST00000581094.1_Silent_p.G361G|RHOT1_ENST00000545287.2_Silent_p.G361G|RHOT1_ENST00000358365.3_Silent_p.G361G|RHOT1_ENST00000394692.2_Silent_p.G361G|RHOT1_ENST00000583994.1_Silent_p.G234G|RHOT1_ENST00000354266.3_Silent_p.G340G	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1	361					cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				CCTACCAGGGATTCCTTTCCC	0.378																																							uc002hgz.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(1081-1083)GGA>GGG		ras homolog gene family, member T1 isoform 3							104.0	100.0	101.0					17																	30526552		2203	4300	6503	SO:0001819	synonymous_variant	55288				apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding	g.chr17:30526552A>G	AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.1083A>G	17.37:g.30526552A>G						RHOT1_uc002hgw.2_Silent_p.G361G|RHOT1_uc002hgy.2_Silent_p.G361G|RHOT1_uc002hha.2_Silent_p.G234G|RHOT1_uc010csv.2_RNA|RHOT1_uc002hgx.2_Silent_p.G234G|RHOT1_uc010wby.1_Silent_p.G361G|RHOT1_uc002hhb.2_Silent_p.G340G|RHOT1_uc002hgv.2_Silent_p.G361G	p.G361G	NM_018307	NP_060777	Q8IXI2	MIRO1_HUMAN			13	1322	+		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)	361			Mitochondrial intermembrane (Potential).		A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	Silent	SNP	ENST00000333942.6	37	c.1083A>G	CCDS32612.1																																																																																				0.378	RHOT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000447097.1	NM_018307		25	70	0	0	0	0.007291	0	25	70				
MED1	5469	broad.mit.edu	37	17	37563895	37563895	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:37563895T>C	ENST00000300651.6	-	17	4802	c.4579A>G	c.(4579-4581)Agc>Ggc	p.S1527G	MED1_ENST00000394287.3_Intron|CTB-131K11.1_ENST00000582842.1_RNA	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GGCTTGATGCTATGAGATTTT	0.428										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)	Pancreas(21;279 768 2492 4877 24026)	uc002hrv.3		NA																	0				lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8						c.(4579-4581)AGC>GGC		mediator complex subunit 1							222.0	202.0	209.0					17																	37563895		2203	4300	6503	SO:0001583	missense	5469				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:37563895T>C	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.4579A>G	17.37:g.37563895T>C	ENSP00000300651:p.Ser1527Gly	HNSCC(31;0.082)				MED1_uc010wee.1_Missense_Mutation_p.S1355G|MED1_uc002hru.2_Intron	p.S1527G	NM_004774	NP_004765	Q15648	MED1_HUMAN	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)	17	4791	-		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	1527			Lys-rich.		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000300651.6	37	c.4579A>G	CCDS11336.1	.	.	.	.	.	.	.	.	.	.	T	10.42	1.344012	0.24339	.	.	ENSG00000125686	ENST00000300651	T	0.33654	1.4	5.78	5.78	0.91487	.	.	.	.	.	T	0.25382	0.0617	N	0.19112	0.55	0.33279	D	0.56207	B	0.02656	0.0	B	0.04013	0.001	T	0.24905	-1.0147	9	0.39692	T	0.17	-8.0644	11.9497	0.52948	0.0:0.0692:0.0:0.9307	.	1527	Q15648	MED1_HUMAN	G	1527	ENSP00000300651:S1527G	ENSP00000300651:S1527G	S	-	1	0	MED1	34817421	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.628000	0.46477	2.200000	0.70718	0.533000	0.62120	AGC		0.428	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256943.3	NM_004774		30	70	0	0	0	0.010818	0	30	70				
TOP2A	7153	broad.mit.edu	37	17	38556186	38556186	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:38556186G>A	ENST00000423485.1	-	24	3292	c.3134C>T	c.(3133-3135)tCt>tTt	p.S1045F		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	1045					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	CAGTTTAGCAGATTCAGCACC	0.333																																							uc002huq.2		NA																	0				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						c.(3133-3135)TCT>TTT		DNA topoisomerase II, alpha isozyme	Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Gatifloxacin(DB01044)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)						73.0	69.0	70.0					17																	38556186		1835	4071	5906	SO:0001583	missense	7153				apoptotic chromosome condensation|DNA ligation|DNA repair|DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|phosphatidylinositol-mediated signaling|positive regulation of apoptosis|positive regulation of retroviral genome replication|resolution of meiotic recombination intermediates|sister chromatid segregation	cytoplasm|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|drug binding|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity|ubiquitin binding	g.chr17:38556186G>A		CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.3134C>T	17.37:g.38556186G>A	ENSP00000411532:p.Ser1045Phe						p.S1045F	NM_001067	NP_001058	P11388	TOP2A_HUMAN	STAD - Stomach adenocarcinoma(5;0.00183)		24	3260	-		Breast(137;0.00328)	1045					B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Missense_Mutation	SNP	ENST00000423485.1	37	c.3134C>T	CCDS45672.1	.	.	.	.	.	.	.	.	.	.	G	13.21	2.169932	0.38315	.	.	ENSG00000131747	ENST00000423485;ENST00000269577;ENST00000348049;ENST00000357601	T	0.24350	1.86	5.41	5.41	0.78517	DNA topoisomerase, type IIA, subunit A/C-terminal (2);DNA topoisomerase, type IIA, subunit A/ C-terminal, alpha-beta (1);DNA topoisomerase, type IIA, central (1);	0.138996	0.64402	D	0.000003	T	0.30070	0.0753	L	0.31526	0.94	0.80722	D	1	P	0.40211	0.707	P	0.49421	0.61	T	0.01238	-1.1409	10	0.10902	T	0.67	.	19.561	0.95373	0.0:0.0:1.0:0.0	.	1045	P11388	TOP2A_HUMAN	F	1045;1125;1068;1081	ENSP00000411532:S1045F	ENSP00000269577:S1125F	S	-	2	0	TOP2A	35809712	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.514000	0.60482	2.696000	0.92011	0.655000	0.94253	TCT		0.333	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1			4	31	0	0	0	0.009096	0	4	31				
BRCA1	672	broad.mit.edu	37	17	41258529	41258529	+	Silent	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:41258529G>T	ENST00000357654.3	-	4	274	c.156C>A	c.(154-156)ctC>ctA	p.L52L	BRCA1_ENST00000352993.3_Silent_p.L52L|BRCA1_ENST00000471181.2_Silent_p.L52L|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000491747.2_Silent_p.L52L|BRCA1_ENST00000493795.1_Silent_p.L5L|BRCA1_ENST00000346315.3_Silent_p.L52L|BRCA1_ENST00000354071.3_Silent_p.L52L|BRCA1_ENST00000351666.3_Silent_p.L52L|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000309486.4_5'UTR|BRCA1_ENST00000468300.1_Silent_p.L52L	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	52					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TCTTCTGGTTGAGAAGTTTCA	0.323			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																													uc002icq.2		NA	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	D|Mis|N|F|S	familial breast/ovarian cancer gene 1			E		breast|ovarian	ovarian		0				ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52						c.(154-156)CTC>CTA	Homologous_recombination	breast cancer 1, early onset isoform 1							44.0	43.0	43.0					17																	41258529		2202	4295	6497	SO:0001819	synonymous_variant	672	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	Familial Cancer Database		androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr17:41258529G>T	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.156C>A	17.37:g.41258529G>T		TCGA Ovarian(2;0.000030)				BRCA1_uc010whp.1_Silent_p.L5L|BRCA1_uc010whl.1_Silent_p.L52L|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_5'UTR|BRCA1_uc002icu.2_Silent_p.L52L|BRCA1_uc010cyx.2_Silent_p.L5L|BRCA1_uc002ict.2_Silent_p.L52L|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_5'Flank|BRCA1_uc002idc.1_Silent_p.L52L|BRCA1_uc010whr.1_Silent_p.L5L|BRCA1_uc002idd.2_Silent_p.L52L|BRCA1_uc002ide.1_5'Flank|BRCA1_uc010cyy.1_Silent_p.L52L|BRCA1_uc010whs.1_Silent_p.L52L|BRCA1_uc010cyz.2_Silent_p.L5L|BRCA1_uc010cza.2_Intron|BRCA1_uc010wht.1_Intron	p.L52L	NM_007294	NP_009225	P38398	BRCA1_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.126)	4	388	-		Breast(137;0.000717)	52			RING-type.		O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Silent	SNP	ENST00000357654.3	37	c.156C>A	CCDS11453.1																																																																																				0.323	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294		5	46	1	0	2.0095e-06	0.001984	2.17587e-06	5	46				
MPP3	4356	broad.mit.edu	37	17	41891569	41891569	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:41891569C>G	ENST00000398389.4	-	15	1335	c.1170G>C	c.(1168-1170)ctG>ctC	p.L390L	MPP3_ENST00000475450.1_5'UTR|MPP3_ENST00000398393.1_Silent_p.L415L	NM_001932.4	NP_001923.2	Q13368	MPP3_HUMAN	membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)	390	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	guanylate kinase activity (GO:0004385)	p.L390L(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		ACCTACCGATCAGAACCACCA	0.612																																							uc002iei.3		NA																	1	Substitution - coding silent(1)		upper_aerodigestive_tract(1)	large_intestine(1)|skin(1)	2						c.(1168-1170)CTG>CTC		palmitoylated membrane protein 3							111.0	124.0	120.0					17																	41891569		1918	4124	6042	SO:0001819	synonymous_variant	4356				signal transduction	cell surface|integral to plasma membrane	guanylate kinase activity	g.chr17:41891569C>G		CCDS42344.1	17q12-q21	2008-07-18			ENSG00000161647	ENSG00000161647			7221	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 3"", ""discs, large (Drosophila) homolog 3"", ""membrane protein palmitoylated 3"""	601114		DLG3		8824795	Standard	NR_003562		Approved		uc002iei.4	Q13368	OTTHUMG00000133838	ENST00000398389.4:c.1170G>C	17.37:g.41891569C>G						MPP3_uc002ieh.2_Silent_p.L415L|MPP3_uc002iej.2_RNA	p.L390L	NM_001932	NP_001923	Q13368	MPP3_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.119)	15	1336	-		Breast(137;0.00394)	390			Guanylate kinase-like.		B2R7N0|D3DX47|Q4GX05|Q6PGR3|Q86SV1	Silent	SNP	ENST00000398389.4	37	c.1170G>C	CCDS42344.1																																																																																				0.612	MPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258371.1	NM_001932		40	176	0	0	0	0.006999	0	40	176				
NFE2L1	4779	broad.mit.edu	37	17	46128846	46128846	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:46128846C>T	ENST00000362042.3	+	2	982	c.366C>T	c.(364-366)ctC>ctT	p.L122L	NFE2L1_ENST00000357480.5_Silent_p.L122L|NFE2L1_ENST00000585291.1_Silent_p.L122L|NFE2L1_ENST00000361665.3_Silent_p.L122L	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1	122					anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						ACTCAGGCCTCGCCCTCGAGA	0.592																																							uc002imz.3		NA																	0				skin(1)	1						c.(364-366)CTC>CTT		nuclear factor erythroid 2-like 1							59.0	64.0	62.0					17																	46128846		2203	4300	6503	SO:0001819	synonymous_variant	4779				anatomical structure morphogenesis|heme biosynthetic process|inflammatory response|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity	g.chr17:46128846C>T	AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.366C>T	17.37:g.46128846C>T						NFE2L1_uc002ina.3_Silent_p.L122L|NFE2L1_uc002inb.3_Silent_p.L122L|NFE2L1_uc002inc.1_Silent_p.L122L	p.L122L	NM_003204	NP_003195	Q14494	NF2L1_HUMAN			2	1017	+			122					D3DTU3|D3DTU5|Q12877|Q96FN6	Silent	SNP	ENST00000362042.3	37	c.366C>T	CCDS11524.1																																																																																				0.592	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443019.1	NM_003204		6	116	0	0	0	0.001168	0	6	116				
B4GALNT2	124872	broad.mit.edu	37	17	47241632	47241632	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:47241632G>A	ENST00000300404.2	+	8	1188	c.1129G>A	c.(1129-1131)Ggg>Agg	p.G377R	B4GALNT2_ENST00000393354.2_Missense_Mutation_p.G317R|B4GALNT2_ENST00000504681.1_Missense_Mutation_p.G291R	NM_153446.2	NP_703147.2	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	377					lipid glycosylation (GO:0030259)|negative regulation of cell-cell adhesion (GO:0022408)|protein glycosylation (GO:0006486)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)			endometrium(3)|large_intestine(6)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	24			all cancers(6;0.000316)			TATGCCCTTTGGGAAGGTATG	0.532																																					GBM(124;244 1635 8663 18097 33175)	GBM(124;244 1635 8663 18097 33175)	uc002ion.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(1129-1131)GGG>AGG		beta-1,4-N-acetyl-galactosaminyl transferase 2							102.0	99.0	100.0					17																	47241632		2203	4300	6503	SO:0001583	missense	124872				lipid glycosylation|negative regulation of cell-cell adhesion|UDP-N-acetylgalactosamine metabolic process	integral to Golgi membrane	acetylgalactosaminyltransferase activity	g.chr17:47241632G>A	AJ517770	CCDS11544.1, CCDS54139.1, CCDS54140.1	17q21.33	2013-02-22	2006-01-08	2006-01-08	ENSG00000167080	ENSG00000167080	2.4.1.-	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	24136	protein-coding gene	gene with protein product		111730	"""UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase"""	GALGT2		8782649, 12678917	Standard	NM_153446		Approved	Sda, Cad	uc002ion.2	Q8NHY0	OTTHUMG00000161307	ENST00000300404.2:c.1129G>A	17.37:g.47241632G>A	ENSP00000300404:p.Gly377Arg					B4GALNT2_uc010wlt.1_Missense_Mutation_p.G291R|B4GALNT2_uc010wlu.1_Missense_Mutation_p.G317R	p.G377R	NM_153446	NP_703147	Q8NHY0	B4GN2_HUMAN	all cancers(6;0.000316)		8	1188	+			377			Lumenal (Potential).		B4DZE4|Q14CP1|Q86Y40	Missense_Mutation	SNP	ENST00000300404.2	37	c.1129G>A	CCDS11544.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.379886	0.82682	.	.	ENSG00000167080	ENST00000504681;ENST00000393354;ENST00000300404	T;T;T	0.60672	0.17;0.17;0.17	5.58	4.6	0.57074	Glycosyl transferase, family 2 (1);	0.138696	0.47455	N	0.000229	T	0.74846	0.3770	M	0.74647	2.275	0.44547	D	0.997508	D;D	0.76494	0.999;0.999	D;D	0.75484	0.967;0.986	T	0.76305	-0.3008	10	0.44086	T	0.13	-16.9087	15.4611	0.75356	0.0:0.1397:0.8603:0.0	.	317;377	Q8NHY0-2;Q8NHY0	.;B4GN2_HUMAN	R	291;317;377	ENSP00000425510:G291R;ENSP00000377022:G317R;ENSP00000300404:G377R	ENSP00000300404:G377R	G	+	1	0	B4GALNT2	44596631	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	8.974000	0.93433	1.342000	0.45619	-0.314000	0.08810	GGG		0.532	B4GALNT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364477.1	NM_153446		21	143	0	0	0	0.014323	0	21	143				
ABCC3	8714	broad.mit.edu	37	17	48736659	48736659	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:48736659G>A	ENST00000285238.8	+	7	816	c.736G>A	c.(736-738)Gag>Aag	p.E246K	ABCC3_ENST00000427699.1_Missense_Mutation_p.E246K	NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	246					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	CCTAAAGGAAGAGGACAGATC	0.642																																							uc002isl.2		NA																	0				skin(3)|central_nervous_system(1)	4						c.(736-738)GAG>AAG		ATP-binding cassette, sub-family C, member 3	Glibenclamide(DB01016)						88.0	80.0	82.0					17																	48736659		2203	4300	6503	SO:0001583	missense	8714				bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity	g.chr17:48736659G>A	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.736G>A	17.37:g.48736659G>A	ENSP00000285238:p.Glu246Lys					ABCC3_uc002isk.3_Missense_Mutation_p.E246K	p.E246K	NM_003786	NP_003777	O15438	MRP3_HUMAN	BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		7	816	+			246			Cytoplasmic (By similarity).		B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	37	c.736G>A	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.598616	0.46318	.	.	ENSG00000108846	ENST00000427699;ENST00000285238	D;D	0.86865	-2.18;-2.18	4.87	3.91	0.45181	.	0.598136	0.17661	N	0.166303	D	0.85754	0.5770	L	0.53671	1.685	0.09310	N	1	B;B	0.25563	0.129;0.09	B;B	0.34991	0.058;0.193	T	0.77892	-0.2418	10	0.45353	T	0.12	-3.9927	12.6675	0.56849	0.0802:0.0:0.9198:0.0	.	246;246	O15438;O15438-5	MRP3_HUMAN;.	K	246	ENSP00000395160:E246K;ENSP00000285238:E246K	ENSP00000285238:E246K	E	+	1	0	ABCC3	46091658	0.993000	0.37304	0.018000	0.16275	0.794000	0.44872	1.725000	0.38074	1.285000	0.44548	0.561000	0.74099	GAG		0.642	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038		15	107	0	0	0	0.004007	0	15	107				
ANKFN1	162282	broad.mit.edu	37	17	54534307	54534307	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:54534307G>A	ENST00000318698.2	+	11	1337	c.1302G>A	c.(1300-1302)gtG>gtA	p.V434V	ANKFN1_ENST00000566473.2_Silent_p.V434V	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	434										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						ACAAGTTTGTGAAGACCTTAA	0.383																																							uc002iun.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(1300-1302)GTG>GTA		ankyrin-repeat and fibronectin type III domain							62.0	61.0	61.0					17																	54534307		2203	4300	6503	SO:0001819	synonymous_variant	162282							g.chr17:54534307G>A	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.1302G>A	17.37:g.54534307G>A							p.V434V	NM_153228	NP_694960	Q8N957	ANKF1_HUMAN			11	1337	+			434						Silent	SNP	ENST00000318698.2	37	c.1302G>A	CCDS32686.1																																																																																				0.383	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228		4	48	0	0	0	0.001168	0	4	48				
AKAP1	8165	broad.mit.edu	37	17	55194219	55194219	+	Splice_Site	SNP	A	A	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:55194219A>C	ENST00000337714.3	+	8	2665		c.e8-1		AKAP1_ENST00000539273.1_Splice_Site|AKAP1_ENST00000572557.1_Splice_Site|AKAP1_ENST00000571629.1_Splice_Site	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1						blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					TTGCCTTCCCAGGTCTGACTT	0.517																																							uc002iux.2		NA																	0				ovary(1)	1						c.e8-2		A-kinase anchor protein 1 precursor							203.0	182.0	189.0					17																	55194219		2203	4300	6503	SO:0001630	splice_region_variant	8165				blood coagulation	cytosol|integral to membrane|mitochondrial outer membrane	protein binding|RNA binding	g.chr17:55194219A>C	X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.2433-1A>C	17.37:g.55194219A>C						AKAP1_uc010wnl.1_Splice_Site_p.R811_splice|AKAP1_uc010dcm.2_Splice_Site_p.R811_splice	p.R811_splice	NM_003488	NP_003479	Q92667	AKAP1_HUMAN			8	2664	+	Breast(9;5.46e-08)							A8K8Q1|D3DTZ0|Q13320|Q9BW14	Splice_Site	SNP	ENST00000337714.3	37	c.2433_splice	CCDS11594.1	.	.	.	.	.	.	.	.	.	.	A	19.89	3.911361	0.72983	.	.	ENSG00000121057	ENST00000337714;ENST00000427138;ENST00000539273	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1956	0.65670	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AKAP1	52549218	1.000000	0.71417	0.927000	0.36925	0.945000	0.59286	8.564000	0.90726	1.944000	0.56390	0.459000	0.35465	.		0.517	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277069.1		Intron	20	124	0	0	0	0.010504	0	20	124				
EPX	8288	broad.mit.edu	37	17	56277623	56277623	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:56277623C>T	ENST00000225371.5	+	10	1685	c.1575C>T	c.(1573-1575)acC>acT	p.T525T		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	525					defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	TCATGGCCACCCCTGCCAAGC	0.612											OREG0024608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002ivq.2		NA																	0				ovary(2)	2						c.(1573-1575)ACC>ACT		eosinophil peroxidase preproprotein							68.0	68.0	68.0					17																	56277623		2203	4300	6503	SO:0001819	synonymous_variant	8288				hydrogen peroxide catabolic process		heme binding|peroxidase activity|protein binding	g.chr17:56277623C>T	M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.1575C>T	17.37:g.56277623C>T			OREG0024608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1014		p.T525T	NM_000502	NP_000493	P11678	PERE_HUMAN			10	1661	+			525					Q4TVP3	Silent	SNP	ENST00000225371.5	37	c.1575C>T	CCDS11602.1																																																																																				0.612	EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443367.1	NM_000502		49	55	0	0	0	0.01441	0	49	55				
INTS2	57508	broad.mit.edu	37	17	59958421	59958421	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:59958421C>T	ENST00000444766.3	-	17	2300	c.2225G>A	c.(2224-2226)cGa>cAa	p.R742Q	INTS2_ENST00000251334.6_Missense_Mutation_p.R734Q	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	742					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						CAGGAGCATTCGCCGTAGCAG	0.398																																							uc002izn.2		NA																	0				ovary(1)|lung(1)|pancreas(1)	3						c.(2224-2226)CGA>CAA		integrator complex subunit 2							115.0	108.0	110.0					17																	59958421		1892	4109	6001	SO:0001583	missense	57508				snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding	g.chr17:59958421C>T	AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.2225G>A	17.37:g.59958421C>T	ENSP00000414237:p.Arg742Gln					INTS2_uc002izm.2_Missense_Mutation_p.R734Q	p.R742Q	NM_020748	NP_065799	Q9H0H0	INT2_HUMAN			17	2301	-			742					Q9ULD3	Missense_Mutation	SNP	ENST00000444766.3	37	c.2225G>A	CCDS45750.1	.	.	.	.	.	.	.	.	.	.	C	16.89	3.247131	0.59103	.	.	ENSG00000108506	ENST00000444766;ENST00000251334	T	0.43294	0.95	5.74	5.74	0.90152	.	0.099714	0.64402	D	0.000003	T	0.30854	0.0778	L	0.29908	0.895	0.44388	D	0.997293	P	0.46327	0.876	B	0.34652	0.187	T	0.06285	-1.0835	9	.	.	.	-9.1776	18.9027	0.92449	0.0:1.0:0.0:0.0	.	742	Q9H0H0	INT2_HUMAN	Q	742;741	ENSP00000414237:R742Q	.	R	-	2	0	INTS2	57313203	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.536000	0.53582	2.707000	0.92482	0.557000	0.71058	CGA		0.398	INTS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000445368.1	NM_020748		15	87	0	0	0	0.003163	0	15	87				
ABCA6	23460	broad.mit.edu	37	17	67129836	67129836	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:67129836C>G	ENST00000284425.2	-	6	911	c.737G>C	c.(736-738)aGa>aCa	p.R246T		NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	246					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					AGACTTTTTTCTCTCTTTTGT	0.294																																							uc002jhw.1		NA																	0				upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7						c.(736-738)AGA>ACA		ATP-binding cassette, sub-family A, member 6							71.0	73.0	72.0					17																	67129836		2202	4300	6502	SO:0001583	missense	23460				transport	integral to membrane	ATP binding|ATPase activity	g.chr17:67129836C>G	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.737G>C	17.37:g.67129836C>G	ENSP00000284425:p.Arg246Thr						p.R246T	NM_080284	NP_525023	Q8N139	ABCA6_HUMAN			6	912	-	Breast(10;5.65e-12)		246					Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	ENST00000284425.2	37	c.737G>C	CCDS11683.1	.	.	.	.	.	.	.	.	.	.	C	15.18	2.755925	0.49362	.	.	ENSG00000154262	ENST00000284425	D	0.89810	-2.57	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000013	D	0.94450	0.8214	M	0.84326	2.69	0.80722	D	1	D	0.63046	0.992	D	0.70487	0.969	D	0.94644	0.7833	10	0.72032	D	0.01	.	15.4919	0.75611	0.0:1.0:0.0:0.0	.	246	Q8N139	ABCA6_HUMAN	T	246	ENSP00000284425:R246T	ENSP00000284425:R246T	R	-	2	0	ABCA6	64641431	0.977000	0.34250	1.000000	0.80357	0.257000	0.26127	1.521000	0.35910	2.803000	0.96430	0.655000	0.94253	AGA		0.294	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284		7	76	0	0	0	0.00308	0	7	76				
CD300E	342510	broad.mit.edu	37	17	72613371	72613371	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:72613371G>T	ENST00000328630.3	-	2	314	c.274C>A	c.(274-276)Cag>Aag	p.Q92K	CD300E_ENST00000426295.2_Missense_Mutation_p.Q133K|CD300E_ENST00000392619.1_Missense_Mutation_p.Q119K			Q496F6	CLM2_HUMAN	CD300e molecule	92	Ig-like V-type.				innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	19						TTGAGGTTCTGCATGGTCACA	0.542																																							uc002jlb.1		NA																	0				skin(2)|large_intestine(1)|ovary(1)	4						c.(274-276)CAG>AAG		CD300e molecule precursor							210.0	160.0	177.0					17																	72613371		2203	4300	6503	SO:0001583	missense	342510					integral to membrane|plasma membrane	receptor activity	g.chr17:72613371G>T	BX648376	CCDS11702.1	17q25.1	2013-01-11	2006-03-28	2006-02-22	ENSG00000186407	ENSG00000186407		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	28874	protein-coding gene	gene with protein product		609801	"""CD300 antigen like family member E"", ""CD300e antigen"""	CD300LE		15549731, 15557162	Standard	NM_181449		Approved	IREM2, CLM2	uc002jlb.2	Q496F6	OTTHUMG00000067605	ENST00000328630.3:c.274C>A	17.37:g.72613371G>T	ENSP00000329942:p.Gln92Lys						p.Q92K	NM_181449	NP_852114	Q496F6	CLM2_HUMAN			2	315	-			92			Ig-like V-type.|Extracellular (Potential).		B4DNS1|Q7Z7I3	Missense_Mutation	SNP	ENST00000328630.3	37	c.274C>A	CCDS11702.1	.	.	.	.	.	.	.	.	.	.	G	5.887	0.347700	0.11126	.	.	ENSG00000186407	ENST00000392619;ENST00000426295;ENST00000328630;ENST00000412268	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	4.89	1.79	0.24919	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.275863	0.25135	N	0.032872	T	0.33847	0.0877	N	0.03999	-0.3	0.21915	N	0.999478	B	0.22683	0.073	B	0.20577	0.03	T	0.19451	-1.0305	10	0.49607	T	0.09	-9.5145	5.4572	0.16598	0.0:0.6335:0.1754:0.1912	.	92	Q496F6	CLM2_HUMAN	K	119;133;92;94	ENSP00000376395:Q119K;ENSP00000416642:Q133K;ENSP00000329942:Q92K;ENSP00000415488:Q94K	ENSP00000329942:Q92K	Q	-	1	0	CD300E	70124966	0.061000	0.20836	0.718000	0.30602	0.025000	0.11179	-0.219000	0.09228	0.327000	0.23409	-0.340000	0.08031	CAG		0.542	CD300E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_181449		21	150	1	0	5.35356e-11	0.00278	6.10397e-11	21	150				
SEPT9	10801	broad.mit.edu	37	17	75478401	75478401	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:75478401C>G	ENST00000427177.1	+	4	1023	c.897C>G	c.(895-897)ttC>ttG	p.F299L	SEPT9_ENST00000541152.2_Missense_Mutation_p.F48L|SEPT9_ENST00000591198.1_Missense_Mutation_p.F280L|SEPT9_ENST00000592951.1_Missense_Mutation_p.F48L|SEPT9_ENST00000427180.1_Missense_Mutation_p.F187L|SEPT9_ENST00000431235.2_Missense_Mutation_p.F135L|SEPT9_ENST00000449803.2_Missense_Mutation_p.F135L|SEPT9_ENST00000592420.1_Missense_Mutation_p.F108L|SEPT9_ENST00000423034.2_Missense_Mutation_p.F292L|SEPT9_ENST00000585930.1_Missense_Mutation_p.F75L|SEPT9_ENST00000590294.1_Missense_Mutation_p.F281L|SEPT9_ENST00000591088.1_Missense_Mutation_p.F48L|SEPT9_ENST00000592481.1_3'UTR|SEPT9_ENST00000590917.1_Missense_Mutation_p.F48L|SEPT9_ENST00000588690.1_Missense_Mutation_p.F135L|SEPT9_ENST00000427674.2_Missense_Mutation_p.F135L|SEPT9_ENST00000329047.8_Missense_Mutation_p.F281L	NM_001113491.1	NP_001106963.1	Q9UHD8	SEPT9_HUMAN	septin 9	299	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|protein heterooligomerization (GO:0051291)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)	16			BRCA - Breast invasive adenocarcinoma(99;0.153)			GCTTCGAGTTCAACATCATGG	0.612																																							uc002jts.3		NA																	0				breast(2)|ovary(1)	3						c.(895-897)TTC>TTG		septin 9 isoform a							49.0	55.0	53.0					17																	75478401		2151	4262	6413	SO:0001583	missense	10801				cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding	g.chr17:75478401C>G	AB023208	CCDS45790.1, CCDS45791.1, CCDS45792.1, CCDS45793.1, CCDS45794.1, CCDS45795.1, CCDS74166.1	17q25.3	2014-09-17	2005-01-11	2005-01-12	ENSG00000184640	ENSG00000184640		"""Septins"""	7323	protein-coding gene	gene with protein product	"""Ov/Br septin"""	604061	"""MLL septin-like fusion"""	MSF		10339604, 10485469	Standard	NM_006640		Approved	MSF1, KIAA0991, PNUTL4, AF17q25, SeptD1	uc002jts.4	Q9UHD8		ENST00000427177.1:c.897C>G	17.37:g.75478401C>G	ENSP00000391249:p.Phe299Leu					SEPT9_uc010wtk.1_Missense_Mutation_p.F280L|SEPT9_uc002jtt.3_Missense_Mutation_p.F135L|SEPT9_uc002jtu.3_Missense_Mutation_p.F281L|SEPT9_uc002jtv.2_Missense_Mutation_p.F292L|SEPT9_uc002jtw.2_Missense_Mutation_p.F135L|SEPT9_uc002jtx.1_Missense_Mutation_p.F135L|SEPT9_uc010wtl.1_Missense_Mutation_p.F75L|SEPT9_uc002jty.3_Missense_Mutation_p.F48L|SEPT9_uc010wtm.1_Missense_Mutation_p.F48L|SEPT9_uc010wtn.1_Missense_Mutation_p.F48L|SEPT9_uc010dhd.2_Missense_Mutation_p.F187L	p.F299L	NM_001113491	NP_001106963	Q9UHD8	SEPT9_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.153)		4	1023	+			299					A8K2V3|B3KPM0|B4DTL9|B4E0N2|B4E274|B7Z654|Q96QF3|Q96QF4|Q96QF5|Q9HA04|Q9UG40|Q9Y5W4	Missense_Mutation	SNP	ENST00000427177.1	37	c.897C>G	CCDS45790.1	.	.	.	.	.	.	.	.	.	.	c	16.28	3.079030	0.55753	.	.	ENSG00000184640	ENST00000427177;ENST00000397613;ENST00000449803;ENST00000329047;ENST00000423034;ENST00000427674;ENST00000541152;ENST00000431235;ENST00000427180	T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73	4.99	4.0	0.46444	.	0.061267	0.64402	D	0.000001	T	0.38427	0.1040	L	0.43923	1.385	0.39267	D	0.964328	B;B;B;P;B;B;B	0.40619	0.002;0.009;0.149;0.724;0.007;0.007;0.009	B;B;B;B;B;B;B	0.39152	0.004;0.006;0.109;0.292;0.036;0.036;0.06	T	0.29640	-1.0005	10	0.40728	T	0.16	.	9.5529	0.39321	0.0:0.7815:0.1416:0.0769	.	75;280;187;260;292;281;299	Q9UHD8-9;Q9UHD8-7;Q9UHD8-8;Q1WWK5;Q9UHD8-5;Q9UHD8-2;Q9UHD8	.;.;.;.;.;.;SEPT9_HUMAN	L	299;48;135;281;292;135;75;48;187	ENSP00000391249:F299L;ENSP00000400181:F135L;ENSP00000329161:F281L;ENSP00000405877:F292L;ENSP00000403194:F135L;ENSP00000415624:F187L	ENSP00000329161:F281L	F	+	3	2	SEPT9	72989996	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.157000	0.50716	1.077000	0.40990	0.562000	0.76482	TTC		0.612	SEPT9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000436304.2	NM_006640		5	48	0	0	0	0.001168	0	5	48				
ENGASE	64772	broad.mit.edu	37	17	77082418	77082418	+	Nonsense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:77082418C>G	ENST00000579016.1	+	14	2219	c.2219C>G	c.(2218-2220)tCa>tGa	p.S740*		NM_001042573.2	NP_001036038.1	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	740						cytoplasm (GO:0005737)	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925)			breast(2)|endometrium(4)|large_intestine(1)|lung(15)|prostate(2)|skin(1)	25						CTGCTTTATTCAGCCCCTGCA	0.652																																							uc002jwv.2		NA																	0				skin(1)	1						c.(2218-2220)TCA>TGA		endo-beta-N-acetylglucosaminidase							35.0	41.0	39.0					17																	77082418		1973	4141	6114	SO:0001587	stop_gained	64772					cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity	g.chr17:77082418C>G	AF512564	CCDS42394.1	17q25.3	2009-03-03			ENSG00000167280	ENSG00000167280	3.2.1.96		24622	protein-coding gene	gene with protein product	"""Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase"", ""Di-N-acetylchitobiosyl beta-N-acetylglucosaminidase"""	611898				12114544, 18586680	Standard	NM_001042573		Approved	FLJ21865	uc002jwv.4	Q8NFI3	OTTHUMG00000167714	ENST00000579016.1:c.2219C>G	17.37:g.77082418C>G	ENSP00000462333:p.Ser740*					ENGASE_uc002jww.2_Nonsense_Mutation_p.S445*	p.S740*	NM_001042573	NP_001036038	Q8NFI3	ENASE_HUMAN			14	2227	+			740					Q659F0|Q8TB86|Q9H6U4	Nonsense_Mutation	SNP	ENST00000579016.1	37	c.2219C>G	CCDS42394.1	.	.	.	.	.	.	.	.	.	.	C	35	5.507777	0.96386	.	.	ENSG00000167280	ENST00000545583	.	.	.	4.48	4.48	0.54585	.	0.673781	0.15142	N	0.278257	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.4114	15.3034	0.73972	0.0:1.0:0.0:0.0	.	.	.	.	X	740	.	ENSP00000438577:S740X	S	+	2	0	ENGASE	74594013	0.879000	0.30193	0.004000	0.12327	0.005000	0.04900	1.912000	0.39946	2.193000	0.70182	0.591000	0.81541	TCA		0.652	ENGASE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395807.1	NM_022759		7	59	0	0	0	0.001984	0	7	59				
ACTG1	71	broad.mit.edu	37	17	79478006	79478006	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:79478006C>T	ENST00000575842.1	-	4	1357	c.931G>A	c.(931-933)Gac>Aac	p.D311N	ACTG1_ENST00000573283.1_Missense_Mutation_p.D311N|ACTG1_ENST00000575087.1_Missense_Mutation_p.D311N|AC139149.1_ENST00000584254.1_RNA|ACTG1_ENST00000331925.2_Missense_Mutation_p.D311N			P63261	ACTG_HUMAN	actin, gamma 1	311					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			TGCATCCTGTCGGCAATGCCC	0.612																																							uc002kaj.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(931-933)GAC>AAC		actin, gamma 1 propeptide							66.0	64.0	65.0					17																	79478006		2203	4300	6503	SO:0001583	missense	71				adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol	ATP binding|identical protein binding	g.chr17:79478006C>T		CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.931G>A	17.37:g.79478006C>T	ENSP00000458162:p.Asp311Asn					ACTG1_uc002kah.1_Missense_Mutation_p.D189N|ACTG1_uc002kai.1_Missense_Mutation_p.D268N|ACTG1_uc002kak.1_Missense_Mutation_p.D311N|ACTG1_uc010wun.1_Missense_Mutation_p.D311N|ACTG1_uc002kal.1_Missense_Mutation_p.D311N|ACTG1_uc002kag.2_RNA	p.D311N	NM_001614	NP_001605	P63261	ACTG_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)		4	956	-	all_neural(118;0.0878)|Melanoma(429;0.242)		311					A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000575842.1	37	c.931G>A	CCDS11782.1	.	.	.	.	.	.	.	.	.	.	c	15.95	2.983767	0.53827	.	.	ENSG00000184009	ENST00000331925;ENST00000447294	D	0.94862	-3.54	4.05	2.07	0.26955	.	0.000000	0.85682	D	0.000000	D	0.94118	0.8114	M	0.88181	2.935	0.42968	D	0.994423	B	0.14438	0.01	B	0.23852	0.049	D	0.90907	0.4773	10	0.87932	D	0	.	8.9278	0.35652	0.0:0.8133:0.0:0.1867	.	311	P63261	ACTG_HUMAN	N	311;269	ENSP00000331514:D311N	ENSP00000331514:D311N	D	-	1	0	ACTG1	77092601	1.000000	0.71417	0.763000	0.31416	0.868000	0.49771	7.261000	0.78400	0.399000	0.25367	0.645000	0.84053	GAC		0.612	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439935.2	NM_001614		15	85	0	0	0	0.003163	0	15	85				
LAMA1	284217	broad.mit.edu	37	18	7044805	7044805	+	Missense_Mutation	SNP	C	C	A	rs565276715		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr18:7044805C>A	ENST00000389658.3	-	7	985	c.892G>T	c.(892-894)Ggg>Tgg	p.G298W		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	298	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CAGCTCTCCCCGCAAGTATTA	0.448																																							uc002knm.2		NA																	0				ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21						c.(892-894)GGG>TGG		laminin, alpha 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						120.0	115.0	116.0					18																	7044805		2203	4300	6503	SO:0001583	missense	284217				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding	g.chr18:7044805C>A	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.892G>T	18.37:g.7044805C>A	ENSP00000374309:p.Gly298Trp					LAMA1_uc010wzj.1_5'UTR	p.G298W	NM_005559	NP_005550	P25391	LAMA1_HUMAN			7	986	-		Colorectal(10;0.172)	298			Laminin EGF-like 1.			Missense_Mutation	SNP	ENST00000389658.3	37	c.892G>T	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	C	16.37	3.105495	0.56291	.	.	ENSG00000101680	ENST00000389658	D	0.91996	-2.95	4.97	4.97	0.65823	EGF-like, laminin (4);	0.140039	0.44688	D	0.000423	D	0.97798	0.9277	H	0.97852	4.09	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99490	1.0950	10	0.87932	D	0	.	18.579	0.91165	0.0:1.0:0.0:0.0	.	298	P25391	LAMA1_HUMAN	W	298	ENSP00000374309:G298W	ENSP00000374309:G298W	G	-	1	0	LAMA1	7034805	1.000000	0.71417	0.342000	0.25602	0.049000	0.14656	7.743000	0.85020	2.456000	0.83038	0.655000	0.94253	GGG		0.448	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559		43	106	1	0	9.58827e-17	0.01441	1.14e-16	43	106				
PPP4R1	9989	broad.mit.edu	37	18	9570248	9570248	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr18:9570248G>A	ENST00000400556.3	-	11	1553	c.1480C>T	c.(1480-1482)Ccc>Tcc	p.P494S	PPP4R1_ENST00000400555.3_Missense_Mutation_p.P477S	NM_001042388.2	NP_001035847.1	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	494					dephosphorylation (GO:0016311)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase 4 complex (GO:0030289)	protein phosphatase type 4 regulator activity (GO:0030362)			large_intestine(1)|skin(2)	3						GGAGAACTGGGCACAGGGCCC	0.478																																					Melanoma(188;1232 2082 5061 11948 35994)	Melanoma(188;1232 2082 5061 11948 35994)	uc002koe.1		NA																	0				skin(1)	1						c.(1480-1482)CCC>TCC		protein phosphatase 4, regulatory subunit 1							100.0	94.0	96.0					18																	9570248		1846	4098	5944	SO:0001583	missense	9989				protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity	g.chr18:9570248G>A	AF111106	CCDS42412.1, CCDS42413.1	18p11.22	2010-06-18			ENSG00000154845	ENSG00000154845		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	9320	protein-coding gene	gene with protein product		604908				10026142	Standard	NM_001042388		Approved	PP4R1	uc002koe.2	Q8TF05	OTTHUMG00000137466	ENST00000400556.3:c.1480C>T	18.37:g.9570248G>A	ENSP00000383402:p.Pro494Ser					PPP4R1_uc002kof.2_5'UTR|PPP4R1_uc010wzo.1_Missense_Mutation_p.P340S|PPP4R1_uc002kod.1_Missense_Mutation_p.P477S|PPP4R1_uc010wzp.1_RNA	p.P494S	NM_001042388	NP_001035847	Q8TF05	PP4R1_HUMAN			11	1598	-			494					Q99774|Q9UNQ7	Missense_Mutation	SNP	ENST00000400556.3	37	c.1480C>T	CCDS42412.1	.	.	.	.	.	.	.	.	.	.	G	2.765	-0.256916	0.05829	.	.	ENSG00000154845	ENST00000400556;ENST00000400555;ENST00000285124	T;T	0.14640	2.49;2.49	5.14	3.33	0.38152	Armadillo-type fold (1);	0.191148	0.37715	N	0.001971	T	0.13628	0.0330	M	0.67953	2.075	0.09310	N	1	B;B;B	0.12013	0.005;0.003;0.002	B;B;B	0.12837	0.008;0.005;0.005	T	0.23440	-1.0188	9	.	.	.	-2.7681	5.7401	0.18089	0.2245:0.143:0.6325:0.0	.	477;494;477	A8K923;Q8TF05;Q8TF05-2	.;PP4R1_HUMAN;.	S	494;477;405	ENSP00000383402:P494S;ENSP00000383401:P477S	.	P	-	1	0	PPP4R1	9560248	0.751000	0.28327	0.001000	0.08648	0.003000	0.03518	2.093000	0.41710	0.635000	0.30488	-0.274000	0.10170	CCC		0.478	PPP4R1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268571.1	NM_005134		25	41	0	0	0	0.00278	0	25	41				
TXNDC2	84203	broad.mit.edu	37	18	9888081	9888081	+	Silent	SNP	T	T	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr18:9888081T>C	ENST00000306084.6	+	2	1804	c.1605T>C	c.(1603-1605)gaT>gaC	p.D535D	TXNDC2_ENST00000357775.5_Silent_p.D468D|TXNDC2_ENST00000536353.2_3'UTR	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	535	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						AAAAGGTGGATGAACTTTGCG	0.433																																							uc002koi.3		NA																	0				ovary(1)|pancreas(1)	2						c.(1603-1605)GAT>GAC		thioredoxin domain-containing 2 isoform 2							40.0	41.0	41.0					18																	9888081		2203	4300	6503	SO:0001819	synonymous_variant	84203				cell differentiation|cell redox homeostasis|glycerol ether metabolic process|multicellular organismal development|spermatogenesis	cytoplasm	electron carrier activity|nutrient reservoir activity|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity	g.chr18:9888081T>C	AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.1605T>C	18.37:g.9888081T>C						TXNDC2_uc010wzq.1_RNA|TXNDC2_uc002koh.3_Silent_p.D468D	p.D535D	NM_001098529	NP_001091999	Q86VQ3	TXND2_HUMAN			2	2054	+			535			Thioredoxin.		A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Silent	SNP	ENST00000306084.6	37	c.1605T>C	CCDS42414.1																																																																																				0.433	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1			11	27	0	0	0	0.001855	0	11	27				
CABYR	26256	broad.mit.edu	37	18	21735667	21735667	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr18:21735667G>A	ENST00000399496.3	+	4	367	c.202G>A	c.(202-204)Gag>Aag	p.E68K	CABYR_ENST00000581397.1_Missense_Mutation_p.E68K|CABYR_ENST00000399499.1_Missense_Mutation_p.E68K|CABYR_ENST00000415309.2_Missense_Mutation_p.E68K|CABYR_ENST00000327201.6_5'UTR|CABYR_ENST00000399481.2_5'UTR	NM_012189.2|NM_153769.1	NP_036321.2|NP_722453.1	O75952	CABYR_HUMAN	calcium binding tyrosine-(Y)-phosphorylation regulated	68					epithelial cilium movement (GO:0003351)|sperm capacitation (GO:0048240)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|protein heterodimerization activity (GO:0046982)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)	11	all_cancers(21;9.13e-05)|all_epithelial(16;5.49e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0305)|Ovarian(20;0.17)					TTTTTCAGTAGAGAAATGGTC	0.333																																							uc002kux.2		NA																	0					0						c.(202-204)GAG>AAG		calcium-binding tyrosine							52.0	53.0	53.0					18																	21735667		2203	4300	6503	SO:0001583	missense	26256				ciliary or flagellar motility|signal transduction|sperm capacitation	cytoplasm|cytoskeleton|flagellum|motile cilium|nucleus	calcium ion binding|cAMP-dependent protein kinase regulator activity|enzyme binding|protein heterodimerization activity|SH3 domain binding	g.chr18:21735667G>A	AF088868	CCDS11881.1, CCDS11882.1, CCDS11883.1, CCDS42420.1, CCDS45840.1	18q11.2	2009-08-06	2007-11-22		ENSG00000154040	ENSG00000154040			15569	protein-coding gene	gene with protein product	"""fibrousheathin 2"", ""cancer/testis antigen 88"""	612135				11820818, 17317841, 16139264	Standard	NM_012189		Approved	FSP-2, CBP86, CT88	uc002kux.3	O75952	OTTHUMG00000037365	ENST00000399496.3:c.202G>A	18.37:g.21735667G>A	ENSP00000382419:p.Glu68Lys					CABYR_uc010xbb.1_5'UTR|CABYR_uc002kuy.2_Missense_Mutation_p.E68K|CABYR_uc002kuz.2_Missense_Mutation_p.E68K|CABYR_uc002kva.2_Missense_Mutation_p.E50K|CABYR_uc002kvb.2_5'UTR|CABYR_uc002kvc.2_Missense_Mutation_p.E68K|CABYR_uc010dlw.2_RNA	p.E68K	NM_012189	NP_036321	O75952	CABYR_HUMAN			4	354	+	all_cancers(21;9.13e-05)|all_epithelial(16;5.49e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0305)|Ovarian(20;0.17)		68					B2R857|Q8WXW5|Q9HAY3|Q9HAY4|Q9HAY5|Q9HCY9	Missense_Mutation	SNP	ENST00000399496.3	37	c.202G>A	CCDS42420.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.477704	0.26511	.	.	ENSG00000154040	ENST00000399496;ENST00000415309;ENST00000399499	T;T;T	0.47177	0.85;1.44;0.85	6.08	5.21	0.72293	.	0.000000	0.56097	D	0.000021	T	0.46405	0.1391	L	0.34521	1.04	0.80722	D	1	P;P;P;P	0.45531	0.666;0.86;0.649;0.78	P;P;B;B	0.47134	0.539;0.453;0.164;0.197	T	0.49224	-0.8962	10	0.66056	D	0.02	-9.7216	14.8282	0.70130	0.0:0.1438:0.8562:0.0	.	50;68;68;68	O75952-2;O75952-4;O75952-3;O75952	.;.;.;CABYR_HUMAN	K	68	ENSP00000382419:E68K;ENSP00000399973:E68K;ENSP00000382421:E68K	ENSP00000382419:E68K	E	+	1	0	CABYR	19989665	1.000000	0.71417	0.988000	0.46212	0.405000	0.30901	2.170000	0.42443	1.580000	0.49851	-0.150000	0.13652	GAG		0.333	CABYR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090926.2	NM_153770		12	35	0	0	0	0.013537	0	12	35				
NOL4	8715	broad.mit.edu	37	18	31599332	31599332	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr18:31599332G>A	ENST00000261592.5	-	6	1303	c.1006C>T	c.(1006-1008)Cta>Tta	p.L336L	NOL4_ENST00000535475.1_Silent_p.L181L|NOL4_ENST00000589544.1_Silent_p.L336L|NOL4_ENST00000269185.4_Silent_p.L222L|NOL4_ENST00000538587.1_Silent_p.L262L|NOL4_ENST00000535384.1_Silent_p.L51L	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	336						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						TCAGAAATTAGAAGATTCTTA	0.413																																							uc010dmi.2		NA																	0				ovary(3)	3						c.(1006-1008)CTA>TTA		nucleolar protein 4							142.0	125.0	131.0					18																	31599332		2203	4300	6503	SO:0001819	synonymous_variant	8715					nucleolus	RNA binding	g.chr18:31599332G>A	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1006C>T	18.37:g.31599332G>A						NOL4_uc010xbs.1_Silent_p.L51L|NOL4_uc002kxr.3_Silent_p.L172L|NOL4_uc010xbt.1_Silent_p.L262L|NOL4_uc010dmh.2_Silent_p.L262L|NOL4_uc010xbu.1_Silent_p.L336L|NOL4_uc002kxt.3_Silent_p.L336L|NOL4_uc010xbv.1_Silent_p.L85L|NOL4_uc010xbw.1_Silent_p.L222L	p.L336L	NM_003787	NP_003778	O94818	NOL4_HUMAN			6	1235	-			336					B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Silent	SNP	ENST00000261592.5	37	c.1006C>T	CCDS11907.2																																																																																				0.413	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787		13	33	0	0	0	0.00245	0	13	33				
FHOD3	80206	broad.mit.edu	37	18	34273246	34273246	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr18:34273246G>C	ENST00000359247.4	+	13	1520	c.1520G>C	c.(1519-1521)aGa>aCa	p.R507T	FHOD3_ENST00000590592.1_Missense_Mutation_p.R699T|FHOD3_ENST00000445677.1_Missense_Mutation_p.R486T|FHOD3_ENST00000587493.1_3'UTR|FHOD3_ENST00000257209.4_Missense_Mutation_p.R524T|FHOD3_ENST00000591635.1_Intron	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	507					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				AGCCGGGGCAGAGCCGACCTC	0.567																																							uc002kzt.1		NA																	0				skin(3)|large_intestine(2)|breast(2)|ovary(1)	8						c.(1519-1521)AGA>ACA		formin homology 2 domain containing 3							47.0	52.0	51.0					18																	34273246		2203	4300	6503	SO:0001583	missense	80206				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding	g.chr18:34273246G>C	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1520G>C	18.37:g.34273246G>C	ENSP00000352186:p.Arg507Thr					FHOD3_uc002kzr.1_Missense_Mutation_p.R507T|FHOD3_uc002kzs.1_Missense_Mutation_p.R524T|FHOD3_uc010dmz.1_Missense_Mutation_p.R239T|FHOD3_uc010dna.1_5'UTR	p.R507T	NM_025135	NP_079411	Q2V2M9	FHOD3_HUMAN			13	1617	+		all_epithelial(2;0.0181)|Colorectal(2;0.0195)	507					A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37	c.1520G>C		.	.	.	.	.	.	.	.	.	.	G	19.51	3.841865	0.71488	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.18338	2.22;2.22;2.22	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.39627	0.1085	M	0.64997	1.995	0.54753	D	0.999988	B;D;D;D	0.69078	0.119;0.997;0.989;0.967	B;D;D;D	0.75020	0.14;0.918;0.985;0.916	T	0.06041	-1.0849	10	0.52906	T	0.07	.	16.1224	0.81369	0.0:0.0:1.0:0.0	.	486;507;524;699	Q2V2M9-2;Q2V2M9;Q2V2M9-3;E5F5Q0	.;FHOD3_HUMAN;.;.	T	524;507;486	ENSP00000257209:R524T;ENSP00000352186:R507T;ENSP00000411430:R486T	ENSP00000257209:R524T	R	+	2	0	FHOD3	32527244	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.700000	0.74619	2.583000	0.87209	0.579000	0.79373	AGA		0.567	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114		4	23	0	0	0	0.000602	0	4	23				
NETO1	81832	broad.mit.edu	37	18	70451117	70451117	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr18:70451117C>T	ENST00000327305.6	-	7	1321	c.664G>A	c.(664-666)Gag>Aag	p.E222K	NETO1_ENST00000583169.1_Missense_Mutation_p.E222K|NETO1_ENST00000299430.2_Missense_Mutation_p.E221K	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	222	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		TTCTGCATCTCATAGTCCAAG	0.348																																							uc002lkw.2		NA																	0				ovary(2)|skin(2)	4						c.(664-666)GAG>AAG		neuropilin- and tolloid-like protein 1 isoform 3							102.0	100.0	101.0					18																	70451117		2203	4300	6503	SO:0001583	missense	81832				memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity	g.chr18:70451117C>T	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.664G>A	18.37:g.70451117C>T	ENSP00000313088:p.Glu222Lys					NETO1_uc002lkx.1_Missense_Mutation_p.E221K|NETO1_uc002lky.1_Missense_Mutation_p.E222K	p.E222K	NM_138966	NP_620416	Q8TDF5	NETO1_HUMAN		READ - Rectum adenocarcinoma(1;0.0487)	7	948	-		Esophageal squamous(42;0.129)	222			CUB 2.|Extracellular (Potential).		Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	ENST00000327305.6	37	c.664G>A	CCDS12000.1	.	.	.	.	.	.	.	.	.	.	C	17.30	3.353842	0.61293	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	T;T	0.20598	2.06;2.06	5.54	5.54	0.83059	CUB (5);	0.000000	0.64402	D	0.000011	T	0.27697	0.0681	L	0.33485	1.01	0.80722	D	1	D;B	0.57257	0.979;0.392	P;B	0.48982	0.597;0.173	T	0.01273	-1.1399	10	0.87932	D	0	-4.2964	19.8487	0.96730	0.0:1.0:0.0:0.0	.	221;222	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	K	222;221	ENSP00000313088:E222K;ENSP00000299430:E221K	ENSP00000299430:E221K	E	-	1	0	NETO1	68602097	1.000000	0.71417	0.991000	0.47740	0.990000	0.78478	5.587000	0.67510	2.748000	0.94277	0.650000	0.86243	GAG		0.348	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999		23	79	0	0	0	0.012319	0	23	79				
SPPL2B	56928	broad.mit.edu	37	19	2337592	2337592	+	RNA	SNP	C	C	T	rs548345424		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:2337592C>T	ENST00000452401.2	+	0	417							Q8TCT7	SPP2B_HUMAN	signal peptide peptidase like 2B						membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	endosome membrane (GO:0010008)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCGGAGCACGCGGGCTGCT	0.692													C|||	1	0.000199681	0.0	0.0	5008	,	,		15155	0.001		0.0	False		,,,				2504	0.0						uc002lvs.2		NA																	0					0						c.(337-339)CGC>TGC		signal peptide peptidase-like 2B isoform 2							29.0	33.0	32.0					19																	2337592		2029	4165	6194			56928					Golgi membrane|integral to membrane	aspartic-type endopeptidase activity	g.chr19:2337592C>T		CCDS74252.1, CCDS74253.1	19p13.3	2012-02-21			ENSG00000005206	ENSG00000005206			30627	protein-coding gene	gene with protein product	"""intramembrane protease 4"""	608239				10819331	Standard	NM_001077238		Approved	IMP4, PSL1, KIAA1532	uc002lvs.3	Q8TCT7			19.37:g.2337592C>T						SPPL2B_uc010dsw.1_Missense_Mutation_p.R85C|SPPL2B_uc010dsy.1_Missense_Mutation_p.R85C|SPPL2B_uc010dsz.1_Missense_Mutation_p.R113C|SPPL2B_uc002lvr.2_Missense_Mutation_p.R113C|SPPL2B_uc010dta.1_5'Flank|SPPL2B_uc002lvu.2_5'Flank	p.R113C	NM_152988	NP_694533	Q8TCT7	PSL1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	3	417	+		Hepatocellular(1079;0.137)	113			Cytoplasmic (Potential).|PA.		D6W609|O60365|Q567S3|Q8IUH9|Q9BUY6|Q9H3M4|Q9NPN2|Q9P1Z6	Missense_Mutation	SNP	ENST00000452401.2	37	c.337C>T		.	.	.	.	.	.	.	.	.	.	c	19.47	3.833177	0.71258	.	.	ENSG00000005206	ENST00000452401;ENST00000382189	.	.	.	4.87	4.87	0.63330	Protease-associated domain, PA (1);	0.202774	0.43579	D	0.000555	T	0.72260	0.3438	M	0.74881	2.28	0.28405	N	0.918448	D;D;D;D;D	0.89917	0.998;0.997;0.998;1.0;0.999	P;P;P;D;D	0.65987	0.809;0.711;0.799;0.939;0.94	T	0.79706	-0.1691	8	0.54805	T	0.06	-24.5718	12.0847	0.53690	0.1723:0.8277:0.0:0.0	.	113;113;113;113;113	A6NFV1;Q8TCT7-3;Q8TCT7-2;Q8TCT7;C9JFE6	.;.;.;PSL1_HUMAN;.	C	113	.	ENSP00000371624:R113C	R	+	1	0	AC004410.1	2288592	0.763000	0.28462	0.157000	0.22605	0.818000	0.46254	4.500000	0.60387	2.392000	0.81423	0.556000	0.70494	CGC		0.692	SPPL2B-202	KNOWN	basic	processed_transcript	processed_transcript		NM_020172		7	16	0	0	0	0.001984	0	7	16				
SPPL2B	56928	broad.mit.edu	37	19	2337594	2337594	+	RNA	SNP	C	C	G	rs192000517|rs35767987		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:2337594C>G	ENST00000452401.2	+	0	419							Q8TCT7	SPP2B_HUMAN	signal peptide peptidase like 2B						membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	endosome membrane (GO:0010008)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)	p.R113R(2)					Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGGAGCACGCGGGCTGCTCA	0.692																																							uc002lvs.2		NA																	2	Substitution - coding silent(2)		lung(1)|endometrium(1)		0						c.(337-339)CGC>CGG		signal peptide peptidase-like 2B isoform 2							28.0	32.0	31.0					19																	2337594		2034	4164	6198			56928					Golgi membrane|integral to membrane	aspartic-type endopeptidase activity	g.chr19:2337594C>G		CCDS74252.1, CCDS74253.1	19p13.3	2012-02-21			ENSG00000005206	ENSG00000005206			30627	protein-coding gene	gene with protein product	"""intramembrane protease 4"""	608239				10819331	Standard	NM_001077238		Approved	IMP4, PSL1, KIAA1532	uc002lvs.3	Q8TCT7			19.37:g.2337594C>G						SPPL2B_uc010dsw.1_Silent_p.R85R|SPPL2B_uc010dsy.1_Silent_p.R85R|SPPL2B_uc010dsz.1_Silent_p.R113R|SPPL2B_uc002lvr.2_Silent_p.R113R|SPPL2B_uc010dta.1_5'Flank|SPPL2B_uc002lvu.2_5'Flank	p.R113R	NM_152988	NP_694533	Q8TCT7	PSL1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	3	419	+		Hepatocellular(1079;0.137)	113			Cytoplasmic (Potential).|PA.		D6W609|O60365|Q567S3|Q8IUH9|Q9BUY6|Q9H3M4|Q9NPN2|Q9P1Z6	Silent	SNP	ENST00000452401.2	37	c.339C>G																																																																																					0.692	SPPL2B-202	KNOWN	basic	processed_transcript	processed_transcript		NM_020172		7	15	0	0	0	0.001984	0	7	15				
STAP2	55620	broad.mit.edu	37	19	4325283	4325283	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:4325283G>A	ENST00000594605.1	-	11	1125	c.1002C>T	c.(1000-1002)gtC>gtT	p.V334V	STAP2_ENST00000600324.1_Silent_p.V334V|STAP2_ENST00000597593.1_5'UTR	NM_001013841.1	NP_001013863.1	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	334	Pro-rich.					cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTTCAGGATGACTGGCCAAC	0.562																																							uc002mab.2		NA																	0				central_nervous_system(1)	1						c.(1000-1002)GTC>GTT		signal transducing adaptor family member 2							64.0	52.0	56.0					19																	4325283		2203	4300	6503	SO:0001819	synonymous_variant	55620					cytoplasm|nucleus	protein binding	g.chr19:4325283G>A	AJ245719	CCDS12128.1, CCDS45926.1	19p13.3	2011-05-03	2007-08-09		ENSG00000178078	ENSG00000178078			30430	protein-coding gene	gene with protein product		607881				10980601, 11441184	Standard	XM_005259592		Approved	STAP-2, BKS	uc002mac.3	Q9UGK3		ENST00000594605.1:c.1002C>T	19.37:g.4325283G>A						STAP2_uc002mac.2_Silent_p.V334V|STAP2_uc002mad.2_Silent_p.V227V	p.V334V	NM_001013841	NP_001013863	Q9UGK3	STAP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)	11	1099	-		Hepatocellular(1079;0.137)	334			Pro-rich.		A6NKK3|Q9NXI2	Silent	SNP	ENST00000594605.1	37	c.1002C>T	CCDS45926.1																																																																																				0.562	STAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458114.2	NM_001013841		8	8	0	0	0	0.00308	0	8	8				
PLIN5	440503	broad.mit.edu	37	19	4523664	4523664	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:4523664T>G	ENST00000381848.3	-	8	1348	c.1268A>C	c.(1267-1269)cAc>cCc	p.H423P		NM_001013706.2	NP_001013728.2	Q00G26	PLIN5_HUMAN	perilipin 5	423	Interaction with PNPLA2 and ABHD5. {ECO:0000250}.				lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|mitochondrion localization (GO:0051646)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of lipase activity (GO:0060192)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of triglyceride catabolic process (GO:0010897)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of lipase activity (GO:0060193)|positive regulation of lipid storage (GO:0010884)|positive regulation of sequestering of triglyceride (GO:0010890)|positive regulation of triglyceride biosynthetic process (GO:0010867)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)				endometrium(4)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10						CCCGTCCCTGTGCTCTGCCTC	0.706											OREG0025168	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002mas.2		NA																	0					0						c.(1267-1269)CAC>CCC		lipid storage droplet protein 5							67.0	76.0	73.0					19																	4523664		2002	4164	6166	SO:0001583	missense	440503					lipid particle		g.chr19:4523664T>G	DQ839131	CCDS42473.1	19p13.3	2009-08-12			ENSG00000214456	ENSG00000214456		"""Perilipins"""	33196	protein-coding gene	gene with protein product	"""lipid storage droplet protein 5"""	613248				17234449, 19638644	Standard	NM_001013706		Approved	LSDP5, LSDA5, OXPAT, MLDP	uc002mas.3	Q00G26		ENST00000381848.3:c.1268A>C	19.37:g.4523664T>G	ENSP00000371272:p.His423Pro		OREG0025168	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	619		p.H423P	NM_001013706	NP_001013728	Q00G26	PLIN5_HUMAN			8	1321	-			423					A2RRC1|Q6ZS68	Missense_Mutation	SNP	ENST00000381848.3	37	c.1268A>C	CCDS42473.1	.	.	.	.	.	.	.	.	.	.	T	10.98	1.504869	0.26949	.	.	ENSG00000214456	ENST00000381848	T	0.12039	2.72	4.69	1.13	0.20643	.	1.381930	0.05611	U	0.578105	T	0.11196	0.0273	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39921	-0.9590	10	0.41790	T	0.15	-2.4369	10.1781	0.42950	0.0:0.0:0.5434:0.4566	.	423	Q00G26	PLIN5_HUMAN	P	423	ENSP00000371272:H423P	ENSP00000371272:H423P	H	-	2	0	PLIN5	4474664	0.029000	0.19370	0.001000	0.08648	0.005000	0.04900	1.154000	0.31688	-0.144000	0.11314	-0.429000	0.05907	CAC		0.706	PLIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458647.1	NM_001013706		34	105	0	0	0	0.006999	0	34	105				
LRRC8E	80131	broad.mit.edu	37	19	7964676	7964676	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:7964676C>G	ENST00000306708.6	+	3	1370	c.1269C>G	c.(1267-1269)ctC>ctG	p.L423L	RN7SL115P_ENST00000392196.5_RNA|AC010336.1_ENST00000539278.1_Missense_Mutation_p.Q197H	NM_001268284.1|NM_001268285.1|NM_025061.4	NP_001255213.1|NP_001255214.1|NP_079337.2	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member E	423					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(10)	35						AGCTGGCCCTCTGCATGCTGC	0.627																																							uc002mir.2		NA																	0				lung(1)|pancreas(1)	2						c.(1267-1269)CTC>CTG		leucine rich repeat containing 8 family, member							29.0	29.0	29.0					19																	7964676		2203	4300	6503	SO:0001819	synonymous_variant	80131					integral to membrane		g.chr19:7964676C>G		CCDS12189.1	19p13.2	2008-02-05				ENSG00000171017			26272	protein-coding gene	gene with protein product		612891				12477932	Standard	NM_025061		Approved	FLJ23420	uc002mir.3	Q6NSJ5		ENST00000306708.6:c.1269C>G	19.37:g.7964676C>G							p.L423L	NM_025061	NP_079337	Q6NSJ5	LRC8E_HUMAN			3	1370	+			423					B3KR78|Q2YDY3|Q7L236|Q8N3B0|Q9H5H8	Silent	SNP	ENST00000306708.6	37	c.1269C>G	CCDS12189.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.275062	0.23307	.	.	ENSG00000214248	ENST00000539278	.	.	.	4.49	-2.66	0.06077	.	.	.	.	.	T	0.56455	0.1986	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60058	-0.7337	5	0.87932	D	0	.	5.2889	0.15716	0.1284:0.3698:0.4183:0.0835	.	.	.	.	H	197	.	ENSP00000441047:Q197H	Q	-	3	2	AC010336.2	7870676	0.009000	0.17119	0.987000	0.45799	0.893000	0.52053	-0.998000	0.03701	-0.110000	0.12022	0.555000	0.69702	CAG		0.627	LRRC8E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461354.1	NM_025061		5	32	0	0	0	0.001168	0	5	32				
MUC16	94025	broad.mit.edu	37	19	9058315	9058315	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:9058315C>T	ENST00000397910.4	-	3	29334	c.29131G>A	c.(29131-29133)Gaa>Aaa	p.E9711K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9713	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GACAGACTTTCAGGACCCCTG	0.488																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(29131-29133)GAA>AAA		mucin 16							83.0	78.0	79.0					19																	9058315		1932	4141	6073	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9058315C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29131G>A	19.37:g.9058315C>T	ENSP00000381008:p.Glu9711Lys						p.E9711K	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	29335	-			9713			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.29131G>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	8.865	0.947793	0.18356	.	.	ENSG00000181143	ENST00000397910	T	0.25749	1.78	3.13	-2.36	0.06663	.	.	.	.	.	T	0.13841	0.0335	N	0.19112	0.55	.	.	.	B	0.28713	0.22	B	0.26416	0.069	T	0.22800	-1.0206	8	0.87932	D	0	.	6.4386	0.21837	0.0:0.3115:0.5588:0.1297	.	9711	B5ME49	.	K	9711	ENSP00000381008:E9711K	ENSP00000381008:E9711K	E	-	1	0	MUC16	8919315	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.993000	0.03720	-0.309000	0.08779	-0.291000	0.09656	GAA		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		7	26	0	0	0	0.00308	0	7	26				
MUC16	94025	broad.mit.edu	37	19	9064992	9064992	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:9064992G>T	ENST00000397910.4	-	3	22657	c.22454C>A	c.(22453-22455)tCc>tAc	p.S7485Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7487	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCCAGAACTGGAAGTTCCAAC	0.478																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(22453-22455)TCC>TAC		mucin 16							188.0	176.0	180.0					19																	9064992		1963	4151	6114	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9064992G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.22454C>A	19.37:g.9064992G>T	ENSP00000381008:p.Ser7485Tyr						p.S7485Y	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	22658	-			7487			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.22454C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	N	5.366	0.252771	0.10185	.	.	ENSG00000181143	ENST00000397910	T	0.24908	1.83	2.91	-3.0	0.05480	.	.	.	.	.	T	0.15565	0.0375	N	0.24115	0.695	.	.	.	D	0.59767	0.986	P	0.47015	0.534	T	0.12915	-1.0529	8	0.87932	D	0	.	1.3354	0.02144	0.1272:0.1773:0.3348:0.3608	.	7485	B5ME49	.	Y	7485	ENSP00000381008:S7485Y	ENSP00000381008:S7485Y	S	-	2	0	MUC16	8925992	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.079000	0.11357	-0.418000	0.07450	0.508000	0.49915	TCC		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		23	52	1	0	7.87624e-14	0.00278	9.21659e-14	23	52				
OR7D4	125958	broad.mit.edu	37	19	9324997	9324997	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:9324997C>T	ENST00000308682.2	-	1	545	c.517G>A	c.(517-519)Gag>Aag	p.E173K		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E173K(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						TGCGGAATCTCAGTGCCTGTG	0.507																																							uc002mla.1		NA																	1	Substitution - Missense(1)	p.E173K(1)	ovary(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(517-519)GAG>AAG		olfactory receptor, family 7, subfamily D,							96.0	90.0	92.0					19																	9324997		2203	4300	6503	SO:0001583	missense	125958				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:9324997C>T		CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.517G>A	19.37:g.9324997C>T	ENSP00000310488:p.Glu173Lys						p.E173K	NM_001005191	NP_001005191	Q8NG98	OR7D4_HUMAN			1	517	-			173			Extracellular (Potential).		A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Missense_Mutation	SNP	ENST00000308682.2	37	c.517G>A	CCDS32901.1	.	.	.	.	.	.	.	.	.	.	C	9.671	1.146698	0.21288	.	.	ENSG00000174667	ENST00000308682	T	0.00115	8.71	4.0	1.85	0.25348	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000014	T	0.00144	0.0004	L	0.33792	1.035	0.09310	N	1	P	0.35628	0.513	B	0.43838	0.433	T	0.19811	-1.0294	10	0.51188	T	0.08	.	5.2584	0.15559	0.0:0.6389:0.1684:0.1926	.	173	Q8NG98	OR7D4_HUMAN	K	173	ENSP00000310488:E173K	ENSP00000310488:E173K	E	-	1	0	OR7D4	9185997	0.000000	0.05858	0.006000	0.13384	0.007000	0.05969	-1.227000	0.02950	0.484000	0.27630	0.436000	0.28706	GAG		0.507	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449004.1			15	58	0	0	0	0.003163	0	15	58				
ZNF562	54811	broad.mit.edu	37	19	9763741	9763741	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:9763741G>C	ENST00000448622.1	-	6	1327	c.1165C>G	c.(1165-1167)Caa>Gaa	p.Q389E	ZNF562_ENST00000293648.4_Missense_Mutation_p.Q317E|ZNF562_ENST00000453792.2_Missense_Mutation_p.Q320E|ZNF562_ENST00000541032.1_Missense_Mutation_p.Q352E|ZNF562_ENST00000537617.1_Missense_Mutation_p.Q273E|ZNF562_ENST00000590155.1_Missense_Mutation_p.Q388E|ZNF562_ENST00000453372.2_Missense_Mutation_p.Q389E	NM_001130031.1|NM_001130032.1	NP_001123503.1|NP_001123504.1	Q6V9R5	ZN562_HUMAN	zinc finger protein 562	389					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	17						CTTCTATGTTGAGTAAGCGTT	0.408																																							uc010xks.1		NA																	0					0						c.(1165-1167)CAA>GAA		zinc finger protein 562 isoform a							116.0	109.0	111.0					19																	9763741		2203	4300	6503	SO:0001583	missense	54811				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9763741G>C	AK000086	CCDS12217.1, CCDS45956.1, CCDS74280.1	19p13.2	2013-09-20			ENSG00000171466	ENSG00000171466		"""Zinc fingers, C2H2-type"", ""-"""	25950	protein-coding gene	gene with protein product							Standard	NM_001130031		Approved	FLJ20079	uc010xks.2	Q6V9R5	OTTHUMG00000180205	ENST00000448622.1:c.1165C>G	19.37:g.9763741G>C	ENSP00000411784:p.Gln389Glu					ZNF562_uc002mly.2_Missense_Mutation_p.Q389E|ZNF562_uc002mlx.2_Missense_Mutation_p.Q317E|ZNF562_uc010xkt.1_Missense_Mutation_p.Q352E|ZNF562_uc010xku.1_Missense_Mutation_p.Q320E|ZNF562_uc010xkv.1_Missense_Mutation_p.Q388E|ZNF562_uc010xkw.1_Missense_Mutation_p.Q273E	p.Q389E	NM_001130032	NP_001123504	Q6V9R5	ZN562_HUMAN			6	1328	-			389			C2H2-type 7.		Q32MN2|Q9NXS5	Missense_Mutation	SNP	ENST00000448622.1	37	c.1165C>G	CCDS45956.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.344197	0.00222	.	.	ENSG00000171466	ENST00000453372;ENST00000448622;ENST00000293648;ENST00000541032;ENST00000453792;ENST00000537617	T;T;T;T;T;T	0.16324	2.35;2.35;2.35;2.35;2.35;2.35	1.67	-3.33	0.04958	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05960	0.0155	N	0.17474	0.49	0.09310	N	1	B;B;B;B;B	0.29988	0.001;0.001;0.264;0.0;0.001	B;B;B;B;B	0.25614	0.002;0.002;0.062;0.002;0.002	T	0.36648	-0.9739	9	0.02654	T	1	.	3.6699	0.08270	0.4703:0.199:0.3307:0.0	.	273;388;352;389;317	F5H1B4;B4DMG0;B4DZP9;Q6V9R5;Q6V9R5-2	.;.;.;ZN562_HUMAN;.	E	389;389;317;352;320;273	ENSP00000410734:Q389E;ENSP00000411784:Q389E;ENSP00000293648:Q317E;ENSP00000442614:Q352E;ENSP00000440451:Q320E;ENSP00000445816:Q273E	ENSP00000293648:Q317E	Q	-	1	0	ZNF562	9624741	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-5.128000	0.00148	-0.902000	0.03886	0.313000	0.20887	CAA		0.408	ZNF562-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450239.1	NM_017656		13	45	0	0	0	0.013537	0	13	45				
ZNF846	162993	broad.mit.edu	37	19	9872820	9872820	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:9872820C>A	ENST00000397902.2	-	4	580	c.167G>T	c.(166-168)aGt>aTt	p.S56I	ZNF846_ENST00000586293.1_Missense_Mutation_p.S56I|ZNF846_ENST00000592859.1_Intron|ZNF846_ENST00000588267.1_5'UTR	NM_001077624.1	NP_001071092.1	Q147U1	ZN846_HUMAN	zinc finger protein 846	56	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22						AGACATGAGACTACGTTTGAA	0.458																																							uc002mmb.1		NA																	0				ovary(1)	1						c.(166-168)AGT>ATT		zinc finger protein 846							169.0	167.0	168.0					19																	9872820		1892	4126	6018	SO:0001583	missense	162993				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9872820C>A	AK097652	CCDS42496.1	19p13.2	2013-01-08			ENSG00000196605	ENSG00000196605		"""Zinc fingers, C2H2-type"", ""-"""	27260	protein-coding gene	gene with protein product							Standard	NM_001077624		Approved		uc002mmb.1	Q147U1		ENST00000397902.2:c.167G>T	19.37:g.9872820C>A	ENSP00000380999:p.Ser56Ile					ZNF846_uc010xky.1_RNA|ZNF846_uc010xkz.1_RNA|ZNF846_uc010dww.2_Intron|ZNF846_uc002mmc.1_5'UTR	p.S56I	NM_001077624	NP_001071092	Q147U1	ZN846_HUMAN			4	698	-			56			KRAB.		A8K0H1|B3KUP1	Missense_Mutation	SNP	ENST00000397902.2	37	c.167G>T	CCDS42496.1	.	.	.	.	.	.	.	.	.	.	.	2.966	-0.213458	0.06140	.	.	ENSG00000196605	ENST00000397902	T	0.00873	5.59	2.15	-4.3	0.03710	Krueppel-associated box (3);	.	.	.	.	T	0.00608	0.0020	N	0.20807	0.61	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46005	-0.9222	8	.	.	.	.	1.4992	0.02473	0.1766:0.4037:0.1788:0.2409	.	56	Q147U1	ZN846_HUMAN	I	56	ENSP00000380999:S56I	.	S	-	2	0	ZNF846	9733820	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.311000	0.02723	-1.631000	0.01543	-1.322000	0.01289	AGT		0.458	ZNF846-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450253.1	NM_001077624		22	78	1	0	6.44725e-10	0.014323	7.2518e-10	22	78				
ICAM5	7087	broad.mit.edu	37	19	10406060	10406060	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:10406060G>A	ENST00000221980.4	+	10	2332	c.2269G>A	c.(2269-2271)Gga>Aga	p.G757R		NM_003259.3	NP_003250.3	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5, telencephalin	757	Ig-like C2-type 9.				phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			CTCGCCCCCTGGAGGCGTGCG	0.687																																							uc002mnu.3		NA																	0				breast(3)	3						c.(2269-2271)GGA>AGA		intercellular adhesion molecule 5 precursor							12.0	14.0	13.0					19																	10406060		2127	4260	6387	SO:0001583	missense	7087				cell-cell adhesion	integral to plasma membrane		g.chr19:10406060G>A	U72671	CCDS12233.1	19p13.2	2013-01-14				ENSG00000105376		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5348	protein-coding gene	gene with protein product	"""telencephalin"""	601852		TLCN		8995416, 9828136	Standard	NM_003259		Approved	TLN	uc002mnu.4	Q9UMF0		ENST00000221980.4:c.2269G>A	19.37:g.10406060G>A	ENSP00000221980:p.Gly757Arg					ICAM5_uc002mnv.3_Missense_Mutation_p.G632R	p.G757R	NM_003259	NP_003250	Q9UMF0	ICAM5_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)		10	2334	+			757			Extracellular (Potential).|Ig-like C2-type 9.		Q9Y6F3	Missense_Mutation	SNP	ENST00000221980.4	37	c.2269G>A	CCDS12233.1	.	.	.	.	.	.	.	.	.	.	G	13.59	2.283899	0.40394	.	.	ENSG00000105376	ENST00000221980	T	0.12039	2.72	3.71	3.71	0.42584	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.339066	0.22848	N	0.054881	T	0.27933	0.0688	L	0.46157	1.445	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.01492	-1.1341	10	0.66056	D	0.02	-15.6151	10.8378	0.46698	0.0:0.0:1.0:0.0	.	757	Q9UMF0	ICAM5_HUMAN	R	757	ENSP00000221980:G757R	ENSP00000221980:G757R	G	+	1	0	ICAM5	10267060	0.584000	0.26766	0.028000	0.17463	0.200000	0.23975	2.542000	0.45744	1.929000	0.55896	0.549000	0.68633	GGA		0.687	ICAM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451217.1	NM_003259		5	18	0	0	0	0.001168	0	5	18				
ICAM5	7087	broad.mit.edu	37	19	10406079	10406079	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:10406079G>A	ENST00000221980.4	+	10	2351	c.2288G>A	c.(2287-2289)gGa>gAa	p.G763E		NM_003259.3	NP_003250.3	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5, telencephalin	763	Ig-like C2-type 9.				phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			CGCCCAGGAGGAAACTTCACG	0.697																																							uc002mnu.3		NA																	0				breast(3)	3						c.(2287-2289)GGA>GAA		intercellular adhesion molecule 5 precursor							12.0	15.0	14.0					19																	10406079		2147	4272	6419	SO:0001583	missense	7087				cell-cell adhesion	integral to plasma membrane		g.chr19:10406079G>A	U72671	CCDS12233.1	19p13.2	2013-01-14				ENSG00000105376		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5348	protein-coding gene	gene with protein product	"""telencephalin"""	601852		TLCN		8995416, 9828136	Standard	NM_003259		Approved	TLN	uc002mnu.4	Q9UMF0		ENST00000221980.4:c.2288G>A	19.37:g.10406079G>A	ENSP00000221980:p.Gly763Glu					ICAM5_uc002mnv.3_Missense_Mutation_p.G638E	p.G763E	NM_003259	NP_003250	Q9UMF0	ICAM5_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)		10	2353	+			763			Extracellular (Potential).|Ig-like C2-type 9.		Q9Y6F3	Missense_Mutation	SNP	ENST00000221980.4	37	c.2288G>A	CCDS12233.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.307212	0.60305	.	.	ENSG00000105376	ENST00000221980	T	0.32753	1.44	4.72	4.72	0.59763	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.51477	D	0.000091	T	0.29458	0.0734	N	0.02973	-0.45	0.38129	D	0.9381	D	0.89917	1.0	D	0.97110	1.0	T	0.43343	-0.9397	10	0.37606	T	0.19	-39.178	13.0387	0.58887	0.0:0.0:1.0:0.0	.	763	Q9UMF0	ICAM5_HUMAN	E	763	ENSP00000221980:G763E	ENSP00000221980:G763E	G	+	2	0	ICAM5	10267079	1.000000	0.71417	0.892000	0.35008	0.294000	0.27393	2.924000	0.48876	2.469000	0.83416	0.549000	0.68633	GGA		0.697	ICAM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451217.1	NM_003259		4	15	0	0	0	0.009096	0	4	15				
PDE4A	5141	broad.mit.edu	37	19	10570163	10570163	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:10570163A>G	ENST00000352831.6	+	9	1299	c.1189A>G	c.(1189-1191)Atg>Gtg	p.M397V	PDE4A_ENST00000344979.3_Missense_Mutation_p.M158V|PDE4A_ENST00000592685.1_Missense_Mutation_p.M375V|PDE4A_ENST00000440014.2_Missense_Mutation_p.M336V|PDE4A_ENST00000380702.2_Missense_Mutation_p.M375V|PDE4A_ENST00000293683.5_Missense_Mutation_p.M371V	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	397	Catalytic.				cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	CATCATGTACATGATATTCCA	0.622																																							uc002moj.2		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)	3						c.(1189-1191)ATG>GTG		phosphodiesterase 4A isoform 1	Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)						63.0	56.0	58.0					19																	10570163		2203	4300	6503	SO:0001583	missense	5141				signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding	g.chr19:10570163A>G		CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.1189A>G	19.37:g.10570163A>G	ENSP00000270474:p.Met397Val					PDE4A_uc002mok.2_Missense_Mutation_p.M371V|PDE4A_uc002mol.2_Missense_Mutation_p.M336V|PDE4A_uc002mom.2_Missense_Mutation_p.M158V|PDE4A_uc002mon.2_Intron|PDE4A_uc002moo.2_Missense_Mutation_p.M63V	p.M397V	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		9	1297	+			397			Catalytic.		O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Missense_Mutation	SNP	ENST00000352831.6	37	c.1189A>G	CCDS45961.1	.	.	.	.	.	.	.	.	.	.	A	10.62	1.400765	0.25291	.	.	ENSG00000065989	ENST00000380702;ENST00000352831;ENST00000293683;ENST00000440014;ENST00000344979;ENST00000380686	T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37	3.7	3.7	0.42460	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.129541	0.52532	D	0.000077	T	0.53465	0.1798	L	0.29908	0.895	0.22684	N	0.998859	B;B;B;B;B	0.20459	0.045;0.006;0.04;0.022;0.008	B;B;B;B;B	0.22386	0.005;0.03;0.039;0.007;0.001	T	0.53528	-0.8426	10	0.66056	D	0.02	.	10.6536	0.45663	1.0:0.0:0.0:0.0	.	63;158;336;371;397	P27815-5;P27815-4;P27815-6;P27815-2;P27815	.;.;.;.;PDE4A_HUMAN	V	375;397;371;336;158;63	ENSP00000370078:M375V;ENSP00000270474:M397V;ENSP00000293683:M371V;ENSP00000394754:M336V;ENSP00000341007:M158V	ENSP00000293683:M371V	M	+	1	0	PDE4A	10431163	0.259000	0.24043	0.999000	0.59377	0.682000	0.39822	1.317000	0.33631	1.686000	0.51046	0.379000	0.24179	ATG		0.622	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451244.1			6	20	0	0	0	0.001984	0	6	20				
CNN1	1264	broad.mit.edu	37	19	11657493	11657493	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:11657493C>T	ENST00000252456.2	+	3	400	c.189C>T	c.(187-189)ttC>ttT	p.F63F	CNN1_ENST00000544952.1_Silent_p.F43F|CNN1_ENST00000535659.2_Silent_p.F13F|CNN1_ENST00000592923.1_Silent_p.F13F	NM_001299.4	NP_001290.2	P51911	CNN1_HUMAN	calponin 1, basic, smooth muscle	63	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actomyosin structure organization (GO:0031032)|regulation of smooth muscle contraction (GO:0006940)	cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				breast(1)|endometrium(2)|large_intestine(4)|lung(2)	9						TTCTCAGATTCATCAATAAGC	0.562																																							uc002msc.1		NA																	0					0						c.(187-189)TTC>TTT		calponin 1, basic, smooth muscle							118.0	105.0	109.0					19																	11657493		2203	4300	6503	SO:0001819	synonymous_variant	1264				actomyosin structure organization|regulation of smooth muscle contraction	cytoskeleton	actin binding|calmodulin binding	g.chr19:11657493C>T	U37019	CCDS12263.1	19p13.2-p13.1	2008-07-16				ENSG00000130176			2155	protein-coding gene	gene with protein product		600806				8526917, 9332369	Standard	XM_005259741		Approved	SMCC, Sm-Calp	uc002msc.1	P51911		ENST00000252456.2:c.189C>T	19.37:g.11657493C>T						CNN1_uc010xmb.1_Silent_p.F13F|CNN1_uc010xmc.1_Silent_p.F13F	p.F63F	NM_001299	NP_001290	P51911	CNN1_HUMAN			3	353	+			63			CH.		B2R868|B4DUX6|O00638|Q15416|Q8IY93|Q99438	Silent	SNP	ENST00000252456.2	37	c.189C>T	CCDS12263.1																																																																																				0.562	CNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458854.1	NM_001299		14	52	0	0	0	0.003163	0	14	52				
ZNF709	163051	broad.mit.edu	37	19	12575365	12575365	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:12575365G>A	ENST00000397732.3	-	4	1542	c.1371C>T	c.(1369-1371)ttC>ttT	p.F457F	ZNF709_ENST00000428311.1_Silent_p.F457F|CTD-3105H18.18_ENST00000598753.1_Intron	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	457					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|upper_aerodigestive_tract(3)	6						TGGAACAACTGAAGGCTTTAC	0.398																																					GBM(33;565 669 12371 29134 51667)	GBM(33;565 669 12371 29134 51667)	uc002mtv.3		NA																	0					0						c.(1369-1371)TTC>TTT		zinc finger protein 709 isoform a							102.0	108.0	106.0					19																	12575365		2203	4298	6501	SO:0001819	synonymous_variant	163051				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12575365G>A	AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.1371C>T	19.37:g.12575365G>A						ZNF709_uc002mtw.3_Silent_p.F425F|ZNF709_uc002mtx.3_Silent_p.F457F	p.F457F	NM_152601	NP_689814	Q8N972	ZN709_HUMAN			4	1532	-			457			C2H2-type 13.		A8K4E6	Silent	SNP	ENST00000397732.3	37	c.1371C>T	CCDS42504.1																																																																																				0.398	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344088.1	NM_152601		25	86	0	0	0	0.007291	0	25	86				
ZNF709	163051	broad.mit.edu	37	19	12575934	12575934	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:12575934G>A	ENST00000397732.3	-	4	973	c.802C>T	c.(802-804)Caa>Taa	p.Q268*	ZNF709_ENST00000428311.1_Nonsense_Mutation_p.Q268*|CTD-3105H18.18_ENST00000598753.1_Intron	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	268					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|upper_aerodigestive_tract(3)	6						TCATGTATTTGAAAAGTTTGG	0.383																																					GBM(33;565 669 12371 29134 51667)	GBM(33;565 669 12371 29134 51667)	uc002mtv.3		NA																	0					0						c.(802-804)CAA>TAA		zinc finger protein 709 isoform a							40.0	41.0	41.0					19																	12575934		2148	4275	6423	SO:0001587	stop_gained	163051				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12575934G>A	AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.802C>T	19.37:g.12575934G>A	ENSP00000380840:p.Gln268*					ZNF709_uc002mtw.3_Nonsense_Mutation_p.Q236*|ZNF709_uc002mtx.3_Nonsense_Mutation_p.Q268*	p.Q268*	NM_152601	NP_689814	Q8N972	ZN709_HUMAN			4	963	-			268			C2H2-type 6.		A8K4E6	Nonsense_Mutation	SNP	ENST00000397732.3	37	c.802C>T	CCDS42504.1	.	.	.	.	.	.	.	.	.	.	G	34	5.359978	0.95877	.	.	ENSG00000242852;ENSG00000196826	ENST00000397732;ENST00000428311	.	.	.	3.03	1.93	0.25924	.	0.583164	0.13071	N	0.416097	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	1.7933	0.03056	0.121:0.2103:0.4524:0.2164	.	.	.	.	X	268	.	ENSP00000404127:Q268X	Q	-	1	0	ZNF709;CTD-2192J16.17	12436934	0.000000	0.05858	0.001000	0.08648	0.945000	0.59286	-1.019000	0.03622	0.808000	0.34231	0.467000	0.42956	CAA		0.383	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344088.1	NM_152601		9	27	0	0	0	0.004482	0	9	27				
IER2	9592	broad.mit.edu	37	19	13264100	13264100	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:13264100C>T	ENST00000588173.1	+	1	1312	c.100C>T	c.(100-102)Ctg>Ttg	p.L34L	IER2_ENST00000587885.1_Silent_p.L34L|STX10_ENST00000343587.5_5'Flank|IER2_ENST00000292433.3_Silent_p.L34L|CTC-250I14.6_ENST00000592882.1_RNA|CTC-250I14.6_ENST00000586483.1_RNA			Q9BTL4	IER2_HUMAN	immediate early response 2	34						cytoplasm (GO:0005737)				kidney(1)|lung(1)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(19;3.41e-21)			GCACCGGAGTCTGCAGCTGTC	0.667											OREG0025291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002mwr.2		NA																	0				kidney(1)	1						c.(100-102)CTG>TTG		immediate early response 2							17.0	18.0	17.0					19																	13264100		2200	4295	6495	SO:0001819	synonymous_variant	9592							g.chr19:13264100C>T	M62831	CCDS12295.1	19p13.13	2008-02-05				ENSG00000160888			28871	protein-coding gene	gene with protein product						2061303	Standard	NM_004907		Approved	ETR101	uc002mwr.3	Q9BTL4		ENST00000588173.1:c.100C>T	19.37:g.13264100C>T			OREG0025291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	686		p.L34L	NM_004907	NP_004898	Q9BTL4	IER2_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;3.41e-21)		2	428	+			34					Q03827|Q2TAZ2	Silent	SNP	ENST00000588173.1	37	c.100C>T	CCDS12295.1																																																																																				0.667	IER2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453033.1	NM_004907		5	9	0	0	0	0.001168	0	5	9				
CLEC17A	388512	broad.mit.edu	37	19	14707757	14707757	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:14707757A>G	ENST00000417570.1	+	9	553	c.515A>G	c.(514-516)tAc>tGc	p.Y172C	CLEC17A_ENST00000547437.1_Missense_Mutation_p.Y172C|CLEC17A_ENST00000397439.2_Missense_Mutation_p.Y155C	NM_001204118.1	NP_001191047.1	Q6ZS10	CL17A_HUMAN	C-type lectin domain family 17, member A	172						cell surface (GO:0009986)|integral component of membrane (GO:0016021)	fucose binding (GO:0042806)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)										TGGATGGTGTACCTGTGTCTG	0.587																																							uc010dzn.1		NA																	0					0						c.(514-516)TAC>TGC		SubName: Full=CLEC17A protein;							107.0	116.0	113.0					19																	14707757		2152	4260	6412	SO:0001583	missense	388512					cell surface|integral to membrane	fucose binding|mannose binding|metal ion binding|receptor activity	g.chr19:14707757A>G	AK127809	CCDS46002.1, CCDS46002.2, CCDS56087.1	19p13.12	2009-06-26			ENSG00000187912	ENSG00000187912		"""C-type lectin domain containing"""	34520	protein-coding gene	gene with protein product	"""prolectin"""					19419970	Standard	NM_207390		Approved	FLJ45910	uc010dzn.2	Q6ZS10		ENST00000417570.1:c.515A>G	19.37:g.14707757A>G	ENSP00000393719:p.Tyr172Cys					CLEC17A_uc002mzh.1_Missense_Mutation_p.Y155C|CLEC17A_uc010xnt.1_RNA|CLEC17A_uc010xnu.1_Missense_Mutation_p.Y172C|CLEC17A_uc010dzo.1_Missense_Mutation_p.Y172C	p.Y172C			Q6ZS10	CL17A_HUMAN			9	592	+			172			Cytoplasmic (Potential).		A8MX68|B2RTX0|B7ZMM4	Missense_Mutation	SNP	ENST00000417570.1	37	c.515A>G	CCDS56087.1	.	.	.	.	.	.	.	.	.	.	A	0.222	-1.027731	0.02045	.	.	ENSG00000187912	ENST00000547437;ENST00000397439;ENST00000417570	T;T;T	0.64085	-0.08;-0.08;-0.08	4.19	-8.39	0.00969	.	3.508450	0.00979	N	0.003351	T	0.42017	0.1184	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.12013	0.005;0.002;0.0;0.002	B;B;B;B	0.06405	0.002;0.001;0.0;0.001	T	0.37776	-0.9691	10	0.49607	T	0.09	.	4.2305	0.10601	0.0906:0.4108:0.2527:0.2458	.	172;172;172;172	Q6ZS10-2;Q6ZS10-3;Q6ZS10;F8W1T8	.;.;CL17A_HUMAN;.	C	172;155;172	ENSP00000450065:Y172C;ENSP00000380581:Y155C;ENSP00000393719:Y172C	ENSP00000341620:Y172C	Y	+	2	0	CLEC17A	14568757	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.433000	0.02428	-5.434000	0.00014	-1.964000	0.00472	TAC		0.587	CLEC17A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403400.1	NM_207390		4	10	0	0	0	0.009096	0	4	10				
EMR2	30817	broad.mit.edu	37	19	14876338	14876338	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:14876338G>A	ENST00000315576.3	-	9	1277	c.826C>T	c.(826-828)Cag>Tag	p.Q276*	EMR2_ENST00000594076.1_Nonsense_Mutation_p.Q183*|EMR2_ENST00000392964.3_Nonsense_Mutation_p.Q15*|EMR2_ENST00000392967.2_Nonsense_Mutation_p.Q276*|EMR2_ENST00000346057.1_Nonsense_Mutation_p.Q227*|EMR2_ENST00000392965.3_Nonsense_Mutation_p.Q276*|EMR2_ENST00000596991.2_Nonsense_Mutation_p.Q276*|EMR2_ENST00000601345.1_Nonsense_Mutation_p.Q276*|EMR2_ENST00000353876.1_Nonsense_Mutation_p.Q183*|EMR2_ENST00000594294.1_Nonsense_Mutation_p.Q227*|EMR2_ENST00000595839.1_Nonsense_Mutation_p.Q134*|EMR2_ENST00000353005.1_Nonsense_Mutation_p.Q134*	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	276					cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						CCACTCACCTGGCTGTGGACT	0.612																																							uc002mzp.1		NA																	0				lung(2)|ovary(1)|skin(1)	4						c.(826-828)CAG>TAG		egf-like module containing, mucin-like, hormone							48.0	50.0	50.0					19																	14876338		2202	4277	6479	SO:0001587	stop_gained	30817				cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr19:14876338G>A	AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.826C>T	19.37:g.14876338G>A	ENSP00000319883:p.Gln276*					EMR2_uc010dzs.1_5'UTR|EMR2_uc010xnw.1_Nonsense_Mutation_p.Q276*|EMR2_uc002mzo.1_Nonsense_Mutation_p.Q276*|EMR2_uc002mzq.1_Nonsense_Mutation_p.Q227*|EMR2_uc002mzr.1_Nonsense_Mutation_p.Q227*|EMR2_uc002mzs.1_Nonsense_Mutation_p.Q134*|EMR2_uc002mzt.1_Nonsense_Mutation_p.Q183*|EMR2_uc002mzu.1_Nonsense_Mutation_p.Q183*|EMR2_uc010xnx.1_RNA|EMR2_uc010xny.1_RNA	p.Q276*	NM_013447	NP_038475	Q9UHX3	EMR2_HUMAN			9	1282	-			276			Extracellular (Potential).		B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Nonsense_Mutation	SNP	ENST00000315576.3	37	c.826C>T	CCDS32935.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.663161	0.88251	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000353005;ENST00000392965;ENST00000392964;ENST00000392962	.	.	.	3.82	-2.16	0.07080	.	.	.	.	.	.	.	.	.	.	.	0.43569	D	0.995892	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	6.4521	0.21910	0.0:0.1699:0.3116:0.5185	.	.	.	.	X	276;276;227;183;134;276;15;227	.	ENSP00000319883:Q276X	Q	-	1	0	EMR2	14737338	0.782000	0.28689	0.050000	0.19076	0.013000	0.08279	-0.141000	0.10327	0.008000	0.14787	0.382000	0.24955	CAG		0.612	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466502.2			4	22	0	0	0	0.001168	0	4	22				
OR7C2	26658	broad.mit.edu	37	19	15052879	15052879	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:15052879C>A	ENST00000248072.3	+	1	579	c.579C>A	c.(577-579)ttC>ttA	p.F193L		NM_012377.1	NP_036509.1	O60412	OR7C2_HUMAN	olfactory receptor, family 7, subfamily C, member 2	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(8)|ovary(2)|skin(2)	15	Ovarian(108;0.203)					CTGACACCTTCATCAATAACA	0.428																																							uc010xoc.1		NA																	0				ovary(2)|skin(1)	3						c.(577-579)TTC>TTA		olfactory receptor, family 7, subfamily C,							210.0	195.0	200.0					19																	15052879		2203	4300	6503	SO:0001583	missense	26658				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr19:15052879C>A	U86255	CCDS12320.1	19p13.1	2012-08-09				ENSG00000127529		"""GPCR / Class A : Olfactory receptors"""	8374	protein-coding gene	gene with protein product				OR7C3			Standard	NM_012377		Approved	OR19-18	uc010xoc.2	O60412		ENST00000248072.3:c.579C>A	19.37:g.15052879C>A	ENSP00000248072:p.Phe193Leu						p.F193L	NM_012377	NP_036509	O60412	OR7C2_HUMAN			1	579	+	Ovarian(108;0.203)		193			Extracellular (Potential).		O43881|Q6IFP9	Missense_Mutation	SNP	ENST00000248072.3	37	c.579C>A	CCDS12320.1	.	.	.	.	.	.	.	.	.	.	c	4.758	0.140921	0.09083	.	.	ENSG00000127529	ENST00000248072	T	0.00137	8.68	4.19	-4.43	0.03568	GPCR, rhodopsin-like superfamily (1);	0.623150	0.13160	N	0.409162	T	0.00073	0.0002	N	0.03967	-0.31	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.05599	-1.0875	10	0.17832	T	0.49	.	11.4487	0.50138	0.0:0.2524:0.0:0.7476	.	193	O60412	OR7C2_HUMAN	L	193	ENSP00000248072:F193L	ENSP00000248072:F193L	F	+	3	2	OR7C2	14913879	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.830000	0.00355	-0.611000	0.05709	-0.351000	0.07748	TTC		0.428	OR7C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466281.1			21	53	1	0	2.4624e-09	0.008871	2.75574e-09	21	53				
