#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
EXOSC10	5394	broad.mit.edu	37	1	11142751	11142751	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr1:11142751C>G	ENST00000376936.4	-	10	1323	c.1274G>C	c.(1273-1275)aGa>aCa	p.R425T	EXOSC10_ENST00000485606.1_5'Flank|EXOSC10_ENST00000304457.7_Missense_Mutation_p.R425T|EXOSC10_ENST00000544779.1_Missense_Mutation_p.R425T	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10	425					CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		TGACCGTATTCTCCAATCAGC	0.488																																					Colon(179;105 1987 14326 27364 29542)	Colon(179;105 1987 14326 27364 29542)	uc001asa.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(1273-1275)AGA>ACA		exosome component 10 isoform 1							169.0	156.0	160.0					1																	11142751		2203	4300	6503	SO:0001583	missense	5394				CUT catabolic process|histone mRNA catabolic process|maturation of 5.8S rRNA|nuclear polyadenylation-dependent rRNA catabolic process|nuclear retention of unspliced pre-mRNA at the site of transcription|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasm|nuclear exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5' exonuclease activity|exoribonuclease activity|identical protein binding|nucleotide binding|protein serine/threonine kinase activity|RNA binding	g.chr1:11142751C>G	BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.1274G>C	1.37:g.11142751C>G	ENSP00000366135:p.Arg425Thr					EXOSC10_uc001asb.2_Missense_Mutation_p.R425T|EXOSC10_uc009vmy.1_Missense_Mutation_p.R425T	p.R425T	NM_001001998	NP_001001998	Q01780	EXOSX_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)	10	1324	-	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	425					B1AKQ0|B1AKQ1|Q15158	Missense_Mutation	SNP	ENST00000376936.4	37	c.1274G>C	CCDS30584.1	.	.	.	.	.	.	.	.	.	.	C	31	5.098851	0.94197	.	.	ENSG00000171824	ENST00000376936;ENST00000304457;ENST00000544779	T;T;T	0.64260	-0.09;-0.09;-0.09	5.96	5.96	0.96718	-5&apos (2);Ribonuclease H-like (1); exonuclease (2);3&apos (2);	0.000000	0.85682	D	0.000000	T	0.82024	0.4947	M	0.83692	2.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.83202	-0.0078	10	0.72032	D	0.01	-26.4625	19.3889	0.94570	0.0:1.0:0.0:0.0	.	425;425	Q01780-2;Q01780	.;EXOSX_HUMAN	T	425	ENSP00000366135:R425T;ENSP00000307307:R425T;ENSP00000439473:R425T	ENSP00000307307:R425T	R	-	2	0	EXOSC10	11065338	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.818000	0.86416	2.826000	0.97356	0.655000	0.94253	AGA		0.488	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006078.1	NM_001001998		13	114	0	0	0	0.00499	0	13	114				
EPHA8	2046	broad.mit.edu	37	1	22927936	22927936	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr1:22927936C>G	ENST00000166244.3	+	16	2945	c.2873C>G	c.(2872-2874)tCt>tGt	p.S958C		NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	958	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GGATACTCCTCTCTGGGCATG	0.716																																							uc001bfx.1		NA																	0				central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13						c.(2872-2874)TCT>TGT		ephrin receptor EphA8 isoform 1 precursor							36.0	42.0	40.0					1																	22927936		2203	4295	6498	SO:0001583	missense	2046					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr1:22927936C>G	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.2873C>G	1.37:g.22927936C>G	ENSP00000166244:p.Ser958Cys						p.S958C	NM_020526	NP_065387	P29322	EPHA8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)	16	2998	+		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)	958			Cytoplasmic (Potential).|SAM.		Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	ENST00000166244.3	37	c.2873C>G	CCDS225.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.254166	0.80135	.	.	ENSG00000070886	ENST00000166244	T	0.56275	0.47	5.23	5.23	0.72850	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.067780	0.64402	D	0.000012	T	0.75576	0.3868	M	0.88979	2.995	0.80722	D	1	D	0.76494	0.999	D	0.65323	0.934	T	0.80553	-0.1331	10	0.87932	D	0	.	16.319	0.82939	0.0:1.0:0.0:0.0	.	958	P29322	EPHA8_HUMAN	C	958	ENSP00000166244:S958C	ENSP00000166244:S958C	S	+	2	0	EPHA8	22800523	0.914000	0.31030	0.978000	0.43139	0.957000	0.61999	3.848000	0.55903	2.722000	0.93159	0.491000	0.48974	TCT		0.716	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526		18	48	0	0	0	0.007413	0	18	48				
PAQR7	164091	broad.mit.edu	37	1	26189836	26189836	+	Silent	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr1:26189836G>A	ENST00000374296.3	-	2	1161	c.495C>T	c.(493-495)gcC>gcT	p.A165A	RP1-125I3.2_ENST00000455431.1_RNA	NM_178422.5	NP_848509.1	Q86WK9	MPRA_HUMAN	progestin and adipoQ receptor family member VII	165					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|response to steroid hormone (GO:0048545)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)			breast(3)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.16e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000724)|BRCA - Breast invasive adenocarcinoma(304;0.000965)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0136)|READ - Rectum adenocarcinoma(331;0.0649)		GGGCATGCCAGGCGGGCTCGA	0.542																																					Esophageal Squamous(111;1206 1556 18433 19151 38418)	Esophageal Squamous(111;1206 1556 18433 19151 38418)	uc001bkx.2		NA																	0				breast(3)	3						c.(493-495)GCC>GCT		progestin and adipoQ receptor family member VII							84.0	91.0	89.0					1																	26189836		2203	4300	6503	SO:0001819	synonymous_variant	164091				cell differentiation|multicellular organismal development|oogenesis	integral to membrane|plasma membrane	receptor activity|steroid binding	g.chr1:26189836G>A		CCDS267.1	1p35.3	2012-08-10			ENSG00000182749	ENSG00000182749			23146	protein-coding gene	gene with protein product	"""membrane progestin receptor alpha"""	607779					Standard	NM_178422		Approved	mSR, MPRA	uc001bkx.3	Q86WK9	OTTHUMG00000007373	ENST00000374296.3:c.495C>T	1.37:g.26189836G>A							p.A165A	NM_178422	NP_848509	Q86WK9	MPRA_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.16e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000724)|BRCA - Breast invasive adenocarcinoma(304;0.000965)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0136)|READ - Rectum adenocarcinoma(331;0.0649)	2	1162	-		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)	165			Extracellular (Potential).		A2A2D3|Q5XKF9|Q86VE4	Silent	SNP	ENST00000374296.3	37	c.495C>T	CCDS267.1																																																																																				0.542	PAQR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019312.1	NM_178422		27	79	0	0	0	0.00632	0	27	79				
TARS2	80222	broad.mit.edu	37	1	150479448	150479448	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr1:150479448C>T	ENST00000369064.3	+	18	2099	c.2065C>T	c.(2065-2067)Cgt>Tgt	p.R689C	TARS2_ENST00000606933.1_Missense_Mutation_p.R607C|ECM1_ENST00000369049.4_5'Flank|TARS2_ENST00000369054.2_Missense_Mutation_p.R559C|ECM1_ENST00000346569.6_5'Flank|ECM1_ENST00000369047.4_5'Flank	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	689					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	TCGAGATAATCGTCGCCTTGG	0.517																																							uc001euq.2		NA																	0				ovary(1)	1						c.