CTC-260E6.6	0	broad.mit.edu	37	19	20369855	20369855	+	RNA	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:20369855C>G	ENST00000593655.1	-	0	199																											CTCACTTGATCAATGTTGAAG	0.398																																							uc002nov.2		NA																	0					0						c.(646-648)ATC>ATG		SubName: Full=cDNA FLJ51655, highly similar to Actin-like protein 2;																																						284441							g.chr19:20369855C>G																													19.37:g.20369855C>G							p.I216M	NR_003128						1	1399	+									Missense_Mutation	SNP	ENST00000593655.1	37	c.648C>G																																																																																					0.398	CTC-260E6.6-006	KNOWN	basic	antisense	antisense	OTTHUMT00000462901.1			7	19	0	0	0	0.001984	0	7	19				
ZNF737	100129842	broad.mit.edu	37	19	20727915	20727915	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:20727915C>T	ENST00000427401.4	-	4	1188	c.1094G>A	c.(1093-1095)gGa>gAa	p.G365E		NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						GGGTTTCTCTCCACTATGAAT	0.393																																							uc002npa.2		NA																	0				ovary(1)	1						c.(1093-1095)GGA>GAA		zinc finger protein 737							21.0	21.0	21.0					19																	20727915		692	1591	2283	SO:0001583	missense	100129842				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding	g.chr19:20727915C>T	BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.1094G>A	19.37:g.20727915C>T	ENSP00000395733:p.Gly365Glu						p.G365E	NM_001159293	NP_001152765	C9JHM3	C9JHM3_HUMAN			4	1274	-			365					C9JHM3	Missense_Mutation	SNP	ENST00000427401.4	37	c.1094G>A	CCDS54238.1	.	.	.	.	.	.	.	.	.	.	N	10.21	1.288386	0.23478	.	.	ENSG00000237440	ENST00000427401	T	0.25749	1.78	0.801	0.801	0.18679	.	.	.	.	.	T	0.23289	0.0563	L	0.39467	1.215	0.33332	D	0.568774	P	0.41393	0.748	P	0.45071	0.468	T	0.33189	-0.9878	9	0.51188	T	0.08	.	6.955	0.24565	0.0:1.0:0.0:0.0	.	365	C9JHM3	.	E	365	ENSP00000395733:G365E	ENSP00000395733:G365E	G	-	2	0	ZNF737	20519755	0.022000	0.18835	0.478000	0.27316	0.480000	0.33159	1.396000	0.34531	0.170000	0.19704	0.173000	0.16961	GGA		0.393	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447844.2	NM_145289		11	35	0	0	0	0.010729	0	11	35				
ZFP30	22835	broad.mit.edu	37	19	38135626	38135626	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:38135626C>T	ENST00000351218.2	-	4	578	c.21G>A	c.(19-21)atG>atA	p.M7I	ZFP30_ENST00000392144.1_Missense_Mutation_p.M7I|ZFP30_ENST00000514101.2_Missense_Mutation_p.M7I|ZFP30_ENST00000589018.1_Missense_Mutation_p.M7I	NM_014898.2	NP_055713.1	Q9Y2G7	ZFP30_HUMAN	ZFP30 zinc finger protein	7	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	21			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CATCTCTGAACATCACCAAAT	0.373																																							uc002ogv.1		NA																	0					0						c.(19-21)ATG>ATA		zinc finger protein 30 homolog							96.0	88.0	91.0					19																	38135626		2203	4300	6503	SO:0001583	missense	22835				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:38135626C>T	AB023178	CCDS33005.1	19q13.13	2013-01-08	2012-11-27		ENSG00000120784	ENSG00000120784		"""Zinc fingers, C2H2-type"", ""-"""	29555	protein-coding gene	gene with protein product			"""zinc finger protein 30 homolog (mouse)"""			10231032	Standard	NM_014898		Approved	ZNF745, KIAA0961	uc002ogx.1	Q9Y2G7	OTTHUMG00000048177	ENST00000351218.2:c.21G>A	19.37:g.38135626C>T	ENSP00000343581:p.Met7Ile					ZFP30_uc002ogw.1_Missense_Mutation_p.M7I|ZFP30_uc002ogx.1_Missense_Mutation_p.M7I|ZFP30_uc010xtt.1_Missense_Mutation_p.M7I	p.M7I	NM_014898	NP_055713	Q9Y2G7	ZFP30_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		4	537	-			7			KRAB.		Q58EY8	Missense_Mutation	SNP	ENST00000351218.2	37	c.21G>A	CCDS33005.1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.371865	0.42003	.	.	ENSG00000120784	ENST00000351218;ENST00000514101;ENST00000392144;ENST00000440715	T;T;T	0.01665	4.7;4.7;4.7	4.83	2.73	0.32206	Krueppel-associated box (4);	0.469226	0.16183	N	0.225738	T	0.01765	0.0056	L	0.43152	1.355	0.29704	N	0.839965	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.33523	-0.9865	10	0.87932	D	0	.	1.5063	0.02487	0.1738:0.4725:0.1676:0.1861	.	7;7	D3Y2A0;Q9Y2G7	.;ZFP30_HUMAN	I	7	ENSP00000343581:M7I;ENSP00000422930:M7I;ENSP00000375988:M7I	ENSP00000343581:M7I	M	-	3	0	ZFP30	42827466	0.963000	0.33076	1.000000	0.80357	0.994000	0.84299	-0.203000	0.09438	1.380000	0.46344	0.650000	0.86243	ATG		0.373	ZFP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109601.2	NM_014898		10	41	0	0	0	0.010729	0	10	41				
RYR1	6261	broad.mit.edu	37	19	39001185	39001185	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:39001185G>C	ENST00000359596.3	+	59	8980	c.8980G>C	c.(8980-8982)Gag>Cag	p.E2994Q	RYR1_ENST00000360985.3_Missense_Mutation_p.E2994Q|RYR1_ENST00000355481.4_Missense_Mutation_p.E2994Q			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2994					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ACATGAACAGGAGATTAAATT	0.567																																							uc002oit.2		NA																	0				ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12						c.(8980-8982)GAG>CAG		skeletal muscle ryanodine receptor isoform 1	Dantrolene(DB01219)						124.0	125.0	125.0					19																	39001185		2203	4300	6503	SO:0001583	missense	6261				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr19:39001185G>C	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.8980G>C	19.37:g.39001185G>C	ENSP00000352608:p.Glu2994Gln					RYR1_uc002oiu.2_Missense_Mutation_p.E2994Q|RYR1_uc002oiv.1_5'UTR|RYR1_uc010xuf.1_5'Flank	p.E2994Q	NM_000540	NP_000531	P21817	RYR1_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		59	9110	+	all_cancers(60;7.91e-06)		2994			Cytoplasmic.		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	c.8980G>C	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	19.77	3.888627	0.72524	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.65364	-0.15;-0.15;-0.15	5.19	5.19	0.71726	.	0.000000	0.64402	U	0.000002	T	0.76011	0.3928	L	0.53249	1.67	0.54753	D	0.999985	D;D	0.71674	0.998;0.997	D;D	0.80764	0.994;0.986	T	0.76545	-0.2920	10	0.51188	T	0.08	.	18.3259	0.90254	0.0:0.0:1.0:0.0	.	2994;2994	P21817-2;P21817	.;RYR1_HUMAN	Q	2994	ENSP00000352608:E2994Q;ENSP00000347667:E2994Q;ENSP00000354254:E2994Q	ENSP00000347667:E2994Q	E	+	1	0	RYR1	43693025	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.474000	0.97718	2.423000	0.82170	0.561000	0.74099	GAG		0.567	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1			21	73	0	0	0	0.010504	0	21	73				
PSG2	5670	broad.mit.edu	37	19	43579684	43579684	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:43579684G>T	ENST00000406487.1	-	3	629	c.531C>A	c.(529-531)agC>agA	p.S177R		NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	177	Ig-like C2-type 1.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				ACCACTGGTAGCTTGTGTCCG	0.502																																							uc002ovr.2		NA																	0					0						c.(529-531)AGC>AGA		pregnancy specific beta-1-glycoprotein 2							246.0	247.0	246.0					19																	43579684		2202	4298	6500	SO:0001583	missense	5670				cell migration|female pregnancy	extracellular region		g.chr19:43579684G>T		CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.531C>A	19.37:g.43579684G>T	ENSP00000385706:p.Ser177Arg					PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG2_uc002ovq.3_Missense_Mutation_p.S177R|PSG2_uc010eiq.1_Missense_Mutation_p.S177R|PSG2_uc002ovs.3_Missense_Mutation_p.S177R|PSG2_uc002ovt.3_Missense_Mutation_p.S177R	p.S177R	NM_031246	NP_112536	P11465	PSG2_HUMAN			3	624	-		Prostate(69;0.00682)	177			Ig-like C2-type 1.		Q8TCD9|Q9UEA4|Q9UQ78	Missense_Mutation	SNP	ENST00000406487.1	37	c.531C>A	CCDS12616.1	.	.	.	.	.	.	.	.	.	.	N	10.80	1.452613	0.26074	.	.	ENSG00000242221	ENST00000406487;ENST00000329509;ENST00000401942;ENST00000406917	T	0.12672	2.66	1.33	0.222	0.15288	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.20981	0.0505	L	0.47078	1.49	0.09310	N	1	P;D	0.57571	0.494;0.98	B;P	0.62740	0.314;0.906	T	0.12477	-1.0546	9	0.59425	D	0.04	.	3.1083	0.06350	0.3157:0.0:0.6843:0.0	.	177;177	B5MCM8;P11465	.;PSG2_HUMAN	R	177	ENSP00000385706:S177R	ENSP00000332984:S177R	S	-	3	2	PSG2	48271524	0.041000	0.20044	0.007000	0.13788	0.003000	0.03518	0.100000	0.15231	0.703000	0.31848	0.454000	0.30748	AGC		0.502	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323083.1	NM_031246		59	224	1	0	7.41606e-26	0.01441	9.1772e-26	59	224				
ZNF223	7766	broad.mit.edu	37	19	44570525	44570526	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:44570525_44570526GG>TT	ENST00000434772.3	+	5	799_800	c.544_545GG>TT	c.(544-546)GGa>TTa	p.G182L	ZNF223_ENST00000591793.1_Missense_Mutation_p.G292L	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223	182					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G182*(1)		endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				TGATGAGTGTGGAAAAAGCTTC	0.431																																							uc002oyf.1		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(1)	1						c.(544-546)GGA>TTA		zinc finger protein 223																																				SO:0001583	missense	7766				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44570525_44570526GG>TT	AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		Exception_encountered	19.37:g.44570525_44570526delinsTT	ENSP00000401947:p.Gly182Leu					ZNF284_uc010ejd.2_RNA	p.G182L	NM_013361	NP_037493	Q9UK11	ZN223_HUMAN			5	797_798	+		Prostate(69;0.0352)	182			C2H2-type 1.		Q15736|Q8TBJ3|Q9HCA9	Missense_Mutation	DNP	ENST00000434772.3	37	c.544_545GG>TT	CCDS12635.1																																																																																				0.431	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460469.2			44	117	0	0	0	0.004672	0	44	117				
ZNF112	7771	broad.mit.edu	37	19	44833574	44833574	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:44833574G>A	ENST00000337401.4	-	5	842	c.754C>T	c.(754-756)Caa>Taa	p.Q252*	ZNF112_ENST00000536500.1_Nonsense_Mutation_p.Q269*|ZNF112_ENST00000354340.4_Nonsense_Mutation_p.Q246*	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	252					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TCCTCTGTTTGAATTGACTCC	0.423																																						Melanoma(53;975 1202 7512 15993 27273)	uc010ejj.2		NA																	0				ovary(3)|skin(2)	5						c.(754-756)CAA>TAA		zinc finger protein 228 isoform 1							123.0	120.0	121.0					19																	44833574		2203	4300	6503	SO:0001587	stop_gained	7771				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44833574G>A	AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.754C>T	19.37:g.44833574G>A	ENSP00000337081:p.Gln252*					ZFP112_uc002ozc.3_Nonsense_Mutation_p.Q246*|ZFP112_uc010xwy.1_Nonsense_Mutation_p.Q269*|ZFP112_uc010xwz.1_Nonsense_Mutation_p.Q251*	p.Q252*	NM_001083335	NP_001076804	Q9UJU3	ZF112_HUMAN			5	867	-			252					A4FU53|Q9HCA7	Nonsense_Mutation	SNP	ENST00000337401.4	37	c.754C>T	CCDS54276.1	.	.	.	.	.	.	.	.	.	.	G	18.63	3.665888	0.67700	.	.	ENSG00000062370	ENST00000337401;ENST00000412927;ENST00000354340;ENST00000536500;ENST00000253426	.	.	.	4.85	1.28	0.21552	.	0.544626	0.13898	N	0.355109	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-2.1527	9.457	0.38760	0.0:0.1438:0.5768:0.2794	.	.	.	.	X	252;252;246;269;251	.	ENSP00000253426:Q251X	Q	-	1	0	ZNF285	49525414	0.011000	0.17503	0.000000	0.03702	0.048000	0.14542	0.559000	0.23485	0.270000	0.21984	0.561000	0.74099	CAA		0.423	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460744.1	NM_013380		19	63	0	0	0	0.007413	0	19	63				
CLPTM1	1209	broad.mit.edu	37	19	45493695	45493695	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:45493695C>G	ENST00000337392.5	+	10	1325	c.1175C>G	c.(1174-1176)tCc>tGc	p.S392C	CLPTM1_ENST00000541297.2_Missense_Mutation_p.S378C|CLPTM1_ENST00000546079.1_Missense_Mutation_p.S290C	NM_001282175.1|NM_001282176.1|NM_001294.2	NP_001269104.1|NP_001269105.1|NP_001285.1	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane protein 1	392					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of T cell differentiation in thymus (GO:0033081)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		GAGGGCCTGTCCGTGCGCTCC	0.597																																							uc002pai.2		NA																	0				ovary(1)	1						c.(1174-1176)TCC>TGC		cleft lip and palate associated transmembrane							142.0	138.0	139.0					19																	45493695		2203	4300	6503	SO:0001583	missense	1209				cell differentiation|multicellular organismal development|regulation of T cell differentiation in thymus	external side of plasma membrane|integral to plasma membrane		g.chr19:45493695C>G	AF037339	CCDS12651.1, CCDS74394.1, CCDS74395.1	19q13.3	2008-02-05				ENSG00000104853			2087	protein-coding gene	gene with protein product		604783				9828125	Standard	NM_001294		Approved		uc002pai.3	O96005		ENST00000337392.5:c.1175C>G	19.37:g.45493695C>G	ENSP00000336994:p.Ser392Cys					CLPTM1_uc010xxf.1_Missense_Mutation_p.S290C|CLPTM1_uc010xxg.1_Missense_Mutation_p.S378C	p.S392C	NM_001294	NP_001285	O96005	CLPT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)	10	1190	+		all_neural(266;0.224)|Ovarian(192;0.231)	392			Helical; (Potential).		B3KQH2|B4DDS3|B4E2X9|B7Z9X9|F5H8J3|Q53ET6|Q9BSS5	Missense_Mutation	SNP	ENST00000337392.5	37	c.1175C>G	CCDS12651.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.745214	0.89663	.	.	ENSG00000104853	ENST00000546079;ENST00000541297;ENST00000337392;ENST00000347493	.	.	.	4.8	4.8	0.61643	.	0.187313	0.47852	D	0.000218	D	0.86239	0.5885	H	0.94925	3.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.982;0.989	D	0.90030	0.4134	9	0.87932	D	0	-14.7484	15.4469	0.75238	0.0:1.0:0.0:0.0	.	378;392	F5H8J3;O96005	.;CLPT1_HUMAN	C	290;378;392;392	.	ENSP00000336994:S392C	S	+	2	0	CLPTM1	50185535	1.000000	0.71417	0.936000	0.37596	0.985000	0.73830	7.071000	0.76770	2.513000	0.84729	0.485000	0.47835	TCC		0.597	CLPTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453267.1	NM_001294		38	157	0	0	0	0.007835	0	38	157				
CD3EAP	10849	broad.mit.edu	37	19	45912504	45912504	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:45912504G>C	ENST00000309424.3	+	3	1766	c.1278G>C	c.(1276-1278)aaG>aaC	p.K426N	PPP1R13L_ENST00000418234.2_5'Flank|CD3EAP_ENST00000589804.1_Missense_Mutation_p.K428N|ERCC1_ENST00000588738.1_5'Flank|ERCC1_ENST00000300853.3_3'UTR|ERCC1_ENST00000423698.2_3'UTR	NM_012099.1	NP_036231.1	O15446	RPA34_HUMAN	CD3e molecule, epsilon associated protein	426	Poly-Lys.				rRNA transcription (GO:0009303)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		agaagaagaagaagaaagaga	0.577																																							uc002pbq.1		NA																	0				large_intestine(2)|ovary(2)	4						c.(1276-1278)AAG>AAC		CD3E antigen, epsilon polypeptide associated							41.0	49.0	46.0					19																	45912504		2199	4295	6494	SO:0001583	missense	10849				rRNA transcription|transmembrane receptor protein tyrosine kinase signaling pathway	chromosome|RNA polymerase I transcription factor complex	DNA-directed RNA polymerase activity	g.chr19:45912504G>C	U86751	CCDS12661.1, CCDS74397.1	19q13.3	2008-02-05	2006-03-28			ENSG00000117877			24219	protein-coding gene	gene with protein product	"""CD3 epsilon associated protein"", ""antisense to ERCC 1"""	107325	"""CD3e antigen, epsilon polypeptide associated protein"""			10373416, 9426281, 15226435	Standard	XM_005258425		Approved	ASE-1, CAST, PAF49	uc002pbq.1	O15446		ENST00000309424.3:c.1278G>C	19.37:g.45912504G>C	ENSP00000310966:p.Lys426Asn					PPP1R13L_uc002pbo.2_5'Flank|PPP1R13L_uc002pbp.2_5'Flank|CD3EAP_uc002pbr.1_Missense_Mutation_p.K428N	p.K426N	NM_012099	NP_036231	O15446	RPA34_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0251)	3	1766	+		all_neural(266;0.224)|Ovarian(192;0.231)	426			Poly-Lys.		Q32N11|Q7Z5U2|Q9UPF6	Missense_Mutation	SNP	ENST00000309424.3	37	c.1278G>C	CCDS12661.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.011102	0.35511	.	.	ENSG00000117877	ENST00000309424	T	0.19394	2.15	3.96	0.327	0.15913	.	0.376510	0.19203	N	0.120129	T	0.15435	0.0372	L	0.32530	0.975	0.58432	D	0.999999	P;P	0.50819	0.939;0.9	P;B	0.45538	0.484;0.291	T	0.06499	-1.0823	10	0.72032	D	0.01	-12.286	5.2642	0.15589	0.2076:0.1709:0.6216:0.0	.	428;426	O15446-2;O15446	.;RPA34_HUMAN	N	426	ENSP00000310966:K426N	ENSP00000310966:K426N	K	+	3	2	CD3EAP	50604344	0.988000	0.35896	0.785000	0.31869	0.808000	0.45660	0.550000	0.23345	0.683000	0.31428	-0.221000	0.12465	AAG		0.577	CD3EAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459538.1	NM_012099		13	27	0	0	0	0.013537	0	13	27				
EML2	24139	broad.mit.edu	37	19	46124873	46124873	+	Silent	SNP	C	C	T	rs199582284		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:46124873C>T	ENST00000245925.3	-	10	914	c.864G>A	c.(862-864)gcG>gcA	p.A288A	EML2_ENST00000586902.1_5'UTR|EML2_ENST00000536630.1_Silent_p.A435A|EML2_ENST00000587152.1_Silent_p.A489A|EML2_ENST00000589876.1_Silent_p.A288A	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	288	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		CGCCCAGCACCGCCTGTGTGA	0.672													C|||	1	0.000199681	0.0	0.0	5008	,	,		14351	0.0		0.001	False		,,,				2504	0.0						uc002pcn.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(862-864)GCG>GCA		echinoderm microtubule associated protein like							24.0	26.0	25.0					19																	46124873		2203	4298	6501	SO:0001819	synonymous_variant	24139				sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding	g.chr19:46124873C>T	AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.864G>A	19.37:g.46124873C>T						EML2_uc002pco.2_RNA|EML2_uc002pcp.2_Silent_p.A172A|EML2_uc010xxl.1_Silent_p.A435A|EML2_uc010xxm.1_Silent_p.A489A|EML2_uc010xxn.1_RNA|EML2_uc010xxo.1_Silent_p.A288A|EML2_uc010ekj.2_Missense_Mutation_p.R255Q	p.A288A	NM_012155	NP_036287	O95834	EMAL2_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)	10	899	-		Ovarian(192;0.179)|all_neural(266;0.224)	288			WD 4.		B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Silent	SNP	ENST00000245925.3	37	c.864G>A	CCDS12670.1																																																																																				0.672	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459608.1	NM_012155		4	29	0	0	0	0.001168	0	4	29				
PIH1D1	55011	broad.mit.edu	37	19	49950617	49950617	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:49950617C>T	ENST00000262265.5	-	6	824	c.589G>A	c.(589-591)Gcc>Acc	p.A197T	PIH1D1_ENST00000602226.1_5'Flank|PIH1D1_ENST00000596049.1_Missense_Mutation_p.A197T	NM_017916.2	NP_060386.1	Q9NWS0	PIHD1_HUMAN	PIH1 domain containing 1	197					box C/D snoRNP assembly (GO:0000492)|epithelial cell differentiation (GO:0030855)	pre-snoRNP complex (GO:0070761)				NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|urinary_tract(1)	11		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)		CTCCCGGGGGCGGGCGTGTAC	0.627																																							uc002pns.2		NA																	0					0						c.(589-591)GCC>ACC		NOP17							60.0	65.0	63.0					19																	49950617		2203	4300	6503	SO:0001583	missense	55011				box C/D snoRNP assembly	pre-snoRNP complex		g.chr19:49950617C>T	AK000650	CCDS12765.1	19q13.33	2012-07-18	2007-01-31	2007-01-31	ENSG00000104872	ENSG00000104872			26075	protein-coding gene	gene with protein product		611480		NOP17		12477932	Standard	NM_017916		Approved	FLJ20643	uc002pns.2	Q9NWS0		ENST00000262265.5:c.589G>A	19.37:g.49950617C>T	ENSP00000262265:p.Ala197Thr						p.A197T	NM_017916	NP_060386	Q9NWS0	PIHD1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)	6	873	-		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)	197					B4DGN7|B4E2X7|Q9BVL0	Missense_Mutation	SNP	ENST00000262265.5	37	c.589G>A	CCDS12765.1	.	.	.	.	.	.	.	.	.	.	C	5.463	0.270482	0.10349	.	.	ENSG00000104872	ENST00000262265	T	0.11712	2.75	3.56	0.246	0.15516	.	1.572840	0.03593	N	0.232161	T	0.06416	0.0165	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36456	-0.9747	10	0.14252	T	0.57	-1.3313	5.6981	0.17867	0.0:0.6426:0.0:0.3574	.	197	Q9NWS0	PIHD1_HUMAN	T	197	ENSP00000262265:A197T	ENSP00000262265:A197T	A	-	1	0	PIH1D1	54642429	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.066000	0.11598	0.150000	0.19136	0.655000	0.94253	GCC		0.627	PIH1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465389.2	NM_017916		14	59	0	0	0	0.004007	0	14	59				
SIGLEC11	114132	broad.mit.edu	37	19	50453287	50453287	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:50453287C>T	ENST00000447370.2	-	11	2127	c.2037G>A	c.(2035-2037)ctG>ctA	p.L679L	U3_ENST00000408198.1_RNA|CTC-326K19.6_ENST00000451973.1_Intron|SIGLEC11_ENST00000426971.2_Silent_p.L583L	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	679					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		CTGGGCCCCTCAGGGGCTGTC	0.612																																							uc010ybh.1		NA																	0				ovary(3)|central_nervous_system(2)|pancreas(1)	6						c.(2035-2037)CTG>CTA		sialic acid binding Ig-like lectin 11 isoform 1							35.0	33.0	34.0					19																	50453287		2202	4300	6502	SO:0001819	synonymous_variant	114132				cell adhesion	integral to membrane	sugar binding	g.chr19:50453287C>T	AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.2037G>A	19.37:g.50453287C>T						SIGLEC11_uc010ybi.1_Silent_p.L583L	p.L679L	NM_052884	NP_443116	Q96RL6	SIG11_HUMAN		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)	11	2128	-		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)	679			Cytoplasmic (Potential).			Silent	SNP	ENST00000447370.2	37	c.2037G>A	CCDS12790.2																																																																																				0.612	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1	NM_052884		6	19	0	0	0	0.001168	0	6	19				
ZNF610	162963	broad.mit.edu	37	19	52869486	52869486	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:52869486G>T	ENST00000403906.3	+	6	1311	c.855G>T	c.(853-855)gaG>gaT	p.E285D	ZNF610_ENST00000601151.1_Missense_Mutation_p.E242D|ZNF610_ENST00000327920.8_Missense_Mutation_p.E285D|ZNF610_ENST00000321287.8_Missense_Mutation_p.E285D	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	285					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		ATACTGGAGAGAAGCCTCACA	0.393																																							uc002pyx.3		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(853-855)GAG>GAT		zinc finger protein 610 isoform a							52.0	48.0	49.0					19																	52869486		2203	4300	6503	SO:0001583	missense	162963				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52869486G>T	AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.855G>T	19.37:g.52869486G>T	ENSP00000383922:p.Glu285Asp					ZNF610_uc002pyy.3_Missense_Mutation_p.E285D|ZNF610_uc002pyz.3_Missense_Mutation_p.E242D|ZNF610_uc002pza.2_Missense_Mutation_p.E285D	p.E285D	NM_001161426	NP_001154898	Q8N9Z0	ZN610_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)	6	1261	+			285					A8K4C3|Q86YH8|Q8NDS9	Missense_Mutation	SNP	ENST00000403906.3	37	c.855G>T	CCDS12851.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.599766	0.46318	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	T;T	0.26810	1.71;1.71	1.69	-1.01	0.10169	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22589	0.0545	N	0.17872	0.535	0.22835	N	0.998672	P;P	0.48998	0.899;0.918	P;P	0.55577	0.671;0.779	T	0.13656	-1.0501	9	0.66056	D	0.02	.	3.0313	0.06108	0.2998:0.0:0.4939:0.2062	.	242;285	Q8N9Z0-2;Q8N9Z0	.;ZN610_HUMAN	D	285;242;285	ENSP00000383922:E285D;ENSP00000327597:E285D	ENSP00000324441:E242D	E	+	3	2	ZNF610	57561298	0.987000	0.35691	0.063000	0.19743	0.715000	0.41141	0.678000	0.25277	-0.405000	0.07599	0.313000	0.20887	GAG		0.393	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462880.1	NM_173530		11	35	1	0	2.80697e-09	0.010729	3.13086e-09	11	35				
KIR3DX1	90011	broad.mit.edu	37	19	55049204	55049204	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:55049204C>T	ENST00000335056.3	+	6	1007	c.969C>T	c.(967-969)ctC>ctT	p.L323L	KIR3DX1_ENST00000482404.1_3'UTR			Q9H7L2	KI3X1_HUMAN	killer cell immunoglobulin-like receptor, three domains, X1	323						extracellular region (GO:0005576)				endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|skin(1)	24				GBM - Glioblastoma multiforme(193;0.099)		GAGTACTCCTCTGTCATTCAC	0.453																																					Colon(183;529 2002 28270 32358 35845)|Esophageal Squamous(50;443 1006 2278 10294 37938)	Colon(183;529 2002 28270 32358 35845)|Esophageal Squamous(50;443 1006 2278 10294 37938)	uc010erm.2		NA																	0				ovary(1)	1						c.(268-270)CTC>CTT		Homo sapiens killer cell immunoglobulin-like receptor, three domains, X1, mRNA (cDNA clone IMAGE:4849085).							140.0	133.0	135.0					19																	55049204		1876	4110	5986	SO:0001819	synonymous_variant	90011							g.chr19:55049204C>T	BC033195		19q13.42	2013-03-26	2006-09-12	2006-09-12	ENSG00000104970	ENSG00000104970		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	25043	other	unknown			"""leukocyte receptor cluster (LRC) member 12"""	LENG12		11441184	Standard	NR_026716		Approved	FLJ00060	uc010erm.2	Q9H7L2	OTTHUMG00000065696	ENST00000335056.3:c.969C>T	19.37:g.55049204C>T						KIR3DX1_uc010yfa.1_RNA|KIR3DX1_uc010yfb.1_RNA|KIR3DX1_uc010yfc.1_RNA|KIR3DX1_uc010yfd.1_RNA	p.L90L						GBM - Glioblastoma multiforme(193;0.099)	2	282	+								B7WNL0|Q8N0S4	Silent	SNP	ENST00000335056.3	37	c.270C>T																																																																																					0.453	KIR3DX1-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000140800.2	NR_026716		24	81	0	0	0	0.005443	0	24	81				
KIR3DL1	3811	broad.mit.edu	37	19	55349312	55349312	+	Intron	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:55349312C>A	ENST00000402254.2	+	6	1033				KIR2DS4_ENST00000339924.8_RNA			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		CAGTGACCCTCTGGACATGGT	0.507																																							uc002qhm.1		NA																	0					0						c.(352-354)CTG>ATG		killer cell immunoglobulin-like receptor, two							303.0	261.0	275.0					19																	55349312		2174	4195	6369	SO:0001627	intron_variant	3809					integral to plasma membrane	receptor activity	g.chr19:55349312C>A	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000402254.2:c.1000+12779C>A	19.37:g.55349312C>A						KIR2DS4_uc010yfj.1_Missense_Mutation_p.L111M|KIR2DS4_uc010yfk.1_RNA|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_Missense_Mutation_p.L118M|KIR2DS4_uc002qhn.1_Missense_Mutation_p.L65M	p.L118M	NM_012314	NP_036446	P43632	KI2S4_HUMAN		GBM - Glioblastoma multiforme(193;0.0192)	3	398	+			118			Extracellular (Potential).		O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000402254.2	37	c.352C>A																																																																																					0.507	KIR3DL1-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_013289		74	285	1	0	1.13027e-35	0.01441	1.42782e-35	74	285				
PEG3	5178	broad.mit.edu	37	19	57334186	57334186	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:57334186C>A	ENST00000326441.9	-	6	863	c.500G>T	c.(499-501)cGg>cTg	p.R167L	ZIM2_ENST00000593931.1_Missense_Mutation_p.R42L|PEG3_ENST00000598410.1_Missense_Mutation_p.R42L|ZIM2_ENST00000601070.1_Missense_Mutation_p.R42L|PEG3_ENST00000593695.1_Missense_Mutation_p.R41L|ZIM2_ENST00000221722.5_Missense_Mutation_p.R42L|ZIM2_ENST00000599935.1_Missense_Mutation_p.R42L|ZIM2_ENST00000593711.1_Missense_Mutation_p.R42L|ZIM2_ENST00000391708.3_Missense_Mutation_p.R42L|PEG3_ENST00000423103.2_Missense_Mutation_p.R167L|PEG3_ENST00000594706.1_5'Flank	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	167					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TCTGCCCCTCCGGTCCCAGTC	0.542																																							uc002qnu.2		NA																	0				ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(499-501)CGG>CTG		paternally expressed 3 isoform 1							112.0	81.0	92.0					19																	57334186		2203	4300	6503	SO:0001583	missense	5178				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:57334186C>A	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.500G>T	19.37:g.57334186C>A	ENSP00000326581:p.Arg167Leu					ZIM2_uc010ygq.1_5'UTR|ZIM2_uc010ygr.1_5'UTR|ZIM2_uc002qnr.2_Missense_Mutation_p.R42L|ZIM2_uc002qnq.2_Missense_Mutation_p.R42L|ZIM2_uc010etp.2_Missense_Mutation_p.R42L|ZIM2_uc010ygs.1_Missense_Mutation_p.R42L|PEG3_uc002qnt.2_Missense_Mutation_p.R168L|PEG3_uc002qnv.2_Missense_Mutation_p.R167L|PEG3_uc002qnw.2_Missense_Mutation_p.R42L|PEG3_uc002qnx.2_Missense_Mutation_p.R41L|PEG3_uc010etr.2_Missense_Mutation_p.R167L	p.R167L	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN		GBM - Glioblastoma multiforme(193;0.0269)	3	851	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	167					A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	c.500G>T	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.496363	0.44352	.	.	ENSG00000198300	ENST00000391708;ENST00000221722;ENST00000326441;ENST00000423103;ENST00000292074	T;T;T;T	0.10668	2.85;2.85;4.11;4.11	3.88	3.88	0.44766	.	0.359730	0.20263	N	0.095821	T	0.05502	0.0145	N	0.14661	0.345	.	.	.	P;P;B;P	0.50272	0.649;0.649;0.006;0.933	B;B;B;B	0.41466	0.14;0.14;0.003;0.358	T	0.04811	-1.0925	9	0.02654	T	1	-11.255	11.633	0.51187	0.0:1.0:0.0:0.0	.	42;167;101;42	A7E2B8;Q9GZU2;Q96Q96;Q9NZV7	.;PEG3_HUMAN;.;ZIM2_HUMAN	L	42;42;167;167;167	ENSP00000375589:R42L;ENSP00000221722:R42L;ENSP00000326581:R167L;ENSP00000403051:R167L	ENSP00000221722:R42L	R	-	2	0	ZIM2	62025998	0.000000	0.05858	0.345000	0.25642	0.193000	0.23685	-0.001000	0.12947	2.454000	0.82982	0.561000	0.74099	CGG		0.542	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			7	10	1	0	8.12818e-05	0.001984	8.59192e-05	7	10				
ZNF547	284306	broad.mit.edu	37	19	57888907	57888907	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:57888907A>G	ENST00000282282.3	+	4	713	c.563A>G	c.(562-564)aAa>aGa	p.K188R	AC003002.4_ENST00000597658.1_Intron	NM_173631.2	NP_775902.2	Q8IVP9	ZN547_HUMAN	zinc finger protein 547	188					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AAGTGCAGCAAATGTGGGATA	0.413																																							uc002qol.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(562-564)AAA>AGA		zinc finger protein 547							77.0	75.0	76.0					19																	57888907		2203	4300	6503	SO:0001583	missense	284306				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57888907A>G	AK055662	CCDS33131.1	19q13.43	2013-01-08				ENSG00000152433		"""Zinc fingers, C2H2-type"", ""-"""	26432	protein-coding gene	gene with protein product							Standard	NM_173631		Approved	FLJ31100	uc002qol.3	Q8IVP9		ENST00000282282.3:c.563A>G	19.37:g.57888907A>G	ENSP00000282282:p.Lys188Arg					ZNF547_uc002qpm.3_Missense_Mutation_p.K114R|ZNF547_uc010ygx.1_Missense_Mutation_p.K188R	p.K188R	NM_173631	NP_775902	Q8IVP9	ZN547_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	4	756	+		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)	188			C2H2-type 3.		A8K5Z9|Q96NC4	Missense_Mutation	SNP	ENST00000282282.3	37	c.563A>G	CCDS33131.1	.	.	.	.	.	.	.	.	.	.	A	9.185	1.024569	0.19433	.	.	ENSG00000152433	ENST00000391704;ENST00000282282	T	0.20069	2.1	1.87	-3.53	0.04667	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14614	0.0353	L	0.39633	1.23	0.09310	N	1	B;B;B	0.22909	0.005;0.077;0.0	B;B;B	0.28139	0.008;0.086;0.001	T	0.35425	-0.9789	9	0.87932	D	0	.	2.8132	0.05447	0.4623:0.0:0.2213:0.3165	.	188;188;188	Q8IVP9-2;C9JTQ3;Q8IVP9	.;.;ZN547_HUMAN	R	188	ENSP00000282282:K188R	ENSP00000282282:K188R	K	+	2	0	ZNF547	62580719	0.000000	0.05858	0.000000	0.03702	0.185000	0.23345	0.231000	0.17872	-1.253000	0.02488	-1.475000	0.01000	AAA		0.413	ZNF547-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465787.1	NM_173631		22	58	0	0	0	0.00333	0	22	58				
ZSCAN1	284312	broad.mit.edu	37	19	58563859	58563859	+	Splice_Site	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:58563859C>T	ENST00000282326.1	+	5	714	c.467C>T	c.(466-468)gCg>gTg	p.A156V		NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	156					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)	p.A156E(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CCATTCTAGGCGTCTGAGCTG	0.617																																							uc002qrc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(466-468)GCG>GTG		zinc finger and SCAN domain containing 1							60.0	59.0	59.0					19																	58563859		2203	4300	6503	SO:0001630	splice_region_variant	284312				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58563859C>T	AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.466-1C>T	19.37:g.58563859C>T							p.A156V	NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)	5	714	+		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	156					Q3B798|Q6WLH8|Q86WS8	Missense_Mutation	SNP	ENST00000282326.1	37	c.467C>T	CCDS12969.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.686210	0.00738	.	.	ENSG00000152467	ENST00000282326	T	0.04317	3.65	1.91	-0.689	0.11313	.	.	.	.	.	T	0.01905	0.0060	N	0.19112	0.55	0.09310	N	1	P	0.48230	0.907	B	0.28139	0.086	T	0.48479	-0.9032	9	0.16896	T	0.51	.	4.8185	0.13378	0.0:0.6172:0.0:0.3828	.	156	Q8NBB4	ZSCA1_HUMAN	V	156	ENSP00000282326:A156V	ENSP00000282326:A156V	A	+	2	0	ZSCAN1	63255671	0.016000	0.18221	0.002000	0.10522	0.005000	0.04900	0.473000	0.22132	-0.288000	0.09051	-0.339000	0.08088	GCG		0.617	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466427.1	NM_182572	Missense_Mutation	15	56	0	0	0	0.006122	0	15	56				
RNASEH1	246243	broad.mit.edu	37	2	3605786	3605786	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:3605786G>C	ENST00000315212.3	-	1	420	c.65C>G	c.(64-66)tCt>tGt	p.S22C	AC108488.3_ENST00000426725.1_RNA|AC108488.3_ENST00000438436.1_RNA	NM_002936.3	NP_002927.2	O60930	RNH1_HUMAN	ribonuclease H1	22					mitochondrial DNA replication (GO:0006264)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)|RNA binding (GO:0003723)|RNA-DNA hybrid ribonuclease activity (GO:0004523)			endometrium(1)|kidney(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	13	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0713)|Epithelial(75;0.167)|all cancers(51;0.22)		GAACCCGCGAGAGCCGCGGCG	0.697																																							uc002qxt.2		NA																	0				ovary(1)	1						c.(64-66)TCT>TGT		ribonuclease H1							13.0	14.0	14.0					2																	3605786		2190	4281	6471	SO:0001583	missense	246243				RNA catabolic process	cytoplasm	magnesium ion binding|ribonuclease H activity|RNA binding	g.chr2:3605786G>C	AF039652	CCDS1647.1	2p25	2008-03-11			ENSG00000171865	ENSG00000171865	3.1.26.-		18466	protein-coding gene	gene with protein product	"""RNase H1"""	604123				12036296, 17964265	Standard	XR_244873		Approved		uc002qxt.3	O60930	OTTHUMG00000090279	ENST00000315212.3:c.65C>G	2.37:g.3605786G>C	ENSP00000313350:p.Ser22Cys					RNASEH1_uc002qxs.2_5'UTR|uc002qxu.2_5'Flank|uc002qxv.2_5'Flank	p.S22C	NM_002936	NP_002927	O60930	RNH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.0713)|Epithelial(75;0.167)|all cancers(51;0.22)	1	155	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)		22					B3KQU4|O60523|O60857|Q57Z93|Q5U0C1|Q6FHD4	Missense_Mutation	SNP	ENST00000315212.3	37	c.65C>G	CCDS1647.1	.	.	.	.	.	.	.	.	.	.	G	11.44	1.638879	0.29157	.	.	ENSG00000171865	ENST00000315212	T	0.45668	0.89	4.61	-1.44	0.08856	.	1.003590	0.08033	N	0.993790	T	0.16938	0.0407	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22208	-1.0223	10	0.52906	T	0.07	-5.3409	7.1706	0.25717	0.4083:0.318:0.2737:0.0	.	22	O60930	RNH1_HUMAN	C	22	ENSP00000313350:S22C	ENSP00000313350:S22C	S	-	2	0	RNASEH1	3583661	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	-0.569000	0.05902	-0.162000	0.10964	-0.344000	0.07964	TCT		0.697	RNASEH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206605.2			2	8	0	0	0	0.004672	0	2	8				
RDH14	57665	broad.mit.edu	37	2	18736478	18736478	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:18736478C>T	ENST00000381249.3	-	2	1097	c.990G>A	c.(988-990)gtG>gtA	p.V330V	RDH14_ENST00000468071.1_5'UTR	NM_020905.3	NP_065956.1	Q9HBH5	RDH14_HUMAN	retinol dehydrogenase 14 (all-trans/9-cis/11-cis)	330					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)				Vitamin A(DB00162)	GGCCAACCATCACTTCACTGA	0.398																																							uc010exr.2		NA																	0				skin(2)|ovary(1)	3						c.(1930-1932)GTG>GTA		5' nucleotidase, cytosolic IB isoform 2							146.0	144.0	145.0					2																	18736478		2203	4300	6503	SO:0001819	synonymous_variant	93034				purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding	g.chr2:18736478C>T	AF237952	CCDS1693.1	2p24.2	2011-09-14	2006-05-09		ENSG00000240857	ENSG00000240857	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19979	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 4"""		"""retinol dehydrogenase 14 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_020905		Approved	PAN2, SDR7C4		Q9HBH5	OTTHUMG00000090705	ENST00000381249.3:c.990G>A	2.37:g.18736478C>T						NT5C1B_uc002rcy.2_3'UTR|RDH14_uc002rcx.3_Silent_p.V330V	p.V644V	NM_033253	NP_150278	Q96P26	5NT1B_HUMAN			9	2036	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)	Error:Variant_position_missing_in_Q96P26_after_alignment						Silent	SNP	ENST00000381249.3	37	c.1932G>A	CCDS1693.1																																																																																				0.398	RDH14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207394.1			19	104	0	0	0	0.010504	0	19	104				
APOB	338	broad.mit.edu	37	2	21225915	21225915	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:21225915C>T	ENST00000233242.1	-	29	12506	c.12379G>A	c.(12379-12381)Gac>Aac	p.D4127N	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4127					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AACCTCACGTCGATATCATCA	0.502																																							uc002red.2		NA																	0				ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27						c.(12379-12381)GAC>AAC		apolipoprotein B precursor	Atorvastatin(DB01076)						145.0	137.0	140.0					2																	21225915		2203	4300	6503	SO:0001583	missense	338				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	g.chr2:21225915C>T	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.12379G>A	2.37:g.21225915C>T	ENSP00000233242:p.Asp4127Asn						p.D4127N	NM_000384	NP_000375	P04114	APOB_HUMAN			29	12507	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		4127					O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	c.12379G>A	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	12.28	1.890580	0.33348	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.32023	1.47	5.99	1.79	0.24919	.	1.071370	0.07198	N	0.857017	T	0.22282	0.0537	L	0.29908	0.895	0.09310	N	0.999995	B	0.18968	0.032	B	0.08055	0.003	T	0.28839	-1.0031	10	0.30078	T	0.28	.	7.9066	0.29765	0.0:0.4896:0.3625:0.1479	.	4127	P04114	APOB_HUMAN	N	4127	ENSP00000233242:D4127N	ENSP00000233242:D4127N	D	-	1	0	APOB	21079420	0.013000	0.17824	0.000000	0.03702	0.009000	0.06853	0.312000	0.19397	0.029000	0.15352	0.655000	0.94253	GAC		0.502	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			12	135	0	0	0	0.001855	0	12	135				
OTOF	9381	broad.mit.edu	37	2	26750699	26750699	+	Splice_Site	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:26750699C>A	ENST00000272371.2	-	3	354		c.e3+1		OTOF_ENST00000403946.3_Splice_Site	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin						membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCACACTTACTTGTTGCTGA	0.562																																					GBM(102;732 1451 20652 24062 31372)	GBM(102;732 1451 20652 24062 31372)	uc002rhk.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7						c.e3+1		otoferlin isoform a							99.0	100.0	100.0					2																	26750699		2203	4300	6503	SO:0001630	splice_region_variant	9381				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding	g.chr2:26750699C>A	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.227+1G>T	2.37:g.26750699C>A							p.K76_splice	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN			3	354	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)							B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Splice_Site	SNP	ENST00000272371.2	37	c.227_splice	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.093953	0.76870	.	.	ENSG00000115155	ENST00000272371;ENST00000403946	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6718	0.85269	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	OTOF	26604203	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	5.967000	0.70403	2.528000	0.85240	0.561000	0.74099	.		0.562	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		Intron	8	69	1	0	0.000442599	0.006214	0.000463444	8	69				
LRPPRC	10128	broad.mit.edu	37	2	44204152	44204152	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:44204152C>T	ENST00000260665.7	-	5	688	c.631G>A	c.(631-633)Gga>Aga	p.G211R	LRPPRC_ENST00000409659.1_Missense_Mutation_p.G211R|LRPPRC_ENST00000409946.1_Missense_Mutation_p.G211R	NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	211					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TCAATATCTCCTACATTACAA	0.303																																							uc002rtr.2		NA																	0				ovary(2)|skin(1)	3						c.(631-633)GGA>AGA		leucine-rich PPR motif-containing protein							80.0	81.0	81.0					2																	44204152		2203	4299	6502	SO:0001583	missense	10128				mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding	g.chr2:44204152C>T	M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.631G>A	2.37:g.44204152C>T	ENSP00000260665:p.Gly211Arg					LRPPRC_uc010yob.1_Missense_Mutation_p.G111R|LRPPRC_uc010faw.1_Missense_Mutation_p.G185R	p.G211R	NM_133259	NP_573566	P42704	LPPRC_HUMAN			5	689	-		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	211			PPR 3.		A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	ENST00000260665.7	37	c.631G>A	CCDS33189.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.341525	0.81911	.	.	ENSG00000138095	ENST00000465633;ENST00000260665;ENST00000409946;ENST00000409659;ENST00000447246	T;T;T;T	0.77229	-0.43;-0.51;-0.52;-1.08	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.88351	0.6413	M	0.71296	2.17	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.87496	0.2430	10	0.59425	D	0.04	-10.1344	20.5632	0.99335	0.0:1.0:0.0:0.0	.	111;185;211	F5H4J6;C9JCA9;P42704	.;.;LPPRC_HUMAN	R	111;211;211;211;185	ENSP00000260665:G211R;ENSP00000386234:G211R;ENSP00000386562:G211R;ENSP00000403637:G185R	ENSP00000260665:G211R	G	-	1	0	LRPPRC	44057656	1.000000	0.71417	0.968000	0.41197	0.451000	0.32288	6.009000	0.70745	2.937000	0.99478	0.650000	0.86243	GGA		0.303	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259		3	40	0	0	0	0.004672	0	3	40				
PPM1B	5495	broad.mit.edu	37	2	44428516	44428516	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:44428516G>C	ENST00000282412.4	+	2	590	c.178G>C	c.(178-180)Gat>Cat	p.D60H	PPM1B_ENST00000345249.4_Intron|PPM1B_ENST00000409895.4_Missense_Mutation_p.D60H|PPM1B_ENST00000409432.3_Missense_Mutation_p.D60H|PPM1B_ENST00000378540.4_3'UTR|PPM1B_ENST00000378551.2_Missense_Mutation_p.D60H	NM_002706.4	NP_002697.1	O75688	PPM1B_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1B	60					cytokine-mediated signaling pathway (GO:0019221)|N-terminal protein myristoylation (GO:0006499)|negative regulation of defense response to virus (GO:0050687)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(4)|large_intestine(3)|lung(7)|skin(2)	16		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TGCAGTTTATGATGGTCATGC	0.448																																							uc002rtt.2		NA																	0				kidney(1)|skin(1)	2						c.(178-180)GAT>CAT		protein phosphatase 1B isoform 1							234.0	200.0	211.0					2																	44428516		2203	4300	6503	SO:0001583	missense	5495				protein dephosphorylation	protein serine/threonine phosphatase complex	magnesium ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity	g.chr2:44428516G>C	AJ005801	CCDS1816.1, CCDS1817.1, CCDS1818.1, CCDS46271.1	2p22.1	2012-04-17	2010-03-05		ENSG00000138032	ENSG00000138032	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9276	protein-coding gene	gene with protein product	"""protein phosphatase 2C, beta isoform"""	603770	"""protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform"""			9684878	Standard	NM_002706		Approved	PPC2BETAX, PP2CB, PP2CBETA	uc002rtt.3	O75688	OTTHUMG00000128757	ENST00000282412.4:c.178G>C	2.37:g.44428516G>C	ENSP00000282412:p.Asp60His					PPM1B_uc002rts.2_Missense_Mutation_p.D60H|PPM1B_uc002rtu.2_Missense_Mutation_p.D60H|PPM1B_uc002rtv.2_Intron|PPM1B_uc002rtw.2_Missense_Mutation_p.D60H|PPM1B_uc002rtx.2_Missense_Mutation_p.D60H	p.D60H	NM_002706	NP_002697	O75688	PPM1B_HUMAN			2	606	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	60				Manganese 1 (By similarity).|Manganese 2 (By similarity).	Q461Q2|Q4J6C1|Q4J6C2|Q658R4|Q96ER6|Q9HAY8	Missense_Mutation	SNP	ENST00000282412.4	37	c.178G>C	CCDS1817.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.497839	0.85069	.	.	ENSG00000138032	ENST00000419807;ENST00000409895;ENST00000409432;ENST00000282412;ENST00000378551;ENST00000409473	T;T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43;0.43	5.82	5.82	0.92795	Protein phosphatase 2C-like (5);	0.084454	0.85682	D	0.000000	D	0.86871	0.6037	H	0.99794	4.785	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.92645	0.6128	10	0.87932	D	0	-27.4438	20.0852	0.97797	0.0:0.0:1.0:0.0	.	60;60;60;60;60	Q4J6C0;O75688-2;Q4J6C1;O75688;Q4J6C2	.;.;.;PPM1B_HUMAN;.	H	60	ENSP00000390087:D60H;ENSP00000387341:D60H;ENSP00000387287:D60H;ENSP00000282412:D60H;ENSP00000367813:D60H;ENSP00000386982:D60H	ENSP00000282412:D60H	D	+	1	0	PPM1B	44282020	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.752000	0.94435	0.655000	0.94253	GAT		0.448	PPM1B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250672.1	NM_002706		37	144	0	0	0	0.004878	0	37	144				
MCFD2	90411	broad.mit.edu	37	2	47136169	47136169	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:47136169C>G	ENST00000409105.1	-	3	321	c.142G>C	c.(142-144)Gac>Cac	p.D48H	MCFD2_ENST00000493804.1_Intron|MCFD2_ENST00000409207.1_Missense_Mutation_p.D48H|MCFD2_ENST00000409800.1_Intron|MCFD2_ENST00000319466.4_Missense_Mutation_p.D48H|MCFD2_ENST00000409913.1_Intron|MCFD2_ENST00000409218.1_Missense_Mutation_p.D48H|MCFD2_ENST00000444761.2_Intron|MCFD2_ENST00000409147.1_Intron|AC016722.4_ENST00000429761.1_RNA|MCFD2_ENST00000409973.1_Missense_Mutation_p.D48H	NM_001171506.2	NP_001164977.1	Q8NI22	MCFD2_HUMAN	multiple coagulation factor deficiency 2	48					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			central_nervous_system(1)|large_intestine(1)|lung(2)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)		Antihemophilic Factor(DB00025)	TACTCTTGGTCGTGCACTGTG	0.622																																							uc002rvk.2		NA																	0				central_nervous_system(1)	1						c.(142-144)GAC>CAC		multiple coagulation factor deficiency 2	Antihemophilic Factor(DB00025)						90.0	86.0	87.0					2																	47136169		2203	4300	6503	SO:0001583	missense	90411				post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|vesicle-mediated transport	endoplasmic reticulum|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment|Golgi apparatus	calcium ion binding	g.chr2:47136169C>G	AF475284	CCDS33192.1, CCDS54354.1, CCDS54355.1	2p21	2014-09-17			ENSG00000180398	ENSG00000180398		"""EF-hand domain containing"""	18451	protein-coding gene	gene with protein product		607788				12717434, 2463956	Standard	NM_139279		Approved	F5F8D, LMAN1IP, SDNSF	uc021vha.1	Q8NI22	OTTHUMG00000153100	ENST00000409105.1:c.142G>C	2.37:g.47136169C>G	ENSP00000386651:p.Asp48His					MCFD2_uc002rvl.2_Intron|MCFD2_uc010fba.2_Missense_Mutation_p.D46H|MCFD2_uc010yof.1_Intron	p.D48H	NM_139279	NP_644808	Q8NI22	MCFD2_HUMAN	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)		2	236	-		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	48					A8K7W2|D6W5A9|E9PD95|Q53SS3|Q68D61|Q8N3M5	Missense_Mutation	SNP	ENST00000409105.1	37	c.142G>C	CCDS33192.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.174637	0.78452	.	.	ENSG00000180398	ENST00000409105;ENST00000319466;ENST00000409207;ENST00000409973;ENST00000409218;ENST00000412438;ENST00000434262;ENST00000417180	D;D;D;D;D;D;D	0.92099	-2.07;-2.07;-2.07;-2.07;-2.07;-2.07;-2.97	5.23	4.33	0.51752	.	0.044861	0.85682	D	0.000000	D	0.92391	0.7585	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	D	0.92720	0.6190	10	0.72032	D	0.01	-6.9383	11.5851	0.50914	0.0:0.9081:0.0:0.0919	.	48	Q8NI22	MCFD2_HUMAN	H	48;48;48;48;48;48;15;48	ENSP00000386651:D48H;ENSP00000317271:D48H;ENSP00000386386:D48H;ENSP00000386279:D48H;ENSP00000386261:D48H;ENSP00000402717:D48H;ENSP00000387360:D15H	ENSP00000317271:D48H	D	-	1	0	MCFD2	46989673	1.000000	0.71417	0.995000	0.50966	0.890000	0.51754	3.715000	0.54897	1.352000	0.45808	0.462000	0.41574	GAC		0.622	MCFD2-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329518.1	NM_139279		16	78	0	0	0	0.008871	0	16	78				
FSHR	2492	broad.mit.edu	37	2	49190117	49190117	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:49190117G>A	ENST00000406846.2	-	10	1962	c.1843C>T	c.(1843-1845)Cac>Tac	p.H615Y	FSHR_ENST00000304421.4_Missense_Mutation_p.H589Y|FSHR_ENST00000541117.1_Missense_Mutation_p.H351Y|FSHR_ENST00000346173.3_Missense_Mutation_p.H553Y	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	615					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	TTGATGGGGTGAAACAGAACC	0.483									Gonadal Dysgenesis, 46 XX																														uc002rww.2		NA																	0				ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8						c.(1843-1845)CAC>TAC		follicle stimulating hormone receptor isoform 1	Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)						78.0	81.0	80.0					2																	49190117		2203	4300	6503	SO:0001583	missense	2492	Gonadal_Dysgenesis_46_XX	Familial Cancer Database		female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding	g.chr2:49190117G>A		CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1843C>T	2.37:g.49190117G>A	ENSP00000384708:p.His615Tyr					FSHR_uc002rwx.2_Missense_Mutation_p.H553Y|FSHR_uc010fbn.2_Missense_Mutation_p.H589Y	p.H615Y	NM_000145	NP_000136	P23945	FSHR_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		10	1917	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	615			Helical; Name=7; (Potential).		A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	ENST00000406846.2	37	c.1843C>T	CCDS1843.1	.	.	.	.	.	.	.	.	.	.	A	0.028	-1.352725	0.01256	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000541117	D;D;D;D	0.92199	-2.99;-2.99;-2.99;-2.99	5.35	5.35	0.76521	GPCR, rhodopsin-like superfamily (1);	0.129696	0.53938	N	0.000046	T	0.57460	0.2055	N	0.00004	-3.38	0.21147	N	0.999773	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.61501	-0.7050	9	.	.	.	.	10.9219	0.47169	0.9269:0.0:0.0731:0.0	.	589;553;615	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	Y	615;553;589;351	ENSP00000384708:H615Y;ENSP00000333908:H553Y;ENSP00000306780:H589Y;ENSP00000444172:H351Y	.	H	-	1	0	FSHR	49043621	1.000000	0.71417	1.000000	0.80357	0.315000	0.28087	7.291000	0.78721	1.158000	0.42547	-0.254000	0.11334	CAC		0.483	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2			8	59	0	0	0	0.006214	0	8	59				
NRXN1	9378	broad.mit.edu	37	2	50574003	50574003	+	Intron	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:50574003C>A	ENST00000406316.2	-	18	4841				NRXN1_ENST00000401710.1_Intron|NRXN1_ENST00000331040.5_Intron|NRXN1_ENST00000404971.1_Intron|NRXN1_ENST00000342183.5_Missense_Mutation_p.G29W|NRXN1_ENST00000401669.2_Intron|NRXN1_ENST00000406859.3_Intron|NRXN1_ENST00000402717.3_Intron|NRXN1_ENST00000405472.3_Intron	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GCCAGGCGCCCCCCTGcgccg	0.756																																							uc010fbp.2		NA																	0				ovary(2)	2						c.(85-87)GGG>TGG		neurexin 1 isoform beta precursor							9.0	9.0	9.0					2																	50574003		2175	4265	6440	SO:0001627	intron_variant	9378				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding	g.chr2:50574003C>A	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3365-109895G>T	2.37:g.50574003C>A						NRXN1_uc002rxb.3_Intron|NRXN1_uc010fbq.2_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxc.1_Intron	p.G29W	NM_138735	NP_620072	P58400	NRX1B_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)		1	892	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	29					A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	c.85G>T	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	C	13.53	2.264089	0.39995	.	.	ENSG00000179915	ENST00000342183	T	0.48522	0.81	5.05	5.05	0.67936	.	.	.	.	.	T	0.27663	0.0680	N	0.08118	0	0.80722	D	1	D	0.53312	0.959	B	0.40066	0.318	T	0.13335	-1.0513	9	0.45353	T	0.12	.	12.8153	0.57660	0.0:0.8352:0.1647:0.0	.	29	P58400	NRX1B_HUMAN	W	29	ENSP00000341184:G29W	ENSP00000341184:G29W	G	-	1	0	NRXN1	50427507	0.022000	0.18835	1.000000	0.80357	0.904000	0.53231	-0.299000	0.08254	2.366000	0.80165	0.462000	0.41574	GGG		0.756	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			5	6	1	0	1.23904e-05	0.000602	1.32442e-05	5	6				
C2orf73	129852	broad.mit.edu	37	2	54587462	54587462	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:54587462G>C	ENST00000398634.2	+	5	669	c.627G>C	c.(625-627)gaG>gaC	p.E209D	C2orf73_ENST00000491538.1_Intron|C2orf73_ENST00000405749.1_Intron	NM_001100396.1	NP_001093866.1	Q8N5S3	CB073_HUMAN	chromosome 2 open reading frame 73	209										breast(2)	2						AAAAAACAGAGAAAGGAAACT	0.448																																							uc002rxt.1		NA																	0					0						c.(625-627)GAG>GAC		hypothetical protein LOC129852							45.0	42.0	43.0					2																	54587462		1892	4116	6008	SO:0001583	missense	129852							g.chr2:54587462G>C	BC031669, AK097617	CCDS46285.1	2p16.2	2008-07-07			ENSG00000177994	ENSG00000177994			26861	protein-coding gene	gene with protein product						14702039	Standard	NM_001100396		Approved	FLJ40298	uc002rxt.1	Q8N5S3	OTTHUMG00000151826	ENST00000398634.2:c.627G>C	2.37:g.54587462G>C	ENSP00000381631:p.Glu209Asp					C2orf73_uc010yor.1_Missense_Mutation_p.E151D|C2orf73_uc002rxs.1_Missense_Mutation_p.E88D|C2orf73_uc010yos.1_RNA	p.E209D	NM_001100396	NP_001093866	Q8N5S3	CB073_HUMAN			5	669	+			209					A0AV79|A0AV81|Q8N7V4	Missense_Mutation	SNP	ENST00000398634.2	37	c.627G>C	CCDS46285.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.637405	0.47049	.	.	ENSG00000177994	ENST00000486488;ENST00000398634;ENST00000447328	T;T;T	0.34859	1.34;1.34;1.34	5.14	4.24	0.50183	.	0.176543	0.37857	N	0.001911	T	0.25382	0.0617	N	0.20685	0.6	0.33444	D	0.582773	P;B	0.36959	0.575;0.215	B;B	0.36030	0.216;0.216	T	0.29971	-0.9994	10	0.27082	T	0.32	-16.512	15.5137	0.75806	0.0:0.1437:0.8562:0.0	.	151;209	B7ZM12;Q8N5S3	.;CB073_HUMAN	D	215;209;151	ENSP00000417971:E215D;ENSP00000381631:E209D;ENSP00000389570:E151D	ENSP00000381631:E209D	E	+	3	2	C2orf73	54440966	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.402000	0.52608	1.248000	0.43934	0.650000	0.86243	GAG		0.448	C2orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324075.2	NM_001100396		3	24	0	0	0	0.004672	0	3	24				
USP34	9736	broad.mit.edu	37	2	61522325	61522325	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:61522325C>G	ENST00000398571.2	-	31	4431	c.4355G>C	c.(4354-4356)aGa>aCa	p.R1452T		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1452					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CCTTATTCTTCTATTAGGTTT	0.333																																							uc002sbe.2		NA																	0				ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19						c.(4354-4356)AGA>ACA		ubiquitin specific protease 34							126.0	121.0	122.0					2																	61522325		1815	4079	5894	SO:0001583	missense	9736				positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr2:61522325C>G	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.4355G>C	2.37:g.61522325C>G	ENSP00000381577:p.Arg1452Thr						p.R1452T	NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	Epithelial(17;0.229)		31	4377	-			1452					A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	c.4355G>C	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	C	15.33	2.802945	0.50315	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.03441	3.93	5.08	4.2	0.49525	.	0.000000	0.85682	D	0.000000	T	0.03959	0.0111	L	0.40543	1.245	0.50467	D	0.999871	B	0.17667	0.023	B	0.18263	0.021	T	0.37934	-0.9684	10	0.12103	T	0.63	.	12.5674	0.56318	0.0:0.9197:0.0:0.0803	.	1452	Q70CQ2	UBP34_HUMAN	T	1300;1300;1452	ENSP00000381577:R1452T	ENSP00000263989:R1300T	R	-	2	0	USP34	61375829	1.000000	0.71417	1.000000	0.80357	0.494000	0.33585	7.818000	0.86416	1.137000	0.42214	-0.136000	0.14681	AGA		0.333	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4			24	91	0	0	0	0.005443	0	24	91				
VAX2	25806	broad.mit.edu	37	2	71160154	71160154	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:71160154G>A	ENST00000234392.2	+	3	725	c.693G>A	c.(691-693)ccG>ccA	p.P231P	ATP6V1B1_ENST00000412314.1_5'Flank|snoU13_ENST00000459218.1_RNA|ATP6V1B1_ENST00000234396.4_5'Flank	NM_012476.2	NP_036608.1	Q9UIW0	VAX2_HUMAN	ventral anterior homeobox 2	231					axonogenesis (GO:0007409)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic eye morphogenesis (GO:0048048)|forebrain development (GO:0030900)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	7						GCCTCAACCCGCTGTCCTCGG	0.692																																							uc002shh.2		NA																	0					0						c.(691-693)CCG>CCA		ventral anterior homeobox 2							29.0	33.0	32.0					2																	71160154		2203	4300	6503	SO:0001819	synonymous_variant	25806				ectoderm development|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:71160154G>A	Y17791	CCDS1911.1	2p13.3	2011-06-20			ENSG00000116035	ENSG00000116035		"""Homeoboxes / ANTP class : NKL subclass"""	12661	protein-coding gene	gene with protein product		604295				10485894	Standard	NM_012476		Approved	DRES93	uc002shh.3	Q9UIW0	OTTHUMG00000129714	ENST00000234392.2:c.693G>A	2.37:g.71160154G>A						ATP6V1B1_uc002shi.1_5'Flank|ATP6V1B1_uc002shj.2_5'Flank|ATP6V1B1_uc010fdv.2_5'Flank|ATP6V1B1_uc010fdw.2_5'Flank	p.P231P	NM_012476	NP_036608	Q9UIW0	VAX2_HUMAN			3	725	+			231					Q53Y33	Silent	SNP	ENST00000234392.2	37	c.693G>A	CCDS1911.1																																																																																				0.692	VAX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251923.1			16	41	0	0	0	0.008871	0	16	41				
FUNDC2P2	388965	broad.mit.edu	37	2	84518384	84518384	+	RNA	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:84518384G>C	ENST00000331369.5	+	0	578									FUN14 domain containing 2 pseudogene 2																		CTTTCTGCTTGGCATGGCATC	0.468																																							uc010ffz.1		NA																	0					0						c.(442-444)GGC>CGC		RecName: Full=FUN14 domain-containing protein 2; AltName: Full=Hepatitis C virus core-binding protein 6; AltName: Full=Cervical cancer proto-oncogene 3 protein;          Short=HCC-3;																																						388965							g.chr2:84518384G>C			2p11.2	2010-03-12			ENSG00000182814	ENSG00000182814			17247	pseudogene	pseudogene							Standard	NR_003663		Approved		uc010ffz.1		OTTHUMG00000152875		2.37:g.84518384G>C							p.G148R	NR_003663						1	579	+									Missense_Mutation	SNP	ENST00000331369.5	37	c.442G>C																																																																																					0.468	FUNDC2P2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000333681.1	NR_003663		45	102	0	0	0	0.01441	0	45	102				
RNF103	7844	broad.mit.edu	37	2	86849937	86849937	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:86849937T>C	ENST00000237455.4	-	1	1041	c.73A>G	c.(73-75)Att>Gtt	p.I25V	RNF103_ENST00000477307.1_5'UTR|RNF103-CHMP3_ENST00000604011.1_Intron|CHMP3_ENST00000439940.2_Intron	NM_001198951.1|NM_005667.3	NP_001185880.1|NP_005658.1	O00237	RN103_HUMAN	ring finger protein 103	25					central nervous system development (GO:0007417)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(7)|skin(2)	25						TACCACACAATGGCCTCAAAA	0.522																																							uc002srn.2		NA																	0				central_nervous_system(1)	1						c.(73-75)ATT>GTT		ring finger protein 103							56.0	57.0	56.0					2																	86849937		2203	4300	6503	SO:0001583	missense	7844				central nervous system development|ER-associated protein catabolic process	endoplasmic reticulum membrane|integral to membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr2:86849937T>C	D76444	CCDS33237.1	2p11.2	2013-01-09	2003-05-14	2003-05-16	ENSG00000239305	ENSG00000239305		"""RING-type (C3HC4) zinc fingers"""	12859	protein-coding gene	gene with protein product		602507	"""zinc finger protein 103 homolog (mouse)"""	ZFP103		9070305	Standard	NM_005667		Approved	hkf-1, KF1	uc021vkg.1	O00237	OTTHUMG00000153197	ENST00000237455.4:c.73A>G	2.37:g.86849937T>C	ENSP00000237455:p.Ile25Val					VPS24_uc010ytl.1_Intron|RNF103_uc002srp.2_Missense_Mutation_p.I25V	p.I25V	NM_005667	NP_005658	O00237	RN103_HUMAN			1	1042	-			25			Helical; (Potential).		A6NFV6|B2RAG4|Q53SU6|Q8IVB9	Missense_Mutation	SNP	ENST00000237455.4	37	c.73A>G	CCDS33237.1	.	.	.	.	.	.	.	.	.	.	T	6.448	0.450812	0.12223	.	.	ENSG00000249884;ENSG00000239305	ENST00000440757;ENST00000237455	T;T	0.76186	-1.0;1.02	4.07	2.89	0.33648	.	0.149031	0.45606	D	0.000345	T	0.64068	0.2565	L	0.47716	1.5	0.39764	D	0.97206	B	0.02656	0.0	B	0.01281	0.0	T	0.59857	-0.7375	10	0.46703	T	0.11	-10.4597	7.8777	0.29603	0.0:0.1932:0.0:0.8068	.	25	O00237	RN103_HUMAN	V	25	ENSP00000392995:I25V;ENSP00000237455:I25V	ENSP00000237455:I25V	I	-	1	0	RNF103;RNF103-VPS24	86703448	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	3.125000	0.50469	0.698000	0.31739	-0.451000	0.05528	ATT		0.522	RNF103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330041.2	NM_005667		10	34	0	0	0	0.006214	0	10	34				
RANBP2	5903	broad.mit.edu	37	2	109382771	109382771	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:109382771G>T	ENST00000283195.6	+	20	5902	c.5776G>T	c.(5776-5778)Gat>Tat	p.D1926Y		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1926					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CCAGGCTCAGGATATTAGTGG	0.408																																							uc002tem.3		NA																RANBP2/ALK(16)	0				soft_tissue(16)|lung(1)|pancreas(1)	18						c.(5776-5778)GAT>TAT		RAN binding protein 2							137.0	156.0	149.0					2																	109382771		2200	4296	6496	SO:0001583	missense	5903				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding	g.chr2:109382771G>T	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.5776G>T	2.37:g.109382771G>T	ENSP00000283195:p.Asp1926Tyr						p.D1926Y	NM_006267	NP_006258	P49792	RBP2_HUMAN			20	5902	+			1926					Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	c.5776G>T	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.378113	0.24944	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.28895	1.59	5.75	5.75	0.90469	.	.	.	.	.	T	0.45955	0.1368	M	0.62723	1.935	0.34835	D	0.740059	D	0.61080	0.989	P	0.55667	0.781	T	0.59974	-0.7353	9	0.72032	D	0.01	-26.6605	13.1899	0.59704	0.0726:0.0:0.9273:0.0	.	1926	P49792	RBP2_HUMAN	Y	950;1926	ENSP00000283195:D1926Y	ENSP00000283195:D1926Y	D	+	1	0	RANBP2	108749203	0.696000	0.27757	0.991000	0.47740	0.439000	0.31926	1.945000	0.40273	2.710000	0.92621	0.557000	0.71058	GAT		0.408	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267		96	203	1	0	2.57667e-78	0.01441	3.2736e-78	96	203				
POLR1B	84172	broad.mit.edu	37	2	113331367	113331367	+	Missense_Mutation	SNP	G	G	T	rs553658068		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:113331367G>T	ENST00000263331.5	+	14	3080	c.2500G>T	c.(2500-2502)Ggg>Tgg	p.G834W	POLR1B_ENST00000541869.1_Missense_Mutation_p.G872W|POLR1B_ENST00000417433.2_Missense_Mutation_p.G778W|POLR1B_ENST00000537335.1_Missense_Mutation_p.G623W|POLR1B_ENST00000409894.3_Missense_Mutation_p.G651W	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	834					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)	p.G834R(1)		breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						CCTCAACACCGGGGAAAGTTT	0.438																																					Ovarian(16;256 576 9537 23969 41147)	Ovarian(16;256 576 9537 23969 41147)	uc002thw.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(1)	1						c.(2500-2502)GGG>TGG		RNA polymerase I polypeptide B isoform 1							126.0	136.0	132.0					2																	113331367		2203	4300	6503	SO:0001583	missense	84172				termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding	g.chr2:113331367G>T	AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.2500G>T	2.37:g.113331367G>T	ENSP00000263331:p.Gly834Trp					POLR1B_uc010fkn.2_Missense_Mutation_p.G778W|POLR1B_uc002thx.2_Missense_Mutation_p.G695W|POLR1B_uc010fko.2_Missense_Mutation_p.G651W|POLR1B_uc010fkp.2_Missense_Mutation_p.G273W|POLR1B_uc010yxn.1_Missense_Mutation_p.G872W|POLR1B_uc002thy.2_Missense_Mutation_p.G695W|POLR1B_uc010yxo.1_Missense_Mutation_p.G611W	p.G834W	NM_019014	NP_061887	Q9H9Y6	RPA2_HUMAN			14	3080	+			834					B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Missense_Mutation	SNP	ENST00000263331.5	37	c.2500G>T	CCDS2097.1	.	.	.	.	.	.	.	.	.	.	G	18.31	3.596570	0.66332	.	.	ENSG00000125630	ENST00000263331;ENST00000541869;ENST00000409894;ENST00000537335;ENST00000417433;ENST00000458012;ENST00000536096	T;T;T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69;-0.69;-0.69	5.7	4.82	0.62117	DNA-directed RNA polymerase, subunit 2, domain 6 (1);	0.045272	0.85682	D	0.000000	D	0.84969	0.5590	M	0.84433	2.695	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.996;0.993;0.999	D	0.87393	0.2364	10	0.87932	D	0	-24.6548	13.7209	0.62725	0.0753:0.0:0.9247:0.0	.	872;651;778;834	F5GZX4;F8W898;Q9H9Y6-2;Q9H9Y6	.;.;.;RPA2_HUMAN	W	834;872;651;623;778;219;193	ENSP00000263331:G834W;ENSP00000444136:G872W;ENSP00000387143:G651W;ENSP00000437914:G623W;ENSP00000405358:G778W;ENSP00000394408:G219W	ENSP00000263331:G834W	G	+	1	0	POLR1B	113047838	1.000000	0.71417	0.100000	0.21137	0.652000	0.38707	9.365000	0.97139	1.412000	0.46977	0.555000	0.69702	GGG		0.438	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254083.1	NM_019014		40	93	1	0	1.62957e-23	0.00874	2.0091e-23	40	93				
WDR33	55339	broad.mit.edu	37	2	128467308	128467308	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:128467308C>A	ENST00000322313.4	-	19	3589	c.3431G>T	c.(3430-3432)cGa>cTa	p.R1144L		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	1144					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		ATCTCGTCCTCGGGCCGCTTC	0.562																																							uc002tpg.1		NA																	0					0						c.(3430-3432)CGA>CTA		WD repeat domain 33 isoform 1							86.0	95.0	92.0					2																	128467308		2203	4300	6503	SO:0001583	missense	55339				postreplication repair|spermatogenesis	collagen|nucleus	protein binding	g.chr2:128467308C>A		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.3431G>T	2.37:g.128467308C>A	ENSP00000325377:p.Arg1144Leu						p.R1144L	NM_018383	NP_060853	Q9C0J8	WDR33_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0695)	19	3614	-	Colorectal(110;0.1)		1144					Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Missense_Mutation	SNP	ENST00000322313.4	37	c.3431G>T	CCDS2150.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.760855	0.89932	.	.	ENSG00000136709	ENST00000322313	D	0.92299	-3.01	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.87970	0.6312	N	0.14661	0.345	0.80722	D	1	D	0.57257	0.979	P	0.46110	0.504	D	0.89735	0.3929	10	0.54805	T	0.06	-9.7435	18.9833	0.92762	0.0:1.0:0.0:0.0	.	1144	Q9C0J8	WDR33_HUMAN	L	1144	ENSP00000325377:R1144L	ENSP00000325377:R1144L	R	-	2	0	WDR33	128183778	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.618000	0.61211	2.493000	0.84123	0.561000	0.74099	CGA		0.562	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383		7	161	1	0	2.0095e-06	0.001984	2.17587e-06	7	161				
SMPD4	55627	broad.mit.edu	37	2	130930378	130930378	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:130930378C>A	ENST00000409031.1	-	6	1701	c.553G>T	c.(553-555)Ggt>Tgt	p.G185C	SMPD4_ENST00000473720.1_Intron|SMPD4_ENST00000452225.2_Intron|SMPD4_ENST00000453750.1_Intron|SMPD4_ENST00000339679.7_Missense_Mutation_p.G72C|SMPD4_ENST00000431183.2_Missense_Mutation_p.G112C|SMPD4_ENST00000426662.2_Intron|SMPD4_ENST00000443958.2_Intron|SMPD4_ENST00000351288.6_Missense_Mutation_p.G185C	NM_017951.4	NP_060421.2	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)	146					cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glycerophospholipid catabolic process (GO:0046475)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)|sphingomyelin phosphodiesterase D activity (GO:0050290)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(17)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	AAGTTCAGACCAAGGCCCCCA	0.607																																							uc002tqq.1		NA																	0					0						c.(553-555)GGT>TGT		sphingomyelin phosphodiesterase 4 isoform 2	Phosphatidylserine(DB00144)						46.0	49.0	48.0					2																	130930378		2203	4300	6503	SO:0001583	missense	55627				sphingomyelin catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|trans-Golgi network	metal ion binding|protein binding|sphingomyelin phosphodiesterase activity|sphingomyelin phosphodiesterase D activity	g.chr2:130930378C>A	AF052134	CCDS2156.2, CCDS42751.1, CCDS54398.1	2q21.1	2009-11-06			ENSG00000136699	ENSG00000136699			32949	protein-coding gene	gene with protein product		610457				16517606	Standard	NM_001171083		Approved	FLJ20297, FLJ20756, nSMase-3, KIAA1418, NSMASE3, NET13	uc002tqr.2	Q9NXE4	OTTHUMG00000131624	ENST00000409031.1:c.553G>T	2.37:g.130930378C>A	ENSP00000386531:p.Gly185Cys					SMPD4_uc002tqp.1_5'UTR|SMPD4_uc010yzy.1_Intron|SMPD4_uc010yzz.1_Intron|SMPD4_uc002tqr.1_Missense_Mutation_p.G185C|SMPD4_uc002tqs.1_Missense_Mutation_p.G53C|SMPD4_uc002tqt.1_Missense_Mutation_p.G63C|SMPD4_uc010zaa.1_Missense_Mutation_p.G72C|SMPD4_uc010zab.1_Missense_Mutation_p.G112C|SMPD4_uc010zac.1_Intron|SMPD4_uc010zad.1_Intron	p.G185C	NM_017951	NP_060421	Q9NXE4	NSMA3_HUMAN			6	1073	-	Colorectal(110;0.1)		146					B4DM23|B4DQ31|B4DRB8|B4DWK7|B4E0L6|E7ESA2|E9PCE6|Q6FI76|Q6P1P7|Q6ZT43|Q9H0M2|Q9NW20|Q9NWL2|Q9P2C9	Missense_Mutation	SNP	ENST00000409031.1	37	c.553G>T	CCDS42751.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	12.93|12.93	2.084595|2.084595	0.36758|0.36758	.|.	.|.	ENSG00000136699|ENSG00000136699	ENST00000351288;ENST00000409031;ENST00000431183;ENST00000339679|ENST00000439886	.|.	.|.	.|.	3.74|3.74	2.83|2.83	0.33086|0.33086	.|.	0.234566|.	0.37348|.	N|.	0.002133|.	T|T	0.54598|0.54598	0.1868|0.1868	L|L	0.54323|0.54323	1.7|1.7	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.998;0.997|.	D;D;D;D;P|.	0.97110|.	0.995;0.995;1.0;0.927;0.855|.	T|T	0.49771|0.49771	-0.8904|-0.8904	9|6	0.62326|0.37606	D|T	0.03|0.19	.|.	4.2368|4.2368	0.10630|0.10630	0.2304:0.6499:0.0:0.1197|0.2304:0.6499:0.0:0.1197	.|.	112;72;146;146;185|.	E7ESA2;B4E0T5;Q9NXE4-2;Q9NXE4;B1PBA3|.	.;.;.;NSMA3_HUMAN;.|.	C|F	185;185;112;72|13	.|.	ENSP00000339721:G72C|ENSP00000401648:L13F	G|L	-|-	1|3	0|2	SMPD4|SMPD4	130646848|130646848	0.929000|0.929000	0.31497|0.31497	0.998000|0.998000	0.56505|0.56505	0.518000|0.518000	0.34316|0.34316	1.741000|1.741000	0.38238|0.38238	0.728000|0.728000	0.32382|0.32382	0.455000|0.455000	0.32223|0.32223	GGT|TTG		0.607	SMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254516.3	NM_017751		27	30	1	0	6.36457e-07	0.003954	6.93655e-07	27	30				
NEB	4703	broad.mit.edu	37	2	152500536	152500536	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:152500536C>T	ENST00000172853.10	-	57	7899	c.7752G>A	c.(7750-7752)caG>caA	p.Q2584Q	NEB_ENST00000427231.2_Silent_p.Q2584Q|NEB_ENST00000409198.1_Silent_p.Q2584Q|NEB_ENST00000604864.1_Silent_p.Q2584Q|NEB_ENST00000397345.3_Silent_p.Q2584Q|NEB_ENST00000603639.1_Silent_p.Q2584Q			P20929	NEBU_HUMAN	nebulin	2584					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CCCTGTCACTCTGGATCTTGG	0.542																																							uc010fnx.2		NA																	0				ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20						c.(7750-7752)CAG>CAA		nebulin isoform 3							372.0	352.0	359.0					2																	152500536		1974	4154	6128	SO:0001819	synonymous_variant	4703				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	g.chr2:152500536C>T	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.7752G>A	2.37:g.152500536C>T							p.Q2584Q	NM_004543	NP_004534	P20929	NEBU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.219)	57	7943	-			2584			Nebulin 69.		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37	c.7752G>A																																																																																					0.542	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		140	292	0	0	0	0.01441	0	140	292				
KCNJ3	3760	broad.mit.edu	37	2	155711819	155711819	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:155711819C>T	ENST00000295101.2	+	3	1977	c.1500C>T	c.(1498-1500)ttC>ttT	p.F500F		NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	500					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	CTGATCGCTTCACATAACAAA	0.398																																							uc002tyv.1		NA																	0				upper_aerodigestive_tract(1)|pancreas(1)	2						c.(1498-1500)TTC>TTT		potassium inwardly-rectifying channel J3	Halothane(DB01159)						17.0	17.0	17.0					2																	155711819		2203	4299	6502	SO:0001819	synonymous_variant	3760				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr2:155711819C>T	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.1500C>T	2.37:g.155711819C>T						KCNJ3_uc010zce.1_3'UTR	p.F500F	NM_002239	NP_002230	P48549	IRK3_HUMAN			3	1695	+			500			Cytoplasmic (By similarity).		B4DEW7|Q8TBI0	Silent	SNP	ENST00000295101.2	37	c.1500C>T	CCDS2200.1																																																																																				0.398	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239		7	17	0	0	0	0.001984	0	7	17				
TTN	7273	broad.mit.edu	37	2	179424766	179424766	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:179424766C>A	ENST00000591111.1	-	276	81394	c.81170G>T	c.(81169-81171)tGg>tTg	p.W27057L	TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.W19633L|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.W19825L|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.W26130L|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.W19758L|TTN_ENST00000589042.1_Missense_Mutation_p.W28698L|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	27057	Fibronectin type-III 97. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGAAGTTTTCCAGTCAGTGTC	0.398																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(78388-78390)TGG>TTG		titin isoform N2-A							72.0	68.0	69.0					2																	179424766		1856	4091	5947	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179424766C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.81170G>T	2.37:g.179424766C>A	ENSP00000465570:p.Trp27057Leu					uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.W19825L|TTN_uc010zfi.1_Missense_Mutation_p.W19758L|TTN_uc010zfj.1_Missense_Mutation_p.W19633L	p.W26130L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	78613	-			27057					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.78389G>T		.	.	.	.	.	.	.	.	.	.	C	14.52	2.561106	0.45590	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	5.87	4.99	0.66335	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76292	0.3967	M	0.92317	3.295	0.80722	D	1	D;D;D;D	0.58268	0.982;0.982;0.982;0.967	P;P;P;P	0.59825	0.864;0.864;0.864;0.812	D	0.83558	0.0105	9	0.87932	D	0	.	15.7188	0.77691	0.0:0.9338:0.0:0.0662	.	19633;19758;19825;27057	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	26130;19633;19825;19758;19630	ENSP00000343764:W26130L;ENSP00000434586:W19633L;ENSP00000340554:W19825L;ENSP00000352154:W19758L	ENSP00000340554:W19825L	W	-	2	0	TTN	179133012	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.729000	0.84864	1.599000	0.50093	0.655000	0.94253	TGG		0.398	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		13	37	1	0	1.49906e-05	0.00245	1.5998e-05	13	37				
TTN	7273	broad.mit.edu	37	2	179433143	179433143	+	Missense_Mutation	SNP	C	C	T	rs56341835		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:179433143C>T	ENST00000591111.1	-	276	73017	c.72793G>A	c.(72793-72795)Gaa>Aaa	p.E24265K	TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E16841K|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E17033K|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E23338K|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E16966K|TTN_ENST00000589042.1_Missense_Mutation_p.E25906K|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	24265	Fibronectin type-III 76. {ECO:0000255|PROSITE-ProRule:PRU00316}.		E -> K. {ECO:0000269|PubMed:17344846}.		adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTAATACTTTCAGCACTGACG	0.408													C|||	1	0.000199681	0.0	0.0	5008	,	,		22814	0.0		0.001	False		,,,				2504	0.0						uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(70012-70014)GAA>AAA		titin isoform N2-A		C	LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU	0,3740		0,0,1870	108.0	95.0	99.0		50521,70012,50896,51097	6.0	1.0	2	dbSNP_129	99	12,8222		0,12,4105	yes	missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	56,56,56,56	0,12,5975	TT,TC,CC		0.1457,0.0,0.1002	probably-damaging,probably-damaging,probably-damaging,probably-damaging	16841/26927,23338/33424,16966/27052,17033/27119	179433143	12,11962	1870	4117	5987	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179433143C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.72793G>A	2.37:g.179433143C>T	ENSP00000465570:p.Glu24265Lys					uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E17033K|TTN_uc010zfi.1_Missense_Mutation_p.E16966K|TTN_uc010zfj.1_Missense_Mutation_p.E16841K	p.E23338K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		275	70236	-			24265					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.70012G>A		1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	16.54	3.152128	0.57259	0.0	0.001457	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	6.03	6.03	0.97812	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.68842	0.3045	L	0.45352	1.415	0.58432	D	0.999998	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.68610	-0.5363	9	0.87932	D	0	.	20.5666	0.99351	0.0:1.0:0.0:0.0	rs56341835	16841;16966;17033;24265	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	23338;16841;17033;16966;16839	ENSP00000343764:E23338K;ENSP00000434586:E16841K;ENSP00000340554:E17033K;ENSP00000352154:E16966K	ENSP00000340554:E17033K	E	-	1	0	TTN	179141389	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.041000	0.70988	2.854000	0.98071	0.655000	0.94253	GAA		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		4	21	0	0	0	0.000602	0	4	21				
TTN	7273	broad.mit.edu	37	2	179456184	179456184	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:179456184C>A	ENST00000591111.1	-	254	55569	c.55345G>T	c.(55345-55347)Gta>Tta	p.V18449L	TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.V11025L|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V11217L|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V17522L|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V11150L|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V20090L|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	18449	Ig-like 106.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCAGCCTTTACCACAAGACCT	0.393																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(52564-52566)GTA>TTA		titin isoform N2-A							191.0	188.0	189.0					2																	179456184		1916	4122	6038	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179456184C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.55345G>T	2.37:g.179456184C>A	ENSP00000465570:p.Val18449Leu					uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V11217L|TTN_uc010zfi.1_Missense_Mutation_p.V11150L|TTN_uc010zfj.1_Missense_Mutation_p.V11025L	p.V17522L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		253	52788	-			18449					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.52564G>T		.	.	.	.	.	.	.	.	.	.	C	20.4	3.982539	0.74474	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.70986	-0.53;-0.53;-0.53;-0.53	6.1	6.1	0.99115	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.86493	0.5946	M	0.82716	2.605	0.58432	D	0.999999	D;D;D;D	0.69078	0.997;0.997;0.997;0.997	D;D;D;D	0.80764	0.994;0.994;0.994;0.994	D	0.86770	0.1972	9	0.87932	D	0	.	20.7146	0.99709	0.0:1.0:0.0:0.0	.	11025;11150;11217;18449	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	17522;11025;11217;11150;11023	ENSP00000343764:V17522L;ENSP00000434586:V11025L;ENSP00000340554:V11217L;ENSP00000352154:V11150L	ENSP00000340554:V11217L	V	-	1	0	TTN	179164430	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.770000	0.85390	2.902000	0.99343	0.650000	0.86243	GTA		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		81	174	1	0	7.3878e-23	0.01441	9.02502e-23	81	174				
TTN	7273	broad.mit.edu	37	2	179464429	179464429	+	Silent	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:179464429G>C	ENST00000591111.1	-	239	51500	c.51276C>G	c.(51274-51276)ctC>ctG	p.L17092L	TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000460472.2_Silent_p.L9668L|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342175.6_Silent_p.L9860L|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Silent_p.L16165L|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_Silent_p.L9793L|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Silent_p.L18733L|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17092	Ig-like 102.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.L9860L(1)|p.L16163L(1)|p.L16165L(1)|p.L9793L(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGTGTCATAGAGAACAGGTT	0.438																																							uc010zfg.1		NA																	4	Substitution - coding silent(4)		lung(4)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(48493-48495)CTC>CTG		titin isoform N2-A							165.0	157.0	159.0					2																	179464429		1888	4104	5992	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179464429G>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.51276C>G	2.37:g.179464429G>C						uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.L9860L|TTN_uc010zfi.1_Silent_p.L9793L|TTN_uc010zfj.1_Silent_p.L9668L	p.L16165L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		238	48719	-			17092					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.48495C>G																																																																																					0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		27	112	0	0	0	0.00632	0	27	112				
CCDC141	285025	broad.mit.edu	37	2	179718180	179718180	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:179718180G>C	ENST00000420890.2	-	20	3349	c.3232C>G	c.(3232-3234)Cag>Gag	p.Q1078E	CCDC141_ENST00000295723.5_Missense_Mutation_p.Q503E	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1078										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TATAAGTGCTGAGCAAGGTCA	0.433																																							uc002unf.1		NA																	0				ovary(7)|pancreas(2)|skin(1)	10						c.(1507-1509)CAG>GAG		coiled-coil domain containing 141							170.0	167.0	168.0					2																	179718180		2203	4300	6503	SO:0001583	missense	285025						protein binding	g.chr2:179718180G>C	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3232C>G	2.37:g.179718180G>C	ENSP00000395995:p.Gln1078Glu						p.Q503E	NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)		10	1564	-			503					H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000420890.2	37	c.1507C>G		.	.	.	.	.	.	.	.	.	.	G	8.194	0.796682	0.16327	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	T;T;T	0.35421	1.31;1.31;1.31	5.39	4.43	0.53597	.	0.295993	0.23832	N	0.044130	T	0.23171	0.0560	L	0.29908	0.895	0.22639	N	0.998905	P	0.36837	0.571	B	0.31101	0.124	T	0.12630	-1.0540	10	0.21540	T	0.41	-3.6001	12.8887	0.58058	0.0:0.0:0.7164:0.2836	.	503	Q6ZP82	CC141_HUMAN	E	1078;522;503	ENSP00000395995:Q1078E;ENSP00000344627:Q522E;ENSP00000295723:Q503E	ENSP00000295723:Q503E	Q	-	1	0	CCDC141	179426425	0.997000	0.39634	0.946000	0.38457	0.990000	0.78478	2.026000	0.41069	2.508000	0.84585	0.655000	0.94253	CAG		0.433	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648		23	151	0	0	0	0.005443	0	23	151				
CCDC141	285025	broad.mit.edu	37	2	179718348	179718348	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:179718348G>C	ENST00000420890.2	-	20	3181	c.3064C>G	c.(3064-3066)Cat>Gat	p.H1022D	CCDC141_ENST00000295723.5_Missense_Mutation_p.H447D	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1022										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TACCAAAAATGACACTAAATT	0.358																																							uc002unf.1		NA																	0				ovary(7)|pancreas(2)|skin(1)	10						c.(1339-1341)CAT>GAT		coiled-coil domain containing 141							71.0	72.0	71.0					2																	179718348		2203	4300	6503	SO:0001583	missense	285025						protein binding	g.chr2:179718348G>C	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3064C>G	2.37:g.179718348G>C	ENSP00000395995:p.His1022Asp						p.H447D	NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)		10	1396	-			447					H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000420890.2	37	c.1339C>G		.	.	.	.	.	.	.	.	.	.	G	12.38	1.921649	0.33908	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	T;T;T	0.33654	1.4;1.4;1.4	6.07	1.86	0.25419	.	0.419802	0.22744	N	0.056168	T	0.18964	0.0455	N	0.24115	0.695	0.26763	N	0.969963	B	0.11235	0.004	B	0.08055	0.003	T	0.18650	-1.0330	10	0.21014	T	0.42	-4.7337	4.6552	0.12613	0.129:0.1084:0.6086:0.1539	.	447	Q6ZP82	CC141_HUMAN	D	1022;466;447	ENSP00000395995:H1022D;ENSP00000344627:H466D;ENSP00000295723:H447D	ENSP00000295723:H447D	H	-	1	0	CCDC141	179426593	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	2.179000	0.42528	0.034000	0.15491	0.655000	0.94253	CAT		0.358	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648		17	55	0	0	0	0.006122	0	17	55				
NCKAP1	10787	broad.mit.edu	37	2	183791550	183791550	+	Silent	SNP	T	T	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:183791550T>C	ENST00000361354.4	-	30	3636	c.3264A>G	c.(3262-3264)ctA>ctG	p.L1088L	NCKAP1_ENST00000360982.2_Silent_p.L1094L|NCKAP1_ENST00000478449.1_5'Flank	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	1088					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TTACCATATCTAGCAGTAAAT	0.318																																							uc002upc.2		NA																	0				ovary(2)	2						c.(3262-3264)CTA>CTG		NCK-associated protein 1 isoform 1							84.0	83.0	83.0					2																	183791550		2202	4298	6500	SO:0001819	synonymous_variant	10787				apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding	g.chr2:183791550T>C	AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.3264A>G	2.37:g.183791550T>C						NCKAP1_uc002upb.2_Silent_p.L1094L	p.L1088L	NM_013436	NP_038464	Q9Y2A7	NCKP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)		30	3666	-			1088					O60329|Q53QN5|Q53S94|Q53Y35	Silent	SNP	ENST00000361354.4	37	c.3264A>G	CCDS2287.1																																																																																				0.318	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255867.2	NM_205842		20	38	0	0	0	0.010504	0	20	38				