(2065-2067)CGT>TGT		threonyl-tRNA synthetase 2, mitochondrial	L-Threonine(DB00156)						114.0	106.0	109.0					1																	150479448		2203	4300	6503	SO:0001583	missense	80222				threonyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|threonine-tRNA ligase activity	g.chr1:150479448C>T	BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.2065C>T	1.37:g.150479448C>T	ENSP00000358060:p.Arg689Cys					TARS2_uc001eur.2_Missense_Mutation_p.R607C|TARS2_uc009wlt.2_Missense_Mutation_p.R315C|TARS2_uc009wls.2_Missense_Mutation_p.R559C|ECM1_uc010pce.1_5'Flank|ECM1_uc010pcf.1_5'Flank|ECM1_uc001eus.2_5'Flank|ECM1_uc001eut.2_5'Flank|ECM1_uc001euu.2_5'Flank|ECM1_uc001euv.2_5'Flank|ECM1_uc009wlu.2_5'Flank	p.R689C	NM_025150	NP_079426	Q9BW92	SYTM_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		18	2072	+	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		689					Q53GW7|Q96I50|Q9H9V2	Missense_Mutation	SNP	ENST00000369064.3	37	c.2065C>T	CCDS952.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.172196	0.57584	.	.	ENSG00000143374	ENST00000369054;ENST00000369064;ENST00000369051;ENST00000369052	D;D;D	0.84223	-1.82;-1.82;-1.82	5.26	2.23	0.28157	Anticodon-binding (3);	0.749846	0.13128	N	0.411686	D	0.83737	0.5319	M	0.69823	2.125	0.09310	N	0.999998	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.66847	0.947;0.939;0.863	T	0.73036	-0.4109	10	0.72032	D	0.01	-23.1926	3.208	0.06672	0.1402:0.5684:0.1361:0.1553	.	559;414;689	Q9H9V2;E7EVR9;Q9BW92	.;.;SYTM_HUMAN	C	559;689;414;414	ENSP00000358050:R559C;ENSP00000358060:R689C;ENSP00000358047:R414C	ENSP00000358047:R414C	R	+	1	0	TARS2	148746072	0.003000	0.15002	0.002000	0.10522	0.064000	0.16182	1.981000	0.40628	0.785000	0.33685	0.655000	0.94253	CGT		0.517	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035847.1	NM_025150		24	35	0	0	0	0.01892	0	24	35				
NPR1	4881	broad.mit.edu	37	1	153661467	153661467	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr1:153661467G>A	ENST00000368680.3	+	16	2928	c.2456G>A	c.(2455-2457)cGc>cAc	p.R819H		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	819					body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	CTGCTGTCCCGCATGGAGCAG	0.627																																					Pancreas(141;1349 1870 15144 15830 40702)	Pancreas(141;1349 1870 15144 15830 40702)	uc001fcs.3		NA																	0				ovary(3)|lung(2)|stomach(1)|breast(1)	7						c.(2455-2457)CGC>CAC		natriuretic peptide receptor 1 precursor	Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Nesiritide(DB04899)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)						129.0	114.0	119.0					1																	153661467		2203	4300	6503	SO:0001583	missense	4881				body fluid secretion|intracellular signal transduction|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation		ATP binding|GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|peptide receptor activity, G-protein coupled|protein kinase activity	g.chr1:153661467G>A	BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.2456G>A	1.37:g.153661467G>A	ENSP00000357669:p.Arg819His					NPR1_uc010pdz.1_Missense_Mutation_p.R565H|NPR1_uc010pea.1_Missense_Mutation_p.R297H	p.R819H	NM_000906	NP_000897	P16066	ANPRA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)		16	2877	+	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		819			Cytoplasmic (Potential).		B0ZBF0|Q5SR08|Q6P4Q3	Missense_Mutation	SNP	ENST00000368680.3	37	c.2456G>A	CCDS1051.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.107454	0.77096	.	.	ENSG00000169418	ENST00000368680;ENST00000428723	T	0.62498	0.02	3.35	3.35	0.38373	Protein kinase-like domain (1);	0.221107	0.37483	N	0.002064	T	0.79070	0.4384	M	0.92507	3.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.972	D	0.83584	0.0119	10	0.66056	D	0.02	.	12.9982	0.58660	0.0:0.0:1.0:0.0	.	298;819	B7Z4Y7;P16066	.;ANPRA_HUMAN	H	819;298	ENSP00000357669:R819H	ENSP00000357669:R819H	R	+	2	0	NPR1	151928091	1.000000	0.71417	0.998000	0.56505	0.604000	0.37047	9.509000	0.98002	2.170000	0.68504	0.455000	0.32223	CGC		0.627	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090034.1	NM_000906		4	159	0	0	0	0.009096	0	4	159				