NCKAP1	10787	broad.mit.edu	37	2	183791552	183791552	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:183791552G>A	ENST00000361354.4	-	30	3634	c.3262C>T	c.(3262-3264)Cta>Tta	p.L1088L	NCKAP1_ENST00000360982.2_Silent_p.L1094L|NCKAP1_ENST00000478449.1_5'Flank	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	1088					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			ACCATATCTAGCAGTAAATAA	0.318																																							uc002upc.2		NA																	0				ovary(2)	2						c.(3262-3264)CTA>TTA		NCK-associated protein 1 isoform 1							87.0	85.0	86.0					2																	183791552		2202	4298	6500	SO:0001819	synonymous_variant	10787				apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding	g.chr2:183791552G>A	AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.3262C>T	2.37:g.183791552G>A						NCKAP1_uc002upb.2_Silent_p.L1094L	p.L1088L	NM_013436	NP_038464	Q9Y2A7	NCKP1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)		30	3664	-			1088					O60329|Q53QN5|Q53S94|Q53Y35	Silent	SNP	ENST00000361354.4	37	c.3262C>T	CCDS2287.1																																																																																				0.318	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255867.2	NM_205842		20	37	0	0	0	0.010504	0	20	37				
ANKAR	150709	broad.mit.edu	37	2	190611111	190611111	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:190611111G>A	ENST00000520309.1	+	23	4151	c.4063G>A	c.(4063-4065)Gag>Aag	p.E1355K	ANKAR_ENST00000313581.4_Missense_Mutation_p.E1355K|ANKAR_ENST00000281412.6_3'UTR|ANKAR_ENST00000438402.2_3'UTR|ANKAR_ENST00000431575.2_Missense_Mutation_p.E1284K	NM_144708.3	NP_653309.3	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	1355						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(16)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(2)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			TTTAGGGAAGGAGCACCGAAG	0.333																																							uc002uqw.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(3850-3852)GAG>AAG		ankyrin and armadillo repeat containing							97.0	109.0	105.0					2																	190611111		2203	4300	6503	SO:0001583	missense	150709					integral to membrane	binding	g.chr2:190611111G>A	AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687		"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803				15110750	Standard	NM_144708		Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.4063G>A	2.37:g.190611111G>A	ENSP00000427882:p.Glu1355Lys					ANKAR_uc002uqu.2_RNA|ANKAR_uc002uqx.1_RNA|ANKAR_uc002uqy.1_3'UTR	p.E1284K	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)		22	3850	+			1355					Q3ZCS6|Q4G0M2|Q6ZU02	Missense_Mutation	SNP	ENST00000520309.1	37	c.3850G>A	CCDS33351.2	.	.	.	.	.	.	.	.	.	.	G	14.65	2.597622	0.46318	.	.	ENSG00000151687	ENST00000520309;ENST00000313581;ENST00000431575	T;T;T	0.29655	1.56;1.56;1.56	4.55	3.67	0.42095	.	0.258280	0.30492	N	0.009503	T	0.32971	0.0847	L	0.44542	1.39	0.80722	D	1	.	.	.	.	.	.	T	0.04413	-1.0953	8	0.31617	T	0.26	-9.3792	9.968	0.41736	0.0969:0.0:0.9031:0.0	.	.	.	.	K	1355;1355;1284	ENSP00000427882:E1355K;ENSP00000313513:E1355K;ENSP00000393043:E1284K	ENSP00000313513:E1355K	E	+	1	0	ANKAR	190319356	1.000000	0.71417	0.977000	0.42913	0.839000	0.47603	2.107000	0.41844	1.275000	0.44379	0.591000	0.81541	GAG		0.333	ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335045.3	NM_144708		13	173	0	0	0	0.00245	0	13	173				
HECW2	57520	broad.mit.edu	37	2	197105193	197105193	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:197105193G>A	ENST00000260983.3	-	21	3926	c.3744C>T	c.(3742-3744)gtC>gtT	p.V1248V	HECW2_ENST00000409111.1_Silent_p.V892V	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1248	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						CAACGAAGGTGACATATAGCT	0.473																																							uc002utm.1		NA																	0				skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						c.(3742-3744)GTC>GTT		HECT, C2 and WW domain containing E3 ubiquitin							119.0	119.0	119.0					2																	197105193		2203	4300	6503	SO:0001819	synonymous_variant	57520				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity	g.chr2:197105193G>A	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.3744C>T	2.37:g.197105193G>A						HECW2_uc002utl.1_Silent_p.V892V	p.V1248V	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN			21	3927	-			1248			HECT.		B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Silent	SNP	ENST00000260983.3	37	c.3744C>T	CCDS33354.1																																																																																				0.473	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760		37	55	0	0	0	0.006999	0	37	55				
NIF3L1	60491	broad.mit.edu	37	2	201760030	201760030	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:201760030C>T	ENST00000409020.1	+	4	937	c.643C>T	c.(643-645)Cag>Tag	p.Q215*	NIF3L1_ENST00000416651.1_Nonsense_Mutation_p.Q215*|NIF3L1_ENST00000409357.1_Nonsense_Mutation_p.Q215*|NIF3L1_ENST00000359683.4_Nonsense_Mutation_p.Q188*|NIF3L1_ENST00000409588.1_Nonsense_Mutation_p.Q215*			Q9GZT8	GTPC1_HUMAN	NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)	215					7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|metal ion binding (GO:0046872)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(2)	13						GAATTGTACTCAGAAGGCTTT	0.368																																							uc002uwm.2		NA																	0				skin(1)	1						c.(643-645)CAG>TAG		NIF3 NGG1 interacting factor 3-like 1 isoform 1							143.0	130.0	134.0					2																	201760030		1838	4087	5925	SO:0001587	stop_gained	60491				positive regulation of transcription, DNA-dependent		transcription factor binding	g.chr2:201760030C>T	AB038949	CCDS42797.1, CCDS46485.1, CCDS46486.1	2q33	2011-11-10	2011-11-10		ENSG00000196290	ENSG00000196290			13390	protein-coding gene	gene with protein product		605778	"""NIF3 (Ngg1 interacting factor 3, S.pombe homolog)-like 1"", ""NIF3 NGG1 interacting factor 3-like 1 (S. pombe)"""	ALS2CR1		11124544, 11161814, 12522100	Standard	NM_001136039		Approved	CALS-7, MDS015	uc002uwm.2	Q9GZT8	OTTHUMG00000154588	ENST00000409020.1:c.643C>T	2.37:g.201760030C>T	ENSP00000386394:p.Gln215*					NIF3L1_uc002uwl.2_Nonsense_Mutation_p.Q188*|NIF3L1_uc002uwn.2_Nonsense_Mutation_p.Q188*|NIF3L1_uc002uwo.2_Nonsense_Mutation_p.Q215*|NIF3L1_uc002uwp.2_Nonsense_Mutation_p.Q215*|NIF3L1_uc002uwq.2_Nonsense_Mutation_p.Q215*	p.Q215*	NM_001136039	NP_001129511	Q9GZT8	NIF3L_HUMAN			4	734	+			215					Q53TX4|Q6X735|Q9H2D2|Q9HC18	Nonsense_Mutation	SNP	ENST00000409020.1	37	c.643C>T	CCDS46485.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.298076	0.81025	.	.	ENSG00000196290	ENST00000426253;ENST00000416651;ENST00000409020;ENST00000359683;ENST00000409357;ENST00000374679;ENST00000409588	.	.	.	5.47	3.62	0.41486	.	0.351810	0.33732	N	0.004610	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-9.3723	14.457	0.67423	0.0:0.6955:0.3045:0.0	.	.	.	.	X	188;215;215;188;215;215;215	.	ENSP00000352711:Q188X	Q	+	1	0	NIF3L1	201468275	0.961000	0.32948	0.997000	0.53966	0.997000	0.91878	1.671000	0.37513	0.740000	0.32651	0.655000	0.94253	CAG		0.368	NIF3L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336201.1	NM_021824		51	118	0	0	0	0.01441	0	51	118				
ALS2CR11	151254	broad.mit.edu	37	2	202352615	202352615	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:202352615T>A	ENST00000286195.3	-	15	1636	c.1592A>T	c.(1591-1593)gAt>gTt	p.D531V	ALS2CR11_ENST00000439140.1_Missense_Mutation_p.D1728V|ALS2CR11_ENST00000439802.1_3'UTR|ALS2CR11_ENST00000482942.1_5'UTR	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11	531										NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						CTCAAATTTATCTGAACAATC	0.294																																							uc002uye.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(1591-1593)GAT>GTT		amyotrophic lateral sclerosis 2 (juvenile)							61.0	60.0	60.0					2																	202352615		2203	4300	6503	SO:0001583	missense	151254							g.chr2:202352615T>A	AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.1592A>T	2.37:g.202352615T>A	ENSP00000286195:p.Asp531Val					ALS2CR11_uc002uyf.2_Missense_Mutation_p.D1728V|ALS2CR11_uc010fti.2_3'UTR	p.D531V	NM_152525	NP_689738	Q53TS8	AL2SA_HUMAN			15	1640	-			531					C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Missense_Mutation	SNP	ENST00000286195.3	37	c.1592A>T	CCDS2349.1	.	.	.	.	.	.	.	.	.	.	T	15.76	2.928132	0.52759	.	.	ENSG00000155754	ENST00000286195;ENST00000439140	T;T	0.53206	0.63;2.11	5.02	5.02	0.67125	.	0.000000	0.41938	D	0.000784	T	0.51958	0.1705	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.56854	-0.7910	10	0.72032	D	0.01	.	11.0586	0.47933	0.0:0.0:0.0:1.0	.	1728;531	E9PGG4;Q53TS8	.;AL2SA_HUMAN	V	531;1728	ENSP00000286195:D531V;ENSP00000409937:D1728V	ENSP00000286195:D531V	D	-	2	0	ALS2CR11	202060860	1.000000	0.71417	0.978000	0.43139	0.707000	0.40811	3.756000	0.55205	2.101000	0.63845	0.528000	0.53228	GAT		0.294	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256296.2	NM_152525		10	75	0	0	0	0.006214	0	10	75				
NBEAL1	65065	broad.mit.edu	37	2	204000719	204000719	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:204000719C>G	ENST00000449802.1	+	27	4379	c.4046C>G	c.(4045-4047)tCt>tGt	p.S1349C		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1349										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GAAGATAGCTCTGTGGGAGAA	0.408																																							uc002uzt.3		NA																	0				ovary(1)|skin(1)	2						c.(4045-4047)TCT>TGT		neurobeachin-like 1 isoform 3							91.0	85.0	87.0					2																	204000719		1855	4093	5948	SO:0001583	missense	65065						binding	g.chr2:204000719C>G	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.4046C>G	2.37:g.204000719C>G	ENSP00000399903:p.Ser1349Cys					NBEAL1_uc002uzs.3_Missense_Mutation_p.S59C	p.S1349C	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN			27	4379	+			1349					A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	37	c.4046C>G	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	C	17.11	3.305294	0.60305	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.56611	0.45	5.29	4.41	0.53225	.	0.372112	0.30492	N	0.009517	T	0.49983	0.1589	L	0.46157	1.445	0.38027	D	0.935059	D;D	0.57571	0.98;0.98	P;P	0.46975	0.533;0.533	T	0.54470	-0.8289	10	0.39692	T	0.17	.	12.1436	0.54012	0.0:0.9193:0.0:0.0807	.	1349;1338	Q6ZS30;C9JGK5	NBEL1_HUMAN;.	C	1349	ENSP00000399903:S1349C	ENSP00000344985:S1349C	S	+	2	0	NBEAL1	203708964	0.934000	0.31675	0.994000	0.49952	0.828000	0.46876	3.357000	0.52277	1.246000	0.43901	0.655000	0.94253	TCT		0.408	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4			18	73	0	0	0	0.00499	0	18	73				
ZDBF2	57683	broad.mit.edu	37	2	207173357	207173357	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:207173357G>A	ENST00000374423.3	+	5	4491	c.4105G>A	c.(4105-4107)Gat>Aat	p.D1369N		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1369							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						AGAAAGTTCTGATTCCAATGA	0.398																																							uc002vbp.2		NA																	0				ovary(3)	3						c.(4105-4107)GAT>AAT		zinc finger, DBF-type containing 2							51.0	49.0	50.0					2																	207173357		1840	4108	5948	SO:0001583	missense	57683						nucleic acid binding|zinc ion binding	g.chr2:207173357G>A	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.4105G>A	2.37:g.207173357G>A	ENSP00000363545:p.Asp1369Asn						p.D1369N	NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN			5	4355	+			1369					Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	c.4105G>A	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	G	11.19	1.564513	0.27915	.	.	ENSG00000204186	ENST00000374423	T	0.48836	0.8	3.48	2.55	0.30701	.	.	.	.	.	T	0.32376	0.0827	L	0.38175	1.15	0.09310	N	1	P	0.43477	0.808	B	0.39027	0.288	T	0.07520	-1.0768	9	0.22706	T	0.39	.	6.1781	0.20455	0.1477:0.0:0.8523:0.0	.	1369	Q9HCK1	ZDBF2_HUMAN	N	1369	ENSP00000363545:D1369N	ENSP00000363545:D1369N	D	+	1	0	ZDBF2	206881602	0.038000	0.19896	0.083000	0.20561	0.012000	0.07955	1.633000	0.37113	0.976000	0.38417	0.650000	0.86243	GAT		0.398	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923		7	58	0	0	0	0.001984	0	7	58				
PRKAG3	53632	broad.mit.edu	37	2	219688556	219688556	+	Missense_Mutation	SNP	C	C	A	rs144562493	byFrequency	TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:219688556C>A	ENST00000529249.1	-	13	1714	c.1399G>T	c.(1399-1401)Gtg>Ttg	p.V467L	PRKAG3_ENST00000439262.2_Missense_Mutation_p.V442L|PRKAG3_ENST00000545803.1_Missense_Mutation_p.V283L			Q9UGI9	AAKG3_HUMAN	protein kinase, AMP-activated, gamma 3 non-catalytic subunit	467	CBS 4. {ECO:0000255|PROSITE- ProRule:PRU00703}.				cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|protein phosphorylation (GO:0006468)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)	AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			large_intestine(7)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Acetylsalicylic acid(DB00945)	AGGGAGACCACGCCCAAGAGA	0.612																																							uc002vjb.1		NA																	0				ovary(1)|lung(1)	2						c.(1399-1401)GTG>TTG		AMP-activated protein kinase, non-catalytic							133.0	107.0	116.0					2																	219688556		2203	4300	6503	SO:0001583	missense	53632				cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|intracellular protein kinase cascade|regulation of fatty acid oxidation	cytosol	AMP-activated protein kinase activity|protein kinase binding	g.chr2:219688556C>A	AF214519	CCDS2424.1	2q35	2012-09-20			ENSG00000115592	ENSG00000115592			9387	protein-coding gene	gene with protein product		604976				10818001	Standard	NM_017431		Approved		uc002vjb.1	Q9UGI9	OTTHUMG00000133078	ENST00000529249.1:c.1399G>T	2.37:g.219688556C>A	ENSP00000436068:p.Val467Leu						p.V467L	NM_017431	NP_059127	Q9UGI9	AAKG3_HUMAN		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	13	1418	-		Renal(207;0.0474)	467			CBS 4.		Q4QQG8|Q4V779|Q9NRL1	Missense_Mutation	SNP	ENST00000529249.1	37	c.1399G>T	CCDS2424.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255120	0.80135	.	.	ENSG00000115592	ENST00000439262;ENST00000545803;ENST00000529249	D;D;D	0.93659	-3.26;-3.26;-3.26	5.21	3.4	0.38934	Cystathionine beta-synthase, core (3);	0.118078	0.56097	D	0.000033	D	0.91355	0.7273	L	0.28556	0.865	0.80722	D	1	D	0.54964	0.969	P	0.58172	0.834	D	0.89594	0.3830	10	0.54805	T	0.06	-16.0174	5.989	0.19450	0.0:0.659:0.0:0.341	.	467	Q9UGI9	AAKG3_HUMAN	L	442;283;467	ENSP00000397133:V442L;ENSP00000444536:V283L;ENSP00000436068:V467L	ENSP00000233944:V467L	V	-	1	0	PRKAG3	219396800	1.000000	0.71417	0.993000	0.49108	0.985000	0.73830	3.592000	0.53993	1.183000	0.42943	0.561000	0.74099	GTG		0.612	PRKAG3-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385992.1			29	47	1	0	7.26314e-15	0.007291	8.55921e-15	29	47				
DAW1	164781	broad.mit.edu	37	2	228756020	228756020	+	Missense_Mutation	SNP	C	C	T	rs199504696		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:228756020C>T	ENST00000309931.2	+	4	391	c.308C>T	c.(307-309)tCg>tTg	p.S103L	DAW1_ENST00000373666.2_Missense_Mutation_p.S103L|DAW1_ENST00000472604.1_3'UTR|DAW1_ENST00000545118.1_Missense_Mutation_p.S88L	NM_178821.1	NP_849143.1	Q8N136	DAW1_HUMAN	dynein assembly factor with WDR repeat domains 1	103						cilium (GO:0005929)											CTTAACAAATCGGGCTCATGG	0.299													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19628	0.0		0.0	False		,,,				2504	0.0						uc002vpn.1		NA																	0				breast(1)	1						c.(307-309)TCG>TTG		WD repeat domain 69							133.0	136.0	135.0					2																	228756020		2203	4299	6502	SO:0001583	missense	164781							g.chr2:228756020C>T		CCDS2470.1	2q36.3	2013-09-03	2013-02-19	2013-02-19	ENSG00000123977	ENSG00000123977		"""WD repeat domain containing"""	26383	protein-coding gene	gene with protein product	"""outer row dynein assembly 16 homolog (Chlamydomonas)"""		"""WD repeat domain 69"""	WDR69		20568242, 21953912	Standard	NM_178821		Approved	FLJ25955, ODA16	uc002vpn.1	Q8N136	OTTHUMG00000133190	ENST00000309931.2:c.308C>T	2.37:g.228756020C>T	ENSP00000311899:p.Ser103Leu					WDR69_uc010zlw.1_Missense_Mutation_p.S88L|WDR69_uc002vpo.1_RNA	p.S103L	NM_178821	NP_849143	Q8N136	WDR69_HUMAN		Epithelial(121;1.22e-10)|all cancers(144;8.11e-08)|Lung(261;0.011)|LUSC - Lung squamous cell carcinoma(224;0.0148)	4	387	+		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	103			WD 1.		Q6ZRY1|Q8N776	Missense_Mutation	SNP	ENST00000309931.2	37	c.308C>T	CCDS2470.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	18.22	3.575517	0.65878	.	.	ENSG00000123977	ENST00000373666;ENST00000309931;ENST00000545118	D;T;T	0.82344	-1.6;0.05;1.52	5.66	5.66	0.87406	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.192526	0.46758	D	0.000270	D	0.86070	0.5845	L	0.46885	1.475	0.53688	D	0.999979	D	0.54397	0.966	P	0.54629	0.757	D	0.86065	0.1534	10	0.51188	T	0.08	.	18.3197	0.90234	0.0:1.0:0.0:0.0	.	103	Q8N136	WDR69_HUMAN	L	103;103;88	ENSP00000362770:S103L;ENSP00000311899:S103L;ENSP00000437887:S88L	ENSP00000311899:S103L	S	+	2	0	WDR69	228464264	1.000000	0.71417	0.972000	0.41901	0.992000	0.81027	6.504000	0.73704	2.656000	0.90262	0.655000	0.94253	TCG		0.299	DAW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331745.1	NM_178821		17	60	0	0	0	0.010504	0	17	60				
INPP5D	3635	broad.mit.edu	37	2	234104107	234104107	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:234104107C>T	ENST00000359570.5	+	26	2623	c.2623C>T	c.(2623-2625)Cac>Tac	p.H875Y	INPP5D_ENST00000455936.2_Missense_Mutation_p.H639Y|INPP5D_ENST00000450745.1_Missense_Mutation_p.H639Y			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	887					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)			central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		CCTCACCAGCCACGACCCCAT	0.567																																					NSCLC(82;1215 1426 16163 20348 41018)	NSCLC(82;1215 1426 16163 20348 41018)	uc010zmo.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2659-2661)CAC>TAC		SH2 containing inositol phosphatase isoform a							70.0	71.0	70.0					2																	234104107		1949	4129	6078	SO:0001583	missense	3635				apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding	g.chr2:234104107C>T	U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.2623C>T	2.37:g.234104107C>T	ENSP00000352575:p.His875Tyr					INPP5D_uc010zmp.1_Missense_Mutation_p.H886Y	p.H887Y	NM_001017915	NP_001017915	Q92835	SHIP1_HUMAN		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)	23	2812	+		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)	887					O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Missense_Mutation	SNP	ENST00000359570.5	37	c.2659C>T		.	.	.	.	.	.	.	.	.	.	C	14.16	2.451750	0.43531	.	.	ENSG00000168918	ENST00000359570;ENST00000450745;ENST00000455936;ENST00000435188;ENST00000415617;ENST00000445964;ENST00000417661	D;D;D;D;D;D	0.96554	-4.0;-4.05;-4.05;-4.03;-4.03;-4.03	5.06	4.19	0.49359	.	0.227360	0.30949	N	0.008541	D	0.92185	0.7522	.	.	.	0.26728	N	0.970654	B;B	0.33000	0.34;0.393	B;B	0.31686	0.134;0.086	D	0.86643	0.1893	9	0.48119	T	0.1	.	7.6132	0.28142	0.0:0.8144:0.0:0.1856	.	886;887	Q92835-2;Q92835	.;SHIP1_HUMAN	Y	875;639;639;508;508;508;9	ENSP00000352575:H875Y;ENSP00000407916:H639Y;ENSP00000404610:H639Y;ENSP00000400151:H508Y;ENSP00000397421:H508Y;ENSP00000405338:H508Y	ENSP00000352575:H875Y	H	+	1	0	INPP5D	233768846	0.996000	0.38824	0.992000	0.48379	0.954000	0.61252	1.357000	0.34090	1.363000	0.46019	0.655000	0.94253	CAC		0.567	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001017915		24	52	0	0	0	0.00278	0	24	52				
SEPT2	4735	broad.mit.edu	37	2	242283227	242283227	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:242283227G>T	ENST00000391973.2	+	9	1285	c.757G>T	c.(757-759)Gtc>Ttc	p.V253F	SEPT2_ENST00000407971.1_Missense_Mutation_p.V213F|SEPT2_ENST00000360051.3_Missense_Mutation_p.V253F|SEPT2_ENST00000401990.1_Missense_Mutation_p.V263F|SEPT2_ENST00000402092.2_Missense_Mutation_p.V253F|SEPT2_ENST00000391971.2_Missense_Mutation_p.V253F	NM_006155.1	NP_006146.1	Q15019	SEPT2_HUMAN	septin 2	253	Septin-type G.				cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|neuron projection development (GO:0031175)|regulation of L-glutamate transport (GO:0002036)|regulation of protein localization (GO:0032880)|smoothened signaling pathway (GO:0007224)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|ciliary membrane (GO:0060170)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|synapse (GO:0045202)	enzyme regulator activity (GO:0030234)|GTP binding (GO:0005525)			central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)		AGGAAAGAAGGTCAGAGGCCG	0.502																																							uc002wbc.2		NA																	0				central_nervous_system(1)	1						c.(757-759)GTC>TTC		septin 2							260.0	266.0	264.0					2																	242283227		2203	4300	6503	SO:0001583	missense	4735				cell division|mitosis	actin cytoskeleton|cleavage furrow|condensed chromosome kinetochore|midbody|nucleolus|septin complex|spindle	GTP binding	g.chr2:242283227G>T	D28540	CCDS2548.1, CCDS63195.1, CCDS74682.1	2q37.3	2013-01-21	2005-01-11	2005-01-12	ENSG00000168385	ENSG00000168385		"""Septins"""	7729	protein-coding gene	gene with protein product		601506	"""neural precursor cell expressed, developmentally down-regulated 5"""	DIFF6, NEDD5		8697812	Standard	XM_005247011		Approved	KIAA0158, hNedd5, Pnutl3	uc002wbd.3	Q15019	OTTHUMG00000133394	ENST00000391973.2:c.757G>T	2.37:g.242283227G>T	ENSP00000375834:p.Val253Phe					SEPT2_uc002wbd.2_Missense_Mutation_p.V253F|SEPT2_uc002wbf.2_Missense_Mutation_p.V253F|SEPT2_uc002wbg.2_Missense_Mutation_p.V253F|SEPT2_uc002wbh.2_Missense_Mutation_p.V263F|SEPT2_uc010zop.1_Missense_Mutation_p.V288F	p.V253F	NM_001008491	NP_001008491	Q15019	SEPT2_HUMAN		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)	10	1178	+		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)	253					B4DGE8|Q14132|Q53QU3|Q8IUK9|Q96CB0	Missense_Mutation	SNP	ENST00000391973.2	37	c.757G>T	CCDS2548.1	.	.	.	.	.	.	.	.	.	.	G	33	5.288615	0.95517	.	.	ENSG00000168385	ENST00000391973;ENST00000360051;ENST00000391971;ENST00000401990;ENST00000407971;ENST00000402092;ENST00000391972;ENST00000421717	T;T;T;T;T;T;T	0.60797	0.16;0.16;0.16;0.16;0.16;0.16;0.16	6.08	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.77329	0.4114	M	0.85197	2.74	0.80722	D	1	P;D;D	0.56746	0.906;0.976;0.977	P;P;D	0.64144	0.787;0.76;0.922	T	0.79883	-0.1615	10	0.62326	D	0.03	.	16.8632	0.86023	0.0:0.0:0.8712:0.1288	.	288;213;253	Q15019-2;B5MCX3;Q15019	.;.;SEPT2_HUMAN	F	253;253;253;263;213;253;288;108	ENSP00000375834:V253F;ENSP00000353157:V253F;ENSP00000375832:V253F;ENSP00000385109:V263F;ENSP00000384525:V213F;ENSP00000385172:V253F;ENSP00000408296:V108F	ENSP00000353157:V253F	V	+	1	0	SEPT2	241931900	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.701000	0.84566	2.894000	0.99253	0.655000	0.94253	GTC		0.502	SEPT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323177.3	NM_006155		11	264	1	0	0.00010058	0.013537	0.000105982	11	264				
STK25	10494	broad.mit.edu	37	2	242438131	242438131	+	Silent	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr2:242438131G>C	ENST00000316586.4	-	8	1189	c.840C>G	c.(838-840)ctC>ctG	p.L280L	STK25_ENST00000543554.1_Silent_p.L186L|STK25_ENST00000405585.1_Silent_p.L203L|STK25_ENST00000535007.1_Silent_p.L186L|STK25_ENST00000401869.1_Silent_p.L280L|STK25_ENST00000405883.3_Silent_p.L203L|STK25_ENST00000403346.3_Silent_p.L280L|STK25_ENST00000478403.1_5'UTR	NM_001271977.1|NM_001271978.1|NM_001282308.1	NP_001258906.1|NP_001258907.1|NP_001269237.1	O00506	STK25_HUMAN	serine/threonine kinase 25	280					establishment or maintenance of cell polarity (GO:0007163)|Golgi localization (GO:0051645)|positive regulation of axonogenesis (GO:0050772)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		TGAGCTCCGTGAGGAAGGAGG	0.577																																					NSCLC(99;1100 1566 7679 28647 48345)	NSCLC(99;1100 1566 7679 28647 48345)	uc002wbm.2		NA																	0					0						c.(838-840)CTC>CTG		serine/threonine kinase 25							150.0	129.0	136.0					2																	242438131		2203	4300	6503	SO:0001819	synonymous_variant	10494				response to oxidative stress|signal transduction	Golgi apparatus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity	g.chr2:242438131G>C	D63780	CCDS2549.1, CCDS63199.1, CCDS63200.1	2q37.3	2010-06-25	2010-06-25		ENSG00000115694	ENSG00000115694			11404	protein-coding gene	gene with protein product		602255	"""serine/threonine kinase 25 (Ste20, yeast homolog)"""			8887545, 9160885, 15037601	Standard	NM_001271977		Approved	SOK1, YSK1	uc002wbp.4	O00506	OTTHUMG00000133408	ENST00000316586.4:c.840C>G	2.37:g.242438131G>C						STK25_uc002wbk.2_Silent_p.L99L|STK25_uc002wbl.2_3'UTR|STK25_uc002wbn.2_Silent_p.L280L|STK25_uc002wbo.2_Silent_p.L203L|STK25_uc010zos.1_Silent_p.L186L|STK25_uc010zot.1_Silent_p.L206L|STK25_uc002wbp.2_Silent_p.L280L|STK25_uc010fzo.2_Silent_p.L203L|STK25_uc010zou.1_Silent_p.L186L|STK25_uc010zov.1_Silent_p.L186L	p.L280L	NM_006374	NP_006365	O00506	STK25_HUMAN		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)	7	1111	-		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)	280					A8K6Z3|A8K7D2|B7Z9K1|Q15522|Q5BJF1	Silent	SNP	ENST00000316586.4	37	c.840C>G	CCDS2549.1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.307981	0.23821	.	.	ENSG00000115694	ENST00000423004	.	.	.	5.19	2.15	0.27550	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.2289	0.10594	0.0761:0.2442:0.4557:0.224	.	.	.	.	X	162	.	.	S	-	2	0	STK25	242086804	0.960000	0.32886	1.000000	0.80357	0.998000	0.95712	0.097000	0.15168	0.657000	0.30906	0.655000	0.94253	TCA		0.577	STK25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257265.4	NM_006374		15	59	0	0	0	0.006122	0	15	59				
CDS2	8760	broad.mit.edu	37	20	5170746	5170746	+	Splice_Site	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr20:5170746A>G	ENST00000460006.1	+	13	1512		c.e13-1		CDS2_ENST00000535100.1_Splice_Site|CDS2_ENST00000379070.3_Splice_Site|CDS2_ENST00000379062.4_Splice_Site	NM_003818.3	NP_003809.1	O95674	CDS2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2						CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	phosphatidate cytidylyltransferase activity (GO:0004605)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|stomach(1)	14						ATTCTGTTCCAGAGGCCCTAA	0.512																																							uc002wls.2		NA																	0					0						c.e13-2		phosphatidate cytidylyltransferase 2							82.0	69.0	74.0					20																	5170746		2203	4300	6503	SO:0001630	splice_region_variant	8760				phospholipid biosynthetic process	integral to membrane|mitochondrial inner membrane	phosphatidate cytidylyltransferase activity	g.chr20:5170746A>G	AF069532	CCDS13088.1	20p13	2006-03-28			ENSG00000101290	ENSG00000101290	2.7.7.41		1801	protein-coding gene	gene with protein product		603549				9806839, 9889000	Standard	NM_003818		Approved		uc002wls.3	O95674	OTTHUMG00000031801	ENST00000460006.1:c.1206-1A>G	20.37:g.5170746A>G						CDS2_uc010zqt.1_Splice_Site|CDS2_uc002wlu.2_Splice_Site|CDS2_uc010zqu.1_Splice_Site_p.R282_splice|CDS2_uc002wlv.2_Splice_Site_p.R304_splice|CDS2_uc010zqv.1_Splice_Site_p.R172_splice	p.R402_splice	NM_003818	NP_003809	O95674	CDS2_HUMAN			13	1463	+								B2RDC6|D3DW04|Q5TDY2|Q5TDY3|Q5TDY4|Q5TDY5|Q9BYK5|Q9NTT2	Splice_Site	SNP	ENST00000460006.1	37	c.1206_splice	CCDS13088.1	.	.	.	.	.	.	.	.	.	.	A	13.86	2.363575	0.41902	.	.	ENSG00000101290	ENST00000460006;ENST00000379062;ENST00000535100	.	.	.	4.95	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1007	0.53783	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDS2	5118746	1.000000	0.71417	0.974000	0.42286	0.374000	0.29953	8.895000	0.92512	2.077000	0.62373	0.454000	0.30748	.		0.512	CDS2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077858.2		Intron	22	28	0	0	0	0.014323	0	22	28				
TASP1	55617	broad.mit.edu	37	20	13550200	13550200	+	Silent	SNP	T	T	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr20:13550200T>G	ENST00000337743.4	-	7	642	c.522A>C	c.(520-522)gcA>gcC	p.A174A	TASP1_ENST00000480436.1_5'UTR|TASP1_ENST00000539805.1_Intron	NM_017714.2	NP_060184.2	Q9H6P5	TASP1_HUMAN	taspase, threonine aspartase, 1	174					positive regulation of transcription, DNA-templated (GO:0045893)		threonine-type endopeptidase activity (GO:0004298)			NS(1)|breast(1)|endometrium(2)|large_intestine(11)|liver(1)|lung(11)|stomach(2)|urinary_tract(2)	31						CATGATCTACTGCCCATCTGT	0.323																																							uc002woi.2		NA																	0					0						c.(520-522)GCA>GCC		taspase 1 precursor							97.0	99.0	99.0					20																	13550200		2203	4300	6503	SO:0001819	synonymous_variant	55617				asparagine catabolic process via L-aspartate|positive regulation of transcription, DNA-dependent|protein maturation		threonine-type endopeptidase activity	g.chr20:13550200T>G	AK000219	CCDS13116.1	20p12	2005-10-15	2005-10-15	2005-10-15	ENSG00000089123	ENSG00000089123	3.4.25.-		15859	protein-coding gene	gene with protein product		608270	"""chromosome 20 open reading frame 13"""	C20orf13		14636557	Standard	XR_430268		Approved	FLJ20212, dJ585I14.2	uc002woi.3	Q9H6P5	OTTHUMG00000031904	ENST00000337743.4:c.522A>C	20.37:g.13550200T>G						TASP1_uc010zri.1_Intron|TASP1_uc002woh.2_Silent_p.A151A|TASP1_uc010zrj.1_Intron	p.A174A	NM_017714	NP_060184	Q9H6P5	TASP1_HUMAN			7	639	-			174					B7Z690|B7Z963|Q5TDU9|Q9BQN0|Q9NQ08|Q9NTS6|Q9NXJ2	Silent	SNP	ENST00000337743.4	37	c.522A>C	CCDS13116.1																																																																																				0.323	TASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078041.2	NM_017714		16	53	0	0	0	0.010504	0	16	53				
RIN2	54453	broad.mit.edu	37	20	19937423	19937423	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr20:19937423C>G	ENST00000255006.6	+	4	619	c.470C>G	c.(469-471)gCa>gGa	p.A157G	RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Missense_Mutation_p.A108G	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	108	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						GAGGAGGCAGCAGAGGTCCTG	0.592																																							uc002wro.1		NA																	0				lung(4)|ovary(1)	5						c.(322-324)GCA>GGA		Ras and Rab interactor 2							24.0	27.0	26.0					20																	19937423		1971	4141	6112	SO:0001583	missense	54453				endocytosis|small GTPase mediated signal transduction	cytoplasm	GTPase activator activity|Rab guanyl-nucleotide exchange factor activity	g.chr20:19937423C>G	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.470C>G	20.37:g.19937423C>G	ENSP00000255006:p.Ala157Gly					RIN2_uc010gcu.1_Missense_Mutation_p.A108G|RIN2_uc010gcv.1_5'UTR	p.A108G	NM_018993	NP_061866	Q8WYP3	RIN2_HUMAN			3	359	+			108			SH2.		Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	ENST00000255006.6	37	c.323C>G	CCDS56182.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.169099	0.57584	.	.	ENSG00000132669	ENST00000255006;ENST00000440354	T;T	0.30714	1.52;3.12	5.41	4.4	0.53042	SH2 motif (3);	0.243192	0.43416	D	0.000575	T	0.37892	0.1020	L	0.52573	1.65	0.09310	N	1	D;B	0.59357	0.985;0.278	P;B	0.50314	0.637;0.039	T	0.20405	-1.0276	9	.	.	.	-20.0052	15.2339	0.73413	0.0:0.8589:0.1411:0.0	.	108;108	E7EPJ1;Q8WYP3	.;RIN2_HUMAN	G	157;108	ENSP00000255006:A157G;ENSP00000391239:A108G	.	A	+	2	0	RIN2	19885423	0.002000	0.14202	0.622000	0.29159	0.950000	0.60333	1.484000	0.35508	2.541000	0.85698	0.561000	0.74099	GCA		0.592	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078212.1			2	6	0	0	0	0.004672	0	2	6				
CST1	1469	broad.mit.edu	37	20	23729677	23729677	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr20:23729677G>A	ENST00000304749.2	-	2	388	c.318C>T	c.(316-318)ttC>ttT	p.F106F	CST1_ENST00000398402.1_Silent_p.F106F	NM_001898.2	NP_001889.2	P01037	CYTN_HUMAN	cystatin SN	106					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			kidney(1)|large_intestine(1)|lung(8)|ovary(1)|stomach(1)|urinary_tract(1)	13	Lung NSC(19;0.0676)|all_lung(19;0.148)					GCTGTTCATGGAAGGCACAGG	0.577																																							uc002wtp.2		NA																	0				ovary(1)	1						c.(316-318)TTC>TTT		cystatin SN precursor							206.0	156.0	173.0					20																	23729677		2203	4300	6503	SO:0001819	synonymous_variant	1469					extracellular region	cysteine-type endopeptidase inhibitor activity	g.chr20:23729677G>A	M19169	CCDS13160.1	20p11.2	2008-04-15			ENSG00000170373	ENSG00000170373			2473	protein-coding gene	gene with protein product		123855					Standard	NM_001898		Approved		uc002wtp.3	P01037	OTTHUMG00000032085	ENST00000304749.2:c.318C>T	20.37:g.23729677G>A							p.F106F	NM_001898	NP_001889	P01037	CYTN_HUMAN			2	389	-	Lung NSC(19;0.0676)|all_lung(19;0.148)		106					Q96LE6|Q9UCQ6	Silent	SNP	ENST00000304749.2	37	c.318C>T	CCDS13160.1																																																																																				0.577	CST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078351.2	NM_001898		53	60	0	0	0	0.01441	0	53	60				
CST2	1470	broad.mit.edu	37	20	23805871	23805871	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr20:23805871G>A	ENST00000304725.2	-	2	388	c.318C>T	c.(316-318)ttC>ttT	p.F106F		NM_001322.2	NP_001313.1	P09228	CYTT_HUMAN	cystatin SA	106					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|cervix(1)|large_intestine(1)|liver(1)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	10						GCTGTTCATGGAAGGCACAGG	0.552																																					Pancreas(193;496 3017 22514 29918)	Pancreas(193;496 3017 22514 29918)	uc002wtq.1		NA																	0					0						c.(316-318)TTC>TTT		cystatin SA precursor							331.0	244.0	273.0					20																	23805871		2203	4298	6501	SO:0001819	synonymous_variant	1470					extracellular region	cysteine-type endopeptidase inhibitor activity	g.chr20:23805871G>A	M19671	CCDS13161.1	20p11.2	2007-11-29			ENSG00000170369	ENSG00000170369			2474	protein-coding gene	gene with protein product	"""cystatin 2"""	123856					Standard	NM_001322		Approved		uc002wtq.1	P09228	OTTHUMG00000032086	ENST00000304725.2:c.318C>T	20.37:g.23805871G>A							p.F106F	NM_001322	NP_001313	P09228	CYTT_HUMAN			2	333	-			106					Q9UCQ7	Silent	SNP	ENST00000304725.2	37	c.318C>T	CCDS13161.1																																																																																				0.552	CST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078352.2			6	129	0	0	0	0.001168	0	6	129				
NINL	22981	broad.mit.edu	37	20	25457142	25457142	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr20:25457142T>A	ENST00000278886.6	-	17	2858	c.2785A>T	c.(2785-2787)Agc>Tgc	p.S929C	NINL_ENST00000422516.1_Intron	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	929					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CCCGCTGCGCTCGCGCCGAAA	0.672																																							uc002wux.1		NA																	0				ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(2785-2787)AGC>TGC		ninein-like							12.0	14.0	14.0					20																	25457142		2123	4156	6279	SO:0001583	missense	22981				G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding	g.chr20:25457142T>A		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.2785A>T	20.37:g.25457142T>A	ENSP00000278886:p.Ser929Cys					NINL_uc010gdn.1_Intron	p.S929C	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN			17	2859	-			929					A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	37	c.2785A>T	CCDS33452.1	.	.	.	.	.	.	.	.	.	.	T	8.801	0.932820	0.18131	.	.	ENSG00000101004	ENST00000278886	T	0.27104	1.69	3.08	-1.4	0.08968	.	28.256900	0.00166	N	0.000000	T	0.11367	0.0277	N	0.08118	0	0.09310	N	1	P	0.39782	0.688	B	0.31751	0.135	T	0.11012	-1.0605	10	0.54805	T	0.06	1.8714	3.4079	0.07348	0.0:0.3941:0.2065:0.3995	.	929	Q9Y2I6	NINL_HUMAN	C	929	ENSP00000278886:S929C	ENSP00000278886:S929C	S	-	1	0	NINL	25405142	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.755000	0.04782	-0.227000	0.09884	-1.443000	0.01068	AGC		0.672	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176		5	14	0	0	0	0.000602	0	5	14				
NINL	22981	broad.mit.edu	37	20	25477351	25477351	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr20:25477351C>G	ENST00000278886.6	-	10	1331	c.1258G>C	c.(1258-1260)Gag>Cag	p.E420Q	NINL_ENST00000422516.1_Missense_Mutation_p.E420Q	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	420					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						TCGTCCATCTCTTTCACAAAC	0.602																																							uc002wux.1		NA																	0				ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						c.(1258-1260)GAG>CAG		ninein-like							106.0	89.0	95.0					20																	25477351		2203	4300	6503	SO:0001583	missense	22981				G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding	g.chr20:25477351C>G		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.1258G>C	20.37:g.25477351C>G	ENSP00000278886:p.Glu420Gln					NINL_uc010gdn.1_Missense_Mutation_p.E420Q|NINL_uc010gdo.1_Missense_Mutation_p.E203Q|NINL_uc010ztf.1_Missense_Mutation_p.E436Q	p.E420Q	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN			10	1332	-			420			Potential.		A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	37	c.1258G>C	CCDS33452.1	.	.	.	.	.	.	.	.	.	.	C	19.97	3.924569	0.73213	.	.	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.64085	0.19;-0.08	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.79975	0.4539	M	0.78637	2.42	0.54753	D	0.999986	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.82518	-0.0417	10	0.87932	D	0	-40.7668	17.2899	0.87153	0.0:1.0:0.0:0.0	.	420;420	Q9Y2I6-2;Q9Y2I6	.;NINL_HUMAN	Q	420	ENSP00000278886:E420Q;ENSP00000410431:E420Q	ENSP00000278886:E420Q	E	-	1	0	NINL	25425351	0.998000	0.40836	0.997000	0.53966	0.521000	0.34408	4.188000	0.58351	2.596000	0.87737	0.650000	0.86243	GAG		0.602	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176		11	62	0	0	0	0.008291	0	11	62				
TPX2	22974	broad.mit.edu	37	20	30345357	30345357	+	Silent	SNP	A	A	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr20:30345357A>T	ENST00000300403.6	+	3	606	c.78A>T	c.(76-78)ggA>ggT	p.G26G	TPX2_ENST00000340513.4_Silent_p.G26G	NM_012112.4	NP_036244.2	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated	26					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|regulation of mitotic spindle organization (GO:0060236)	axon hillock (GO:0043203)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			ATGATGAAGGAGATACTCAAA	0.393																																							uc002wwp.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(76-78)GGA>GGT		TPX2, microtubule-associated protein homolog							162.0	148.0	153.0					20																	30345357		2203	4300	6503	SO:0001819	synonymous_variant	22974				activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding	g.chr20:30345357A>T	AF098158	CCDS13190.1	20q11.2	2013-07-23	2013-07-23	2003-10-08	ENSG00000088325	ENSG00000088325			1249	protein-coding gene	gene with protein product		605917	"""chromosome 20 open reading frame 1"", ""TPX2, microtubule-associated, homolog (Xenopus laevis)"""	C20orf2, C20orf1		9207457, 10393424	Standard	NM_012112		Approved	p100, DIL-2	uc002wwp.1	Q9ULW0	OTTHUMG00000032190	ENST00000300403.6:c.78A>T	20.37:g.30345357A>T						TPX2_uc010gdv.1_Silent_p.G26G	p.G26G	NM_012112	NP_036244	Q9ULW0	TPX2_HUMAN	Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)		3	776	+			26					Q9H1R4|Q9NRA3|Q9UFN9|Q9UL00|Q9Y2M1	Silent	SNP	ENST00000300403.6	37	c.78A>T	CCDS13190.1																																																																																				0.393	TPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078569.2			27	41	0	0	0	0.00632	0	27	41				
FAM83C	128876	broad.mit.edu	37	20	33875148	33875148	+	Silent	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr20:33875148G>T	ENST00000374408.3	-	4	1530	c.1434C>A	c.(1432-1434)ccC>ccA	p.P478P	EIF6_ENST00000374443.3_5'Flank|EIF6_ENST00000462894.1_5'Flank|EIF6_ENST00000374450.3_5'Flank|EIF6_ENST00000374436.3_5'Flank|FAM83C-AS1_ENST00000429167.1_RNA	NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	478										central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			GACCCCGCAGGGGGCTGGGCT	0.642																																							uc010zux.1		NA																	0				ovary(2)	2						c.(1432-1434)CCC>CCA		hypothetical protein LOC128876							30.0	31.0	31.0					20																	33875148		2193	4269	6462	SO:0001819	synonymous_variant	128876							g.chr20:33875148G>T	AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.1434C>A	20.37:g.33875148G>T						EIF6_uc002xbv.1_5'Flank|EIF6_uc002xbx.1_5'Flank|EIF6_uc002xbz.1_5'Flank|EIF6_uc002xby.1_5'Flank|FAM83C_uc002xcb.1_Silent_p.P133P	p.P478P	NM_178468	NP_848563	Q9BQN1	FA83C_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.00252)		4	1552	-			478					Q14D67|Q5JWN6|Q8N276	Silent	SNP	ENST00000374408.3	37	c.1434C>A	CCDS13251.1																																																																																				0.642	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078854.3			17	47	1	0	1.99824e-07	0.00499	2.19214e-07	17	47				
SPAG4	6676	broad.mit.edu	37	20	34207574	34207574	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr20:34207574G>A	ENST00000374273.3	+	10	1095	c.983G>A	c.(982-984)cGa>cAa	p.R328Q		NM_003116.1	NP_003107.1	Q9NPE6	SPAG4_HUMAN	sperm associated antigen 4	328	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|motile cilium (GO:0031514)	structural molecule activity (GO:0005198)			NS(1)|cervix(5)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)	21	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			CTGCCGGGCCGAGTGCAGCTG	0.652																																							uc002xdb.1		NA																	0					0						c.(982-984)CGA>CAA		sperm associated antigen 4							51.0	52.0	52.0					20																	34207574		2203	4300	6503	SO:0001583	missense	6676				spermatogenesis	cilium|flagellar axoneme|integral to membrane	structural molecule activity	g.chr20:34207574G>A	AF043344	CCDS13259.1	20q11.2	2010-04-23			ENSG00000061656	ENSG00000061656			11214	protein-coding gene	gene with protein product	"""acrosomal protein ACR55"", ""Sad1 and UNC84 domain containing 4"", ""cancer/testis antigen 127"""	603038				9691178, 10373309	Standard	NM_003116		Approved	SUN4, CT127	uc002xdb.1	Q9NPE6	OTTHUMG00000032352	ENST00000374273.3:c.983G>A	20.37:g.34207574G>A	ENSP00000363391:p.Arg328Gln					SPAG4_uc010zvi.1_Missense_Mutation_p.R251Q	p.R328Q	NM_003116	NP_003107	Q9NPE6	SPAG4_HUMAN	BRCA - Breast invasive adenocarcinoma(18;0.0127)		10	1100	+	Lung NSC(9;0.0053)|all_lung(11;0.00785)		328			SUN.		O43648	Missense_Mutation	SNP	ENST00000374273.3	37	c.983G>A	CCDS13259.1	.	.	.	.	.	.	.	.	.	.	G	14.57	2.575754	0.45902	.	.	ENSG00000061656	ENST00000374273;ENST00000454819;ENST00000430878	T;T;T	0.41400	1.0;1.0;1.0	4.56	0.101	0.14517	Sad1/UNC-like, C-terminal (2);	0.575787	0.17601	N	0.168403	T	0.29491	0.0735	L	0.38175	1.15	0.22835	N	0.998679	P;P	0.49447	0.873;0.924	B;B	0.44085	0.44;0.34	T	0.15407	-1.0438	10	0.59425	D	0.04	-17.5454	4.0751	0.09901	0.3196:0.1762:0.5042:0.0	.	203;328	C9JJZ6;Q9NPE6	.;SPAG4_HUMAN	Q	328;203;23	ENSP00000363391:R328Q;ENSP00000396670:R203Q;ENSP00000399231:R23Q	ENSP00000363391:R328Q	R	+	2	0	SPAG4	33670988	0.277000	0.24220	0.952000	0.39060	0.302000	0.27658	0.535000	0.23114	0.130000	0.18549	0.561000	0.74099	CGA		0.652	SPAG4-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078896.1	NM_003116		16	50	0	0	0	0.004007	0	16	50				
ZHX3	23051	broad.mit.edu	37	20	39832861	39832861	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr20:39832861G>A	ENST00000309060.3	-	4	1111	c.696C>T	c.(694-696)ttC>ttT	p.F232F	ZHX3_ENST00000557816.1_Intron|ZHX3_ENST00000540170.1_Silent_p.F232F|ZHX3_ENST00000432768.2_Silent_p.F232F|ZHX3_ENST00000544979.2_Silent_p.F232F|ZHX3_ENST00000558993.1_Intron|ZHX3_ENST00000559234.1_Silent_p.F232F|ZHX3_ENST00000560361.1_Silent_p.F232F			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	232					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				CCCCATTGATGAAGGAATGGT	0.557																																							uc002xjs.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(694-696)TTC>TTT		zinc fingers and homeoboxes 3							116.0	105.0	109.0					20																	39832861		2203	4300	6503	SO:0001819	synonymous_variant	23051				negative regulation of transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr20:39832861G>A	AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.696C>T	20.37:g.39832861G>A						ZHX3_uc002xjq.1_Intron|ZHX3_uc002xjr.1_Silent_p.F232F|ZHX3_uc002xjt.1_Silent_p.F232F|ZHX3_uc002xju.1_Silent_p.F232F|ZHX3_uc002xjv.1_Silent_p.F232F|ZHX3_uc002xjw.1_Silent_p.F232F|ZHX3_uc010ggg.1_Silent_p.F232F	p.F232F	NM_015035	NP_055850	Q9H4I2	ZHX3_HUMAN			3	1074	-		Myeloproliferative disorder(115;0.00425)	232					E1P5W5|F5H820|O43145|Q6NUJ7	Silent	SNP	ENST00000309060.3	37	c.696C>T	CCDS13315.1																																																																																				0.557	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079262.3	NM_015035		17	93	0	0	0	0.00499	0	17	93				
GNAS	2778	broad.mit.edu	37	20	57415491	57415491	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr20:57415491G>A	ENST00000313949.7	+	1	719	c.330G>A	c.(328-330)gaG>gaA	p.E110E	GNAS_ENST00000371075.3_Silent_p.E110E|GNAS_ENST00000371098.2_Silent_p.E110E|GNAS-AS1_ENST00000424094.2_RNA|GNAS-AS1_ENST00000598163.1_RNA|GNAS-AS1_ENST00000443966.1_RNA			P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			TCGACTACGAGACCGAGAGCG	0.622			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	Colon(117;935 1597 6045 8307 46442)	uc002xzt.2		NA		Dom	yes		20	20q13.2	2778	Mis	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	McCune-Albright syndrome; pseudohypoparathyroidism|type IA	E			pituitary adenoma		0				pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292						c.(328-330)GAG>GAA		GNAS complex locus NESP55							92.0	90.0	91.0					20																	57415491		2203	4300	6503	SO:0001819	synonymous_variant	2778	3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome			activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity	g.chr20:57415491G>A	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000313949.7:c.330G>A	20.37:g.57415491G>A		TSP Lung(22;0.16)				GNASAS_uc002xzs.1_Intron|GNAS_uc002xzu.3_5'Flank|GNAS_uc010gjq.2_5'Flank	p.E110E	NM_016592	NP_057676	P63092	GNAS2_HUMAN	BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)		1	697	+	all_lung(29;0.0104)		123					A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Silent	SNP	ENST00000313949.7	37	c.330G>A	CCDS13471.1																																																																																				0.622	GNAS-002	KNOWN	NMD_exception|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080418.7	NM_000516		11	80	0	0	0	0.001855	0	11	80				
GATA5	140628	broad.mit.edu	37	20	61048574	61048574	+	Missense_Mutation	SNP	A	A	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr20:61048574A>C	ENST00000252997.2	-	3	645	c.584T>G	c.(583-585)cTg>cGg	p.L195R		NM_080473.4	NP_536721.1	Q9BWX5	GATA5_HUMAN	GATA binding protein 5	195					blood coagulation (GO:0007596)|cellular response to BMP stimulus (GO:0071773)|intestinal epithelial cell differentiation (GO:0060575)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			kidney(1)|lung(3)|ovary(1)|stomach(1)	6	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;3.08e-06)			CGGTGTGGACAGGGCCCCGCA	0.672																																							uc002ycx.1		NA																	0					0						c.(583-585)CTG>CGG		GATA binding protein 5							48.0	40.0	43.0					20																	61048574		2195	4296	6491	SO:0001583	missense	140628				blood coagulation|intestinal epithelial cell differentiation|positive regulation of transcription from RNA polymerase II promoter	nucleoplasm	sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding	g.chr20:61048574A>C	BC047790, BC117356	CCDS13499.1	20q13.33	2013-07-17	2001-11-28		ENSG00000130700	ENSG00000130700		"""GATA zinc finger domain containing"""	15802	protein-coding gene	gene with protein product		611496	"""GATA-binding protein 5"""			9566909	Standard	NM_080473		Approved	bB379O24.1, GATAS	uc002ycx.1	Q9BWX5	OTTHUMG00000032919	ENST00000252997.2:c.584T>G	20.37:g.61048574A>C	ENSP00000252997:p.Leu195Arg						p.L195R	NM_080473	NP_536721	Q9BWX5	GATA5_HUMAN	BRCA - Breast invasive adenocarcinoma(19;3.08e-06)		3	646	-	Breast(26;2.05e-08)		195			GATA-type 1.		D9ZGF7|Q17RE2|Q86VU4	Missense_Mutation	SNP	ENST00000252997.2	37	c.584T>G	CCDS13499.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.593631	0.86953	.	.	ENSG00000130700	ENST00000370545;ENST00000540404;ENST00000252997	D	0.99488	-6.0	4.78	4.78	0.61160	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (5);	0.151384	0.56097	D	0.000023	D	0.97952	0.9326	N	0.02275	-0.615	0.38973	D	0.958788	P	0.52463	0.953	P	0.59825	0.864	D	0.99943	1.1432	10	0.66056	D	0.02	-25.2647	14.3577	0.66748	1.0:0.0:0.0:0.0	.	195	Q9BWX5	GATA5_HUMAN	R	195;215;195	ENSP00000252997:L195R	ENSP00000252997:L195R	L	-	2	0	GATA5	60481969	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.246000	0.65411	1.799000	0.52666	0.454000	0.30748	CTG		0.672	GATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080038.2	NM_080473		3	5	0	0	0	0.009096	0	3	5				
SRMS	6725	broad.mit.edu	37	20	62178612	62178612	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr20:62178612C>T	ENST00000217188.1	-	1	245	c.205G>A	c.(205-207)Gag>Aag	p.E69K		NM_080823.2	NP_543013.1	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites	69	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				peptidyl-tyrosine autophosphorylation (GO:0038083)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(2)|stomach(1)	19	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			ACACTCAGCTCCCCGCCACAC	0.697																																							uc002yfi.1		NA																	0				stomach(1)|lung(1)	2						c.(205-207)GAG>AAG		src-related kinase lacking C-terminal regulatory							124.0	128.0	127.0					20																	62178612		2180	4260	6440	SO:0001583	missense	6725						ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr20:62178612C>T		CCDS13525.1	20q13.33	2013-02-14	2003-08-22		ENSG00000125508	ENSG00000125508		"""SH2 domain containing"""	11298	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 148"""	C20orf148		7935409	Standard	NM_080823		Approved	SRM, dJ697K14.1	uc002yfi.1	Q9H3Y6	OTTHUMG00000032977	ENST00000217188.1:c.205G>A	20.37:g.62178612C>T	ENSP00000217188:p.Glu69Lys						p.E69K	NM_080823	NP_543013	Q9H3Y6	SRMS_HUMAN	Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)		1	246	-	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		69			SH3.			Missense_Mutation	SNP	ENST00000217188.1	37	c.205G>A	CCDS13525.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.341546	0.61073	.	.	ENSG00000125508	ENST00000217188	T	0.63255	-0.03	4.09	4.09	0.47781	Src homology-3 domain (3);	0.000000	0.53938	D	0.000045	D	0.85053	0.5609	H	0.98199	4.17	0.44247	D	0.997093	D	0.89917	1.0	D	0.74348	0.983	D	0.89161	0.3530	10	0.87932	D	0	.	11.2197	0.48846	0.1837:0.8163:0.0:0.0	.	69	Q9H3Y6	SRMS_HUMAN	K	69	ENSP00000217188:E69K	ENSP00000217188:E69K	E	-	1	0	SRMS	61649056	1.000000	0.71417	0.632000	0.29296	0.059000	0.15707	6.003000	0.70701	1.820000	0.53075	0.491000	0.48974	GAG		0.697	SRMS-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080148.1	NM_080823		4	14	0	0	0	0.001168	0	4	14				
TPTE	7179	broad.mit.edu	37	21	10906930	10906930	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr21:10906930C>A	ENST00000361285.4	-	24	1960	c.1631G>T	c.(1630-1632)aGt>aTt	p.S544I	TPTE_ENST00000342420.5_Missense_Mutation_p.S506I|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Missense_Mutation_p.S526I	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	544					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TACAACATCACTGGAAGTCAT	0.388																																							uc002yip.1		NA																	0				ovary(2)|lung(1)|breast(1)|skin(1)	5						c.(1630-1632)AGT>ATT		transmembrane phosphatase with tensin homology							146.0	128.0	134.0					21																	10906930		2203	4300	6503	SO:0001583	missense	7179				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr21:10906930C>A	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1631G>T	21.37:g.10906930C>A	ENSP00000355208:p.Ser544Ile					TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.S526I|TPTE_uc002yir.1_Missense_Mutation_p.S506I|TPTE_uc010gkv.1_Missense_Mutation_p.S406I	p.S544I	NM_199261	NP_954870	P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)	24	1999	-			544					B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	c.1631G>T	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	10.18	1.279474	0.23307	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.94758	-3.36;-3.51;-3.47	1.6	0.648	0.17801	.	.	.	.	.	T	0.81894	0.4919	N	0.08118	0	0.09310	N	1	P;P;B	0.34977	0.478;0.478;0.183	B;B;B	0.23275	0.045;0.045;0.039	T	0.72272	-0.4342	9	0.15066	T	0.55	.	6.5931	0.22658	0.0:0.8037:0.0:0.1963	.	506;526;544	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	I	526;544;506	ENSP00000298232:S526I;ENSP00000355208:S544I;ENSP00000344441:S506I	ENSP00000298232:S526I	S	-	2	0	TPTE	9928801	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-1.039000	0.03550	-0.142000	0.11354	-1.461000	0.01025	AGT		0.388	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1			18	47	1	0	1.87028e-06	0.012319	2.03172e-06	18	47				
SON	6651	broad.mit.edu	37	21	34922480	34922480	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr21:34922480G>A	ENST00000356577.4	+	3	1418	c.943G>A	c.(943-945)Gag>Aag	p.E315K	SON_ENST00000381692.2_Intron|SON_ENST00000381679.4_Missense_Mutation_p.E315K|SON_ENST00000290239.6_Missense_Mutation_p.E315K|SON_ENST00000300278.4_Missense_Mutation_p.E315K	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	315					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GACACCTACTGAGGTGTACCC	0.478											OREG0003564	type=REGULATORY REGION|Gene=AK074269|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																											uc002yse.1		NA																	0				ovary(4)|skin(2)	6						c.(943-945)GAG>AAG		SON DNA-binding protein isoform F							81.0	79.0	80.0					21																	34922480		2203	4300	6503	SO:0001583	missense	6651				anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding	g.chr21:34922480G>A	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.943G>A	21.37:g.34922480G>A	ENSP00000348984:p.Glu315Lys		OREG0003564	type=REGULATORY REGION|Gene=AK074269|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	851	SON_uc002ysb.1_Missense_Mutation_p.E315K|SON_uc002ysc.2_Missense_Mutation_p.E315K|SON_uc002ysd.2_5'UTR|SON_uc002ysf.1_Intron|SON_uc002ysg.2_5'Flank	p.E315K	NM_138927	NP_620305	P18583	SON_HUMAN			3	992	+			315					D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	c.943G>A	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.141419	0.77775	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.23348	2.17;2.06;2.06;1.91	5.54	4.66	0.58398	.	0.000000	0.56097	D	0.000038	T	0.38054	0.1026	L	0.34521	1.04	0.31228	N	0.696698	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.991;0.996;0.996	T	0.35822	-0.9773	10	0.37606	T	0.19	.	12.8648	0.57934	0.0:0.1633:0.8367:0.0	.	315;315;315	P18583;P18583-3;P18583-6	SON_HUMAN;.;.	K	315	ENSP00000348984:E315K;ENSP00000290239:E315K;ENSP00000300278:E315K;ENSP00000371095:E315K	ENSP00000290239:E315K	E	+	1	0	SON	33844350	0.997000	0.39634	0.997000	0.53966	0.998000	0.95712	2.861000	0.48380	1.474000	0.48178	0.561000	0.74099	GAG		0.478	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927		9	62	0	0	0	0.004482	0	9	62				
DSCAM	1826	broad.mit.edu	37	21	41725430	41725430	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr21:41725430T>A	ENST00000400454.1	-	5	1373	c.896A>T	c.(895-897)tAc>tTc	p.Y299F		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	299	Ig-like C2-type 3.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				AGCAGTTCCGTATCTGTTGGA	0.512																																					Melanoma(134;970 1778 1785 21664 32388)	Melanoma(134;970 1778 1785 21664 32388)	uc002yyq.1		NA																	0				ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11						c.(895-897)TAC>TTC		Down syndrome cell adhesion molecule isoform							131.0	127.0	128.0					21																	41725430		1990	4170	6160	SO:0001583	missense	1826				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding	g.chr21:41725430T>A	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.896A>T	21.37:g.41725430T>A	ENSP00000383303:p.Tyr299Phe					DSCAM_uc002yyr.1_RNA	p.Y299F	NM_001389	NP_001380	O60469	DSCAM_HUMAN			5	1348	-		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)	299			Extracellular (Potential).|Ig-like C2-type 3.		O60468	Missense_Mutation	SNP	ENST00000400454.1	37	c.896A>T	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	T	6.025	0.373040	0.11409	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.65732	-0.17;-0.17	5.53	4.3	0.51218	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.065673	0.64402	D	0.000005	T	0.37461	0.1004	N	0.11154	0.105	0.39262	D	0.964232	B	0.06786	0.001	B	0.10450	0.005	T	0.28996	-1.0026	10	0.06757	T	0.87	.	11.6983	0.51556	0.1324:0.0:0.0:0.8676	.	299	O60469	DSCAM_HUMAN	F	299;51	ENSP00000383303:Y299F;ENSP00000385342:Y51F	ENSP00000383303:Y299F	Y	-	2	0	DSCAM	40647300	1.000000	0.71417	0.990000	0.47175	0.962000	0.63368	4.554000	0.60760	2.214000	0.71695	0.533000	0.62120	TAC		0.512	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389		19	130	0	0	0	0.014323	0	19	130				
COL6A2	1292	broad.mit.edu	37	21	47545457	47545457	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr21:47545457C>T	ENST00000300527.4	+	25	1999	c.1895C>T	c.(1894-1896)aCa>aTa	p.T632I	COL6A2_ENST00000310645.5_Missense_Mutation_p.T632I|COL6A2_ENST00000397763.1_Missense_Mutation_p.T632I|COL6A2_ENST00000357838.4_Missense_Mutation_p.T632I|COL6A2_ENST00000409416.1_Missense_Mutation_p.T632I	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	632	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		ACCAACTTCACACTGGAGAAG	0.617																																							uc002zia.1		NA																	0				central_nervous_system(7)|ovary(1)	8						c.(1894-1896)ACA>ATA		alpha 2 type VI collagen isoform 2C2 precursor							85.0	66.0	73.0					21																	47545457		2203	4300	6503	SO:0001583	missense	1292				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging	g.chr21:47545457C>T	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.1895C>T	21.37:g.47545457C>T	ENSP00000300527:p.Thr632Ile					COL6A2_uc002zhy.1_Missense_Mutation_p.T632I|COL6A2_uc002zhz.1_Missense_Mutation_p.T632I|COL6A2_uc002zib.1_Missense_Mutation_p.T38I|COL6A2_uc002zic.1_5'Flank	p.T632I	NM_001849	NP_001840	P12110	CO6A2_HUMAN		Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)	25	1977	+	Breast(49;0.245)		632			VWFA 2.|Nonhelical region.		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	37	c.1895C>T	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522636	0.85600	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763;ENST00000413758	D;D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74;-1.74	4.07	4.07	0.47477	von Willebrand factor, type A (3);	0.233425	0.43747	D	0.000529	D	0.88012	0.6323	L	0.56769	1.78	0.80722	D	1	D;D;D	0.64830	0.994;0.971;0.971	P;P;P	0.62435	0.902;0.628;0.628	D	0.88715	0.3225	10	0.49607	T	0.09	-19.5245	16.2537	0.82501	0.0:1.0:0.0:0.0	.	632;632;632	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	I	632;632;632;632;632;189	ENSP00000300527:T632I;ENSP00000350497:T632I;ENSP00000312529:T632I;ENSP00000387115:T632I;ENSP00000380870:T632I;ENSP00000395751:T189I	ENSP00000300527:T632I	T	+	2	0	COL6A2	46369885	1.000000	0.71417	0.987000	0.45799	0.924000	0.55760	7.408000	0.80041	1.820000	0.53075	0.297000	0.19635	ACA		0.617	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1			29	34	0	0	0	0.007291	0	29	34				
ARVCF	421	broad.mit.edu	37	22	19961246	19961246	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr22:19961246G>C	ENST00000263207.3	-	13	2450	c.2159C>G	c.(2158-2160)tCt>tGt	p.S720C	ARVCF_ENST00000406522.1_Missense_Mutation_p.S651C|ARVCF_ENST00000401994.1_Missense_Mutation_p.S657C|ARVCF_ENST00000406259.1_Missense_Mutation_p.S714C|ARVCF_ENST00000344269.3_Missense_Mutation_p.S657C	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	720					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					GTCGGTCTCAGACTGCAGCAG	0.662																																							uc002zqz.2		NA																	0				liver(1)	1						c.(2158-2160)TCT>TGT		armadillo repeat protein							90.0	78.0	82.0					22																	19961246		2203	4300	6503	SO:0001583	missense	421				cell adhesion|multicellular organismal development		protein binding	g.chr22:19961246G>C		CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.2159C>G	22.37:g.19961246G>C	ENSP00000263207:p.Ser720Cys					ARVCF_uc002zqy.2_Missense_Mutation_p.S236C	p.S720C	NM_001670	NP_001661	O00192	ARVC_HUMAN			13	2430	-	Colorectal(54;0.0993)		720			ARM 8.		B7WNV2	Missense_Mutation	SNP	ENST00000263207.3	37	c.2159C>G	CCDS13771.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112275	0.77210	.	.	ENSG00000099889	ENST00000263207;ENST00000344269;ENST00000401994;ENST00000406522;ENST00000406259	T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5	4.66	3.64	0.41730	Armadillo-like helical (1);Armadillo-type fold (1);	0.056915	0.64402	D	0.000001	T	0.69602	0.3129	M	0.73598	2.24	0.54753	D	0.999981	D;D	0.89917	0.999;1.0	D;D	0.87578	0.96;0.998	T	0.71230	-0.4654	9	.	.	.	-21.0227	12.3096	0.54922	0.0847:0.0:0.9153:0.0	.	720;236	O00192;E7EV58	ARVC_HUMAN;.	C	720;657;657;651;714	ENSP00000263207:S720C;ENSP00000342042:S657C;ENSP00000384341:S657C;ENSP00000384732:S651C;ENSP00000385444:S714C	.	S	-	2	0	ARVCF	18341246	0.987000	0.35691	0.816000	0.32577	0.984000	0.73092	1.913000	0.39956	1.317000	0.45149	0.491000	0.48974	TCT		0.662	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075314.5	NM_001670		5	71	0	0	0	0.001168	0	5	71				
SLC2A11	66035	broad.mit.edu	37	22	24226953	24226953	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr22:24226953G>A	ENST00000345044.6	+	12	1676	c.1408G>A	c.(1408-1410)Gaa>Aaa	p.E470K	SLC2A11_ENST00000316185.8_Missense_Mutation_p.E473K|AP000350.10_ENST00000433835.3_Intron|SLC2A11_ENST00000398356.2_Missense_Mutation_p.E477K			Q9BYW1	GTR11_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 11	470					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(2)	12						GATCTCCAAGGAATTACACAG	0.562																																							uc002zyn.3		NA																	0				ovary(1)	1						c.(1408-1410)GAA>AAA		glucose transporter protein 10 isoform c							116.0	106.0	109.0					22																	24226953		2203	4300	6503	SO:0001583	missense	66035					integral to membrane|plasma membrane	sugar transmembrane transporter activity	g.chr22:24226953G>A	AJ271290	CCDS13818.1, CCDS33616.1, CCDS46673.1, CCDS74828.1	22q11.23	2013-05-22			ENSG00000133460	ENSG00000133460		"""Solute carriers"""	14239	protein-coding gene	gene with protein product		610367					Standard	NM_001024938		Approved	GLUT11, GLUT10	uc002zyp.4	Q9BYW1	OTTHUMG00000166469	ENST00000345044.6:c.1408G>A	22.37:g.24226953G>A	ENSP00000342542:p.Glu470Lys					SLC2A11_uc002zym.3_Missense_Mutation_p.E477K|SLC2A11_uc002zyo.3_RNA|SLC2A11_uc011ajc.1_Silent_p.R476R|SLC2A11_uc002zyp.3_Missense_Mutation_p.E473K	p.E470K	NM_001024938	NP_001020109	Q9BYW1	GTR11_HUMAN			12	1507	+			470			Cytoplasmic (Potential).		E9PH55|Q542Y4|Q6ICJ5|Q8WXF9|Q8WYM4	Missense_Mutation	SNP	ENST00000345044.6	37	c.1408G>A	CCDS46673.1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.311749	0.23821	.	.	ENSG00000133460	ENST00000345044;ENST00000398356;ENST00000316185	T;T;T	0.79554	-1.27;-1.27;-1.28	3.25	3.25	0.37280	Major facilitator superfamily domain, general substrate transporter (1);	0.236920	0.41712	D	0.000824	D	0.86527	0.5954	M	0.79475	2.455	0.44880	D	0.997892	D;P;D	0.76494	0.998;0.952;0.999	D;P;D	0.73708	0.967;0.792;0.981	D	0.84146	0.0420	10	0.07030	T	0.85	.	14.3177	0.66463	0.0:0.0:1.0:0.0	.	473;470;477	Q9BYW1-3;Q9BYW1;E9PH55	.;GTR11_HUMAN;.	K	470;477;473	ENSP00000342542:E470K;ENSP00000381399:E477K;ENSP00000326748:E473K	ENSP00000326748:E473K	E	+	1	0	SLC2A11	22556953	1.000000	0.71417	0.033000	0.17914	0.060000	0.15804	5.863000	0.69568	2.149000	0.67028	0.603000	0.83216	GAA		0.562	SLC2A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319889.3	NM_030807		21	59	0	0	0	0.008871	0	21	59				
RFPL1	5988	broad.mit.edu	37	22	29837589	29837589	+	Silent	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr22:29837589C>A	ENST00000354373.2	+	2	641	c.432C>A	c.(430-432)ctC>ctA	p.L144L	RFPL1S_ENST00000461286.3_RNA|RFPL1S_ENST00000539579.1_RNA	NM_021026.2	NP_066306.2	O75677	RFPL1_HUMAN	ret finger protein-like 1	144	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(1)|lung(6)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	16						CTGACGACCTCAGGAGCGTCC	0.502																																							uc003afn.2		NA																	0					0						c.(430-432)CTC>CTA		ret finger protein-like 1							125.0	109.0	114.0					22																	29837589		2203	4300	6503	SO:0001819	synonymous_variant	5988						zinc ion binding	g.chr22:29837589C>A	AJ010228	CCDS13857.2	22q12	2006-04-25			ENSG00000128250	ENSG00000128250		"""RING-type (C3HC4) zinc fingers"""	9977	protein-coding gene	gene with protein product		605968				10508838	Standard	NM_021026		Approved	RNF78	uc003afn.3	O75677	OTTHUMG00000150516	ENST00000354373.2:c.432C>A	22.37:g.29837589C>A						RFPL1S_uc003afm.1_RNA	p.L144L	NM_021026	NP_066306	O75677	RFPL1_HUMAN			2	641	+			144			B30.2/SPRY.		Q6IC06|Q9UJ97	Silent	SNP	ENST00000354373.2	37	c.432C>A	CCDS13857.2																																																																																				0.502	RFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318719.1	NM_021026		23	90	1	0	1.17739e-12	0.005443	1.36341e-12	23	90				
SF3A1	10291	broad.mit.edu	37	22	30740986	30740986	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr22:30740986T>C	ENST00000215793.8	-	4	741	c.587A>G	c.(586-588)gAc>gGc	p.D196G	SF3A1_ENST00000439242.1_Missense_Mutation_p.D131G	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	196					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						GCGGAGAAAGTCAAACTGGTA	0.572																																							uc003ahl.2		NA																	0				ovary(3)|large_intestine(1)|pancreas(1)	5						c.(586-588)GAC>GGC		splicing factor 3a, subunit 1, 120kDa isoform 1							160.0	143.0	149.0					22																	30740986		2203	4300	6503	SO:0001583	missense	10291				nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|U2-type spliceosomal complex	protein binding|RNA binding	g.chr22:30740986T>C	X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.587A>G	22.37:g.30740986T>C	ENSP00000215793:p.Asp196Gly						p.D196G	NM_005877	NP_005868	Q15459	SF3A1_HUMAN			4	719	-			196			SURP motif 2.		E9PAW1	Missense_Mutation	SNP	ENST00000215793.8	37	c.587A>G	CCDS13875.1	.	.	.	.	.	.	.	.	.	.	T	18.91	3.724320	0.68959	.	.	ENSG00000099995	ENST00000439242;ENST00000215793;ENST00000536049	T;T	0.46063	0.88;0.88	5.28	5.28	0.74379	SWAP/Surp (3);	0.000000	0.85682	D	0.000000	T	0.65491	0.2696	M	0.78801	2.425	0.42380	D	0.992487	D	0.69078	0.997	D	0.77004	0.989	T	0.69859	-0.5031	10	0.59425	D	0.04	-27.5207	15.3678	0.74538	0.0:0.0:0.0:1.0	.	196	Q15459	SF3A1_HUMAN	G	131;196;93	ENSP00000390336:D131G;ENSP00000215793:D196G	ENSP00000215793:D196G	D	-	2	0	SF3A1	29070986	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.763000	0.85283	2.219000	0.72066	0.533000	0.62120	GAC		0.572	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320916.2	NM_005877		59	61	0	0	0	0.01441	0	59	61				
H1F0	3005	broad.mit.edu	37	22	38201558	38201558	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr22:38201558G>C	ENST00000340857.2	+	1	445	c.7G>C	c.(7-9)Gag>Cag	p.E3Q	GCAT_ENST00000323205.6_5'Flank|GCAT_ENST00000248924.6_5'Flank	NM_005318.3	NP_005309.1	P07305	H10_HUMAN	H1 histone family, member 0	3					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|nucleosome assembly (GO:0006334)	actin cytoskeleton (GO:0015629)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(2)|prostate(2)|urinary_tract(1)	7	Melanoma(58;0.045)					CACCATGACCGAGAATTCCAC	0.627																																					NSCLC(191;1872 2984 30230 41544)|Esophageal Squamous(4;11 371 39444 52196)	NSCLC(191;1872 2984 30230 41544)|Esophageal Squamous(4;11 371 39444 52196)	uc003aty.2		NA																	0					0						c.(7-9)GAG>CAG		H1 histone family, member 0							43.0	43.0	43.0					22																	38201558		2203	4300	6503	SO:0001583	missense	3005				DNA fragmentation involved in apoptotic nuclear change|nucleosome assembly	actin cytoskeleton|Golgi apparatus|nucleoplasm|nucleosome	DNA binding	g.chr22:38201558G>C	X03473	CCDS13956.1	22q13.1	2011-01-27			ENSG00000189060	ENSG00000189060		"""Histones / Replication-independent"""	4714	protein-coding gene	gene with protein product	"""H1.0, H1(0), H1-0"""	142708		H1FV		3084796	Standard	NM_005318		Approved	H10	uc003aty.3	P07305	OTTHUMG00000150659	ENST00000340857.2:c.7G>C	22.37:g.38201558G>C	ENSP00000344504:p.Glu3Gln					GCAT_uc003atz.2_5'Flank|GCAT_uc003aua.1_5'Flank	p.E3Q	NM_005318	NP_005309	P07305	H10_HUMAN			1	445	+	Melanoma(58;0.045)		3					B2R6I0|B4DRD6|Q6FG88|Q8N6R3	Missense_Mutation	SNP	ENST00000340857.2	37	c.7G>C	CCDS13956.1	.	.	.	.	.	.	.	.	.	.	N	15.52	2.857678	0.51376	.	.	ENSG00000189060	ENST00000340857;ENST00000455466	T	0.05649	3.41	5.26	3.19	0.36642	.	0.062124	0.64402	D	0.000007	T	0.06005	0.0156	L	0.43923	1.385	0.43399	D	0.995526	P	0.39601	0.68	B	0.31547	0.132	T	0.30880	-0.9963	10	0.72032	D	0.01	.	11.8412	0.52355	0.142:0.0:0.858:0.0	.	3	P07305	H10_HUMAN	Q	3	ENSP00000344504:E3Q	ENSP00000344504:E3Q	E	+	1	0	H1F0	36531504	1.000000	0.71417	0.994000	0.49952	0.748000	0.42578	8.738000	0.91569	0.739000	0.32628	-0.141000	0.14075	GAG		0.627	H1F0-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319453.1	NM_005318		8	33	0	0	0	0.00308	0	8	33				
GCAT	23464	broad.mit.edu	37	22	38211274	38211274	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr22:38211274G>T	ENST00000248924.6	+	5	774	c.718G>T	c.(718-720)Ggg>Tgg	p.G240W	GCAT_ENST00000323205.6_Missense_Mutation_p.G266W	NM_014291.3	NP_055106.1	O75600	KBL_HUMAN	glycine C-acetyltransferase	240					biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|L-threonine catabolic process to glycine (GO:0019518)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	glycine C-acetyltransferase activity (GO:0008890)|pyridoxal phosphate binding (GO:0030170)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	12	Melanoma(58;0.045)				Glycine(DB00145)	TGGCTTCCTGGGGCCCACAGG	0.617																																							uc003atz.2		NA																	0					0						c.(718-720)GGG>TGG		glycine C-acetyltransferase precursor	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)						33.0	30.0	31.0					22																	38211274		2203	4300	6503	SO:0001583	missense	23464				biosynthetic process|cellular amino acid metabolic process		glycine C-acetyltransferase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups	g.chr22:38211274G>T	AF077740	CCDS13957.1, CCDS54527.1	22q13.1	2010-01-19	2010-01-19		ENSG00000100116	ENSG00000100116	2.3.1.29		4188	protein-coding gene	gene with protein product	"""2-amino-3-ketobutyrate coenzyme A ligase"""	607422	"""glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase)"""				Standard	NM_014291		Approved	KBL	uc003aua.2	O75600	OTTHUMG00000150664	ENST00000248924.6:c.718G>T	22.37:g.38211274G>T	ENSP00000248924:p.Gly240Trp					GCAT_uc003aua.1_Missense_Mutation_p.G266W	p.G240W	NM_014291	NP_055106	O75600	KBL_HUMAN			5	738	+	Melanoma(58;0.045)		240					E2QC23|Q6ZWF1|Q96CA9	Missense_Mutation	SNP	ENST00000248924.6	37	c.718G>T	CCDS13957.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.313433	0.81358	.	.	ENSG00000100116	ENST00000323205;ENST00000248924	D;D	0.93763	-3.28;-3.28	4.68	4.68	0.58851	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.048187	0.85682	D	0.000000	D	0.98529	0.9509	H	0.99847	4.84	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99671	1.0996	10	0.87932	D	0	-22.0061	17.778	0.88515	0.0:0.0:1.0:0.0	.	266;240	E2QC23;O75600	.;KBL_HUMAN	W	266;240	ENSP00000371110:G266W;ENSP00000248924:G240W	ENSP00000248924:G240W	G	+	1	0	GCAT	36541220	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.696000	0.91302	2.440000	0.82611	0.561000	0.74099	GGG		0.617	GCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319506.1	NM_014291.2		4	24	1	0	1.23904e-05	0.000602	1.32442e-05	4	24				
TNFRSF13C	115650	broad.mit.edu	37	22	42321413	42321413	+	Silent	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr22:42321413A>G	ENST00000291232.3	-	3	557	c.513T>C	c.(511-513)acT>acC	p.T171T	CTA-250D10.23_ENST00000566575.1_lincRNA|MIR378I_ENST00000582688.1_RNA	NM_052945.3	NP_443177.1	Q96RJ3	TR13C_HUMAN	tumor necrosis factor receptor superfamily, member 13C	171					B cell costimulation (GO:0031296)|B cell homeostasis (GO:0001782)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of germinal center formation (GO:0002636)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				lung(2)|urinary_tract(1)	3						TCACCAGTTCAGTGGAGCCCA	0.677																																							uc003bbl.2		NA																	0					0						c.(511-513)ACT>ACC		BAFF receptor							35.0	37.0	36.0					22																	42321413		2202	4300	6502	SO:0001819	synonymous_variant	115650					integral to membrane	receptor activity	g.chr22:42321413A>G	AF373846	CCDS14024.1	22q13.1-q13.3	2014-09-17			ENSG00000159958	ENSG00000159958		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	17755	protein-coding gene	gene with protein product		606269				11509692	Standard	NM_052945		Approved	BAFFR, CD268	uc003bbl.2	Q96RJ3	OTTHUMG00000151271	ENST00000291232.3:c.513T>C	22.37:g.42321413A>G						WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|TNFRSF13C_uc010gyp.1_Silent_p.T172T	p.T171T	NM_052945	NP_443177	Q96RJ3	TR13C_HUMAN			3	557	-			171			Cytoplasmic (Potential).			Silent	SNP	ENST00000291232.3	37	c.513T>C	CCDS14024.1																																																																																				0.677	TNFRSF13C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322046.1			19	24	0	0	0	0.014323	0	19	24				
WBP2NL	164684	broad.mit.edu	37	22	42418274	42418274	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr22:42418274G>C	ENST00000328823.9	+	5	459	c.428G>C	c.(427-429)aGa>aCa	p.R143T	WBP2NL_ENST00000543212.1_Missense_Mutation_p.R69T	NM_152613.2	NP_689826.2	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like	143					egg activation (GO:0007343)|male pronucleus assembly (GO:0035039)|meiotic nuclear division (GO:0007126)	perinuclear theca (GO:0033011)	WW domain binding (GO:0050699)			breast(2)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)	14						TTTCCACTTAGAACCTTAAAT	0.383																																							uc011ape.1		NA																	0				ovary(2)	2						c.(427-429)AGA>ACA		WBP2 N-terminal like							128.0	123.0	124.0					22																	42418274		2203	4300	6503	SO:0001583	missense	164684				egg activation|male pronucleus assembly|meiosis	perinuclear theca	WW domain binding	g.chr22:42418274G>C	BC022546	CCDS14029.1	22q13.2	2007-07-18			ENSG00000183066	ENSG00000183066			28389	protein-coding gene	gene with protein product	"""postacrosomal sheath WW domain-binding protein"""	610981				17289678	Standard	NM_152613		Approved	FLJ26145, MGC26816, PAWP	uc003bbt.3	Q6ICG8	OTTHUMG00000151270	ENST00000328823.9:c.428G>C	22.37:g.42418274G>C	ENSP00000332983:p.Arg143Thr					WBP2NL_uc003bbt.2_Missense_Mutation_p.R143T|WBP2NL_uc011apk.1_Missense_Mutation_p.R15T|WBP2NL_uc003bbu.2_RNA|WBP2NL_uc003bbv.1_RNA	p.R143T	NM_152613	NP_689826	Q6ICG8	WBP2L_HUMAN			6	444	+			143					A3KFF7|A8MSG5|B3KXX4|Q8TBF0|Q8TBF3	Missense_Mutation	SNP	ENST00000328823.9	37	c.428G>C	CCDS14029.1	.	.	.	.	.	.	.	.	.	.	G	7.171	0.587618	0.13812	.	.	ENSG00000183066	ENST00000328823;ENST00000543212	T;T	0.29655	1.56;1.56	3.35	2.33	0.28932	WW-domain-binding protein (1);	0.973813	0.08349	N	0.959604	T	0.23766	0.0575	L	0.43152	1.355	0.09310	N	1	P	0.37176	0.586	B	0.37015	0.239	T	0.16660	-1.0395	10	0.14656	T	0.56	-1.5282	6.624	0.22818	0.1311:0.0:0.8689:0.0	.	143	Q6ICG8	WBP2L_HUMAN	T	143;69	ENSP00000332983:R143T;ENSP00000442447:R69T	ENSP00000332983:R143T	R	+	2	0	WBP2NL	40748220	0.143000	0.22626	0.007000	0.13788	0.278000	0.26855	1.502000	0.35704	0.985000	0.38656	0.650000	0.86243	AGA		0.383	WBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322037.1	NM_152613		20	84	0	0	0	0.012319	0	20	84				
POLDIP3	84271	broad.mit.edu	37	22	42991591	42991591	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr22:42991591C>T	ENST00000252115.5	-	6	947	c.843G>A	c.(841-843)aaG>aaA	p.K281K	POLDIP3_ENST00000491021.1_5'UTR|POLDIP3_ENST00000451060.2_Silent_p.K125K|POLDIP3_ENST00000348657.2_Silent_p.K252K|POLDIP3_ENST00000339677.6_Intron	NM_032311.3	NP_115687.2	Q9BY77	PDIP3_HUMAN	polymerase (DNA-directed), delta interacting protein 3	281	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)	16						TCACAGTCATCTTGGTGCCTT	0.468																																					Ovarian(52;967 1128 5875 19997 42537)	Ovarian(52;967 1128 5875 19997 42537)	uc003bcu.2		NA																	0					0						c.(841-843)AAG>AAA		DNA polymerase delta interacting protein 3							155.0	126.0	136.0					22																	42991591		2203	4300	6503	SO:0001819	synonymous_variant	84271				positive regulation of translation	cytoplasm|nuclear speck	nucleotide binding|protein binding|RNA binding	g.chr22:42991591C>T		CCDS14038.1, CCDS14039.1, CCDS74873.1	22q13.31	2013-02-12			ENSG00000100227	ENSG00000100227		"""RNA binding motif (RRM) containing"""	23782	protein-coding gene	gene with protein product		611520				12522211	Standard	NM_032311		Approved	PDIP46, KIAA1649	uc003bcu.3	Q9BY77	OTTHUMG00000150887	ENST00000252115.5:c.843G>A	22.37:g.42991591C>T						POLDIP3_uc011app.1_Silent_p.K202K|POLDIP3_uc003bcv.2_Silent_p.K252K|POLDIP3_uc011apq.1_Silent_p.K298K|POLDIP3_uc010gza.2_RNA|POLDIP3_uc011apr.1_RNA|POLDIP3_uc010gzb.1_Intron	p.K281K	NM_032311	NP_115687	Q9BY77	PDIP3_HUMAN			6	942	-			281			RRM.		A8K6F8|A8K6V9|Q009A7|Q5H972|Q6PGN6|Q7Z6Z0|Q9NSP5|Q9NSP6	Silent	SNP	ENST00000252115.5	37	c.843G>A	CCDS14038.1																																																																																				0.468	POLDIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320433.1	NM_032311		6	48	0	0	0	0.001168	0	6	48				
PACSIN2	11252	broad.mit.edu	37	22	43287087	43287087	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr22:43287087C>T	ENST00000263246.3	-	4	520	c.319G>A	c.(319-321)Gat>Aat	p.D107N	PACSIN2_ENST00000403744.3_Missense_Mutation_p.D107N|PACSIN2_ENST00000402229.1_Missense_Mutation_p.D107N|PACSIN2_ENST00000407585.1_Missense_Mutation_p.D107N|PACSIN2_ENST00000337959.4_Missense_Mutation_p.D107N	NM_001184970.1	NP_001171899.1	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in neurons 2	107	F-BAR domain.				actin cytoskeleton organization (GO:0030036)|caveola assembly (GO:0070836)|caveolin-mediated endocytosis (GO:0072584)|cell projection morphogenesis (GO:0048858)|membrane tubulation (GO:0097320)|negative regulation of endocytosis (GO:0045806)|protein localization to endosome (GO:0036010)	caveola (GO:0005901)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	19		Glioma(61;0.222)				TCGAAGTCATCGTTCATCAGT	0.572																																							uc010gzg.2		NA																	0					0						c.(319-321)GAT>AAT		protein kinase C and casein kinase substrate in							85.0	84.0	85.0					22																	43287087		2177	4290	6467	SO:0001583	missense	11252				actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity	g.chr22:43287087C>T	AF128536	CCDS43023.1, CCDS54536.1	22q13.2-q13.33	2009-05-08			ENSG00000100266	ENSG00000100266			8571	protein-coding gene	gene with protein product	"""syndapin II"""	604960				10431838, 11082044	Standard	NM_007229		Approved	SDPII	uc003bdg.4	Q9UNF0	OTTHUMG00000150701	ENST00000263246.3:c.319G>A	22.37:g.43287087C>T	ENSP00000263246:p.Asp107Asn					PACSIN2_uc003bdg.3_Missense_Mutation_p.D107N|PACSIN2_uc003bde.3_Missense_Mutation_p.D107N|PACSIN2_uc003bdf.3_Missense_Mutation_p.D107N	p.D107N	NM_007229	NP_009160	Q9UNF0	PACN2_HUMAN			4	541	-		Glioma(61;0.222)	107					O95921|Q96HV9|Q9H0D3|Q9NPN1|Q9Y4V2	Missense_Mutation	SNP	ENST00000263246.3	37	c.319G>A	CCDS43023.1	.	.	.	.	.	.	.	.	.	.	C	15.33	2.802196	0.50315	.	.	ENSG00000100266	ENST00000263246;ENST00000337959;ENST00000407585;ENST00000403744;ENST00000402229;ENST00000453643;ENST00000418133;ENST00000422336	T;T;T;T;T;T;T;T	0.44881	2.51;2.51;2.51;2.51;2.51;0.91;0.91;0.91	4.81	3.79	0.43588	.	0.151282	0.56097	D	0.000021	T	0.39809	0.1092	M	0.62723	1.935	0.41603	D	0.988869	B;B	0.26975	0.095;0.165	B;B	0.18871	0.023;0.023	T	0.40459	-0.9562	10	0.49607	T	0.09	-3.5806	13.4956	0.61424	0.0:0.9243:0.0:0.0757	.	107;107	Q6FIA3;Q9UNF0	.;PACN2_HUMAN	N	107	ENSP00000263246:D107N;ENSP00000338379:D107N;ENSP00000385952:D107N;ENSP00000385372:D107N;ENSP00000385040:D107N;ENSP00000398573:D107N;ENSP00000396816:D107N;ENSP00000403435:D107N	ENSP00000263246:D107N	D	-	1	0	PACSIN2	41617031	1.000000	0.71417	0.964000	0.40570	0.397000	0.30659	4.741000	0.62095	1.409000	0.46915	0.542000	0.68232	GAT		0.572	PACSIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319665.1	NM_007229		11	41	0	0	0	0.013537	0	11	41				
PKDREJ	10343	broad.mit.edu	37	22	46655967	46655967	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr22:46655967G>A	ENST00000253255.5	-	1	3252	c.3253C>T	c.(3253-3255)Cgt>Tgt	p.R1085C		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1085					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)	p.R1085C(1)		NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		ATGACAAAACGAGGTGCCTGC	0.502																																							uc003bhh.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	breast(3)|ovary(2)	5						c.(3253-3255)CGT>TGT		receptor for egg jelly-like protein precursor							62.0	56.0	58.0					22																	46655967		2203	4300	6503	SO:0001583	missense	10343				acrosome reaction|neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity	g.chr22:46655967G>A	AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.3253C>T	22.37:g.46655967G>A	ENSP00000253255:p.Arg1085Cys						p.R1085C	NM_006071	NP_006062	Q9NTG1	PKDRE_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)	1	3253	-		Ovarian(80;0.00965)|all_neural(38;0.0416)	1085			Extracellular (Potential).		B1AJY3|O95850	Missense_Mutation	SNP	ENST00000253255.5	37	c.3253C>T	CCDS14073.1	.	.	.	.	.	.	.	.	.	.	G	9.641	1.138986	0.21123	.	.	ENSG00000130943	ENST00000253255	T	0.37411	1.2	5.2	1.79	0.24919	.	0.740118	0.12898	N	0.430054	T	0.33673	0.0871	M	0.61703	1.905	0.09310	N	1	D	0.61697	0.99	B	0.43809	0.432	T	0.15838	-1.0423	10	0.38643	T	0.18	-2.0166	6.6372	0.22889	0.1176:0.0:0.5874:0.295	.	1085	Q9NTG1	PKDRE_HUMAN	C	1085	ENSP00000253255:R1085C	ENSP00000253255:R1085C	R	-	1	0	PKDREJ	45034631	0.003000	0.15002	0.001000	0.08648	0.023000	0.10783	1.249000	0.32839	0.660000	0.30964	-0.538000	0.04264	CGT		0.502	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071		7	31	0	0	0	0.00308	0	7	31				
CELSR1	9620	broad.mit.edu	37	22	46787649	46787649	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr22:46787649G>C	ENST00000262738.3	-	15	6028	c.6029C>G	c.(6028-6030)tCc>tGc	p.S2010C		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2010	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.|Laminin EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00460}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GCGGCTGTGGGAGCCATGGGG	0.632																																							uc003bhw.1		NA																	0				lung(4)|breast(4)|pancreas(2)|skin(1)	11						c.(6028-6030)TCC>TGC		cadherin EGF LAG seven-pass G-type receptor 1							30.0	37.0	35.0					22																	46787649		2202	4300	6502	SO:0001583	missense	9620				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity	g.chr22:46787649G>C	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.6029C>G	22.37:g.46787649G>C	ENSP00000262738:p.Ser2010Cys					CELSR1_uc011arc.1_Missense_Mutation_p.S331C	p.S2010C	NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)	15	6029	-		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)	2010			Extracellular (Potential).|Laminin EGF-like.|EGF-like 8; calcium-binding.		O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	c.6029C>G	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	G	18.25	3.582380	0.65992	.	.	ENSG00000075275	ENST00000262738	T	0.65916	-0.18	4.43	4.43	0.53597	EGF-like, laminin (3);	0.189717	0.34853	U	0.003640	D	0.88422	0.6432	H	0.99573	4.635	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	D	0.93938	0.7220	10	0.87932	D	0	.	16.6568	0.85230	0.0:0.0:1.0:0.0	.	331;2010	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	C	2010	ENSP00000262738:S2010C	ENSP00000262738:S2010C	S	-	2	0	CELSR1	45166313	1.000000	0.71417	1.000000	0.80357	0.429000	0.31625	9.116000	0.94341	2.023000	0.59567	0.462000	0.41574	TCC		0.632	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246		4	20	0	0	0	0.009096	0	4	20				
CELSR1	9620	broad.mit.edu	37	22	46806436	46806436	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr22:46806436G>C	ENST00000262738.3	-	7	4791	c.4792C>G	c.(4792-4794)Cta>Gta	p.L1598V		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1598	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CCCAGGAGTAGAGGGCCGGTC	0.637																																							uc003bhw.1		NA																	0				lung(4)|breast(4)|pancreas(2)|skin(1)	11						c.(4792-4794)CTA>GTA		cadherin EGF LAG seven-pass G-type receptor 1							57.0	54.0	55.0					22																	46806436		2203	4300	6503	SO:0001583	missense	9620				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity	g.chr22:46806436G>C	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.4792C>G	22.37:g.46806436G>C	ENSP00000262738:p.Leu1598Val					CELSR1_uc011arc.1_5'Flank	p.L1598V	NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)	7	4792	-		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)	1598			Extracellular (Potential).|Laminin G-like 1.		O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	c.4792C>G	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.833579	0.50951	.	.	ENSG00000075275	ENST00000262738	T	0.80909	-1.43	4.73	4.73	0.59995	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.52532	U	0.000061	D	0.85712	0.5760	M	0.65677	2.01	0.80722	D	1	D	0.59767	0.986	D	0.64877	0.93	D	0.85161	0.0992	10	0.44086	T	0.13	.	9.5634	0.39383	0.1378:0.0:0.8622:0.0	.	1598	Q9NYQ6	CELR1_HUMAN	V	1598	ENSP00000262738:L1598V	ENSP00000262738:L1598V	L	-	1	2	CELSR1	45185100	1.000000	0.71417	0.830000	0.32933	0.265000	0.26407	3.522000	0.53480	2.178000	0.69098	0.655000	0.94253	CTA		0.637	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246		15	39	0	0	0	0.003163	0	15	39				