BCAN	63827	broad.mit.edu	37	1	156627540	156627540	+	Silent	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr1:156627540C>G	ENST00000329117.5	+	11	2619	c.2283C>G	c.(2281-2283)ggC>ggG	p.G761G	RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	761	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGTCGGATGGCGTCCCCCTGG	0.632											OREG0013880	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001fpp.2		NA																	0				ovary(1)|pancreas(1)	2						c.(2281-2283)GGC>GGG		brevican isoform 1							85.0	69.0	75.0					1																	156627540		2203	4300	6503	SO:0001819	synonymous_variant	63827				cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding	g.chr1:156627540C>G	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.2283C>G	1.37:g.156627540C>G			OREG0013880	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1779		p.G761G	NM_021948	NP_068767	Q96GW7	PGCB_HUMAN			11	2619	+	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		761			C-type lectin.		D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Silent	SNP	ENST00000329117.5	37	c.2283C>G	CCDS1149.1																																																																																				0.632	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948		5	30	0	0	0	0.001168	0	5	30				
TAGLN2	8407	broad.mit.edu	37	1	159890245	159890245	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr1:159890245C>G	ENST00000368097.4	-	2	365	c.55G>C	c.(55-57)Gag>Cag	p.E19Q	TAGLN2_ENST00000478033.1_5'UTR|TAGLN2_ENST00000368096.1_Missense_Mutation_p.E40Q|TAGLN2_ENST00000320307.4_Missense_Mutation_p.E19Q	NM_001277223.1|NM_003564.1	NP_001264152.1|NP_003555.1	P37802	TAGL2_HUMAN	transgelin 2	19					epithelial cell differentiation (GO:0030855)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)				endometrium(1)|large_intestine(2)|lung(6)	9	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TATTGTTTCTCAATCTTCTGC	0.597																																							uc001fum.1		NA																	0					0						c.(55-57)GAG>CAG		transgelin 2							46.0	42.0	43.0					1																	159890245		2203	4300	6503	SO:0001583	missense	8407				muscle organ development	nuclear membrane|plasma membrane	protein binding	g.chr1:159890245C>G	D21261	CCDS1189.1, CCDS60314.1	1q21-q25	2008-07-18			ENSG00000158710	ENSG00000158710			11554	protein-coding gene	gene with protein product	"""SM22-alpha homolog"""	604634				9693045	Standard	NM_001277223		Approved	KIAA0120, HA1756	uc031pqu.1	P37802	OTTHUMG00000022793	ENST00000368097.4:c.55G>C	1.37:g.159890245C>G	ENSP00000357077:p.Glu19Gln					CCDC19_uc001ful.2_Intron|TAGLN2_uc001fun.1_Missense_Mutation_p.E19Q|TAGLN2_uc001fuo.1_Missense_Mutation_p.E19Q|TAGLN2_uc010piy.1_Missense_Mutation_p.E19Q	p.E19Q	NM_003564	NP_003555	P37802	TAGL2_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		1	105	-	all_hematologic(112;0.0597)		19					E9KL39|Q5JRQ6|Q5JRQ7|Q6FGI1|Q9BUH5|Q9H4P0	Missense_Mutation	SNP	ENST00000368097.4	37	c.55G>C	CCDS1189.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.189788	0.57909	.	.	ENSG00000158710	ENST00000368097;ENST00000368096;ENST00000320307;ENST00000397334	T;T;T;T	0.60424	0.19;0.19;0.19;0.19	4.82	4.82	0.62117	Calponin homology domain (2);	0.119014	0.35235	U	0.003350	T	0.66346	0.2780	M	0.61703	1.905	0.48185	D	0.999609	D;B	0.76494	0.999;0.319	D;B	0.74023	0.982;0.276	T	0.66064	-0.6016	9	.	.	.	-33.8449	15.7833	0.78281	0.0:1.0:0.0:0.0	.	19;19	B7Z5A2;P37802	.;TAGL2_HUMAN	Q	19;40;19;19	ENSP00000357077:E19Q;ENSP00000357076:E40Q;ENSP00000357075:E19Q;ENSP00000412429:E19Q	.	E	-	1	0	TAGLN2	158156869	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.447000	0.80620	2.395000	0.81488	0.561000	0.74099	GAG		0.597	TAGLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059105.1	NM_003564		15	46	0	0	0	0.003163	0	15	46				