MOV10L1	54456	broad.mit.edu	37	22	50591507	50591507	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr22:50591507G>A	ENST00000262794.5	+	22	3009	c.2926G>A	c.(2926-2928)Gag>Aag	p.E976K	MOV10L1_ENST00000540615.1_Missense_Mutation_p.E956K|MOV10L1_ENST00000395843.1_Missense_Mutation_p.E19K|MOV10L1_ENST00000545383.1_Missense_Mutation_p.E976K|MOV10L1_ENST00000395852.1_Missense_Mutation_p.E103K|MOV10L1_ENST00000395858.3_Missense_Mutation_p.E976K|MOV10L1_ENST00000354853.2_Missense_Mutation_p.E19K	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	976					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		CCGGTCCCACGAGGCCCTGCT	0.587																																							uc003bjj.2		NA																	0				ovary(2)|skin(1)	3						c.(2926-2928)GAG>AAG		MOV10-like 1 isoform 1							142.0	139.0	140.0					22																	50591507		2203	4300	6503	SO:0001583	missense	54456				germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding	g.chr22:50591507G>A	AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.2926G>A	22.37:g.50591507G>A	ENSP00000262794:p.Glu976Lys					MOV10L1_uc003bjk.3_Missense_Mutation_p.E976K|MOV10L1_uc011arp.1_Missense_Mutation_p.E956K|MOV10L1_uc003bjl.2_Missense_Mutation_p.E103K|MOV10L1_uc003bjm.1_Missense_Mutation_p.E19K	p.E976K	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)	22	3009	+		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)	976					A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Missense_Mutation	SNP	ENST00000262794.5	37	c.2926G>A	CCDS14084.1	.	.	.	.	.	.	.	.	.	.	.	8.503	0.864798	0.17250	.	.	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000395858;ENST00000395843;ENST00000540615;ENST00000395852;ENST00000354853	D;D;D;D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54;-1.54;-1.54;-1.54	4.97	1.54	0.23209	.	0.633895	0.17651	N	0.166661	T	0.68705	0.3030	L	0.35593	1.075	0.20307	N	0.999919	B;B;B;B;B	0.24258	0.1;0.02;0.006;0.071;0.071	B;B;B;B;B	0.21360	0.02;0.009;0.005;0.034;0.034	T	0.56056	-0.8042	10	0.44086	T	0.13	-2.0777	9.6966	0.40161	0.0:0.0737:0.5732:0.3531	.	956;19;103;976;976	F5H403;Q9BXT6-3;Q9BXT6-2;A8MXC6;Q9BXT6	.;.;.;.;M10L1_HUMAN	K	976;976;976;19;956;103;19	ENSP00000438978:E976K;ENSP00000262794:E976K;ENSP00000379199:E976K;ENSP00000379184:E19K;ENSP00000438542:E956K;ENSP00000379193:E103K;ENSP00000346917:E19K	ENSP00000262794:E976K	E	+	1	0	MOV10L1	48933634	0.997000	0.39634	0.493000	0.27502	0.141000	0.21300	0.459000	0.21908	-0.046000	0.13446	0.462000	0.41574	GAG		0.587	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	NM_018995		21	73	0	0	0	0.010504	0	21	73				
SYN2	6854	broad.mit.edu	37	3	12046037	12046037	+	RNA	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr3:12046037C>T	ENST00000432424.2	+	0	158							Q92777	SYN2_HUMAN	synapsin II						neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(5)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	18						TGATGAACTTCCTGCGGCGCC	0.687																																							uc003bwm.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(10-12)TTC>TTT		synapsin II isoform IIa							6.0	8.0	7.0					3																	12046037		1871	4050	5921			6854				neurotransmitter secretion	synaptic vesicle	ATP binding|ligase activity	g.chr3:12046037C>T		CCDS74900.1, CCDS74901.1	3p25.2	2013-09-20			ENSG00000157152	ENSG00000157152			11495	protein-coding gene	gene with protein product		600755				8530057	Standard	XM_006713311		Approved	SYNII, SYNIIa, SYNIIb	uc003bwm.3	Q92777	OTTHUMG00000155335		3.37:g.12046037C>T						SYN2_uc003bwl.1_Silent_p.F4F	p.F4F	NM_133625	NP_598328	Q92777	SYN2_HUMAN			1	176	+			4					A8MY98	Silent	SNP	ENST00000432424.2	37	c.12C>T																																																																																					0.687	SYN2-002	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000339528.3	NM_133625		4	8	0	0	0	0.00308	0	4	8				
TSEN2	80746	broad.mit.edu	37	3	12531405	12531405	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr3:12531405G>C	ENST00000284995.6	+	2	493	c.106G>C	c.(106-108)Gaa>Caa	p.E36Q	TSEN2_ENST00000402228.3_Missense_Mutation_p.E36Q|TSEN2_ENST00000415684.1_Missense_Mutation_p.E36Q|TSEN2_ENST00000314571.7_Missense_Mutation_p.E36Q|TSEN2_ENST00000444864.1_Missense_Mutation_p.E36Q|TSEN2_ENST00000454502.2_Missense_Mutation_p.E36Q|TSEN2_ENST00000383797.5_Missense_Mutation_p.E36Q	NM_025265.3	NP_079541.1	Q8NCE0	SEN2_HUMAN	TSEN2 tRNA splicing endonuclease subunit	36					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)	19						TCCTCTGAAAGAATTCAAGAT	0.448																																							uc003bxc.2		NA																	0				central_nervous_system(1)	1						c.(106-108)GAA>CAA		tRNA-intron nuclease 2 isoform 1							111.0	106.0	108.0					3																	12531405		2203	4300	6503	SO:0001583	missense	80746				mRNA processing|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|nucleolus|tRNA-intron endonuclease complex	nucleic acid binding|tRNA-intron endonuclease activity	g.chr3:12531405G>C	BC019582	CCDS2611.1, CCDS46757.1, CCDS46758.1, CCDS46759.1	3p25.2	2013-08-06	2013-08-06		ENSG00000154743	ENSG00000154743		"""tRNA splicing endonuclease subunits"""	28422	protein-coding gene	gene with protein product		608753	"""tRNA splicing endonuclease 2 homolog (SEN2, S. cerevisiae)"", ""tRNA splicing endonuclease 2 homolog (S. cerevisiae)"""			15109492	Standard	NM_025265		Approved	SEN2, SEN2L, MGC2776	uc003bxb.3	Q8NCE0	OTTHUMG00000129765	ENST00000284995.6:c.106G>C	3.37:g.12531405G>C	ENSP00000284995:p.Glu36Gln					TSEN2_uc003bwy.2_Missense_Mutation_p.E36Q|TSEN2_uc003bwz.2_Missense_Mutation_p.E36Q|TSEN2_uc003bxa.2_Missense_Mutation_p.E36Q|TSEN2_uc011auq.1_Missense_Mutation_p.E36Q|TSEN2_uc003bxb.2_Missense_Mutation_p.E36Q|TSEN2_uc011aur.1_5'UTR	p.E36Q	NM_025265	NP_079541	Q8NCE0	SEN2_HUMAN			2	493	+			36					B7Z6K1|C9IZI7|G5E9Q3|Q8WTW7|Q9BPU7	Missense_Mutation	SNP	ENST00000284995.6	37	c.106G>C	CCDS2611.1	.	.	.	.	.	.	.	.	.	.	.	11.97	1.798412	0.31777	.	.	ENSG00000154743	ENST00000446004;ENST00000314571;ENST00000454502;ENST00000383797;ENST00000402228;ENST00000284995;ENST00000444864;ENST00000537959;ENST00000415684	T;T;T;T;T;T;T;T	0.57107	0.43;0.43;0.44;0.44;0.44;0.44;0.42;0.43	5.7	3.81	0.43845	.	0.521574	0.20172	N	0.097716	T	0.52853	0.1760	L	0.40543	1.245	0.09310	N	1	D;D;D;P	0.60160	0.987;0.974;0.973;0.863	P;P;P;B	0.59221	0.854;0.475;0.576;0.372	T	0.36915	-0.9728	10	0.20046	T	0.44	-8.0788	7.5949	0.28041	0.087:0.2508:0.6622:0.0	.	36;36;36;36	G5E9Q3;Q8NCE0;Q8NCE0-3;C9IZI7	.;SEN2_HUMAN;.;.	Q	36	ENSP00000406238:E36Q;ENSP00000323188:E36Q;ENSP00000392029:E36Q;ENSP00000373307:E36Q;ENSP00000385976:E36Q;ENSP00000284995:E36Q;ENSP00000407974:E36Q;ENSP00000416510:E36Q	ENSP00000284995:E36Q	E	+	1	0	TSEN2	12506405	0.440000	0.25618	0.005000	0.12908	0.012000	0.07955	1.766000	0.38491	1.414000	0.47017	0.655000	0.94253	GAA		0.448	TSEN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251981.1	NM_025265		13	64	0	0	0	0.001855	0	13	64				
TGFBR2	7048	broad.mit.edu	37	3	30713446	30713446	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr3:30713446G>C	ENST00000295754.5	+	4	1153	c.771G>C	c.(769-771)gaG>gaC	p.E257D	TGFBR2_ENST00000359013.4_Missense_Mutation_p.E282D	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	257	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						GCTTTGCTGAGGTCTATAAGG	0.517																																							uc003ceo.2		NA																	0				pancreas(9)|large_intestine(6)|stomach(4)|lung(3)|ovary(3)|central_nervous_system(1)	26						c.(769-771)GAG>GAC		transforming growth factor, beta receptor II							140.0	123.0	129.0					3																	30713446		2203	4300	6503	SO:0001583	missense	7048				activation of protein kinase activity|brain development|embryonic cranial skeleton morphogenesis|embryonic hemopoiesis|heart development|myeloid dendritic cell differentiation|palate development|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of B cell tolerance induction|positive regulation of mesenchymal cell proliferation|positive regulation of NK T cell differentiation|positive regulation of reactive oxygen species metabolic process|positive regulation of T cell tolerance induction|positive regulation of tolerance induction to self antigen|response to cholesterol|response to drug|transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|vasculogenesis	caveola|external side of plasma membrane	ATP binding|glycosaminoglycan binding|metal ion binding|protein binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type II|type I transforming growth factor beta receptor binding|type I transforming growth factor beta receptor binding|type III transforming growth factor beta receptor binding	g.chr3:30713446G>C		CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.771G>C	3.37:g.30713446G>C	ENSP00000295754:p.Glu257Asp					TGFBR2_uc003cen.2_Missense_Mutation_p.E282D	p.E257D	NM_003242	NP_003233	P37173	TGFR2_HUMAN			4	1153	+			257			Protein kinase.|Cytoplasmic (Potential).|ATP (By similarity).		B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	ENST00000295754.5	37	c.771G>C	CCDS2648.1	.	.	.	.	.	.	.	.	.	.	G	10.93	1.489643	0.26686	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000439925	T;T	0.66460	-0.21;-0.21	5.44	3.62	0.41486	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.045494	0.85682	D	0.000000	T	0.58566	0.2131	L	0.42686	1.345	0.58432	D	0.999994	B;B	0.28470	0.213;0.067	B;B	0.37943	0.261;0.261	T	0.52442	-0.8575	10	0.26408	T	0.33	.	7.3896	0.26903	0.3627:0.0:0.6373:0.0	.	257;282	P37173;D2JYI1	TGFR2_HUMAN;.	D	257;282;123	ENSP00000295754:E257D;ENSP00000351905:E282D	ENSP00000295754:E257D	E	+	3	2	TGFBR2	30688450	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.276000	0.51646	1.281000	0.44480	0.591000	0.81541	GAG		0.517	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2			8	53	0	0	0	0.004482	0	8	53				
MLH1	4292	broad.mit.edu	37	3	37053541	37053541	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr3:37053541G>A	ENST00000231790.2	+	8	844	c.628G>A	c.(628-630)Gcc>Acc	p.A210T	MLH1_ENST00000458205.2_5'UTR|MLH1_ENST00000536378.1_5'UTR|MLH1_ENST00000539477.1_5'UTR|MLH1_ENST00000455445.2_5'UTR|MLH1_ENST00000435176.1_Missense_Mutation_p.A112T	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	210					ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						ACTACCCAATGCCTCAACCGT	0.383		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														uc003cgl.2		1	yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	D|Mis|N|F|S	E.coli MutL homolog gene			"""E, O"""		colorectal|endometrial|ovarian|CNS	colorectal|endometrial|ovarian|CNS		1	Whole gene deletion(1)	p.0?(1)	ovary(1)	large_intestine(40)|haematopoietic_and_lymphoid_tissue(8)|ovary(6)|pancreas(5)|stomach(3)|central_nervous_system(3)|endometrium(3)|breast(3)|prostate(3)|skin(2)|NS(1)	77						c.(628-630)GCC>ACC	MMR	MutL protein homolog 1							148.0	137.0	141.0					3																	37053541		2203	4300	6503	SO:0001583	missense	4292	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	mismatch repair|somatic hypermutation of immunoglobulin genes	chiasma|MutLalpha complex|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|protein binding	g.chr3:37053541G>A	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.628G>A	3.37:g.37053541G>A	ENSP00000231790:p.Ala210Thr					MLH1_uc011aye.1_5'UTR|MLH1_uc011ayb.1_5'UTR|MLH1_uc010hge.2_Missense_Mutation_p.A210T|MLH1_uc003cgn.3_5'UTR|MLH1_uc011ayc.1_Missense_Mutation_p.A112T|MLH1_uc011ayd.1_5'UTR|MLH1_uc003cgo.2_5'UTR|MLH1_uc010hgg.1_5'UTR|MLH1_uc010hgh.1_5'UTR|MLH1_uc010hgi.1_5'UTR|MLH1_uc010hgj.1_5'UTR|MLH1_uc010hgk.2_5'UTR|MLH1_uc010hgl.1_5'Flank	p.A210T	NM_000249	NP_000240	P40692	MLH1_HUMAN			8	688	+			210					B4DI13|B4DQ11|E9PCU2	Missense_Mutation	SNP	ENST00000231790.2	37	c.628G>A	CCDS2663.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.1|28.1	4.886494|4.886494	0.91814|0.91814	.|.	.|.	ENSG00000076242|ENSG00000076242	ENST00000231790;ENST00000436867;ENST00000537937;ENST00000383761;ENST00000435176|ENST00000456676	D;D|.	0.89810|.	-2.57;-2.57|.	5.76|5.76	5.76|5.76	0.90799|0.90799	Ribosomal protein S5 domain 2-type fold (1);DNA mismatch repair protein, N-terminal (1);ATPase-like, ATP-binding domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71221|0.71221	0.3314|0.3314	L|L	0.50993|0.50993	1.605|1.605	0.80722|0.80722	D|D	1|1	B;B;B|.	0.24483|.	0.104;0.104;0.104|.	B;B;B|.	0.28916|.	0.065;0.096;0.04|.	T|T	0.66093|0.66093	-0.6009|-0.6009	10|5	0.39692|.	T|.	0.17|.	-16.2925|-16.2925	19.9576|19.9576	0.97228|0.97228	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	112;210;210|.	E9PCU2;Q53GX1;P40692|.	.;.;MLH1_HUMAN|.	T|I	210;176;176;74;112|201	ENSP00000231790:A210T;ENSP00000402564:A112T|.	ENSP00000231790:A210T|.	A|M	+|+	1|3	0|0	MLH1|MLH1	37028545|37028545	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.938000|0.938000	0.57974|0.57974	9.345000|9.345000	0.97053|0.97053	2.736000|2.736000	0.93811|0.93811	0.655000|0.655000	0.94253|0.94253	GCC|ATG		0.383	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253337.2	NM_000249		14	54	0	0	0	0.00499	0	14	54				
GOLGA4	2803	broad.mit.edu	37	3	37367527	37367527	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr3:37367527C>T	ENST00000361924.2	+	14	4524	c.4150C>T	c.(4150-4152)Caa>Taa	p.Q1384*	GOLGA4_ENST00000356847.4_Nonsense_Mutation_p.Q1406*|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	1384	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TGTTCAGCTTCAAAATAGCAT	0.343																																							uc003cgv.2		NA																	0				ovary(2)|breast(1)|central_nervous_system(1)	4						c.(4150-4152)CAA>TAA		golgi autoantigen, golgin subfamily a, 4							29.0	30.0	30.0					3																	37367527		2200	4299	6499	SO:0001587	stop_gained	2803				Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding	g.chr3:37367527C>T	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.4150C>T	3.37:g.37367527C>T	ENSP00000354486:p.Gln1384*					GOLGA4_uc010hgr.1_Nonsense_Mutation_p.Q945*|GOLGA4_uc003cgw.2_Nonsense_Mutation_p.Q1406*|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgx.2_Nonsense_Mutation_p.Q1265*	p.Q1384*	NM_002078	NP_002069	Q13439	GOGA4_HUMAN			14	4454	+			1384			Potential.|Glu-rich.		F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Nonsense_Mutation	SNP	ENST00000361924.2	37	c.4150C>T	CCDS2666.1	.	.	.	.	.	.	.	.	.	.	C	43	10.373383	0.99393	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	.	.	.	5.13	3.22	0.36961	.	0.237219	0.21875	N	0.067834	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	16.1135	0.81278	0.0:0.4614:0.5386:0.0	.	.	.	.	X	1384;1406;1255	.	ENSP00000349305:Q1406X	Q	+	1	0	GOLGA4	37342531	1.000000	0.71417	0.947000	0.38551	0.887000	0.51463	3.041000	0.49807	1.122000	0.41944	0.563000	0.77884	CAA		0.343	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078		9	28	0	0	0	0.004482	0	9	28				
EXOG	9941	broad.mit.edu	37	3	38537932	38537932	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr3:38537932T>C	ENST00000287675.5	+	1	170	c.74T>C	c.(73-75)gTa>gCa	p.V25A	EXOG_ENST00000422077.2_Missense_Mutation_p.V25A|EXOG_ENST00000358249.2_5'UTR	NM_005107.3	NP_005098.2	Q9Y2C4	EXOG_HUMAN	endo/exonuclease (5'-3'), endonuclease G-like	25					DNA catabolic process, endonucleolytic (GO:0000737)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			central_nervous_system(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	17						GCTGGGGCTGTAGTGGGCGCT	0.637											OREG0015479	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003cih.2		NA																	0					0						c.(73-75)GTA>GCA		endo/exonuclease (5'-3'), endonuclease G-like							43.0	44.0	44.0					3																	38537932		2203	4300	6503	SO:0001583	missense	9941					mitochondrial inner membrane	endonuclease activity|metal ion binding|nucleic acid binding	g.chr3:38537932T>C	AB020523	CCDS2680.1, CCDS46795.1	3p21.3	2010-05-07	2009-01-08	2009-01-08	ENSG00000157036	ENSG00000157036	3.1.30.-		3347	protein-coding gene	gene with protein product		604051	"""endonuclease G-like 1"", ""endonuclease G-like 2"""	ENDOGL1, ENDOGL2		10231028, 18187503	Standard	NM_005107		Approved	ENGL-a, ENGL, ENGL-b	uc003cih.2	Q9Y2C4	OTTHUMG00000131295	ENST00000287675.5:c.74T>C	3.37:g.38537932T>C	ENSP00000287675:p.Val25Ala		OREG0015479	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	879	EXOG_uc010hhg.2_RNA|EXOG_uc011ayq.1_Missense_Mutation_p.V25A|EXOG_uc003cij.2_5'UTR|EXOG_uc010hhd.2_5'UTR|EXOG_uc010hhe.2_5'UTR|EXOG_uc003cik.2_5'UTR|EXOG_uc010hhf.2_5'UTR|EXOG_uc003cii.2_5'UTR	p.V25A	NM_005107	NP_005098	Q9Y2C4	EXOG_HUMAN			1	170	+			25					A8K242|B4DVG2|Q3SXM9|Q9Y2C8	Missense_Mutation	SNP	ENST00000287675.5	37	c.74T>C	CCDS2680.1	.	.	.	.	.	.	.	.	.	.	T	11.20	1.569003	0.28003	.	.	ENSG00000157036	ENST00000287675;ENST00000422077	T;T	0.50813	0.99;0.73	5.04	-1.64	0.08318	.	0.683524	0.13532	N	0.380849	T	0.21921	0.0528	N	0.08118	0	0.20975	N	0.999817	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.14476	-1.0471	10	0.28530	T	0.3	-2.1321	6.9042	0.24299	0.0:0.4942:0.1593:0.3465	.	25;25	Q9Y2C4-4;Q9Y2C4	.;EXOG_HUMAN	A	25	ENSP00000287675:V25A;ENSP00000404305:V25A	ENSP00000287675:V25A	V	+	2	0	EXOG	38512936	0.009000	0.17119	0.009000	0.14445	0.056000	0.15407	-0.158000	0.10070	-0.437000	0.07243	0.533000	0.62120	GTA		0.637	EXOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254063.2	NM_005107		20	25	0	0	0	0.012319	0	20	25				
LRRC2	79442	broad.mit.edu	37	3	46574379	46574379	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr3:46574379C>G	ENST00000395905.3	-	5	903	c.511G>C	c.(511-513)Gaa>Caa	p.E171Q	LRRC2_ENST00000296144.3_Missense_Mutation_p.E171Q	NM_024512.4	NP_078788.2	Q9BYS8	LRRC2_HUMAN	leucine rich repeat containing 2	171								p.E171*(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	17		Ovarian(412;0.0563)		OV - Ovarian serous cystadenocarcinoma(275;6.37e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00133)|KIRC - Kidney renal clear cell carcinoma(197;0.0214)|Kidney(197;0.0254)		ACATTGAGTTCTTTCAGGTTC	0.348																																							uc010hji.2		NA																	1	Substitution - Nonsense(1)		large_intestine(1)	ovary(1)	1						c.(511-513)GAA>CAA		leucine rich repeat containing 2							93.0	93.0	93.0					3																	46574379		2203	4300	6503	SO:0001583	missense	79442							g.chr3:46574379C>G	AJ308569	CCDS2741.1	3p21.3	2014-07-30	2003-11-19		ENSG00000163827	ENSG00000163827			14676	protein-coding gene	gene with protein product		607180	"""leucine-rich repeat-containing 2"""			11896456	Standard	NM_024512		Approved		uc010hji.3	Q9BYS8	OTTHUMG00000133479	ENST00000395905.3:c.511G>C	3.37:g.46574379C>G	ENSP00000379241:p.Glu171Gln					LRRC2_uc003cpu.3_Missense_Mutation_p.E171Q	p.E171Q	NM_024512	NP_078788	Q9BYS8	LRRC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(275;6.37e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00133)|KIRC - Kidney renal clear cell carcinoma(197;0.0214)|Kidney(197;0.0254)	5	875	-		Ovarian(412;0.0563)	171			LRR 3.		B2RDQ7|Q96LT5	Missense_Mutation	SNP	ENST00000395905.3	37	c.511G>C	CCDS2741.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.540520	0.85917	.	.	ENSG00000163827	ENST00000395905;ENST00000296144	T;T	0.41400	1.0;1.0	5.41	5.41	0.78517	.	0.151910	0.44688	D	0.000438	T	0.55273	0.1910	L	0.41236	1.265	0.58432	D	0.999999	D	0.89917	1.0	D	0.75484	0.986	T	0.44112	-0.9349	10	0.28530	T	0.3	.	17.0743	0.86582	0.0:1.0:0.0:0.0	.	171	Q9BYS8	LRRC2_HUMAN	Q	171	ENSP00000379241:E171Q;ENSP00000296144:E171Q	ENSP00000296144:E171Q	E	-	1	0	LRRC2	46549383	1.000000	0.71417	0.997000	0.53966	0.930000	0.56654	6.912000	0.75753	2.707000	0.92482	0.563000	0.77884	GAA		0.348	LRRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257375.2			18	77	0	0	0	0.010504	0	18	77				
PTPN23	25930	broad.mit.edu	37	3	47453061	47453061	+	Missense_Mutation	SNP	C	C	T	rs146178681		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr3:47453061C>T	ENST00000265562.4	+	20	3850	c.3773C>T	c.(3772-3774)cCg>cTg	p.P1258L	PTPN23_ENST00000431726.1_Missense_Mutation_p.P1132L	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	1258	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)	p.P1258L(2)		breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TACTGCCCCCCGCTAGTGGCA	0.577													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19590	0.0		0.0	False		,,,				2504	0.0						uc003crf.1		NA																	2	Substitution - Missense(2)	p.P1258L(1)	skin(2)	breast(1)|central_nervous_system(1)|skin(1)	3						c.(3772-3774)CCG>CTG		protein tyrosine phosphatase, non-receptor type		C	LEU/PRO	5,4401	9.9+/-24.2	0,5,2198	50.0	46.0	48.0		3773	4.6	0.1	3	dbSNP_134	48	2,8598	2.2+/-6.3	0,2,4298	yes	missense	PTPN23	NM_015466.2	98	0,7,6496	TT,TC,CC		0.0233,0.1135,0.0538	probably-damaging	1258/1637	47453061	7,12999	2203	4300	6503	SO:0001583	missense	25930				cilium morphogenesis	cilium|cytoplasmic membrane-bounded vesicle|microtubule basal body	protein tyrosine phosphatase activity	g.chr3:47453061C>T	AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.3773C>T	3.37:g.47453061C>T	ENSP00000265562:p.Pro1258Leu					PTPN23_uc011baw.1_Missense_Mutation_p.P1223L|PTPN23_uc011bax.1_RNA|PTPN23_uc011bay.1_Missense_Mutation_p.P1128L|uc003cri.2_5'Flank	p.P1258L	NM_015466	NP_056281	Q9H3S7	PTN23_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	20	3869	+			1258			Tyrosine-protein phosphatase.		A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	ENST00000265562.4	37	c.3773C>T	CCDS2754.1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.502086	0.44455	0.001135	2.33E-4	ENSG00000076201	ENST00000265562	D	0.83075	-1.68	4.62	4.62	0.57501	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.149549	0.43747	D	0.000525	T	0.71753	0.3377	N	0.16833	0.445	0.43628	D	0.996011	D;D	0.59357	0.985;0.985	B;B	0.42959	0.403;0.278	T	0.77172	-0.2685	10	0.72032	D	0.01	-23.7934	12.294	0.54836	0.0:0.8287:0.1713:0.0	.	1132;1258	B4DST5;Q9H3S7	.;PTN23_HUMAN	L	1258	ENSP00000265562:P1258L	ENSP00000265562:P1258L	P	+	2	0	PTPN23	47428065	0.983000	0.35010	0.068000	0.19968	0.453000	0.32348	4.957000	0.63652	2.389000	0.81357	0.563000	0.77884	CCG		0.577	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257492.2	NM_015466		6	54	0	0	0	0.001984	0	6	54				
COL7A1	1294	broad.mit.edu	37	3	48607742	48607742	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr3:48607742C>A	ENST00000328333.8	-	97	7513	c.7406G>T	c.(7405-7407)gGg>gTg	p.G2469V	COL7A1_ENST00000454817.1_Missense_Mutation_p.G2437V	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2469	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GCCTCGGGGCCCAGGCAGCCC	0.627																																							uc003ctz.2		NA																	0				ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11						c.(7405-7407)GGG>GTG		alpha 1 type VII collagen precursor							71.0	79.0	76.0					3																	48607742		2203	4300	6503	SO:0001583	missense	1294				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity	g.chr3:48607742C>A	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.7406G>T	3.37:g.48607742C>A	ENSP00000332371:p.Gly2469Val						p.G2469V	NM_000094	NP_000085	Q02388	CO7A1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	97	7407	-			2469			Triple-helical region.		Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	c.7406G>T	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	C	9.366	1.069317	0.20147	.	.	ENSG00000114270	ENST00000328333;ENST00000454817;ENST00000422991	D;D;D	0.99353	-5.77;-5.77;-5.53	4.89	4.89	0.63831	.	0.000000	0.46145	D	0.000310	D	0.99645	0.9869	H	0.98256	4.185	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.97464	1.0036	10	0.87932	D	0	.	14.7827	0.69779	0.0:1.0:0.0:0.0	.	2469	Q02388	CO7A1_HUMAN	V	2469;2437;134	ENSP00000332371:G2469V;ENSP00000412569:G2437V;ENSP00000391608:G134V	ENSP00000332371:G2469V	G	-	2	0	COL7A1	48582746	0.999000	0.42202	0.966000	0.40874	0.051000	0.14879	5.505000	0.66981	2.261000	0.74972	0.563000	0.77884	GGG		0.627	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094		26	39	1	0	9.22233e-05	0.004656	9.73306e-05	26	39				
GMPPB	29925	broad.mit.edu	37	3	49759191	49759191	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr3:49759191G>A	ENST00000480687.1	-	10	1193	c.1077C>T	c.(1075-1077)atC>atT	p.I359I	GMPPB_ENST00000308375.6_Silent_p.I386I|AMIGO3_ENST00000320431.7_5'Flank|AMIGO3_ENST00000535833.1_5'UTR|GMPPB_ENST00000308388.6_Silent_p.I359I			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B	359					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCCCTCACATGATGATACGAG	0.557																																							uc003cxk.1		NA																	0					0						c.(1075-1077)ATC>ATT		GDP-mannose pyrophosphorylase B isoform 2							38.0	38.0	38.0					3																	49759191		2203	4299	6502	SO:0001819	synonymous_variant	29925				dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine		GTP binding|mannose-1-phosphate guanylyltransferase activity	g.chr3:49759191G>A	AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.1077C>T	3.37:g.49759191G>A						AMIGO3_uc003cxj.2_5'Flank|GMPPB_uc003cxl.1_Silent_p.I386I	p.I359I	NM_021971	NP_068806	Q9Y5P6	GMPPB_HUMAN		BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	9	1302	-			359					A8K6N5|Q9H7U3	Silent	SNP	ENST00000480687.1	37	c.1077C>T	CCDS2803.1																																																																																				0.557	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350291.1	NM_013334		5	31	0	0	0	0.001984	0	5	31				
POC1A	25886	broad.mit.edu	37	3	52172224	52172224	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr3:52172224C>G	ENST00000296484.2	-	7	813	c.774G>C	c.(772-774)ctG>ctC	p.L258L	POC1A_ENST00000394970.2_Silent_p.L258L|POC1A_ENST00000474012.1_Silent_p.L220L	NM_015426.4	NP_056241.3	Q8NBT0	POC1A_HUMAN	POC1 centriolar protein A	258					cell projection organization (GO:0030030)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				endometrium(1)|large_intestine(4)|liver(1)|lung(4)|prostate(3)|skin(1)	14						GGCCCTCCATCAGGTCCAGGA	0.602																																							uc003dcu.2		NA																	0					0						c.(772-774)CTG>CTC		WD repeat domain 51A isoform 1							107.0	92.0	97.0					3																	52172224		2203	4300	6503	SO:0001819	synonymous_variant	25886					centriole|microtubule basal body		g.chr3:52172224C>G	AL117629	CCDS2846.1, CCDS54591.1, CCDS54592.1	3p21.2	2014-05-02	2013-08-21	2010-03-26	ENSG00000164087	ENSG00000164087		"""WD repeat domain containing"""	24488	protein-coding gene	gene with protein product		614783	"""WD repeat domain 51A"", ""POC1 centriolar protein homolog A (Chlamydomonas)"""	WDR51A		19109428, 22840364	Standard	NM_015426		Approved	DKFZP434C245	uc003dcu.3	Q8NBT0	OTTHUMG00000157817	ENST00000296484.2:c.774G>C	3.37:g.52172224C>G						POC1A_uc003dcv.2_Silent_p.L220L|POC1A_uc003dcw.2_Silent_p.L258L	p.L258L	NM_015426	NP_056241	Q8NBT0	POC1A_HUMAN			7	1092	-			258			WD 6.		A4FUW4|E9PFC6|Q0VDF8|Q2TAK6|Q96IK6|Q9UFJ8	Silent	SNP	ENST00000296484.2	37	c.774G>C	CCDS2846.1																																																																																				0.602	POC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349685.1	NM_015426		8	37	0	0	0	0.004482	0	8	37				
DNAH1	25981	broad.mit.edu	37	3	52398911	52398911	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr3:52398911C>G	ENST00000420323.2	+	34	5655	c.5394C>G	c.(5392-5394)ctC>ctG	p.L1798L		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1798					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AGGAGGACCTCAAGCTCTTCT	0.627																																							uc011bef.1		NA																	0				large_intestine(3)	3						c.(5392-5394)CTC>CTG		dynein, axonemal, heavy chain 1							86.0	90.0	89.0					3																	52398911		2164	4260	6424	SO:0001819	synonymous_variant	25981				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr3:52398911C>G	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.5394C>G	3.37:g.52398911C>G							p.L1798L	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	34	5655	+			1798					B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Silent	SNP	ENST00000420323.2	37	c.5394C>G	CCDS46842.1																																																																																				0.627	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512		13	51	0	0	0	0.013537	0	13	51				
PTX3	5806	broad.mit.edu	37	3	157160592	157160592	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr3:157160592G>C	ENST00000295927.3	+	3	1115	c.970G>C	c.(970-972)Gat>Cat	p.D324H	VEPH1_ENST00000543418.1_Intron|VEPH1_ENST00000362010.2_Intron|VEPH1_ENST00000392832.2_Intron|VEPH1_ENST00000392833.2_Intron	NM_002852.3	NP_002843.2	P26022	PTX3_HUMAN	pentraxin 3, long	324	Pentaxin.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of viral entry into host cell (GO:0046597)|opsonization (GO:0008228)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phagocytosis (GO:0050766)|response to yeast (GO:0001878)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	(1->3)-beta-D-glucan binding (GO:0001872)|complement component C1q binding (GO:0001849)|virion binding (GO:0046790)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)	10			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			TGGTGGCTTTGATGAAACATT	0.493																																							uc003fbl.3		NA																	0				central_nervous_system(1)	1						c.(970-972)GAT>CAT		pentraxin 3 precursor							123.0	121.0	122.0					3																	157160592		2203	4300	6503	SO:0001583	missense	5806				inflammatory response	extracellular region		g.chr3:157160592G>C	X63613	CCDS3180.1	3q25	2010-03-11	2010-03-11		ENSG00000163661	ENSG00000163661			9692	protein-coding gene	gene with protein product		602492	"""pentaxin-related gene, rapidly induced by IL-1 beta"", ""tumor necrosis factor, alpha-induced protein 5"", ""pentraxin-related gene, rapidly induced by IL-1 beta"""	TNFAIP5		1429570	Standard	NM_002852		Approved	TSG-14	uc003fbl.4	P26022	OTTHUMG00000158750	ENST00000295927.3:c.970G>C	3.37:g.157160592G>C	ENSP00000295927:p.Asp324His					VEPH1_uc003fbj.1_Intron|VEPH1_uc003fbk.1_Intron|VEPH1_uc010hvu.1_Intron	p.D324H	NM_002852	NP_002843	P26022	PTX3_HUMAN	Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)		3	1113	+			324			Pentaxin.		B2R6T6|Q38M82	Missense_Mutation	SNP	ENST00000295927.3	37	c.970G>C	CCDS3180.1	.	.	.	.	.	.	.	.	.	.	G	18.94	3.730557	0.69074	.	.	ENSG00000163661	ENST00000295927	T	0.09630	2.96	5.97	5.97	0.96955	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.295374	0.41294	D	0.000918	T	0.39733	0.1089	M	0.88979	2.995	0.58432	D	0.999993	D	0.89917	1.0	D	0.81914	0.995	T	0.33163	-0.9879	10	0.87932	D	0	-26.762	14.5705	0.68208	0.0693:0.0:0.9307:0.0	.	324	P26022	PTX3_HUMAN	H	324	ENSP00000295927:D324H	ENSP00000295927:D324H	D	+	1	0	PTX3	158643286	1.000000	0.71417	0.949000	0.38748	0.955000	0.61496	4.774000	0.62339	2.836000	0.97738	0.655000	0.94253	GAT		0.493	PTX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352028.1	NM_002852		10	88	0	0	0	0.008291	0	10	88				
SI	6476	broad.mit.edu	37	3	164793764	164793764	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr3:164793764G>A	ENST00000264382.3	-	2	99	c.37C>T	c.(37-39)Ctg>Ttg	p.L13L		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	13					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	AGGACAATCAGAGAGATTTCC	0.279										HNSCC(35;0.089)																													uc003fei.2		NA																	0				ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14						c.(37-39)CTG>TTG		sucrase-isomaltase	Acarbose(DB00284)						65.0	66.0	65.0					3																	164793764		2203	4293	6496	SO:0001819	synonymous_variant	6476				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity	g.chr3:164793764G>A	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.37C>T	3.37:g.164793764G>A		HNSCC(35;0.089)					p.L13L	NM_001041	NP_001032	P14410	SUIS_HUMAN			2	99	-		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)	13			Helical; Signal-anchor for type II membrane protein; (Potential).		A2RUC3|Q1JQ80|Q1RMC2	Silent	SNP	ENST00000264382.3	37	c.37C>T	CCDS3196.1																																																																																				0.279	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041		12	72	0	0	0	0.013537	0	12	72				
FGFRL1	53834	broad.mit.edu	37	4	1018245	1018245	+	Missense_Mutation	SNP	G	G	A	rs200852436		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:1018245G>A	ENST00000398484.2	+	7	1445	c.865G>A	c.(865-867)Gag>Aag	p.E289K	FGFRL1_ENST00000510644.1_Missense_Mutation_p.E289K|FGFRL1_ENST00000264748.6_Missense_Mutation_p.E289K|FGFRL1_ENST00000504138.1_Missense_Mutation_p.E289K			Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	289	Ig-like C2-type 3.				diaphragm development (GO:0060539)|heart valve morphogenesis (GO:0003179)|negative regulation of cell proliferation (GO:0008285)|skeletal system development (GO:0001501)|ventricular septum morphogenesis (GO:0060412)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)			endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GTACGGCGCCGAGGGCCGCCA	0.657																																							uc003gce.2		NA																	0					0						c.(865-867)GAG>AAG		fibroblast growth factor receptor-like 1			LYS/GLU,LYS/GLU,LYS/GLU	1,4397		0,1,2198	36.0	37.0	37.0		865,865,865	5.4	1.0	4		37	0,8596		0,0,4298	yes	missense,missense,missense	FGFRL1	NM_001004356.2,NM_001004358.1,NM_021923.3	56,56,56	0,1,6496	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	289/505,289/505,289/505	1018245	1,12993	2199	4298	6497	SO:0001583	missense	53834				regulation of cell growth	integral to membrane|plasma membrane	fibroblast growth factor receptor activity|heparin binding	g.chr4:1018245G>A		CCDS3344.1	4p16	2013-01-11			ENSG00000127418	ENSG00000127418		"""Immunoglobulin superfamily / I-set domain containing"""	3693	protein-coding gene	gene with protein product		605830					Standard	NM_021923		Approved		uc003gcg.3	Q8N441	OTTHUMG00000118998	ENST00000398484.2:c.865G>A	4.37:g.1018245G>A	ENSP00000381498:p.Glu289Lys					FGFRL1_uc003gcf.2_Missense_Mutation_p.E289K|FGFRL1_uc003gcg.2_Missense_Mutation_p.E289K|FGFRL1_uc010ibo.2_Missense_Mutation_p.E289K	p.E289K	NM_021923	NP_068742	Q8N441	FGRL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0158)		6	1026	+			289			Ig-like C2-type 3.|Extracellular (Potential).		B2RAU9|Q6PJN1|Q9BXN7|Q9H4D7	Missense_Mutation	SNP	ENST00000398484.2	37	c.865G>A	CCDS3344.1	.	.	.	.	.	.	.	.	.	.	g	25.3	4.619326	0.87460	2.27E-4	0.0	ENSG00000127418	ENST00000398484;ENST00000542622;ENST00000510644;ENST00000504138;ENST00000264748	T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18	5.43	5.43	0.79202	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.75620	0.3874	L	0.56769	1.78	0.80722	D	1	P	0.47962	0.903	B	0.41236	0.351	T	0.75252	-0.3383	10	0.30078	T	0.28	-55.2326	18.2069	0.89858	0.0:0.0:1.0:0.0	.	289	Q8N441	FGRL1_HUMAN	K	289;259;289;289;289	ENSP00000381498:E289K;ENSP00000425025:E289K;ENSP00000423091:E289K;ENSP00000264748:E289K	ENSP00000264748:E289K	E	+	1	0	FGFRL1	1008245	1.000000	0.71417	0.971000	0.41717	0.951000	0.60555	7.444000	0.80532	2.543000	0.85770	0.574000	0.79327	GAG		0.657	FGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239195.2	NM_021923		10	39	0	0	0	0.008291	0	10	39				
ADD1	118	broad.mit.edu	37	4	2916722	2916722	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:2916722G>C	ENST00000398129.1	+	12	1737	c.1717G>C	c.(1717-1719)Gag>Cag	p.E573Q	ADD1_ENST00000398125.1_Missense_Mutation_p.E604Q|ADD1_ENST00000355842.3_Missense_Mutation_p.E604Q|ADD1_ENST00000398123.2_Missense_Mutation_p.E604Q|ADD1_ENST00000446856.1_Missense_Mutation_p.E573Q|ADD1_ENST00000503455.2_Missense_Mutation_p.E604Q|ADD1_ENST00000264758.7_Missense_Mutation_p.E604Q|ADD1_ENST00000513328.2_Missense_Mutation_p.E573Q			P35611	ADDA_HUMAN	adducin 1 (alpha)	573					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CCGTGAGCTGGAGGAGTACCG	0.602																																					Esophageal Squamous(71;505 1201 20414 34538 37449)	Esophageal Squamous(71;505 1201 20414 34538 37449)	uc003gfr.2		NA																	0				ovary(1)	1						c.(1717-1719)GAG>CAG		adducin 1 (alpha) isoform a							96.0	91.0	93.0					4																	2916722		2203	4300	6503	SO:0001583	missense	118				actin filament bundle assembly|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|positive regulation of protein binding	cytosol|F-actin capping protein complex|nucleus|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding|transcription factor binding	g.chr4:2916722G>C	L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.1717G>C	4.37:g.2916722G>C	ENSP00000381197:p.Glu573Gln					ADD1_uc003gfn.2_Intron|ADD1_uc003gfo.2_Missense_Mutation_p.E604Q|ADD1_uc003gfp.2_Missense_Mutation_p.E573Q|ADD1_uc003gfq.2_Missense_Mutation_p.E604Q|ADD1_uc003gfs.2_Missense_Mutation_p.E604Q	p.E573Q	NM_001119	NP_001110	P35611	ADDA_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.168)	13	1905	+			573					A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Missense_Mutation	SNP	ENST00000398129.1	37	c.1717G>C	CCDS43205.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.4|29.4	5.000548|5.000548	0.93227|0.93227	.|.	.|.	ENSG00000087274|ENSG00000087274	ENST00000264758;ENST00000446856;ENST00000398125;ENST00000513328;ENST00000503455;ENST00000355842;ENST00000398123;ENST00000398129|ENST00000514940;ENST00000541843	T;T;T;T;T;T;T;T|.	0.21543|.	2.0;2.0;2.0;2.0;2.0;2.0;2.0;2.0|.	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	0.047973|.	0.85682|.	D|.	0.000000|.	T|T	0.65984|0.65984	0.2744|0.2744	L|L	0.39085|0.39085	1.19|1.19	0.80722|0.80722	D|D	1|1	P;D;D;P;D|.	0.69078|.	0.507;0.996;0.997;0.675;0.971|.	P;P;D;B;P|.	0.69142|.	0.501;0.881;0.962;0.329;0.883|.	T|T	0.61252|0.61252	-0.7100|-0.7100	10|5	0.45353|.	T|.	0.12|.	-14.9662|-14.9662	19.2547|19.2547	0.93941|0.93941	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	604;573;604;573;604|.	Q86XM2;P35611;P35611-3;P35611-2;A2A3N8|.	.;ADDA_HUMAN;.;.;.|.	Q|C	604;573;604;573;604;604;604;573|309;18	ENSP00000264758:E604Q;ENSP00000399828:E573Q;ENSP00000381193:E604Q;ENSP00000421907:E573Q;ENSP00000423024:E604Q;ENSP00000348100:E604Q;ENSP00000381191:E604Q;ENSP00000381197:E573Q|.	ENSP00000264758:E604Q|.	E|W	+|+	1|3	0|0	ADD1|ADD1	2886520|2886520	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	9.267000|9.267000	0.95665|0.95665	2.548000|2.548000	0.85928|0.85928	0.563000|0.563000	0.77884|0.77884	GAG|TGG		0.602	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242840.1	NM_014189		6	28	0	0	0	0.001168	0	6	28				
HS3ST1	9957	broad.mit.edu	37	4	11400759	11400759	+	Nonsense_Mutation	SNP	C	C	A	rs561783570		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:11400759C>A	ENST00000002596.5	-	2	2045	c.871G>T	c.(871-873)Gag>Tag	p.E291*		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	291					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						TTATTTGGCTCATGAAAATAT	0.488																																							uc003gmq.2		NA																	0				skin(1)	1						c.(871-873)GAG>TAG		heparan sulfate D-glucosaminyl							82.0	85.0	84.0					4																	11400759		2203	4300	6503	SO:0001587	stop_gained	9957					Golgi lumen|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity	g.chr4:11400759C>A	AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.871G>T	4.37:g.11400759C>A	ENSP00000002596:p.Glu291*						p.E291*	NM_005114	NP_005105	O14792	HS3S1_HUMAN			2	1194	-			291					B3KUA6|Q6PEY8	Nonsense_Mutation	SNP	ENST00000002596.5	37	c.871G>T	CCDS3408.1	.	.	.	.	.	.	.	.	.	.	C	46	12.605373	0.99681	.	.	ENSG00000002587	ENST00000002596	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	18.3674	0.90396	0.0:1.0:0.0:0.0	.	.	.	.	X	291	.	ENSP00000002596:E291X	E	-	1	0	HS3ST1	11009857	1.000000	0.71417	0.983000	0.44433	0.654000	0.38779	4.755000	0.62198	2.571000	0.86741	0.655000	0.94253	GAG		0.488	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207073.3	NM_005114		42	104	1	0	5.48756e-27	0.011902	6.81602e-27	42	104				
SLIT2	9353	broad.mit.edu	37	4	20530616	20530616	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:20530616G>A	ENST00000504154.1	+	16	1759	c.1507G>A	c.(1507-1509)Gat>Aat	p.D503N	SLIT2_ENST00000503823.1_Missense_Mutation_p.D495N|SLIT2_ENST00000503837.1_Missense_Mutation_p.D499N|MIR218-1_ENST00000384999.1_RNA|SLIT2_ENST00000273739.5_Missense_Mutation_p.D507N	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	503	LRRNT 3.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						CTGCTTTGCGGATCTGGCTTG	0.398																																							uc003gpr.1		NA																	0				central_nervous_system(4)|skin(4)|ovary(3)	11						c.(1507-1509)GAT>AAT		slit homolog 2 precursor							120.0	122.0	121.0					4																	20530616		2203	4300	6503	SO:0001583	missense	9353				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	g.chr4:20530616G>A	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1507G>A	4.37:g.20530616G>A	ENSP00000422591:p.Asp503Asn					SLIT2_uc003gps.1_Missense_Mutation_p.D495N	p.D503N	NM_004787	NP_004778	O94813	SLIT2_HUMAN			16	1711	+			503			LRRNT 3.		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	37	c.1507G>A	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.951070	0.92660	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	T;T;T;T	0.25250	1.81;1.81;1.81;1.81	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.39963	0.1098	M	0.75264	2.295	0.80722	D	1	P;B	0.39847	0.691;0.232	B;B	0.41813	0.367;0.11	T	0.31613	-0.9937	10	0.87932	D	0	.	20.3465	0.98790	0.0:0.0:1.0:0.0	.	495;503	O94813-3;O94813	.;SLIT2_HUMAN	N	495;503;507;499;499	ENSP00000427548:D495N;ENSP00000422591:D503N;ENSP00000273739:D507N;ENSP00000422261:D499N	ENSP00000273739:D507N	D	+	1	0	SLIT2	20139714	1.000000	0.71417	0.987000	0.45799	0.974000	0.67602	9.467000	0.97671	2.798000	0.96311	0.655000	0.94253	GAT		0.398	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2			20	93	0	0	0	0.00333	0	20	93				
SLIT2	9353	broad.mit.edu	37	4	20533668	20533668	+	Nonsense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:20533668C>T	ENST00000504154.1	+	17	1927	c.1675C>T	c.(1675-1677)Caa>Taa	p.Q559*	SLIT2_ENST00000503823.1_Nonsense_Mutation_p.Q551*|SLIT2_ENST00000503837.1_Nonsense_Mutation_p.Q555*|SLIT2_ENST00000273739.5_Nonsense_Mutation_p.Q563*	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	559					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GAAACTTCCTCAATTACGTAA	0.294																																							uc003gpr.1		NA																	0				central_nervous_system(4)|skin(4)|ovary(3)	11						c.(1675-1677)CAA>TAA		slit homolog 2 precursor							50.0	50.0	50.0					4																	20533668		2203	4298	6501	SO:0001587	stop_gained	9353				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	g.chr4:20533668C>T	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1675C>T	4.37:g.20533668C>T	ENSP00000422591:p.Gln559*					SLIT2_uc003gps.1_Nonsense_Mutation_p.Q551*	p.Q559*	NM_004787	NP_004778	O94813	SLIT2_HUMAN			17	1879	+			559			LRR 13.		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Nonsense_Mutation	SNP	ENST00000504154.1	37	c.1675C>T	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	C	41	8.736776	0.98935	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	.	.	.	5.7	5.7	0.88788	.	0.100723	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	19.8481	0.96728	0.0:1.0:0.0:0.0	.	.	.	.	X	551;559;563;555;555	.	ENSP00000273739:Q563X	Q	+	1	0	SLIT2	20142766	1.000000	0.71417	0.988000	0.46212	0.703000	0.40648	7.294000	0.78760	2.705000	0.92388	0.650000	0.86243	CAA		0.294	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2			7	14	0	0	0	0.00308	0	7	14				
GPR125	166647	broad.mit.edu	37	4	22389690	22389690	+	Missense_Mutation	SNP	C	C	A	rs141222776	byFrequency	TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:22389690C>A	ENST00000334304.5	-	19	3873	c.3604G>T	c.(3604-3606)Gtg>Ttg	p.V1202L	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	1202					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				CCGTTCTGCACGCTTCCTTCC	0.527																																							uc003gqm.1		NA																	0				skin(1)	1						c.(3604-3606)GTG>TTG		G protein-coupled receptor 125 precursor							98.0	91.0	93.0					4																	22389690		2203	4300	6503	SO:0001583	missense	166647				neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity	g.chr4:22389690C>A	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.3604G>T	4.37:g.22389690C>A	ENSP00000334952:p.Val1202Leu					GPR125_uc010ieo.1_Missense_Mutation_p.V1058L|GPR125_uc003gql.1_Missense_Mutation_p.V329L	p.V1202L	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN			19	3869	-		Breast(46;0.198)	1202			Cytoplasmic (Potential).		Q6UXK9|Q86SQ5|Q8TC55	Missense_Mutation	SNP	ENST00000334304.5	37	c.3604G>T	CCDS33964.1	.	.	.	.	.	.	.	.	.	.	C	8.495	0.862871	0.17178	.	.	ENSG00000152990	ENST00000334304	T	0.53423	0.62	5.9	5.9	0.94986	.	0.113667	0.64402	N	0.000015	T	0.44746	0.1308	M	0.62723	1.935	0.80722	D	1	B;B	0.16396	0.004;0.017	B;B	0.13407	0.009;0.009	T	0.30031	-0.9992	10	0.15499	T	0.54	-2.054	14.4394	0.67306	0.0:0.93:0.0:0.07	.	1059;1202	Q8IWK6-3;Q8IWK6	.;GP125_HUMAN	L	1202	ENSP00000334952:V1202L	ENSP00000334952:V1202L	V	-	1	0	GPR125	21998788	1.000000	0.71417	0.979000	0.43373	0.279000	0.26890	4.619000	0.61218	2.786000	0.95864	0.650000	0.86243	GTG		0.527	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3			27	68	1	0	2.85442e-18	0.010818	3.41812e-18	27	68				
SRD5A3	79644	broad.mit.edu	37	4	56236183	56236183	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:56236183C>G	ENST00000264228.4	+	5	1110	c.882C>G	c.(880-882)ctC>ctG	p.L294L	SRD5A3-AS1_ENST00000595103.1_RNA|SRD5A3-AS1_ENST00000609487.1_RNA|SRD5A3-AS1_ENST00000609700.1_RNA|SRD5A3-AS1_ENST00000608558.1_RNA|SRD5A3-AS1_ENST00000608086.1_RNA|SRD5A3-AS1_ENST00000608265.1_RNA|SRD5A3-AS1_ENST00000595734.1_RNA|SRD5A3-AS1_ENST00000598906.1_RNA|SRD5A3-AS1_ENST00000609580.1_RNA|SRD5A3-AS1_ENST00000433175.2_RNA|SRD5A3-AS1_ENST00000596312.1_RNA|SRD5A3-AS1_ENST00000510637.1_RNA|SRD5A3-AS1_ENST00000609573.1_RNA|SRD5A3-AS1_ENST00000596289.1_RNA|SRD5A3-AS1_ENST00000609051.1_RNA|SRD5A3-AS1_ENST00000609500.1_RNA	NM_024592.4	NP_078868.1	Q9H8P0	PORED_HUMAN	steroid 5 alpha-reductase 3	294					androgen biosynthetic process (GO:0006702)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|polyprenol catabolic process (GO:0016095)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)			cervix(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	12	all_cancers(7;0.0308)|all_lung(4;0.00195)|Lung NSC(11;0.00431)|all_epithelial(27;0.0425)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.0179)		Spironolactone(DB00421)	CTGCCTTTCTCAGCCACCAAT	0.423																																							uc003hau.2		NA																	0					0						c.(880-882)CTC>CTG		steroid 5 alpha-reductase 3							148.0	132.0	137.0					4																	56236183		2203	4300	6503	SO:0001819	synonymous_variant	79644				androgen biosynthetic process|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|polyprenol catabolic process	endoplasmic reticulum membrane|integral to membrane	3-oxo-5-alpha-steroid 4-dehydrogenase activity|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor	g.chr4:56236183C>G	AK023414	CCDS3498.1	4q12	2009-07-21			ENSG00000128039	ENSG00000128039			25812	protein-coding gene	gene with protein product		611715				17986282	Standard	NM_024592		Approved	FLJ13352, SRD5A2L, SRD5A2L1	uc003hau.3	Q9H8P0	OTTHUMG00000128733	ENST00000264228.4:c.882C>G	4.37:g.56236183C>G						uc003hav.1_Intron|uc003haw.1_Intron	p.L294L	NM_024592	NP_078868	Q9H8P0	PORED_HUMAN	Epithelial(7;0.0179)		5	977	+	all_cancers(7;0.0308)|all_lung(4;0.00195)|Lung NSC(11;0.00431)|all_epithelial(27;0.0425)|Glioma(25;0.08)|all_neural(26;0.101)		294			Cytoplasmic (Potential).		Q4W5Q6	Silent	SNP	ENST00000264228.4	37	c.882C>G	CCDS3498.1																																																																																				0.423	SRD5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250644.2	NM_024592		5	101	0	0	0	0.001984	0	5	101				
LPHN3	23284	broad.mit.edu	37	4	62845391	62845391	+	Silent	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:62845391G>T	ENST00000514591.1	+	17	3041	c.2712G>T	c.(2710-2712)ggG>ggT	p.G904G	LPHN3_ENST00000509896.1_Silent_p.G972G|LPHN3_ENST00000508946.1_Silent_p.G904G|LPHN3_ENST00000508693.1_Silent_p.G972G|LPHN3_ENST00000506700.1_Silent_p.G904G|LPHN3_ENST00000504896.1_Silent_p.G904G|LPHN3_ENST00000514996.1_Silent_p.G904G|LPHN3_ENST00000506720.1_Silent_p.G972G|LPHN3_ENST00000507164.1_Silent_p.G972G|LPHN3_ENST00000545650.1_Silent_p.G904G|LPHN3_ENST00000507625.1_Silent_p.G972G|LPHN3_ENST00000506746.1_Silent_p.G972G|LPHN3_ENST00000511324.1_Silent_p.G972G|LPHN3_ENST00000514157.1_Silent_p.G904G|LPHN3_ENST00000512091.2_Silent_p.G904G			Q9HAR2	LPHN3_HUMAN	latrophilin 3	891					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						TTTTCCGGGGGCTCCAGAGTG	0.498																																							uc010ihh.2		NA																	0				lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(2710-2712)GGG>GGT		latrophilin 3 precursor							216.0	217.0	217.0					4																	62845391		2048	4219	6267	SO:0001819	synonymous_variant	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62845391G>T	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.2712G>T	4.37:g.62845391G>T						LPHN3_uc003hcq.3_Silent_p.G904G|LPHN3_uc003hct.2_Silent_p.G297G	p.G904G	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN			15	2885	+			891			Cytoplasmic (Potential).		E9PE04|O94867|Q9NWK5	Silent	SNP	ENST00000514591.1	37	c.2712G>T	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	G	9.104	1.004932	0.19199	.	.	ENSG00000150471	ENST00000502815	.	.	.	5.5	0.174	0.15040	.	.	.	.	.	T	0.44371	0.1290	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23013	-1.0200	4	.	.	.	.	3.8968	0.09143	0.1979:0.2105:0.4939:0.0977	.	.	.	.	S	362	.	.	A	+	1	0	LPHN3	62527986	0.961000	0.32948	0.993000	0.49108	0.980000	0.70556	0.092000	0.15066	0.012000	0.14892	-0.499000	0.04595	GCT		0.498	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			72	85	1	0	3.41413e-29	0.01441	4.26447e-29	72	85				
UGT2B27P	54569	broad.mit.edu	37	4	69874758	69874758	+	IGR	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:69874758C>A								UGT2A3 (57249 upstream) : UGT2B7 (42435 downstream)																							GCCATTGGCTCCACCATGAGT	0.398																																						Melanoma(133;755 1763 25578 26334 46021)	uc011cao.1		NA																	0				skin(3)|ovary(2)	5						c.(1012-1014)GGA>GTA		RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;							57.0	45.0	48.0					4																	69874758		692	1589	2281	SO:0001628	intergenic_variant	7365				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:69874758C>A																													4.37:g.69874758C>A						UGT2B10_uc011can.1_Missense_Mutation_p.G254V	p.G338V			P36537	UDB10_HUMAN			8	1149	-			375						Missense_Mutation	SNP		37	c.1013G>T																																																																																				0	0.398									33	156	1	0	3.21399e-22	0.004878	3.9048e-22	33	156				
UGT2B28	54490	broad.mit.edu	37	4	70156375	70156375	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:70156375C>A	ENST00000335568.5	+	5	1158	c.1156C>A	c.(1156-1158)Cat>Aat	p.H386N	UGT2B28_ENST00000511240.1_Intron	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	386					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						GGCAATCTACCATGGGATCCC	0.428																																							uc003hej.2		NA																	0				skin(1)	1						c.(1156-1158)CAT>AAT		UDP glucuronosyltransferase 2 family,	Flunitrazepam(DB01544)						94.0	98.0	97.0					4																	70156375		2043	4231	6274	SO:0001583	missense	54490				xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:70156375C>A	AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.1156C>A	4.37:g.70156375C>A	ENSP00000334276:p.His386Asn					UGT2B28_uc010ihr.2_Intron	p.H386N	NM_053039	NP_444267	Q9BY64	UDB28_HUMAN			5	1158	+			386					B5BUM0|Q9BY62|Q9BY63	Missense_Mutation	SNP	ENST00000335568.5	37	c.1156C>A	CCDS3528.1	.	.	.	.	.	.	.	.	.	.	-	5.297	0.240249	0.10023	.	.	ENSG00000135226	ENST00000335568	T	0.62498	0.02	1.85	1.85	0.25348	.	0.000000	0.64402	U	0.000001	T	0.65974	0.2743	M	0.74546	2.27	0.80722	D	1	B	0.31503	0.326	P	0.45946	0.498	T	0.57831	-0.7743	10	0.14252	T	0.57	.	9.3109	0.37903	0.0:1.0:0.0:0.0	.	386	Q9BY64	UDB28_HUMAN	N	386	ENSP00000334276:H386N	ENSP00000334276:H386N	H	+	1	0	UGT2B28	70190964	1.000000	0.71417	0.401000	0.26359	0.023000	0.10783	3.960000	0.56752	1.023000	0.39654	0.184000	0.17185	CAT		0.428	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	NM_053039		39	442	1	0	8.16904e-11	0.007835	9.25085e-11	39	442				
SULT1E1	6783	broad.mit.edu	37	4	70707720	70707720	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:70707720C>T	ENST00000226444.3	-	8	989	c.877G>A	c.(877-879)Gag>Aag	p.E293K		NM_005420.2	NP_005411.1	P49888	ST1E1_HUMAN	sulfotransferase family 1E, estrogen-preferring, member 1	293					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|estrogen metabolic process (GO:0008210)|female pregnancy (GO:0007565)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	estrone sulfotransferase activity (GO:0004304)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid binding (GO:0005496)|steroid sulfotransferase activity (GO:0050294)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	10					Acetaminophen(DB00316)|Cyclizine(DB01176)	TCTTAGATCTCAGTTCGAAAC	0.303																																							uc003heo.2		NA																	0				ovary(1)	1						c.(877-879)GAG>AAG		estrogen sulfotransferase							106.0	107.0	107.0					4																	70707720		2202	4298	6500	SO:0001583	missense	6783				3'-phosphoadenosine 5'-phosphosulfate metabolic process|sulfation|xenobiotic metabolic process	cytosol|nuclear membrane	estrone sulfotransferase activity|flavonol 3-sulfotransferase activity|steroid binding|steroid sulfotransferase activity	g.chr4:70707720C>T	BC027956	CCDS3531.1	4q13.1	2008-02-05	2004-02-06	2004-02-04	ENSG00000109193	ENSG00000109193	2.8.2.4	"""Sulfotransferases, cytosolic"""	11377	protein-coding gene	gene with protein product		600043	"""sulfotransferase, estrogen-preferring"""	STE		7961757	Standard	NM_005420		Approved	EST	uc003heo.3	P49888	OTTHUMG00000129403	ENST00000226444.3:c.877G>A	4.37:g.70707720C>T	ENSP00000226444:p.Glu293Lys						p.E293K	NM_005420	NP_005411	P49888	ST1E1_HUMAN			8	990	-			293					Q8N6X5	Missense_Mutation	SNP	ENST00000226444.3	37	c.877G>A	CCDS3531.1	.	.	.	.	.	.	.	.	.	.	C	14.80	2.642385	0.47153	.	.	ENSG00000109193	ENST00000226444	T	0.02121	4.44	4.23	2.25	0.28309	.	0.435107	0.21479	N	0.073872	T	0.03305	0.0096	L	0.58969	1.84	0.46061	D	0.998847	B	0.21071	0.051	B	0.23574	0.047	T	0.38394	-0.9663	10	0.62326	D	0.03	.	8.3858	0.32499	0.0:0.7837:0.0:0.2163	.	293	P49888	ST1E1_HUMAN	K	293	ENSP00000226444:E293K	ENSP00000226444:E293K	E	-	1	0	SULT1E1	70742309	0.290000	0.24343	0.052000	0.19188	0.245000	0.25701	0.745000	0.26259	0.419000	0.25927	0.585000	0.79938	GAG		0.303	SULT1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251559.1	NM_005420		10	84	0	0	0	0.008291	0	10	84				
GRSF1	2926	broad.mit.edu	37	4	71690060	71690060	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:71690060C>T	ENST00000254799.6	-	9	1536	c.1419G>A	c.(1417-1419)ctG>ctA	p.L473L	GRSF1_ENST00000508091.1_Intron|GRSF1_ENST00000545193.1_Silent_p.L355L|GRSF1_ENST00000502323.1_Silent_p.L311L|GRSF1_ENST00000439371.1_Silent_p.L311L	NM_002092.3	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1	473	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anterior/posterior pattern specification (GO:0009952)|morphogenesis of embryonic epithelium (GO:0016331)|mRNA polyadenylation (GO:0006378)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(2)	17		all_hematologic(202;0.21)	Lung(101;0.235)			GACATGAATTCAGGAACAGTT	0.358																																							uc010iia.1		NA																	0					0						c.(1417-1419)CTG>CTA		G-rich RNA sequence binding factor 1 isoform 1							84.0	75.0	78.0					4																	71690060		1817	4070	5887	SO:0001819	synonymous_variant	2926				mRNA polyadenylation		mRNA binding|nucleotide binding	g.chr4:71690060C>T	BC040485	CCDS47069.1, CCDS47070.1	4q13	2013-07-16				ENSG00000132463		"""RNA binding motif (RRM) containing"""	4610	protein-coding gene	gene with protein product		604851				8036161	Standard	NM_001098477		Approved		uc010iia.1	Q12849		ENST00000254799.6:c.1419G>A	4.37:g.71690060C>T						GRSF1_uc011caz.1_Silent_p.L355L|GRSF1_uc003hfs.2_Silent_p.L311L	p.L473L	NM_002092	NP_002083	Q12849	GRSF1_HUMAN	Lung(101;0.235)		9	1502	-		all_hematologic(202;0.21)	473			RRM 3.		B3KPW0|Q4W5S5|Q6ZST3|Q8IWD6|Q8NBD2	Silent	SNP	ENST00000254799.6	37	c.1419G>A	CCDS47069.1																																																																																				0.358	GRSF1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362642.1	NM_002092		3	15	0	0	0	0.004672	0	3	15				
CCDC158	339965	broad.mit.edu	37	4	77292610	77292610	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:77292610T>A	ENST00000388914.3	-	9	1261	c.1109A>T	c.(1108-1110)cAg>cTg	p.Q370L		NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	370										breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						TCCAGATTCCTGACTGAATTG	0.373																																							uc003hkb.3		NA																	0				skin(3)|ovary(2)|pancreas(1)	6						c.(1108-1110)CAG>CTG		coiled-coil domain containing 158							116.0	104.0	108.0					4																	77292610		1818	4085	5903	SO:0001583	missense	339965							g.chr4:77292610T>A	BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.1109A>T	4.37:g.77292610T>A	ENSP00000373566:p.Gln370Leu						p.Q370L	NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN			9	1262	-			370			Potential.		Q8IYQ1|Q8N7D4|Q8N7E3	Missense_Mutation	SNP	ENST00000388914.3	37	c.1109A>T	CCDS43242.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.340699	0.81911	.	.	ENSG00000163749	ENST00000388914	T	0.78246	-1.16	5.99	5.99	0.97316	.	0.000000	0.53938	D	0.000056	T	0.79441	0.4446	N	0.19112	0.55	0.80722	D	1	D	0.63046	0.992	D	0.72982	0.979	T	0.78505	-0.2178	10	0.31617	T	0.26	.	14.791	0.69844	0.0:0.0:0.0:1.0	.	370	Q5M9N0	CD158_HUMAN	L	370	ENSP00000373566:Q370L	ENSP00000373566:Q370L	Q	-	2	0	CCDC158	77511634	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.316000	0.65815	2.299000	0.77371	0.529000	0.55759	CAG		0.373	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362694.2	NM_001042784		55	16	0	0	0	0.01441	0	55	16				
BMP2K	55589	broad.mit.edu	37	4	79831813	79831813	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:79831813C>G	ENST00000335016.5	+	16	2278	c.2112C>G	c.(2110-2112)ggC>ggG	p.G704G	PAQR3_ENST00000295462.3_Intron	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	704					regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						AAGAAAATGGCACTGCAAACC	0.388																																							uc003hlk.2		NA																	0				lung(1)	1						c.(2110-2112)GGC>GGG		BMP-2 inducible kinase isoform a							56.0	51.0	52.0					4																	79831813		1838	4092	5930	SO:0001819	synonymous_variant	55589					nucleus	ATP binding|protein serine/threonine kinase activity	g.chr4:79831813C>G	AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.2112C>G	4.37:g.79831813C>G						PAQR3_uc003hlm.2_Intron|PAQR3_uc003hln.2_Intron|uc010ijm.1_5'Flank	p.G704G	NM_198892	NP_942595	Q9NSY1	BMP2K_HUMAN			16	2278	+			704					O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Silent	SNP	ENST00000335016.5	37	c.2112C>G	CCDS47083.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.996940	0.00435	.	.	ENSG00000138756	ENST00000502613	.	.	.	5.34	4.47	0.54385	.	.	.	.	.	T	0.33440	0.0863	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.20806	-1.0264	4	.	.	.	1.469	6.3728	0.21491	0.0:0.6849:0.1496:0.1654	.	.	.	.	D	397	.	.	H	+	1	0	BMP2K	80050837	0.000000	0.05858	0.004000	0.12327	0.132000	0.20833	0.472000	0.22116	1.205000	0.43262	0.484000	0.47621	CAC		0.388	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_017593		29	21	0	0	0	0.005443	0	29	21				
PDLIM5	10611	broad.mit.edu	37	4	95445019	95445019	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:95445019C>G	ENST00000317968.4	+	3	377	c.241C>G	c.(241-243)Ctg>Gtg	p.L81V	PDLIM5_ENST00000380180.3_Missense_Mutation_p.L81V|PDLIM5_ENST00000450793.1_Missense_Mutation_p.L81V|PDLIM5_ENST00000514743.1_Missense_Mutation_p.L81V|PDLIM5_ENST00000538141.1_Missense_Mutation_p.L81V|PDLIM5_ENST00000318007.5_Missense_Mutation_p.L81V|PDLIM5_ENST00000437932.1_Missense_Mutation_p.L81V|PDLIM5_ENST00000542407.1_Intron|PDLIM5_ENST00000508216.1_Missense_Mutation_p.L81V	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5	81	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		GAATATGACTCTGCAAAGGTA	0.393																																							uc003hti.2		NA																	0				ovary(1)|skin(1)	2						c.(241-243)CTG>GTG		PDZ and LIM domain 5 isoform a							120.0	111.0	114.0					4																	95445019		2203	4300	6503	SO:0001583	missense	10611				regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding	g.chr4:95445019C>G	AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.241C>G	4.37:g.95445019C>G	ENSP00000321746:p.Leu81Val					PDLIM5_uc003htf.2_Missense_Mutation_p.L81V|PDLIM5_uc003htg.2_Missense_Mutation_p.L81V|PDLIM5_uc011cdx.1_Missense_Mutation_p.L81V|PDLIM5_uc003hth.2_Missense_Mutation_p.L81V|PDLIM5_uc003htj.2_5'UTR|PDLIM5_uc003htk.2_Missense_Mutation_p.L81V|PDLIM5_uc011cdy.1_Intron	p.L81V	NM_006457	NP_006448	Q96HC4	PDLI5_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)	3	392	+		Hepatocellular(203;0.114)	81			PDZ.		A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	Missense_Mutation	SNP	ENST00000317968.4	37	c.241C>G	CCDS3641.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.050016	0.75846	.	.	ENSG00000163110	ENST00000437932;ENST00000380180;ENST00000318007;ENST00000450793;ENST00000538141;ENST00000317968;ENST00000503974;ENST00000508216;ENST00000514743	T;T;T;T;T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74	5.82	5.82	0.92795	PDZ/DHR/GLGF (4);	0.083385	0.49916	D	0.000127	T	0.41696	0.1170	L	0.28014	0.82	0.80722	D	1	P;D;P;P;D;B	0.76494	0.947;0.999;0.738;0.725;0.996;0.013	P;D;P;B;D;B	0.87578	0.856;0.998;0.752;0.396;0.986;0.171	T	0.20438	-1.0275	10	0.54805	T	0.06	.	19.7145	0.96110	0.0:1.0:0.0:0.0	.	81;81;81;81;81;81	E9PBF5;D6RB78;Q96HC4;Q96HC4-4;Q96HC4-2;Q96HC4-3	.;.;PDLI5_HUMAN;.;.;.	V	81	ENSP00000398469:L81V;ENSP00000369527:L81V;ENSP00000322021:L81V;ENSP00000401579:L81V;ENSP00000439795:L81V;ENSP00000321746:L81V;ENSP00000424297:L81V;ENSP00000426804:L81V;ENSP00000424360:L81V	ENSP00000321746:L81V	L	+	1	2	PDLIM5	95664042	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.485000	0.53208	2.755000	0.94549	0.555000	0.69702	CTG		0.393	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253586.1			6	37	0	0	0	0.001168	0	6	37				
COL25A1	84570	broad.mit.edu	37	4	110222978	110222978	+	Silent	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:110222978G>C	ENST00000399132.1	-	2	728	c.198C>G	c.(196-198)ctC>ctG	p.L66L	COL25A1_ENST00000399127.1_Silent_p.L66L|COL25A1_ENST00000399126.1_Silent_p.L66L|AC004051.2_ENST00000500526.1_lincRNA	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		TGGCGGATTCGAGAGCGGCGA	0.602																																							uc003hze.1		NA																	0				ovary(2)	2						c.(196-198)CTC>CTG		collagen, type XXV, alpha 1 isoform 1							100.0	104.0	103.0					4																	110222978		1966	4151	6117	SO:0001819	synonymous_variant	84570					collagen|extracellular space	beta-amyloid binding|heparin binding	g.chr4:110222978G>C	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.198C>G	4.37:g.110222978G>C						COL25A1_uc003hzg.2_Silent_p.L66L|COL25A1_uc003hzh.1_Silent_p.L66L	p.L66L	NM_198721	NP_942014	Q9BXS0	COPA1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000173)	2	729	-		Hepatocellular(203;0.217)	66			Extracellular (Potential).			Silent	SNP	ENST00000399132.1	37	c.198C>G	CCDS43258.1																																																																																				0.602	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518		10	162	0	0	0	0.008291	0	10	162				
ANK2	287	broad.mit.edu	37	4	114278095	114278095	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:114278095G>T	ENST00000357077.4	+	38	8374	c.8321G>T	c.(8320-8322)gGc>gTc	p.G2774V	ANK2_ENST00000264366.6_Missense_Mutation_p.G2741V|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2774					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ATCTGTGATGGCCATGGATGT	0.488																																							uc003ibe.3		NA																	0				central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.(8320-8322)GGC>GTC		ankyrin 2 isoform 1							79.0	71.0	74.0					4																	114278095		2203	4300	6503	SO:0001583	missense	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114278095G>T	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.8321G>T	4.37:g.114278095G>T	ENSP00000349588:p.Gly2774Val					ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Missense_Mutation_p.G76V|ANK2_uc011cgb.1_Missense_Mutation_p.G2789V	p.G2774V	NM_001148	NP_001139	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	38	8421	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	2741					Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	c.8321G>T	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.218941	0.39201	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.66815	-0.22;-0.23	6.03	3.42	0.39159	.	0.674299	0.13902	N	0.354875	T	0.64249	0.2581	L	0.54323	1.7	0.22342	N	0.999188	P;B	0.41366	0.747;0.161	B;B	0.43508	0.422;0.155	T	0.51663	-0.8677	9	.	.	.	.	10.4064	0.44260	0.2023:0.0:0.7977:0.0	.	2741;2774	Q01484;Q01484-4	ANK2_HUMAN;.	V	2774;2741	ENSP00000349588:G2774V;ENSP00000264366:G2741V	.	G	+	2	0	ANK2	114497544	0.171000	0.23029	0.020000	0.16555	0.028000	0.11728	3.040000	0.49799	0.456000	0.26937	0.655000	0.94253	GGC		0.488	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148		14	102	1	0	6.31663e-08	0.003163	6.96395e-08	14	102				
SMARCA5	8467	broad.mit.edu	37	4	144467174	144467174	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:144467174G>C	ENST00000283131.3	+	19	2956	c.2494G>C	c.(2494-2496)Gag>Cag	p.E832Q		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	832					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					TGAAGAGTTAGAGGAAAAAGA	0.383																																							uc003ijg.2		NA																	0				skin(1)	1						c.(2494-2496)GAG>CAG		SWI/SNF-related matrix-associated							69.0	71.0	70.0					4																	144467174		2203	4300	6503	SO:0001583	missense	8467				CenH3-containing nucleosome assembly at centromere|nucleosome positioning|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	condensed chromosome|nucleolus|nucleoplasm|NURF complex|RSF complex	ATP binding|ATPase activity|DNA binding|helicase activity|nucleosome binding|protein binding	g.chr4:144467174G>C	AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.2494G>C	4.37:g.144467174G>C	ENSP00000283131:p.Glu832Gln						p.E832Q	NM_003601	NP_003592	O60264	SMCA5_HUMAN			19	2956	+	all_hematologic(180;0.158)		832						Missense_Mutation	SNP	ENST00000283131.3	37	c.2494G>C	CCDS3761.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.654271	0.47467	.	.	ENSG00000153147	ENST00000283131;ENST00000536484;ENST00000535006	D	0.91180	-2.8	5.24	5.24	0.73138	ATPase, nucleosome remodelling ISWI, HAND domain (2);	0.000000	0.85682	D	0.000000	D	0.88514	0.6457	L	0.52266	1.64	0.80722	D	1	B	0.15930	0.015	B	0.12156	0.007	D	0.83731	0.0198	10	0.29301	T	0.29	-2.4045	19.1908	0.93666	0.0:0.0:1.0:0.0	.	832	O60264	SMCA5_HUMAN	Q	832;775;775	ENSP00000283131:E832Q	ENSP00000283131:E832Q	E	+	1	0	SMARCA5	144686624	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.212000	0.95126	2.608000	0.88229	0.655000	0.94253	GAG		0.383	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365077.3			16	45	0	0	0	0.004007	0	16	45				
GYPB	2994	broad.mit.edu	37	4	145061855	145061855	+	5'Flank	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:145061855G>T	ENST00000283126.7	-	0	0				GYPA_ENST00000512789.1_5'Flank|GYPA_ENST00000512064.1_5'Flank|GYPA_ENST00000503627.1_5'Flank|GYPA_ENST00000360771.4_De_novo_Start_OutOfFrame|GYPA_ENST00000504786.1_5'Flank|GYPA_ENST00000535709.1_5'Flank|GYPA_ENST00000324022.10_5'Flank			P06028	GLPB_HUMAN	glycophorin B (MNS blood group)							integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|skin(1)	4	all_hematologic(180;0.158)					GCAAGTGTCAGTGTCTGACCT	0.433																																							uc003ijo.3		NA																	0				central_nervous_system(2)	2						c.(-68--64)CACTG>CAATG		glycophorin A precursor							133.0	102.0	112.0					4																	145061855		692	1591	2283	SO:0001631	upstream_gene_variant	2993				interspecies interaction between organisms	membrane fraction	receptor activity	g.chr4:145061855G>T		CCDS54809.1	4q31.21	2014-09-17	2006-02-23			ENSG00000250361		"""CD molecules"", ""Blood group antigens"""	4703	protein-coding gene	gene with protein product		111740	"""glycophorin B (includes Ss blood group)"", ""glycophorin B (Ss blood group)"""	MNS			Standard	NM_002100		Approved	GPB, SS, CD235b		P06028			4.37:g.145061855G>T	Exception_encountered					GYPA_uc003ijn.2_Translation_Start_Site|GYPA_uc011cia.1_RNA|GYPA_uc011cib.1_Translation_Start_Site|GYPA_uc003ijp.3_Translation_Start_Site|GYPA_uc010ioq.2_Translation_Start_Site|GYPA_uc010ior.2_Translation_Start_Site|GYPA_uc010ios.1_RNA		NM_002099	NP_002090	P02724	GLPA_HUMAN			1	50	-	all_hematologic(180;0.15)							B8Q174|E2QBW7|Q0VAF4|Q58HE9|Q58HF0|Q58HF1|Q9UCH7	Translation_Start_Site	SNP	ENST00000283126.7	37	c.-66C>A																																																																																					0.433	GYPB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_002100		6	15	1	0	2.7689e-08	0.001984	3.06278e-08	6	15				
SH3D19	152503	broad.mit.edu	37	4	152054279	152054279	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:152054279C>T	ENST00000409252.2	-	16	2532	c.1825G>A	c.(1825-1827)Gcc>Acc	p.A609T	SH3D19_ENST00000514152.1_Missense_Mutation_p.A586T|SH3D19_ENST00000427414.2_Missense_Mutation_p.A550T|SH3D19_ENST00000304527.4_Missense_Mutation_p.A609T|SH3D19_ENST00000424281.1_Missense_Mutation_p.A550T|SH3D19_ENST00000409598.4_Missense_Mutation_p.A586T|SH3D19_ENST00000455740.1_Missense_Mutation_p.A586T			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	609	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				TCTCCTCTGGCCCATTCCTCA	0.428																																							uc010ipl.1		NA																	0				ovary(1)|skin(1)	2						c.(1825-1827)GCC>ACC		SH3 domain containing 19 isoform a							100.0	107.0	104.0					4																	152054279		2203	4300	6503	SO:0001583	missense	152503				cellular membrane organization|positive regulation of membrane protein ectodomain proteolysis|post-Golgi vesicle-mediated transport	cytosol|Golgi apparatus|nucleus|plasma membrane	proline-rich region binding	g.chr4:152054279C>T	BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.1825G>A	4.37:g.152054279C>T	ENSP00000386848:p.Ala609Thr					SH3D19_uc003imb.2_Missense_Mutation_p.A364T|SH3D19_uc003imc.2_Missense_Mutation_p.A550T|SH3D19_uc003ime.2_Missense_Mutation_p.A586T|SH3D19_uc010ipm.2_Missense_Mutation_p.A586T	p.A609T	NM_001009555	NP_001009555	Q5HYK7	SH319_HUMAN			17	2915	-	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)	609			SH3 3.		B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Missense_Mutation	SNP	ENST00000409252.2	37	c.1825G>A	CCDS34077.2	.	.	.	.	.	.	.	.	.	.	C	36	5.675676	0.96764	.	.	ENSG00000109686	ENST00000409598;ENST00000304527;ENST00000455740;ENST00000424281;ENST00000427414;ENST00000409252;ENST00000514152	T;T;T;T;T;T;T	0.13778	2.56;2.56;2.56;2.56;2.56;2.56;2.56	5.36	5.36	0.76844	Src homology-3 domain (4);	0.363277	0.23485	N	0.047672	T	0.26629	0.0651	L	0.35593	1.075	0.80722	D	1	P;P;B;D	0.64830	0.736;0.69;0.286;0.994	P;P;B;D	0.66979	0.653;0.596;0.221;0.948	T	0.01688	-1.1295	10	0.22706	T	0.39	-4.3665	19.0859	0.93202	0.0:1.0:0.0:0.0	.	609;586;550;364	Q5HYK7;Q5HYK7-2;Q5HYK7-3;B3KY23	SH319_HUMAN;.;.;.	T	586;609;586;550;550;609;586	ENSP00000387030:A586T;ENSP00000302913:A609T;ENSP00000416708:A586T;ENSP00000404542:A550T;ENSP00000415694:A550T;ENSP00000386848:A609T;ENSP00000423449:A586T	ENSP00000302913:A609T	A	-	1	0	SH3D19	152273729	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.623000	0.67757	2.496000	0.84212	0.561000	0.74099	GCC		0.428	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335132.3	NM_001009555		6	122	0	0	0	0.001168	0	6	122				
DCHS2	54798	broad.mit.edu	37	4	155312413	155312413	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:155312413C>G	ENST00000357232.4	-	1	36	c.37G>C	c.(37-39)Gac>Cac	p.D13H	DCHS2_ENST00000339452.1_Intron	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	13					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ttttctccgtcttcattctct	0.373																																							uc003inw.2		NA																	0				ovary(3)|pancreas(1)	4						c.(37-39)GAC>CAC		dachsous 2 isoform 1							179.0	153.0	161.0					4																	155312413		2202	4299	6501	SO:0001583	missense	54798				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:155312413C>G	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.37G>C	4.37:g.155312413C>G	ENSP00000349768:p.Asp13His					DCHS2_uc003inx.2_Intron	p.D13H	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.107)	1	37	-	all_hematologic(180;0.208)	Renal(120;0.0854)	13					B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	c.37G>C	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	C	7.047	0.563676	0.13498	.	.	ENSG00000197410	ENST00000357232	T	0.56444	0.46	3.27	0.463	0.16700	.	3.135340	0.01445	U	0.015266	T	0.28764	0.0713	N	0.08118	0	0.09310	N	0.999999	P	0.39964	0.697	B	0.32465	0.146	T	0.24083	-1.0170	10	0.66056	D	0.02	.	2.5725	0.04798	0.232:0.5047:0.0:0.2633	.	13	Q6V1P9	PCD23_HUMAN	H	13	ENSP00000349768:D13H	ENSP00000349768:D13H	D	-	1	0	DCHS2	155531863	0.000000	0.05858	0.004000	0.12327	0.002000	0.02628	-0.399000	0.07250	0.046000	0.15833	-0.293000	0.09583	GAC		0.373	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552		6	35	0	0	0	0.001168	0	6	35				
GLRB	2743	broad.mit.edu	37	4	158091631	158091631	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:158091631G>A	ENST00000264428.4	+	10	1515	c.1245G>A	c.(1243-1245)ctG>ctA	p.L415L	GLRB_ENST00000509282.1_Silent_p.L415L|GLRB_ENST00000541722.1_3'UTR|GLRB_ENST00000512619.1_Silent_p.*57*	NM_000824.4	NP_000815.1	P48167	GLRB_HUMAN	glycine receptor, beta	415					acrosome reaction (GO:0007340)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|extracellular-glycine-gated ion channel activity (GO:0016933)|glycine binding (GO:0016594)			central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(6)|skin(5)|upper_aerodigestive_tract(1)	27	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Enflurane(DB00228)|Glycine(DB00145)|Lindane(DB00431)	AGTCTGATCTGAGATCTAATG	0.338																																							uc003ipj.2		NA																	0				skin(2)	2						c.(1243-1245)CTG>CTA		glycine receptor, beta isoform A precursor	Glycine(DB00145)						76.0	78.0	77.0					4																	158091631		2203	4300	6503	SO:0001819	synonymous_variant	2743				nervous system development|neuropeptide signaling pathway|startle response	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|protein binding|receptor activity	g.chr4:158091631G>A	U33267	CCDS3796.1, CCDS54813.1	4q31.3	2008-02-05			ENSG00000109738	ENSG00000109738			4329	protein-coding gene	gene with protein product		138492				9676428, 8717357	Standard	NM_000824		Approved		uc003ipj.2	P48167	OTTHUMG00000161954	ENST00000264428.4:c.1245G>A	4.37:g.158091631G>A							p.L415L	NM_000824	NP_000815	P48167	GLRB_HUMAN		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	10	1447	+	all_hematologic(180;0.24)	Renal(120;0.0458)	415			Cytoplasmic (Probable).		A8K3K2|D3DP23|F5GWE1	Silent	SNP	ENST00000264428.4	37	c.1245G>A	CCDS3796.1																																																																																				0.338	GLRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366507.1	NM_000824		48	38	0	0	0	0.01441	0	48	38				
RAPGEF2	9693	broad.mit.edu	37	4	160244634	160244634	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:160244634C>T	ENST00000264431.4	+	5	950	c.531C>T	c.(529-531)ctC>ctT	p.L177L		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	177					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		CAGTGATTCTCAATGGATCTG	0.398																																							uc003iqg.3		NA																	0				lung(2)|upper_aerodigestive_tract(1)|skin(1)	4						c.(529-531)CTC>CTT		Rap guanine nucleotide exchange factor 2							121.0	111.0	114.0					4																	160244634		1879	4114	5993	SO:0001819	synonymous_variant	9693				cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr4:160244634C>T	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.531C>T	4.37:g.160244634C>T							p.L177L	NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN		COAD - Colon adenocarcinoma(41;0.0817)	5	841	+	all_hematologic(180;0.24)		177			cNMP.		D3DP27	Silent	SNP	ENST00000264431.4	37	c.531C>T	CCDS43277.1																																																																																				0.398	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	NM_014247		6	106	0	0	0	0.00308	0	6	106				
CPE	1363	broad.mit.edu	37	4	166405735	166405735	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:166405735G>T	ENST00000402744.4	+	5	1232	c.952G>T	c.(952-954)Gct>Tct	p.A318S		NM_001873.2	NP_001864.1	P16870	CBPE_HUMAN	carboxypeptidase E	318					cardiac left ventricle morphogenesis (GO:0003214)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|insulin processing (GO:0030070)|metabolic process (GO:0008152)|neuropeptide signaling pathway (GO:0007218)|protein localization to membrane (GO:0072657)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)	carboxypeptidase activity (GO:0004180)|cell adhesion molecule binding (GO:0050839)|metallocarboxypeptidase activity (GO:0004181)|neurexin family protein binding (GO:0042043)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	26	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.137)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CAACGGTGGTGCTTGGTACAG	0.453																																							uc003irg.3		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(952-954)GCT>TCT		carboxypeptidase E preproprotein	Glucagon recombinant(DB00040)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						249.0	232.0	238.0					4																	166405735		2203	4300	6503	SO:0001583	missense	1363				cardiac left ventricle morphogenesis|neuropeptide signaling pathway|protein modification process	extracellular region|nucleus|plasma membrane	metallocarboxypeptidase activity|protein binding|zinc ion binding	g.chr4:166405735G>T	X51405	CCDS3810.1	4q32.3	2012-02-10			ENSG00000109472	ENSG00000109472	3.4.17.10		2303	protein-coding gene	gene with protein product	"""carboxypeptidase H"", ""enkephalin convertase"", ""insulin granule-associated carboxypeptidase"", ""cobalt-stimulated chromaffin granule carboxypeptidase"""	114855				2334405	Standard	NM_001873		Approved		uc003irg.4	P16870	OTTHUMG00000150252	ENST00000402744.4:c.952G>T	4.37:g.166405735G>T	ENSP00000386104:p.Ala318Ser						p.A318S	NM_001873	NP_001864	P16870	CBPE_HUMAN		GBM - Glioblastoma multiforme(119;0.137)	5	1229	+	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)	318					A8K4N1|B3KR42|B4DFN4|D3DP33|Q9UIU9	Missense_Mutation	SNP	ENST00000402744.4	37	c.952G>T	CCDS3810.1	.	.	.	.	.	.	.	.	.	.	G	11.43	1.635248	0.29068	.	.	ENSG00000109472	ENST00000402744;ENST00000261510	T	0.10668	2.85	5.67	5.67	0.87782	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.08758	0.0217	N	0.17594	0.5	0.80722	D	1	B	0.31769	0.339	B	0.36378	0.223	T	0.05683	-1.0870	10	0.02654	T	1	-0.1055	20.1284	0.97992	0.0:0.0:1.0:0.0	.	318	P16870	CBPE_HUMAN	S	318;282	ENSP00000386104:A318S	ENSP00000261510:A282S	A	+	1	0	CPE	166625185	1.000000	0.71417	0.907000	0.35723	0.704000	0.40688	9.136000	0.94489	2.829000	0.97493	0.650000	0.86243	GCT		0.453	CPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317094.2	NM_001873		49	135	1	0	1.19451e-25	0.01441	1.47544e-25	49	135				
PALLD	23022	broad.mit.edu	37	4	169433199	169433199	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:169433199A>G	ENST00000505667.1	+	2	717	c.544A>G	c.(544-546)Ata>Gta	p.I182V	PALLD_ENST00000333488.4_Missense_Mutation_p.I59V|PALLD_ENST00000335742.7_5'UTR|PALLD_ENST00000261509.6_Missense_Mutation_p.I182V			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	182					cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		GCTAACATCCATATTTAAAGC	0.502									Pancreatic Cancer, Familial Clustering of																												Esophageal Squamous(109;1482 1532 18347 40239 51172)	Esophageal Squamous(109;1482 1532 18347 40239 51172)	uc011cjx.1		NA																	0				ovary(1)	1						c.(544-546)ATA>GTA		palladin isoform 2							103.0	116.0	111.0					4																	169433199		2203	4300	6503	SO:0001583	missense	23022	Pancreatic_Cancer_Familial_Clustering_of	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding	g.chr4:169433199A>G	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.544A>G	4.37:g.169433199A>G	ENSP00000425556:p.Ile182Val					PALLD_uc003iru.2_Missense_Mutation_p.I182V	p.I182V	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN		GBM - Glioblastoma multiforme(119;0.204)	2	755	+		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)	182					B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	ENST00000505667.1	37	c.544A>G	CCDS54818.1	.	.	.	.	.	.	.	.	.	.	A	15.33	2.801001	0.50315	.	.	ENSG00000129116	ENST00000261509;ENST00000505667;ENST00000508898;ENST00000333488	T;T;T;T	0.69435	-0.3;-0.04;-0.4;-0.16	5.55	5.55	0.83447	.	0.000000	0.35151	U	0.003411	T	0.68751	0.3035	M	0.69823	2.125	0.80722	D	1	D;D	0.57257	0.979;0.979	P;P	0.47744	0.556;0.556	T	0.67806	-0.5575	10	0.09843	T	0.71	.	15.7004	0.77538	1.0:0.0:0.0:0.0	.	182;182	B7ZMM5;B2RTX2	.;.	V	182;182;161;59	ENSP00000261509:I182V;ENSP00000425556:I182V;ENSP00000423063:I161V;ENSP00000328945:I59V	ENSP00000261509:I182V	I	+	1	0	PALLD	169669774	1.000000	0.71417	0.943000	0.38184	0.141000	0.21300	5.727000	0.68523	2.117000	0.64856	0.482000	0.46254	ATA		0.502	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1	NM_016081		24	79	0	0	0	0.005443	0	24	79				
MFAP3L	9848	broad.mit.edu	37	4	170912946	170912946	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:170912946C>T	ENST00000361618.3	-	3	1120	c.813G>A	c.(811-813)gtG>gtA	p.V271V	MFAP3L_ENST00000393704.3_Silent_p.V168V|RP11-6E9.4_ENST00000508955.1_RNA	NM_021647.6	NP_067679.6	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like	271						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		GAGTATGCCTCACAAAATTCT	0.592																																							uc003isp.3		NA																	0				ovary(1)	1						c.(811-813)GTG>GTA		microfibrillar-associated protein 3-like isoform							65.0	62.0	63.0					4																	170912946		2203	4300	6503	SO:0001819	synonymous_variant	9848					integral to membrane|plasma membrane		g.chr4:170912946C>T	AB014526	CCDS34103.1, CCDS43281.1	4q33	2014-08-12			ENSG00000198948	ENSG00000198948		"""Immunoglobulin superfamily / I-set domain containing"""	29083	protein-coding gene	gene with protein product						9734811	Standard	XM_005263366		Approved	KIAA0626, NYD-sp9	uc003isp.4	O75121	OTTHUMG00000160942	ENST00000361618.3:c.813G>A	4.37:g.170912946C>T						MFAP3L_uc003isn.3_Silent_p.V168V	p.V271V	NM_021647	NP_067679	O75121	MFA3L_HUMAN		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)	3	991	-		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)	271			Cytoplasmic (Potential).		A8K1X6|D3DP35|Q4W5N7|Q4W5N9|Q6TNA8|Q9BVE1|Q9BXK0	Silent	SNP	ENST00000361618.3	37	c.813G>A	CCDS34103.1																																																																																				0.592	MFAP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363043.2	NM_021647		23	47	0	0	0	0.005443	0	23	47				
ASB5	140458	broad.mit.edu	37	4	177142365	177142365	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr4:177142365G>A	ENST00000296525.3	-	5	724	c.611C>T	c.(610-612)cCt>cTt	p.P204L	ASB5_ENST00000511879.1_5'Flank|ASB5_ENST00000512254.1_Missense_Mutation_p.P151L	NM_080874.3	NP_543150.1	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box containing 5	204					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					endometrium(2)|kidney(1)|large_intestine(9)|lung(18)|prostate(2)|skin(2)	34		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		TACATAGAGAGGAGTTCCCAA	0.413																																							uc003iuq.1		NA																	0				skin(2)	2						c.(610-612)CCT>CTT		ankyrin repeat and SOCS box-containing protein							106.0	98.0	101.0					4																	177142365		2203	4300	6503	SO:0001583	missense	140458				intracellular signal transduction			g.chr4:177142365G>A	AY057053	CCDS3827.1	4q34.1	2013-01-10	2011-01-25		ENSG00000164122	ENSG00000164122		"""Ankyrin repeat domain containing"""	17180	protein-coding gene	gene with protein product		615050	"""ankyrin repeat and SOCS box-containing 5"""				Standard	NM_080874		Approved		uc003iuq.2	Q8WWX0	OTTHUMG00000160793	ENST00000296525.3:c.611C>T	4.37:g.177142365G>A	ENSP00000296525:p.Pro204Leu					ASB5_uc003iup.1_Missense_Mutation_p.P151L	p.P204L	NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)	5	627	-		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)	204			ANK 5.		Q8N7B5	Missense_Mutation	SNP	ENST00000296525.3	37	c.611C>T	CCDS3827.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.402445	0.62288	.	.	ENSG00000164122	ENST00000296525;ENST00000512254	T;T	0.71698	-0.59;-0.49	5.91	5.91	0.95273	Ankyrin repeat-containing domain (4);	0.049987	0.85682	D	0.000000	D	0.83271	0.5218	M	0.79805	2.47	0.80722	D	1	D;D	0.58970	0.962;0.984	B;P	0.56563	0.394;0.801	D	0.84368	0.0542	10	0.66056	D	0.02	-23.4329	20.2983	0.98569	0.0:0.0:1.0:0.0	.	204;151	Q8WWX0;Q8N7B5	ASB5_HUMAN;.	L	204;151	ENSP00000296525:P204L;ENSP00000422877:P151L	ENSP00000296525:P204L	P	-	2	0	ASB5	177379359	1.000000	0.71417	0.966000	0.40874	0.008000	0.06430	8.860000	0.92272	2.802000	0.96397	0.655000	0.94253	CCT		0.413	ASB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362344.1			18	19	0	0	0	0.007413	0	18	19				
ICE1	23379	broad.mit.edu	37	5	5473764	5473764	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:5473764G>A	ENST00000296564.7	+	16	6538	c.6316G>A	c.(6316-6318)Ggt>Agt	p.G2106S		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		2106					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)	p.G2106R(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						TGAAAAATTTGGTGAAGACCT	0.398																																							uc003jdm.3		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(6316-6318)GGT>AGT		hypothetical protein LOC23379							57.0	54.0	55.0					5																	5473764		1864	4102	5966	SO:0001583	missense	23379							g.chr5:5473764G>A																												ENST00000296564.7:c.6316G>A	5.37:g.5473764G>A	ENSP00000296564:p.Gly2106Ser						p.G2106S	NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN			16	6538	+			2106					Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	c.6316G>A	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.019732	0.93462	.	.	ENSG00000164151	ENST00000296564	T	0.14893	2.47	5.44	5.44	0.79542	.	.	.	.	.	T	0.41073	0.1143	M	0.61703	1.905	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	T	0.17623	-1.0363	9	0.87932	D	0	-14.0014	16.7623	0.85515	0.0:0.0:1.0:0.0	.	2106	Q9Y2F5	K0947_HUMAN	S	2106	ENSP00000296564:G2106S	ENSP00000296564:G2106S	G	+	1	0	KIAA0947	5526764	1.000000	0.71417	0.835000	0.33067	0.995000	0.86356	8.552000	0.90682	2.562000	0.86427	0.655000	0.94253	GGT		0.398	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1			7	40	0	0	0	0.001984	0	7	40				
TRIO	7204	broad.mit.edu	37	5	14291313	14291313	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:14291313G>A	ENST00000344204.4	+	5	1053	c.1029G>A	c.(1027-1029)agG>agA	p.R343R	TRIO_ENST00000509967.2_Silent_p.R294R|TRIO_ENST00000537187.1_Silent_p.R343R	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	343					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					TCCAGCTGAGGCTGTTTGAAC	0.587																																							uc003jff.2		NA																	0				skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18						c.(1027-1029)AGG>AGA		triple functional domain (PTPRF interacting)							41.0	39.0	40.0					5																	14291313		2202	4299	6501	SO:0001819	synonymous_variant	7204				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	g.chr5:14291313G>A	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.1029G>A	5.37:g.14291313G>A						TRIO_uc003jfg.2_RNA|TRIO_uc011cna.1_Silent_p.R294R|TRIO_uc003jfh.1_5'Flank	p.R343R	NM_007118	NP_009049	O75962	TRIO_HUMAN			5	1035	+	Lung NSC(4;0.000742)		343			Spectrin 1.		D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	ENST00000344204.4	37	c.1029G>A	CCDS3883.1																																																																																				0.587	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118		26	63	0	0	0	0.00333	0	26	63				
CDH10	1008	broad.mit.edu	37	5	24509699	24509699	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:24509699G>T	ENST00000264463.4	-	7	1739	c.1232C>A	c.(1231-1233)cCa>cAa	p.P411Q		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	411	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		AATAGAATCTGGGTCCCTTGC	0.473										HNSCC(23;0.051)																													uc003jgr.1		NA																	0				ovary(6)|pancreas(4)|breast(2)	12						c.(1231-1233)CCA>CAA		cadherin 10, type 2 preproprotein							92.0	92.0	92.0					5																	24509699		2203	4300	6503	SO:0001583	missense	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24509699G>T	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1232C>A	5.37:g.24509699G>T	ENSP00000264463:p.Pro411Gln	HNSCC(23;0.051)				CDH10_uc011cnu.1_RNA	p.P411Q	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	7	1564	-			411			Cadherin 4.|Extracellular (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.1232C>A	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	G	18.42	3.620631	0.66787	.	.	ENSG00000040731	ENST00000264463	T	0.01705	4.68	5.26	4.38	0.52667	Cadherin (4);Cadherin-like (1);	0.052088	0.85682	D	0.000000	T	0.11239	0.0274	M	0.83953	2.67	0.38186	D	0.939756	D	0.76494	0.999	D	0.72338	0.977	T	0.02705	-1.1121	10	0.72032	D	0.01	.	15.3159	0.74078	0.0:0.1404:0.8596:0.0	.	411	Q9Y6N8	CAD10_HUMAN	Q	411	ENSP00000264463:P411Q	ENSP00000264463:P411Q	P	-	2	0	CDH10	24545456	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.402000	0.73260	1.341000	0.45600	0.650000	0.86243	CCA		0.473	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		13	88	1	0	8.60227e-14	0.004007	1.0031e-13	13	88				
AGXT2	64902	broad.mit.edu	37	5	35037091	35037091	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:35037091C>G	ENST00000231420.6	-	4	642	c.442G>C	c.(442-444)Gaa>Caa	p.E148Q	AC010368.1_ENST00000390793.2_RNA	NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	148					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	TCTGCATATTCATGCATTGGA	0.488																																							uc003jjf.2		NA																	0				ovary(3)|skin(1)	4						c.(442-444)GAA>CAA		alanine-glyoxylate aminotransferase 2 precursor	Glycine(DB00145)|L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)						116.0	112.0	113.0					5																	35037091		2203	4300	6503	SO:0001583	missense	64902				glyoxylate metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	mitochondrial matrix	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity|alanine-glyoxylate transaminase activity|pyridoxal phosphate binding	g.chr5:35037091C>G	AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.442G>C	5.37:g.35037091C>G	ENSP00000231420:p.Glu148Gln					AGXT2_uc011com.1_Missense_Mutation_p.E148Q|AGXT2_uc011con.1_Missense_Mutation_p.E56Q	p.E148Q	NM_031900	NP_114106	Q9BYV1	AGT2_HUMAN	COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	4	521	-	all_lung(31;4.52e-05)		148					B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Missense_Mutation	SNP	ENST00000231420.6	37	c.442G>C	CCDS3908.1	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851265	0.51270	.	.	ENSG00000113492	ENST00000231420	D	0.85773	-2.03	5.7	3.94	0.45596	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.140114	0.64402	D	0.000005	D	0.89649	0.6776	M	0.67625	2.065	0.58432	D	0.999998	P;D;D	0.58970	0.859;0.976;0.984	P;P;D	0.63381	0.609;0.883;0.914	D	0.88557	0.3120	10	0.46703	T	0.11	-6.7045	12.5613	0.56283	0.0:0.8799:0.0:0.1201	.	56;148;148	B7Z3M3;E9PDL7;Q9BYV1	.;.;AGT2_HUMAN	Q	148	ENSP00000231420:E148Q	ENSP00000231420:E148Q	E	-	1	0	AGXT2	35072848	1.000000	0.71417	0.111000	0.21465	0.008000	0.06430	4.411000	0.59781	0.782000	0.33613	0.650000	0.86243	GAA		0.488	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207574.2	NM_031900		8	75	0	0	0	0.008291	0	8	75				
PRLR	5618	broad.mit.edu	37	5	35065601	35065601	+	Missense_Mutation	SNP	C	C	T	rs139147779		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:35065601C>T	ENST00000382002.5	-	10	1885	c.1459G>A	c.(1459-1461)Gac>Aac	p.D487N	PRLR_ENST00000310101.5_Intron|PRLR_ENST00000542609.1_Intron|PRLR_ENST00000511486.1_Missense_Mutation_p.D386N|PRLR_ENST00000348262.3_Intron|PRLR_ENST00000231423.3_Intron|PRLR_ENST00000397391.3_Intron|PRLR_ENST00000509934.1_5'Flank|PRLR_ENST00000513753.1_Intron|PRLR_ENST00000342362.5_Missense_Mutation_p.D386N	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	487					activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	GTATCCTGGTCAGTCTCAGAA	0.493																																							uc003jjm.2		NA																	0				ovary(2)|skin(1)	3						c.(1459-1461)GAC>AAC		prolactin receptor precursor	Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	C	ASN/ASP,ASN/ASP,,,,	1,4405	2.1+/-5.4	0,1,2202	94.0	103.0	100.0		1459,1156,,,,	5.2	0.6	5	dbSNP_134	100	0,8600		0,0,4300	no	missense,missense,intron,intron,intron,intron	PRLR	NM_000949.5,NM_001204314.1,NM_001204315.1,NM_001204316.1,NM_001204317.1,NM_001204318.1	23,23,,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign,,,,	487/623,386/522,,,,	35065601	1,13005	2203	4300	6503	SO:0001583	missense	5618				activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity	g.chr5:35065601C>T		CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.1459G>A	5.37:g.35065601C>T	ENSP00000371432:p.Asp487Asn					PRLR_uc003jjg.1_Intron|PRLR_uc003jjh.1_Intron|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Intron|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Missense_Mutation_p.D386N	p.D487N	NM_000949	NP_000940	P16471	PRLR_HUMAN	COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		10	1989	-	all_lung(31;3.83e-05)		487			Cytoplasmic (Potential).		B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Missense_Mutation	SNP	ENST00000382002.5	37	c.1459G>A	CCDS3909.1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.444424	0.25987	2.27E-4	0.0	ENSG00000113494	ENST00000342362;ENST00000382002;ENST00000511486	D;D;D	0.89939	-2.59;-1.67;-2.59	5.2	5.2	0.72013	.	0.538081	0.21471	N	0.073990	D	0.87799	0.6268	L	0.54908	1.71	0.37852	D	0.929409	B;B	0.19331	0.005;0.035	B;B	0.18561	0.008;0.022	D	0.85978	0.1481	10	0.59425	D	0.04	-1.9102	18.743	0.91780	0.0:1.0:0.0:0.0	.	487;386	P16471;P16471-2	PRLR_HUMAN;.	N	386;487;386	ENSP00000339213:D386N;ENSP00000371432:D487N;ENSP00000422556:D386N	ENSP00000339213:D386N	D	-	1	0	PRLR	35101358	0.938000	0.31826	0.644000	0.29465	0.022000	0.10575	1.737000	0.38197	2.437000	0.82529	0.655000	0.94253	GAC		0.493	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207575.2			19	120	0	0	0	0.008871	0	19	120				
LIFR	3977	broad.mit.edu	37	5	38510737	38510737	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:38510737G>C	ENST00000263409.4	-	7	982	c.820C>G	c.(820-822)Caa>Gaa	p.Q274E	LIFR_ENST00000503088.1_5'UTR|LIFR_ENST00000453190.2_Missense_Mutation_p.Q274E	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	274					cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					ACTTTTTCTTGACTCACACAA	0.378			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)	Melanoma(13;4 730 6426 9861 34751)	uc010ive.1		NA		Dom	yes		5	5p13-p12	3977	T	leukemia inhibitory factor receptor			E	PLAG1		salivary adenoma		0				ovary(3)|large_intestine(1)	4						c.(820-822)CAA>GAA		leukemia inhibitory factor receptor precursor							101.0	89.0	93.0					5																	38510737		2203	4300	6503	SO:0001583	missense	3977				positive regulation of cell proliferation	extracellular region|integral to plasma membrane	ciliary neurotrophic factor receptor binding|growth factor binding|leukemia inhibitory factor receptor activity	g.chr5:38510737G>C	X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.820C>G	5.37:g.38510737G>C	ENSP00000263409:p.Gln274Glu					LIFR_uc003jli.2_Missense_Mutation_p.Q274E	p.Q274E	NM_001127671	NP_001121143	P42702	LIFR_HUMAN			7	1152	-	all_lung(31;0.00021)		274			Extracellular (Potential).		Q6LCD9	Missense_Mutation	SNP	ENST00000263409.4	37	c.820C>G	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	G	7.148	0.583091	0.13749	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.65916	-0.18;-0.18	5.65	2.6	0.31112	.	0.539284	0.21708	N	0.070318	T	0.44932	0.1317	L	0.34521	1.04	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21449	-1.0245	10	0.14252	T	0.57	-3.2548	8.9524	0.35796	0.0:0.1493:0.5798:0.271	.	274	P42702	LIFR_HUMAN	E	274	ENSP00000263409:Q274E;ENSP00000398368:Q274E	ENSP00000263409:Q274E	Q	-	1	0	LIFR	38546494	0.335000	0.24748	0.942000	0.38095	0.953000	0.61014	0.312000	0.19397	0.691000	0.31592	0.655000	0.94253	CAA		0.378	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310		10	54	0	0	0	0.008291	0	10	54				
PTGER4	5734	broad.mit.edu	37	5	40692198	40692198	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:40692198C>T	ENST00000302472.3	+	3	2209	c.1185C>T	c.(1183-1185)ctC>ctT	p.L395L		NM_000958.2	NP_000949.1	P35408	PE2R4_HUMAN	prostaglandin E receptor 4 (subtype EP4)	395					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|bone development (GO:0060348)|cellular response to mechanical stimulus (GO:0071260)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|JNK cascade (GO:0007254)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of eosinophil extravasation (GO:2000420)|negative regulation of inflammatory response (GO:0050728)|negative regulation of integrin activation (GO:0033624)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|regulation of ossification (GO:0030278)|regulation of stress fiber assembly (GO:0051492)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|T-helper cell differentiation (GO:0042093)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)			breast(1)|endometrium(3)|liver(1)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23					Dinoprostone(DB00917)|Misoprostol(DB00929)	CTCAGACCCTCCTGCCAGACC	0.567																																							uc003jlz.2		NA																	0				lung(2)	2						c.(1183-1185)CTC>CTT		prostaglandin E receptor 4, subtype EP4							65.0	62.0	63.0					5																	40692198		2203	4300	6503	SO:0001819	synonymous_variant	5734				G-protein signaling, coupled to cAMP nucleotide second messenger|immune response	integral to membrane|plasma membrane	prostaglandin E receptor activity	g.chr5:40692198C>T	L28175	CCDS3930.1	5p13.1	2012-08-08			ENSG00000171522	ENSG00000171522		"""GPCR / Class A : Prostanoid receptors"""	9596	protein-coding gene	gene with protein product		601586				7759114, 8661119	Standard	NM_000958		Approved	EP4	uc003jlz.3	P35408	OTTHUMG00000094769	ENST00000302472.3:c.1185C>T	5.37:g.40692198C>T							p.L395L	NM_000958	NP_000949	P35408	PE2R4_HUMAN			3	1777	+			395			Cytoplasmic (Potential).		Q3MJ87	Silent	SNP	ENST00000302472.3	37	c.1185C>T	CCDS3930.1																																																																																				0.567	PTGER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211578.2	NM_000958		21	49	0	0	0	0.00333	0	21	49				
PRKAA1	5562	broad.mit.edu	37	5	40765169	40765169	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:40765169C>G	ENST00000397128.2	-	7	1001	c.993G>C	c.(991-993)ttG>ttC	p.L331F	PRKAA1_ENST00000354209.3_Missense_Mutation_p.L346F	NM_006251.5|NM_206907.3	NP_006242.5|NP_996790.3	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic subunit	331	AIS.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to glucose starvation (GO:0042149)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|cold acclimation (GO:0009631)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|fatty acid oxidation (GO:0019395)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of glucosylceramide biosynthetic process (GO:0046318)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of gene expression (GO:0010628)|positive regulation of glycolytic process (GO:0045821)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of transcription, DNA-templated (GO:0006355)|regulation of vesicle-mediated transport (GO:0060627)|response to activity (GO:0014823)|response to caffeine (GO:0031000)|response to camptothecin (GO:1901563)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	AMP-activated protein kinase complex (GO:0031588)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|tau-protein kinase activity (GO:0050321)			breast(1)	1					Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	AGGCAACTGCCAAAGGATCCT	0.388																																							uc003jmc.2		NA																	0				breast(1)	1						c.(991-993)TTG>TTC		protein kinase, AMP-activated, alpha 1 catalytic	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)						124.0	117.0	119.0					5																	40765169		1871	4101	5972	SO:0001583	missense	5562				activation of MAPK activity|cell cycle arrest|cholesterol biosynthetic process|fatty acid biosynthetic process|insulin receptor signaling pathway|negative regulation of glucosylceramide biosynthetic process|positive regulation of anti-apoptosis|positive regulation of cholesterol biosynthetic process|regulation of fatty acid oxidation|response to hypoxia	cytosol	ATP binding|cAMP-dependent protein kinase activity|metal ion binding|protein binding	g.chr5:40765169C>G		CCDS3932.2, CCDS3933.2	5p13.1	2012-10-03			ENSG00000132356	ENSG00000132356			9376	protein-coding gene	gene with protein product	"""AMPK, alpha, 1"""	602739				8557660	Standard	XM_006714481		Approved	AMPKa1	uc003jmb.3	Q13131	OTTHUMG00000162269	ENST00000397128.2:c.993G>C	5.37:g.40765169C>G	ENSP00000380317:p.Leu331Phe					PRKAA1_uc003jmb.2_Missense_Mutation_p.L346F	p.L331F	NM_006251	NP_006242	Q13131	AAPK1_HUMAN			7	999	-			331					A8MTQ6|B2R7E1|O00286|Q5D0E1|Q86VS1|Q9UNQ4	Missense_Mutation	SNP	ENST00000397128.2	37	c.993G>C	CCDS3932.2	.	.	.	.	.	.	.	.	.	.	C	16.53	3.148072	0.57151	.	.	ENSG00000132356	ENST00000397128;ENST00000354209	T;T	0.75154	-0.82;-0.91	6.02	2.26	0.28386	.	0.000000	0.85682	D	0.000000	T	0.81880	0.4916	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.997;0.999	T	0.76443	-0.2957	10	0.33141	T	0.24	-7.593	5.7625	0.18209	0.1247:0.5611:0.0:0.3142	.	331;346	Q13131;Q13131-2	AAPK1_HUMAN;.	F	331;346	ENSP00000380317:L331F;ENSP00000346148:L346F	ENSP00000346148:L346F	L	-	3	2	AC008810.1	40800926	0.995000	0.38212	0.853000	0.33588	0.997000	0.91878	0.370000	0.20433	0.126000	0.18424	0.650000	0.86243	TTG		0.388	PRKAA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253833.2	NM_006251		16	122	0	0	0	0.004007	0	16	122				
GHR	2690	broad.mit.edu	37	5	42718993	42718993	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:42718993G>A	ENST00000230882.4	+	10	1574	c.1384G>A	c.(1384-1386)Gaa>Aaa	p.E462K	GHR_ENST00000357703.3_Missense_Mutation_p.E440K|GHR_ENST00000537449.1_Missense_Mutation_p.E275K	NM_000163.4|NM_001242399.2|NM_001242400.2|NM_001242401.3|NM_001242402.2|NM_001242403.2|NM_001242404.2|NM_001242405.2|NM_001242406.2	NP_000154.1|NP_001229328.1|NP_001229329.1|NP_001229330.1|NP_001229331.1|NP_001229332.1|NP_001229333.1|NP_001229334.1|NP_001229335.1	P10912	GHR_HUMAN	growth hormone receptor	462					2-oxoglutarate metabolic process (GO:0006103)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPK activity (GO:0000187)|allantoin metabolic process (GO:0000255)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|endocytosis (GO:0006897)|fatty acid metabolic process (GO:0006631)|growth hormone receptor signaling pathway (GO:0060396)|insulin-like growth factor receptor signaling pathway (GO:0048009)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|multicellular organismal metabolic process (GO:0044236)|oxaloacetate metabolic process (GO:0006107)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|receptor internalization (GO:0031623)|regulation of multicellular organism growth (GO:0040014)|response to cycloheximide (GO:0046898)|response to estradiol (GO:0032355)|succinate metabolic process (GO:0006105)|taurine metabolic process (GO:0019530)|valine metabolic process (GO:0006573)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|growth hormone receptor complex (GO:0070195)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine receptor activity (GO:0004896)|growth factor binding (GO:0019838)|peptide hormone binding (GO:0017046)|proline-rich region binding (GO:0070064)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			NS(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	ACTTCCTACTGAAGGAGCTGA	0.453																																							uc003jmt.2		NA																	0				lung(4)|kidney(1)|skin(1)	6						c.(1384-1386)GAA>AAA		growth hormone receptor precursor	Pegvisomant(DB00082)|Somatropin recombinant(DB00052)						67.0	61.0	63.0					5																	42718993		2203	4300	6503	SO:0001583	missense	2690				2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding	g.chr5:42718993G>A		CCDS3940.1, CCDS56364.1, CCDS75239.1, CCDS75240.1	5p14-p12	2013-03-25			ENSG00000112964	ENSG00000112964		"""Fibronectin type III domain containing"""	4263	protein-coding gene	gene with protein product	"""growth hormone binding protein"""	600946					Standard	NM_001242460		Approved	GHBP	uc003jmt.3	P10912	OTTHUMG00000094791	ENST00000230882.4:c.1384G>A	5.37:g.42718993G>A	ENSP00000230882:p.Glu462Lys					GHR_uc011cpq.1_Missense_Mutation_p.E275K	p.E462K	NM_000163	NP_000154	P10912	GHR_HUMAN			10	1427	+		Myeloproliferative disorder(839;0.00878)	462			Cytoplasmic (Potential).		Q9HCX2	Missense_Mutation	SNP	ENST00000230882.4	37	c.1384G>A	CCDS3940.1	.	.	.	.	.	.	.	.	.	.	G	4.509	0.094426	0.08632	.	.	ENSG00000112964	ENST00000230882;ENST00000357703;ENST00000537449	T;T;T	0.35973	1.28;1.28;1.28	5.82	2.62	0.31277	.	0.596957	0.18228	N	0.147641	T	0.22936	0.0554	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.15983	-1.0418	10	0.27785	T	0.31	-3.7668	10.5914	0.45312	0.36:0.0:0.64:0.0	.	462	P10912	GHR_HUMAN	K	462;440;275	ENSP00000230882:E462K;ENSP00000350335:E440K;ENSP00000442206:E275K	ENSP00000230882:E462K	E	+	1	0	GHR	42754750	0.004000	0.15560	0.302000	0.25058	0.098000	0.18820	0.511000	0.22739	0.792000	0.33850	0.467000	0.42956	GAA		0.453	GHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211605.2	NM_000163		18	75	0	0	0	0.006122	0	18	75				
MRPS30	10884	broad.mit.edu	37	5	44809664	44809664	+	Splice_Site	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:44809664C>T	ENST00000507110.1	+	1	638	c.600C>T	c.(598-600)ctC>ctT	p.L200L	RP11-53O19.1_ENST00000508945.1_RNA|RP11-53O19.1_ENST00000503452.1_RNA|RP11-53O19.1_ENST00000514597.1_RNA|RP11-53O19.1_ENST00000503179.1_RNA|RP11-53O19.1_ENST00000508123.1_RNA|RP11-53O19.1_ENST00000505302.1_RNA|RP11-53O19.1_ENST00000505401.1_RNA|RP11-53O19.1_ENST00000505637.1_RNA	NM_016640.3	NP_057724.2	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	200					apoptotic process (GO:0006915)|translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(11)|prostate(1)	20	Lung NSC(6;8.08e-07)					CTGCCGCCCTCGGTGAGCCTT	0.607																																							uc003joh.2		NA																	0					0						c.(598-600)CTC>CTT		mitochondrial ribosomal protein S30							32.0	39.0	36.0					5																	44809664		2185	4269	6454	SO:0001630	splice_region_variant	10884				apoptosis|translation	mitochondrion|ribosome	structural constituent of ribosome	g.chr5:44809664C>T	AF146192	CCDS3951.1	5q11	2012-09-13		2001-11-09	ENSG00000112996	ENSG00000112996		"""Mitochondrial ribosomal proteins / small subunits"""	8769	protein-coding gene	gene with protein product		611991		PDCD9		10640817, 11279123	Standard	NM_016640		Approved	PAP	uc003joh.3	Q9NP92	OTTHUMG00000096967	ENST00000507110.1:c.601+1C>T	5.37:g.44809664C>T						MRPS30_uc003joi.1_5'Flank	p.L200L	NM_016640	NP_057724	Q9NP92	RT30_HUMAN			1	638	+	Lung NSC(6;8.08e-07)		200					Q96I91|Q96Q19|Q9H0P8|Q9NSF9|Q9NZ76	Silent	SNP	ENST00000507110.1	37	c.600C>T	CCDS3951.1																																																																																				0.607	MRPS30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214033.2	NM_016640	Silent	10	61	0	0	0	0.013537	0	10	61				
ITGA2	3673	broad.mit.edu	37	5	52362956	52362956	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:52362956G>C	ENST00000296585.5	+	16	2095	c.1952G>C	c.(1951-1953)aGt>aCt	p.S651T		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	651					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				AGGTCACAAAGTATTGCTGAT	0.373																																							uc003joy.2		NA																	0				lung(1)	1						c.(1951-1953)AGT>ACT		integrin alpha 2 precursor							94.0	91.0	92.0					5																	52362956		2202	4299	6501	SO:0001583	missense	3673				axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity	g.chr5:52362956G>C		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.1952G>C	5.37:g.52362956G>C	ENSP00000296585:p.Ser651Thr					ITGA2_uc011cqa.1_RNA|ITGA2_uc011cqb.1_RNA|ITGA2_uc011cqc.1_Missense_Mutation_p.S575T|ITGA2_uc011cqd.1_RNA|ITGA2_uc011cqe.1_RNA	p.S651T	NM_002203	NP_002194	P17301	ITA2_HUMAN			16	2095	+		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)	651			FG-GAP 7.|Extracellular (Potential).		Q14595	Missense_Mutation	SNP	ENST00000296585.5	37	c.1952G>C	CCDS3957.1	.	.	.	.	.	.	.	.	.	.	G	9.624	1.134532	0.21123	.	.	ENSG00000164171	ENST00000296585	T	0.48201	0.82	4.66	4.66	0.58398	Integrin alpha-2 (1);	0.152244	0.64402	D	0.000012	T	0.38214	0.1032	L	0.36672	1.1	0.35437	D	0.794524	B;B	0.14438	0.003;0.01	B;B	0.13407	0.008;0.009	T	0.49862	-0.8894	10	0.72032	D	0.01	.	11.4462	0.50125	0.0831:0.0:0.9169:0.0	.	651;651	E7ESP4;P17301	.;ITA2_HUMAN	T	651	ENSP00000296585:S651T	ENSP00000296585:S651T	S	+	2	0	ITGA2	52398713	1.000000	0.71417	0.927000	0.36925	0.936000	0.57629	5.063000	0.64332	2.313000	0.78055	0.561000	0.74099	AGT		0.373	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203		9	46	0	0	0	0.006214	0	9	46				
KIF2A	3796	broad.mit.edu	37	5	61651013	61651013	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:61651013G>A	ENST00000401507.3	+	7	897	c.586G>A	c.(586-588)Gaa>Aaa	p.E196K	KIF2A_ENST00000381103.2_Missense_Mutation_p.E176K|KIF2A_ENST00000506857.1_Missense_Mutation_p.E150K|KIF2A_ENST00000509663.2_Intron|KIF2A_ENST00000407818.3_Missense_Mutation_p.E196K	NM_001243953.1|NM_004520.4	NP_001230882.1|NP_004511.2	O00139	KIF2A_HUMAN	kinesin heavy chain member 2A	196	Globular. {ECO:0000255}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|nervous system development (GO:0007399)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	15		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		CCCAAATTATGAAATTATGTG	0.299																																							uc003jsy.3		NA																	0					0						c.(586-588)GAA>AAA		kinesin heavy chain member 2 isoform 1							89.0	95.0	93.0					5																	61651013		2203	4300	6503	SO:0001583	missense	3796				blood coagulation|cell differentiation|cell division|microtubule-based movement|mitotic prometaphase|mitotic spindle organization|nervous system development	centrosome|cytosol|microtubule|spindle pole	ATP binding|microtubule motor activity|protein binding	g.chr5:61651013G>A	BC031828	CCDS3980.2, CCDS47216.1, CCDS58949.1	5q12-q13	2008-02-05	2006-09-26	2006-09-26	ENSG00000068796	ENSG00000068796		"""Kinesins"""	6318	protein-coding gene	gene with protein product		602591	"""kinesin heavy chain member 2"""	KIF2		9177777	Standard	NM_001098511		Approved	HK2	uc003jsz.4	O00139	OTTHUMG00000097755	ENST00000401507.3:c.586G>A	5.37:g.61651013G>A	ENSP00000385622:p.Glu196Lys					KIF2A_uc003jsz.3_Missense_Mutation_p.E196K|KIF2A_uc010iwp.2_Missense_Mutation_p.E177K|KIF2A_uc003jsx.3_Missense_Mutation_p.E176K|KIF2A_uc010iwq.2_5'UTR	p.E196K	NM_004520	NP_004511	O00139	KIF2A_HUMAN		Lung(70;0.14)	7	897	+		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)	196			Globular (Potential).		A5YM42|A5YM54|B4DY54|D3DW97|E9PB70|Q7Z5I3|Q8N5Q7	Missense_Mutation	SNP	ENST00000401507.3	37	c.586G>A	CCDS3980.2	.	.	.	.	.	.	.	.	.	.	G	36	5.717308	0.96839	.	.	ENSG00000068796	ENST00000401507;ENST00000381103;ENST00000514082;ENST00000407818;ENST00000506857	T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.45597	0.1350	M	0.87547	2.89	0.80722	D	1	P;D;D;P	0.65815	0.947;0.969;0.995;0.947	P;P;P;P	0.58013	0.742;0.828;0.831;0.742	T	0.53365	-0.8449	10	0.72032	D	0.01	.	19.3436	0.94355	0.0:0.0:1.0:0.0	.	196;196;196;176	B4DM85;O00139-4;O00139;E9PB70	.;.;KIF2A_HUMAN;.	K	196;176;177;196;150	ENSP00000385622:E196K;ENSP00000370493:E176K;ENSP00000423542:E177K;ENSP00000385000:E196K;ENSP00000423772:E150K	ENSP00000370493:E176K	E	+	1	0	KIF2A	61686770	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.378000	0.97191	2.583000	0.87209	0.580000	0.79431	GAA		0.299	KIF2A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317989.1	NM_004520		17	54	0	0	0	0.008871	0	17	54				
MSH3	4437	broad.mit.edu	37	5	80171579	80171579	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:80171579C>G	ENST00000265081.6	+	24	3392	c.3312C>G	c.(3310-3312)ctC>ctG	p.L1104L		NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	1104					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		GAAAGAGACTCAAGTATTTTG	0.363								Mismatch excision repair (MMR)																													Melanoma(88;1010 1399 13793 26548 36275)	Melanoma(88;1010 1399 13793 26548 36275)	uc003kgz.2		NA																	0				lung(2)|ovary(1)|breast(1)	4						c.(3310-3312)CTC>CTG	MMR	mutS homolog 3							62.0	61.0	62.0					5																	80171579		2203	4300	6503	SO:0001819	synonymous_variant	4437				maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding	g.chr5:80171579C>G	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.3312C>G	5.37:g.80171579C>G							p.L1104L	NM_002439	NP_002430	P20585	MSH3_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)	24	3565	+		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)	1104					A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Silent	SNP	ENST00000265081.6	37	c.3312C>G	CCDS34195.1																																																																																				0.363	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439		9	45	0	0	0	0.010729	0	9	45				
VCAN	1462	broad.mit.edu	37	5	82786003	82786003	+	Missense_Mutation	SNP	C	C	A	rs201466502		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:82786003C>A	ENST00000265077.3	+	3	722	c.157C>A	c.(157-159)Cca>Aca	p.P53T	VCAN_ENST00000513984.1_Missense_Mutation_p.P53T|VCAN_ENST00000512590.2_Missense_Mutation_p.P5T|VCAN_ENST00000343200.5_Missense_Mutation_p.P53T|VCAN_ENST00000342785.4_Missense_Mutation_p.P53T|VCAN_ENST00000502527.2_Missense_Mutation_p.P53T	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	53	Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GCCTACTTTGCCACCCAGTTA	0.453																																							uc003kii.3		NA																	0				ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16						c.(157-159)CCA>ACA		versican isoform 1 precursor							87.0	84.0	85.0					5																	82786003		2203	4300	6503	SO:0001583	missense	1462				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding	g.chr5:82786003C>A	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.157C>A	5.37:g.82786003C>A	ENSP00000265077:p.Pro53Thr					VCAN_uc003kij.3_Missense_Mutation_p.P53T|VCAN_uc010jau.2_Missense_Mutation_p.P53T|VCAN_uc003kik.3_Missense_Mutation_p.P53T|VCAN_uc003kih.3_Missense_Mutation_p.P53T	p.P53T	NM_004385	NP_004376	P13611	CSPG2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	3	513	+		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)	53			Ig-like V-type.		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	c.157C>A	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	C	8.467	0.856676	0.17106	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000342785;ENST00000512590;ENST00000513960;ENST00000513984;ENST00000502527	T;T;T;T;T;T;T	0.66638	1.63;1.63;1.63;-0.22;1.63;1.63;1.63	5.78	4.91	0.64330	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000009	T	0.57770	0.2076	L	0.48362	1.52	0.34816	D	0.738239	B;P;P;B;B	0.37276	0.234;0.486;0.589;0.277;0.002	B;B;B;B;B	0.40940	0.197;0.149;0.344;0.297;0.01	T	0.61505	-0.7049	10	0.11794	T	0.64	.	9.1789	0.37129	0.0:0.7425:0.1221:0.1354	.	53;53;53;53;53	P13611-3;P13611-4;P13611-2;P13611;Q86W61	.;.;.;CSPG2_HUMAN;.	T	53;53;53;5;53;53;53	ENSP00000265077:P53T;ENSP00000340062:P53T;ENSP00000342768:P53T;ENSP00000425959:P5T;ENSP00000426251:P53T;ENSP00000426715:P53T;ENSP00000421362:P53T	ENSP00000265077:P53T	P	+	1	0	VCAN	82821759	0.038000	0.19896	0.982000	0.44146	0.068000	0.16541	0.347000	0.20014	1.454000	0.47793	-0.137000	0.14449	CCA		0.453	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385		39	65	1	0	4.92203e-23	0.00623	6.04602e-23	39	65				
CAST	831	broad.mit.edu	37	5	96093323	96093323	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:96093323G>A	ENST00000341926.3	+	22	1711	c.1549G>A	c.(1549-1551)Gag>Aag	p.E517K	CAST_ENST00000359176.4_Missense_Mutation_p.E581K|CAST_ENST00000509903.1_Missense_Mutation_p.E482K|CAST_ENST00000395813.1_Missense_Mutation_p.E600K|CAST_ENST00000348386.3_3'UTR|CAST_ENST00000508608.1_Missense_Mutation_p.E563K|CAST_ENST00000338252.3_Missense_Mutation_p.E504K|CAST_ENST00000395812.2_Missense_Mutation_p.E559K|CAST_ENST00000504465.1_Missense_Mutation_p.E445K|CAST_ENST00000511049.1_Missense_Mutation_p.E503K|CAST_ENST00000325674.7_Missense_Mutation_p.E565K|CAST_ENST00000508579.1_Missense_Mutation_p.E232K|CAST_ENST00000510756.1_Missense_Mutation_p.E578K|CAST_ENST00000515663.1_Missense_Mutation_p.E240K|CAST_ENST00000511782.1_Missense_Mutation_p.E503K|CAST_ENST00000309190.5_Missense_Mutation_p.E495K|CAST_ENST00000508830.1_Missense_Mutation_p.E600K			P20810	ICAL_HUMAN	calpastatin	517					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	22		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		TGCTTTGTCTGAGGACTTCTC	0.383																																							uc003klz.1		NA																	0				central_nervous_system(3)|ovary(1)|kidney(1)	5						c.(1549-1551)GAG>AAG		calpastatin isoform i							136.0	129.0	132.0					5																	96093323		2203	4300	6503	SO:0001583	missense	831						calcium-dependent cysteine-type endopeptidase inhibitor activity|protein binding	g.chr5:96093323G>A	AF327443	CCDS4082.1, CCDS54882.1, CCDS54883.1, CCDS75279.1	5q15	2012-09-20			ENSG00000153113	ENSG00000153113			1515	protein-coding gene	gene with protein product		114090				8340353, 14685690, 15820218	Standard	NM_173060		Approved		uc003klx.3	P20810	OTTHUMG00000128413	ENST00000341926.3:c.1549G>A	5.37:g.96093323G>A	ENSP00000339914:p.Glu517Lys					CAST_uc003klt.2_Missense_Mutation_p.E504K|CAST_uc003klu.2_Missense_Mutation_p.E600K|CAST_uc003klv.2_Missense_Mutation_p.E578K|CAST_uc003klw.2_Missense_Mutation_p.E581K|CAST_uc003klx.2_Missense_Mutation_p.E559K|CAST_uc003kly.2_Missense_Mutation_p.E565K|CAST_uc011cuo.1_Missense_Mutation_p.E563K|CAST_uc011cur.1_Missense_Mutation_p.E503K|CAST_uc011cus.1_Missense_Mutation_p.E504K|CAST_uc003kma.1_Missense_Mutation_p.E476K|CAST_uc011cut.1_Missense_Mutation_p.E445K|CAST_uc003kmb.2_Missense_Mutation_p.E463K|CAST_uc003kmc.2_Missense_Mutation_p.E517K|CAST_uc003kmd.2_Missense_Mutation_p.E495K|CAST_uc003kme.2_Missense_Mutation_p.E476K|CAST_uc003kmf.2_Missense_Mutation_p.E482K|CAST_uc003kmh.2_Missense_Mutation_p.E232K|CAST_uc010jbj.2_Missense_Mutation_p.E232K|CAST_uc010jbk.2_Missense_Mutation_p.E232K|CAST_uc010jbl.1_Missense_Mutation_p.E240K|CAST_uc003kmi.2_RNA|CAST_uc003kmj.2_Missense_Mutation_p.E240K|CAST_uc003kmk.2_RNA	p.E517K	NM_001042443	NP_001035908	P20810	ICAL_HUMAN		all cancers(79;6.85e-15)	22	1711	+		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)	517					B7Z468|G5E946|G5E9D3|O95360|Q05DE8|Q7Z4K0|Q96D08|Q9H1Z5	Missense_Mutation	SNP	ENST00000341926.3	37	c.1549G>A		.	.	.	.	.	.	.	.	.	.	G	12.35	1.912080	0.33721	.	.	ENSG00000153113	ENST00000338252;ENST00000508830;ENST00000395813;ENST00000359176;ENST00000325674;ENST00000395812;ENST00000510756;ENST00000508608;ENST00000341926;ENST00000511049;ENST00000309190;ENST00000510156;ENST00000504465;ENST00000509903;ENST00000511782;ENST00000508579;ENST00000515663	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.16324	2.35;2.35;2.35;2.35;2.35;2.35;2.35;2.35;2.35;2.35;2.35;2.35;2.35;2.35;2.35;2.35;2.35	5.9	0.627	0.17675	.	0.437392	0.26635	N	0.023296	T	0.08537	0.0212	N	0.16708	0.43	0.28985	N	0.888419	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.11235	0.002;0.001;0.0;0.001;0.0;0.002;0.002;0.001;0.001;0.004;0.003;0.002;0.002;0.001;0.003;0.002	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.17979	0.007;0.003;0.003;0.007;0.003;0.02;0.009;0.005;0.004;0.009;0.004;0.009;0.008;0.003;0.008;0.005	T	0.39961	-0.9588	10	0.09843	T	0.71	-5.2537	10.054	0.42233	0.0803:0.212:0.7077:0.0	.	445;563;240;268;240;503;482;495;476;517;565;559;581;578;600;504	E9PDE4;B7Z468;E7EQA0;Q86YM9;E7EPY6;E7EVY3;E9PCH5;G5E946;P20810-4;P20810;P20810-5;G5E9D3;P20810-7;E7ESM9;P20810-6;P20810-2	.;.;.;.;.;.;.;.;.;ICAL_HUMAN;.;.;.;.;.;.	K	504;600;600;581;565;559;578;563;517;503;495;517;445;482;503;232;240	ENSP00000343421:E504K;ENSP00000425721:E600K;ENSP00000379158:E600K;ENSP00000352098:E581K;ENSP00000320319:E565K;ENSP00000379157:E559K;ENSP00000422176:E578K;ENSP00000422677:E563K;ENSP00000339914:E517K;ENSP00000421130:E503K;ENSP00000312523:E495K;ENSP00000422325:E517K;ENSP00000425670:E445K;ENSP00000426946:E482K;ENSP00000423638:E503K;ENSP00000425787:E232K;ENSP00000422929:E240K	ENSP00000312523:E495K	E	+	1	0	CAST	96119079	0.973000	0.33851	0.977000	0.42913	0.976000	0.68499	0.067000	0.14510	-0.181000	0.10619	0.650000	0.86243	GAG		0.383	CAST-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000250199.2	NM_173062		12	59	0	0	0	0.001855	0	12	59				
ALDH7A1	501	broad.mit.edu	37	5	125896781	125896781	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:125896781T>C	ENST00000409134.3	-	10	1126	c.907A>G	c.(907-909)Att>Gtt	p.I303V	ALDH7A1_ENST00000447989.2_Missense_Mutation_p.I330V|ALDH7A1_ENST00000553117.1_Missense_Mutation_p.I303V	NM_001182.4|NM_001201377.1	NP_001173.2|NP_001188306.1	P49419	AL7A1_HUMAN	aldehyde dehydrogenase 7 family, member A1	303					cellular aldehyde metabolic process (GO:0006081)|cellular nitrogen compound metabolic process (GO:0034641)|glycine betaine biosynthetic process from choline (GO:0019285)|lysine catabolic process (GO:0006554)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|betaine-aldehyde dehydrogenase activity (GO:0008802)|L-aminoadipate-semialdehyde dehydrogenase activity (GO:0004043)			endometrium(1)|kidney(4)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.24)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0417)|OV - Ovarian serous cystadenocarcinoma(64;0.068)|all cancers(49;0.109)		TTACCAATAATGGCATTGTTT	0.363																																							uc003ktx.2		NA																	0				kidney(2)|ovary(1)	3						c.(907-909)ATT>GTT		aldehyde dehydrogenase 7 family, member A1	NADH(DB00157)|Pyridoxine(DB00165)						137.0	134.0	135.0					5																	125896781		2203	4300	6503	SO:0001583	missense	501				cellular aldehyde metabolic process|lysine catabolic process|sensory perception of sound	cytosol|mitochondrial matrix|nucleus	aldehyde dehydrogenase (NAD) activity|betaine-aldehyde dehydrogenase activity|L-aminoadipate-semialdehyde dehydrogenase activity	g.chr5:125896781T>C	S74728	CCDS4137.2, CCDS56380.1	5q31	2013-06-03			ENSG00000164904	ENSG00000164904	1.2.1.31	"""Aldehyde dehydrogenases"""	877	protein-coding gene	gene with protein product	"""antiquitin 1"", ""26g turgor protein homolog"", ""alpha-aminoadipic semialdehyde dehydrogenase"", ""alpha-AASA dehydrogenase"", ""delta1-piperideine-6-carboxylate dehydrogenease"", ""P6c dehydrogenase"""	107323		ATQ1		9417906	Standard	NM_001182		Approved	EPD, PDE	uc003ktx.3	P49419	OTTHUMG00000128942	ENST00000409134.3:c.907A>G	5.37:g.125896781T>C	ENSP00000387123:p.Ile303Val					ALDH7A1_uc003ktv.2_5'UTR|ALDH7A1_uc003kty.2_RNA|ALDH7A1_uc011cxa.1_Missense_Mutation_p.I330V	p.I303V	NM_001182	NP_001173	P49419	AL7A1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0417)|OV - Ovarian serous cystadenocarcinoma(64;0.068)|all cancers(49;0.109)	10	1099	-		all_cancers(142;0.24)|Prostate(80;0.081)	303					B2R669|B4DIC7|B4DMA0|E7EPT3|O14619|Q6IPU8|Q9BUL4	Missense_Mutation	SNP	ENST00000409134.3	37	c.907A>G	CCDS4137.2	.	.	.	.	.	.	.	.	.	.	T	13.53	2.263309	0.39995	.	.	ENSG00000164904	ENST00000409134;ENST00000553117;ENST00000447989;ENST00000437170	T;T;T	0.75938	-0.98;-0.98;-0.98	5.9	5.9	0.94986	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.049125	0.85682	D	0.000000	T	0.76955	0.4060	L	0.33339	1.005	0.80722	D	1	P;P	0.52577	0.732;0.954	P;P	0.56916	0.657;0.809	T	0.76926	-0.2778	10	0.42905	T	0.14	.	15.9889	0.80183	0.0:0.0:0.0:1.0	.	330;303	E7EPT3;P49419	.;AL7A1_HUMAN	V	303;303;330;111	ENSP00000387123:I303V;ENSP00000448593:I303V;ENSP00000414132:I330V	ENSP00000387123:I303V	I	-	1	0	ALDH7A1	125924680	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.599000	0.67592	2.266000	0.75297	0.528000	0.53228	ATT		0.363	ALDH7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250921.2	NM_001182		17	100	0	0	0	0.006122	0	17	100				
CTXN3	613212	broad.mit.edu	37	5	126993409	126993409	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:126993409G>C	ENST00000379445.3	+	3	747	c.196G>C	c.(196-198)Gat>Cat	p.D66H	CTXN3_ENST00000395322.3_Missense_Mutation_p.D66H|CTC-548H10.2_ENST00000512352.1_RNA	NM_001048252.2	NP_001041717.1	Q4LDR2	CTXN3_HUMAN	cortexin 3	66						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(1)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0128)|COAD - Colon adenocarcinoma(49;0.0234)|OV - Ovarian serous cystadenocarcinoma(64;0.038)		TACCTGGGCTGATGGACTTGA	0.488																																							uc003kul.3		NA																	0					0						c.(196-198)GAT>CAT		cortexin 3							92.0	86.0	88.0					5																	126993409		2203	4300	6503	SO:0001583	missense	613212					integral to membrane		g.chr5:126993409G>C	AB219764	CCDS34221.1	5q23.2	2006-09-21				ENSG00000205279			31110	protein-coding gene	gene with protein product							Standard	NM_001048252		Approved		uc003kum.4	Q4LDR2		ENST00000379445.3:c.196G>C	5.37:g.126993409G>C	ENSP00000368758:p.Asp66His					CTXN3_uc003kum.3_Missense_Mutation_p.D66H	p.D66H	NM_001048252	NP_001041717	Q4LDR2	CTXN3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0128)|COAD - Colon adenocarcinoma(49;0.0234)|OV - Ovarian serous cystadenocarcinoma(64;0.038)	3	770	+		Prostate(80;0.165)	66					B2RV32|D3DQ82	Missense_Mutation	SNP	ENST00000379445.3	37	c.196G>C	CCDS34221.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716896	0.89205	.	.	ENSG00000205279	ENST00000379445;ENST00000395322	T;T	0.54279	0.58;0.58	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	T	0.73853	0.3640	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77493	-0.2567	9	0.87932	D	0	-28.0008	18.1587	0.89702	0.0:0.0:1.0:0.0	.	66	Q4LDR2	CTXN3_HUMAN	H	66	ENSP00000368758:D66H;ENSP00000378732:D66H	ENSP00000368758:D66H	D	+	1	0	CTXN3	127021308	1.000000	0.71417	0.990000	0.47175	0.987000	0.75469	9.000000	0.93564	2.793000	0.96121	0.655000	0.94253	GAT		0.488	CTXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372467.1	XM_932841		9	70	0	0	0	0.008291	0	9	70				
SLC22A4	6583	broad.mit.edu	37	5	131630476	131630476	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:131630476C>G	ENST00000200652.3	+	1	341	c.167C>G	c.(166-168)gCg>gGg	p.A56G	P4HA2_ENST00000471826.1_Intron	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	56					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	CCGGACGCCGCGAACCTGAGC	0.682																																							uc003kwq.2		NA																	0					0						c.(166-168)GCG>GGG		solute carrier family 22 member 4	L-Carnitine(DB00583)						31.0	37.0	35.0					5																	131630476		2202	4299	6501	SO:0001583	missense	6583				body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity	g.chr5:131630476C>G	AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.167C>G	5.37:g.131630476C>G	ENSP00000200652:p.Ala56Gly					uc003kwm.3_Intron|SLC22A4_uc010jdq.1_5'Flank	p.A56G	NM_003059	NP_003050	Q9H015	S22A4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		1	332	+		all_cancers(142;0.0752)|Breast(839;0.198)	56			Extracellular (Potential).		O14546	Missense_Mutation	SNP	ENST00000200652.3	37	c.167C>G	CCDS4153.1	.	.	.	.	.	.	.	.	.	.	C	16.42	3.117257	0.56505	.	.	ENSG00000197208	ENST00000200652	T	0.74106	-0.81	4.45	3.57	0.40892	Major facilitator superfamily domain, general substrate transporter (1);	0.740466	0.12581	N	0.456437	T	0.74107	0.3673	M	0.78223	2.4	0.37284	D	0.907945	B	0.18863	0.031	B	0.23852	0.049	T	0.70414	-0.4878	10	0.25106	T	0.35	.	11.8896	0.52622	0.0:0.9128:0.0:0.0872	.	56	Q9H015	S22A4_HUMAN	G	56	ENSP00000200652:A56G	ENSP00000200652:A56G	A	+	2	0	SLC22A4	131658375	1.000000	0.71417	0.983000	0.44433	0.891000	0.51852	1.480000	0.35464	1.192000	0.43071	0.491000	0.48974	GCG		0.682	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132661.1	NM_003059		13	43	0	0	0	0.001855	0	13	43				
PCDHA2	56146	broad.mit.edu	37	5	140175984	140175984	+	Missense_Mutation	SNP	G	G	T	rs17844250		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:140175984G>T	ENST00000526136.1	+	1	1435	c.1435G>T	c.(1435-1437)Gcg>Tcg	p.A479S	PCDHA2_ENST00000378132.1_Missense_Mutation_p.A479S|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000520672.2_Missense_Mutation_p.A479S|PCDHA1_ENST00000394633.3_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	479	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACGGTGTCAGCGTGGGATGC	0.657																																							uc003lhd.2		NA																	0				ovary(4)	4						c.(1435-1437)GCG>TCG		protocadherin alpha 2 isoform 1 precursor							72.0	75.0	74.0					5																	140175984		2203	4300	6503	SO:0001583	missense	56146				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140175984G>T	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1435G>T	5.37:g.140175984G>T	ENSP00000431748:p.Ala479Ser					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Missense_Mutation_p.A479S|PCDHA2_uc011czy.1_Missense_Mutation_p.A479S	p.A479S	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1541	+			479			Cadherin 5.|Extracellular (Potential).		O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	c.1435G>T	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	g	17.53	3.412180	0.62511	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.61510	0.1;0.1;0.1	3.94	3.94	0.45596	Cadherin (4);Cadherin-like (1);	0.000000	0.39475	U	0.001347	T	0.81288	0.4791	M	0.92833	3.35	0.46981	D	0.999273	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.87234	0.2262	10	0.87932	D	0	.	16.402	0.83643	0.0:0.0:1.0:0.0	.	479;479;479	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	S	479	ENSP00000430584:A479S;ENSP00000367372:A479S;ENSP00000431748:A479S	ENSP00000367372:A479S	A	+	1	0	PCDHA2	140156168	1.000000	0.71417	0.732000	0.30844	0.192000	0.23643	9.316000	0.96319	1.915000	0.55452	0.644000	0.83932	GCG		0.657	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905		41	69	1	0	7.05121e-23	0.010771	8.62965e-23	41	69				
PCDHA5	56143	broad.mit.edu	37	5	140203212	140203212	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:140203212C>T	ENST00000529859.1	+	1	1852	c.1852C>T	c.(1852-1854)Cgc>Tgc	p.R618C	PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.R618C|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.R618C|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	618	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGCAGTGCGCGCATCCCGTT	0.652																																							uc003lhl.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(1852-1854)CGC>TGC		protocadherin alpha 5 isoform 1 precursor							74.0	77.0	76.0					5																	140203212		2203	4300	6503	SO:0001583	missense	56143				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140203212C>T	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1852C>T	5.37:g.140203212C>T	ENSP00000436557:p.Arg618Cys					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Missense_Mutation_p.R618C|PCDHA5_uc003lhj.1_Missense_Mutation_p.R618C	p.R618C	NM_018908	NP_061731	Q9Y5H7	PCDA5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1852	+			618			Extracellular (Potential).|Cadherin 6.		O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	c.1852C>T	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.808547	0.31961	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.52983	0.64;0.64;0.64	3.87	2.98	0.34508	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.67040	0.2851	M	0.85462	2.755	0.34779	D	0.734581	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.65140	0.932;0.921;0.924	T	0.76916	-0.2782	9	0.66056	D	0.02	.	10.4141	0.44311	0.1957:0.8043:0.0:0.0	.	618;618;618	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	C	618	ENSP00000433416:R618C;ENSP00000436557:R618C;ENSP00000367366:R618C	ENSP00000367366:R618C	R	+	1	0	PCDHA5	140183396	0.004000	0.15560	0.130000	0.21974	0.286000	0.27126	1.039000	0.30266	0.733000	0.32492	0.306000	0.20318	CGC		0.652	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908		32	53	0	0	0	0.003755	0	32	53				
PCDHGA4	56111	broad.mit.edu	37	5	140736861	140736861	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:140736861C>T	ENST00000571252.1	+	1	2094	c.2094C>T	c.(2092-2094)gcC>gcT	p.A698A	PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	698					homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGCAGTGGCCGCTGTCTCCT	0.607																																							uc003ljq.1		NA																	0					0						c.(2092-2094)GCC>GCT		protocadherin gamma subfamily A, 4 isoform 1							40.0	45.0	43.0					5																	140736861		2202	4300	6502	SO:0001819	synonymous_variant	56111				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140736861C>T	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.2094C>T	5.37:g.140736861C>T						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGB2_uc003ljs.1_5'Flank|PCDHGA4_uc003ljp.1_Silent_p.A698A|PCDHGB2_uc011dar.1_5'Flank	p.A698A	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2094	+			698			Helical; (Potential).		Q9Y5D3	Silent	SNP	ENST00000571252.1	37	c.2094C>T	CCDS58979.1																																																																																				0.607	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917		16	29	0	0	0	0.007413	0	16	29				
PCDHGB3	56102	broad.mit.edu	37	5	140751042	140751042	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:140751042G>T	ENST00000576222.1	+	1	1212	c.1081G>T	c.(1081-1083)Gag>Tag	p.E361*	PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_5'Flank|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	361	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAAGATGCTGAGCTGGGGAC	0.403																																							uc003ljw.1		NA																	0					0						c.(1081-1083)GAG>TAG		protocadherin gamma subfamily B, 3 isoform 1							42.0	42.0	42.0					5																	140751042		1924	4147	6071	SO:0001587	stop_gained	56102				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140751042G>T	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.1081G>T	5.37:g.140751042G>T	ENSP00000461862:p.Glu361*					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGA6_uc003ljy.1_5'Flank|PCDHGB3_uc011dat.1_Nonsense_Mutation_p.E361*|PCDHGA6_uc011dau.1_5'Flank	p.E361*	NM_018924	NP_061747	Q9Y5G1	PCDGF_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1081	+			361			Extracellular (Potential).|Cadherin 4.		A7E229|Q9Y5C7	Nonsense_Mutation	SNP	ENST00000576222.1	37	c.1081G>T	CCDS58980.1																																																																																				0.403	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924		8	15	1	0	5.18039e-06	0.00308	5.5821e-06	8	15				
PCDHGA7	56108	broad.mit.edu	37	5	140764134	140764134	+	Silent	SNP	T	T	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:140764134T>C	ENST00000518325.1	+	1	1668	c.1668T>C	c.(1666-1668)aaT>aaC	p.N556N	PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018920.2	NP_061743.1	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7	556	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(1)|endometrium(8)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|skin(1)|stomach(3)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGACCAGAATGACAACCCGC	0.602																																							uc003lka.1		NA																	0					0						c.(1666-1668)AAT>AAC		protocadherin gamma subfamily A, 7 isoform 1							89.0	104.0	99.0					5																	140764134		2198	4299	6497	SO:0001819	synonymous_variant	56108				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140764134T>C	AF152514	CCDS54927.1, CCDS75336.1	5q31	2010-01-26				ENSG00000253537		"""Cadherins / Protocadherins : Clustered"""	8705	other	protocadherin		606294				10380929	Standard	NM_018920		Approved	PCDH-GAMMA-A7		Q9Y5G6		ENST00000518325.1:c.1668T>C	5.37:g.140764134T>C						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003ljz.1_Silent_p.N556N	p.N556N	NM_018920	NP_061743	Q9Y5G6	PCDG7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1668	+			556			Extracellular (Potential).|Cadherin 5.		B2RN87|Q9Y5D0	Silent	SNP	ENST00000518325.1	37	c.1668T>C	CCDS54927.1																																																																																				0.602	PCDHGA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374744.1	NM_018920		34	111	0	0	0	0.004878	0	34	111				
NR3C1	2908	broad.mit.edu	37	5	142779799	142779799	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:142779799C>T	ENST00000343796.2	-	2	1599	c.606G>A	c.(604-606)ggG>ggA	p.G202G	NR3C1_ENST00000394466.2_Silent_p.G202G|NR3C1_ENST00000503201.1_Silent_p.G202G|NR3C1_ENST00000416954.2_Intron|NR3C1_ENST00000504572.1_Silent_p.G202G|NR3C1_ENST00000394464.2_Silent_p.G202G|NR3C1_ENST00000231509.3_Silent_p.G202G|NR3C1_ENST00000424646.2_Silent_p.G202G|NR3C1_ENST00000415690.2_Silent_p.G202G	NM_001018074.1|NM_001018075.1|NM_001018077.1	NP_001018084.1|NP_001018085.1|NP_001018087.1	P04150	GCR_HUMAN	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	202	Modulating.				adrenal gland development (GO:0030325)|chromatin modification (GO:0016568)|gene expression (GO:0010467)|glucocorticoid metabolic process (GO:0008211)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of glucocorticoid mediated signaling pathway (GO:1900170)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucocorticoid biosynthetic process (GO:0031946)|regulation of gluconeogenesis (GO:0006111)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	glucocorticoid receptor activity (GO:0004883)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|zinc ion binding (GO:0008270)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	35		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Budesonide(DB01222)|Ciclesonide(DB01410)|Clobetasol propionate(DB01013)|Clocortolone(DB00838)|Cortisone acetate(DB01380)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Difluprednate(DB06781)|Fludrocortisone(DB00687)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Fluoxymesterone(DB01185)|Flurandrenolide(DB00846)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol(DB00873)|Medrysone(DB00253)|Megestrol acetate(DB00351)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Paramethasone(DB01384)|Prednicarbate(DB01130)|Prednisolone(DB00860)|Prednisone(DB00635)|Rimexolone(DB00896)|Spironolactone(DB00421)|Triamcinolone(DB00620)	TACCTGGGGACCCAGAAGAAA	0.463																																							uc003lmz.2		NA																	0				ovary(2)	2						c.(604-606)GGG>GGA		glucocorticoid receptor isoform alpha	Amcinonide(DB00288)|Betamethasone(DB00443)|Budesonide(DB01222)|Dexamethasone(DB01234)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluticasone Propionate(DB00588)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol Etabonate(DB00873)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Prednisone(DB00635)						65.0	68.0	67.0					5																	142779799		2203	4300	6503	SO:0001819	synonymous_variant	2908				chromatin modification|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus|transcription from RNA polymerase II promoter	mitochondrial matrix|nucleoplasm	glucocorticoid receptor activity|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding	g.chr5:142779799C>T	X03225	CCDS4278.1, CCDS34258.1, CCDS47298.1	5q31-q32	2013-01-16	2002-08-27		ENSG00000113580	ENSG00000113580		"""Nuclear hormone receptors"""	7978	protein-coding gene	gene with protein product		138040	"""nuclear receptor subfamily 3, group C, member 1"""	GRL		2867473	Standard	NM_001204258		Approved	GR	uc003lnb.3	P04150	OTTHUMG00000129677	ENST00000343796.2:c.606G>A	5.37:g.142779799C>T						NR3C1_uc003lmy.2_Silent_p.G202G|NR3C1_uc003lna.2_Silent_p.G202G|NR3C1_uc003lnb.2_Silent_p.G202G|NR3C1_uc011dbk.1_Intron|NR3C1_uc003lnc.2_Silent_p.G202G|NR3C1_uc003lnd.2_Silent_p.G202G|NR3C1_uc003lne.2_Silent_p.G202G|NR3C1_uc003lnf.2_Silent_p.G202G|NR3C1_uc003lng.2_Silent_p.G202G|NR3C1_uc003lnh.2_Silent_p.G202G|NR3C1_uc003lni.2_Silent_p.G202G	p.G202G	NM_000176	NP_000167	P04150	GCR_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		2	1098	-		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	202			Modulating.		A0ZXF9|B0LPG8|D3DQF4|P04151|Q53EP5|Q6N0A4	Silent	SNP	ENST00000343796.2	37	c.606G>A	CCDS4278.1																																																																																				0.463	NR3C1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370829.1			9	42	0	0	0	0.006214	0	9	42				
JAKMIP2	9832	broad.mit.edu	37	5	146997621	146997621	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:146997621G>C	ENST00000265272.5	-	19	2666	c.2199C>G	c.(2197-2199)atC>atG	p.I733M	JAKMIP2_ENST00000333010.6_Missense_Mutation_p.I691M|JAKMIP2_ENST00000507386.1_Missense_Mutation_p.I712M	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	733						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACCAAACTTGATAACAGTTT	0.403																																							uc003loq.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(2197-2199)ATC>ATG		janus kinase and microtubule interacting protein							153.0	143.0	146.0					5																	146997621		2203	4300	6503	SO:0001583	missense	9832					Golgi apparatus		g.chr5:146997621G>C	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.2199C>G	5.37:g.146997621G>C	ENSP00000265272:p.Ile733Met					JAKMIP2_uc011dbx.1_Missense_Mutation_p.I691M|JAKMIP2_uc003lor.1_Missense_Mutation_p.I712M|uc003lop.1_Intron|JAKMIP2_uc010jgo.1_Missense_Mutation_p.I733M	p.I733M	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		19	2581	-			733			Potential.		A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	c.2199C>G	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	G	14.52	2.560085	0.45590	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.23147	1.92;1.92;1.92	5.61	2.72	0.32119	.	0.247105	0.39407	N	0.001366	T	0.23727	0.0574	L	0.44542	1.39	0.43982	D	0.996671	D;D;D;D	0.54207	0.965;0.965;0.965;0.965	P;P;P;P	0.47981	0.563;0.563;0.563;0.466	T	0.01858	-1.1259	10	0.32370	T	0.25	.	7.2731	0.26268	0.1532:0.0:0.6524:0.1944	.	691;733;712;733	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	M	712;733;691;712	ENSP00000421398:I712M;ENSP00000265272:I733M;ENSP00000328989:I691M	ENSP00000265272:I733M	I	-	3	3	JAKMIP2	146977814	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.333000	0.43912	0.857000	0.35407	-0.251000	0.11542	ATC		0.403	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790		33	54	0	0	0	0.00623	0	33	54				
SYNPO	11346	broad.mit.edu	37	5	150028936	150028936	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:150028936C>T	ENST00000394243.1	+	3	2205	c.1831C>T	c.(1831-1833)Ctg>Ttg	p.L611L	SYNPO_ENST00000522122.1_Silent_p.L611L|SYNPO_ENST00000519664.1_Silent_p.L367L|SYNPO_ENST00000307662.4_Silent_p.L367L	NM_001166208.1	NP_001159680.1	Q8N3V7	SYNPO_HUMAN	synaptopodin	611					positive regulation of actin filament bundle assembly (GO:0032233)|regulation of stress fiber assembly (GO:0051492)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic membrane (GO:0045211)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin binding (GO:0003779)			NS(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(4)|prostate(1)|urinary_tract(2)	18		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GACGGGCATTCTGGAGGAGTC	0.582																																							uc003lsn.2		NA																	0				large_intestine(1)	1						c.(1831-1833)CTG>TTG		synaptopodin isoform B							43.0	51.0	48.0					5																	150028936		2203	4298	6501	SO:0001819	synonymous_variant	11346				positive regulation of actin filament bundle assembly|regulation of stress fiber assembly	actin cytoskeleton|cytoplasm|dendritic spine|perikaryon|postsynaptic density|postsynaptic membrane|tight junction	actin binding|protein binding	g.chr5:150028936C>T	AF499137	CCDS4308.1, CCDS54937.1, CCDS54938.1	5q33.1	2008-02-05			ENSG00000171992	ENSG00000171992			30672	protein-coding gene	gene with protein product		608155				9314539, 10470851	Standard	NM_007286		Approved	KIAA1029	uc003lsn.3	Q8N3V7	OTTHUMG00000130078	ENST00000394243.1:c.1831C>T	5.37:g.150028936C>T						SYNPO_uc003lso.3_Silent_p.L367L|SYNPO_uc003lsp.2_Silent_p.L367L	p.L611L	NM_001109974	NP_001103444	Q8N3V7	SYNPO_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		3	2205	+		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	611					A5PKZ8|D3DQG8|O15271|Q9UPX1	Silent	SNP	ENST00000394243.1	37	c.1831C>T	CCDS54937.1																																																																																				0.582	SYNPO-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252371.1	NM_007286		13	75	0	0	0	0.004007	0	13	75				
PANK3	79646	broad.mit.edu	37	5	167993025	167993025	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:167993025C>A	ENST00000239231.6	-	3	944	c.628G>T	c.(628-630)Ggg>Tgg	p.G210W	PANK3_ENST00000520504.1_5'UTR	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3	210					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		TACCTTGTCCCAGTCACTCGT	0.368																																							uc003lzz.1		NA																	0				ovary(1)	1						c.(628-630)GGG>TGG		pantothenate kinase 3							151.0	134.0	140.0					5																	167993025		2203	4300	6503	SO:0001583	missense	79646				coenzyme A biosynthetic process	cytoplasm|nucleus	ATP binding|pantothenate kinase activity	g.chr5:167993025C>A	AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.628G>T	5.37:g.167993025C>A	ENSP00000239231:p.Gly210Trp						p.G210W	NM_024594	NP_078870	Q9H999	PANK3_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)	3	928	-	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	210					D3DQL1|Q53FJ9|Q7RTX4	Missense_Mutation	SNP	ENST00000239231.6	37	c.628G>T	CCDS4368.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.531580	0.85706	.	.	ENSG00000120137	ENST00000239231	D	0.99912	-7.94	4.94	4.94	0.65067	.	0.098235	0.64402	D	0.000001	D	0.99932	0.9969	H	0.96111	3.77	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95835	0.8861	10	0.87932	D	0	-1.6602	17.2075	0.86922	0.0:1.0:0.0:0.0	.	210	Q9H999	PANK3_HUMAN	W	210	ENSP00000239231:G210W	ENSP00000239231:G210W	G	-	1	0	PANK3	167925603	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.818000	0.86416	2.272000	0.75746	0.579000	0.79373	GGG		0.368	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252793.2	NM_024594		46	80	1	0	8.72198e-27	0.01441	1.08133e-26	46	80				
SLIT3	6586	broad.mit.edu	37	5	168233492	168233492	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:168233492C>G	ENST00000519560.1	-	9	1313	c.894G>C	c.(892-894)ttG>ttC	p.L298F	SLIT3_ENST00000332966.8_Missense_Mutation_p.L298F|SLIT3_ENST00000404867.3_Missense_Mutation_p.L298F	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	298	LRRNT 2.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAATCTCCATCAAGCCCTTTC	0.587																																					Ovarian(29;311 847 10864 17279 24903)	Ovarian(29;311 847 10864 17279 24903)	uc003mab.2		NA																	0				ovary(3)|skin(1)	4						c.(892-894)TTG>TTC		slit homolog 3 precursor							92.0	83.0	86.0					5																	168233492		2203	4300	6503	SO:0001583	missense	6586				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding	g.chr5:168233492C>G	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.894G>C	5.37:g.168233492C>G	ENSP00000430333:p.Leu298Phe					SLIT3_uc010jjg.2_Missense_Mutation_p.L298F|SLIT3_uc010jji.2_Missense_Mutation_p.L298F|SLIT3_uc003mac.1_Missense_Mutation_p.L95F	p.L298F	NM_003062	NP_003053	O75094	SLIT3_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		9	1314	-	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	298			LRRNT 2.		A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	37	c.894G>C	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	C	17.36	3.369522	0.61624	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	D;D;D	0.99515	-6.06;-6.06;-6.06	5.52	4.65	0.58169	Leucine-rich repeat-containing N-terminal (2);	0.068270	0.56097	D	0.000023	D	0.99429	0.9798	M	0.87038	2.855	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.996	D	0.99719	1.1009	10	0.87932	D	0	.	7.7029	0.28634	0.0:0.7076:0.1805:0.1119	.	298;298;298	O75094-2;O75094-3;O75094	.;.;SLIT3_HUMAN	F	298	ENSP00000430333:L298F;ENSP00000332164:L298F;ENSP00000384890:L298F	ENSP00000332164:L298F	L	-	3	2	SLIT3	168166070	0.993000	0.37304	0.979000	0.43373	0.808000	0.45660	0.200000	0.17257	1.300000	0.44818	0.655000	0.94253	TTG		0.587	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062		16	68	0	0	0	0.007413	0	16	68				
DDX41	51428	broad.mit.edu	37	5	176939118	176939118	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr5:176939118C>G	ENST00000507955.1	-	16	2234	c.1711G>C	c.(1711-1713)Gag>Cag	p.E571Q	DOK3_ENST00000377112.4_5'Flank|DOK3_ENST00000501403.2_5'Flank|DOK3_ENST00000357198.4_5'Flank|DDX41_ENST00000506965.1_5'Flank|DOK3_ENST00000312943.6_5'Flank	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	571					apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)					all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			AGCATGGACTCATCCCCGCAA	0.617																																							uc003mho.2		NA																	0					0						c.(1711-1713)GAG>CAG		DEAD-box protein abstrakt							63.0	59.0	60.0					5																	176939118		2203	4300	6503	SO:0001583	missense	51428				apoptosis|multicellular organismal development	catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|zinc ion binding	g.chr5:176939118C>G	AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.1711G>C	5.37:g.176939118C>G	ENSP00000422753:p.Glu571Gln					DOK3_uc003mhi.3_5'Flank|DOK3_uc003mhj.3_5'Flank|DOK3_uc003mhk.2_5'Flank|DOK3_uc003mhl.2_5'Flank|DDX41_uc003mhm.2_Missense_Mutation_p.E351Q|DDX41_uc003mhn.2_Missense_Mutation_p.E440Q|DDX41_uc003mhp.2_Missense_Mutation_p.E440Q	p.E571Q	NM_016222	NP_057306	Q9UJV9	DDX41_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)		16	1732	-	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	571					B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Missense_Mutation	SNP	ENST00000507955.1	37	c.1711G>C	CCDS4427.1	.	.	.	.	.	.	.	.	.	.	C	15.97	2.989822	0.54041	.	.	ENSG00000183258	ENST00000330503;ENST00000507955	T;T	0.27890	1.64;1.65	5.68	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.33498	0.0865	M	0.65498	2.005	0.80722	D	1	B	0.29716	0.255	B	0.28991	0.097	T	0.08493	-1.0719	10	0.29301	T	0.29	-34.1494	14.8252	0.70107	0.0:0.9303:0.0:0.0697	.	571	Q9UJV9	DDX41_HUMAN	Q	589;571	ENSP00000330349:E589Q;ENSP00000422753:E571Q	ENSP00000330349:E589Q	E	-	1	0	DDX41	176871724	1.000000	0.71417	0.975000	0.42487	0.794000	0.44872	7.637000	0.83313	1.397000	0.46682	0.655000	0.94253	GAG		0.617	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253432.2	NM_016222		19	97	0	0	0	0.012319	0	19	97				
DUSP22	56940	broad.mit.edu	37	6	348125	348125	+	Missense_Mutation	SNP	G	G	A	rs138056339	byFrequency	TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:348125G>A	ENST00000344450.5	+	6	729	c.286G>A	c.(286-288)Gtg>Atg	p.V96M	DUSP22_ENST00000605863.1_5'UTR|DUSP22_ENST00000419235.2_Missense_Mutation_p.V96M|DUSP22_ENST00000604971.1_5'UTR|DUSP22_ENST00000603453.1_5'UTR|DUSP22_ENST00000605315.1_5'UTR|DUSP22_ENST00000605035.1_5'UTR	NM_020185.3	NP_064570.1	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	96	Tyrosine-protein phosphatase.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.V96M(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(2)	26	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		CTCCAGGAGCGTGACACTGGT	0.612																																							uc003msx.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(1)|kidney(1)|central_nervous_system(1)	3						c.(286-288)GTG>ATG		dual specificity phosphatase 22		G	MET/VAL	2,4404	2.1+/-5.4	0,2,2201	175.0	163.0	167.0		286	5.8	1.0	6	dbSNP_134	167	2,8598	2.2+/-6.3	0,2,4298	yes	missense	DUSP22	NM_020185.3	21	0,4,6499	AA,AG,GG		0.0233,0.0454,0.0308	probably-damaging	96/185	348125	4,13002	2203	4300	6503	SO:0001583	missense	56940				apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	g.chr6:348125G>A	AF165519	CCDS4468.1, CCDS69035.1	6p25.3	2013-09-19			ENSG00000112679	ENSG00000112679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16077	protein-coding gene	gene with protein product						9205128, 11717427	Standard	NM_001286555		Approved	MKPX, JSP1, JKAP, VHX	uc003msx.3	Q9NRW4	OTTHUMG00000014113	ENST00000344450.5:c.286G>A	6.37:g.348125G>A	ENSP00000345281:p.Val96Met					DUSP22_uc011dhn.1_Missense_Mutation_p.V96M|DUSP22_uc003msy.1_Missense_Mutation_p.V53M	p.V96M	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)	6	725	+	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)	96			Tyrosine-protein phosphatase.		B4DK56|Q59GW2|Q5VWR2|Q96AR1	Missense_Mutation	SNP	ENST00000344450.5	37	c.286G>A	CCDS4468.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.413586|5.413586	0.96072|0.96072	4.54E-4|4.54E-4	2.33E-4|2.33E-4	ENSG00000112679|ENSG00000112679	ENST00000419235|ENST00000344450	.|T	.|0.61040	.|0.14	5.82|5.82	5.82|5.82	0.92795|0.92795	.|Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	.|0.000000	.|0.64402	.|D	.|0.000001	D|D	0.82834|0.82834	0.5123|0.5123	H|H	0.96208|0.96208	3.785|3.785	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.73380	.|0.98;0.972;0.961	D|D	0.87323|0.87323	0.2319|0.2319	5|10	.|0.72032	.|D	.|0.01	.|.	20.0852|20.0852	0.97797|0.97797	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|96;53;96	.|Q9NRW4-2;B3KSA8;Q9NRW4	.|.;.;DUS22_HUMAN	H|M	33|96	.|ENSP00000345281:V96M	.|ENSP00000345281:V96M	R|V	+|+	2|1	0|0	DUSP22|DUSP22	293125|293125	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.967000|0.967000	0.64934|0.64934	7.947000|7.947000	0.87758|0.87758	2.752000|2.752000	0.94435|0.94435	0.655000|0.655000	0.94253|0.94253	CGT|GTG		0.612	DUSP22-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000039621.1	NM_020185		22	192	0	0	0	0.012319	0	22	192				
DSP	1832	broad.mit.edu	37	6	7583579	7583579	+	Silent	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:7583579A>G	ENST00000379802.3	+	24	6425	c.6084A>G	c.(6082-6084)aaA>aaG	p.K2028K	DSP_ENST00000418664.2_Silent_p.K1429K	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2028	4.5 X 38 AA tandem repeats (Domain A).|Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		CTAAGGAAAAATACTCTTTGG	0.483																																							uc003mxp.1		NA																	0				central_nervous_system(6)|ovary(2)|skin(1)	9						c.(6082-6084)AAA>AAG		desmoplakin isoform I							50.0	55.0	53.0					6																	7583579		2203	4300	6503	SO:0001819	synonymous_variant	1832				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton	g.chr6:7583579A>G	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.6084A>G	6.37:g.7583579A>G						DSP_uc003mxq.1_Silent_p.K1429K	p.K2028K	NM_004415	NP_004406	P15924	DESP_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.000508)	24	6363	+	Ovarian(93;0.0584)	all_hematologic(90;0.236)	2028			Plectin 1.|Globular 2.		B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	37	c.6084A>G	CCDS4501.1																																																																																				0.483	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415		28	38	0	0	0	0.005443	0	28	38				
HIVEP1	3096	broad.mit.edu	37	6	12123906	12123906	+	Nonsense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:12123906C>G	ENST00000379388.2	+	4	4210	c.3878C>G	c.(3877-3879)tCa>tGa	p.S1293*	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1293					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				GAACATTCCTCAACAGAATCG	0.458																																							uc003nac.2		NA																	0				ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(3877-3879)TCA>TGA		human immunodeficiency virus type I enhancer							73.0	72.0	72.0					6																	12123906		1887	4132	6019	SO:0001587	stop_gained	3096				transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:12123906C>G	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.3878C>G	6.37:g.12123906C>G	ENSP00000368698:p.Ser1293*					HIVEP1_uc011diq.1_RNA	p.S1293*	NM_002114	NP_002105	P15822	ZEP1_HUMAN			4	4057	+	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)	1293					B2RTU3|Q14122|Q5MPB1|Q5VW60	Nonsense_Mutation	SNP	ENST00000379388.2	37	c.3878C>G	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	C	44	11.068036	0.99511	.	.	ENSG00000095951	ENST00000379388	.	.	.	6.07	6.07	0.98685	.	0.000000	0.31233	N	0.008011	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-20.6436	20.6439	0.99570	0.0:1.0:0.0:0.0	.	.	.	.	X	1293	.	.	S	+	2	0	HIVEP1	12231892	1.000000	0.71417	0.847000	0.33407	0.514000	0.34195	7.818000	0.86416	2.884000	0.98904	0.655000	0.94253	TCA		0.458	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114		9	90	0	0	0	0.006214	0	9	90				
JARID2	3720	broad.mit.edu	37	6	15517468	15517468	+	Missense_Mutation	SNP	G	G	A	rs367941514		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:15517468G>A	ENST00000341776.2	+	17	3771	c.3527G>A	c.(3526-3528)cGa>cAa	p.R1176Q	JARID2_ENST00000397311.3_Missense_Mutation_p.R1004Q	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	1176					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R1176Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				AAGTCCTGCCGAGGGCTGAAG	0.617																																							uc003nbj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|lung(1)|pancreas(1)	4						c.(3526-3528)CGA>CAA		jumonji, AT rich interactive domain 2 protein		G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	174.0	148.0	157.0		3527	5.1	1.0	6		157	0,8600		0,0,4300	no	missense	JARID2	NM_004973.2	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1176/1247	15517468	1,13005	2203	4300	6503	SO:0001583	missense	3720				central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding	g.chr6:15517468G>A	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.3527G>A	6.37:g.15517468G>A	ENSP00000341280:p.Arg1176Gln					JARID2_uc011div.1_Missense_Mutation_p.R1004Q	p.R1176Q	NM_004973	NP_004964	Q92833	JARD2_HUMAN			17	3771	+	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)	1176					A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	c.3527G>A	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	G	36	5.690685	0.96793	2.27E-4	0.0	ENSG00000008083	ENST00000341776;ENST00000397311	D;D	0.88046	-2.33;-2.33	5.12	5.12	0.69794	Zinc finger, C5HC2-type (1);	0.000000	0.85682	D	0.000000	D	0.88009	0.6322	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89006	0.3425	10	0.52906	T	0.07	-10.2368	18.9128	0.92493	0.0:0.0:1.0:0.0	.	1176	Q92833	JARD2_HUMAN	Q	1176;1004	ENSP00000341280:R1176Q;ENSP00000380478:R1004Q	ENSP00000341280:R1176Q	R	+	2	0	JARID2	15625447	1.000000	0.71417	0.976000	0.42696	0.985000	0.73830	9.813000	0.99286	2.544000	0.85801	0.555000	0.69702	CGA		0.617	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973		20	103	0	0	0	0.012319	0	20	103				
HIST1H2BF	8343	broad.mit.edu	37	6	26199818	26199818	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:26199818C>T	ENST00000359985.1	+	1	71	c.32C>T	c.(31-33)cCa>cTa	p.P11L	HIST1H3D_ENST00000356476.2_5'Flank|HIST1H2AD_ENST00000341023.1_5'Flank|HIST1H3D_ENST00000377831.5_5'Flank	NM_003522.3	NP_003513.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bf	11					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(7)|upper_aerodigestive_tract(3)	17		all_hematologic(11;0.196)				GCTCCTGCTCCAAAAAAGGGC	0.488																																							uc003ngx.2		NA																	0					0						c.(31-33)CCA>CTA		histone cluster 1, H2bf							98.0	96.0	97.0					6																	26199818		2203	4300	6503	SO:0001583	missense	8343				defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding	g.chr6:26199818C>T	Z80779	CCDS4592.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197846	ENSG00000277224		"""Histones / Replication-dependent"""	4752	protein-coding gene	gene with protein product		602804	"""H2B histone family, member G"", ""histone 1, H2bf"""	H2BFG		9119399, 12408966	Standard	NM_003522		Approved	H2B/g	uc003ngx.3	P62807	OTTHUMG00000014445	ENST00000359985.1:c.32C>T	6.37:g.26199818C>T	ENSP00000353074:p.Pro11Leu					HIST1H3D_uc003ngv.2_5'Flank|HIST1H2AD_uc003ngw.2_5'Flank	p.P11L	NM_003522	NP_003513	P62807	H2B1C_HUMAN			1	32	+		all_hematologic(11;0.196)	11					P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	ENST00000359985.1	37	c.32C>T	CCDS4592.1	.	.	.	.	.	.	.	.	.	.	.	15.60	2.881669	0.51908	.	.	ENSG00000197846	ENST00000359985	T	0.22743	1.94	4.71	4.71	0.59529	.	0.000000	0.40908	D	0.000990	T	0.34048	0.0884	.	.	.	0.51012	D	0.999909	.	.	.	.	.	.	T	0.16808	-1.0390	7	0.87932	D	0	.	16.9899	0.86351	0.0:1.0:0.0:0.0	.	.	.	.	L	11	ENSP00000353074:P11L	ENSP00000353074:P11L	P	+	2	0	HIST1H2BF	26307797	0.888000	0.30383	0.644000	0.29465	0.115000	0.19883	4.809000	0.62591	2.318000	0.78349	0.650000	0.86243	CCA		0.488	HIST1H2BF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040108.1	NM_003522		44	85	0	0	0	0.009718	0	44	85				
GPX5	2880	broad.mit.edu	37	6	28500165	28500165	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:28500165G>T	ENST00000412168.2	+	4	516	c.427G>T	c.(427-429)Gaa>Taa	p.E143*	GPX5_ENST00000442674.2_3'UTR|GPX5_ENST00000469384.1_3'UTR	NM_001509.2	NP_001500.1	O75715	GPX5_HUMAN	glutathione peroxidase 5 (epididymal androgen-related protein)	143					lipid metabolic process (GO:0006629)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)			endometrium(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16					Glutathione(DB00143)	TGTGAATGGTGAAAAAGAACA	0.443																																							uc003nll.2		NA																	0				skin(1)	1						c.(427-429)GAA>TAA		glutathione peroxidase 5 isoform 1 precursor	Glutathione(DB00143)						152.0	143.0	146.0					6																	28500165		2203	4300	6503	SO:0001587	stop_gained	2880				lipid metabolic process|response to oxidative stress	extracellular region	glutathione peroxidase activity	g.chr6:28500165G>T	AJ005277	CCDS4652.1, CCDS4653.1	6p22.1	2008-02-05			ENSG00000224586	ENSG00000224586	1.11.1.9		4557	protein-coding gene	gene with protein product		603435				9639555	Standard	NM_001509		Approved		uc003nll.2	O75715	OTTHUMG00000016307	ENST00000412168.2:c.427G>T	6.37:g.28500165G>T	ENSP00000392398:p.Glu143*					GPX5_uc003nlm.2_3'UTR|GPX5_uc003nln.2_RNA	p.E143*	NM_001509	NP_001500	O75715	GPX5_HUMAN			4	429	+			143					A1A4Y0	Nonsense_Mutation	SNP	ENST00000412168.2	37	c.427G>T	CCDS4652.1	.	.	.	.	.	.	.	.	.	.	G	16.10	3.027003	0.54683	.	.	ENSG00000224586	ENST00000412168	.	.	.	4.16	2.37	0.29283	.	0.791796	0.12351	N	0.476525	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-9.9545	4.2806	0.10831	0.2067:0.1909:0.6024:0.0	.	.	.	.	X	143	.	ENSP00000392398:E143X	E	+	1	0	GPX5	28608144	0.700000	0.27796	0.027000	0.17364	0.632000	0.37999	0.942000	0.29017	0.700000	0.31782	0.655000	0.94253	GAA		0.443	GPX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043672.2			52	57	1	0	4.45325e-31	0.01441	5.57283e-31	52	57				
OR12D3	81797	broad.mit.edu	37	6	29342268	29342268	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:29342268G>C	ENST00000396806.3	-	1	800	c.797C>G	c.(796-798)tCc>tGc	p.S266C	OR5V1_ENST00000377154.1_Intron	NM_030959.2	NP_112221.1	Q9UGF7	O12D3_HUMAN	olfactory receptor, family 12, subfamily D, member 3	266						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)	23						CTGAATCATGGAGGTGGCTGA	0.483																																							uc003nme.2		NA																	0				ovary(2)|breast(1)	3						c.(796-798)TCC>TGC		olfactory receptor, family 12, subfamily D,							93.0	86.0	89.0					6																	29342268		1510	2707	4217	SO:0001583	missense	81797				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29342268G>C		CCDS4658.1	6p22.1	2013-09-24			ENSG00000112462	ENSG00000112462		"""GPCR / Class A : Olfactory receptors"""	13963	protein-coding gene	gene with protein product							Standard	NM_030959		Approved	hs6M1-27	uc003nme.3	Q9UGF7	OTTHUMG00000031051	ENST00000396806.3:c.797C>G	6.37:g.29342268G>C	ENSP00000380023:p.Ser266Cys						p.S266C	NM_030959	NP_112221	Q9UGF7	O12D3_HUMAN			1	801	-			266			Extracellular (Potential).		A2BDZ1|Q5SQI8|Q6IF23	Missense_Mutation	SNP	ENST00000396806.3	37	c.797C>G	CCDS4658.1	.	.	.	.	.	.	.	.	.	.	G	9.501	1.103317	0.20632	.	.	ENSG00000112462	ENST00000377143;ENST00000396806	T	0.00279	8.33	4.19	2.35	0.29111	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00412	0.0013	M	0.94101	3.495	0.09310	N	1	D	0.89917	1.0	D	0.73708	0.981	T	0.16897	-1.0387	9	0.87932	D	0	-6.1152	12.3559	0.55176	0.1583:0.0:0.8417:0.0	.	266	Q9UGF7	O12D3_HUMAN	C	266	ENSP00000380023:S266C	ENSP00000366348:S266C	S	-	2	0	OR12D3	29450247	0.116000	0.22171	0.001000	0.08648	0.278000	0.26855	1.670000	0.37502	0.086000	0.17137	-1.021000	0.02439	TCC		0.483	OR12D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076056.3			8	69	0	0	0	0.004482	0	8	69				
ZNRD1-AS1	80862	broad.mit.edu	37	6	29977359	29977359	+	RNA	SNP	G	G	A	rs367861986|rs3831361|rs370297731	byFrequency	TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:29977359G>A	ENST00000376797.3	-	0	731				HLA-J_ENST00000462773.1_RNA|ZNRD1-AS1_ENST00000444051.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		ATTTGTTCATGCCTTCCCTTT	0.453																																							uc003rtl.3		NA																	0					0						c.(376-378)ATG>ATA		Homo sapiens major histocompatibility complex, class I, J (pseudogene), mRNA (cDNA clone IMAGE:4694038).																																						3137							g.chr6:29977359G>A	AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29977359G>A						HLA-G_uc011dmb.1_3'UTR|NCRNA00171_uc011dme.1_Intron|HLA-J_uc003nou.3_RNA|HLA-J_uc003nov.3_RNA	p.M126I							5	740	+									Missense_Mutation	SNP	ENST00000376797.3	37	c.378G>A																																																																																					0.453	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	antisense	OTTHUMT00000253083.1	NR_026751		8	60	0	0	0	0.00308	0	8	60				
GTF2H4	2968	broad.mit.edu	37	6	30880223	30880223	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:30880223C>T	ENST00000259895.4	+	11	1300	c.1077C>T	c.(1075-1077)atC>atT	p.I359I	GTF2H4_ENST00000376316.2_Silent_p.I359I|VARS2_ENST00000321897.5_5'Flank|VARS2_ENST00000416670.2_5'Flank|VARS2_ENST00000542001.1_5'Flank|VARS2_ENST00000541562.1_5'Flank	NM_001517.4	NP_001508.1	Q92759	TF2H4_HUMAN	general transcription factor IIH, polypeptide 4, 52kDa	359					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)	ATP-dependent DNA helicase activity (GO:0004003)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11						CCAGTGGCATCACAGCCCAGC	0.602								Nucleotide excision repair (NER)																															uc003nsa.1		NA																	0				ovary(2)|breast(1)	3						c.(1075-1077)ATC>ATT	NER	general transcription factor IIH, polypeptide 4,							96.0	91.0	93.0					6																	30880223		1511	2709	4220	SO:0001819	synonymous_variant	2968				mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding|sequence-specific DNA binding transcription factor activity	g.chr6:30880223C>T	Y07595	CCDS34386.1	6p21.3	2012-11-05	2002-08-29		ENSG00000213780	ENSG00000213780		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4658	protein-coding gene	gene with protein product		601760	"""general transcription factor IIH, polypeptide 4 (52kD subunit)"""			9118947	Standard	NM_001517		Approved	TFB2, TFIIH, P52	uc003nsa.1	Q92759	OTTHUMG00000031043	ENST00000259895.4:c.1077C>T	6.37:g.30880223C>T						GTF2H4_uc003nsb.1_Silent_p.I197I|GTF2H4_uc011dmw.1_Silent_p.I365I|VARS2_uc003nsc.1_5'Flank|VARS2_uc003nsd.2_5'Flank|VARS2_uc011dmx.1_5'Flank|VARS2_uc011dmy.1_5'Flank|VARS2_uc011dmz.1_5'Flank|VARS2_uc011dna.1_5'Flank|VARS2_uc011dnb.1_5'Flank|VARS2_uc011dnc.1_5'Flank	p.I359I	NM_001517	NP_001508	Q92759	TF2H4_HUMAN			11	1284	+			359					B4DTJ5|Q76KU4	Silent	SNP	ENST00000259895.4	37	c.1077C>T	CCDS34386.1																																																																																				0.602	GTF2H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076044.3	NM_001517		33	72	0	0	0	0.003755	0	33	72				
ABHD16A	7920	broad.mit.edu	37	6	31671053	31671053	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:31671053C>T	ENST00000395952.3	-	1	168	c.6G>A	c.(4-6)gcG>gcA	p.A2A	ABHD16A_ENST00000538874.1_5'UTR|XXbac-BPG32J3.20_ENST00000461287.1_Intron|MIR4646_ENST00000580775.1_RNA|ABHD16A_ENST00000375842.4_5'Flank|ABHD16A_ENST00000440843.2_5'Flank	NM_021160.2	NP_066983.1	O95870	ABHGA_HUMAN	abhydrolase domain containing 16A	2						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10						TCAGCAGCTTCGCCATGGCCC	0.692																																							uc003nvy.1		NA																	0					0						c.(4-6)GCG>GCA		HLA-B associated transcript 5							11.0	13.0	13.0					6																	31671053		2173	4274	6447	SO:0001819	synonymous_variant	7920					integral to membrane	hydrolase activity|protein binding	g.chr6:31671053C>T	AF129756	CCDS4713.1, CCDS54988.1	6p21.3	2013-01-17	2010-12-09	2010-12-09	ENSG00000204427	ENSG00000204427		"""Abhydrolase domain containing"""	13921	protein-coding gene	gene with protein product		142620	"""HLA-B associated transcript 5"""	BAT5		2911734, 2813433	Standard	NM_021160		Approved	NG26, D6S82E	uc003nvy.2	O95870	OTTHUMG00000031177	ENST00000395952.3:c.6G>A	6.37:g.31671053C>T						BAT5_uc003nvx.1_5'Flank|BAT5_uc011dny.1_5'Flank|BAT5_uc003nvz.1_5'UTR|BAT5_uc011dnz.1_Intron|BAT5_uc010jtc.1_RNA|BAT5_uc011doa.1_5'UTR	p.A2A	NM_021160	NP_066983	O95870	ABHGA_HUMAN			1	36	-			2					A2BEY3|B7Z4R6|Q5SRR1|Q5SRR2|Q8WYH0|Q9NW33	Silent	SNP	ENST00000395952.3	37	c.6G>A	CCDS4713.1																																																																																				0.692	ABHD16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076342.4			6	39	0	0	0	0.001168	0	6	39				
RXRB	6257	broad.mit.edu	37	6	33164323	33164323	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:33164323C>G	ENST00000374680.3	-	5	1092	c.881G>C	c.(880-882)gGa>gCa	p.G294A	RXRB_ENST00000413614.2_Missense_Mutation_p.G198A|RXRB_ENST00000544186.1_Missense_Mutation_p.G104A|RXRB_ENST00000374685.4_Missense_Mutation_p.G294A	NM_001270401.1|NM_021976.4	NP_001257330.1|NP_068811.1	P28702	RXRB_HUMAN	retinoid X receptor, beta	294	Hinge.				cardiac muscle cell proliferation (GO:0060038)|cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(1)|skin(2)	15					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tazarotene(DB00799)|Tretinoin(DB00755)	CTCGGGGGCTCCCCCAGCCCC	0.632																																							uc003odb.2		NA																	0				ovary(3)	3						c.(880-882)GGA>GCA		retinoid X receptor, beta	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etretinate(DB00926)|Tazarotene(DB00799)|Tretinoin(DB00755)						57.0	73.0	67.0					6																	33164323		1510	2706	4216	SO:0001583	missense	6257				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	ligand-regulated transcription factor activity|retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding	g.chr6:33164323C>G	M84820	CCDS4768.1, CCDS59007.1	6p21.3	2013-01-16			ENSG00000204231	ENSG00000204231		"""Nuclear hormone receptors"""	10478	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 2"""	180246				8257090	Standard	NM_021976		Approved	NR2B2, H-2RIIBP, RCoR-1	uc003odc.4	P28702	OTTHUMG00000031298	ENST00000374680.3:c.881G>C	6.37:g.33164323C>G	ENSP00000363812:p.Gly294Ala					RXRB_uc003odc.2_Missense_Mutation_p.G294A|RXRB_uc003odd.2_Missense_Mutation_p.G198A|RXRB_uc011dqr.1_Missense_Mutation_p.G104A|RXRB_uc011dqs.1_Missense_Mutation_p.G177A|RXRB_uc003ode.1_Missense_Mutation_p.G158A|RXRB_uc011dqt.1_Missense_Mutation_p.G294A|RXRB_uc011dqu.1_Missense_Mutation_p.G198A	p.G294A	NM_021976	NP_068811	P28702	RXRB_HUMAN			5	1060	-			294			Hinge.		P28703|Q59G65|Q5JP92|Q5STQ1	Missense_Mutation	SNP	ENST00000374680.3	37	c.881G>C	CCDS4768.1	.	.	.	.	.	.	.	.	.	.	C	10.17	1.277011	0.23307	.	.	ENSG00000204231	ENST00000374685;ENST00000374680;ENST00000544186;ENST00000413614	T;T;T;D	0.92048	-0.39;-0.39;-0.39;-2.96	4.97	4.97	0.65823	Nuclear hormone receptor, ligand-binding (1);	0.330809	0.31323	N	0.007850	T	0.79684	0.4488	L	0.35542	1.07	0.37989	D	0.933854	B;B;B;B;B;B;B;B	0.32781	0.384;0.184;0.01;0.001;0.012;0.037;0.072;0.037	B;B;B;B;B;B;B;B	0.26517	0.07;0.019;0.009;0.001;0.004;0.008;0.01;0.008	T	0.79577	-0.1746	10	0.33940	T	0.23	.	11.4564	0.50185	0.0:0.8185:0.1815:0.0	.	198;294;177;104;294;294;334;294	B7Z3E4;B7Z6J2;B7Z6X3;E9PK95;Q5STQ1;Q5STP9;Q59G65;P28702	.;.;.;.;.;.;.;RXRB_HUMAN	A	294;294;104;198	ENSP00000363817:G294A;ENSP00000363812:G294A;ENSP00000439222:G104A;ENSP00000415561:G198A	ENSP00000363812:G294A	G	-	2	0	RXRB	33272301	0.011000	0.17503	1.000000	0.80357	0.996000	0.88848	0.238000	0.18004	2.577000	0.86979	0.549000	0.68633	GGA		0.632	RXRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076642.2	NM_021976		18	105	0	0	0	0.007413	0	18	105				