TNN	63923	broad.mit.edu	37	1	175086186	175086186	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr1:175086186C>T	ENST00000239462.4	+	10	2344	c.2231C>T	c.(2230-2232)tCt>tTt	p.S744F		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	744	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CGCTACACCTCTGCCAAGGAC	0.632																																							uc001gkl.1		NA																	0				large_intestine(5)|ovary(3)|central_nervous_system(1)	9						c.(2230-2232)TCT>TTT		tenascin N precursor							85.0	81.0	82.0					1																	175086186		2203	4300	6503	SO:0001583	missense	63923				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix		g.chr1:175086186C>T	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2231C>T	1.37:g.175086186C>T	ENSP00000239462:p.Ser744Phe						p.S744F	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)	10	2344	+		Breast(1374;0.000962)	744			Fibronectin type-III 6.		B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	c.2231C>T	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.004991	0.74932	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.58652	0.32	5.37	5.37	0.77165	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.131393	0.51477	D	0.000100	T	0.80949	0.4722	M	0.90019	3.08	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.84692	0.0723	10	0.87932	D	0	.	17.2488	0.87035	0.0:1.0:0.0:0.0	.	744	Q9UQP3	TENN_HUMAN	F	744;567	ENSP00000239462:S744F	ENSP00000239462:S744F	S	+	2	0	TNN	173352809	1.000000	0.71417	0.984000	0.44739	0.530000	0.34684	6.585000	0.74062	2.677000	0.91161	0.655000	0.94253	TCT		0.632	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527		27	104	0	0	0	0.004656	0	27	104				
SERTAD4	56256	broad.mit.edu	37	1	210415113	210415113	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr1:210415113C>G	ENST00000367012.3	+	4	732	c.502C>G	c.(502-504)Caa>Gaa	p.Q168E	SERTAD4_ENST00000490620.1_3'UTR	NM_019605.3	NP_062551.1	Q9NUC0	SRTD4_HUMAN	SERTA domain containing 4	168						nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0237)|all cancers(67;0.127)		GTTTATGGCTCAAGACTGCCC	0.463																																							uc001hhy.2		NA																	0				ovary(1)|pancreas(1)	2						c.(502-504)CAA>GAA		SERTA domain containing 4							172.0	176.0	175.0					1																	210415113		2203	4300	6503	SO:0001583	missense	56256						protein binding	g.chr1:210415113C>G	BC012083	CCDS1494.1	1q32.1-q41	2008-02-05			ENSG00000082497	ENSG00000082497			25236	protein-coding gene	gene with protein product						12477932	Standard	NM_019605		Approved	DJ667H12.2	uc001hhy.3	Q9NUC0	OTTHUMG00000036391	ENST00000367012.3:c.502C>G	1.37:g.210415113C>G	ENSP00000355979:p.Gln168Glu					SERTAD4_uc009xcw.2_Missense_Mutation_p.Q168E	p.Q168E	NM_019605	NP_062551	Q9NUC0	SRTD4_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0237)|all cancers(67;0.127)	4	681	+			168					B2RD32	Missense_Mutation	SNP	ENST00000367012.3	37	c.502C>G	CCDS1494.1	.	.	.	.	.	.	.	.	.	.	C	13.80	2.345071	0.41498	.	.	ENSG00000082497	ENST00000367012	.	.	.	5.55	4.63	0.57726	.	0.000000	0.64402	D	0.000002	T	0.54062	0.1835	L	0.32530	0.975	0.39096	D	0.961189	B	0.06786	0.001	B	0.08055	0.003	T	0.55354	-0.8154	9	0.72032	D	0.01	-11.5092	16.8403	0.85967	0.0:0.8715:0.1285:0.0	.	168	Q9NUC0	SRTD4_HUMAN	E	168	.	ENSP00000355979:Q168E	Q	+	1	0	SERTAD4	208481736	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.571000	0.67404	1.466000	0.48025	0.655000	0.94253	CAA		0.463	SERTAD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088577.1	NM_019605		4	204	0	0	0	0.009096	0	4	204				