KIFC1	3833	broad.mit.edu	37	6	33373380	33373380	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:33373380G>A	ENST00000428849.2	+	7	1958	c.1508G>A	c.(1507-1509)cGa>cAa	p.R503Q		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	503	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						ACCAATGCTCGATATGTCCCT	0.612																																							uc003oef.3		NA																	0					0						c.(1507-1509)CGA>CAA		kinesin family member C1							23.0	24.0	24.0					6																	33373380		2203	4300	6503	SO:0001583	missense	3833				blood coagulation|cell division|microtubule-based movement|mitotic sister chromatid segregation	early endosome|microtubule|microtubule associated complex|microtubule organizing center|nucleus|spindle	ATP binding|microtubule motor activity	g.chr6:33373380G>A	D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.1508G>A	6.37:g.33373380G>A	ENSP00000393963:p.Arg503Gln					KIFC1_uc011drf.1_Missense_Mutation_p.R495Q	p.R503Q	NM_002263	NP_002254	Q9BW19	KIFC1_HUMAN			7	1958	+			503			Kinesin-motor.		O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Missense_Mutation	SNP	ENST00000428849.2	37	c.1508G>A	CCDS34430.1	.	.	.	.	.	.	.	.	.	.	G	14.89	2.669980	0.47677	.	.	ENSG00000237649	ENST00000428849	T	0.74842	-0.88	5.22	3.41	0.39046	Kinesin, motor domain (4);	0.075304	0.53938	D	0.000047	T	0.41534	0.1163	N	0.20845	0.615	0.34577	D	0.714034	P;P	0.41673	0.759;0.583	B;B	0.37692	0.256;0.186	T	0.43893	-0.9363	10	0.38643	T	0.18	-30.4467	9.9734	0.41768	0.1701:0.0:0.8299:0.0	.	495;503	B4E063;Q9BW19	.;KIFC1_HUMAN	Q	503	ENSP00000393963:R503Q	ENSP00000393963:R503Q	R	+	2	0	KIFC1	33481358	0.004000	0.15560	0.923000	0.36655	0.999000	0.98932	1.449000	0.35123	1.443000	0.47586	0.655000	0.94253	CGA		0.612	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076417.1	NM_002263		6	26	0	0	0	0.001168	0	6	26				
PHF1	5252	broad.mit.edu	37	6	33382112	33382112	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:33382112C>G	ENST00000374516.3	+	9	1116	c.845C>G	c.(844-846)tCt>tGt	p.S282C	PHF1_ENST00000374512.3_Missense_Mutation_p.S282C	NM_024165.2	NP_077084.1	O43189	PHF1_HUMAN	PHD finger protein 1	282					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of histone H3-K27 methylation (GO:0061087)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19		Ovarian(999;0.0443)				CCCTTCACTTCTGAGAATTGG	0.493											OREG0017346	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003oeh.2		NA																	0					0						c.(844-846)TCT>TGT		PHD finger protein 1 isoform b							113.0	114.0	114.0					6																	33382112		2203	4300	6503	SO:0001583	missense	5252				chromatin modification	nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr6:33382112C>G	AF029678	CCDS4777.1, CCDS4778.1	6p21.3	2013-01-28			ENSG00000112511	ENSG00000112511		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	8919	protein-coding gene	gene with protein product	"""tudor domain containing 19C"""	602881				9545646, 18385154	Standard	NM_024165		Approved	MTF2L2, TDRD19C	uc003oeh.3	O43189	OTTHUMG00000031105	ENST00000374516.3:c.845C>G	6.37:g.33382112C>G	ENSP00000363640:p.Ser282Cys		OREG0017346	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	839	PHF1_uc011drh.1_RNA|PHF1_uc003oei.2_Missense_Mutation_p.S282C|PHF1_uc010jux.2_Missense_Mutation_p.S82C	p.S282C	NM_024165	NP_077084	O43189	PHF1_HUMAN			9	1081	+		Ovarian(999;0.0443)	282					B1AZX2|B1AZX3|O60929|Q5SU07|Q5SU08|Q96KM7	Missense_Mutation	SNP	ENST00000374516.3	37	c.845C>G	CCDS4777.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.653079	0.67472	.	.	ENSG00000112511	ENST00000374512;ENST00000374516	T;T	0.25085	1.82;1.85	5.54	3.76	0.43208	.	0.163302	0.51477	D	0.000085	T	0.14570	0.0352	N	0.14661	0.345	0.29694	N	0.840702	D;D	0.64830	0.994;0.97	D;B	0.65573	0.936;0.339	T	0.04752	-1.0929	10	0.87932	D	0	-6.8738	6.5741	0.22555	0.3194:0.5988:0.0:0.0818	.	282;282	O43189-2;O43189	.;PHF1_HUMAN	C	282	ENSP00000363636:S282C;ENSP00000363640:S282C	ENSP00000363636:S282C	S	+	2	0	PHF1	33490090	0.997000	0.39634	1.000000	0.80357	0.918000	0.54935	1.775000	0.38584	0.887000	0.36136	0.655000	0.94253	TCT		0.493	PHF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076175.3			5	88	0	0	0	0.000602	0	5	88				
MAPK13	5603	broad.mit.edu	37	6	36099123	36099123	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:36099123C>T	ENST00000211287.4	+	2	457	c.195C>T	c.(193-195)ttC>ttT	p.F65F	MAPK13_ENST00000490334.1_3'UTR|MAPK13_ENST00000373759.1_5'UTR|MAPK13_ENST00000373766.5_Silent_p.F65F|MAPK13_ENST00000373761.6_Silent_p.F65F	NM_002754.4	NP_002745.1	O15264	MK13_HUMAN	mitogen-activated protein kinase 13	65	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-6 production (GO:0032755)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|prostate(2)|skin(1)	12						CCGAGATCTTCGCCAAGCGCG	0.662																																							uc003ols.2		NA																	0				breast(2)|central_nervous_system(1)	3						c.(193-195)TTC>TTT		mitogen-activated protein kinase 13							63.0	67.0	66.0					6																	36099123		2203	4300	6503	SO:0001819	synonymous_variant	5603				cell cycle|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|positive regulation of interleukin-6 production|Ras protein signal transduction|response to stress		ATP binding|MAP kinase activity|protein binding	g.chr6:36099123C>T	Y10488	CCDS4818.1	6p21	2011-06-09			ENSG00000156711	ENSG00000156711	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6875	protein-coding gene	gene with protein product		602899		PRKM13		9295308, 9218798	Standard	NM_002754		Approved	SAPK4, p38delta	uc003ols.4	O15264	OTTHUMG00000014587	ENST00000211287.4:c.195C>T	6.37:g.36099123C>T						MAPK13_uc003olt.2_RNA	p.F65F	NM_002754	NP_002745	O15264	MK13_HUMAN			2	293	+			65			Protein kinase.		O14739|O15124|Q5U4A5|Q6FI46|Q9UNU0	Silent	SNP	ENST00000211287.4	37	c.195C>T	CCDS4818.1																																																																																				0.662	MAPK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040328.1			14	92	0	0	0	0.00499	0	14	92				
C6orf89	221477	broad.mit.edu	37	6	36867275	36867275	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:36867275G>T	ENST00000480824.2	+	3	349	c.55G>T	c.(55-57)Gat>Tat	p.D19Y	C6orf89_ENST00000373685.1_Missense_Mutation_p.D19Y|C6orf89_ENST00000355190.3_Missense_Mutation_p.D26Y|C6orf89_ENST00000510325.2_5'UTR|C6orf89_ENST00000359359.2_5'UTR			Q6UWU4	CF089_HUMAN	chromosome 6 open reading frame 89	19					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	15						AGAGACTGTTGATTTGGTGAG	0.433																																							uc003omx.2		NA																	0				ovary(1)	1						c.(55-57)GAT>TAT		hypothetical protein LOC221477							92.0	93.0	93.0					6																	36867275		2203	4300	6503	SO:0001583	missense	221477					integral to membrane		g.chr6:36867275G>T	AK058086	CCDS4827.1, CCDS69100.1, CCDS75444.1	6p21.31	2013-03-14			ENSG00000198663	ENSG00000198663			21114	protein-coding gene	gene with protein product	"""bombesin receptor activated protein"""					21857995, 23460338	Standard	NM_152734		Approved	FLJ25357, BRAP	uc003omw.3	Q6UWU4	OTTHUMG00000014613	ENST00000480824.2:c.55G>T	6.37:g.36867275G>T	ENSP00000475947:p.Asp19Tyr					C6orf89_uc003omv.2_5'UTR|C6orf89_uc003omw.2_Missense_Mutation_p.D26Y|C6orf89_uc011dtr.1_5'UTR	p.D19Y	NM_152734	NP_689947	Q6UWU4	CF089_HUMAN			3	339	+			19					B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Missense_Mutation	SNP	ENST00000480824.2	37	c.55G>T		.	.	.	.	.	.	.	.	.	.	G	22.9	4.351698	0.82132	.	.	ENSG00000198663	ENST00000355190;ENST00000373685;ENST00000416621;ENST00000540072	T;T	0.58652	0.32;0.32	6.08	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.66839	0.2830	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.988	T	0.68735	-0.5330	10	0.87932	D	0	-7.0564	13.1196	0.59318	0.0731:0.0:0.9269:0.0	.	19;26	Q6UWU4;Q6UWU4-2	CF089_HUMAN;.	Y	26;19;26;25	ENSP00000347322:D26Y;ENSP00000362789:D19Y	ENSP00000347322:D26Y	D	+	1	0	C6orf89	36975253	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.368000	0.59505	2.894000	0.99253	0.655000	0.94253	GAT		0.433	C6orf89-004	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000040387.2	NM_152734		22	111	1	0	5.45024e-15	0.00333	6.44559e-15	22	111				
MDGA1	266727	broad.mit.edu	37	6	37622594	37622594	+	Missense_Mutation	SNP	G	G	A	rs376372020		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:37622594G>A	ENST00000434837.3	-	5	1872	c.694C>T	c.(694-696)Cgg>Tgg	p.R232W	MDGA1_ENST00000297153.7_Missense_Mutation_p.R232W|MDGA1_ENST00000505425.1_Missense_Mutation_p.R232W	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	232					brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						TTGGTGAGCCGGAAGGTGATG	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		20112	0.001		0.0	False		,,,				2504	0.0						uc003onu.1		NA																	0				central_nervous_system(2)	2						c.(694-696)CGG>TGG		MAM domain containing		G	TRP/ARG	0,4360		0,0,2180	215.0	226.0	222.0		694	4.9	1.0	6		222	1,8537		0,1,4268	no	missense	MDGA1	NM_153487.3	101	0,1,6448	AA,AG,GG		0.0117,0.0,0.0078	possibly-damaging	232/956	37622594	1,12897	2180	4269	6449	SO:0001583	missense	266727				brain development|neuron migration|spinal cord association neuron differentiation	anchored to plasma membrane		g.chr6:37622594G>A	AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.694C>T	6.37:g.37622594G>A	ENSP00000402584:p.Arg232Trp					MDGA1_uc003onw.3_5'Flank	p.R232W	NM_153487	NP_705691	Q8NFP4	MDGA1_HUMAN			5	1873	-			232					A6NHG0|Q8NBE3	Missense_Mutation	SNP	ENST00000434837.3	37	c.694C>T	CCDS47417.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.672047	0.67928	0.0	1.17E-4	ENSG00000112139	ENST00000434837;ENST00000297153;ENST00000505425	T;T;T	0.54071	0.59;0.59;0.59	5.82	4.95	0.65309	Immunoglobulin subtype (1);	0.455157	0.18596	N	0.136581	T	0.37100	0.0991	L	0.43152	1.355	0.34907	D	0.74711	P	0.48640	0.913	B	0.43990	0.438	T	0.45440	-0.9261	10	0.87932	D	0	.	14.3763	0.66879	0.0714:0.0:0.9286:0.0	.	232	Q8NFP4	MDGA1_HUMAN	W	232	ENSP00000402584:R232W;ENSP00000297153:R232W;ENSP00000422042:R232W	ENSP00000297153:R232W	R	-	1	2	MDGA1	37730572	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.429000	0.44758	1.463000	0.47967	0.655000	0.94253	CGG		0.592	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040419.3			58	153	0	0	0	0.01441	0	58	153				
BTBD9	114781	broad.mit.edu	37	6	38545402	38545402	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:38545402T>A	ENST00000481247.1	-	6	1279	c.1128A>T	c.(1126-1128)aaA>aaT	p.K376N	BTBD9_ENST00000408958.1_Missense_Mutation_p.K308N|BTBD9_ENST00000314100.6_Missense_Mutation_p.K308N|BTBD9_ENST00000419706.2_Missense_Mutation_p.K317N|BTBD9_ENST00000403056.1_Missense_Mutation_p.K376N	NM_001099272.1|NM_052893.1	NP_001092742.1|NP_443125.1	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9	376					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|circadian sleep/wake cycle, non-REM sleep (GO:0042748)|long-term memory (GO:0007616)|multicellular organismal iron ion homeostasis (GO:0060586)|regulation of synaptic vesicle endocytosis (GO:1900242)|sensory perception of temperature stimulus (GO:0050951)|serotonin metabolic process (GO:0042428)					breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	12						GAAAATATAATTTCTGCCAAG	0.368																																							uc003ooa.3		NA																	0					0						c.(1126-1128)AAA>AAT		BTB (POZ) domain containing 9 isoform a							103.0	99.0	100.0					6																	38545402		1869	4097	5966	SO:0001583	missense	114781				cell adhesion			g.chr6:38545402T>A		CCDS43458.1, CCDS47418.1, CCDS54998.1	6p21	2014-01-28			ENSG00000183826	ENSG00000183826		"""BTB/POZ domain containing"""	21228	protein-coding gene	gene with protein product		611237				11572484	Standard	NM_052893		Approved	KIAA1880, dJ322I12.1	uc010jwx.3	Q96Q07	OTTHUMG00000014634	ENST00000481247.1:c.1128A>T	6.37:g.38545402T>A	ENSP00000418751:p.Lys376Asn					BTBD9_uc003ony.3_Missense_Mutation_p.K308N|BTBD9_uc010jwv.2_Missense_Mutation_p.K308N|BTBD9_uc010jww.2_RNA|BTBD9_uc010jwx.2_Missense_Mutation_p.K376N	p.K376N	NM_052893	NP_443125	Q96Q07	BTBD9_HUMAN			7	1704	-			376					Q494V9|Q494W1|Q96M00	Missense_Mutation	SNP	ENST00000481247.1	37	c.1128A>T	CCDS47418.1	.	.	.	.	.	.	.	.	.	.	T	11.40	1.627252	0.28978	.	.	ENSG00000183826	ENST00000314100;ENST00000481247;ENST00000419706;ENST00000403056;ENST00000408958	D;D;T;D;D	0.97976	-4.64;-4.64;-0.58;-4.64;-4.64	5.71	0.554	0.17241	Coagulation factor 5/8 C-terminal type domain (1);Galactose-binding domain-like (1);	0.298471	0.36134	N	0.002770	D	0.83908	0.5356	N	0.04508	-0.205	0.38425	D	0.946288	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.72814	-0.4179	10	0.28530	T	0.3	.	7.0363	0.24995	0.0:0.4587:0.1214:0.42	.	317;376	Q494V9;Q96Q07	.;BTBD9_HUMAN	N	308;376;317;376;308	ENSP00000323408:K308N;ENSP00000418751:K376N;ENSP00000415365:K317N;ENSP00000386121:K376N;ENSP00000386211:K308N	ENSP00000323408:K308N	K	-	3	2	BTBD9	38653380	0.550000	0.26489	0.944000	0.38274	0.991000	0.79684	-0.184000	0.09698	0.016000	0.14998	-0.297000	0.09499	AAA		0.368	BTBD9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040433.2	NM_152733		17	79	0	0	0	0.008871	0	17	79				
CUL7	9820	broad.mit.edu	37	6	43019473	43019473	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:43019473C>G	ENST00000265348.3	-	3	694	c.609G>C	c.(607-609)ctG>ctC	p.L203L	CUL7_ENST00000535468.1_Silent_p.L287L			Q14999	CUL7_HUMAN	cullin 7	203					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CTTGTTGGCTCAGTGACAGAA	0.512																																							uc003otq.2		NA																	0				ovary(3)|kidney(1)	4						c.(607-609)CTG>CTC		cullin 7							161.0	147.0	152.0					6																	43019473		2203	4300	6503	SO:0001819	synonymous_variant	9820				interspecies interaction between organisms|ubiquitin-dependent protein catabolic process|vasculogenesis	anaphase-promoting complex|mitochondrion	ubiquitin protein ligase binding	g.chr6:43019473C>G	BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.609G>C	6.37:g.43019473C>G						CUL7_uc011dvb.1_Silent_p.L287L|CUL7_uc010jyh.2_Intron|KLC4_uc003otr.1_Intron	p.L203L	NM_014780	NP_055595	Q14999	CUL7_HUMAN	all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)		3	912	-			203					B4DYZ0|F5H0L1|Q5T654	Silent	SNP	ENST00000265348.3	37	c.609G>C	CCDS4881.1																																																																																				0.512	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780		12	164	0	0	0	0.001855	0	12	164				
CUL9	23113	broad.mit.edu	37	6	43174229	43174229	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:43174229C>T	ENST00000252050.4	+	26	5277	c.5193C>T	c.(5191-5193)ttC>ttT	p.F1731F	CUL9_ENST00000502937.1_3'UTR|CUL9_ENST00000354495.3_Silent_p.F1621F|CUL9_ENST00000372647.2_Silent_p.F1731F	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1731					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						TTGACCGTTTCTCCAGTTTCT	0.552																																							uc003ouk.2		NA																	0				ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						c.(5191-5193)TTC>TTT		p53-associated parkin-like cytoplasmic protein							91.0	88.0	89.0					6																	43174229		2203	4300	6503	SO:0001819	synonymous_variant	23113				ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding	g.chr6:43174229C>T	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.5193C>T	6.37:g.43174229C>T						CUL9_uc003oul.2_Silent_p.F1731F|CUL9_uc010jyk.2_Silent_p.F883F	p.F1731F	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN			26	5268	+			1731					O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	37	c.5193C>T	CCDS4890.1																																																																																				0.552	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089		5	95	0	0	0	0.001168	0	5	95				
ABCC10	89845	broad.mit.edu	37	6	43411937	43411937	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:43411937G>T	ENST00000372530.4	+	12	2750	c.2535G>T	c.(2533-2535)gaG>gaT	p.E845D	ABCC10_ENST00000244533.3_Missense_Mutation_p.E817D	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	845					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	AAACAAAGGAGGGGCTGGAGG	0.552																																							uc003ouy.1		NA																	0				ovary(6)|central_nervous_system(1)	7						c.(2533-2535)GAG>GAT		ATP-binding cassette, sub-family C, member 10							48.0	47.0	47.0					6																	43411937		2203	4300	6503	SO:0001583	missense	89845					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr6:43411937G>T	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.2535G>T	6.37:g.43411937G>T	ENSP00000361608:p.Glu845Asp					ABCC10_uc003ouz.1_Missense_Mutation_p.E817D|ABCC10_uc010jyo.1_Translation_Start_Site	p.E845D	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		12	2750	+	all_lung(25;0.00536)		845					Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	ENST00000372530.4	37	c.2535G>T	CCDS56430.1	.	.	.	.	.	.	.	.	.	.	G	16.54	3.151607	0.57151	.	.	ENSG00000124574	ENST00000372530;ENST00000244533	D;D	0.91295	-2.82;-2.82	5.86	4.04	0.47022	.	0.504726	0.21745	N	0.069770	T	0.73133	0.3548	L	0.37850	1.14	0.09310	N	1	B;B	0.23377	0.0;0.084	B;B	0.21708	0.005;0.036	T	0.60203	-0.7309	10	0.21540	T	0.41	-8.5073	10.1524	0.42803	0.2198:0.0:0.7802:0.0	.	817;845	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	D	845;817	ENSP00000361608:E845D;ENSP00000244533:E817D	ENSP00000244533:E817D	E	+	3	2	ABCC10	43519915	1.000000	0.71417	0.008000	0.14137	0.976000	0.68499	2.999000	0.49473	0.777000	0.33496	0.655000	0.94253	GAG		0.552	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450		10	23	1	0	7.48243e-07	0.006214	8.14157e-07	10	23				
SUPT3H	8464	broad.mit.edu	37	6	44900479	44900479	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:44900479C>G	ENST00000371459.1	-	10	988	c.823G>C	c.(823-825)Gag>Cag	p.E275Q	SUPT3H_ENST00000371461.2_Missense_Mutation_p.E286Q|SUPT3H_ENST00000371458.1_Missense_Mutation_p.E58Q|SUPT3H_ENST00000306867.5_Missense_Mutation_p.E275Q|SUPT3H_ENST00000371460.1_Missense_Mutation_p.E286Q	NM_001261823.1|NM_003599.3	NP_001248752.1|NP_003590.1	O75486	SUPT3_HUMAN	suppressor of Ty 3 homolog (S. cerevisiae)	357					chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	transcription coactivator activity (GO:0003713)			breast(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)	12						CTGTGAGCCTCAACACCACAG	0.453																																							uc003oxo.2		NA																	0				ovary(2)|breast(1)	3						c.(856-858)GAG>CAG		suppressor of Ty 3 homolog isoform 2							76.0	59.0	65.0					6																	44900479		2203	4300	6503	SO:0001583	missense	8464				histone deubiquitination|histone H3 acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	STAGA complex|transcription factor TFTC complex	DNA binding|transcription coactivator activity	g.chr6:44900479C>G	AF069734	CCDS34465.1, CCDS34466.1, CCDS75464.1	6p21.1-p12.3	2008-05-15	2001-11-28		ENSG00000196284	ENSG00000196284			11466	protein-coding gene	gene with protein product		602947	"""suppressor of Ty (S.cerevisiae) 3 homolog"""			9674425, 9726987	Standard	NM_003599		Approved	SPT3, SPT3L	uc003oxp.4	O75486	OTTHUMG00000014773	ENST00000371459.1:c.823G>C	6.37:g.44900479C>G	ENSP00000360514:p.Glu275Gln					SUPT3H_uc003oxn.1_Missense_Mutation_p.E275Q|SUPT3H_uc011dvv.1_Missense_Mutation_p.E123Q|SUPT3H_uc003oxp.2_Missense_Mutation_p.E275Q|SUPT3H_uc011dvw.1_Missense_Mutation_p.E189Q	p.E286Q	NM_181356	NP_852001	O75486	SUPT3_HUMAN			12	1174	-			357					A6NKG9|B2R9Q5|O76066|Q5TAV9|Q86VN7	Missense_Mutation	SNP	ENST00000371459.1	37	c.856G>C	CCDS34465.1	.	.	.	.	.	.	.	.	.	.	C	19.62	3.862334	0.71949	.	.	ENSG00000196284	ENST00000371460;ENST00000371459;ENST00000371458;ENST00000306867;ENST00000371461	T;T;T;T;T	0.51325	0.76;0.78;0.71;0.78;0.76	5.43	5.43	0.79202	.	0.050783	0.85682	D	0.000000	T	0.60418	0.2267	M	0.72894	2.215	0.53688	D	0.999974	D;D	0.71674	0.998;0.993	D;D	0.80764	0.994;0.979	T	0.53641	-0.8410	10	0.22109	T	0.4	.	19.2497	0.93919	0.0:1.0:0.0:0.0	.	286;357	O75486-3;O75486	.;SUPT3_HUMAN	Q	286;275;58;275;286	ENSP00000360515:E286Q;ENSP00000360514:E275Q;ENSP00000360513:E58Q;ENSP00000306718:E275Q;ENSP00000360516:E286Q	ENSP00000306718:E275Q	E	-	1	0	SUPT3H	45008457	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.065000	0.76727	2.549000	0.85964	0.655000	0.94253	GAG		0.453	SUPT3H-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106911.2	NM_181356		5	35	0	0	0	0.000602	0	5	35				
GPR116	221395	broad.mit.edu	37	6	46851846	46851846	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:46851846C>A	ENST00000283296.7	-	5	779	c.491G>T	c.(490-492)tGc>tTc	p.C164F	GPR116_ENST00000456426.2_Missense_Mutation_p.C164F|GPR116_ENST00000478711.1_5'Flank|GPR116_ENST00000362015.4_Missense_Mutation_p.C164F|GPR116_ENST00000265417.7_Missense_Mutation_p.C164F	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	164					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			CTGAAGCAGGCAAAAAGGTCC	0.478																																					NSCLC(59;410 1274 8751 36715 50546)	NSCLC(59;410 1274 8751 36715 50546)	uc003oyo.3		NA																	0				central_nervous_system(1)|skin(1)	2						c.(490-492)TGC>TTC		G-protein coupled receptor 116 precursor							120.0	109.0	113.0					6																	46851846		2203	4300	6503	SO:0001583	missense	221395				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:46851846C>A	AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.491G>T	6.37:g.46851846C>A	ENSP00000283296:p.Cys164Phe					GPR116_uc003oyp.3_Missense_Mutation_p.C164F|GPR116_uc003oyq.3_Missense_Mutation_p.C164F|GPR116_uc003oyr.2_Missense_Mutation_p.C164F	p.C164F	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	Lung(136;0.192)		5	780	-			164			SEA.|Extracellular (Potential).		O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	ENST00000283296.7	37	c.491G>T	CCDS4919.1	.	.	.	.	.	.	.	.	.	.	C	15.35	2.807031	0.50421	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000265417	T;T;T;T	0.59364	0.37;0.76;0.27;0.37	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000003	T	0.70448	0.3225	M	0.73598	2.24	0.80722	D	1	D;D;D	0.76494	0.995;0.999;0.995	P;D;P	0.87578	0.868;0.998;0.868	T	0.74219	-0.3736	10	0.87932	D	0	-28.056	14.5188	0.67838	0.0:1.0:0.0:0.0	.	164;164;164	A8K0D8;Q8IZF2-3;Q8IZF2	.;.;GP116_HUMAN	F	164	ENSP00000283296:C164F;ENSP00000354563:C164F;ENSP00000412866:C164F;ENSP00000265417:C164F	ENSP00000265417:C164F	C	-	2	0	GPR116	46959805	1.000000	0.71417	1.000000	0.80357	0.250000	0.25880	3.478000	0.53158	2.572000	0.86782	0.655000	0.94253	TGC		0.478	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040806.2	NM_015234		40	91	1	0	1.22674e-20	0.00874	1.48232e-20	40	91				
BMP5	653	broad.mit.edu	37	6	55638877	55638877	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:55638877G>A	ENST00000370830.3	-	4	1695	c.997C>T	c.(997-999)Cag>Tag	p.Q333*	BMP5_ENST00000446683.2_Nonsense_Mutation_p.Q333*	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	333					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			GAGGAGTCCTGATGAGAGCTG	0.468																																							uc003pcq.2		NA																	0				ovary(2)	2						c.(997-999)CAG>TAG		bone morphogenetic protein 5 preproprotein							164.0	143.0	150.0					6																	55638877		2203	4299	6502	SO:0001587	stop_gained	653				cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity	g.chr6:55638877G>A		CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.997C>T	6.37:g.55638877G>A	ENSP00000359866:p.Gln333*					BMP5_uc011dxf.1_Nonsense_Mutation_p.Q333*	p.Q333*	NM_021073	NP_066551	P22003	BMP5_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.181)		4	1709	-	Lung NSC(77;0.0462)		333					B4E0Y4|Q9H547|Q9NTM5	Nonsense_Mutation	SNP	ENST00000370830.3	37	c.997C>T	CCDS4958.1	.	.	.	.	.	.	.	.	.	.	G	44	10.816568	0.99472	.	.	ENSG00000112175	ENST00000370830;ENST00000446683	.	.	.	5.74	5.74	0.90152	.	0.214824	0.49916	D	0.000137	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	19.9351	0.97137	0.0:0.0:1.0:0.0	.	.	.	.	X	333	.	ENSP00000359866:Q333X	Q	-	1	0	BMP5	55746836	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.508000	0.81686	2.703000	0.92315	0.655000	0.94253	CAG		0.468	BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041000.1			11	70	0	0	0	0.010729	0	11	70				
COL9A1	1297	broad.mit.edu	37	6	70935635	70935635	+	Splice_Site	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:70935635C>A	ENST00000357250.6	-	37	2739	c.2581G>T	c.(2581-2583)Ggt>Tgt	p.G861C	RP1-149L1.1_ENST00000522264.1_RNA|COL9A1_ENST00000489611.1_5'UTR|COL9A1_ENST00000370499.4_Splice_Site_p.G618C|COL9A1_ENST00000320755.7_Splice_Site_p.G618C	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	861	Collagen-like 10.|Triple-helical region (COL1).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						ACACACTTACCTGGGAGACCT	0.433																																							uc003pfg.3		NA																	0				ovary(4)	4						c.(2581-2583)GGT>TGT		alpha 1 type IX collagen isoform 1 precursor							78.0	73.0	75.0					6																	70935635		2203	4300	6503	SO:0001630	splice_region_variant	1297				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding	g.chr6:70935635C>A		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.2581+1G>T	6.37:g.70935635C>A						COL9A1_uc003pfe.3_Missense_Mutation_p.G410C|COL9A1_uc003pff.3_Missense_Mutation_p.G618C	p.G861C	NM_001851	NP_001842	P20849	CO9A1_HUMAN			37	2740	-			861			Triple-helical region (COL1).		Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	c.2581G>T	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	C	12.54	1.967210	0.34754	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	D;D;D	0.99369	-5.78;-5.78;-5.78	5.13	4.26	0.50523	.	0.053614	0.85682	D	0.000000	D	0.99711	0.9889	H	0.99535	4.615	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.91635	0.999;0.997;0.935	D	0.97117	0.9808	9	.	.	.	.	13.9657	0.64207	0.0:0.9263:0.0:0.0737	.	861;618;410	P20849;P20849-2;B3KWS8	CO9A1_HUMAN;.;.	C	861;618;618	ENSP00000349790:G861C;ENSP00000315252:G618C;ENSP00000359530:G618C	.	G	-	1	0	COL9A1	70992356	1.000000	0.71417	1.000000	0.80357	0.187000	0.23431	7.081000	0.76844	1.308000	0.44962	0.591000	0.81541	GGT		0.433	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		Missense_Mutation	37	54	1	0	6.68952e-21	0.013114	8.09784e-21	37	54				
COL9A1	1297	broad.mit.edu	37	6	70964208	70964208	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:70964208G>A	ENST00000357250.6	-	25	1848	c.1690C>T	c.(1690-1692)Cct>Tct	p.P564S	COL9A1_ENST00000489611.1_5'UTR|COL9A1_ENST00000370499.4_Missense_Mutation_p.P321S|COL9A1_ENST00000320755.7_Missense_Mutation_p.P321S	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	564	Triple-helical region (COL2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						GCATCACCAGGAGGCCCAGGT	0.388																																							uc003pfg.3		NA																	0				ovary(4)	4						c.(1690-1692)CCT>TCT		alpha 1 type IX collagen isoform 1 precursor							73.0	69.0	71.0					6																	70964208		2203	4300	6503	SO:0001583	missense	1297				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding	g.chr6:70964208G>A		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.1690C>T	6.37:g.70964208G>A	ENSP00000349790:p.Pro564Ser					COL9A1_uc003pfe.3_Missense_Mutation_p.P137S|COL9A1_uc003pff.3_Missense_Mutation_p.P321S	p.P564S	NM_001851	NP_001842	P20849	CO9A1_HUMAN			25	1849	-			564			Triple-helical region (COL2).		Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	c.1690C>T	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	G	18.10	3.548423	0.65311	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	D;D;D	0.98649	-5.05;-3.02;-3.02	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.98745	0.9578	M	0.66560	2.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.98581	1.0650	10	0.23891	T	0.37	.	18.2813	0.90099	0.0:0.0:1.0:0.0	.	564;321;137	P20849;P20849-2;B3KWS8	CO9A1_HUMAN;.;.	S	564;321;321	ENSP00000349790:P564S;ENSP00000315252:P321S;ENSP00000359530:P321S	ENSP00000315252:P321S	P	-	1	0	COL9A1	71020929	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.834000	0.69361	2.748000	0.94277	0.591000	0.81541	CCT		0.388	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2			17	67	0	0	0	0.010504	0	17	67				
COL12A1	1303	broad.mit.edu	37	6	75804895	75804895	+	Splice_Site	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:75804895C>A	ENST00000322507.8	-	60	8887	c.8578G>T	c.(8578-8580)Gga>Tga	p.G2860*	COL12A1_ENST00000345356.6_Splice_Site_p.G1696*|COL12A1_ENST00000511023.1_5'UTR|COL12A1_ENST00000483888.2_Intron|COL12A1_ENST00000416123.2_Splice_Site_p.G2784*	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2860	Collagen-like 3.|Triple-helical region (COL2) with 1 imperfection.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CCTGGGCTTCCCTACAACACA	0.473																																							uc003phs.2		NA																	0				ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						c.(8578-8580)GGA>TGA		collagen, type XII, alpha 1 long isoform							67.0	64.0	65.0					6																	75804895		1899	4122	6021	SO:0001630	splice_region_variant	1303				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength	g.chr6:75804895C>A	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.8578-1G>T	6.37:g.75804895C>A						COL12A1_uc003pht.2_Nonsense_Mutation_p.G1696*	p.G2860*	NM_004370	NP_004361	Q99715	COCA1_HUMAN			60	8744	-			2860			Triple-helical region (COL2) with 1 imperfection.		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Nonsense_Mutation	SNP	ENST00000322507.8	37	c.8578G>T	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	49	15.028009	0.99819	.	.	ENSG00000111799	ENST00000322507;ENST00000425443;ENST00000432784;ENST00000345356;ENST00000416123	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.6555	0.95837	0.0:1.0:0.0:0.0	.	.	.	.	X	2860;498;2784;1696;2784	.	ENSP00000325146:G2860X	G	-	1	0	COL12A1	75861615	1.000000	0.71417	1.000000	0.80357	0.336000	0.28762	7.121000	0.77160	2.653000	0.90120	0.557000	0.71058	GGA		0.473	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	Nonsense_Mutation	17	32	1	0	2.4624e-09	0.008871	2.75574e-09	17	32				
SYNCRIP	10492	broad.mit.edu	37	6	86351130	86351130	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:86351130C>T	ENST00000369622.3	-	2	528	c.28G>A	c.(28-30)Ggt>Agt	p.G10S	SYNCRIP_ENST00000355238.6_Missense_Mutation_p.G10S	NM_001159675.1|NM_006372.4	NP_001153147.1|NP_006363.4	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA interacting protein	10					cellular response to interferon-gamma (GO:0071346)|CRD-mediated mRNA stabilization (GO:0070934)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|endoplasmic reticulum (GO:0005783)|GAIT complex (GO:0097452)|histone pre-mRNA 3'end processing complex (GO:0071204)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		TCTTCAGTACCATTTCCATTA	0.358																																							uc003pla.2		NA																	0				ovary(2)	2						c.(28-30)GGT>AGT		synaptotagmin binding, cytoplasmic RNA							81.0	73.0	76.0					6																	86351130		2203	4300	6503	SO:0001583	missense	10492				CRD-mediated mRNA stabilization|interspecies interaction between organisms	catalytic step 2 spliceosome|CRD-mediated mRNA stability complex|endoplasmic reticulum|histone pre-mRNA 3'end processing complex|microsome|nucleoplasm	nucleotide binding|protein binding	g.chr6:86351130C>T	AF037448	CCDS5005.1, CCDS55041.1, CCDS75491.1	6q14-q15	2013-05-23			ENSG00000135316	ENSG00000135316		"""RNA binding motif (RRM) containing"""	16918	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein Q"""					9847309, 11352648	Standard	NM_006372		Approved	NSAP1, GRY-RBP, dJ3J17.2, HNRPQ1, hnRNP-Q, HNRNPQ	uc003pla.2	O60506	OTTHUMG00000015141	ENST00000369622.3:c.28G>A	6.37:g.86351130C>T	ENSP00000358635:p.Gly10Ser					SYNCRIP_uc003pku.2_Missense_Mutation_p.G10S|SYNCRIP_uc003pkw.2_Missense_Mutation_p.G10S|SYNCRIP_uc003pky.2_Intron|SYNCRIP_uc003pkv.2_Missense_Mutation_p.G10S|SYNCRIP_uc003pkx.2_Intron|SYNCRIP_uc003pkz.2_Missense_Mutation_p.G10S	p.G10S	NM_006372	NP_006363	O60506	HNRPQ_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0389)	2	569	-		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)	10					E1P501|E1P502|Q53H05|Q5TCG2|Q5TCG3|Q8IW78|Q8N599|Q96LC1|Q96LC2|Q9Y583	Missense_Mutation	SNP	ENST00000369622.3	37	c.28G>A	CCDS5005.1	.	.	.	.	.	.	.	.	.	.	C	17.32	3.360140	0.61403	.	.	ENSG00000135316	ENST00000355238;ENST00000369622;ENST00000444272	T;T	0.29397	1.58;1.57	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.24353	0.0590	L	0.49126	1.545	0.80722	D	1	P;P;P;P;P	0.40230	0.485;0.708;0.545;0.619;0.485	B;B;B;B;B	0.43052	0.23;0.269;0.165;0.406;0.23	T	0.02450	-1.1157	10	0.36615	T	0.2	.	18.1622	0.89712	0.0:1.0:0.0:0.0	.	10;10;10;10;10	O60506;O60506-2;O60506-4;O60506-3;B2R8Z8	HNRPQ_HUMAN;.;.;.;.	S	10	ENSP00000347380:G10S;ENSP00000358635:G10S	ENSP00000347380:G10S	G	-	1	0	SYNCRIP	86407849	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.212000	0.77941	2.361000	0.80049	0.563000	0.77884	GGT		0.358	SYNCRIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041396.1	NM_006372		12	47	0	0	0	0.003163	0	12	47				
GABRR1	2569	broad.mit.edu	37	6	89907945	89907945	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:89907945G>A	ENST00000454853.2	-	5	476	c.366C>T	c.(364-366)ctC>ctT	p.L122L	GABRR1_ENST00000435811.1_Silent_p.L105L|GABRR1_ENST00000369451.3_Silent_p.L35L	NM_001256704.1|NM_002042.4	NP_001243633.1|NP_002033.2	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 1	122					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(7)|lung(16)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	35		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	GCCTCAGGTAGAGGGTCATCG	0.557																																							uc003pna.2		NA																	0				pancreas(1)	1						c.(364-366)CTC>CTT		gamma-aminobutyric acid (GABA) receptor, rho 1	Picrotoxin(DB00466)						199.0	188.0	191.0					6																	89907945		2203	4300	6503	SO:0001819	synonymous_variant	2569				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr6:89907945G>A		CCDS5019.2, CCDS59028.1, CCDS59029.1	6q15	2012-06-22	2012-02-03		ENSG00000146276	ENSG00000146276		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4090	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 1"""	137161	"""gamma-aminobutyric acid (GABA) receptor, rho 1"""			1849271, 1315307	Standard	NM_002042		Approved		uc003pna.2	P24046	OTTHUMG00000015195	ENST00000454853.2:c.366C>T	6.37:g.89907945G>A						GABRR1_uc011dzv.1_Silent_p.L99L	p.L122L	NM_002042	NP_002033	P24046	GBRR1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.00917)	5	821	-		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)	122			Extracellular (Probable).		A1L401|B4DJK8|B4DQT5|B7ZBQ7|Q9BX06	Silent	SNP	ENST00000454853.2	37	c.366C>T	CCDS5019.2																																																																																				0.557	GABRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041479.2			45	165	0	0	0	0.013114	0	45	165				
LYRM2	57226	broad.mit.edu	37	6	90348409	90348409	+	Silent	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:90348409C>A	ENST00000523377.1	-	1	63	c.27G>T	c.(25-27)gcG>gcT	p.A9A	LYRM2_ENST00000520318.1_Silent_p.A9A|LYRM2_ENST00000520441.1_Silent_p.A9A|LYRM2_ENST00000517396.1_5'Flank	NM_020466.4	NP_065199.1	Q9NU23	LYRM2_HUMAN	LYR motif containing 2	9						mitochondrion (GO:0005739)				kidney(1)|large_intestine(1)|lung(1)	3		all_cancers(76;2.76e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;3.72e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0131)		ACGTTAGCGTCGCTGGGGGTA	0.637																																							uc003pnm.2		NA																	0					0						c.(25-27)GCG>GCT		LYR motif containing 2							94.0	93.0	93.0					6																	90348409		2203	4300	6503	SO:0001819	synonymous_variant	57226							g.chr6:90348409C>A	BC009782	CCDS5023.1	6q15	2006-09-19			ENSG00000083099	ENSG00000083099		"""LYR motif containing"""	25229	protein-coding gene	gene with protein product						12477932	Standard	NM_020466		Approved	DJ122O8.2	uc003pnm.3	Q9NU23	OTTHUMG00000015203	ENST00000523377.1:c.27G>T	6.37:g.90348409C>A						LYRM2_uc010kce.1_5'Flank|LYRM2_uc003png.2_RNA|LYRM2_uc010kcf.1_5'Flank|LYRM2_uc010kcg.2_5'Flank|LYRM2_uc003pnl.3_5'Flank	p.A9A	NM_020466	NP_065199	Q9NU23	LYRM2_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0131)	1	66	-		all_cancers(76;2.76e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;3.72e-05)|Lung NSC(302;0.238)	9					B2R4U2|E1P517	Silent	SNP	ENST00000523377.1	37	c.27G>T	CCDS5023.1																																																																																				0.637	LYRM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041498.2	NM_020466		29	139	1	0	4.31634e-10	0.012213	4.86317e-10	29	139				
MAP3K7	6885	broad.mit.edu	37	6	91281451	91281451	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:91281451C>G	ENST00000369329.3	-	2	357	c.196G>C	c.(196-198)Gaa>Caa	p.E66Q	MAP3K7_ENST00000369327.3_Missense_Mutation_p.E66Q|MAP3K7_ENST00000369332.3_Missense_Mutation_p.E66Q|MAP3K7_ENST00000369325.3_Missense_Mutation_p.E66Q	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	66	Interaction with MAPK8IP1. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		GATTCACTTTCTATTTGTTTA	0.333																																							uc003pnz.1		NA																	0				ovary(2)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)	6						c.(196-198)GAA>CAA		mitogen-activated protein kinase kinase kinase 7							153.0	139.0	144.0					6																	91281451		2203	4299	6502	SO:0001583	missense	6885				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|histone H3 acetylation|I-kappaB phosphorylation|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytosol|endosome membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding|protein binding	g.chr6:91281451C>G	AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.196G>C	6.37:g.91281451C>G	ENSP00000358335:p.Glu66Gln					MAP3K7_uc003poa.1_Missense_Mutation_p.E66Q|MAP3K7_uc003pob.1_Missense_Mutation_p.E66Q|MAP3K7_uc003poc.1_Missense_Mutation_p.E66Q	p.E66Q	NM_145331	NP_663304	O43318	M3K7_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)	2	358	-		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)	66			Protein kinase.		B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Missense_Mutation	SNP	ENST00000369329.3	37	c.196G>C	CCDS5028.1	.	.	.	.	.	.	.	.	.	.	C	19.04	3.749661	0.69533	.	.	ENSG00000135341	ENST00000369332;ENST00000369329;ENST00000369325;ENST00000369327;ENST00000450832	D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66	5.57	5.57	0.84162	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74145	0.3678	N	0.05124	-0.11	0.80722	D	1	B;B;D;B	0.67145	0.194;0.109;0.996;0.261	B;B;P;B	0.58660	0.03;0.03;0.843;0.05	T	0.77140	-0.2697	10	0.30078	T	0.28	.	19.5591	0.95366	0.0:1.0:0.0:0.0	.	66;66;66;66	O43318-4;O43318-2;O43318-3;O43318	.;.;.;M3K7_HUMAN	Q	66	ENSP00000358338:E66Q;ENSP00000358335:E66Q;ENSP00000358331:E66Q;ENSP00000358333:E66Q	ENSP00000358331:E66Q	E	-	1	0	MAP3K7	91338172	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.574000	0.82434	2.626000	0.88956	0.557000	0.71058	GAA		0.333	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041530.1	NM_145331		8	57	0	0	0	0.008291	0	8	57				
SIM1	6492	broad.mit.edu	37	6	100838702	100838702	+	Silent	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:100838702G>T	ENST00000369208.3	-	12	2618	c.1836C>A	c.(1834-1836)ccC>ccA	p.P612P	SIM1_ENST00000262901.4_Silent_p.P612P			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	612	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		CTGTTGGTGGGGGCTGTTGGT	0.498																																							uc003pqj.3		NA																	0				ovary(4)	4						c.(1834-1836)CCC>CCA		single-minded homolog 1							91.0	94.0	93.0					6																	100838702		2203	4300	6503	SO:0001819	synonymous_variant	6492				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr6:100838702G>T	U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.1836C>A	6.37:g.100838702G>T						SIM1_uc010kcu.2_Silent_p.P612P	p.P612P	NM_005068	NP_005059	P81133	SIM1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0774)	11	2043	-		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)	612			Single-minded C-terminal.		Q5TDP7	Silent	SNP	ENST00000369208.3	37	c.1836C>A	CCDS5045.1																																																																																				0.498	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041628.3	NM_005068		37	62	1	0	2.42023e-17	0.003271	2.88783e-17	37	62				
SIM1	6492	broad.mit.edu	37	6	100841691	100841691	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:100841691C>T	ENST00000369208.3	-	11	2024	c.1242G>A	c.(1240-1242)acG>acA	p.T414T	SIM1_ENST00000262901.4_Silent_p.T414T			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	414	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		GCGGAGAGGCCGTGTCGGTCA	0.577																																							uc003pqj.3		NA																	0				ovary(4)	4						c.(1240-1242)ACG>ACA		single-minded homolog 1							42.0	40.0	41.0					6																	100841691		2203	4300	6503	SO:0001819	synonymous_variant	6492				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr6:100841691C>T	U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.1242G>A	6.37:g.100841691C>T						SIM1_uc010kcu.2_Silent_p.T414T	p.T414T	NM_005068	NP_005059	P81133	SIM1_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0774)	10	1449	-		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)	414			Single-minded C-terminal.		Q5TDP7	Silent	SNP	ENST00000369208.3	37	c.1242G>A	CCDS5045.1																																																																																				0.577	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041628.3	NM_005068		18	36	0	0	0	0.006122	0	18	36				
TRAF3IP2	10758	broad.mit.edu	37	6	111896952	111896952	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:111896952C>G	ENST00000340026.6	-	5	1716	c.1122G>C	c.(1120-1122)ctG>ctC	p.L374L	TRAF3IP2-AS1_ENST00000449449.2_RNA|TRAF3IP2-AS1_ENST00000440395.1_RNA|TRAF3IP2_ENST00000368761.5_Silent_p.L365L|TRAF3IP2-AS1_ENST00000607066.1_RNA|TRAF3IP2-AS1_ENST00000456352.2_RNA|TRAF3IP2_ENST00000359831.4_Silent_p.L365L|TRAF3IP2-AS1_ENST00000606892.1_RNA|TRAF3IP2-AS1_ENST00000442928.2_RNA|TRAF3IP2_ENST00000368731.2_5'Flank|TRAF3IP2-AS1_ENST00000438298.2_RNA|TRAF3IP2_ENST00000392556.4_5'UTR|TRAF3IP2-AS1_ENST00000532353.1_RNA			O43734	CIKS_HUMAN	TRAF3 interacting protein 2	374					B cell apoptotic process (GO:0001783)|humoral immune response (GO:0006959)|immunoglobulin secretion (GO:0048305)|intracellular signal transduction (GO:0035556)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)					central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	18		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		CCTGTGGTCTCAGCTCTGCAG	0.547																																							uc011ebc.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(1093-1095)CTG>CTC		TRAF3 interacting protein 2 isoform 2							78.0	80.0	80.0					6																	111896952		2203	4300	6503	SO:0001819	synonymous_variant	10758				intracellular signal transduction|positive regulation of I-kappaB kinase/NF-kappaB cascade	intracellular		g.chr6:111896952C>G	AF136405	CCDS5093.1, CCDS55049.1, CCDS55050.1	6q21	2008-09-05	2002-06-20	2005-04-13	ENSG00000056972	ENSG00000056972			1343	protein-coding gene	gene with protein product		607043	"""chromosome 6 open reading frame 5"", ""chromosome 6 open reading frame 2"""	C6orf4, C6orf5, C6orf6, C6orf2		10962033, 10962024	Standard	NR_028338		Approved	DKFZP586G0522, ACT1, CIKS	uc003pvf.4	O43734	OTTHUMG00000015379	ENST00000340026.6:c.1122G>C	6.37:g.111896952C>G						TRAF3IP2_uc003pvd.2_5'Flank|TRAF3IP2_uc003pvg.2_Silent_p.L365L|TRAF3IP2_uc003pvf.2_Silent_p.L365L|TRAF3IP2_uc010kdw.2_Silent_p.L365L|TRAF3IP2_uc010kdx.2_Silent_p.L365L	p.L365L	NM_147686	NP_679211	O43734	CIKS_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)	5	1710	-		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)	374					B2RAY9|E1P555|Q5R3A3|Q7Z6Q1|Q7Z6Q2|Q7Z6Q3|Q9H5W2|Q9H6Y3|Q9NS14|Q9UG72	Silent	SNP	ENST00000340026.6	37	c.1095G>C																																																																																					0.547	TRAF3IP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000041841.2			10	54	0	0	0	0.010729	0	10	54				
ROS1	6098	broad.mit.edu	37	6	117632184	117632184	+	Splice_Site	SNP	T	T	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:117632184T>A	ENST00000368508.3	-	39	6430	c.6232A>T	c.(6232-6234)Agg>Tgg	p.R2078W	ROS1_ENST00000368507.3_Splice_Site_p.R2072W	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	2078	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GAATTGTACCTGTGAATGAAA	0.383			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																		uc003pxp.1		NA		Dom	yes		6	6q22	6098	T	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)			"""O, E"""	GOPC|ROS1		glioblastoma|NSCLC		0				lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25						c.(6232-6234)AGG>TGG		proto-oncogene c-ros-1 protein precursor							120.0	113.0	116.0					6																	117632184		2203	4300	6503	SO:0001630	splice_region_variant	6098				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr6:117632184T>A	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.6233+1A>T	6.37:g.117632184T>A						ROS1_uc011ebi.1_RNA	p.R2078W	NM_002944	NP_002935	P08922	ROS_HUMAN		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)	39	6431	-		all_cancers(87;0.00846)|all_epithelial(87;0.0242)	2078			Protein kinase.|Cytoplasmic (Potential).		Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	37	c.6232A>T	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.809328	0.90707	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	D;D	0.88818	-2.43;-2.43	5.85	5.85	0.93711	.	0.000000	0.64402	D	0.000001	D	0.96892	0.8985	H	0.99273	4.495	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.98602	1.0659	10	0.87932	D	0	.	15.4042	0.74866	0.0:0.0:0.0:1.0	.	2078	P08922	ROS1_HUMAN	W	2078;2072	ENSP00000357494:R2078W;ENSP00000357493:R2072W	ENSP00000357493:R2072W	R	-	1	2	ROS1	117738877	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.665000	0.61547	2.232000	0.73038	0.533000	0.62120	AGG		0.383	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		Missense_Mutation	31	42	0	0	0	0.010818	0	31	42				
MYB	4602	broad.mit.edu	37	6	135511330	135511330	+	Silent	SNP	G	G	T	rs139729764		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:135511330G>T	ENST00000367814.4	+	5	558	c.372G>T	c.(370-372)ggG>ggT	p.G124G	MYB_ENST00000527615.1_Silent_p.G124G|MYB_ENST00000534121.1_Silent_p.G124G|MYB_ENST00000341911.5_Silent_p.G124G|MYB_ENST00000528774.1_Silent_p.G124G|MYB_ENST00000420123.2_Silent_p.G100G|MYB_ENST00000534044.1_Silent_p.G124G|MYB_ENST00000316528.8_Silent_p.G124G|MYB_ENST00000533624.1_Silent_p.G124G|MYB_ENST00000525369.1_Silent_p.G124G|MYB_ENST00000531845.1_3'UTR|MYB_ENST00000442647.2_Silent_p.G124G	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog	124	HTH myb-type 2. {ECO:0000255|PROSITE- ProRule:PRU00625}.|Interaction with HIPK2 and NLK. {ECO:0000250}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		ACTTAAAGGGGAGAATTGGAA	0.398			T	NFIB	adenoid cystic carcinoma																																		uc003qfc.2		NA		Dom	yes		6	6q22-23	4602	T	v-myb myeloblastosis viral oncogene homolog			E	NFIB		adenoid cystic carcinoma		0				lung(1)	1						c.(370-372)GGG>GGT		v-myb myeloblastosis viral oncogene homolog							120.0	116.0	117.0					6																	135511330		2203	4300	6503	SO:0001819	synonymous_variant	4602				blood coagulation|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone H3-K4 methylation|positive regulation of histone H3-K9 methylation|positive regulation of T-helper cell differentiation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear matrix	DNA binding|protein binding	g.chr6:135511330G>T		CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.372G>T	6.37:g.135511330G>T						MYB_uc003qfh.2_Silent_p.G124G|MYB_uc003qfi.2_Silent_p.G124G|MYB_uc010kgi.2_Silent_p.G124G|MYB_uc003qfq.2_Silent_p.G124G|MYB_uc010kgj.2_Silent_p.G124G|MYB_uc003qfo.2_Silent_p.G124G|MYB_uc003qfu.2_Silent_p.G124G|MYB_uc003qfl.2_RNA|MYB_uc003qfv.2_RNA|MYB_uc003qfz.2_RNA|MYB_uc003qfx.2_RNA|MYB_uc003qga.2_RNA|MYB_uc003qgb.2_RNA|MYB_uc010kgk.2_RNA|MYB_uc003qfd.2_RNA|MYB_uc003qfe.2_RNA|MYB_uc003qfg.2_RNA|MYB_uc003qff.2_RNA|MYB_uc003qfj.2_RNA|MYB_uc003qfm.2_RNA|MYB_uc003qfp.2_RNA|MYB_uc003qfn.2_RNA|MYB_uc003qfk.2_RNA|MYB_uc003qfr.2_RNA|MYB_uc003qfs.2_Intron|MYB_uc003qft.2_RNA|MYB_uc003qfw.2_Intron|MYB_uc003qfy.2_RNA|MYB_uc003qgc.2_RNA|MYB_uc003qfb.1_Silent_p.G124G|MYB_uc003qgd.1_5'UTR	p.G124G	NM_005375	NP_005366	P10242	MYB_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)	5	571	+	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)	124			HTH myb-type 2.|Interaction with HIPK2 and NLK (By similarity).|H-T-H motif (By similarity).		E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Silent	SNP	ENST00000367814.4	37	c.372G>T	CCDS5174.1																																																																																				0.398	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042347.4			7	92	1	0	5.18039e-06	0.00308	5.5821e-06	7	92				
MAP3K5	4217	broad.mit.edu	37	6	136977581	136977581	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:136977581A>G	ENST00000359015.4	-	10	1904	c.1544T>C	c.(1543-1545)gTa>gCa	p.V515A	MAP3K5_ENST00000355845.4_5'UTR	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	515					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		AATTGTCTCTACAATAGACTT	0.383																																							uc003qhc.2		NA																	0				ovary(2)|skin(2)|lung(1)	5						c.(1543-1545)GTA>GCA		mitogen-activated protein kinase kinase kinase							105.0	100.0	102.0					6																	136977581		2203	4300	6503	SO:0001583	missense	4217				activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding	g.chr6:136977581A>G	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.1544T>C	6.37:g.136977581A>G	ENSP00000351908:p.Val515Ala					MAP3K5_uc011edj.1_5'UTR|MAP3K5_uc011edk.1_Missense_Mutation_p.V360A|MAP3K5_uc010kgw.1_Missense_Mutation_p.V515A	p.V515A	NM_005923	NP_005914	Q99683	M3K5_HUMAN		GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)	10	1905	-	Colorectal(23;0.24)		515					A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	ENST00000359015.4	37	c.1544T>C	CCDS5179.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.498781	0.85069	.	.	ENSG00000197442	ENST00000359015;ENST00000367768	T	0.09350	2.99	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.24586	0.0596	M	0.70595	2.14	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.997	D;D;D	0.80764	0.963;0.994;0.992	T	0.01367	-1.1373	10	0.72032	D	0.01	.	16.0382	0.80645	1.0:0.0:0.0:0.0	.	595;360;515	Q59GL6;B4DF67;Q99683	.;.;M3K5_HUMAN	A	515;595	ENSP00000351908:V515A	ENSP00000351908:V515A	V	-	2	0	MAP3K5	137019274	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.194000	0.70268	0.533000	0.62120	GTA		0.383	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1			35	98	0	0	0	0.013726	0	35	98				
HECA	51696	broad.mit.edu	37	6	139488428	139488428	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:139488428G>A	ENST00000367658.2	+	2	1564	c.1279G>A	c.(1279-1281)Gag>Aag	p.E427K	RP1-225E12.2_ENST00000415194.2_RNA|RP1-225E12.2_ENST00000586229.1_RNA|RP1-225E12.2_ENST00000588638.1_RNA|RP1-225E12.2_ENST00000589192.1_RNA|RP1-225E12.2_ENST00000585447.1_RNA|RP1-225E12.2_ENST00000587577.1_RNA|RP1-225E12.2_ENST00000588529.1_RNA|RP1-225E12.3_ENST00000585874.1_RNA|RP1-225E12.2_ENST00000591102.1_RNA|RP1-225E12.2_ENST00000590679.1_RNA|RP1-225E12.2_ENST00000586266.1_RNA	NM_016217.2	NP_057301.1	Q9UBI9	HDC_HUMAN	headcase homolog (Drosophila)	427					respiratory tube development (GO:0030323)	membrane (GO:0016020)				endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(68;0.000252)|OV - Ovarian serous cystadenocarcinoma(155;0.000387)		GAGACATGATGAGATCGAATA	0.463																																							uc003qin.2		NA																	0					0						c.(1279-1281)GAG>AAG		headcase							78.0	70.0	73.0					6																	139488428		2203	4300	6503	SO:0001583	missense	51696				respiratory tube development			g.chr6:139488428G>A	AB033492	CCDS5194.1	6q23-q24	2010-11-25			ENSG00000112406	ENSG00000112406			21041	protein-coding gene	gene with protein product		607977				11696983, 19643820	Standard	NM_016217		Approved	HDCL, hHDC, HDC, dJ225E12.1	uc003qin.3	Q9UBI9	OTTHUMG00000015686	ENST00000367658.2:c.1279G>A	6.37:g.139488428G>A	ENSP00000356630:p.Glu427Lys						p.E427K	NM_016217	NP_057301	Q9UBI9	HDC_HUMAN		GBM - Glioblastoma multiforme(68;0.000252)|OV - Ovarian serous cystadenocarcinoma(155;0.000387)	2	1564	+			427						Missense_Mutation	SNP	ENST00000367658.2	37	c.1279G>A	CCDS5194.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.530516	0.85706	.	.	ENSG00000112406	ENST00000367658	.	.	.	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.46367	0.1389	N	0.10916	0.065	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.43147	-0.9409	9	0.12766	T	0.61	.	18.3061	0.90182	0.0:0.0:1.0:0.0	.	427	Q9UBI9	HDC_HUMAN	K	427	.	ENSP00000356630:E427K	E	+	1	0	HECA	139530121	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.179000	0.94861	2.565000	0.86533	0.563000	0.77884	GAG		0.463	HECA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042456.1	NM_016217		16	57	0	0	0	0.003163	0	16	57				
GRM1	2911	broad.mit.edu	37	6	146755353	146755353	+	Silent	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:146755353C>A	ENST00000282753.1	+	8	3241	c.3006C>A	c.(3004-3006)ctC>ctA	p.L1002L	GRM1_ENST00000492807.2_3'UTR|GRM1_ENST00000392299.2_3'UTR|GRM1_ENST00000361719.2_Silent_p.L1002L|GRM1_ENST00000355289.4_3'UTR|GRM1_ENST00000507907.1_3'UTR			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	1002					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		AGACCCCCCTCTTCCTGGCCG	0.687																																							uc010khw.1		NA																	0				lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19						c.(3004-3006)CTC>CTA		glutamate receptor, metabotropic 1 isoform alpha	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)						55.0	65.0	62.0					6																	146755353		2203	4300	6503	SO:0001819	synonymous_variant	2911				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:146755353C>A	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.3006C>A	6.37:g.146755353C>A						GRM1_uc010khv.1_3'UTR|GRM1_uc003qll.2_3'UTR|GRM1_uc011edz.1_3'UTR|GRM1_uc011eea.1_3'UTR	p.L1002L	NM_000838	NP_000829	Q13255	GRM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	9	3476	+		Ovarian(120;0.0387)	1002			Cytoplasmic (Potential).		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Silent	SNP	ENST00000282753.1	37	c.3006C>A	CCDS5209.1																																																																																				0.687	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838		50	79	1	0	3.19069e-20	0.01441	3.84844e-20	50	79				
NUP43	348995	broad.mit.edu	37	6	150048227	150048227	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:150048227C>G	ENST00000340413.2	-	8	1097	c.1021G>C	c.(1021-1023)Gaa>Caa	p.E341Q	NUP43_ENST00000460354.2_Missense_Mutation_p.E341Q|NUP43_ENST00000367403.3_3'UTR|NUP43_ENST00000367404.4_Missense_Mutation_p.E245Q	NM_198887.1	NP_942590.1	Q8NFH3	NUP43_HUMAN	nucleoporin 43kDa	341					carbohydrate metabolic process (GO:0005975)|chromosome segregation (GO:0007059)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				breast(1)|large_intestine(2)|lung(8)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	18		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;4.71e-13)|GBM - Glioblastoma multiforme(68;0.101)		CTTGTGATTTCAATTCGGTCT	0.418																																							uc003qmz.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(1021-1023)GAA>CAA		nucleoporin 43kDa							128.0	116.0	120.0					6																	150048227		2203	4300	6503	SO:0001583	missense	348995				carbohydrate metabolic process|cell division|chromosome segregation|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	protein binding	g.chr6:150048227C>G	AF514997	CCDS5218.1	6q25.1	2013-01-10			ENSG00000120253	ENSG00000120253		"""WD repeat domain containing"""	21182	protein-coding gene	gene with protein product		608141				12196509	Standard	XM_005266961		Approved	bA350J20.1, FLJ13287	uc003qmz.3	Q8NFH3	OTTHUMG00000015795	ENST00000340413.2:c.1021G>C	6.37:g.150048227C>G	ENSP00000342262:p.Glu341Gln					NUP43_uc003qmx.3_RNA|NUP43_uc011eee.1_RNA|NUP43_uc011eef.1_Missense_Mutation_p.E245Q	p.E341Q	NM_198887	NP_942590	Q8NFH3	NUP43_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;4.71e-13)|GBM - Glioblastoma multiforme(68;0.101)	8	1078	-		Ovarian(120;0.0164)	341					B4E2F0|Q9H8S0	Missense_Mutation	SNP	ENST00000340413.2	37	c.1021G>C	CCDS5218.1	.	.	.	.	.	.	.	.	.	.	C	31	5.101092	0.94245	.	.	ENSG00000120253	ENST00000340413;ENST00000460354;ENST00000367404	T;T;T	0.36520	1.25;1.25;1.25	5.74	5.74	0.90152	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.54334	0.1852	M	0.71036	2.16	0.80722	D	1	P;D	0.89917	0.656;1.0	B;D	0.71656	0.358;0.974	T	0.55016	-0.8206	10	0.62326	D	0.03	-24.7253	18.9005	0.92440	0.0:1.0:0.0:0.0	.	245;341	B4E2F0;Q8NFH3	.;NUP43_HUMAN	Q	341;341;245	ENSP00000342262:E341Q;ENSP00000432401:E341Q;ENSP00000356374:E245Q	ENSP00000342262:E341Q	E	-	1	0	NUP43	150089920	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.298000	0.78815	2.723000	0.93209	0.585000	0.79938	GAA		0.418	NUP43-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396947.1	NM_198887		10	68	0	0	0	0.008291	0	10	68				
CCDC170	80129	broad.mit.edu	37	6	151907150	151907150	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:151907150C>G	ENST00000239374.7	+	7	1318	c.1219C>G	c.(1219-1221)Cag>Gag	p.Q407E	CCDC170_ENST00000367290.5_Missense_Mutation_p.Q407E	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	407																	TCTTCAGGGTCAGCTGACACA	0.483																																							uc003qol.2		NA																	0					0						c.(1219-1221)CAG>GAG		hypothetical protein LOC80129							65.0	65.0	65.0					6																	151907150		1895	4120	6015	SO:0001583	missense	80129							g.chr6:151907150C>G	AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.1219C>G	6.37:g.151907150C>G	ENSP00000239374:p.Gln407Glu						p.Q407E	NM_025059	NP_079335	Q8IYT3	CF097_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.111)	OV - Ovarian serous cystadenocarcinoma(155;1.48e-10)	7	1308	+		Ovarian(120;0.126)	407			Potential.		Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Missense_Mutation	SNP	ENST00000239374.7	37	c.1219C>G	CCDS43515.1	.	.	.	.	.	.	.	.	.	.	C	14.86	2.660511	0.47572	.	.	ENSG00000120262	ENST00000239374;ENST00000367290	T;T	0.11495	2.77;2.77	5.76	4.84	0.62591	.	0.396674	0.26190	N	0.025814	T	0.05777	0.0151	L	0.46157	1.445	0.36987	D	0.894604	B	0.13145	0.007	B	0.14023	0.01	T	0.13791	-1.0496	10	0.31617	T	0.26	-2.0744	15.9196	0.79552	0.0:0.8646:0.1354:0.0	.	407	Q8IYT3	CF097_HUMAN	E	407	ENSP00000239374:Q407E;ENSP00000356259:Q407E	ENSP00000239374:Q407E	Q	+	1	0	C6orf97	151948843	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	2.869000	0.48444	2.709000	0.92574	0.591000	0.81541	CAG		0.483	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042727.2	NM_025059		10	40	0	0	0	0.001855	0	10	40				
SYNE1	23345	broad.mit.edu	37	6	152668219	152668219	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:152668219G>A	ENST00000367255.5	-	73	12654	c.12053C>T	c.(12052-12054)tCa>tTa	p.S4018L	SYNE1_ENST00000448038.1_Missense_Mutation_p.S3947L|SYNE1_ENST00000265368.4_Missense_Mutation_p.S4018L|SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000423061.1_Missense_Mutation_p.S3947L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4018					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GCAGATCGCTGAGTAGCTGTC	0.488										HNSCC(10;0.0054)																													uc010kiw.2		NA																	0				central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(12052-12054)TCA>TTA		spectrin repeat containing, nuclear envelope 1							171.0	142.0	152.0					6																	152668219		2203	4300	6503	SO:0001583	missense	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152668219G>A	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.12053C>T	6.37:g.152668219G>A	ENSP00000356224:p.Ser4018Leu	HNSCC(10;0.0054)				SYNE1_uc003qot.3_Missense_Mutation_p.S3947L|SYNE1_uc003qou.3_Missense_Mutation_p.S4018L|SYNE1_uc010kja.1_Missense_Mutation_p.S723L	p.S4018L	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	73	12655	-		Ovarian(120;0.0955)	4018			Spectrin 10.|Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	c.12053C>T	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	17.42	3.384822	0.61956	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038	T;T;T;T	0.35236	1.32;1.32;1.32;1.32	5.91	5.91	0.95273	.	0.000000	0.51477	D	0.000100	T	0.54013	0.1832	M	0.66939	2.045	0.80722	D	1	D;D;D;B	0.89917	1.0;1.0;1.0;0.002	D;D;D;B	0.85130	0.997;0.997;0.997;0.003	T	0.42916	-0.9423	10	0.39692	T	0.17	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	4018;4018;4018;3947	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	L	4018;3947;4018;3947	ENSP00000356224:S4018L;ENSP00000396024:S3947L;ENSP00000265368:S4018L;ENSP00000390975:S3947L	ENSP00000265368:S4018L	S	-	2	0	SYNE1	152709912	1.000000	0.71417	0.972000	0.41901	0.879000	0.50718	7.570000	0.82390	2.793000	0.96121	0.655000	0.94253	TCA		0.488	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		8	52	0	0	0	0.00308	0	8	52				
SYNE1	23345	broad.mit.edu	37	6	152763354	152763354	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:152763354C>G	ENST00000367255.5	-	31	4465	c.3864G>C	c.(3862-3864)aaG>aaC	p.K1288N	SYNE1_ENST00000367253.4_Missense_Mutation_p.K1288N|SYNE1_ENST00000448038.1_Missense_Mutation_p.K1295N|SYNE1_ENST00000265368.4_Missense_Mutation_p.K1288N|SYNE1_ENST00000413186.2_Missense_Mutation_p.K1288N|SYNE1_ENST00000341594.5_Missense_Mutation_p.K1354N|SYNE1_ENST00000423061.1_Missense_Mutation_p.K1295N|SYNE1_ENST00000367248.3_Missense_Mutation_p.K1278N	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1288					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CATCTCTCTTCTTTGCTGAGA	0.532										HNSCC(10;0.0054)																													uc010kiw.2		NA																	0				central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(3862-3864)AAG>AAC		spectrin repeat containing, nuclear envelope 1							79.0	69.0	72.0					6																	152763354		2203	4300	6503	SO:0001583	missense	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152763354C>G	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3864G>C	6.37:g.152763354C>G	ENSP00000356224:p.Lys1288Asn	HNSCC(10;0.0054)				SYNE1_uc003qot.3_Missense_Mutation_p.K1295N|SYNE1_uc003qou.3_Missense_Mutation_p.K1288N|SYNE1_uc010kjb.1_Missense_Mutation_p.K1271N|SYNE1_uc003qow.2_Missense_Mutation_p.K583N|SYNE1_uc003qox.1_Missense_Mutation_p.K804N	p.K1288N	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	31	4466	-		Ovarian(120;0.0955)	1288			Potential.|Cytoplasmic (Potential).		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	c.3864G>C	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	13.05	2.121425	0.37436	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186	T;T;T;T;T;D;D;D	0.88741	0.55;0.55;0.46;0.55;0.62;-2.29;-2.42;-2.42	5.41	2.7	0.31948	.	0.000000	0.64402	D	0.000011	D	0.87573	0.6211	M	0.64997	1.995	0.80722	D	1	D;B;B;D;B;P	0.76494	0.996;0.43;0.309;0.999;0.43;0.565	P;B;B;D;B;B	0.64042	0.766;0.107;0.134;0.921;0.107;0.326	D	0.85531	0.1209	10	0.48119	T	0.1	.	6.0267	0.19658	0.0:0.5361:0.1249:0.339	.	1271;1288;1278;1288;1288;1295	B3W695;Q8NF91;F5GXQ8;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.;.	N	1288;1295;1288;1295;1354;1288;1278;1288	ENSP00000356224:K1288N;ENSP00000396024:K1295N;ENSP00000265368:K1288N;ENSP00000390975:K1295N;ENSP00000341887:K1354N;ENSP00000356222:K1288N;ENSP00000356217:K1278N;ENSP00000414510:K1288N	ENSP00000265368:K1288N	K	-	3	2	SYNE1	152805047	1.000000	0.71417	0.985000	0.45067	0.654000	0.38779	0.995000	0.29706	0.364000	0.24374	-0.142000	0.14014	AAG		0.532	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		11	76	0	0	0	0.010729	0	11	76				
FBXO5	26271	broad.mit.edu	37	6	153296150	153296150	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:153296150C>G	ENST00000229758.3	-	2	768	c.710G>C	c.(709-711)aGa>aCa	p.R237T	FBXO5_ENST00000477822.1_5'Flank|FBXO5_ENST00000367241.3_Missense_Mutation_p.R191T	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5	237	Interaction with EVI5.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		GCCCATTTTTCTGCCAATTAT	0.383																																					NSCLC(121;372 1757 17721 17977 29669)	NSCLC(121;372 1757 17721 17977 29669)	uc003qpg.2		NA																	0					0						c.(709-711)AGA>ACA		F-box only protein 5 isoform a							100.0	103.0	102.0					6																	153296150		2203	4300	6503	SO:0001583	missense	26271				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm|spindle	metal ion binding|protein binding	g.chr6:153296150C>G	AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.710G>C	6.37:g.153296150C>G	ENSP00000229758:p.Arg237Thr					FBXO5_uc003qph.2_Missense_Mutation_p.R191T	p.R237T	NM_012177	NP_036309	Q9UKT4	FBX5_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)	2	819	-		Ovarian(120;0.125)	237			Interaction with EVI5.		B3KNX5|Q5TF47|Q8WV29|Q9UGC8	Missense_Mutation	SNP	ENST00000229758.3	37	c.710G>C	CCDS5242.1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.433468	0.62955	.	.	ENSG00000112029	ENST00000229758;ENST00000367241	T;T	0.40476	1.03;1.03	5.92	5.05	0.67936	.	0.313533	0.43416	D	0.000562	T	0.15869	0.0382	N	0.24115	0.695	0.24973	N	0.991658	D	0.53151	0.958	P	0.45343	0.477	T	0.05517	-1.0880	10	0.59425	D	0.04	-14.6309	6.6734	0.23080	0.0:0.6963:0.0:0.3037	.	237	Q9UKT4	FBX5_HUMAN	T	237;191	ENSP00000229758:R237T;ENSP00000356210:R191T	ENSP00000229758:R237T	R	-	2	0	FBXO5	153337843	0.890000	0.30428	0.999000	0.59377	0.986000	0.74619	0.702000	0.25631	1.484000	0.48361	0.655000	0.94253	AGA		0.383	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042757.1			7	102	0	0	0	0.00308	0	7	102				
TULP4	56995	broad.mit.edu	37	6	158914615	158914615	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:158914615G>C	ENST00000367097.3	+	10	2999	c.1642G>C	c.(1642-1644)Gag>Cag	p.E548Q	TULP4_ENST00000367094.2_Missense_Mutation_p.E548Q	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	548					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		GATCAGCATTGAGGCCCGCAA	0.657																																							uc003qrf.2		NA																	0				ovary(1)	1						c.(1642-1644)GAG>CAG		tubby like protein 4 isoform 1							44.0	49.0	47.0					6																	158914615		2203	4300	6503	SO:0001583	missense	56995				intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity	g.chr6:158914615G>C		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.1642G>C	6.37:g.158914615G>C	ENSP00000356064:p.Glu548Gln					TULP4_uc003qrg.2_Missense_Mutation_p.E548Q	p.E548Q	NM_020245	NP_064630	Q9NRJ4	TULP4_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)	10	2999	+		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)	548					Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Missense_Mutation	SNP	ENST00000367097.3	37	c.1642G>C	CCDS34561.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187559	0.78789	.	.	ENSG00000130338	ENST00000367097;ENST00000367094	T;T	0.62364	0.03;0.87	4.46	4.46	0.54185	Tubby, C-terminal (1);	0.056354	0.64402	D	0.000001	T	0.51176	0.1659	L	0.36672	1.1	0.54753	D	0.99998	P;P	0.51791	0.808;0.948	B;P	0.50860	0.367;0.652	T	0.51482	-0.8700	10	0.36615	T	0.2	-29.3237	15.6383	0.76973	0.0:0.0:1.0:0.0	.	548;548	Q9NRJ4-2;Q9NRJ4	.;TULP4_HUMAN	Q	548	ENSP00000356064:E548Q;ENSP00000356061:E548Q	ENSP00000356061:E548Q	E	+	1	0	TULP4	158834603	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	9.115000	0.94336	2.195000	0.70347	0.563000	0.77884	GAG		0.657	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	NM_020245		12	70	0	0	0	0.010729	0	12	70				
SLC22A3	6581	broad.mit.edu	37	6	160819028	160819028	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:160819028C>G	ENST00000275300.2	+	2	599	c.447C>G	c.(445-447)gtC>gtG	p.V149V	SLC22A3_ENST00000392145.1_Silent_p.V149V	NM_021977.3	NP_068812.1	O75751	S22A3_HUMAN	solute carrier family 22 (organic cation transporter), member 3	149					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|histamine uptake (GO:0051615)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|regulation of appetite (GO:0032098)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine transmembrane transporter activity (GO:0005329)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|toxin transporter activity (GO:0019534)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)	Adefovir Dipivoxil(DB00718)|Amphetamine(DB00182)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Colchicine(DB01394)|Desipramine(DB01151)|Dopamine(DB00988)|Estradiol(DB00783)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imipramine(DB00458)|Irinotecan(DB00762)|Lamivudine(DB00709)|Melphalan(DB01042)|Metformin(DB00331)|Methamphetamine(DB01577)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Phenoxybenzamine(DB00925)|Prazosin(DB00457)|Procainamide(DB01035)|Progesterone(DB00396)|Testosterone(DB00624)|Vincristine(DB00541)	TTGTCTGTGTCAATGCGTGGA	0.453																																							uc003qti.2		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.(445-447)GTC>GTG		solute carrier family 22 member 3							247.0	223.0	231.0					6																	160819028		2203	4300	6503	SO:0001819	synonymous_variant	6581					integral to plasma membrane|membrane fraction	protein binding|quaternary ammonium group transmembrane transporter activity	g.chr6:160819028C>G	AF078749	CCDS5277.1	6q25.3	2013-07-18	2013-07-18		ENSG00000146477	ENSG00000146477		"""Solute carriers"""	10967	protein-coding gene	gene with protein product		604842	"""solute carrier family 22 (extraneuronal monoamine transporter), member 3"""			9632645, 9933568	Standard	NM_021977		Approved	OCT3, EMT	uc003qti.4	O75751	OTTHUMG00000015953	ENST00000275300.2:c.447C>G	6.37:g.160819028C>G						SLC22A3_uc011efx.1_RNA	p.V149V	NM_021977	NP_068812	O75751	S22A3_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)	2	474	+		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)	149					Q5SYN6|Q9UP02	Silent	SNP	ENST00000275300.2	37	c.447C>G	CCDS5277.1																																																																																				0.453	SLC22A3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042953.1	NM_021977		22	139	0	0	0	0.003954	0	22	139				
PACRG	135138	broad.mit.edu	37	6	163235198	163235198	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:163235198C>A	ENST00000337019.3	+	3	400	c.176C>A	c.(175-177)gCa>gAa	p.A59E	PACRG_ENST00000366889.2_Missense_Mutation_p.A59E|PACRG_ENST00000542669.1_3'UTR|PACRG_ENST00000366888.2_Missense_Mutation_p.A59E	NM_152410.2	NP_689623.2	Q96M98	PACRG_HUMAN	PARK2 co-regulated	59					spermatid development (GO:0007286)	cell body (GO:0044297)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm midpiece (GO:0097225)				endometrium(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)		CCTCCAGCTGCAGGGGCATTT	0.378																																							uc003qua.2		NA																	0					0						c.(175-177)GCA>GAA		parkin co-regulated gene protein isoform 1							76.0	83.0	81.0					6																	163235198		2203	4300	6503	SO:0001583	missense	135138							g.chr6:163235198C>A	AK057286	CCDS5284.1, CCDS43524.1	6q26	2004-07-01			ENSG00000112530	ENSG00000112530			19152	protein-coding gene	gene with protein product		608427				12547187	Standard	NM_001080378		Approved	PARK2CRG, FLJ32724, Glup, HAK005771	uc003qua.3	Q96M98	OTTHUMG00000016116	ENST00000337019.3:c.176C>A	6.37:g.163235198C>A	ENSP00000337946:p.Ala59Glu					PACRG_uc003qub.2_Missense_Mutation_p.A59E|PACRG_uc003quc.2_Missense_Mutation_p.A59E	p.A59E	NM_152410	NP_689623	Q96M98	PACRG_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)	3	400	+		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)	59					E1P5B5|Q6IMB8|Q8IZM1|Q8NHP5|Q9H1V9	Missense_Mutation	SNP	ENST00000337019.3	37	c.176C>A	CCDS5284.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.842223	0.71488	.	.	ENSG00000112530	ENST00000337019;ENST00000366889;ENST00000366888	T	0.50001	0.76	5.47	5.47	0.80525	.	0.050230	0.85682	D	0.000000	T	0.56645	0.1999	L	0.48642	1.525	0.58432	D	0.999997	D;D	0.67145	0.991;0.996	D;D	0.68353	0.915;0.957	T	0.57740	-0.7759	10	0.59425	D	0.04	-12.9238	19.3451	0.94359	0.0:1.0:0.0:0.0	.	59;59	Q96M98-2;Q96M98	.;PACRG_HUMAN	E	59	ENSP00000337946:A59E	ENSP00000337946:A59E	A	+	2	0	PACRG	163155188	1.000000	0.71417	0.946000	0.38457	0.744000	0.42396	6.832000	0.75329	2.575000	0.86900	0.563000	0.77884	GCA		0.378	PACRG-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400424.1	NM_152410		27	93	1	0	4.22769e-11	0.00632	4.83683e-11	27	93				
FRMD1	79981	broad.mit.edu	37	6	168468049	168468049	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:168468049C>G	ENST00000283309.6	-	3	446	c.382G>C	c.(382-384)Gaa>Caa	p.E128Q	FRMD1_ENST00000432403.1_5'Flank|FRMD1_ENST00000440994.2_Missense_Mutation_p.E60Q|FRMD1_ENST00000537786.1_5'UTR	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	128	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		ACACTTACTTCATTTCTTTCT	0.512																																					GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)	GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)	uc003qwo.3		NA																	0				ovary(1)	1						c.(382-384)GAA>CAA		FERM domain containing 1 isoform 1							75.0	91.0	86.0					6																	168468049		2203	4300	6503	SO:0001583	missense	79981					cytoskeleton	binding	g.chr6:168468049C>G		CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.382G>C	6.37:g.168468049C>G	ENSP00000283309:p.Glu128Gln					FRMD1_uc003qwm.3_5'Flank|FRMD1_uc011egs.1_5'UTR|FRMD1_uc011egt.1_Missense_Mutation_p.E40Q|FRMD1_uc003qwn.3_Missense_Mutation_p.E60Q	p.E128Q	NM_024919	NP_079195	Q8N878	FRMD1_HUMAN		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)	3	447	-		Breast(66;1.07e-05)|Ovarian(120;0.0728)	128			FERM.		B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Missense_Mutation	SNP	ENST00000283309.6	37	c.382G>C	CCDS5306.1	.	.	.	.	.	.	.	.	.	.	C	9.117	1.008053	0.19199	.	.	ENSG00000153303	ENST00000283309;ENST00000440994;ENST00000511714	D;D	0.82711	-1.64;-1.53	2.8	-5.61	0.02489	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.413927	0.20240	U	0.096316	T	0.36303	0.0962	N	0.08118	0	0.28549	N	0.911716	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.09377	0.004;0.002;0.003	T	0.17349	-1.0372	10	0.56958	D	0.05	.	4.5627	0.12168	0.0:0.2956:0.3168:0.3876	.	40;128;60	B7Z8G9;Q8N878;Q8N878-2	.;FRMD1_HUMAN;.	Q	128;60;170	ENSP00000283309:E128Q;ENSP00000414115:E60Q	ENSP00000283309:E128Q	E	-	1	0	FRMD1	168210898	0.651000	0.27340	0.000000	0.03702	0.006000	0.05464	0.783000	0.26802	-1.964000	0.01012	-0.873000	0.02984	GAA		0.512	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362513.2	NM_024919		8	47	0	0	0	0.00308	0	8	47				
SMOC2	64094	broad.mit.edu	37	6	168927058	168927058	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr6:168927058A>T	ENST00000356284.2	+	3	509	c.289A>T	c.(289-291)Acc>Tcc	p.T97S	SMOC2_ENST00000354536.5_Missense_Mutation_p.T97S	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	97	Thyroglobulin type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		AAGGAAGTATACCCAGGAGCA	0.512																																							uc003qws.1		NA																	0				ovary(1)	1						c.(289-291)ACC>TCC		SPARC related modular calcium binding 2							138.0	110.0	120.0					6																	168927058		2203	4300	6503	SO:0001583	missense	64094				signal transduction	basement membrane	calcium ion binding	g.chr6:168927058A>T	AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.289A>T	6.37:g.168927058A>T	ENSP00000348630:p.Thr97Ser					SMOC2_uc003qwr.1_Missense_Mutation_p.T97S	p.T97S	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)	3	309	+		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)	97			Thyroglobulin type-1 1.		B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Missense_Mutation	SNP	ENST00000356284.2	37	c.289A>T	CCDS55076.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.481774	0.84747	.	.	ENSG00000112562	ENST00000356284;ENST00000354536;ENST00000366793	T;T	0.62788	-0.0;-0.0	4.86	4.86	0.63082	Thyroglobulin type-1 (4);	0.000000	0.85682	D	0.000000	T	0.47746	0.1462	L	0.37561	1.115	0.36747	D	0.882522	P;P	0.52692	0.87;0.955	P;P	0.49887	0.625;0.596	T	0.53394	-0.8445	10	0.44086	T	0.13	-21.4753	12.2643	0.54668	1.0:0.0:0.0:0.0	.	97;97	Q9H3U7;Q9H3U7-2	SMOC2_HUMAN;.	S	97	ENSP00000348630:T97S;ENSP00000346537:T97S	ENSP00000346537:T97S	T	+	1	0	SMOC2	168669907	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.585000	0.82584	1.819000	0.53055	0.529000	0.55759	ACC		0.512	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043201.1			25	55	0	0	0	0.010818	0	25	55				
SDK1	221935	broad.mit.edu	37	7	4277383	4277383	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:4277383G>T	ENST00000404826.2	+	42	6236	c.6097G>T	c.(6097-6099)Ggg>Tgg	p.G2033W	SDK1_ENST00000466611.1_3'UTR|SDK1_ENST00000389531.3_Missense_Mutation_p.G2013W	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	2033					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.G2033W(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CGTCCTGCACGGGCAGAATAA	0.572																																							uc003smx.2		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(3)|ovary(2)|skin(1)	6						c.(6097-6099)GGG>TGG		sidekick 1 precursor							153.0	139.0	143.0					7																	4277383		2203	4300	6503	SO:0001583	missense	221935				cell adhesion	integral to membrane		g.chr7:4277383G>T	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.6097G>T	7.37:g.4277383G>T	ENSP00000385899:p.Gly2033Trp					SDK1_uc010kso.2_Missense_Mutation_p.G1289W|SDK1_uc003smy.2_Missense_Mutation_p.G520W|SDK1_uc003smz.2_Missense_Mutation_p.G93W	p.G2033W	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)	42	6236	+		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)	2033			Extracellular (Potential).|Cytoplasmic (Potential).		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	c.6097G>T	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.528686	0.64860	.	.	ENSG00000146555	ENST00000404826;ENST00000446104;ENST00000389531	T;T	0.62941	-0.01;0.01	5.27	4.39	0.52855	.	0.080733	0.48767	D	0.000161	T	0.79381	0.4436	M	0.80183	2.485	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.989;0.996;0.999	T	0.82481	-0.0436	10	0.87932	D	0	.	14.0324	0.64624	0.0728:0.0:0.9272:0.0	.	2013;93;520;2033	F8W6X9;Q7Z5N4-2;F2Z3E9;Q7Z5N4	.;.;.;SDK1_HUMAN	W	2033;281;2013	ENSP00000385899:G2033W;ENSP00000374182:G2013W	ENSP00000374182:G2013W	G	+	1	0	SDK1	4243909	1.000000	0.71417	0.752000	0.31206	0.728000	0.41692	6.439000	0.73430	1.216000	0.43427	0.609000	0.83330	GGG		0.572	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744		41	36	1	0	3.4345e-17	0.011902	4.09073e-17	41	36				
RBAK	57786	broad.mit.edu	37	7	5103989	5103989	+	Missense_Mutation	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:5103989A>G	ENST00000353796.3	+	6	1226	c.902A>G	c.(901-903)aAg>aGg	p.K301R	RBAK_ENST00000396912.1_Missense_Mutation_p.K301R|RBAK-RBAKDN_ENST00000396904.2_Intron|RBAK-RBAKDN_ENST00000407184.1_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	301					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		TTCAGCCAAAAGGGAACCCTC	0.408																																							uc010kss.1		NA																	0				ovary(3)|kidney(1)|skin(1)	5						c.(901-903)AAG>AGG		RB-associated KRAB repressor							70.0	73.0	72.0					7																	5103989		2203	4300	6503	SO:0001583	missense	57786				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	g.chr7:5103989A>G	AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.902A>G	7.37:g.5103989A>G	ENSP00000275423:p.Lys301Arg					LOC389458_uc003snr.2_Intron|RBAK_uc003sns.1_Missense_Mutation_p.K301R	p.K301R	NM_021163	NP_066986	Q9NYW8	RBAK_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)	6	1226	+		Ovarian(82;0.0175)	301			C2H2-type 2.		A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	ENST00000353796.3	37	c.902A>G	CCDS5337.1	.	.	.	.	.	.	.	.	.	.	A	8.114	0.779423	0.16120	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	T;T	0.15834	2.39;2.39	3.76	3.76	0.43208	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.53938	D	0.000044	T	0.15305	0.0369	N	0.02842	-0.48	0.31326	N	0.685407	D	0.65815	0.995	D	0.69654	0.965	T	0.32214	-0.9915	8	.	.	.	.	11.0559	0.47918	1.0:0.0:0.0:0.0	.	301	Q9NYW8	RBAK_HUMAN	R	301	ENSP00000275423:K301R;ENSP00000380120:K301R	.	K	+	2	0	RBAK	5070515	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	0.165000	0.16564	1.931000	0.55961	0.454000	0.30748	AAG		0.408	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241640.2	NM_021163		25	28	0	0	0	0.00333	0	25	28				
DPY19L1	23333	broad.mit.edu	37	7	34971311	34971311	+	Silent	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:34971311A>G	ENST00000310974.4	-	22	2046	c.1902T>C	c.(1900-1902)gaT>gaC	p.D634D		NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	634						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						GATCTTCTACATCCCAAATTT	0.398																																							uc003tem.3		NA																	0					0						c.(1900-1902)GAT>GAC		dpy-19-like 1							33.0	30.0	31.0					7																	34971311		1828	4094	5922	SO:0001819	synonymous_variant	23333					integral to membrane		g.chr7:34971311A>G	AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.1902T>C	7.37:g.34971311A>G						DPY19L1_uc003tel.1_RNA	p.D634D	NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN			22	2047	-			634					O94954|Q4G151	Silent	SNP	ENST00000310974.4	37	c.1902T>C	CCDS43567.1	.	.	.	.	.	.	.	.	.	.	A	8.973	0.973517	0.18736	.	.	ENSG00000173852	ENST00000428054	.	.	.	5.5	1.83	0.25207	.	.	.	.	.	T	0.55561	0.1928	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44590	-0.9318	4	.	.	.	-21.3496	8.0595	0.30625	0.6925:0.0:0.3075:0.0	.	.	.	.	R	42	.	.	C	-	1	0	DPY19L1	34937836	0.986000	0.35501	1.000000	0.80357	0.997000	0.91878	0.426000	0.21363	0.075000	0.16796	0.523000	0.50628	TGT		0.398	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337506.1			3	36	0	0	0	0.004672	0	3	36				
PKD1L1	168507	broad.mit.edu	37	7	47882650	47882650	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:47882650G>C	ENST00000289672.2	-	34	5405	c.5355C>G	c.(5353-5355)atC>atG	p.I1785M		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1785					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CTTGCAGAAAGATGTAACCAG	0.448																																							uc003tny.1		NA																	0				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						c.(5353-5355)ATC>ATG		polycystin-1L1							66.0	66.0	66.0					7																	47882650		2203	4300	6503	SO:0001583	missense	168507				cell-cell adhesion	integral to membrane		g.chr7:47882650G>C	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.5355C>G	7.37:g.47882650G>C	ENSP00000289672:p.Ile1785Met						p.I1785M	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN			34	5355	-			1785			Cytoplasmic (Potential).		Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	c.5355C>G	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.606765	0.28623	.	.	ENSG00000158683	ENST00000289672	T	0.21361	2.01	5.66	0.699	0.18093	.	0.237466	0.36101	N	0.002787	T	0.25382	0.0617	L	0.34521	1.04	0.25908	N	0.983274	D	0.76494	0.999	D	0.70716	0.97	T	0.08764	-1.0706	10	0.59425	D	0.04	-20.2055	2.9773	0.05942	0.439:0.0:0.2642:0.2968	.	1785	Q8TDX9	PK1L1_HUMAN	M	1785	ENSP00000289672:I1785M	ENSP00000289672:I1785M	I	-	3	3	PKD1L1	47849175	1.000000	0.71417	0.093000	0.20910	0.179000	0.23085	0.863000	0.27913	-0.104000	0.12154	-0.152000	0.13540	ATC		0.448	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295		12	39	0	0	0	0.013537	0	12	39				
POM121L12	285877	broad.mit.edu	37	7	53103733	53103733	+	Silent	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:53103733G>T	ENST00000408890.4	+	1	385	c.369G>T	c.(367-369)ggG>ggT	p.G123G		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	123										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						TGAAAGGGGGGCTGTGTCGTG	0.697																																							uc003tpz.2		NA																	0					0						c.(367-369)GGG>GGT		POM121 membrane glycoprotein-like 12							29.0	35.0	33.0					7																	53103733		1984	4137	6121	SO:0001819	synonymous_variant	285877							g.chr7:53103733G>T		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.369G>T	7.37:g.53103733G>T							p.G123G	NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN			1	385	+			123					Q8NDI9	Silent	SNP	ENST00000408890.4	37	c.369G>T	CCDS43584.1																																																																																				0.697	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595		9	31	1	0	2.17888e-05	0.006214	2.32158e-05	9	31				
ZNF479	90827	broad.mit.edu	37	7	57187738	57187738	+	Nonsense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:57187738C>A	ENST00000331162.4	-	5	1654	c.1384G>T	c.(1384-1386)Gag>Tag	p.E462*		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	462					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			TAGGGTCTCTCTCCAGTATGA	0.423																																							uc010kzo.2		NA																	0				ovary(3)|skin(1)	4						c.(1384-1386)GAG>TAG		zinc finger protein 479							70.0	72.0	71.0					7																	57187738		2105	4239	6344	SO:0001587	stop_gained	90827				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:57187738C>A	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.1384G>T	7.37:g.57187738C>A	ENSP00000333776:p.Glu462*						p.E462*	NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	GBM - Glioblastoma multiforme(1;9.18e-12)		5	1655	-			462						Nonsense_Mutation	SNP	ENST00000331162.4	37	c.1384G>T	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	c	18.37	3.608928	0.66558	.	.	ENSG00000185177	ENST00000331162	.	.	.	0.955	-1.91	0.07641	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	3.4006	0.07321	0.2406:0.5596:0.0:0.1998	.	.	.	.	X	462	.	ENSP00000333776:E462X	E	-	1	0	ZNF479	57191680	0.979000	0.34478	0.001000	0.08648	0.001000	0.01503	2.669000	0.46825	-1.602000	0.01599	-1.623000	0.00790	GAG		0.423	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202		47	88	1	0	1.67211e-32	0.01441	2.09642e-32	47	88				
ZNF92	168374	broad.mit.edu	37	7	64864225	64864225	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:64864225G>T	ENST00000328747.7	+	4	1397	c.1198G>T	c.(1198-1200)Gaa>Taa	p.E400*	ZNF92_ENST00000450302.2_Nonsense_Mutation_p.E331*|ZNF92_ENST00000357512.2_Nonsense_Mutation_p.E368*|ZNF92_ENST00000431504.1_Nonsense_Mutation_p.E324*	NM_152626.2	NP_689839.1	Q03936	ZNF92_HUMAN	zinc finger protein 92	400					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(3)|lung(4)|pancreas(1)|skin(1)|stomach(1)	13		Lung NSC(55;0.159)				CTACAAATGTGAAGAATGTGG	0.383																																							uc003ttz.2		NA																	0					0						c.(1198-1200)GAA>TAA		zinc finger protein 92 isoform 2							37.0	41.0	40.0					7																	64864225		2185	4291	6476	SO:0001587	stop_gained	168374					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr7:64864225G>T	M61872	CCDS34646.1, CCDS47596.1, CCDS75608.1, CCDS75609.1	7q11.21	2013-01-08	2006-05-12		ENSG00000146757	ENSG00000146757		"""Zinc fingers, C2H2-type"", ""-"""	13168	protein-coding gene	gene with protein product		603974	"""zinc finger protein 92 (HTF12)"""			8467795	Standard	NM_001287533		Approved	HPF12, TF12	uc003ttz.3	Q03936	OTTHUMG00000156557	ENST00000328747.7:c.1198G>T	7.37:g.64864225G>T	ENSP00000332595:p.Glu400*					ZNF92_uc003tua.2_Nonsense_Mutation_p.E331*|ZNF92_uc010kzu.2_Nonsense_Mutation_p.E368*|ZNF92_uc003tub.2_Nonsense_Mutation_p.E324*	p.E400*	NM_152626	NP_689839	Q03936	ZNF92_HUMAN			4	1341	+		Lung NSC(55;0.159)	400			C2H2-type 10.		A6NNF9|Q8N492|Q8NB35	Nonsense_Mutation	SNP	ENST00000328747.7	37	c.1198G>T	CCDS34646.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.259080	0.80246	.	.	ENSG00000146757	ENST00000328747;ENST00000431504;ENST00000357512;ENST00000450302	.	.	.	0.418	-0.581	0.11713	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	3.7696	0.08636	0.6253:0.0:0.3747:0.0	.	.	.	.	X	400;324;368;331	.	ENSP00000332595:E400X	E	+	1	0	ZNF92	64501660	0.000000	0.05858	0.461000	0.27105	0.454000	0.32378	-2.777000	0.00775	-0.396000	0.07703	-0.384000	0.06662	GAA		0.383	ZNF92-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344589.2	NM_152626		7	38	1	0	0.00198382	0.001984	0.00205467	7	38				
TRIM50	135892	broad.mit.edu	37	7	72738498	72738498	+	Silent	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:72738498G>C	ENST00000333149.2	-	2	488	c.288C>G	c.(286-288)ctC>ctG	p.L96L	TRIM50_ENST00000493498.1_5'UTR|TRIM50_ENST00000453152.1_Silent_p.L96L	NM_178125.2	NP_835226.2	Q86XT4	TRI50_HUMAN	tripartite motif containing 50	96						cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)	20						AGAAAAGGCTGAGCGGGTTCC	0.667											OREG0018105	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc010lbd.1		NA																	0				skin(1)	1						c.(286-288)CTC>CTG		tripartite motif protein 50A							43.0	47.0	46.0					7																	72738498		2203	4296	6499	SO:0001819	synonymous_variant	135892					cytoplasm|intracellular membrane-bounded organelle	ligase activity|zinc ion binding	g.chr7:72738498G>C	AY081948	CCDS34654.1	7q11.23	2013-01-09	2011-01-25	2006-03-31	ENSG00000146755	ENSG00000146755		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19017	protein-coding gene	gene with protein product		612548	"""tripartite motif-containing 50A"", ""tripartite motif-containing 50"""	TRIM50A			Standard	NM_001281450		Approved	FLJ32804	uc003txy.1	Q86XT4	OTTHUMG00000156805	ENST00000333149.2:c.288C>G	7.37:g.72738498G>C			OREG0018105	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1139	FKBP6_uc003twz.2_Intron|TRIM50_uc003txy.1_Silent_p.L96L|TRIM50_uc003txz.1_Silent_p.L96L	p.L96L	NM_178125	NP_835226	Q86XT4	TRI50_HUMAN			2	413	-			96			B box-type.		Q86XT3	Silent	SNP	ENST00000333149.2	37	c.288C>G	CCDS34654.1																																																																																				0.667	TRIM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345925.1	NM_178125		16	71	0	0	0	0.00499	0	16	71				
SEMA3A	10371	broad.mit.edu	37	7	83640603	83640603	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:83640603C>A	ENST00000265362.4	-	8	1135	c.821G>T	c.(820-822)gGa>gTa	p.G274V	SEMA3A_ENST00000436949.1_Missense_Mutation_p.G274V	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	274	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						TCTGTGCCCTCCAAAGTCATT	0.378																																							uc003uhz.2		NA																	0				ovary(2)|breast(1)|kidney(1)	4						c.(820-822)GGA>GTA		semaphorin 3A precursor							93.0	86.0	89.0					7																	83640603		2203	4300	6503	SO:0001583	missense	10371				axon guidance	extracellular region|membrane	receptor activity	g.chr7:83640603C>A	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.821G>T	7.37:g.83640603C>A	ENSP00000265362:p.Gly274Val						p.G274V	NM_006080	NP_006071	Q14563	SEM3A_HUMAN			8	1136	-			274			Sema.			Missense_Mutation	SNP	ENST00000265362.4	37	c.821G>T	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.650263	0.87958	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.73363	-0.74;-0.74	6.08	6.08	0.98989	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	D	0.91226	0.7235	H	0.95470	3.675	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92620	0.6107	10	0.87932	D	0	.	20.6721	0.99693	0.0:1.0:0.0:0.0	.	274	Q14563	SEM3A_HUMAN	V	274	ENSP00000265362:G274V;ENSP00000415260:G274V	ENSP00000265362:G274V	G	-	2	0	SEMA3A	83478539	1.000000	0.71417	0.973000	0.42090	0.780000	0.44128	7.818000	0.86416	2.894000	0.99253	0.591000	0.81541	GGA		0.378	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080		6	23	1	0	3.59834e-05	0.001168	3.82789e-05	6	23				
AGFG2	3268	broad.mit.edu	37	7	100151083	100151083	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:100151083C>T	ENST00000300176.4	+	4	667	c.545C>T	c.(544-546)cCt>cTt	p.P182L	AGFG2_ENST00000262935.4_Intron|AGFG2_ENST00000474713.1_3'UTR	NM_006076.4	NP_006067.3	O95081	AGFG2_HUMAN	ArfGAP with FG repeats 2	182					regulation of ARF GTPase activity (GO:0032312)	membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CTGGGTGATCCTGCACCGTCT	0.557																																							uc003uvf.2		NA																	0				central_nervous_system(1)	1						c.(544-546)CCT>CTT		ArfGAP with FG repeats 2							93.0	81.0	85.0					7																	100151083		2203	4300	6503	SO:0001583	missense	3268				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding	g.chr7:100151083C>T	AF015042	CCDS5697.1	7q22.1	2008-09-22	2008-09-22	2008-09-22	ENSG00000106351	ENSG00000106351		"""ADP-ribosylation factor GTPase activating proteins"""	5177	protein-coding gene	gene with protein product		604019	"""HIV-1 Rev binding protein-like"""	HRBL		9799793	Standard	XM_005250306		Approved	RABR	uc003uvf.3	O95081	OTTHUMG00000156029	ENST00000300176.4:c.545C>T	7.37:g.100151083C>T	ENSP00000300176:p.Pro182Leu					AGFG2_uc003uvg.1_Intron|AGFG2_uc010lgy.2_Silent_p.L44L	p.P182L	NM_006076	NP_006067	O95081	AGFG2_HUMAN			4	681	+			182					O75429|Q96AB9|Q96GL4	Missense_Mutation	SNP	ENST00000300176.4	37	c.545C>T	CCDS5697.1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.897103	0.52121	.	.	ENSG00000106351	ENST00000300176	T	0.25250	1.81	5.06	5.06	0.68205	.	0.140998	0.46145	D	0.000314	T	0.39226	0.1070	L	0.60455	1.87	0.80722	D	1	D	0.64830	0.994	P	0.56278	0.795	T	0.06972	-1.0797	10	0.54805	T	0.06	-27.871	11.9649	0.53029	0.0:0.8255:0.1745:0.0	.	182	O95081	AGFG2_HUMAN	L	182	ENSP00000300176:P182L	ENSP00000300176:P182L	P	+	2	0	AGFG2	99989019	0.211000	0.23529	1.000000	0.80357	0.719000	0.41307	2.372000	0.44257	2.817000	0.96982	0.644000	0.83932	CCT		0.557	AGFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342769.1	NM_006076		13	76	0	0	0	0.013537	0	13	76				
PRKRIP1	79706	broad.mit.edu	37	7	102036862	102036862	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:102036862G>A	ENST00000496391.1	+	5	1314	c.4G>A	c.(4-6)Gct>Act	p.A2T	PRKRIP1_ENST00000354783.4_5'Flank|PRKRIP1_ENST00000397912.3_Missense_Mutation_p.A2T|PRKRIP1_ENST00000482465.1_Intron|PRKRIP1_ENST00000462601.1_Intron			Q9H875	PKRI1_HUMAN	PRKR interacting protein 1 (IL11 inducible)	2	Interaction with EIF2AK2. {ECO:0000250}.				negative regulation of phosphorylation (GO:0042326)|negative regulation of protein kinase activity (GO:0006469)|renal system process (GO:0003014)	extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)			endometrium(1)|lung(4)|ovary(1)	6						GGCTGCCATGGCTAGCCCAGC	0.667																																							uc003uzh.2		NA																	0				ovary(1)	1						c.(4-6)GCT>ACT		PRKR interacting protein 1 (IL11 inducible)							7.0	9.0	8.0					7																	102036862		2043	4033	6076	SO:0001583	missense	79706					nucleolus		g.chr7:102036862G>A	AK023964	CCDS34714.1	7q22.1	2013-01-09			ENSG00000128563	ENSG00000128563		"""Zinc fingers, C2H2-type"", ""-"""	21894	protein-coding gene	gene with protein product	"""likely ortholog of mouse C114 dsRNA-binding protein"", ""KRAB box domain containing 3"""					12679338	Standard	NM_024653		Approved	C114, FLJ13902, KRBOX3	uc003uzh.2	Q9H875	OTTHUMG00000157717	ENST00000496391.1:c.4G>A	7.37:g.102036862G>A	ENSP00000419270:p.Ala2Thr					PRKRIP1_uc003uzf.2_Intron|PRKRIP1_uc003uzg.2_Intron|PRKRIP1_uc011kkq.1_Intron|PRKRIP1_uc011kkr.1_Missense_Mutation_p.A2T	p.A2T	NM_024653	NP_078929	Q9H875	PKRI1_HUMAN			1	59	+			2			Interaction with EIF2AK2 (By similarity).		B4DGM2|Q8NDM6|Q96CF8	Missense_Mutation	SNP	ENST00000496391.1	37	c.4G>A	CCDS34714.1	.	.	.	.	.	.	.	.	.	.	g	17.20	3.328443	0.60743	.	.	ENSG00000128563	ENST00000496391;ENST00000397912	T;T	0.36520	1.25;1.25	5.17	5.17	0.71159	.	0.115978	0.64402	D	0.000017	T	0.44074	0.1276	L	0.59436	1.845	0.80722	D	1	P	0.51791	0.948	P	0.48738	0.588	T	0.41610	-0.9499	10	0.66056	D	0.02	-10.9146	14.1016	0.65059	0.0:0.0:1.0:0.0	.	2	Q9H875	PKRI1_HUMAN	T	2	ENSP00000419270:A2T;ENSP00000381010:A2T	ENSP00000381010:A2T	A	+	1	0	PRKRIP1	101823867	1.000000	0.71417	1.000000	0.80357	0.036000	0.12997	5.039000	0.64185	2.712000	0.92718	0.550000	0.68814	GCT		0.667	PRKRIP1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349489.1	NM_024653		8	4	0	0	0	0.00308	0	8	4				
RELN	5649	broad.mit.edu	37	7	103341380	103341380	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:103341380G>A	ENST00000428762.1	-	9	1038	c.879C>T	c.(877-879)gaC>gaT	p.D293D	RELN_ENST00000343529.5_Silent_p.D293D|RELN_ENST00000424685.2_Silent_p.D293D	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	293					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GCTGAATCCAGTCCGCAGAGT	0.363																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	0				ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(877-879)GAC>GAT		reelin isoform a							113.0	114.0	113.0					7																	103341380		2203	4300	6503	SO:0001819	synonymous_variant	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103341380G>A		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.879C>T	7.37:g.103341380G>A						RELN_uc010liz.2_Silent_p.D293D	p.D293D	NM_005045	NP_005036	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	9	1039	-			293					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	c.879C>T	CCDS47680.1																																																																																				0.363	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		40	61	0	0	0	0.009718	0	40	61				
AHCYL2	23382	broad.mit.edu	37	7	129046264	129046264	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:129046264G>C	ENST00000325006.3	+	10	1306	c.1252G>C	c.(1252-1254)Gtg>Ctg	p.V418L	AHCYL2_ENST00000474594.1_Missense_Mutation_p.V315L|AHCYL2_ENST00000446212.1_Missense_Mutation_p.V316L|AHCYL2_ENST00000531335.2_Missense_Mutation_p.V337L|RNU7-16P_ENST00000516471.1_RNA|AHCYL2_ENST00000490911.1_Missense_Mutation_p.V315L|AHCYL2_ENST00000446544.2_Missense_Mutation_p.V417L	NM_001130720.2|NM_015328.3	NP_001124192.1|NP_056143.1	Q96HN2	SAHH3_HUMAN	adenosylhomocysteinase-like 2	418					one-carbon metabolic process (GO:0006730)		adenosylhomocysteinase activity (GO:0004013)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	22						GGGCTCCATTGTGTATGTAAC	0.502																																					Pancreas(160;1736 1964 29875 40941 45605)	Pancreas(160;1736 1964 29875 40941 45605)	uc011kov.1		NA																	0				ovary(2)	2						c.(1252-1254)GTG>CTG		S-adenosylhomocysteine hydrolase-like 2 isoform							166.0	139.0	148.0					7																	129046264		2203	4300	6503	SO:0001583	missense	23382				one-carbon metabolic process		adenosylhomocysteinase activity	g.chr7:129046264G>C	AB020635	CCDS5812.1, CCDS47706.1, CCDS47707.1, CCDS47708.1, CCDS47707.2	7q32.1	2009-06-12	2009-06-12		ENSG00000158467	ENSG00000158467			22204	protein-coding gene	gene with protein product			"""S-adenosylhomocysteine hydrolase-like 2"""				Standard	NM_001130720		Approved	KIAA0828	uc011kov.2	Q96HN2	OTTHUMG00000157677	ENST00000325006.3:c.1252G>C	7.37:g.129046264G>C	ENSP00000315931:p.Val418Leu					AHCYL2_uc003vot.2_Missense_Mutation_p.V417L|AHCYL2_uc003vov.2_Missense_Mutation_p.V315L|AHCYL2_uc011kow.1_Missense_Mutation_p.V316L|AHCYL2_uc011kox.1_Missense_Mutation_p.V315L	p.V418L	NM_015328	NP_056143	Q96HN2	SAHH3_HUMAN			10	1306	+			418					B4DIZ5|D9N155|O94917	Missense_Mutation	SNP	ENST00000325006.3	37	c.1252G>C	CCDS5812.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.274058|4.274058	0.80580|0.80580	.|.	.|.	ENSG00000158467|ENSG00000158467	ENST00000466924|ENST00000325006;ENST00000446544;ENST00000531335;ENST00000474594;ENST00000446212;ENST00000490911	.|D;D;D;D;D;D	.|0.86030	.|-2.06;-2.05;-2.02;-1.99;-1.98;-1.99	6.16|6.16	6.16|6.16	0.99307|0.99307	.|S-adenosyl-L-homocysteine hydrolase, NAD binding (1);	.|0.053508	.|0.85682	.|D	.|0.000000	D|D	0.90659|0.90659	0.7070|0.7070	M|M	0.93808|0.93808	3.46|3.46	0.80722|0.80722	D|D	1|1	.|B;B;B;B;B	.|0.24426	.|0.033;0.033;0.103;0.033;0.084	.|B;B;B;B;B	.|0.30943	.|0.054;0.054;0.122;0.054;0.075	D|D	0.88563|0.88563	0.3124|0.3124	5|10	.|0.72032	.|D	.|0.01	-20.1954|-20.1954	18.3537|18.3537	0.90348|0.90348	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|315;316;418;315;417	.|B4DIZ5;D7UEQ7;Q96HN2;D9N155;Q96HN2-2	.|.;.;SAHH3_HUMAN;.;.	F|L	324|418;417;337;315;316;315	.|ENSP00000315931:V418L;ENSP00000413639:V417L;ENSP00000431787:V337L;ENSP00000420459:V315L;ENSP00000405267:V316L;ENSP00000420801:V315L	.|ENSP00000315931:V418L	L|V	+|+	3|1	2|0	AHCYL2|AHCYL2	128833500|128833500	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.499000|9.499000	0.97975|0.97975	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	TTG|GTG		0.502	AHCYL2-012	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354065.1			16	80	0	0	0	0.007413	0	16	80				
STRIP2	57464	broad.mit.edu	37	7	129091575	129091575	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:129091575C>G	ENST00000249344.2	+	4	436	c.396C>G	c.(394-396)ctC>ctG	p.L132L	STRIP2_ENST00000435494.2_Silent_p.L132L	NM_020704.2	NP_065755.1	Q9ULQ0	STRP2_HUMAN	striatin interacting protein 2	132					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)											GGGCTGTTCTCTACCTGGCCC	0.567																																							uc011koy.1		NA																	0					0						c.(394-396)CTC>CTG		hypothetical protein LOC57464 isoform a							55.0	58.0	57.0					7																	129091575		2203	4300	6503	SO:0001819	synonymous_variant	57464							g.chr7:129091575C>G	AB032996	CCDS34752.1, CCDS47709.1	7q32.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000128578	ENSG00000128578			22209	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog B (yeast)"""		"""family with sequence similarity 40, member B"""	FAM40B		22782902, 22298706, 18782753	Standard	NM_020704		Approved	KIAA1170, FAR11B	uc011koy.2	Q9ULQ0	OTTHUMG00000157695	ENST00000249344.2:c.396C>G	7.37:g.129091575C>G						FAM40B_uc003vow.2_Silent_p.L132L	p.L132L	NM_020704	NP_065755	Q9ULQ0	FA40B_HUMAN			4	436	+			132					Q8WUZ4	Silent	SNP	ENST00000249344.2	37	c.396C>G	CCDS34752.1																																																																																				0.567	STRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349418.1	NM_001134336		9	26	0	0	0	0.004482	0	9	26				
MEST	4232	broad.mit.edu	37	7	130140669	130140669	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:130140669G>C	ENST00000223215.4	+	9	908	c.687G>C	c.(685-687)gaG>gaC	p.E229D	MEST_ENST00000462132.1_3'UTR|MEST_ENST00000378576.4_Intron|hsa-mir-335_ENST00000604666.1_RNA|MEST_ENST00000393187.1_Missense_Mutation_p.E220D|MEST_ENST00000341441.5_Missense_Mutation_p.E220D|MEST_ENST00000416162.2_Intron|MEST_ENST00000437945.1_Missense_Mutation_p.E229D	NM_001253900.1|NM_002402.3	NP_001240829.1|NP_002393.2	Q5EB52	MEST_HUMAN	mesoderm specific transcript	229					mesoderm development (GO:0007498)|regulation of lipid storage (GO:0010883)|response to retinoic acid (GO:0032526)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(2)	12	Melanoma(18;0.0435)					GGCCCTCTGAGAGTGAGCTGT	0.498																																					Colon(126;2182 2305 6517 35181)	Colon(126;2182 2305 6517 35181)	uc003vqg.2		NA																	0				ovary(2)	2						c.(685-687)GAG>GAC		mesoderm specific transcript isoform a							81.0	69.0	73.0					7																	130140669		2203	4300	6503	SO:0001583	missense	4232				mesoderm development	endoplasmic reticulum membrane|integral to membrane	hydrolase activity|protein binding	g.chr7:130140669G>C		CCDS5822.1, CCDS5823.1, CCDS59081.1	7q32	2014-08-22	2012-12-07		ENSG00000106484	ENSG00000106484			7028	protein-coding gene	gene with protein product	"""Paternally-expressed gene 1"""	601029	"""mesoderm specific transcript (mouse) homolog"", ""mesoderm specific transcript homolog (mouse)"""			8884280	Standard	NM_002402		Approved	PEG1	uc003vqg.3	Q5EB52	OTTHUMG00000156661	ENST00000223215.4:c.687G>C	7.37:g.130140669G>C	ENSP00000223215:p.Glu229Asp					MEST_uc003vqc.2_Missense_Mutation_p.E220D|MEST_uc003vqd.2_Intron|MEST_uc003vqf.2_Missense_Mutation_p.E220D|MEST_uc011kph.1_Missense_Mutation_p.E215D|MEST_uc010lmg.2_Missense_Mutation_p.E229D	p.E229D	NM_002402	NP_002393	Q5EB52	MEST_HUMAN			9	904	+	Melanoma(18;0.0435)		229					B2R6S1|O14973|O15007|Q6AI49|Q92571	Missense_Mutation	SNP	ENST00000223215.4	37	c.687G>C	CCDS5822.1	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299794	0.40694	.	.	ENSG00000106484	ENST00000341441;ENST00000393187;ENST00000223215;ENST00000437945	T;T;T;T	0.03920	3.76;3.76;3.76;3.76	5.95	2.73	0.32206	.	0.192368	0.53938	D	0.000053	T	0.03608	0.0103	N	0.21545	0.675	0.37663	D	0.922857	B;B;B	0.09022	0.001;0.002;0.002	B;B;B	0.13407	0.009;0.005;0.007	T	0.41070	-0.9529	10	0.13470	T	0.59	-23.9687	12.1425	0.54007	0.22:0.0:0.78:0.0	.	215;229;229	B4DQW6;C9JW74;Q5EB52	.;.;MEST_HUMAN	D	220;220;229;229	ENSP00000342749:E220D;ENSP00000376884:E220D;ENSP00000223215:E229D;ENSP00000401657:E229D	ENSP00000223215:E229D	E	+	3	2	MEST	129927905	0.995000	0.38212	1.000000	0.80357	0.995000	0.86356	0.268000	0.18571	0.842000	0.35045	0.561000	0.74099	GAG		0.498	MEST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345183.2	NM_002402		3	38	0	0	0	0.009096	0	3	38				
AKR1B10	57016	broad.mit.edu	37	7	134222405	134222405	+	Missense_Mutation	SNP	G	G	A	rs201321507	byFrequency	TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:134222405G>A	ENST00000359579.4	+	7	1053	c.733G>A	c.(733-735)Gca>Aca	p.A245T		NM_020299.4	NP_064695.3	O60218	AK1BA_HUMAN	aldo-keto reductase family 1, member B10 (aldose reductase)	245					cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|farnesol catabolic process (GO:0016488)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	aldo-keto reductase (NADP) activity (GO:0004033)|geranylgeranyl reductase activity (GO:0045550)|indanol dehydrogenase activity (GO:0047718)|retinal dehydrogenase activity (GO:0001758)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(9)|skin(5)	20						CAAAAAAACCGCAGCCCAGGT	0.448													g|||	4	0.000798722	0.0	0.0	5008	,	,		21071	0.0		0.0	False		,,,				2504	0.0041						uc003vrr.2		NA																	0				skin(5)	5						c.(733-735)GCA>ACA		aldo-keto reductase family 1, member B10							87.0	96.0	93.0					7																	134222405		2203	4300	6503	SO:0001583	missense	57016				cellular aldehyde metabolic process|digestion|steroid metabolic process	cytoplasm	aldo-keto reductase (NADP) activity|protein binding	g.chr7:134222405G>A	AF052577	CCDS5832.1	7q33	2010-04-08			ENSG00000198074	ENSG00000198074		"""Aldo-keto reductases"""	382	protein-coding gene	gene with protein product	"""aldose reductase-like 1"", ""aldo-keto reductase family 1, member B11 (aldose reductase-like)"", ""aldose reductase-like peptide"", ""aldose reductase-related protein"", ""small intestine reductase"""	604707		AKR1B11		9765596, 9565553	Standard	NM_020299		Approved	AKR1B12, ARL-1, HIS, ARL1, HSI, ALDRLn	uc003vrr.3	O60218	OTTHUMG00000155356	ENST00000359579.4:c.733G>A	7.37:g.134222405G>A	ENSP00000352584:p.Ala245Thr						p.A245T	NM_020299	NP_064695	O60218	AK1BA_HUMAN			7	1053	+			245					A4D1P1|O75890|Q6FHF3|Q8IWZ1	Missense_Mutation	SNP	ENST00000359579.4	37	c.733G>A	CCDS5832.1	.	.	.	.	.	.	.	.	.	.	-	0.003	-2.497169	0.00159	.	.	ENSG00000198074	ENST00000359579	T	0.17054	2.3	4.53	-9.07	0.00724	NADP-dependent oxidoreductase domain (3);	1.017270	0.07817	N	0.959116	T	0.08802	0.0218	L	0.31664	0.95	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.14980	-1.0453	10	0.28530	T	0.3	.	4.1856	0.10397	0.189:0.1995:0.437:0.1745	.	245	O60218	AK1BA_HUMAN	T	245	ENSP00000352584:A245T	ENSP00000352584:A245T	A	+	1	0	AKR1B10	133872945	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-6.548000	0.00062	-5.249000	0.00018	-2.720000	0.00132	GCA		0.448	AKR1B10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339615.1	NM_020299		14	60	0	0	0	0.003163	0	14	60				
NUP205	23165	broad.mit.edu	37	7	135304260	135304260	+	Silent	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:135304260C>G	ENST00000285968.6	+	29	4079	c.4053C>G	c.(4051-4053)ctC>ctG	p.L1351L		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1351					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						AGGCCGTCCTCACTGAACAGA	0.512																																							uc003vsw.2		NA																	0				ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(4051-4053)CTC>CTG		nucleoporin 205kDa							115.0	106.0	109.0					7																	135304260		2203	4300	6503	SO:0001819	synonymous_variant	23165				carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr7:135304260C>G	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.4053C>G	7.37:g.135304260C>G						NUP205_uc003vsx.2_5'Flank	p.L1351L	NM_015135	NP_055950	Q92621	NU205_HUMAN			29	4084	+			1351					A6H8X3|Q86YC1	Silent	SNP	ENST00000285968.6	37	c.4053C>G	CCDS34759.1																																																																																				0.512	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1			25	35	0	0	0	0.003954	0	25	35				
BRAF	673	broad.mit.edu	37	7	140482954	140482954	+	Nonsense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:140482954G>C	ENST00000288602.6	-	10	1241	c.1181C>G	c.(1180-1182)tCa>tGa	p.S394*		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	394					activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	ACCTGTGGTTGATCCTAAATT	0.408		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)	Colon(40;35 892 2973 5743 27438)	uc003vwc.3		61		Dom	yes		7	7q34	673	Mis|T|O	v-raf murine sarcoma viral oncogene homolog B1	yes	Cardio-facio-cutaneous syndrome	E	AKAP9|KIAA1549		melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	0				thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290						c.(1180-1182)TCA>TGA		B-Raf	Sorafenib(DB00398)						46.0	45.0	45.0					7																	140482954		2203	4300	6503	SO:0001587	stop_gained	673	Cardiofaciocutaneous_syndrome	Familial Cancer Database	CFC, CFCS	activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	g.chr7:140482954G>C	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1181C>G	7.37:g.140482954G>C	ENSP00000288602:p.Ser394*						p.S394*	NM_004333	NP_004324	P15056	BRAF_HUMAN			10	1242	-	Melanoma(164;0.00956)		394					A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Nonsense_Mutation	SNP	ENST00000288602.6	37	c.1181C>G	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	41|41	9.072281|9.072281	0.99057|0.99057	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000496384|ENST00000288602	.|.	.|.	.|.	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.75547|.	0.3864|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.71094|.	-0.4692|.	3|.	.|0.34782	.|T	.|0.22	.|.	20.1047|20.1047	0.97888|0.97888	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	E|X	2|394	.|.	.|ENSP00000288602:S394X	Q|S	-|-	1|2	0|0	BRAF|BRAF	140129423|140129423	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.964000|0.964000	0.63967|0.63967	9.230000|9.230000	0.95299|0.95299	2.762000|2.762000	0.94881|0.94881	0.655000|0.655000	0.94253|0.94253	CAA|TCA		0.408	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333		7	33	0	0	0	0.00308	0	7	33				
PRSS1	5644	broad.mit.edu	37	7	142460304	142460304	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:142460304G>T	ENST00000311737.7	+	4	483	c.477G>T	c.(475-477)caG>caT	p.Q159H	PRSS1_ENST00000486171.1_Missense_Mutation_p.Q173H	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	159	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	ACGAGCTGCAGTGCCTGGATG	0.522																																							uc003wak.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(475-477)CAG>CAT		protease, serine, 1 preproprotein							305.0	298.0	300.0					7																	142460304		2203	4300	6503	SO:0001583	missense	5644	Hereditary_Pancreatitis			digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity	g.chr7:142460304G>T	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.477G>T	7.37:g.142460304G>T	ENSP00000308720:p.Gln159His					uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc003wam.2_Missense_Mutation_p.Q99H	p.Q159H	NM_002769	NP_002760	P07477	TRY1_HUMAN	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		4	494	+	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	159			Peptidase S1.		A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	ENST00000311737.7	37	c.477G>T	CCDS5872.1	.	.	.	.	.	.	.	.	.	.	G	12.71	2.020047	0.35606	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243;ENST00000492062	D;D;D	0.94092	-3.35;-3.35;-1.72	3.28	2.38	0.29361	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.140345	0.64402	D	0.000005	D	0.91064	0.7188	L	0.56199	1.76	0.42692	D	0.993587	P;B	0.34780	0.468;0.075	B;B	0.39876	0.312;0.216	D	0.88966	0.3397	10	0.62326	D	0.03	.	9.8667	0.41148	0.1099:0.0:0.8901:0.0	.	173;159	E7EQ64;P07477	.;TRY1_HUMAN	H	173;159;149;109	ENSP00000417854:Q173H;ENSP00000308720:Q159H;ENSP00000419912:Q109H	ENSP00000308720:Q159H	Q	+	3	2	PRSS1	142139878	1.000000	0.71417	1.000000	0.80357	0.076000	0.17211	4.558000	0.60789	0.675000	0.31264	0.398000	0.26397	CAG		0.522	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2			14	262	1	0	3.32936e-07	0.006122	3.64046e-07	14	262				
CASP2	835	broad.mit.edu	37	7	142988758	142988758	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:142988758C>T	ENST00000310447.5	+	2	441	c.200C>T	c.(199-201)aCc>aTc	p.T67I	CASP2_ENST00000493642.1_3'UTR|CASP2_ENST00000392925.2_Missense_Mutation_p.T67I|RN7SL535P_ENST00000479087.2_RNA	NM_032982.3|NM_032983.3	NP_116764.2|NP_116765.2	P42575	CASP2_HUMAN	caspase 2, apoptosis-related cysteine peptidase	67	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|ectopic germ cell programmed cell death (GO:0035234)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|luteolysis (GO:0001554)|neural retina development (GO:0003407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron apoptotic process (GO:0043525)|protein processing (GO:0016485)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(164;0.059)					GACATCATCACCTTGGAAATG	0.438																																							uc003wco.2		NA																	0				lung(2)|ovary(1)	3						c.(199-201)ACC>ATC		caspase 2 isoform 1 preproprotein							160.0	163.0	162.0					7																	142988758		2203	4300	6503	SO:0001583	missense	835				apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|protein maturation by peptide bond cleavage	cytosol	cysteine-type endopeptidase activity|enzyme binding|protein binding|protein domain specific binding	g.chr7:142988758C>T	AK096245, BC002427, BM998653, BX537669, CB988674, U13021	CCDS5879.1, CCDS47733.1	7q34-q35	2014-01-20	2008-08-01		ENSG00000106144	ENSG00000106144		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1503	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 57"""	600639	"""neural precursor cell expressed, developmentally down-regulated 2"""	NEDD2		7789948, 8780721	Standard	NM_032982		Approved	ICH1, PPP1R57, MGC2181	uc003wco.3	P42575	OTTHUMG00000023641	ENST00000310447.5:c.200C>T	7.37:g.142988758C>T	ENSP00000312664:p.Thr67Ile					CASP2_uc003wcp.2_Missense_Mutation_p.T67I|CASP2_uc011kta.1_5'UTR|CASP2_uc003wcq.2_RNA	p.T67I	NM_032982	NP_116764	P42575	CASP2_HUMAN			2	347	+	Melanoma(164;0.059)		67			CARD.		A8K5F9|D3DXD6|E9PDN0|P42576|Q59F21|Q7KZL6|Q86UJ3|Q9BUP7|Q9BZK9|Q9BZL0	Missense_Mutation	SNP	ENST00000310447.5	37	c.200C>T	CCDS5879.1	.	.	.	.	.	.	.	.	.	.	c	25.8	4.679736	0.88542	.	.	ENSG00000106144	ENST00000310447;ENST00000392925;ENST00000392923	T;T	0.26067	1.76;1.76	5.82	5.82	0.92795	DEATH-like (2);Caspase Recruitment (3);	0.000000	0.85682	D	0.000000	T	0.56891	0.2016	M	0.85859	2.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.99;0.991	T	0.60934	-0.7164	10	0.66056	D	0.02	.	17.0624	0.86550	0.0:1.0:0.0:0.0	.	67;67	E9PDN0;P42575	.;CASP2_HUMAN	I	67;67;36	ENSP00000312664:T67I;ENSP00000376656:T67I	ENSP00000312664:T67I	T	+	2	0	CASP2	142698880	1.000000	0.71417	0.976000	0.42696	0.996000	0.88848	5.566000	0.67372	2.764000	0.94973	0.650000	0.86243	ACC		0.438	CASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059962.3	NM_032982		21	124	0	0	0	0.012319	0	21	124				
OR2A12	346525	broad.mit.edu	37	7	143792833	143792833	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:143792833C>T	ENST00000408949.2	+	1	693	c.633C>T	c.(631-633)tgC>tgT	p.C211C		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	211						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					GGCCGCTCTGCCTGGTGCTGG	0.562																																							uc011kty.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(631-633)TGC>TGT		olfactory receptor, family 2, subfamily A,							187.0	183.0	184.0					7																	143792833		2020	4173	6193	SO:0001819	synonymous_variant	346525				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143792833C>T		CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.633C>T	7.37:g.143792833C>T							p.C211C	NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN			1	633	+	Melanoma(164;0.0783)		211			Helical; Name=5; (Potential).		Q6IF43	Silent	SNP	ENST00000408949.2	37	c.633C>T	CCDS43670.1																																																																																				0.562	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349969.1			60	120	0	0	0	0.01441	0	60	120				
ZNF786	136051	broad.mit.edu	37	7	148768612	148768612	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:148768612C>T	ENST00000491431.1	-	4	1316	c.1252G>A	c.(1252-1254)Gcg>Acg	p.A418T	ZNF786_ENST00000451334.3_Missense_Mutation_p.A381T|ZNF786_ENST00000316286.9_Missense_Mutation_p.A332T	NM_152411.3	NP_689624.2	Q8N393	ZN786_HUMAN	zinc finger protein 786	418					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(2)	26	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			CCACCGTGCGCGTGCTGGTGG	0.632																																							uc003wfh.2		NA																	0				breast(3)|skin(1)	4						c.(1252-1254)GCG>ACG		zinc finger protein 786							33.0	36.0	35.0					7																	148768612		2147	4253	6400	SO:0001583	missense	136051				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:148768612C>T	AK095701, AL834510	CCDS47738.1	7q36.1	2013-01-08			ENSG00000197362	ENSG00000197362		"""Zinc fingers, C2H2-type"", ""-"""	21806	protein-coding gene	gene with protein product							Standard	NM_152411		Approved	DKFZp762I137	uc003wfh.2	Q8N393	OTTHUMG00000158975	ENST00000491431.1:c.1252G>A	7.37:g.148768612C>T	ENSP00000417470:p.Ala418Thr					ZNF786_uc011kuk.1_Missense_Mutation_p.A381T|ZNF786_uc003wfi.2_Missense_Mutation_p.A332T	p.A418T	NM_152411	NP_689624	Q8N393	ZN786_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00463)		4	1389	-	Melanoma(164;0.15)		418			C2H2-type 4.		A1A568|B4DMI1	Missense_Mutation	SNP	ENST00000491431.1	37	c.1252G>A	CCDS47738.1	.	.	.	.	.	.	.	.	.	.	C	6.902	0.535924	0.13188	.	.	ENSG00000197362	ENST00000316286;ENST00000538412;ENST00000491431;ENST00000451334	T;T;T	0.04275	3.66;3.66;3.66	3.45	-0.735	0.11137	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01320	0.0043	N	0.01076	-1.035	0.09310	N	1	P	0.38110	0.618	B	0.31946	0.138	T	0.42865	-0.9426	9	0.38643	T	0.18	1.5954	3.9114	0.09205	0.1723:0.4972:0.0:0.3305	.	418	Q8N393	ZN786_HUMAN	T	332;332;418;381	ENSP00000313516:A332T;ENSP00000417470:A418T;ENSP00000404984:A381T	ENSP00000313516:A332T	A	-	1	0	ZNF786	148399545	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.982000	0.03762	0.211000	0.20683	0.655000	0.94253	GCG		0.632	ZNF786-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352751.1	NM_152411		4	24	0	0	0	0.000602	0	4	24				
KCNH2	3757	broad.mit.edu	37	7	150648011	150648011	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:150648011C>G	ENST00000262186.5	-	8	2544	c.2143G>C	c.(2143-2145)Gcg>Ccg	p.A715P	KCNH2_ENST00000392968.2_Missense_Mutation_p.A619P|KCNH2_ENST00000430723.3_Missense_Mutation_p.A715P|KCNH2_ENST00000330883.4_Missense_Mutation_p.A375P	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	715					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GGCCTCACCGCGTTCATGTCG	0.632																																					GBM(137;110 1844 13671 20123 45161)	GBM(137;110 1844 13671 20123 45161)	uc003wic.2		NA																	0				skin(3)|ovary(1)	4						c.(2143-2145)GCG>CCG		voltage-gated potassium channel, subfamily H,	Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Cisapride(DB00604)|Dofetilide(DB00204)|Halofantrine(DB01218)|Ibutilide(DB00308)|Pimozide(DB01100)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terfenadine(DB00342)|Verapamil(DB00661)						73.0	61.0	65.0					7																	150648011		2203	4300	6503	SO:0001583	missense	3757				blood circulation|muscle contraction|regulation of heart contraction|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|two-component sensor activity	g.chr7:150648011C>G	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.2143G>C	7.37:g.150648011C>G	ENSP00000262186:p.Ala715Pro					KCNH2_uc003wib.2_Missense_Mutation_p.A375P|KCNH2_uc011kux.1_Missense_Mutation_p.A619P|KCNH2_uc003wid.2_Missense_Mutation_p.A375P|KCNH2_uc003wie.2_Missense_Mutation_p.A715P	p.A715P	NM_000238	NP_000229	Q12809	KCNH2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	8	2156	-	all_neural(206;0.219)		715			Cytoplasmic (Potential).		A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	37	c.2143G>C	CCDS5910.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.937115	0.52972	.	.	ENSG00000055118	ENST00000330883;ENST00000392968;ENST00000262186;ENST00000430723	D;D;D;D	0.96774	-4.12;-4.12;-4.12;-4.12	4.36	4.36	0.52297	Cyclic nucleotide-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.96959	0.9007	L	0.48642	1.525	0.40649	D	0.982017	D;D;P;D;D	0.89917	1.0;1.0;0.92;0.995;0.99	D;D;P;P;P	0.85130	0.992;0.997;0.663;0.905;0.891	D	0.97502	1.0061	10	0.54805	T	0.06	.	14.7478	0.69501	0.0:1.0:0.0:0.0	.	619;715;375;715;375	C4PFH9;G5E9I0;Q708S9;Q12809;Q12809-2	.;.;.;KCNH2_HUMAN;.	P	375;619;715;715	ENSP00000328531:A375P;ENSP00000376695:A619P;ENSP00000262186:A715P;ENSP00000387657:A715P	ENSP00000262186:A715P	A	-	1	0	KCNH2	150278944	0.999000	0.42202	0.999000	0.59377	0.191000	0.23601	4.020000	0.57189	2.126000	0.65437	0.313000	0.20887	GCG		0.632	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238		11	27	0	0	0	0.004007	0	11	27				
NOS3	4846	broad.mit.edu	37	7	150696133	150696133	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:150696133C>A	ENST00000484524.1	+	7	916	c.916C>A	c.(916-918)Ccc>Acc	p.P306T	NOS3_ENST00000461406.1_Missense_Mutation_p.P100T|NOS3_ENST00000297494.3_Missense_Mutation_p.P306T|NOS3_ENST00000467517.1_Missense_Mutation_p.P306T	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTTCCTTCTGCCCCCCGAGCT	0.642																																							uc003wif.2		NA																	0				central_nervous_system(5)|large_intestine(2)|skin(1)	8						c.(916-918)CCC>ACC		nitric oxide synthase 3 isoform 1	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)						73.0	93.0	86.0					7																	150696133		2203	4292	6495	SO:0001583	missense	4846				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding	g.chr7:150696133C>A		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.916C>A	7.37:g.150696133C>A	ENSP00000420215:p.Pro306Thr					NOS3_uc011kuy.1_Missense_Mutation_p.P100T|NOS3_uc011kuz.1_Missense_Mutation_p.P306T|NOS3_uc011kva.1_Missense_Mutation_p.P306T|NOS3_uc011kvb.1_Missense_Mutation_p.P306T	p.P306T	NM_000603	NP_000594	P29474	NOS3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	8	1212	+	all_neural(206;0.219)		306			Interaction with NOSIP.		Q495E5	Missense_Mutation	SNP	ENST00000484524.1	37	c.916C>A	CCDS55182.1	.	.	.	.	.	.	.	.	.	.	c	17.33	3.362680	0.61403	.	.	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	T;T;T;T	0.51325	0.71;1.18;0.71;0.71	5.25	5.25	0.73442	Nitric oxide synthase, oxygenase domain (2);	0.000000	0.64402	D	0.000016	T	0.78155	0.4239	H	0.95402	3.665	0.58432	D	0.999998	D;D;D;D;D	0.89917	0.995;0.999;0.999;1.0;0.999	D;D;D;D;D	0.80764	0.963;0.978;0.978;0.994;0.963	D	0.84923	0.0855	10	0.87932	D	0	-7.027	16.7063	0.85373	0.0:1.0:0.0:0.0	.	306;306;306;100;306	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	T	306;100;306;306	ENSP00000297494:P306T;ENSP00000417143:P100T;ENSP00000420215:P306T;ENSP00000420551:P306T	ENSP00000297494:P306T	P	+	1	0	NOS3	150327066	1.000000	0.71417	1.000000	0.80357	0.148000	0.21650	6.039000	0.70972	2.597000	0.87782	0.637000	0.83480	CCC		0.642	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1	NM_000603		66	83	1	0	1.37693e-34	0.01441	1.73613e-34	66	83				
SLC4A2	6522	broad.mit.edu	37	7	150764008	150764008	+	Missense_Mutation	SNP	G	G	C	rs533465790		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr7:150764008G>C	ENST00000485713.1	+	7	1934	c.894G>C	c.(892-894)caG>caC	p.Q298H	SLC4A2_ENST00000461735.1_Missense_Mutation_p.Q284H|SLC4A2_ENST00000413384.2_Missense_Mutation_p.Q298H|SLC4A2_ENST00000310317.5_Missense_Mutation_p.Q216H|SLC4A2_ENST00000392826.2_Missense_Mutation_p.Q289H	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	298	Pro-rich.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTTCCACACAGAGTGGCCGAG	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		14800	0.0		0.0	False		,,,				2504	0.001						uc003wit.3		NA																	0					0						c.(892-894)CAG>CAC		solute carrier family 4, anion exchanger, member							51.0	58.0	56.0					7																	150764008		2203	4300	6503	SO:0001583	missense	6522				bicarbonate transport	integral to membrane|membrane fraction	inorganic anion exchanger activity	g.chr7:150764008G>C		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.894G>C	7.37:g.150764008G>C	ENSP00000419412:p.Gln298His					SLC4A2_uc011kve.1_Missense_Mutation_p.Q289H|SLC4A2_uc003wiu.3_Missense_Mutation_p.Q284H	p.Q298H	NM_003040	NP_003031	P04920	B3A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	7	1150	+			298			Cytoplasmic (Potential).|Pro-rich.		B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	ENST00000485713.1	37	c.894G>C	CCDS5917.1	.	.	.	.	.	.	.	.	.	.	G	4.011	-0.000676	0.07819	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.75821	-0.97;-0.97;-0.96;-0.96;-0.96	4.65	2.7	0.31948	.	0.344475	0.28161	N	0.016364	T	0.57844	0.2081	L	0.40543	1.245	0.25876	N	0.983648	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.002;0.001	T	0.36114	-0.9761	10	0.15952	T	0.53	.	4.8971	0.13755	0.1298:0.2176:0.6526:0.0	.	289;284;298	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	H	298;298;216;289;284	ENSP00000419412:Q298H;ENSP00000405600:Q298H;ENSP00000311402:Q216H;ENSP00000376571:Q289H;ENSP00000419164:Q284H	ENSP00000311402:Q216H	Q	+	3	2	SLC4A2	150394941	0.000000	0.05858	0.104000	0.21259	0.606000	0.37113	-0.153000	0.10144	0.495000	0.27882	0.462000	0.41574	CAG		0.657	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040		12	26	0	0	0	0.001855	0	12	26				
ARHGEF10	9639	broad.mit.edu	37	8	1881965	1881965	+	Splice_Site	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr8:1881965G>C	ENST00000398564.1	+	26	3154		c.e26-1		ARHGEF10_ENST00000349830.3_Splice_Site|ARHGEF10_ENST00000262112.6_Splice_Site|ARHGEF10_ENST00000518288.1_Splice_Site|ARHGEF10_ENST00000520359.1_Splice_Site			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10						centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		TTTCTTTTAAGATGGATCCTG	0.418																																							uc003wpr.2		NA																	0				large_intestine(1)	1						c.e26-1		Rho guanine nucleotide exchange factor 10							110.0	110.0	110.0					8																	1881965		2203	4300	6503	SO:0001630	splice_region_variant	9639				centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity	g.chr8:1881965G>C	AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.3155-1G>C	8.37:g.1881965G>C						ARHGEF10_uc003wps.2_Splice_Site_p.D989_splice|ARHGEF10_uc010lre.2_Splice_Site_p.D678_splice	p.D1027_splice	NM_014629	NP_055444	O15013	ARHGA_HUMAN		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)	26	3258	+		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)						O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Splice_Site	SNP	ENST00000398564.1	37	c.3080_splice		.	.	.	.	.	.	.	.	.	.	G	22.1	4.244051	0.79912	.	.	ENSG00000104728	ENST00000349830;ENST00000520359;ENST00000518288;ENST00000398564;ENST00000262112;ENST00000522435	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8838	0.92367	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGEF10	1869372	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	8.147000	0.89628	2.516000	0.84829	0.655000	0.94253	.		0.418	ARHGEF10-203	KNOWN	basic	protein_coding	protein_coding			Intron	21	73	0	0	0	0.00333	0	21	73				
RP1L1	94137	broad.mit.edu	37	8	10465806	10465806	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr8:10465806C>T	ENST00000382483.3	-	4	6025	c.5802G>A	c.(5800-5802)gaG>gaA	p.E1934E		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2014	25 X 16 AA approximate tandem repeats of [ED]-[AT]-[PQ]-[ED]-[AVT]-E-[GKE]-[ED]- [AMT]-Q-[EPK]-[EAT]-[TSELP]-[EG]- [EGSQDI]-[AVIE].				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CACCTTCTGACTCTGGCTCGT	0.602																																							uc003wtc.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(5800-5802)GAG>GAA		retinitis pigmentosa 1-like 1							123.0	140.0	134.0					8																	10465806		2053	4174	6227	SO:0001819	synonymous_variant	94137				intracellular signal transduction			g.chr8:10465806C>T	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5802G>A	8.37:g.10465806C>T							p.E1934E	NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	6031	-			1934					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	c.5802G>A	CCDS43708.1																																																																																				0.602	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			46	121	0	0	0	0.01441	0	46	121				
CYP7B1	9420	broad.mit.edu	37	8	65528839	65528839	+	Splice_Site	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr8:65528839C>T	ENST00000310193.3	-	3	433		c.e3-1		CYP7B1_ENST00000523954.1_5'Flank	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1						bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				ATGTACTTTCCTAGAAAAAAA	0.264																																							uc003xvj.2		NA																	0				ovary(3)	3						c.e3-1		cytochrome P450, family 7, subfamily B,							13.0	13.0	13.0					8																	65528839		2065	4233	6298	SO:0001630	splice_region_variant	9420				bile acid biosynthetic process|cell death|cholesterol metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	25-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity	g.chr8:65528839C>T	AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.260-1G>A	8.37:g.65528839C>T							p.G87_splice	NM_004820	NP_004811	O75881	CP7B1_HUMAN			3	464	-		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)						B2RN07|Q9UNF5	Splice_Site	SNP	ENST00000310193.3	37	c.260_splice	CCDS6180.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.594493	0.46214	.	.	ENSG00000172817	ENST00000310193	.	.	.	5.05	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7716	0.91894	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CYP7B1	65691393	1.000000	0.71417	0.999000	0.59377	0.459000	0.32528	6.823000	0.75282	2.504000	0.84457	0.655000	0.94253	.		0.264	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378550.1		Intron	3	12	0	0	0	0.001168	0	3	12				
CSPP1	79848	broad.mit.edu	37	8	68007596	68007596	+	Silent	SNP	A	A	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr8:68007596A>T	ENST00000262210.5	+	6	610	c.579A>T	c.(577-579)acA>acT	p.T193T	CSPP1_ENST00000412460.1_5'UTR	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	228					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			AAATACAGACATCTTGTGAAA	0.363																																							uc003xxi.2		NA																	0				ovary(3)|breast(2)	5						c.(682-684)ACA>ACT		centrosome spindle pole associated protein 1							81.0	77.0	78.0					8																	68007596		1808	4083	5891	SO:0001819	synonymous_variant	79848					centrosome|microtubule|spindle		g.chr8:68007596A>T	AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.579A>T	8.37:g.68007596A>T						CSPP1_uc003xxg.1_Silent_p.T220T|CSPP1_uc003xxh.1_RNA|CSPP1_uc003xxj.2_Silent_p.T193T|CSPP1_uc003xxk.2_5'UTR	p.T228T	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)		8	715	+	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	228					A6ND63|Q70F00|Q8TBC1	Silent	SNP	ENST00000262210.5	37	c.684A>T	CCDS43744.1																																																																																				0.363	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379254.1	NM_024790		13	69	0	0	0	0.001855	0	13	69				
SULF1	23213	broad.mit.edu	37	8	70550826	70550826	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr8:70550826G>C	ENST00000260128.4	+	20	3091	c.2374G>C	c.(2374-2376)Gag>Cag	p.E792Q	SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000419716.3_Missense_Mutation_p.E792Q|SULF1_ENST00000458141.2_Missense_Mutation_p.E792Q|SULF1_ENST00000402687.4_Missense_Mutation_p.E792Q	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	792					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			TCTTTTCTGTGAGTTTGCTAC	0.353																																							uc010lza.1		NA																	0				central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7						c.(2374-2376)GAG>CAG		sulfatase 1 precursor							163.0	151.0	155.0					8																	70550826		2203	4300	6503	SO:0001583	missense	23213				apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding	g.chr8:70550826G>C	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.2374G>C	8.37:g.70550826G>C	ENSP00000260128:p.Glu792Gln					SULF1_uc003xyd.2_Missense_Mutation_p.E792Q|SULF1_uc003xye.2_Missense_Mutation_p.E792Q|SULF1_uc003xyf.2_Missense_Mutation_p.E792Q|SULF1_uc003xyg.2_Missense_Mutation_p.E792Q|SULF1_uc003xyh.1_RNA|SULF1_uc003xyi.1_Intron|SULF1_uc003xyj.1_5'UTR	p.E792Q	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)		20	3091	+	Breast(64;0.0654)		792					Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	ENST00000260128.4	37	c.2374G>C	CCDS6204.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.980744	0.92982	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	4.9	4.9	0.64082	Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	T	0.45816	0.1361	M	0.77712	2.385	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.47355	-0.9124	10	0.87932	D	0	.	18.6867	0.91567	0.0:0.0:1.0:0.0	.	792	Q8IWU6	SULF1_HUMAN	Q	792	ENSP00000403040:E792Q;ENSP00000260128:E792Q;ENSP00000385704:E792Q;ENSP00000390315:E792Q	ENSP00000260128:E792Q	E	+	1	0	SULF1	70713380	1.000000	0.71417	0.972000	0.41901	0.991000	0.79684	9.597000	0.98273	2.714000	0.92807	0.650000	0.86243	GAG		0.353	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170		13	62	0	0	0	0.013537	0	13	62				
IL7	3574	broad.mit.edu	37	8	79652305	79652305	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr8:79652305C>G	ENST00000263851.4	-	3	760	c.160G>C	c.(160-162)Gaa>Caa	p.E54Q	IL7_ENST00000520269.1_Missense_Mutation_p.E54Q|IL7_ENST00000519833.1_5'UTR|IL7_ENST00000541183.1_Missense_Mutation_p.E3Q	NM_000880.3|NM_001199886.1|NM_001199887.1	NP_000871.1|NP_001186815.1|NP_001186816.1	P13232	IL7_HUMAN	interleukin 7	54					bone resorption (GO:0045453)|cell-cell signaling (GO:0007267)|homeostasis of number of cells within a tissue (GO:0048873)|humoral immune response (GO:0006959)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|organ morphogenesis (GO:0009887)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T cell differentiation (GO:0045582)|regulation of gene expression (GO:0010468)|T cell lineage commitment (GO:0002360)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|interleukin-7 receptor binding (GO:0005139)			endometrium(2)|large_intestine(2)|lung(1)	5						CTACCAATTTCTTTCATGCTG	0.229																																							uc003ybg.2		NA																	0					0						c.(160-162)GAA>CAA		interleukin 7 precursor							40.0	42.0	42.0					8																	79652305		2198	4277	6475	SO:0001583	missense	3574				bone resorption|cell-cell signaling|humoral immune response|organ morphogenesis|positive regulation of B cell proliferation|positive regulation of T cell differentiation	extracellular space	cytokine activity|growth factor activity|interleukin-7 receptor binding	g.chr8:79652305C>G	J04156	CCDS6224.1, CCDS56541.1, CCDS75755.1, CCDS75756.1	8q12-q13	2008-07-03				ENSG00000104432		"""Interleukins and interleukin receptors"""	6023	protein-coding gene	gene with protein product		146660					Standard	NM_000880		Approved	IL-7	uc003ybg.3	P13232		ENST00000263851.4:c.160G>C	8.37:g.79652305C>G	ENSP00000263851:p.Glu54Gln					IL7_uc003ybe.2_Missense_Mutation_p.E13Q|IL7_uc011lfm.1_RNA|IL7_uc003ybh.2_RNA|IL7_uc003ybi.3_RNA	p.E54Q	NM_000880	NP_000871	P13232	IL7_HUMAN			3	761	-			54					A0N0L3|Q5FBY5|Q5FBY9	Missense_Mutation	SNP	ENST00000263851.4	37	c.160G>C	CCDS6224.1	.	.	.	.	.	.	.	.	.	.	C	9.633	1.136961	0.21123	.	.	ENSG00000104432	ENST00000263851;ENST00000520269;ENST00000379114;ENST00000541183	T;T;T	0.45276	0.9;0.9;0.9	5.02	-0.354	0.12591	.	1.160090	0.06389	N	0.716777	T	0.27731	0.0682	N	0.19112	0.55	0.09310	N	1	B;B	0.33413	0.411;0.198	B;B	0.37650	0.255;0.08	T	0.27971	-1.0058	9	.	.	.	.	4.4747	0.11729	0.0:0.4116:0.3074:0.281	.	54;54	P13232;Q5FBY9	IL7_HUMAN;.	Q	54;54;51;3	ENSP00000263851:E54Q;ENSP00000427750:E54Q;ENSP00000438922:E3Q	.	E	-	1	0	IL7	79814860	0.000000	0.05858	0.001000	0.08648	0.993000	0.82548	-0.297000	0.08276	-0.163000	0.10946	0.563000	0.77884	GAA		0.229	IL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379429.1			9	36	0	0	0	0.006214	0	9	36				
MMP16	4325	broad.mit.edu	37	8	89198707	89198707	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr8:89198707G>T	ENST00000286614.6	-	3	683	c.402C>A	c.(400-402)taC>taA	p.Y134*	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	134					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	TCTTATACCTGTAAGTGATGT	0.403																																							uc003yeb.3		NA																	0				upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						c.(400-402)TAC>TAA		matrix metalloproteinase 16 isoform 1							267.0	228.0	241.0					8																	89198707		2203	4300	6503	SO:0001587	stop_gained	4325				collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding	g.chr8:89198707G>T	D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.402C>A	8.37:g.89198707G>T	ENSP00000286614:p.Tyr134*					MMP16_uc003yec.2_Nonsense_Mutation_p.Y134*	p.Y134*	NM_005941	NP_005932	P51512	MMP16_HUMAN			3	684	-			134			Extracellular (Potential).		B2RAN7|Q14824|Q52H48	Nonsense_Mutation	SNP	ENST00000286614.6	37	c.402C>A	CCDS6246.1	.	.	.	.	.	.	.	.	.	.	G	38	6.812854	0.97857	.	.	ENSG00000156103	ENST00000286614;ENST00000522726	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8778	0.96885	0.0:0.0:1.0:0.0	.	.	.	.	X	134;151	.	ENSP00000286614:Y134X	Y	-	3	2	MMP16	89267823	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.437000	0.73421	2.710000	0.92621	0.585000	0.79938	TAC		0.403	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941		69	139	1	0	3.89499e-28	0.01441	4.84693e-28	69	139				
DECR1	1666	broad.mit.edu	37	8	91013744	91013744	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr8:91013744C>G	ENST00000220764.2	+	1	112	c.24C>G	c.(22-24)ttC>ttG	p.F8L	DECR1_ENST00000519007.1_3'UTR|DECR1_ENST00000522161.1_5'UTR	NM_001359.1	NP_001350.1	Q16698	DECR_HUMAN	2,4-dienoyl CoA reductase 1, mitochondrial	8					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2,4-dienoyl-CoA reductase (NADPH) activity (GO:0008670)|NADPH binding (GO:0070402)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	15			BRCA - Breast invasive adenocarcinoma(11;0.00953)			CCAGGGTTTTCTTTACTCTGG	0.667											OREG0018857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003yek.1		NA																	0					0						c.(22-24)TTC>TTG		2,4-dienoyl CoA reductase 1 precursor							25.0	28.0	27.0					8																	91013744		2203	4300	6503	SO:0001583	missense	1666				fatty acid beta-oxidation|protein homotetramerization	mitochondrial matrix|nucleus|plasma membrane	2,4-dienoyl-CoA reductase (NADPH) activity|NADPH binding|oxidoreductase activity, acting on NADH or NADPH	g.chr8:91013744C>G	L26050	CCDS6250.1	8q21.3	2011-09-14			ENSG00000104325	ENSG00000104325		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	2753	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 18C, member 1"""	222745		DECR		7818482, 19027726	Standard	NM_001359		Approved	SDR18C1	uc003yek.1	Q16698	OTTHUMG00000163829	ENST00000220764.2:c.24C>G	8.37:g.91013744C>G	ENSP00000220764:p.Phe8Leu		OREG0018857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1279	DECR1_uc011lgc.1_5'UTR|DECR1_uc011lgd.1_RNA	p.F8L	NM_001359	NP_001350	Q16698	DECR_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.00953)		1	165	+			8					B7Z6B8|Q2M304|Q93085	Missense_Mutation	SNP	ENST00000220764.2	37	c.24C>G	CCDS6250.1	.	.	.	.	.	.	.	.	.	.	C	10.63	1.404578	0.25378	.	.	ENSG00000104325	ENST00000220764	D	0.82984	-1.67	3.88	1.96	0.26148	.	0.924894	0.09115	N	0.846524	T	0.67382	0.2887	N	0.16743	0.435	0.21020	N	0.999808	B	0.02656	0.0	B	0.01281	0.0	T	0.51276	-0.8726	10	0.23302	T	0.38	.	5.4834	0.16737	0.0:0.6811:0.2029:0.116	.	8	Q16698	DECR_HUMAN	L	8	ENSP00000220764:F8L	ENSP00000220764:F8L	F	+	3	2	DECR1	91082920	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-0.024000	0.12435	0.348000	0.23949	0.551000	0.68910	TTC		0.667	DECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375822.1			3	31	0	0	0	0.004672	0	3	31				
CPQ	10404	broad.mit.edu	37	8	98041644	98041644	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr8:98041644G>A	ENST00000220763.5	+	6	1185	c.975G>A	c.(973-975)aaG>aaA	p.K325K		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	325					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										TGCGTCCAAAGAGGACTCTGC	0.428																																							uc003yhw.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(973-975)AAG>AAA		plasma glutamate carboxypeptidase precursor							44.0	43.0	43.0					8																	98041644		2203	4300	6503	SO:0001819	synonymous_variant	10404				peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity	g.chr8:98041644G>A	AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.975G>A	8.37:g.98041644G>A							p.K325K	NM_016134	NP_057218	Q9Y646	PGCP_HUMAN			6	1141	+	Breast(36;1.86e-05)		325					B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Silent	SNP	ENST00000220763.5	37	c.975G>A	CCDS6273.1																																																																																				0.428	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379757.2	NM_016134		4	11	0	0	0	0.009096	0	4	11				
LRP12	29967	broad.mit.edu	37	8	105510107	105510107	+	Missense_Mutation	SNP	G	G	A	rs557441495		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr8:105510107G>A	ENST00000276654.5	-	5	781	c.673C>T	c.(673-675)Cgt>Tgt	p.R225C	LRP12_ENST00000518375.1_5'Flank|LRP12_ENST00000424843.2_Missense_Mutation_p.R206C	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	225	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)	p.R225S(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TTGGTAAAACGGGATAAACAC	0.448													G|||	1	0.000199681	0.0	0.0	5008	,	,		18143	0.001		0.0	False		,,,				2504	0.0						uc003yma.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(673-675)CGT>TGT		low density lipoprotein-related protein 12							156.0	141.0	146.0					8																	105510107		2203	4300	6503	SO:0001583	missense	29967				endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding	g.chr8:105510107G>A	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.673C>T	8.37:g.105510107G>A	ENSP00000276654:p.Arg225Cys					LRP12_uc003ymb.2_Missense_Mutation_p.R206C|LRP12_uc003ylz.2_5'Flank	p.R225C	NM_013437	NP_038465	Q9Y561	LRP12_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)		5	768	-			225			Extracellular (Potential).|LDL-receptor class A 2.		A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	37	c.673C>T	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.052721	0.75960	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	D;D	0.91521	-2.86;-2.86	5.66	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.95056	0.8399	M	0.79614	2.46	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.95196	0.8312	10	0.56958	D	0.05	-18.6095	15.7875	0.78319	0.0:0.0:0.8627:0.1373	.	206;225	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	C	206;225	ENSP00000399148:R206C;ENSP00000276654:R225C	ENSP00000276654:R225C	R	-	1	0	LRP12	105579283	1.000000	0.71417	0.982000	0.44146	0.969000	0.65631	7.606000	0.82863	1.348000	0.45733	0.563000	0.77884	CGT		0.448	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437		45	96	0	0	0	0.01441	0	45	96				
PKHD1L1	93035	broad.mit.edu	37	8	110464993	110464993	+	Nonsense_Mutation	SNP	C	C	G	rs558403696		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr8:110464993C>G	ENST00000378402.5	+	43	6658	c.6554C>G	c.(6553-6555)tCa>tGa	p.S2185*		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2185	G8 1. {ECO:0000255|PROSITE- ProRule:PRU00817}.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCCAATTTCTCATGGGGGGGA	0.388										HNSCC(38;0.096)			C|||	1	0.000199681	0.0	0.0014	5008	,	,		10961	0.0		0.0	False		,,,				2504	0.0						uc003yne.2		NA																	0				ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14						c.(6553-6555)TCA>TGA		fibrocystin L precursor							40.0	37.0	38.0					8																	110464993		1807	4071	5878	SO:0001587	stop_gained	93035				immune response	cytosol|extracellular space|integral to membrane	receptor activity	g.chr8:110464993C>G	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.6554C>G	8.37:g.110464993C>G	ENSP00000367655:p.Ser2185*	HNSCC(38;0.096)					p.S2185*	NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)		43	6658	+			2185			Extracellular (Potential).|G8 1.		Q567P2|Q9UF27	Nonsense_Mutation	SNP	ENST00000378402.5	37	c.6554C>G	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	48	14.284580	0.99788	.	.	ENSG00000205038	ENST00000378402	.	.	.	5.83	5.83	0.93111	.	0.074502	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.6037	0.88032	0.0:1.0:0.0:0.0	.	.	.	.	X	2185	.	ENSP00000367655:S2185X	S	+	2	0	PKHD1L1	110534169	1.000000	0.71417	0.863000	0.33907	0.916000	0.54674	6.036000	0.70948	2.753000	0.94483	0.585000	0.79938	TCA		0.388	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531		2	9	0	0	0	0.004672	0	2	9				
TRPS1	7227	broad.mit.edu	37	8	116632009	116632009	+	Missense_Mutation	SNP	T	T	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr8:116632009T>G	ENST00000220888.5	-	2	436	c.277A>C	c.(277-279)Aag>Cag	p.K93Q	TRPS1_ENST00000395715.3_Missense_Mutation_p.K106Q|TRPS1_ENST00000519674.1_Missense_Mutation_p.K93Q|TRPS1_ENST00000520276.1_Missense_Mutation_p.K97Q|TRPS1_ENST00000519076.1_Intron			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	93					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TTTCCTCCCTTACTGGGGCTT	0.473									Langer-Giedion syndrome																														uc003ynz.2		NA																	0				ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7						c.(277-279)AAG>CAG		zinc finger transcription factor TRPS1							88.0	83.0	85.0					8																	116632009		1917	4127	6044	SO:0001583	missense	7227	Langer-Giedion_syndrome	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:116632009T>G	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.277A>C	8.37:g.116632009T>G	ENSP00000220888:p.Lys93Gln					TRPS1_uc011lhy.1_Missense_Mutation_p.K97Q|TRPS1_uc003yny.2_Missense_Mutation_p.K106Q|TRPS1_uc010mcy.2_Missense_Mutation_p.K93Q	p.K93Q	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)		2	736	-	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		93					B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37	c.277A>C		.	.	.	.	.	.	.	.	.	.	T	20.1	3.934313	0.73442	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000520276;ENST00000519674;ENST00000395713;ENST00000519815	D;D;D;T	0.98889	-5.21;-5.18;-5.19;0.6	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000001	D	0.98166	0.9394	N	0.24115	0.695	0.39711	D	0.971329	D;P;P	0.61080	0.989;0.759;0.844	D;B;P	0.75020	0.985;0.328;0.528	D	0.99951	1.1551	10	0.87932	D	0	-6.465	16.1806	0.81895	0.0:0.0:0.0:1.0	.	97;93;106	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	Q	106;93;97;93;106;106	ENSP00000379065:K106Q;ENSP00000220888:K93Q;ENSP00000428680:K97Q;ENSP00000429174:K93Q	ENSP00000220888:K93Q	K	-	1	0	TRPS1	116701184	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.532000	0.53553	2.221000	0.72209	0.528000	0.53228	AAG		0.473	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112		11	75	0	0	0	0.010729	0	11	75				
FER1L6	654463	broad.mit.edu	37	8	125052198	125052198	+	Nonsense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr8:125052198C>G	ENST00000522917.1	+	20	2746	c.2540C>G	c.(2539-2541)tCa>tGa	p.S847*	FER1L6_ENST00000399018.1_Nonsense_Mutation_p.S847*|FER1L6-AS1_ENST00000518567.1_RNA|RP11-959I15.4_ENST00000522005.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	847	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AATGGACTTTCAGACCCTTTT	0.522																																							uc003yqw.2		NA																	0				ovary(5)|skin(5)|central_nervous_system(1)	11						c.(2539-2541)TCA>TGA		fer-1-like 6							104.0	109.0	107.0					8																	125052198		2051	4194	6245	SO:0001587	stop_gained	654463					integral to membrane		g.chr8:125052198C>G	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2540C>G	8.37:g.125052198C>G	ENSP00000428280:p.Ser847*					uc003yqx.1_Intron	p.S847*	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)		20	2746	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		847			Cytoplasmic (Potential).|C2 3.			Nonsense_Mutation	SNP	ENST00000522917.1	37	c.2540C>G	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	C	44	10.712283	0.99455	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	.	.	.	5.54	5.54	0.83059	.	0.148125	0.47455	U	0.000240	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	18.2567	0.90022	0.0:1.0:0.0:0.0	.	.	.	.	X	847	.	ENSP00000381982:S847X	S	+	2	0	FER1L6	125121379	1.000000	0.71417	0.999000	0.59377	0.935000	0.57460	7.448000	0.80631	2.590000	0.87494	0.563000	0.77884	TCA		0.522	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		6	86	0	0	0	0.001168	0	6	86				
TG	7038	broad.mit.edu	37	8	134030239	134030239	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr8:134030239C>T	ENST00000220616.4	+	38	6819	c.6779C>T	c.(6778-6780)cCa>cTa	p.P2260L	TG_ENST00000542445.1_Missense_Mutation_p.P630L|TG_ENST00000519543.1_Missense_Mutation_p.P393L|TG_ENST00000377869.1_Missense_Mutation_p.P2203L	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2260					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GCCAGCAAGCCAAGGTATGGG	0.532																																							uc003ytw.2		NA																	0				ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15						c.(6778-6780)CCA>CTA		thyroglobulin precursor							27.0	25.0	26.0					8																	134030239		2203	4299	6502	SO:0001583	missense	7038				hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity	g.chr8:134030239C>T	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.6779C>T	8.37:g.134030239C>T	ENSP00000220616:p.Pro2260Leu					TG_uc010mdw.2_Missense_Mutation_p.P1019L|TG_uc011ljb.1_Missense_Mutation_p.P629L|TG_uc011ljc.1_Missense_Mutation_p.P393L	p.P2260L	NM_003235	NP_003226	P01266	THYG_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)	38	6820	+	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	2260					O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	c.6779C>T	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	C	11.93	1.784562	0.31593	.	.	ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445;ENST00000519543	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	5.38	3.59	0.41128	Carboxylesterase, type B (1);	0.401686	0.24766	N	0.035773	T	0.33498	0.0865	N	0.20401	0.57	0.45837	D	0.9987	B;B;B	0.11235	0.004;0.0;0.002	B;B;B	0.15052	0.012;0.001;0.009	T	0.07046	-1.0793	10	0.22109	T	0.4	.	8.6057	0.33771	0.0:0.825:0.0:0.175	.	393;630;2260	E7EVM0;F5GWW5;P01266	.;.;THYG_HUMAN	L	2203;1066;2260;630;393	ENSP00000367100:P2203L;ENSP00000220616:P2260L;ENSP00000441693:P630L;ENSP00000430430:P393L	ENSP00000220616:P2260L	P	+	2	0	TG	134099421	0.329000	0.24696	0.999000	0.59377	0.966000	0.64601	2.495000	0.45337	0.826000	0.34661	-0.137000	0.14449	CCA		0.532	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235		15	20	0	0	0	0.00245	0	15	20				
SPATC1	375686	broad.mit.edu	37	8	145095676	145095676	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr8:145095676C>G	ENST00000377470.3	+	3	1076	c.974C>G	c.(973-975)tCc>tGc	p.S325C	SPATC1_ENST00000447830.2_Missense_Mutation_p.S325C	NM_198572.2	NP_940974.2	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	325						centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			gtccccacctcccccaccacc	0.662																																							uc011lkw.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(973-975)TCC>TGC		spermatogenesis and centriole associated 1							98.0	44.0	62.0					8																	145095676		2197	4296	6493	SO:0001583	missense	375686							g.chr8:145095676C>G	BC053547	CCDS6413.2, CCDS47937.1	8q24.3	2005-01-11			ENSG00000186583	ENSG00000186583			30510	protein-coding gene	gene with protein product		610874				15280373	Standard	NM_198572		Approved	MGC61633, SPATA15, SPERIOLIN	uc011lkw.2	Q76KD6	OTTHUMG00000156976	ENST00000377470.3:c.974C>G	8.37:g.145095676C>G	ENSP00000366690:p.Ser325Cys					SPATC1_uc011lkx.1_Missense_Mutation_p.S325C	p.S325C	NM_198572	NP_940974	Q76KD6	SPERI_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		3	1076	+	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		325					B4DWW9|Q5U5I8|Q7Z6L7	Missense_Mutation	SNP	ENST00000377470.3	37	c.974C>G	CCDS6413.2	.	.	.	.	.	.	.	.	.	.	c	10.68	1.418412	0.25552	.	.	ENSG00000186583	ENST00000377470;ENST00000447830	T	0.57595	0.39	4.39	1.47	0.22746	.	.	.	.	.	T	0.58793	0.2147	L	0.60455	1.87	0.09310	N	1	D;D	0.71674	0.998;0.997	P;P	0.59889	0.865;0.753	T	0.47433	-0.9118	9	0.62326	D	0.03	-17.2417	4.6634	0.12653	0.0:0.6111:0.1802:0.2087	.	325;325	B4DWW9;Q76KD6	.;SPERI_HUMAN	C	325	ENSP00000366690:S325C	ENSP00000366690:S325C	S	+	2	0	SPATC1	145167664	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	0.419000	0.21247	0.057000	0.16193	0.561000	0.74099	TCC		0.662	SPATC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346926.1	NM_198572		5	6	0	0	0	0.000602	0	5	6				
KIAA2026	158358	broad.mit.edu	37	9	5988524	5988524	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr9:5988524C>T	ENST00000399933.3	-	2	614	c.615G>A	c.(613-615)acG>acA	p.T205T	KIAA2026_ENST00000381461.2_Silent_p.T205T	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	205										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TAACTGCTATCGTTGTCTTTT	0.443																																							uc003zjq.3		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(613-615)ACG>ACA		hypothetical protein LOC158358							89.0	83.0	85.0					9																	5988524		1883	4117	6000	SO:0001819	synonymous_variant	158358							g.chr9:5988524C>T	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.615G>A	9.37:g.5988524C>T							p.T205T	NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)	2	831	-		Acute lymphoblastic leukemia(23;0.158)	205					A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Silent	SNP	ENST00000399933.3	37	c.615G>A																																																																																					0.443	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969		4	20	0	0	0	0.000602	0	4	20				
KDM4C	23081	broad.mit.edu	37	9	6986486	6986486	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr9:6986486A>T	ENST00000381309.3	+	11	2062	c.1497A>T	c.(1495-1497)aaA>aaT	p.K499N	KDM4C_ENST00000535193.1_Missense_Mutation_p.K521N|KDM4C_ENST00000428870.2_Missense_Mutation_p.K186N|KDM4C_ENST00000543771.1_Missense_Mutation_p.K499N|KDM4C_ENST00000381306.3_Missense_Mutation_p.K499N|KDM4C_ENST00000442236.2_Missense_Mutation_p.K318N|KDM4C_ENST00000536108.1_Missense_Mutation_p.K318N	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	499					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						AGCCCGAGAAATCAGACCCAT	0.463																																							uc003zkh.2		NA																	0				ovary(1)	1						c.(1495-1497)AAA>AAT		jumonji domain containing 2C isoform 1							131.0	119.0	123.0					9																	6986486		2203	4300	6503	SO:0001583	missense	23081				positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr9:6986486A>T	AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.1497A>T	9.37:g.6986486A>T	ENSP00000370710:p.Lys499Asn					KDM4C_uc010mhu.2_Missense_Mutation_p.K521N|KDM4C_uc011lmi.1_Missense_Mutation_p.K499N|KDM4C_uc011lmj.1_RNA|KDM4C_uc003zkg.2_Missense_Mutation_p.K499N|KDM4C_uc011lmk.1_Missense_Mutation_p.K318N|KDM4C_uc011lml.1_Missense_Mutation_p.K186N	p.K499N	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN			11	2077	+			499					B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	ENST00000381309.3	37	c.1497A>T	CCDS6471.1	.	.	.	.	.	.	.	.	.	.	A	10.30	1.311804	0.23821	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000381309;ENST00000381306;ENST00000442236;ENST00000536108;ENST00000428870	T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78	5.3	-4.56	0.03431	.	1.632920	0.03301	N	0.189028	T	0.22085	0.0532	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.07404	-1.0774	10	0.19590	T	0.45	-32.9839	3.1809	0.06584	0.2616:0.2705:0.3667:0.1012	.	318;499;521;499;499	E7EV17;F5H347;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;KDM4C_HUMAN;.	N	521;499;499;499;318;318;186	ENSP00000442382:K521N;ENSP00000445427:K499N;ENSP00000370710:K499N;ENSP00000370707:K499N;ENSP00000409353:K318N;ENSP00000440656:K318N;ENSP00000405739:K186N	ENSP00000370707:K499N	K	+	3	2	KDM4C	6976486	0.001000	0.12720	0.004000	0.12327	0.008000	0.06430	-0.601000	0.05687	-0.617000	0.05664	0.533000	0.62120	AAA		0.463	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061		10	59	0	0	0	0.008291	0	10	59				
PTPRD	5789	broad.mit.edu	37	9	8436648	8436648	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr9:8436648C>T	ENST00000381196.4	-	32	4573	c.4030G>A	c.(4030-4032)Gac>Aac	p.D1344N	PTPRD_ENST00000397606.3_Missense_Mutation_p.D937N|PTPRD_ENST00000537002.1_Missense_Mutation_p.D934N|PTPRD_ENST00000360074.4_Missense_Mutation_p.D1331N|PTPRD_ENST00000358503.5_Missense_Mutation_p.D1322N|PTPRD_ENST00000355233.5_Missense_Mutation_p.D938N|PTPRD_ENST00000486161.1_Missense_Mutation_p.D937N|PTPRD_ENST00000397617.3_Missense_Mutation_p.D937N|PTPRD_ENST00000397611.3_Missense_Mutation_p.D934N|PTPRD_ENST00000540109.1_Missense_Mutation_p.D1344N|PTPRD_ENST00000356435.5_Missense_Mutation_p.D1344N	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1344					heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TCAATGTGGTCTGCAAGTTCC	0.338										TSP Lung(15;0.13)																													uc003zkk.2		NA																	0				lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(4030-4032)GAC>AAC		protein tyrosine phosphatase, receptor type, D							147.0	145.0	146.0					9																	8436648		2203	4300	6503	SO:0001583	missense	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8436648C>T	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.4030G>A	9.37:g.8436648C>T	ENSP00000370593:p.Asp1344Asn	TSP Lung(15;0.13)				PTPRD_uc003zkp.2_Missense_Mutation_p.D938N|PTPRD_uc003zkq.2_Missense_Mutation_p.D937N|PTPRD_uc003zkr.2_Missense_Mutation_p.D928N|PTPRD_uc003zks.2_Missense_Mutation_p.D937N|PTPRD_uc003zkl.2_Missense_Mutation_p.D1335N|PTPRD_uc003zkm.2_Missense_Mutation_p.D1331N|PTPRD_uc003zkn.2_Missense_Mutation_p.D933N|PTPRD_uc003zko.2_Missense_Mutation_p.D934N	p.D1344N	NM_002839	NP_002830	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	34	4741	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	1344			Cytoplasmic (Potential).		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	c.4030G>A	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	C	15.18	2.757193	0.49468	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54	6.03	6.03	0.97812	.	0.092367	0.64402	D	0.000001	T	0.40909	0.1136	N	0.24115	0.695	0.80722	D	1	D;D;D;D;B;D;B;D;B	0.67145	0.96;0.96;0.96;0.96;0.071;0.976;0.038;0.996;0.003	P;P;P;P;B;P;B;P;B	0.60682	0.759;0.759;0.759;0.759;0.036;0.878;0.018;0.768;0.002	T	0.04825	-1.0924	9	.	.	.	.	20.5596	0.99324	0.0:1.0:0.0:0.0	.	937;928;937;938;934;934;1331;1344;1344	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	N	1344;1344;1331;1322;938;937;934;934;815;1344;937;937	ENSP00000370593:D1344N;ENSP00000348812:D1344N;ENSP00000353187:D1331N;ENSP00000351293:D1322N;ENSP00000347373:D938N;ENSP00000380741:D937N;ENSP00000380735:D934N;ENSP00000440515:D934N;ENSP00000438164:D1344N;ENSP00000417093:D937N;ENSP00000380731:D937N	.	D	-	1	0	PTPRD	8426648	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.463000	0.80869	2.868000	0.98415	0.555000	0.69702	GAC		0.338	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			10	48	0	0	0	0.010729	0	10	48				
FREM1	158326	broad.mit.edu	37	9	14740193	14740193	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr9:14740193G>T	ENST00000380880.3	-	36	7077	c.6294C>A	c.(6292-6294)caC>caA	p.H2098Q	FREM1_ENST00000422223.2_Missense_Mutation_p.H2098Q|FREM1_ENST00000380894.1_Missense_Mutation_p.H634Q|FREM1_ENST00000380881.4_Missense_Mutation_p.H2099Q			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	2098	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		GCCACCGCATGTGCTGCCTGG	0.473																																							uc003zlm.2		NA																	0				ovary(2)|breast(2)|pancreas(1)	5						c.(6292-6294)CAC>CAA		FRAS1 related extracellular matrix 1 precursor							109.0	110.0	109.0					9																	14740193		1985	4154	6139	SO:0001583	missense	158326				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding	g.chr9:14740193G>T	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.6294C>A	9.37:g.14740193G>T	ENSP00000370262:p.His2098Gln					FREM1_uc010mic.2_RNA|FREM1_uc003zlk.2_RNA|FREM1_uc003zll.2_Missense_Mutation_p.H634Q	p.H2098Q	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN		GBM - Glioblastoma multiforme(50;3.53e-06)	36	6884	-			2098			C-type lectin.		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	c.6294C>A	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.115654	0.37339	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380894;ENST00000380880	T;T;T;T	0.16324	2.35;2.35;2.35;2.35	5.83	-3.05	0.05396	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.204155	0.51477	D	0.000098	T	0.07143	0.0181	L	0.28274	0.84	0.35856	D	0.827175	B;B	0.32324	0.035;0.364	B;B	0.27170	0.057;0.077	T	0.36407	-0.9749	10	0.19147	T	0.46	-17.1777	4.8482	0.13524	0.3879:0.088:0.4354:0.0888	.	2098;634	Q5H8C1;B7ZBX4	FREM1_HUMAN;.	Q	2099;2098;634;2098	ENSP00000370263:H2099Q;ENSP00000412940:H2098Q;ENSP00000370278:H634Q;ENSP00000370262:H2098Q	ENSP00000370262:H2098Q	H	-	3	2	FREM1	14730193	0.706000	0.27856	0.899000	0.35326	0.977000	0.68977	-0.286000	0.08399	-0.486000	0.06744	0.655000	0.94253	CAC		0.473	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966		36	49	1	0	2.26627e-22	0.007835	2.76345e-22	36	49				
TAF1L	138474	broad.mit.edu	37	9	32632473	32632473	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr9:32632473C>T	ENST00000242310.4	-	1	3194	c.3105G>A	c.(3103-3105)gaG>gaA	p.E1035E	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1035					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		ACTTTTTAATCTCTTCCTCAG	0.483																																							uc003zrg.1		NA																	0				lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26						c.(3103-3105)GAG>GAA		TBP-associated factor RNA polymerase 1-like							227.0	225.0	226.0					9																	32632473		2203	4300	6503	SO:0001819	synonymous_variant	138474				male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	g.chr9:32632473C>T	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3105G>A	9.37:g.32632473C>T						uc003zrh.1_5'Flank	p.E1035E	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)	1	3195	-			1035					Q0VG57	Silent	SNP	ENST00000242310.4	37	c.3105G>A	CCDS35003.1																																																																																				0.483	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2			40	203	0	0	0	0.007835	0	40	203				
FAM166B	730112	broad.mit.edu	37	9	35563186	35563186	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr9:35563186G>C	ENST00000399742.2	-	2	333	c.263C>G	c.(262-264)tCc>tGc	p.S88C	FAM166B_ENST00000492890.1_5'UTR	NM_001099951.2|NM_001164310.1	NP_001093421.1|NP_001157782.1	A8MTA8	F166B_HUMAN	family with sequence similarity 166, member B	88										kidney(3)|large_intestine(1)|lung(4)|ovary(1)	9						GATCATGCTGGAGCTGAGCCT	0.577																																							uc010mkr.2		NA																	0					0						c.(262-264)TCC>TGC		hypothetical protein LOC730112 isoform 1							126.0	129.0	128.0					9																	35563186		2089	4231	6320	SO:0001583	missense	730112							g.chr9:35563186G>C	BC129999	CCDS47963.1, CCDS56572.1	9p13.3	2008-06-10			ENSG00000215187	ENSG00000215187			34242	protein-coding gene	gene with protein product							Standard	NM_001099951		Approved		uc010mkr.3	A8MTA8	OTTHUMG00000019858	ENST00000399742.2:c.263C>G	9.37:g.35563186G>C	ENSP00000382646:p.Ser88Cys					FAM166B_uc011lov.1_Missense_Mutation_p.S88C|FAM166B_uc011low.1_Missense_Mutation_p.S88C|FAM166B_uc003zwy.2_Missense_Mutation_p.S88C	p.S88C	NM_001164310	NP_001157782	A8MTA8	F166B_HUMAN			2	334	-			88					A1L3B2|B7ZBJ0	Missense_Mutation	SNP	ENST00000399742.2	37	c.263C>G	CCDS56572.1	.	.	.	.	.	.	.	.	.	.	G	17.26	3.343309	0.61073	.	.	ENSG00000215187	ENST00000399742;ENST00000537504	.	.	.	5.8	0.32	0.15878	.	0.632008	0.12127	U	0.497138	T	0.56572	0.1994	M	0.73962	2.25	0.26905	N	0.967024	D;D;D;D	0.89917	1.0;0.999;0.999;1.0	D;D;D;D	0.87578	0.987;0.974;0.921;0.998	T	0.42716	-0.9435	9	0.37606	T	0.19	-12.8648	5.0001	0.14261	0.2487:0.2868:0.4646:0.0	.	88;88;88;88	B7ZW33;B7ZW26;A8MTA8;A8MTA8-2	.;.;F166B_HUMAN;.	C	88	.	ENSP00000382646:S88C	S	-	2	0	FAM166B	35553186	1.000000	0.71417	0.998000	0.56505	0.944000	0.59088	1.114000	0.31196	0.348000	0.23949	0.655000	0.94253	TCC		0.577	FAM166B-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336563.1	NM_001099951		17	96	0	0	0	0.004007	0	17	96				
CCIN	881	broad.mit.edu	37	9	36170550	36170550	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr9:36170550G>T	ENST00000335119.2	+	1	1162	c.1051G>T	c.(1051-1053)Gat>Tat	p.D351Y		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	351					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			GTATGACATGGATGACAACTC	0.572																																							uc003zzb.3		NA																	0				ovary(1)|skin(1)	2						c.(1051-1053)GAT>TAT		calicin							133.0	115.0	121.0					9																	36170550		2203	4300	6503	SO:0001583	missense	881				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton	g.chr9:36170550G>T	Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.1051G>T	9.37:g.36170550G>T	ENSP00000334996:p.Asp351Tyr						p.D351Y	NM_005893	NP_005884	Q13939	CALI_HUMAN	STAD - Stomach adenocarcinoma(86;0.228)		1	1162	+			351			Kelch 2.		Q9BXG7	Missense_Mutation	SNP	ENST00000335119.2	37	c.1051G>T	CCDS6599.1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.602825	0.46423	.	.	ENSG00000185972	ENST00000335119	T	0.50277	0.75	5.97	5.97	0.96955	Kelch-type beta propeller (1);	0.000000	0.64402	D	0.000014	T	0.59307	0.2184	L	0.34521	1.04	0.42872	D	0.994142	D	0.89917	1.0	D	0.87578	0.998	T	0.59495	-0.7444	10	0.59425	D	0.04	.	15.9243	0.79603	0.0:0.0:1.0:0.0	.	351	Q13939	CALI_HUMAN	Y	351	ENSP00000334996:D351Y	ENSP00000334996:D351Y	D	+	1	0	CCIN	36160550	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.496000	0.66918	2.839000	0.97877	0.655000	0.94253	GAT		0.572	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052418.1	NM_005893		16	67	1	0	6.31663e-08	0.003163	6.96395e-08	16	67				
FXN	2395	broad.mit.edu	37	9	71687670	71687670	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr9:71687670G>C	ENST00000377270.3	+	5	1149	c.625G>C	c.(625-627)Gat>Cat	p.D209H	FXN_ENST00000498653.1_Missense_Mutation_p.D134H|FXN_ENST00000396366.2_3'UTR|FXN_ENST00000396364.3_Intron	NM_000144.4	NP_000135.2	Q16595	FRDA_HUMAN	frataxin	209					adult walking behavior (GO:0007628)|aerobic respiration (GO:0009060)|cellular iron ion homeostasis (GO:0006879)|cellular response to hydrogen peroxide (GO:0070301)|embryo development ending in birth or egg hatching (GO:0009792)|heme biosynthetic process (GO:0006783)|ion transport (GO:0006811)|iron incorporation into metallo-sulfur cluster (GO:0018283)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|oxidative phosphorylation (GO:0006119)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)|proprioception (GO:0019230)|protein autoprocessing (GO:0016540)|regulation of ferrochelatase activity (GO:0010722)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)|iron chaperone activity (GO:0034986)|iron-sulfur cluster binding (GO:0051536)	p.D209H(1)		large_intestine(1)|lung(1)	2						TTCCGGAAAAGATGCTTGATG	0.498																																							uc004aha.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(625-627)GAT>CAT		frataxin isoform 1 preproprotein							89.0	84.0	86.0					9																	71687670		2203	4300	6503	SO:0001583	missense	2395				cellular iron ion homeostasis|cellular response to hydrogen peroxide|heme biosynthetic process|ion transport|iron incorporation into metallo-sulfur cluster|negative regulation of apoptosis|negative regulation of release of cytochrome c from mitochondria|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity|protein autoprocessing|regulation of ferrochelatase activity|response to iron ion	cytosol|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferric iron binding|ferrous iron binding|ferroxidase activity|iron chaperone activity|protein binding	g.chr9:71687670G>C	U43752	CCDS6626.1, CCDS43834.1, CCDS55313.1	9q21.11	2014-09-17	2004-08-16	2004-08-19	ENSG00000165060	ENSG00000165060			3951	protein-coding gene	gene with protein product		606829	"""Friedreich ataxia"""	FRDA		8596916, 8841185	Standard	NM_000144		Approved	FA, FARR, X25, CyaY	uc004aha.2	Q16595	OTTHUMG00000019977	ENST00000377270.3:c.625G>C	9.37:g.71687670G>C	ENSP00000366482:p.Asp209His					FXN_uc011lrr.1_Intron|FXN_uc004agz.2_3'UTR	p.D209H	NM_000144	NP_000135	Q16595	FRDA_HUMAN			5	845	+			209					A8MXJ6|C9JJ89|O15545|O95656|Q15294|Q5VZ01	Missense_Mutation	SNP	ENST00000377270.3	37	c.625G>C	CCDS6626.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.76|12.76	2.035768|2.035768	0.35893|0.35893	.|.	.|.	ENSG00000165060|ENSG00000165060	ENST00000377270;ENST00000498653|ENST00000484259	D;D|.	0.95103|.	-3.61;-3.15|.	4.87|4.87	3.96|3.96	0.45880|0.45880	.|.	0.674218|.	0.14626|.	N|.	0.308140|.	T|T	0.58192|0.58192	0.2105|0.2105	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	B|.	0.12630|.	0.006|.	B|.	0.08055|.	0.003|.	T|T	0.54227|0.54227	-0.8325|-0.8325	10|5	0.87932|.	D|.	0|.	-0.008|-0.008	13.1173|13.1173	0.59307|0.59307	0.0:0.161:0.839:0.0|0.0:0.161:0.839:0.0	.|.	209|.	Q16595|.	FRDA_HUMAN|.	H|T	209;134|106	ENSP00000366482:D209H;ENSP00000418015:D134H|.	ENSP00000366482:D209H|.	D|R	+|+	1|2	0|0	FXN|FXN	70877490|70877490	0.996000|0.996000	0.38824|0.38824	0.685000|0.685000	0.30070|0.30070	0.179000|0.179000	0.23085|0.23085	2.177000|2.177000	0.42509|0.42509	1.031000|1.031000	0.39867|0.39867	-0.302000|-0.302000	0.09304|0.09304	GAT|AGA		0.498	FXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052568.2	NM_000144		15	62	0	0	0	0.003163	0	15	62				
PHF2	5253	broad.mit.edu	37	9	96439907	96439907	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr9:96439907G>A	ENST00000359246.4	+	22	3607	c.3240G>A	c.(3238-3240)caG>caA	p.Q1080Q	PHF2_ENST00000375376.4_Silent_p.Q311Q	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	1080					liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		CCGCCAAGCAGAGGCTTGGGA	0.537																																							uc004aub.2		NA																	0				ovary(1)	1						c.(3238-3240)CAG>CAA		PHD finger protein 2							115.0	133.0	127.0					9																	96439907		2203	4300	6503	SO:0001819	synonymous_variant	5253				liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr9:96439907G>A	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.3240G>A	9.37:g.96439907G>A						PHF2_uc004auc.2_Intron	p.Q1080Q	NM_005392	NP_005383	O75151	PHF2_HUMAN		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)	22	3387	+		Myeloproliferative disorder(762;0.0255)	1080					Q4VXG0|Q8N3K2|Q9Y6N4	Silent	SNP	ENST00000359246.4	37	c.3240G>A	CCDS35069.1																																																																																				0.537	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392		36	121	0	0	0	0.003755	0	36	121				
ZNF483	158399	broad.mit.edu	37	9	114304757	114304757	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr9:114304757G>C	ENST00000309235.5	+	6	1700	c.1542G>C	c.(1540-1542)caG>caC	p.Q514H	ZNF483_ENST00000358151.4_Intron	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	514					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						TTAAACATCAGAGAATTCATA	0.408																																							uc004bff.2		NA																	0				skin(1)	1						c.(1540-1542)CAG>CAC		zinc finger protein 483 isoform a							47.0	50.0	49.0					9																	114304757		2203	4300	6503	SO:0001583	missense	158399				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr9:114304757G>C	AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.1542G>C	9.37:g.114304757G>C	ENSP00000311679:p.Gln514His					ZNF483_uc004bfg.2_Intron	p.Q514H	NM_133464	NP_597721	Q8TF39	ZN483_HUMAN			6	1766	+			514			C2H2-type 3.		Q5VZN2|Q8NAE1	Missense_Mutation	SNP	ENST00000309235.5	37	c.1542G>C	CCDS35106.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.925460	0.52759	.	.	ENSG00000173258	ENST00000309235	T	0.18502	2.21	4.2	-1.69	0.08186	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45606	D	0.000348	T	0.26340	0.0643	L	0.42245	1.32	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	T	0.01021	-1.1478	10	0.66056	D	0.02	-19.4807	9.4881	0.38942	0.4654:0.0:0.5346:0.0	.	514	Q8TF39	ZN483_HUMAN	H	514	ENSP00000311679:Q514H	ENSP00000311679:Q514H	Q	+	3	2	ZNF483	113344578	0.000000	0.05858	0.986000	0.45419	0.995000	0.86356	0.093000	0.15086	-0.317000	0.08677	0.655000	0.94253	CAG		0.408	ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053641.1	XM_088567		16	55	0	0	0	0.004007	0	16	55				
CCBL1	883	broad.mit.edu	37	9	131600361	131600361	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr9:131600361C>A	ENST00000302586.3	-	5	569	c.407G>T	c.(406-408)gGg>gTg	p.G136V	CCBL1_ENST00000320665.6_Missense_Mutation_p.G86V|CCBL1_ENST00000436267.2_Missense_Mutation_p.G230V|CCBL1_ENST00000483599.1_5'UTR	NM_001122671.1|NM_004059.4	NP_001116143.1|NP_004050.3	Q16773	KAT1_HUMAN	cysteine conjugate-beta lyase, cytoplasmic	136					cellular amino acid biosynthetic process (GO:0008652)|cellular modified amino acid metabolic process (GO:0006575)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine catabolic process (GO:0097053)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|glutamine-phenylpyruvate transaminase activity (GO:0047316)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|L-glutamine:pyruvate aminotransferase activity (GO:0047945)|L-phenylalanine-oxaloacetate transaminase activity (GO:0036141)|L-phenylalanine:pyruvate aminotransferase activity (GO:0047312)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)	18					L-Glutamine(DB00130)	AGGACGACCCCCTGCCATCAT	0.547																																							uc004bwh.2		NA																	0				ovary(1)	1						c.(406-408)GGG>GTG		kynurenine aminotransferase I isoform a	L-Glutamine(DB00130)|Pyridoxal Phosphate(DB00114)						197.0	209.0	205.0					9																	131600361		2188	4272	6460	SO:0001583	missense	883				kynurenine metabolic process|L-phenylalanine catabolic process|tryptophan catabolic process	cytosol|nucleus	1-aminocyclopropane-1-carboxylate synthase activity|cysteine-S-conjugate beta-lyase activity|glutamine-phenylpyruvate transaminase activity|kynurenine-oxoglutarate transaminase activity|L-glutamine:pyruvate aminotransferase activity|L-phenylalanine:pyruvate aminotransferase activity|protein homodimerization activity|pyridoxal phosphate binding	g.chr9:131600361C>A	Y17448	CCDS43884.1, CCDS48038.1, CCDS75915.1	9q34.11	2008-03-11	2008-03-11		ENSG00000171097	ENSG00000171097	2.6.1.64		1564	protein-coding gene	gene with protein product	"""glutamine transaminase K"", ""kyneurenine aminotransferase"""	600547	"""cysteine conjugate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)"""			7883047	Standard	NM_001122671		Approved	KATI, GTK	uc004bwh.3	Q16773	OTTHUMG00000020767	ENST00000302586.3:c.407G>T	9.37:g.131600361C>A	ENSP00000302227:p.Gly136Val					CCBL1_uc004bwf.2_Missense_Mutation_p.G170V|CCBL1_uc004bwg.2_RNA|CCBL1_uc010myn.2_Missense_Mutation_p.G136V|CCBL1_uc004bwj.2_Missense_Mutation_p.G86V|CCBL1_uc011mbl.1_Missense_Mutation_p.G230V|CCBL1_uc004bwi.2_RNA|CCBL1_uc010myo.2_Missense_Mutation_p.G136V	p.G136V	NM_004059	NP_004050	Q16773	KAT1_HUMAN			5	592	-			136					Q5T275|Q8N191	Missense_Mutation	SNP	ENST00000302586.3	37	c.407G>T	CCDS43884.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.353591	0.82243	.	.	ENSG00000171097	ENST00000302586;ENST00000320665;ENST00000436267;ENST00000451800;ENST00000416084	D;D;D;D;D	0.92858	-3.12;-3.12;-3.12;-3.12;-3.12	5.13	5.13	0.70059	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.97823	0.9285	H	0.98351	4.21	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.99632	1.0986	10	0.87932	D	0	-37.0323	17.1705	0.86828	0.0:1.0:0.0:0.0	.	230;136;86;136;136	B7Z4W5;A8K563;Q16773-2;Q16773;Q5T278	.;.;.;KAT1_HUMAN;.	V	136;86;230;136;136	ENSP00000302227:G136V;ENSP00000317342:G86V;ENSP00000399415:G230V;ENSP00000390377:G136V;ENSP00000412402:G136V	ENSP00000302227:G136V	G	-	2	0	CCBL1	130640182	1.000000	0.71417	0.973000	0.42090	0.711000	0.40976	5.223000	0.65283	2.383000	0.81215	0.655000	0.94253	GGG		0.547	CCBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054521.2			68	117	1	0	1.7488e-33	0.01441	2.1967e-33	68	117				
BARHL1	56751	broad.mit.edu	37	9	135464746	135464746	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr9:135464746G>A	ENST00000263610.2	+	3	1434	c.821G>A	c.(820-822)gGc>gAc	p.G274D	BARHL1_ENST00000542090.1_Missense_Mutation_p.G274D	NM_020064.3	NP_064448.1	Q9BZE3	BARH1_HUMAN	BarH-like homeobox 1	274					midbrain development (GO:0030901)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			cervix(1)|large_intestine(2)|lung(2)|skin(3)	8				OV - Ovarian serous cystadenocarcinoma(145;1.79e-06)|Epithelial(140;3.12e-05)		CTGGACCCCGGCGCGGCGCTC	0.672																																							uc004cbp.1		NA																	0					0						c.(820-822)GGC>GAC		BarH-like homeobox 1							34.0	44.0	41.0					9																	135464746		2201	4296	6497	SO:0001583	missense	56751					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr9:135464746G>A	AJ237816	CCDS6950.1	9q34.13	2011-06-20	2007-07-09		ENSG00000125492	ENSG00000125492		"""Homeoboxes / ANTP class : NKL subclass"""	953	protein-coding gene	gene with protein product		605211	"""BarH (Drosophila)-like 1"""				Standard	NM_020064		Approved		uc004cbp.1	Q9BZE3	OTTHUMG00000020839	ENST00000263610.2:c.821G>A	9.37:g.135464746G>A	ENSP00000263610:p.Gly274Asp						p.G274D	NM_020064	NP_064448	Q9BZE3	BARH1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.79e-06)|Epithelial(140;3.12e-05)	3	1013	+			274					Q5T6V2|Q9NY88	Missense_Mutation	SNP	ENST00000263610.2	37	c.821G>A	CCDS6950.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.254152	0.80135	.	.	ENSG00000125492	ENST00000263610;ENST00000542090	D;D	0.91011	-2.77;-2.77	4.48	4.48	0.54585	.	0.064498	0.64402	D	0.000009	D	0.86364	0.5915	L	0.29908	0.895	0.51233	D	0.999917	P	0.50710	0.938	P	0.46940	0.532	D	0.83710	0.0187	10	0.12430	T	0.62	.	15.8866	0.79255	0.0:0.0:1.0:0.0	.	274	Q9BZE3	BARH1_HUMAN	D	274	ENSP00000263610:G274D;ENSP00000444704:G274D	ENSP00000263610:G274D	G	+	2	0	BARHL1	134454567	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.911000	0.48774	2.307000	0.77673	0.561000	0.74099	GGC		0.672	BARHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054789.2			23	55	0	0	0	0.014323	0	23	55				
PMPCA	23203	broad.mit.edu	37	9	139311650	139311650	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr9:139311650C>T	ENST00000371717.3	+	7	890	c.881C>T	c.(880-882)aCt>aTt	p.T294I	PMPCA_ENST00000462616.1_3'UTR|PMPCA_ENST00000399219.3_Missense_Mutation_p.T163I	NM_001282946.1|NM_015160.1	NP_001269875.1|NP_055975.1	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	294					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	14		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		GCCCAGTACACTGGGGGGATT	0.612																																							uc004chl.2		NA																	0					0						c.(880-882)ACT>ATT		peptidase (mitochondrial processing) alpha							29.0	28.0	28.0					9																	139311650		2203	4300	6503	SO:0001583	missense	23203				proteolysis	mitochondrial inner membrane|mitochondrial matrix	metalloendopeptidase activity|zinc ion binding	g.chr9:139311650C>T	D21064	CCDS35180.1, CCDS65192.1	9q34.3	2008-02-05	2003-06-13	2003-06-20	ENSG00000165688	ENSG00000165688			18667	protein-coding gene	gene with protein product		613036	"""inositol polyphosphate-5-phosphatase, 72 kD"""	INPP5E		8590280, 7788527	Standard	NM_015160		Approved	KIAA0123, Alpha-MPP	uc004chl.3	Q10713	OTTHUMG00000020926	ENST00000371717.3:c.881C>T	9.37:g.139311650C>T	ENSP00000360782:p.Thr294Ile					PMPCA_uc010nbl.2_Missense_Mutation_p.T194I|PMPCA_uc011mdz.1_Missense_Mutation_p.T163I|PMPCA_uc004chm.1_Missense_Mutation_p.T44I|PMPCA_uc004chn.1_5'Flank	p.T294I	NM_015160	NP_055975	Q10713	MPPA_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)	7	886	+		Myeloproliferative disorder(178;0.0821)	294					B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Missense_Mutation	SNP	ENST00000371717.3	37	c.881C>T	CCDS35180.1	.	.	.	.	.	.	.	.	.	.	C	31	5.058532	0.93846	.	.	ENSG00000165688	ENST00000371717;ENST00000399219;ENST00000444897	T;T;T	0.39997	3.08;3.08;1.05	5.7	5.7	0.88788	Peptidase M16, C-terminal (1);Peptidase M16, core (1);	0.000000	0.85682	D	0.000000	T	0.66645	0.2810	M	0.75150	2.29	0.80722	D	1	P;P;D;P	0.89917	0.74;0.911;1.0;0.911	P;P;D;P	0.77557	0.588;0.724;0.99;0.724	T	0.67987	-0.5528	10	0.62326	D	0.03	-16.7425	18.8156	0.92076	0.0:1.0:0.0:0.0	.	163;294;2;294	B4DKL3;Q5SXM9;Q5SXN9;Q10713	.;.;.;MPPA_HUMAN	I	294;163;2	ENSP00000360782:T294I;ENSP00000416702:T163I;ENSP00000408393:T2I	ENSP00000360782:T294I	T	+	2	0	PMPCA	138431471	1.000000	0.71417	0.963000	0.40424	0.909000	0.53808	7.554000	0.82212	2.683000	0.91414	0.609000	0.83330	ACT		0.612	PMPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055054.1	NM_015160		11	23	0	0	0	0.008291	0	11	23				
FRMPD4	9758	broad.mit.edu	37	X	12734961	12734961	+	Nonsense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:12734961G>T	ENST00000380682.1	+	15	2889	c.2383G>T	c.(2383-2385)Gag>Tag	p.E795*		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	795					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						TGATGACAATGAGGATGACTT	0.562																																							uc004cuz.1		NA																	0				central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						c.(2383-2385)GAG>TAG		FERM and PDZ domain containing 4							206.0	155.0	172.0					X																	12734961		2203	4300	6503	SO:0001587	stop_gained	9758				positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding	g.chrX:12734961G>T	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.2383G>T	X.37:g.12734961G>T	ENSP00000370057:p.Glu795*					FRMPD4_uc011mij.1_Nonsense_Mutation_p.E787*	p.E795*	NM_014728	NP_055543	Q14CM0	FRPD4_HUMAN			15	2889	+			795					A8K0X9|O15032	Nonsense_Mutation	SNP	ENST00000380682.1	37	c.2383G>T	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	G	43	10.191515	0.99355	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	.	.	.	5.26	5.26	0.73747	.	0.586540	0.19214	N	0.119845	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	18.2456	0.89984	0.0:0.0:1.0:0.0	.	.	.	.	X	795;786;784	.	ENSP00000304583:E784X	E	+	1	0	FRMPD4	12644882	1.000000	0.71417	0.962000	0.40283	0.992000	0.81027	9.305000	0.96197	2.334000	0.79466	0.600000	0.82982	GAG		0.562	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712		36	123	1	0	1.30015e-28	0.004878	1.62093e-28	36	123				
TCEANC	170082	broad.mit.edu	37	X	13681425	13681425	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:13681425G>A	ENST00000380600.1	+	2	885	c.798G>A	c.(796-798)ctG>ctA	p.L266L	TCEANC_ENST00000545566.1_Silent_p.L266L|TCEANC_ENST00000490617.1_3'UTR|TCEANC_ENST00000314720.4_Silent_p.L296L|TCEANC_ENST00000544987.1_Silent_p.L266L			Q8N8B7	TEANC_HUMAN	transcription elongation factor A (SII) N-terminal and central domain containing	266	TFIIS central. {ECO:0000255|PROSITE- ProRule:PRU00651}.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|large_intestine(5)|lung(2)|pancreas(1)	9						ATAAGGAACTGAAGCAGTTGA	0.428																																							uc004cvk.2		NA																	0				pancreas(1)	1						c.(796-798)CTG>CTA		TFIIS central domain-containing protein 1							25.0	24.0	24.0					X																	13681425		1907	4100	6007	SO:0001819	synonymous_variant	170082				regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding	g.chrX:13681425G>A		CCDS48081.1, CCDS75954.1	Xp22.2	2009-01-30			ENSG00000176896	ENSG00000176896			28277	protein-coding gene	gene with protein product						12477932	Standard	XM_005274454		Approved	MGC17403	uc010neg.1	Q8N8B7	OTTHUMG00000021154	ENST00000380600.1:c.798G>A	X.37:g.13681425G>A						TCEANC_uc010nee.1_Silent_p.L266L|TCEANC_uc010nef.1_Silent_p.L266L|TCEANC_uc010neg.1_Silent_p.L296L|TCEANC_uc004cvl.2_RNA	p.L266L	NM_152634	NP_689847	Q8N8B7	TEANC_HUMAN			2	1028	+			266			TFIIS central.		A6NI06|B2RDM3	Silent	SNP	ENST00000380600.1	37	c.798G>A																																																																																					0.428	TCEANC-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000055796.1	NM_152634		4	10	0	0	0	0.009096	0	4	10				
FANCB	2187	broad.mit.edu	37	X	14883041	14883041	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:14883041G>C	ENST00000324138.3	-	2	745	c.592C>G	c.(592-594)Caa>Gaa	p.Q198E	FANCB_ENST00000398334.1_Missense_Mutation_p.Q198E	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	198					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					GAAGGCTCTTGAGTACATTCT	0.333								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														uc004cwg.1		NA																	0				lung(1)	1						c.(592-594)CAA>GAA	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia complementation group B							91.0	97.0	95.0					X																	14883041		2203	4298	6501	SO:0001583	missense	2187	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	nucleoplasm		g.chrX:14883041G>C	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.592C>G	X.37:g.14883041G>C	ENSP00000326819:p.Gln198Glu					FANCB_uc004cwh.1_Missense_Mutation_p.Q198E	p.Q198E	NM_001018113	NP_001018123	Q8NB91	FANCB_HUMAN			3	860	-	Hepatocellular(33;0.183)		198					B2RMZ4|Q7Z2U2|Q86XG1	Missense_Mutation	SNP	ENST00000324138.3	37	c.592C>G	CCDS14161.1	.	.	.	.	.	.	.	.	.	.	G	0.078	-1.189025	0.01607	.	.	ENSG00000181544	ENST00000324138;ENST00000398334;ENST00000452869	T;T;T	0.36878	1.23;1.23;1.23	5.41	1.43	0.22495	.	1.238750	0.05231	N	0.510322	T	0.28532	0.0706	L	0.50333	1.59	0.09310	N	1	B	0.33171	0.4	B	0.30855	0.121	T	0.17167	-1.0378	10	0.15499	T	0.54	8.3392	4.0014	0.09582	0.0715:0.2413:0.3485:0.3387	.	198	Q8NB91	FANCB_HUMAN	E	198	ENSP00000326819:Q198E;ENSP00000381378:Q198E;ENSP00000397849:Q198E	ENSP00000326819:Q198E	Q	-	1	0	FANCB	14792962	0.020000	0.18652	0.000000	0.03702	0.068000	0.16541	1.836000	0.39191	-0.071000	0.12886	0.600000	0.82982	CAA		0.333	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055835.1	NM_152633		29	131	0	0	0	0.008361	0	29	131				
PIGA	5277	broad.mit.edu	37	X	15339736	15339736	+	Silent	SNP	A	A	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:15339736A>G	ENST00000333590.4	-	6	1431	c.1347T>C	c.(1345-1347)tcT>tcC	p.S449S	PIGA_ENST00000482148.1_5'UTR|PIGA_ENST00000428964.1_Silent_p.S134S|PIGA_ENST00000542278.1_Silent_p.S215S	NM_002641.3	NP_002632.1	P37287	PIGA_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class A	449					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|positive regulation of metabolic process (GO:0009893)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)|UDP-glycosyltransferase activity (GO:0008194)			endometrium(2)|kidney(2)|large_intestine(2)|ovary(1)|prostate(2)|urinary_tract(1)	10	Hepatocellular(33;0.183)					CATCAATGATAGAATCTGGAG	0.428																																							uc004cwr.2		NA																	0					0						c.(1345-1347)TCT>TCC		phosphatidylinositol							123.0	118.0	119.0					X																	15339736		2203	4300	6503	SO:0001819	synonymous_variant	5277				C-terminal protein lipidation|positive regulation of metabolic process|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity|protein binding	g.chrX:15339736A>G	BC038236	CCDS14165.1, CCDS48086.1, CCDS48086.2	Xp22.1	2014-09-17	2008-07-31		ENSG00000165195	ENSG00000165195	2.4.1.198	"""Glycosyltransferase group 1 domain containing"", ""Phosphatidylinositol glycan anchor biosynthesis"""	8957	protein-coding gene	gene with protein product	"""paroxysmal nocturnal hemoglobinuria"", ""phosphatidylinositol N-acetylglucosaminyltransferase"""	311770	"""phosphatidylinositol glycan, class A (paroxysmal nocturnal hemoglobinuria)"""			8500164	Standard	NM_002641		Approved	GPI3	uc004cwr.3	P37287	OTTHUMG00000021174	ENST00000333590.4:c.1347T>C	X.37:g.15339736A>G						PIGA_uc010neu.2_Silent_p.S65S|PIGA_uc004cwq.2_Silent_p.S134S|PIGA_uc010nev.2_Silent_p.S280S|PIGA_uc004cws.2_Silent_p.S134S|PIGA_uc011miq.1_Silent_p.S215S	p.S449S	NM_002641	NP_002632	P37287	PIGA_HUMAN			6	1447	-	Hepatocellular(33;0.183)		449			Lumenal (Potential).		B4E0V2|Q16025|Q16250	Silent	SNP	ENST00000333590.4	37	c.1347T>C	CCDS14165.1																																																																																				0.428	PIGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055854.1	NM_002641		27	102	0	0	0	0.010818	0	27	102				
RPS6KA3	6197	broad.mit.edu	37	X	20187547	20187547	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:20187547C>G	ENST00000379565.3	-	16	1623	c.1416G>C	c.(1414-1416)caG>caC	p.Q472H	RPS6KA3_ENST00000379548.4_Missense_Mutation_p.Q442H|RPS6KA3_ENST00000479809.1_5'UTR|RPS6KA3_ENST00000544447.1_Missense_Mutation_p.Q444H|RPS6KA3_ENST00000540702.1_Missense_Mutation_p.Q443H	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	472	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	TGTTTGGATGCTGTCCATAAC	0.308																																							uc004czu.2		NA																	0				central_nervous_system(4)|stomach(1)|ovary(1)|lung(1)|breast(1)	8						c.(1414-1416)CAG>CAC		ribosomal protein S6 kinase, 90kDa, polypeptide							176.0	169.0	172.0					X																	20187547		2203	4300	6503	SO:0001583	missense	6197				axon guidance|central nervous system development|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|skeletal system development|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|caspase inhibitor activity|magnesium ion binding|protein serine/threonine kinase activity	g.chrX:20187547C>G	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1416G>C	X.37:g.20187547C>G	ENSP00000368884:p.Gln472His					RPS6KA3_uc011mjk.1_Missense_Mutation_p.Q442H|RPS6KA3_uc004czv.2_Missense_Mutation_p.Q459H|RPS6KA3_uc011mjl.1_Missense_Mutation_p.Q443H|RPS6KA3_uc011mjm.1_Missense_Mutation_p.Q444H	p.Q472H	NM_004586	NP_004577	P51812	KS6A3_HUMAN			16	1416	-			472			Protein kinase 2.		B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	37	c.1416G>C	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	C	10.46	1.356128	0.24598	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702	T;T;T;T	0.39406	1.08;1.08;1.08;1.08	5.17	2.46	0.29980	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.36635	0.0974	N	0.10707	0.03	0.80722	D	1	B;B;P;B	0.47253	0.007;0.003;0.892;0.007	B;B;P;B	0.61132	0.018;0.01;0.884;0.016	T	0.08868	-1.0701	10	0.29301	T	0.29	.	10.1879	0.43009	0.0:0.7414:0.0:0.2586	.	443;442;444;472	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	H	472;444;442;443	ENSP00000368884:Q472H;ENSP00000440220:Q444H;ENSP00000368865:Q442H;ENSP00000444837:Q443H	ENSP00000368865:Q442H	Q	-	3	2	RPS6KA3	20097468	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.952000	0.29149	0.164000	0.19529	0.600000	0.82982	CAG		0.308	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586		24	104	0	0	0	0.005443	0	24	104				
KLHL34	257240	broad.mit.edu	37	X	21674331	21674331	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:21674331C>A	ENST00000379499.2	-	1	2117	c.1576G>T	c.(1576-1578)Ggc>Tgc	p.G526C		NM_153270.1	NP_695002.1	Q8N239	KLH34_HUMAN	kelch-like family member 34	526						extracellular space (GO:0005615)				cervix(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	26						AACACAGCGCCGCGCAGCACT	0.647																																							uc004czz.1		NA																	0				ovary(1)	1						c.(1576-1578)GGC>TGC		kelch-like 34							33.0	21.0	25.0					X																	21674331		2199	4289	6488	SO:0001583	missense	257240							g.chrX:21674331C>A	AK092279	CCDS14199.1	Xp22.12	2013-02-22	2013-02-22		ENSG00000185915	ENSG00000185915		"""Kelch-like"", ""BTB/POZ domain containing"""	26634	protein-coding gene	gene with protein product			"""kelch-like 34 (Drosophila)"""				Standard	NM_153270		Approved	FLJ34960, RP11-450P7.3	uc004czz.1	Q8N239	OTTHUMG00000021234	ENST00000379499.2:c.1576G>T	X.37:g.21674331C>A	ENSP00000368813:p.Gly526Cys						p.G526C	NM_153270	NP_695002	Q8N239	KLH34_HUMAN			1	2118	-			526			Kelch 4.			Missense_Mutation	SNP	ENST00000379499.2	37	c.1576G>T	CCDS14199.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.455928	0.63401	.	.	ENSG00000185915	ENST00000379499	T	0.71934	-0.61	5.3	5.3	0.74995	Kelch-type beta propeller (1);	0.067782	0.64402	D	0.000018	D	0.85877	0.5799	M	0.85299	2.745	0.54753	D	0.999987	D	0.89917	1.0	D	0.74348	0.983	D	0.88208	0.2888	10	0.87932	D	0	.	17.9874	0.89159	0.0:1.0:0.0:0.0	.	526	Q8N239	KLH34_HUMAN	C	526	ENSP00000368813:G526C	ENSP00000368813:G526C	G	-	1	0	KLHL34	21584252	0.961000	0.32948	0.432000	0.26747	0.549000	0.35272	4.667000	0.61561	2.438000	0.82558	0.600000	0.82982	GGC		0.647	KLHL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056022.1	NM_153270		3	5	1	0	6.4e-05	0.004672	6.78665e-05	3	5				
YY2	404281	broad.mit.edu	37	X	21875591	21875591	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:21875591C>G	ENST00000429584.2	+	1	1487	c.989C>G	c.(988-990)aCa>aGa	p.T330R	MBTPS2_ENST00000365779.2_Intron|MBTPS2_ENST00000465888.1_3'UTR|MBTPS2_ENST00000379484.5_Intron	NM_206923.3	NP_996806.2	O15391	TYY2_HUMAN	YY2 transcription factor	330	Mediates transcriptional repression.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T330I(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(2)	19						AATTTGCGCACACACTTGCGC	0.527																																							uc011mjp.1		NA																	1	Substitution - Missense(1)		endometrium(1)	breast(1)|skin(1)	2						c.(988-990)ACA>AGA		YY2 transcription factor							184.0	184.0	184.0					X																	21875591		2203	4300	6503	SO:0001583	missense	404281				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|plasma membrane	DNA binding|zinc ion binding	g.chrX:21875591C>G	AK091850	CCDS14202.1	Xp22.2-p22.1	2011-02-11			ENSG00000230797	ENSG00000230797		"""Zinc fingers, C2H2-type"""	31684	protein-coding gene	gene with protein product	"""transcription factor yin yang 2"""	300570				14702039	Standard	NM_206923		Approved	ZNF631	uc011mjp.2	O15391	OTTHUMG00000021236	ENST00000429584.2:c.989C>G	X.37:g.21875591C>G	ENSP00000389381:p.Thr330Arg					MBTPS2_uc004dae.2_Intron|MBTPS2_uc010nfr.2_Intron|YY2_uc010nfq.2_Missense_Mutation_p.T548R|MBTPS2_uc004dab.2_Intron	p.T330R	NM_206923	NP_996806	O15391	TYY2_HUMAN			1	989	+			330			Mediates transcriptional repression.|C2H2-type 3.		B2RP10|Q6Q1S4	Missense_Mutation	SNP	ENST00000429584.2	37	c.989C>G	CCDS14202.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.177844	0.78564	.	.	ENSG00000230797	ENST00000429584	T	0.50001	0.76	4.6	4.6	0.57074	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	U	0.000000	T	0.44244	0.1284	N	0.02802	-0.49	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58713	-0.7588	10	0.52906	T	0.07	.	14.034	0.64634	0.0:1.0:0.0:0.0	.	330	O15391	TYY2_HUMAN	R	330	ENSP00000389381:T330R	ENSP00000389381:T330R	T	+	2	0	YY2	21785512	1.000000	0.71417	0.882000	0.34594	0.684000	0.39900	7.651000	0.83577	2.276000	0.75962	0.544000	0.68410	ACA		0.527	YY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056025.1	NM_206923		54	263	0	0	0	0.01441	0	54	263				
MAGEB6	158809	broad.mit.edu	37	X	26212565	26212565	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:26212565C>A	ENST00000379034.1	+	2	751	c.602C>A	c.(601-603)aCg>aAg	p.T201K		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	201	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.T201M(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						AAGGCGTGCACGTTGGCGCAA	0.483																																							uc004dbr.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(3)	3						c.(601-603)ACG>AAG		melanoma antigen family B, 6							83.0	70.0	75.0					X																	26212565		2202	4300	6502	SO:0001583	missense	158809							g.chrX:26212565C>A	AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.602C>A	X.37:g.26212565C>A	ENSP00000368320:p.Thr201Lys					MAGEB6_uc010ngc.1_5'UTR	p.T201K	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN			2	751	+			201			MAGE.		Q6GS19|Q9H219	Missense_Mutation	SNP	ENST00000379034.1	37	c.602C>A	CCDS14217.1	.	.	.	.	.	.	.	.	.	.	c	0.009	-1.815145	0.00600	.	.	ENSG00000176746	ENST00000379034	T	0.01572	4.76	2.88	-5.76	0.02376	.	0.624921	0.14149	N	0.338154	T	0.00552	0.0018	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40308	-0.9570	10	0.06625	T	0.88	.	3.784	0.08692	0.6019:0.174:0.0996:0.1246	.	201	Q8N7X4	MAGB6_HUMAN	K	201	ENSP00000368320:T201K	ENSP00000368320:T201K	T	+	2	0	MAGEB6	26122486	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.470000	0.00065	-5.416000	0.00015	-4.040000	0.00012	ACG		0.483	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056123.1	NM_173523		39	100	1	0	1.49673e-21	0.00623	1.81513e-21	39	100				
FAM47A	158724	broad.mit.edu	37	X	34148133	34148133	+	Nonsense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:34148133G>A	ENST00000346193.3	-	1	2314	c.2263C>T	c.(2263-2265)Caa>Taa	p.Q755*		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	755										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						AACAGCCTTTGAATGATGCCA	0.408																																							uc004ddg.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(2263-2265)CAA>TAA		hypothetical protein LOC158724							118.0	114.0	115.0					X																	34148133		2202	4297	6499	SO:0001587	stop_gained	158724							g.chrX:34148133G>A	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.2263C>T	X.37:g.34148133G>A	ENSP00000345029:p.Gln755*						p.Q755*	NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN			1	2296	-			755					A8K8I9|Q8TAA0	Nonsense_Mutation	SNP	ENST00000346193.3	37	c.2263C>T	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	g	16.22	3.061900	0.55432	.	.	ENSG00000185448	ENST00000346193	.	.	.	1.13	0.237	0.15475	.	.	.	.	.	.	.	.	.	.	.	0.54753	D	0.999987	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	4.9597	0.14059	0.0:0.6154:0.3846:0.0	.	.	.	.	X	755	.	ENSP00000345029:Q755X	Q	-	1	0	FAM47A	34058054	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	-0.424000	0.07025	0.030000	0.15379	-0.256000	0.11100	CAA		0.408	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408		25	104	0	0	0	0.008361	0	25	104				
FAM47C	442444	broad.mit.edu	37	X	37028224	37028224	+	Missense_Mutation	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:37028224C>A	ENST00000358047.3	+	1	1793	c.1741C>A	c.(1741-1743)Cat>Aat	p.H581N		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	581										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						TGGAGTGTCCCATCTCTGCCC	0.657																																							uc004ddl.1		NA																	0				ovary(3)	3						c.(1741-1743)CAT>AAT		hypothetical protein LOC442444							46.0	52.0	50.0					X																	37028224		2202	4300	6502	SO:0001583	missense	442444							g.chrX:37028224C>A	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1741C>A	X.37:g.37028224C>A	ENSP00000367913:p.His581Asn						p.H581N	NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN			1	1755	+			581					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.1741C>A	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	-	0.858	-0.736391	0.03111	.	.	ENSG00000198173	ENST00000358047	T	0.14266	2.52	1.74	-1.33	0.09172	.	.	.	.	.	T	0.07413	0.0187	L	0.51422	1.61	0.09310	N	1	P	0.41041	0.736	B	0.28232	0.087	T	0.31364	-0.9946	9	0.20046	T	0.44	.	2.3453	0.04270	0.2364:0.3984:0.0:0.3652	.	581	Q5HY64	FA47C_HUMAN	N	581	ENSP00000367913:H581N	ENSP00000367913:H581N	H	+	1	0	FAM47C	36938145	0.009000	0.17119	0.000000	0.03702	0.007000	0.05969	-0.282000	0.08445	-0.685000	0.05177	0.452000	0.29995	CAT		0.657	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		57	115	1	0	3.00063e-23	0.01441	3.69265e-23	57	115				
OTC	5009	broad.mit.edu	37	X	38262962	38262962	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:38262962T>A	ENST00000039007.4	+	6	784	c.632T>A	c.(631-633)tTc>tAc	p.F211Y	TM4SF2_ENST00000465127.1_Intron	NM_000531.5	NP_000522.3	P00480	OTC_HUMAN	ornithine carbamoyltransferase	211					ammonia homeostasis (GO:0097272)|arginine biosynthetic process (GO:0006526)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|liver development (GO:0001889)|midgut development (GO:0007494)|ornithine catabolic process (GO:0006593)|protein homotrimerization (GO:0070207)|response to biotin (GO:0070781)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|ornithine carbamoyltransferase activity (GO:0004585)|phosphate ion binding (GO:0042301)|phospholipid binding (GO:0005543)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22					L-Citrulline(DB00155)|L-Ornithine(DB00129)	GCAGCGAAATTCGGAATGCAC	0.473																																							uc004def.3		NA																	0				ovary(1)|breast(1)	2						c.(631-633)TTC>TAC		ornithine carbamoyltransferase precursor	L-Citrulline(DB00155)|L-Ornithine(DB00129)						107.0	85.0	93.0					X																	38262962		2202	4300	6502	SO:0001583	missense	5009				arginine biosynthetic process|urea cycle	mitochondrial matrix|ornithine carbamoyltransferase complex	ornithine carbamoyltransferase activity	g.chrX:38262962T>A	K02100	CCDS14247.1	Xp21.1	2014-06-28			ENSG00000036473	ENSG00000036473	2.1.3.3		8512	protein-coding gene	gene with protein product		300461					Standard	NM_000531		Approved		uc004def.4	P00480	OTTHUMG00000022727	ENST00000039007.4:c.632T>A	X.37:g.38262962T>A	ENSP00000039007:p.Phe211Tyr						p.F211Y	NM_000531	NP_000522	P00480	OTC_HUMAN			6	846	+			211					A8K9P2|D3DWB0|Q3KNR1|Q6B0I1|Q9NYJ5	Missense_Mutation	SNP	ENST00000039007.4	37	c.632T>A	CCDS14247.1	.	.	.	.	.	.	.	.	.	.	t	33	5.255182	0.95336	.	.	ENSG00000036473	ENST00000039007	D	0.99150	-5.49	5.91	5.91	0.95273	Aspartate/ornithine carbamoyltransferase, Asp/Orn-binding domain (1);	0.150671	0.64402	D	0.000010	D	0.98651	0.9548	L	0.60455	1.87	0.38458	D	0.947131	P	0.51057	0.941	P	0.53912	0.737	D	0.99940	1.1403	10	0.87932	D	0	-13.5966	15.2579	0.73599	0.0:0.0:0.0:1.0	.	211	P00480	OTC_HUMAN	Y	211	ENSP00000039007:F211Y	ENSP00000039007:F211Y	F	+	2	0	OTC	38147906	1.000000	0.71417	0.874000	0.34290	0.902000	0.53008	7.651000	0.83577	1.986000	0.57962	0.481000	0.45027	TTC		0.473	OTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059006.2			16	55	0	0	0	0.003163	0	16	55				
USP11	8237	broad.mit.edu	37	X	47100188	47100188	+	Silent	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:47100188G>A	ENST00000218348.3	+	7	888	c.888G>A	c.(886-888)tcG>tcA	p.S296S	USP11_ENST00000377107.2_Silent_p.S253S	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	296					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						ACAACATGTCGGAAGAGGATG	0.532																																							uc004dhp.2		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(886-888)TCG>TCA		ubiquitin specific peptidase 11							110.0	69.0	83.0					X																	47100188		2203	4300	6503	SO:0001819	synonymous_variant	8237				protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chrX:47100188G>A	U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.888G>A	X.37:g.47100188G>A						USP11_uc004dhq.2_Silent_p.S23S	p.S296S	NM_004651	NP_004642	P51784	UBP11_HUMAN			7	888	+			296					B2RTX1|Q8IUG6|Q9BWE1	Silent	SNP	ENST00000218348.3	37	c.888G>A	CCDS14277.1																																																																																				0.532	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_004651		6	28	0	0	0	0.001168	0	6	28				
SSX9	280660	broad.mit.edu	37	X	48164277	48164277	+	RNA	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:48164277G>A	ENST00000608568.1	-	0	92					NR_073393.1		Q7RTT3	SSX9_HUMAN	synovial sarcoma, X breakpoint 9						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(2)|lung(2)|prostate(1)|stomach(1)	8						CATCGTCTCCGTTCATGGCAC	0.552																																							uc010nib.1		NA																	0					NA						c.(4-6)AAC>AAT		synovial sarcoma, X breakpoint 9							223.0	198.0	206.0					X																	48164277		2203	4299	6502			0							g.chrX:48164277G>A	BK000689		Xp11.23	2013-01-16			ENSG00000204648	ENSG00000204648			19655	other	unknown		300544				12216073	Standard	NR_073393		Approved		uc031tjk.1	Q7RTT3	OTTHUMG00000021490		X.37:g.48164277G>A							p.N2N	NM_174962	NP_777622					2	93	-									Silent	SNP	ENST00000608568.1	37	c.6C>T																																																																																					0.552	SSX9-002	KNOWN	basic	retained_intron	pseudogene	OTTHUMT00000472372.1	NR_073393		50	181	0	0	0	0.01441	0	50	181				
IQSEC2	23096	broad.mit.edu	37	X	53284025	53284025	+	Missense_Mutation	SNP	A	A	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:53284025A>T	ENST00000375368.5	-	3	1258	c.1058T>A	c.(1057-1059)aTg>aAg	p.M353K	IQSEC2_ENST00000375365.2_Missense_Mutation_p.M158K|IQSEC2_ENST00000396435.3_Missense_Mutation_p.M363K			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	353	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						GTTCTTGTTCATGCGGTACTG	0.587																																							uc004dsd.2		NA																	0				ovary(3)	3						c.(1087-1089)ATG>AAG		IQ motif and Sec7 domain 2 isoform1							37.0	29.0	32.0					X																	53284025		2202	4300	6502	SO:0001583	missense	23096				regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity	g.chrX:53284025A>T	AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.1058T>A	X.37:g.53284025A>T	ENSP00000364517:p.Met353Lys					IQSEC2_uc004dsc.2_Missense_Mutation_p.M158K	p.M363K	NM_001111125	NP_001104595	Q5JU85	IQEC2_HUMAN			4	1289	-			353			IQ.		B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	ENST00000375368.5	37	c.1088T>A		.	.	.	.	.	.	.	.	.	.	A	25.3	4.619328	0.87460	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	D;D;D	0.82167	-1.58;-1.58;-1.58	5.09	5.09	0.68999	.	0.093200	0.64402	D	0.000001	D	0.88100	0.6346	L	0.54323	1.7	0.80722	D	1	D;D	0.57899	0.981;0.981	D;D	0.69142	0.962;0.962	D	0.89093	0.3484	10	0.87932	D	0	.	12.9191	0.58222	1.0:0.0:0.0:0.0	.	363;158	Q5JU85-2;Q5JU85-3	.;.	K	363;353;158	ENSP00000379712:M363K;ENSP00000364517:M353K;ENSP00000364514:M158K	ENSP00000364514:M158K	M	-	2	0	IQSEC2	53300750	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.297000	0.96120	1.689000	0.51079	0.417000	0.27973	ATG		0.587	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345		5	19	0	0	0	0.001984	0	5	19				
AMER1	139285	broad.mit.edu	37	X	63411898	63411898	+	Silent	SNP	C	C	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:63411898C>A	ENST00000330258.3	-	2	1541	c.1269G>T	c.(1267-1269)ctG>ctT	p.L423L	AMER1_ENST00000403336.1_Silent_p.L423L|AMER1_ENST00000374869.3_Silent_p.L423L	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	423					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.L423L(4)									GATGGTAGCCCAGGTTCATAT	0.522																																							uc004dvo.2		NA																	71	Whole gene deletion(67)|Substitution - coding silent(4)	p.0?(40)	kidney(65)|lung(4)|ovary(1)|large_intestine(1)	kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						c.(1267-1269)CTG>CTT		family with sequence similarity 123B							210.0	184.0	193.0					X																	63411898		2203	4300	6503	SO:0001819	synonymous_variant	139285				Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		g.chrX:63411898C>A	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1269G>T	X.37:g.63411898C>A							p.L423L	NM_152424	NP_689637	Q5JTC6	F123B_HUMAN			2	1542	-			423					A2IB86|Q8N885	Silent	SNP	ENST00000330258.3	37	c.1269G>T	CCDS14377.2																																																																																				0.522	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424		22	57	1	0	1.39806e-14	0.008361	1.64463e-14	22	57				
ZC4H2	55906	broad.mit.edu	37	X	64137684	64137684	+	Silent	SNP	C	C	T	rs149235340	byFrequency	TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:64137684C>T	ENST00000374839.3	-	5	760	c.654G>A	c.(652-654)ccG>ccA	p.P218P	ZC4H2_ENST00000337990.2_Silent_p.P195P|ZC4H2_ENST00000447788.2_Missense_Mutation_p.R164Q|ZC4H2_ENST00000545618.1_Silent_p.P213P|ZC4H2_ENST00000488608.1_5'UTR	NM_018684.3	NP_061154.1	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing	218					nervous system development (GO:0007399)|neuromuscular junction development (GO:0007528)|spinal cord motor neuron differentiation (GO:0021522)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	metal ion binding (GO:0046872)			endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						GCTTCCGTTTCGGCTTTTTGG	0.488																																							uc004dvu.2		NA																	0				ovary(1)	1						c.(652-654)CCG>CCA		zinc finger, C4H2 domain containing		C	,GLN/ARG,	1,3834		0,1,1631,571	167.0	104.0	126.0		585,491,654	-10.8	0.5	X	dbSNP_134	126	1,6727		0,1,2427,1872	no	coding-synonymous,missense,coding-synonymous	ZC4H2	NM_001178032.2,NM_001178033.2,NM_018684.3	,43,	0,2,4058,2443	TT,TC,CC,C		0.0149,0.0261,0.0189	,,	195/202,164/177,218/225	64137684	2,10561	2203	4300	6503	SO:0001819	synonymous_variant	55906						metal ion binding|protein binding	g.chrX:64137684C>T	AF270491	CCDS14380.1, CCDS55431.1, CCDS55432.1	Xq11.1	2013-07-23	2008-10-01	2008-10-01	ENSG00000126970	ENSG00000126970		"""Zinc fingers"""	24931	protein-coding gene	gene with protein product		300897	"""KIAA1166"", ""Wieacker-Wolff syndrome"""	KIAA1166, WWS		10574461, 12097419, 23623388	Standard	NM_018684		Approved	HCA127	uc004dvu.3	Q9NQZ6	OTTHUMG00000021712	ENST00000374839.3:c.654G>A	X.37:g.64137684C>T						ZC4H2_uc004dvv.2_Silent_p.P195P|ZC4H2_uc011mov.1_Silent_p.P195P|ZC4H2_uc011mow.1_Missense_Mutation_p.R164Q|ZC4H2_uc004dvw.1_3'UTR	p.P218P	NM_018684	NP_061154	Q9NQZ6	ZC4H2_HUMAN			5	742	-			218					B2RDC2|B3KVZ5|B4DED0|E7EM74|G3V1L3|Q53H73|Q5JTF9|Q9H9C3|Q9H9H7|Q9ULQ4	Silent	SNP	ENST00000374839.3	37	c.654G>A	CCDS14380.1	.	.	.	.	.	.	.	.	.	.	C	14.06	2.421866	0.43020	2.61E-4	1.49E-4	ENSG00000126970	ENST00000447788	.	.	.	5.42	-10.8	0.00216	.	.	.	.	.	T	0.34658	0.0905	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16867	-1.0388	7	0.66056	D	0.02	.	3.2734	0.06889	0.0948:0.27:0.3669:0.2684	.	164	B4DED0	.	Q	164	.	ENSP00000399126:R164Q	R	-	2	0	ZC4H2	64054409	0.997000	0.39634	0.497000	0.27552	0.994000	0.84299	0.219000	0.17641	-2.224000	0.00725	-0.365000	0.07479	CGA		0.488	ZC4H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056958.1	NM_018684		4	20	0	0	0	0.009096	0	4	20				
RPS4X	6191	broad.mit.edu	37	X	71496038	71496038	+	Missense_Mutation	SNP	T	T	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:71496038T>C	ENST00000316084.6	-	2	154	c.50A>G	c.(49-51)cAt>cGt	p.H17R	RPS4X_ENST00000373626.3_Missense_Mutation_p.H17R|RPS4X_ENST00000486733.1_5'UTR	NM_001007.4	NP_000998.1	P62701	RS4X_HUMAN	ribosomal protein S4, X-linked	17					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of cell proliferation (GO:0008284)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|ribosome (GO:0005840)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			NS(1)|large_intestine(1)	2	Renal(35;0.156)					CAGCATCCAATGCTTTGGAGC	0.428																																							uc004ear.2		NA																	0					0						c.(49-51)CAT>CGT		ribosomal protein S4, X-linked X isoform							43.0	40.0	41.0					X																	71496038		2203	4300	6503	SO:0001583	missense	6191				endocrine pancreas development|positive regulation of cell proliferation|positive regulation of translation|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|polysome	rRNA binding|structural constituent of ribosome	g.chrX:71496038T>C		CCDS14418.1	Xq13.1	2011-04-05			ENSG00000198034	ENSG00000198034		"""S ribosomal proteins"""	10424	protein-coding gene	gene with protein product	"""40S ribosomal protein S4, X isoform"", ""ribosomal protein S4X isoform"", ""single-copy abundant mRNA"", ""cell cycle gene 2"""	312760				1795030, 8139551	Standard	NM_001007		Approved	DXS306, CCG2, SCAR, SCR10, FLJ40595, RPS4, S4	uc004ear.3	P62701	OTTHUMG00000021813	ENST00000316084.6:c.50A>G	X.37:g.71496038T>C	ENSP00000362744:p.His17Arg					RPS4X_uc011mqb.1_Missense_Mutation_p.H17R	p.H17R	NM_001007	NP_000998	P62701	RS4X_HUMAN			2	146	-	Renal(35;0.156)		17					P12631|P12750|P27576|P55831|Q14727|Q6IPY4	Missense_Mutation	SNP	ENST00000316084.6	37	c.50A>G	CCDS14418.1	.	.	.	.	.	.	.	.	.	.	T	16.97	3.268238	0.59540	.	.	ENSG00000198034	ENST00000316084;ENST00000373626	.	.	.	4.59	4.59	0.56863	Ribosomal protein S4e, N-terminal, conserved site (1);Ribosomal protein S4e, N-terminal (1);	0.069648	0.56097	D	0.000036	T	0.65101	0.2659	M	0.83483	2.645	0.58432	D	0.999999	B;B	0.24092	0.036;0.097	B;B	0.26416	0.056;0.069	T	0.67542	-0.5644	9	0.66056	D	0.02	.	11.1874	0.48664	0.0:0.0:0.0:1.0	.	17;17	B7Z1M6;P62701	.;RS4X_HUMAN	R	17	.	ENSP00000362744:H17R	H	-	2	0	RPS4X	71412763	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.704000	0.84595	1.608000	0.50180	0.481000	0.45027	CAT		0.428	RPS4X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057188.1	NM_001007		3	36	0	0	0	0.000602	0	3	36				
ZCCHC5	203430	broad.mit.edu	37	X	77913593	77913593	+	Missense_Mutation	SNP	G	G	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:77913593G>T	ENST00000321110.1	-	2	620	c.325C>A	c.(325-327)Cca>Aca	p.P109T		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	109	Pro-rich.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						GGGGCTGCTGGGGCCTCCTGG	0.642																																							uc004edc.1		NA																	0				ovary(1)	1						c.(325-327)CCA>ACA		zinc finger, CCHC domain containing 5							20.0	23.0	22.0					X																	77913593		2201	4291	6492	SO:0001583	missense	203430						nucleic acid binding|zinc ion binding	g.chrX:77913593G>T	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.325C>A	X.37:g.77913593G>T	ENSP00000316794:p.Pro109Thr						p.P109T	NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN			2	621	-			109			Pro-rich.		B2RMZ0|Q5JQE9	Missense_Mutation	SNP	ENST00000321110.1	37	c.325C>A	CCDS14440.1	.	.	.	.	.	.	.	.	.	.	G	4.279	0.050944	0.08243	.	.	ENSG00000179300	ENST00000321110	T	0.18657	2.2	3.11	0.374	0.16183	.	.	.	.	.	T	0.09024	0.0223	N	0.08118	0	0.09310	N	1	B	0.34103	0.437	B	0.29862	0.108	T	0.27773	-1.0064	9	0.38643	T	0.18	.	6.8587	0.24054	0.3637:0.0:0.6363:0.0	.	109	Q8N8U3	ZCHC5_HUMAN	T	109	ENSP00000316794:P109T	ENSP00000316794:P109T	P	-	1	0	ZCCHC5	77800249	0.002000	0.14202	0.000000	0.03702	0.063000	0.16089	0.066000	0.14489	-0.048000	0.13401	-0.508000	0.04489	CCA		0.642	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694		11	12	1	0	2.80697e-09	0.010729	3.13086e-09	11	12				
RPA4	29935	broad.mit.edu	37	X	96139888	96139888	+	Silent	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:96139888C>T	ENST00000373040.3	+	1	982	c.579C>T	c.(577-579)aaC>aaT	p.N193N	DIAPH2_ENST00000324765.8_Intron|DIAPH2_ENST00000355827.4_Intron|DIAPH2_ENST00000373054.4_Intron|DIAPH2_ENST00000373061.3_Intron|DIAPH2_ENST00000373049.4_Intron	NM_013347.4	NP_037479.1	Q13156	RFA4_HUMAN	replication protein A4, 30kDa	193					DNA damage checkpoint (GO:0000077)|DNA recombination (GO:0006310)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	13						CTGGGGATAACGATGAGAGTC	0.502								Other identified genes with known or suspected DNA repair function																															uc004efv.3		NA																	0					0						c.(577-579)AAC>AAT	Other_identified_genes_with_known_or_suspected_DNA_repair_function	replication protein A4, 34kDa							162.0	122.0	135.0					X																	96139888		2203	4300	6503	SO:0001819	synonymous_variant	29935				DNA damage checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair	DNA replication factor A complex|nucleoplasm	single-stranded DNA binding	g.chrX:96139888C>T	U24186	CCDS35345.1	Xq21	2010-04-09	2010-04-09		ENSG00000204086	ENSG00000204086			30305	protein-coding gene	gene with protein product		300767	"""replication protein A4, 34kDa"""			7760808	Standard	NM_013347		Approved	HSU24186	uc004efv.4	Q13156	OTTHUMG00000021987	ENST00000373040.3:c.579C>T	X.37:g.96139888C>T						DIAPH2_uc004eft.3_Intron|DIAPH2_uc004efu.3_Intron|DIAPH2_uc004efs.2_Intron	p.N193N	NM_013347	NP_037479	Q13156	RFA4_HUMAN			1	877	+			193					Q3SY03	Silent	SNP	ENST00000373040.3	37	c.579C>T	CCDS35345.1																																																																																				0.502	RPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057464.1	NM_013347		23	64	0	0	0	0.00333	0	23	64				
MORF4L2	9643	broad.mit.edu	37	X	102931253	102931253	+	Missense_Mutation	SNP	T	T	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:102931253T>A	ENST00000441076.2	-	4	1007	c.703A>T	c.(703-705)Att>Ttt	p.I235F	MORF4L2_ENST00000423833.2_Missense_Mutation_p.I235F|MORF4L2_ENST00000433176.2_Missense_Mutation_p.I235F|MORF4L2_ENST00000492116.1_5'Flank|MORF4L2_ENST00000451301.1_Missense_Mutation_p.I235F|MORF4L2_ENST00000360458.1_Missense_Mutation_p.I235F|MORF4L2_ENST00000422154.2_Missense_Mutation_p.I235F	NM_001142419.1|NM_012286.2	NP_001135891.1|NP_036418.1	Q15014	MO4L2_HUMAN	mortality factor 4 like 2	235	MRG. {ECO:0000255|PROSITE- ProRule:PRU00972}.				chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|DNA repair (GO:0006281)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)	13						ATTGCTCCAATTCTTACAAAT	0.438																																							uc004ekw.2		NA																	0					0						c.(703-705)ATT>TTT		mortality factor 4 like 2							84.0	69.0	74.0					X																	102931253		2203	4300	6503	SO:0001583	missense	9643				chromatin modification|DNA repair|regulation of cell growth|transcription, DNA-dependent	nucleolus	protein binding	g.chrX:102931253T>A	AF100620	CCDS14512.1	Xq22	2010-11-24			ENSG00000123562	ENSG00000123562			16849	protein-coding gene	gene with protein product	"""MORF-related gene X"""	300409				9891081, 7584026	Standard	NM_012286		Approved	KIAA0026, MRGX	uc011msa.2	Q15014	OTTHUMG00000022104	ENST00000441076.2:c.703A>T	X.37:g.102931253T>A	ENSP00000391969:p.Ile235Phe					MORF4L2_uc004ela.2_Missense_Mutation_p.I235F|MORF4L2_uc004ekx.2_Missense_Mutation_p.I235F|MORF4L2_uc004elb.2_Missense_Mutation_p.I235F|MORF4L2_uc004eky.2_Missense_Mutation_p.I235F|MORF4L2_uc010nos.2_Missense_Mutation_p.I235F|MORF4L2_uc004ekz.2_Missense_Mutation_p.I235F|MORF4L2_uc011mry.1_Missense_Mutation_p.I235F|MORF4L2_uc011mrz.1_Missense_Mutation_p.I235F|MORF4L2_uc004elc.2_Missense_Mutation_p.I235F|MORF4L2_uc004elf.2_Missense_Mutation_p.I235F|MORF4L2_uc004ele.2_Missense_Mutation_p.I235F|MORF4L2_uc011msa.1_Missense_Mutation_p.I235F|MORF4L2_uc011msb.1_Missense_Mutation_p.I235F|MORF4L2_uc011msc.1_Missense_Mutation_p.I235F|MORF4L2_uc011msd.1_Missense_Mutation_p.I235F|MORF4L2_uc004eld.2_Missense_Mutation_p.I235F	p.I235F	NM_012286	NP_036418	Q15014	MO4L2_HUMAN			4	1935	-			235					B3KP92|D3DXA5|Q567V0|Q8J026	Missense_Mutation	SNP	ENST00000441076.2	37	c.703A>T	CCDS14512.1	.	.	.	.	.	.	.	.	.	.	T	18.02	3.530412	0.64860	.	.	ENSG00000123562	ENST00000360458;ENST00000372620;ENST00000433176;ENST00000422154;ENST00000451301;ENST00000372619;ENST00000441076;ENST00000423833	T;T;T;T;T;T;T	0.09538	2.97;2.97;2.97;2.97;2.97;2.97;2.97	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.11665	0.0284	N	0.20574	0.59	0.80722	D	1	P	0.45672	0.864	P	0.48982	0.597	T	0.04870	-1.0921	10	0.59425	D	0.04	-22.9489	11.5301	0.50604	0.0:0.0:0.0:1.0	.	235	Q15014	MO4L2_HUMAN	F	235;117;235;235;235;217;235;235	ENSP00000353643:I235F;ENSP00000361703:I117F;ENSP00000415476:I235F;ENSP00000394417:I235F;ENSP00000410532:I235F;ENSP00000391969:I235F;ENSP00000416120:I235F	ENSP00000353643:I235F	I	-	1	0	MORF4L2	102817909	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	2.927000	0.48900	2.088000	0.63022	0.486000	0.48141	ATT		0.438	MORF4L2-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057732.1	NM_012286		8	42	0	0	0	0.00308	0	8	42				
COL4A5	1287	broad.mit.edu	37	X	107909764	107909764	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:107909764G>A	ENST00000361603.2	+	39	3737	c.3493G>A	c.(3493-3495)Gaa>Aaa	p.E1165K	COL4A5_ENST00000328300.6_Missense_Mutation_p.E1165K	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1165	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GCCTCCAGGCGAAAAAGGCAA	0.458									Alport syndrome with Diffuse Leiomyomatosis																														uc004enz.1		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(3493-3495)GAA>AAA		type IV collagen alpha 5 isoform 2 precursor							65.0	57.0	60.0					X																	107909764		2203	4300	6503	SO:0001583	missense	1287	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107909764G>A	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.3493G>A	X.37:g.107909764G>A	ENSP00000354505:p.Glu1165Lys					COL4A5_uc011mso.1_Missense_Mutation_p.E1165K	p.E1165K	NM_033380	NP_203699	P29400	CO4A5_HUMAN			39	3695	+			1165			Triple-helical region.		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	c.3493G>A	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.147881	0.78001	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.93247	-3.19;-3.15	5.36	5.36	0.76844	.	0.069091	0.56097	D	0.000024	D	0.94291	0.8166	L	0.50333	1.59	0.49798	D	0.999827	D;D	0.69078	0.997;0.997	P;P	0.60012	0.867;0.867	D	0.92057	0.5653	10	0.12103	T	0.63	.	18.2087	0.89863	0.0:0.0:1.0:0.0	.	1165;1165	E7EVY4;P29400	.;CO4A5_HUMAN	K	1165	ENSP00000331902:E1165K;ENSP00000354505:E1165K	ENSP00000331902:E1165K	E	+	1	0	COL4A5	107796420	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.265000	0.89869	2.237000	0.73441	0.529000	0.55759	GAA		0.458	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			3	18	0	0	0	0.009096	0	3	18				
STAG2	10735	broad.mit.edu	37	X	123190075	123190075	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:123190075C>G	ENST00000371160.1	+	14	1584	c.1294C>G	c.(1294-1296)Ctc>Gtc	p.L432V	STAG2_ENST00000469481.1_Intron|STAG2_ENST00000354548.5_Missense_Mutation_p.L363V|STAG2_ENST00000218089.9_Missense_Mutation_p.L432V|STAG2_ENST00000371145.3_Missense_Mutation_p.L432V|STAG2_ENST00000371144.3_Missense_Mutation_p.L432V|STAG2_ENST00000371157.3_Missense_Mutation_p.L432V	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	432					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TGGAGAATTTCTCTACAAAAA	0.328																																							uc004etz.3		NA																	0				ovary(4)|skin(1)	5						c.(1294-1296)CTC>GTC		stromal antigen 2 isoform b							67.0	65.0	65.0					X																	123190075		2203	4300	6503	SO:0001583	missense	10735				cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding	g.chrX:123190075C>G	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.1294C>G	X.37:g.123190075C>G	ENSP00000360202:p.Leu432Val					STAG2_uc004eua.2_Missense_Mutation_p.L432V|STAG2_uc004eub.2_Missense_Mutation_p.L432V|STAG2_uc004euc.2_Missense_Mutation_p.L432V|STAG2_uc004eud.2_Missense_Mutation_p.L432V|STAG2_uc004eue.2_Missense_Mutation_p.L432V	p.L432V	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN			13	1633	+			432					B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	37	c.1294C>G	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.324095	0.81580	.	.	ENSG00000101972	ENST00000218089;ENST00000455404;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43;0.43;0.43	5.2	5.2	0.72013	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64724	0.2624	L	0.47716	1.5	0.80722	D	1	D;P	0.64830	0.994;0.855	D;B	0.64410	0.925;0.443	T	0.60151	-0.7319	10	0.27082	T	0.32	-20.3835	18.0609	0.89377	0.0:1.0:0.0:0.0	.	432;432	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	V	432;432;363;432;432;432;432	ENSP00000218089:L432V;ENSP00000397265:L432V;ENSP00000346555:L363V;ENSP00000360202:L432V;ENSP00000360199:L432V;ENSP00000360187:L432V;ENSP00000360186:L432V	ENSP00000218089:L432V	L	+	1	0	STAG2	123017756	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.772000	0.85439	2.288000	0.76882	0.544000	0.68410	CTC		0.328	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603		19	40	0	0	0	0.008871	0	19	40				
GPR112	139378	broad.mit.edu	37	X	135429886	135429886	+	Missense_Mutation	SNP	C	C	T			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:135429886C>T	ENST00000394143.1	+	6	4312	c.4021C>T	c.(4021-4023)Cca>Tca	p.P1341S	GPR112_ENST00000370652.1_Missense_Mutation_p.P1341S|GPR112_ENST00000287534.4_Missense_Mutation_p.P1278S|GPR112_ENST00000394141.1_Missense_Mutation_p.P1136S|GPR112_ENST00000412101.1_Missense_Mutation_p.P1136S	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1341					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACAGATTACACCAACCTTGAC	0.473																																							uc004ezu.1		NA																	0				ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(4021-4023)CCA>TCA		G-protein coupled receptor 112							126.0	108.0	114.0					X																	135429886		2203	4300	6503	SO:0001583	missense	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135429886C>T	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.4021C>T	X.37:g.135429886C>T	ENSP00000377699:p.Pro1341Ser					GPR112_uc010nsb.1_Missense_Mutation_p.P1136S|GPR112_uc010nsc.1_Missense_Mutation_p.P1108S	p.P1341S	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN			6	4312	+	Acute lymphoblastic leukemia(192;0.000127)		1341			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	c.4021C>T	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	c	2.584	-0.296815	0.05532	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.29655	1.6;1.6;1.56;1.7;1.56	3.05	-3.24	0.05094	.	.	.	.	.	T	0.11879	0.0289	N	0.17082	0.46	0.09310	N	1	P;P;P	0.46512	0.879;0.642;0.816	B;B;B	0.36885	0.235;0.142;0.132	T	0.12268	-1.0554	9	0.49607	T	0.09	.	0.5952	0.00735	0.1764:0.2675:0.173:0.3831	.	1278;1136;1341	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	S	1341;1341;1136;1278;1136	ENSP00000377699:P1341S;ENSP00000359686:P1341S;ENSP00000416526:P1136S;ENSP00000287534:P1278S;ENSP00000377697:P1136S	ENSP00000287534:P1278S	P	+	1	0	GPR112	135257552	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.849000	0.01672	-0.678000	0.05224	-0.303000	0.09236	CCA		0.473	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			38	45	0	0	0	0.005524	0	38	45				
AFF2	2334	broad.mit.edu	37	X	148037480	148037480	+	Missense_Mutation	SNP	G	G	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:148037480G>C	ENST00000370460.2	+	11	2384	c.1905G>C	c.(1903-1905)gaG>gaC	p.E635D	AFF2_ENST00000342251.3_Missense_Mutation_p.E602D|AFF2_ENST00000286437.5_Missense_Mutation_p.E276D|AFF2_ENST00000370457.5_Missense_Mutation_p.E602D	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	635					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					AAAAAGTTGAGAAGAACACCA	0.423																																							uc004fcp.2		NA																	0				ovary(3)|pancreas(2)	5						c.(1903-1905)GAG>GAC		fragile X mental retardation 2							97.0	104.0	101.0					X																	148037480		2203	4300	6503	SO:0001583	missense	2334				brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding	g.chrX:148037480G>C	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1905G>C	X.37:g.148037480G>C	ENSP00000359489:p.Glu635Asp					AFF2_uc004fcq.2_Missense_Mutation_p.E625D|AFF2_uc004fcr.2_Missense_Mutation_p.E596D|AFF2_uc011mxb.1_Missense_Mutation_p.E600D|AFF2_uc004fcs.2_Missense_Mutation_p.E602D|AFF2_uc011mxc.1_Missense_Mutation_p.E276D	p.E635D	NM_002025	NP_002016	P51816	AFF2_HUMAN			11	2384	+	Acute lymphoblastic leukemia(192;6.56e-05)		635					A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	c.1905G>C	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.748178	0.49257	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	5.5	2.23	0.28157	.	0.053908	0.64402	N	0.000001	T	0.64057	0.2564	M	0.82517	2.595	0.41956	D	0.99068	B;B;B;B;B;B	0.25048	0.117;0.096;0.096;0.096;0.096;0.117	B;B;B;B;B;B	0.31812	0.136;0.083;0.083;0.083;0.083;0.136	T	0.53194	-0.8473	10	0.18276	T	0.48	.	5.7898	0.18353	0.3094:0.1514:0.5392:0.0	.	276;600;602;596;625;635	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	D	635;602;602;276	ENSP00000359489:E635D;ENSP00000359486:E602D;ENSP00000345459:E602D;ENSP00000286437:E276D	ENSP00000286437:E276D	E	+	3	2	AFF2	147845180	1.000000	0.71417	0.992000	0.48379	0.706000	0.40770	1.492000	0.35594	0.478000	0.27488	-0.271000	0.10264	GAG		0.423	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025		34	96	0	0	0	0.012213	0	34	96				
MAGEA4	4103	broad.mit.edu	37	X	151093032	151093032	+	Missense_Mutation	SNP	G	G	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:151093032G>A	ENST00000360243.2	+	3	1163	c.896G>A	c.(895-897)cGc>cAc	p.R299H	MAGEA4_ENST00000393920.1_Missense_Mutation_p.R299H|MAGEA4_ENST00000370335.1_Missense_Mutation_p.R299H|MAGEA4_ENST00000393921.1_Missense_Mutation_p.R299H|MAGEA4_ENST00000370340.3_Missense_Mutation_p.R299H|MAGEA4_ENST00000276344.2_Missense_Mutation_p.R299H|MAGEA4_ENST00000370337.4_Missense_Mutation_p.R299H	NM_001011550.1	NP_001011550.1	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	299	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)	27	Acute lymphoblastic leukemia(192;6.56e-05)					GCAAGAGTTCGCATTGCCTAC	0.572																																							uc004fez.2		NA																	0				ovary(1)|breast(1)|central_nervous_system(1)	3						c.(895-897)CGC>CAC		melanoma antigen family A, 4							116.0	110.0	112.0					X																	151093032		2203	4300	6503	SO:0001583	missense	4103						protein binding	g.chrX:151093032G>A		CCDS14702.1	Xq28	2009-03-13			ENSG00000147381	ENSG00000147381			6802	protein-coding gene	gene with protein product	"""melanoma-associated antigen 4"", ""cancer/testis antigen family 1, member 4"""	300175		MAGE4		8575766	Standard	XM_005274677		Approved	MAGE4A, MAGE4B, MAGE-41, MAGE-X2, MGC21336, CT1.4	uc004ffa.3	P43358	OTTHUMG00000024174	ENST00000360243.2:c.896G>A	X.37:g.151093032G>A	ENSP00000353379:p.Arg299His					MAGEA4_uc004ffa.2_Missense_Mutation_p.R299H|MAGEA4_uc004ffb.2_Missense_Mutation_p.R299H|MAGEA4_uc004ffc.2_Missense_Mutation_p.R299H|MAGEA4_uc004ffd.2_Missense_Mutation_p.R299H	p.R299H	NM_002362	NP_002353	P43358	MAGA4_HUMAN			3	1052	+	Acute lymphoblastic leukemia(192;6.56e-05)		299			MAGE.		Q14798	Missense_Mutation	SNP	ENST00000360243.2	37	c.896G>A	CCDS14702.1	.	.	.	.	.	.	.	.	.	.	G	7.908	0.735853	0.15574	.	.	ENSG00000147381	ENST00000276344;ENST00000393921;ENST00000370337;ENST00000393920;ENST00000370340;ENST00000370335;ENST00000360243	T;T;T;T;T;T;T	0.01572	4.76;4.76;4.76;4.76;4.76;4.76;4.76	2.55	0.691	0.18045	.	0.240065	0.42964	N	0.000630	T	0.01189	0.0039	N	0.17474	0.49	0.09310	N	1	B	0.14805	0.011	B	0.04013	0.001	T	0.49504	-0.8933	9	.	.	.	.	7.91	0.29785	0.0:0.4692:0.5308:0.0	.	299	P43358	MAGA4_HUMAN	H	299	ENSP00000276344:R299H;ENSP00000377498:R299H;ENSP00000359362:R299H;ENSP00000377497:R299H;ENSP00000359365:R299H;ENSP00000359360:R299H;ENSP00000353379:R299H	.	R	+	2	0	MAGEA4	150843688	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	0.316000	0.19469	0.062000	0.16340	0.292000	0.19580	CGC		0.572	MAGEA4-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060898.1	NM_002362		43	103	0	0	0	0.009718	0	43	103				
MAGEA1	4100	broad.mit.edu	37	X	152482539	152482539	+	Missense_Mutation	SNP	C	C	G			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:152482539C>G	ENST00000356661.5	-	3	690	c.472G>C	c.(472-474)Gac>Cac	p.D158H		NM_004988.4	NP_004979.3	P43355	MAGA1_HUMAN	melanoma antigen family A, 1 (directs expression of antigen MZ2-E)	158	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase binding (GO:0042826)			breast(1)|central_nervous_system(7)|kidney(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCCTTCACGTCAATGCCAAAG	0.502																																							uc004fhf.2		NA																	0				central_nervous_system(7)|ovary(1)|lung(1)|breast(1)	10						c.(472-474)GAC>CAC		melanoma antigen family A, 1							128.0	119.0	122.0					X																	152482539		2203	4300	6503	SO:0001583	missense	4100					cytoplasm|plasma membrane		g.chrX:152482539C>G		CCDS76051.1	Xq28	2010-05-26			ENSG00000198681	ENSG00000198681			6796	protein-coding gene	gene with protein product	"""melanoma-associated antigen 1"", ""melanoma-associated antigen MZ2-E"", ""melanoma antigen MAGE-1"", ""melanoma antigen family A 1"", ""cancer/testis antigen family 1, member 1"""	300016		MAGE1		1840703	Standard	NM_004988		Approved	MGC9326, CT1.1	uc004fhf.2	P43355	OTTHUMG00000024192	ENST00000356661.5:c.472G>C	X.37:g.152482539C>G	ENSP00000349085:p.Asp158His						p.D158H	NM_004988	NP_004979	P43355	MAGA1_HUMAN			3	692	-	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		158			MAGE.		B2RC81|O00346	Missense_Mutation	SNP	ENST00000356661.5	37	c.472G>C	CCDS14720.1	.	.	.	.	.	.	.	.	.	.	C	10.04	1.241260	0.22711	.	.	ENSG00000198681	ENST00000356661	T	0.05199	3.48	1.28	0.353	0.16058	.	0.625278	0.17374	N	0.176541	T	0.16769	0.0403	M	0.84326	2.69	0.09310	N	1	D	0.55605	0.972	P	0.59703	0.862	T	0.07462	-1.0771	10	0.72032	D	0.01	.	3.1752	0.06566	0.0:0.6834:0.0:0.3166	.	158	P43355	MAGA1_HUMAN	H	158	ENSP00000349085:D158H	ENSP00000349085:D158H	D	-	1	0	MAGEA1	152135733	0.032000	0.19561	0.046000	0.18839	0.010000	0.07245	0.242000	0.18087	0.049000	0.15920	0.190000	0.17370	GAC		0.502	MAGEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060940.1	NM_004988		38	105	0	0	0	0.005524	0	38	105				
TPRG1L	127262	broad.mit.edu	37	1	3544203	3544204	+	Frame_Shift_Ins	INS	-	-	C			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:3544203_3544204insC	ENST00000378344.2	+	4	681_682	c.610_611insC	c.(610-612)gcafs	p.A204fs	RP11-46F15.2_ENST00000435049.1_RNA|TPRG1L_ENST00000344579.5_Frame_Shift_Ins_p.A145fs	NM_182752.3	NP_877429.2	Q5T0D9	TPRGL_HUMAN	tumor protein p63 regulated 1-like	204						cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(1)	8	all_cancers(77;0.0119)|all_epithelial(69;0.00481)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.41e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.83e-22)|GBM - Glioblastoma multiforme(42;4.77e-14)|Colorectal(212;1.12e-05)|COAD - Colon adenocarcinoma(227;5.61e-05)|Kidney(185;0.000351)|BRCA - Breast invasive adenocarcinoma(365;0.000688)|KIRC - Kidney renal clear cell carcinoma(229;0.00553)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.201)		TGAGAAGACAGCATCTCTGTGT	0.545																																							uc001akm.2		NA																	0					0						c.(610-612)GCAfs		tumor protein p63 regulated 1-like																																				SO:0001589	frameshift_variant	127262					cell junction|synaptic vesicle		g.chr1:3544203_3544204insC	BC019034	CCDS47.1	1p36.32	2008-02-05	2008-01-16	2008-01-16	ENSG00000158109	ENSG00000158109			27007	protein-coding gene	gene with protein product		611460	"""family with sequence similarity 79, member A"""	FAM79A		12477932	Standard	NM_182752		Approved	RP11-46F15.3, FLJ21811	uc001akm.3	Q5T0D9	OTTHUMG00000000609	ENST00000378344.2:c.611dupC	1.37:g.3544204_3544204dupC	ENSP00000367595:p.Ala204fs					TPRG1L_uc009vlj.2_Frame_Shift_Ins_p.A145fs	p.A204fs	NM_182752	NP_877429	Q5T0D9	TPRGL_HUMAN		Epithelial(90;3.41e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.83e-22)|GBM - Glioblastoma multiforme(42;4.77e-14)|Colorectal(212;1.12e-05)|COAD - Colon adenocarcinoma(227;5.61e-05)|Kidney(185;0.000351)|BRCA - Breast invasive adenocarcinoma(365;0.000688)|KIRC - Kidney renal clear cell carcinoma(229;0.00553)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.201)	4	691_692	+	all_cancers(77;0.0119)|all_epithelial(69;0.00481)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)	204					A8K1K4|Q8WV04	Frame_Shift_Ins	INS	ENST00000378344.2	37	c.610_611insC	CCDS47.1																																																																																				0.545	TPRG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001466.1	NM_182752		23	97	NA	NA	NA	NA	NA	23	97	---	---	---	---
EYA3	2140	broad.mit.edu	37	1	28330898	28330898	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:28330898delG	ENST00000373871.3	-	11	1182	c.942delC	c.(940-942)atcfs	p.I316fs	EYA3_ENST00000373863.3_Frame_Shift_Del_p.I270fs|EYA3_ENST00000436342.2_Frame_Shift_Del_p.I190fs|EYA3_ENST00000545175.1_Frame_Shift_Del_p.I263fs|EYA3_ENST00000471498.1_5'UTR|EYA3_ENST00000540618.1_Frame_Shift_Del_p.I270fs|EYA3_ENST00000373864.1_Frame_Shift_Del_p.I159fs	NM_001282561.1|NM_001282562.1	NP_001269490.1|NP_001269491.1	Q99504	EYA3_HUMAN	EYA transcriptional coactivator and phosphatase 3	316					anatomical structure morphogenesis (GO:0009653)|double-strand break repair (GO:0006302)|histone dephosphorylation (GO:0016576)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of DNA repair (GO:0045739)|regulation of transcription, DNA-templated (GO:0006355)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)		GGAAGATGATGATGGTTTCAT	0.353																																							uc001bpi.1		NA																	0				ovary(2)|skin(1)	3						c.(940-942)ATCfs		eyes absent 3							101.0	98.0	99.0					1																	28330898		2203	4300	6503	SO:0001589	frameshift_variant	2140				anatomical structure morphogenesis|double-strand break repair|histone dephosphorylation|multicellular organismal development|positive regulation of DNA repair|regulation of transcription, DNA-dependent|response to ionizing radiation|transcription, DNA-dependent|visual perception	cytoplasm	metal ion binding|protein binding|protein tyrosine phosphatase activity	g.chr1:28330898delG	U81602	CCDS316.1, CCDS60050.1, CCDS60051.1, CCDS60052.1	1p36	2014-06-19	2014-06-19		ENSG00000158161	ENSG00000158161		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3521	protein-coding gene	gene with protein product		601655	"""eyes absent (Drosophila) homolog 3"", ""eyes absent homolog 3 (Drosophila)"""			9020840	Standard	NM_001990		Approved	DKFZp686C132	uc001bpi.2	Q99504	OTTHUMG00000003916	ENST00000373871.3:c.942delC	1.37:g.28330898delG	ENSP00000362978:p.Ile316fs					EYA3_uc010ofs.1_Frame_Shift_Del_p.I261fs|EYA3_uc010oft.1_Frame_Shift_Del_p.I268fs|EYA3_uc001bpj.2_Frame_Shift_Del_p.I268fs|EYA3_uc001bpk.1_RNA|EYA3_uc010ofu.1_RNA	p.I314fs	NM_001990	NP_001981	Q99504	EYA3_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)	11	1107	-		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)	314					A8K190|B4DIR7|B4DNZ7|O95463|Q8IVX7|Q99813	Frame_Shift_Del	DEL	ENST00000373871.3	37	c.942delC	CCDS316.1																																																																																				0.353	EYA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011184.1	NM_001990		16	84	NA	NA	NA	NA	NA	16	84	---	---	---	---
JUN	3725	broad.mit.edu	37	1	59247894	59247894	+	Frame_Shift_Del	DEL	T	T	-			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:59247894delT	ENST00000371222.2	-	1	1891	c.849delA	c.(847-849)aaafs	p.K283fs	RP4-794H19.2_ENST00000419531.2_lincRNA	NM_002228.3	NP_002219.1	P05412	JUN_HUMAN	jun proto-oncogene	283	Leucine-zipper. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				aging (GO:0007568)|angiogenesis (GO:0001525)|axon regeneration (GO:0031103)|cellular response to calcium ion (GO:0071277)|cellular response to potassium ion starvation (GO:0051365)|circadian rhythm (GO:0007623)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leading edge cell differentiation (GO:0035026)|learning (GO:0007612)|liver development (GO:0001889)|membrane depolarization (GO:0051899)|microglial cell activation (GO:0001774)|monocyte differentiation (GO:0030224)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA binding (GO:0043392)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990441)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|SMAD protein import into nucleus (GO:0007184)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nuclear chromosome (GO:0000228)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|R-SMAD binding (GO:0070412)|Rho GTPase activator activity (GO:0005100)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|kidney(2)|lung(5)|skin(1)	10	all_cancers(7;8.55e-07)				Arsenic trioxide(DB01169)|Irbesartan(DB01029)|Pseudoephedrine(DB00852)|Vinblastine(DB00570)	AGGTTTTCACTTTTTCCTCCA	0.547			A		sarcoma						OREG0013518	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001cze.2		NA		Dom	yes		1	1p32-p31	3725	A	jun oncogene			M			sarcoma		0					0						c.(847-849)AAAfs		jun oncogene	Arsenic trioxide(DB01169)|Irbesartan(DB01029)|Vinblastine(DB00570)						109.0	108.0	109.0					1																	59247894		2203	4300	6503	SO:0001589	frameshift_variant	3725				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation by host of viral transcription|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|SMAD protein import into nucleus|SMAD protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway		R-SMAD binding|Rho GTPase activator activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription coactivator activity|transcription factor binding|transcription regulatory region DNA binding	g.chr1:59247894delT	AY217548	CCDS610.1	1p32-p31	2013-01-10	2010-08-27		ENSG00000177606	ENSG00000177606		"""basic leucine zipper proteins"""	6204	protein-coding gene	gene with protein product		165160	"""v-jun avian sarcoma virus 17 oncogene homolog"", ""v-jun sarcoma virus 17 oncogene homolog (avian)"", ""jun oncogene"""			3194415	Standard	NM_002228		Approved	c-Jun, AP-1	uc001cze.3	P05412	OTTHUMG00000008376	ENST00000371222.2:c.849delA	1.37:g.59247894delT	ENSP00000360266:p.Lys283fs		OREG0013518	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1037	uc001czf.2_5'Flank|uc010oop.1_5'Flank	p.K283fs	NM_002228	NP_002219	P05412	JUN_HUMAN			1	1892	-	all_cancers(7;8.55e-07)		283			Leucine-zipper.		Q6FHM7|Q96G93	Frame_Shift_Del	DEL	ENST00000371222.2	37	c.849delA	CCDS610.1																																																																																				0.547	JUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023042.1	NM_002228		43	75	NA	NA	NA	NA	NA	43	75	---	---	---	---
C1orf116	79098	broad.mit.edu	37	1	207198231	207198231	+	Splice_Site	DEL	C	C	-			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:207198231delC	ENST00000359470.5	-	3	533		c.e3+1		C1orf116_ENST00000461135.2_Splice_Site	NM_023938.5	NP_076427.2	Q9BW04	SARG_HUMAN	chromosome 1 open reading frame 116							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(4)|stomach(1)	29	Prostate(682;0.19)					GTCTGCCTTACCCCGGGGAGT	0.602																																							uc001hfd.2		NA																	0				skin(2)|ovary(1)|central_nervous_system(1)	4						c.e3+1		specifically androgen-regulated protein isoform							83.0	91.0	88.0					1																	207198231		2203	4300	6503	SO:0001630	splice_region_variant	79098					cytoplasm|plasma membrane	receptor activity	g.chr1:207198231delC		CCDS1475.1, CCDS44306.1	1q32.1	2012-06-26			ENSG00000182795	ENSG00000182795			28667	protein-coding gene	gene with protein product	"""specifically androgen-regulated gene"""	611680				15525603, 9389513	Standard	NM_023938		Approved	SARG, FLJ36507, MGC2742, MGC4309	uc001hfd.2	Q9BW04	OTTHUMG00000036580	ENST00000359470.5:c.283+1G>-	1.37:g.207198231delC						C1orf116_uc009xcb.1_Splice_Site	p.G95_splice	NM_023938	NP_076427	Q9BW04	SARG_HUMAN			3	542	-	Prostate(682;0.19)							C9JV41|Q658X3	Splice_Site	DEL	ENST00000359470.5	37	c.283_splice	CCDS1475.1																																																																																				0.602	C1orf116-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088973.1	NM_024115	Intron	35	105	NA	NA	NA	NA	NA	35	105	---	---	---	---
HIST3H3	8290	broad.mit.edu	37	1	228612837	228612837	+	Frame_Shift_Del	DEL	G	G	-	rs201294185	byFrequency	TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr1:228612837delG	ENST00000366696.1	-	1	189	c.190delC	c.(190-192)cgcfs	p.R64fs		NM_003493.2	NP_003484.1	Q16695	H31T_HUMAN	histone cluster 3, H3	64					telomere maintenance (GO:0000723)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(1)|lung(2)|prostate(2)|skin(1)	6		Prostate(94;0.0724)				GGCAACTTGCGGATTAGCAGC	0.657																																							uc001hsx.1		NA																	0					0						c.(190-192)CGCfs		histone cluster 3, H3							85.0	88.0	87.0					1																	228612837		2203	4300	6503	SO:0001589	frameshift_variant	8290				nucleosome assembly|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr1:228612837delG	Z49861	CCDS1572.1	1q42.13	2012-09-19	2006-10-11	2003-02-21	ENSG00000168148	ENSG00000168148		"""Histones / Replication-dependent"""	4778	protein-coding gene	gene with protein product		602820	"""H3 histone family, member T"", ""histone 3, H3"""	H3FT		8834248, 12408966	Standard	NM_003493		Approved	H3t, H3/g, H3.4	uc001hsx.1	Q16695	OTTHUMG00000040044	ENST00000366696.1:c.190delC	1.37:g.228612837delG	ENSP00000355657:p.Arg64fs						p.R64fs	NM_003493	NP_003484	Q16695	H31T_HUMAN			1	190	-		Prostate(94;0.0724)	64					B2R5K3|Q6FGU4	Frame_Shift_Del	DEL	ENST00000366696.1	37	c.190delC	CCDS1572.1																																																																																				0.657	HIST3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096595.2	NM_003493		8	183	NA	NA	NA	NA	NA	8	183	---	---	---	---
RGR	5995	broad.mit.edu	37	10	86017689	86017689	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr10:86017689delG	ENST00000359452.4	+	6	721	c.683delG	c.(682-684)tggfs	p.W228fs	RGR_ENST00000358110.5_Intron|RGR_ENST00000479725.1_3'UTR	NM_001012720.1|NM_002921.3	NP_001012738.1|NP_002912.2	P47804	RGR_HUMAN	retinal G protein coupled receptor	224					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	17						CTGCTCGGCTGGGGCCCCTAT	0.537																																					NSCLC(15;204 545 5889 6385 32445)	NSCLC(15;204 545 5889 6385 32445)	uc001kdc.1		NA																	0				ovary(1)	1						c.(670-672)TGGfs		retinal G-protein coupled receptor isoform 2							84.0	76.0	79.0					10																	86017689		2203	4300	6503	SO:0001589	frameshift_variant	5995				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity|protein binding	g.chr10:86017689delG	BC011349	CCDS7374.1, CCDS41543.1	10q23	2013-02-14			ENSG00000148604	ENSG00000148604		"""GPCR / Class A : Opsin receptors"""	9990	protein-coding gene	gene with protein product	"""RGR-opsin"""	600342				8641686	Standard	NM_002921		Approved	RP44	uc001kdd.1	P47804	OTTHUMG00000018636	ENST00000359452.4:c.683delG	10.37:g.86017689delG	ENSP00000352427:p.Trp228fs					RGR_uc001kdd.1_Frame_Shift_Del_p.W228fs|RGR_uc001kde.1_Intron	p.W224fs	NM_001012720	NP_001012738	P47804	RGR_HUMAN			6	709	+			224			Helical; Name=6; (Potential).		A6NKK7|Q96FC5	Frame_Shift_Del	DEL	ENST00000359452.4	37	c.671delG	CCDS7374.1																																																																																				0.537	RGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049116.1	NM_002921		12	61	NA	NA	NA	NA	NA	12	61	---	---	---	---
ATM	472	broad.mit.edu	37	11	108143265	108143265	+	Frame_Shift_Del	DEL	A	A	-			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr11:108143265delA	ENST00000452508.2	+	22	3273	c.3084delA	c.(3082-3084)ctafs	p.L1028fs	ATM_ENST00000278616.4_Frame_Shift_Del_p.L1028fs			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1028					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TCAGGCATCTAACAAAGGAGA	0.313			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													uc001pkb.1		NA	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	D|Mis|N|F|S	ataxia telangiectasia mutated			"""L, O"""		leukemia|lymphoma|medulloblastoma|glioma	T-PLL		0				haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240						c.(3082-3084)CTAfs	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	ataxia telangiectasia mutated isoform 1							91.0	95.0	93.0					11																	108143265		2201	4297	6498	SO:0001589	frameshift_variant	472	Ataxia_Telangiectasia	Familial Cancer Database	AT, Louis-Bar syndrome	cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding	g.chr11:108143265delA	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.3084delA	11.37:g.108143265delA	ENSP00000388058:p.Leu1028fs	TSP Lung(14;0.12)				ATM_uc009yxr.1_Frame_Shift_Del_p.L1028fs	p.L1028fs	NM_000051	NP_000042	Q13315	ATM_HUMAN		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	21	3469	+		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	1028					B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Frame_Shift_Del	DEL	ENST00000452508.2	37	c.3084delA	CCDS31669.1																																																																																				0.313	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051		59	33	NA	NA	NA	NA	NA	59	33	---	---	---	---
MYH7	4625	broad.mit.edu	37	14	23889251	23889251	+	Frame_Shift_Del	DEL	C	C	-			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:23889251delC	ENST00000355349.3	-	27	3691	c.3529delG	c.(3529-3531)gacfs	p.D1177fs	MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1177					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TCCTCCAGGTCCCGCCGCATC	0.682																																							uc001wjx.2		NA																	0				ovary(3)|skin(1)	4						c.(3529-3531)GACfs		myosin, heavy chain 7, cardiac muscle, beta							6.0	7.0	7.0					14																	23889251		1994	3915	5909	SO:0001589	frameshift_variant	4625				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr14:23889251delC	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.3529delG	14.37:g.23889251delC	ENSP00000347507:p.Asp1177fs					MIR208B_hsa-mir-208b|MI0005570_5'Flank	p.D1177fs	NM_000257	NP_000248	P12883	MYH7_HUMAN		GBM - Glioblastoma multiforme(265;0.00725)	27	3635	-	all_cancers(95;2.54e-05)		1177			Potential.		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Frame_Shift_Del	DEL	ENST00000355349.3	37	c.3529delG	CCDS9601.1																																																																																				0.682	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257		9	3	NA	NA	NA	NA	NA	9	3	---	---	---	---
SERPINA1	5265	broad.mit.edu	37	14	94849053	94849053	+	Frame_Shift_Del	DEL	G	G	-	rs72552402	byFrequency	TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr14:94849053delG	ENST00000448921.1	-	4	1094	c.522delC	c.(520-522)accfs	p.T174fs	SERPINA1_ENST00000440909.1_Frame_Shift_Del_p.T174fs|SERPINA1_ENST00000355814.4_Frame_Shift_Del_p.T174fs|SERPINA1_ENST00000404814.4_Frame_Shift_Del_p.T174fs|SERPINA1_ENST00000449399.3_Frame_Shift_Del_p.T174fs|SERPINA1_ENST00000402629.1_Frame_Shift_Del_p.T174fs|SERPINA1_ENST00000555289.1_5'Flank|SERPINA1_ENST00000393087.4_Frame_Shift_Del_p.T174fs|SERPINA1_ENST00000393088.4_Frame_Shift_Del_p.T174fs|SERPINA1_ENST00000437397.1_Frame_Shift_Del_p.T174fs	NM_001002236.2|NM_001127701.1|NM_001127703.1|NM_001127704.1|NM_001127705.1	NP_001002236.1|NP_001121173.1|NP_001121175.1|NP_001121176.1|NP_001121177.1	P01009	A1AT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1	174				T -> H (in Ref. 4; AAA51546). {ECO:0000305}.	acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of proteolysis (GO:0030162)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|skin(6)|stomach(1)	24		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		TGGCCTCTTCGGTGTCCCCGA	0.473																																							uc001ycx.3		NA																	0				skin(1)	1						c.(520-522)ACCfs		serine proteinase inhibitor, clade A, member 1	Alpha-1-proteinase inhibitor(DB00058)						127.0	129.0	128.0					14																	94849053		2203	4300	6503	SO:0001589	frameshift_variant	5265	Alpha-1-Antitrypsin_Deficiency			acute-phase response|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen|proteinaceous extracellular matrix	protease binding|serine-type endopeptidase inhibitor activity	g.chr14:94849053delG	X01683	CCDS9925.1	14q32.1	2014-02-18	2005-08-18		ENSG00000197249	ENSG00000197249		"""Serine (or cysteine) peptidase inhibitors"""	8941	protein-coding gene	gene with protein product	"""protease inhibitor 1 (anti-elastase), alpha-1-antitrypsin"""	107400	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1"""	PI		24172014	Standard	NM_000295		Approved	AAT, A1A, PI1, alpha-1-antitrypsin, A1AT, alpha1AT	uc010aux.3	P01009	OTTHUMG00000150355	ENST00000448921.1:c.522delC	14.37:g.94849053delG	ENSP00000416066:p.Thr174fs					SERPINA1_uc001ycw.3_RNA|SERPINA1_uc010auw.2_Frame_Shift_Del_p.T174fs|SERPINA1_uc010aux.2_Frame_Shift_Del_p.T174fs|SERPINA1_uc001ycy.3_Frame_Shift_Del_p.T174fs|SERPINA1_uc010auy.2_Frame_Shift_Del_p.T174fs|SERPINA1_uc001ycz.3_Frame_Shift_Del_p.T174fs|SERPINA1_uc010auz.2_Frame_Shift_Del_p.T174fs|SERPINA1_uc010ava.2_Frame_Shift_Del_p.T174fs|SERPINA1_uc001ydb.3_Frame_Shift_Del_p.T174fs|SERPINA1_uc010avb.2_Frame_Shift_Del_p.T174fs|SERPINA1_uc001ydc.3_Frame_Shift_Del_p.T174fs|SERPINA1_uc001yda.1_Frame_Shift_Del_p.T174fs	p.T174fs	NM_000295	NP_000286	P01009	A1AT_HUMAN		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)	2	783	-		all_cancers(154;0.0649)|all_epithelial(191;0.223)	174	T -> H (in Ref. 4; AAA51546).				A6PX14|B2RDQ8|Q0PVP5|Q13672|Q53XB8|Q5U0M1|Q7M4R2|Q86U18|Q86U19|Q96BF9|Q96ES1|Q9P1P0|Q9UCE6|Q9UCM3	Frame_Shift_Del	DEL	ENST00000448921.1	37	c.522delC	CCDS9925.1																																																																																				0.473	SERPINA1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317768.2	NM_001002235		89	46	NA	NA	NA	NA	NA	89	46	---	---	---	---
ULK2	9706	broad.mit.edu	37	17	19705093	19705107	+	In_Frame_Del	DEL	AAGGGGAAGGTGAGT	AAGGGGAAGGTGAGT	-	rs201796490		TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	AAGGGGAAGGTGAGT	AAGGGGAAGGTGAGT	-	-	AAGGGGAAGGTGAGT	AAGGGGAAGGTGAGT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr17:19705093_19705107delAAGGGGAAGGTGAGT	ENST00000395544.4	-	16	1923_1937	c.1424_1438delACTCACCTTCCCCTT	c.(1423-1440)tactcaccttcccctttg>ttg	p.YSPSP475del	ULK2_ENST00000361658.2_In_Frame_Del_p.YSPSP475del|ULK2_ENST00000580130.1_5'UTR	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	475					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					TACTTACCCAAAGGGGAAGGTGAGTAAGGCCTAGA	0.479																																							uc002gwm.3		NA																	0				skin(2)|large_intestine(1)|stomach(1)	4						c.(1423-1440)TACTCACCTTCCCCTTTG>TTG		unc-51-like kinase 2																																				SO:0001651	inframe_deletion	9706				signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity	g.chr17:19705093_19705107delAAGGGGAAGGTGAGT	AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.1424_1438delACTCACCTTCCCCTT	17.37:g.19705093_19705107delAAGGGGAAGGTGAGT	ENSP00000378914:p.Tyr475_Pro479del					ULK2_uc002gwn.2_In_Frame_Del_p.YSPSP475del	p.YSPSP475del	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN			16	1933_1947	-	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)		475_479					A8MY69|O75119	In_Frame_Del	DEL	ENST00000395544.4	37	c.1424_1438delACTCACCTTCCCCTT	CCDS11213.1																																																																																				0.479	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683		41	103	NA	NA	NA	NA	NA	41	103	---	---	---	---
REXO1	57455	broad.mit.edu	37	19	1827408	1827409	+	Frame_Shift_Ins	INS	-	-	A			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chr19:1827408_1827409insA	ENST00000170168.4	-	2	1473_1474	c.1379_1380insT	c.(1378-1380)cccfs	p.P460fs	REXO1_ENST00000587524.1_5'Flank|CTB-31O20.4_ENST00000587741.1_RNA|CTB-31O20.4_ENST00000593201.1_RNA	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	460						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCCGCTTGTGGGGCTCGGCCG	0.723																																							uc002lua.3		NA																	0					0						c.(1378-1380)CCCfs		transcription elongation factor B polypeptide 3																																				SO:0001589	frameshift_variant	57455					nucleus	exonuclease activity|nucleic acid binding	g.chr19:1827408_1827409insA	AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.1379_1380insT	19.37:g.1827408_1827409insA	ENSP00000170168:p.Pro460fs					REXO1_uc010dsr.1_Frame_Shift_Ins_p.P414fs	p.P460fs	NM_020695	NP_065746	Q8N1G1	REXO1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	2	1474_1475	-		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)	460					Q9ULT2	Frame_Shift_Ins	INS	ENST00000170168.4	37	c.1379_1380insT	CCDS32866.1																																																																																				0.723	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449200.1	NM_020695		4	4	NA	NA	NA	NA	NA	4	4	---	---	---	---
GPR112	139378	broad.mit.edu	37	X	135432460	135432460	+	Frame_Shift_Del	DEL	G	G	-			TCGA-78-7539-01A-11D-2063-08	TCGA-78-7539-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	eda8bdf1-626a-417c-8c57-998b4a79872e	7385c065-1d06-4525-b66b-cdcecedcb6b9	g.chrX:135432460delG	ENST00000394143.1	+	6	6886	c.6595delG	c.(6595-6597)gggfs	p.G2199fs	GPR112_ENST00000370652.1_Frame_Shift_Del_p.G2199fs|GPR112_ENST00000287534.4_Frame_Shift_Del_p.G2136fs|GPR112_ENST00000394141.1_Frame_Shift_Del_p.G1994fs|GPR112_ENST00000412101.1_Frame_Shift_Del_p.G1994fs	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2199					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CATATCCACTGGGGTGACATA	0.428																																							uc004ezu.1		NA																	0				ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(6595-6597)GGGfs		G-protein coupled receptor 112							198.0	166.0	177.0					X																	135432460		2203	4300	6503	SO:0001589	frameshift_variant	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135432460delG	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.6595delG	X.37:g.135432460delG	ENSP00000377699:p.Gly2199fs					GPR112_uc010nsb.1_Frame_Shift_Del_p.G1994fs|GPR112_uc010nsc.1_Frame_Shift_Del_p.G1966fs	p.G2199fs	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN			6	6886	+	Acute lymphoblastic leukemia(192;0.000127)		2199			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Frame_Shift_Del	DEL	ENST00000394143.1	37	c.6595delG	CCDS35409.1																																																																																				0.428	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			60	58	NA	NA	NA	NA	NA	60	58	---	---	---	---