LBR	3930	broad.mit.edu	37	1	225609951	225609951	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr1:225609951C>T	ENST00000338179.2	-	3	319	c.194G>A	c.(193-195)gGt>gAt	p.G65D	LBR_ENST00000487054.1_5'Flank|LBR_ENST00000272163.4_Missense_Mutation_p.G65D	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	65					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		AGTTGAGCCACCTTTCCTTTG	0.517																																							uc001hoy.2		NA																	0				ovary(1)|skin(1)	2						c.(193-195)GGT>GAT		lamin B receptor							44.0	42.0	43.0					1																	225609951		2203	4300	6503	SO:0001583	missense	3930				cholesterol biosynthetic process	integral to nuclear inner membrane	chromo shadow domain binding|delta14-sterol reductase activity|DNA binding|lamin binding|receptor activity	g.chr1:225609951C>T	L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.194G>A	1.37:g.225609951C>T	ENSP00000339883:p.Gly65Asp					LBR_uc001hoz.2_Missense_Mutation_p.G65D|LBR_uc001hpa.1_Missense_Mutation_p.G65D	p.G65D	NM_002296	NP_002287	Q14739	LBR_HUMAN		GBM - Glioblastoma multiforme(131;0.117)	3	337	-	Breast(184;0.165)		65			Nucleoplasmic (Potential).		B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	ENST00000338179.2	37	c.194G>A	CCDS1545.1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.159038	0.57368	.	.	ENSG00000143815	ENST00000272163;ENST00000338179;ENST00000425080	D;D;T	0.96802	-4.13;-4.13;0.53	6.03	6.03	0.97812	.	0.313944	0.41938	D	0.000800	D	0.91858	0.7423	N	0.14661	0.345	0.31059	N	0.714366	B;B	0.27791	0.189;0.094	B;B	0.19148	0.024;0.01	D	0.89024	0.3437	10	0.54805	T	0.06	-15.1332	18.3299	0.90264	0.0:1.0:0.0:0.0	.	65;65	C9JXK0;Q14739	.;LBR_HUMAN	D	65	ENSP00000272163:G65D;ENSP00000339883:G65D;ENSP00000388059:G65D	ENSP00000272163:G65D	G	-	2	0	LBR	223676574	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.537000	0.60643	2.861000	0.98227	0.655000	0.94253	GGT		0.517	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296		12	38	0	0	0	0.013537	0	12	38				
URB2	9816	broad.mit.edu	37	1	229790095	229790095	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr1:229790095C>T	ENST00000258243.2	+	9	4473	c.4337C>T	c.(4336-4338)tCc>tTc	p.S1446F		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	1446						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						GCTGTGTTTTCCCCATTTATG	0.483																																							uc001hts.1		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(4336-4338)TCC>TTC		URB2 ribosome biogenesis 2 homolog							288.0	238.0	255.0					1																	229790095		2203	4300	6503	SO:0001583	missense	9816					nucleolus		g.chr1:229790095C>T	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.4337C>T	1.37:g.229790095C>T	ENSP00000258243:p.Ser1446Phe					URB2_uc009xfd.1_Missense_Mutation_p.S1446F	p.S1446F	NM_014777	NP_055592	Q14146	URB2_HUMAN			9	4473	+			1446					Q5VYC9	Missense_Mutation	SNP	ENST00000258243.2	37	c.4337C>T	CCDS31052.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.195098	0.78902	.	.	ENSG00000135763	ENST00000258243;ENST00000434387	T;T	0.45668	0.89;0.89	4.95	4.95	0.65309	Nucleolar 27S pre-rRNA processing, Urb2/Npa2, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.65015	0.2651	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65573	-0.6135	9	.	.	.	-20.6178	18.5454	0.91044	0.0:1.0:0.0:0.0	.	1446	Q14146	URB2_HUMAN	F	1446;62	ENSP00000258243:S1446F;ENSP00000395107:S62F	.	S	+	2	0	URB2	227856718	0.974000	0.33945	0.909000	0.35828	0.670000	0.39368	4.087000	0.57671	2.440000	0.82611	0.650000	0.86243	TCC		0.483	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777		34	60	0	0	0	0.019004	0	34	60				
FAM107B	83641	broad.mit.edu	37	10	14816578	14816578	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr10:14816578C>T	ENST00000181796.2	-	1	318	c.85G>A	c.(85-87)Gcc>Acc	p.A29T		NM_031453.2	NP_113641.2	Q9H098	F107B_HUMAN	family with sequence similarity 107, member B	0					sensory perception of sound (GO:0007605)					breast(7)|kidney(1)|large_intestine(4)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CCAAAACAGGCGAGCAGAGCT	0.532																																							uc001ina.1		NA																	0				breast(4)	4						c.(85-87)GCC>ACC		hypothetical protein LOC83641							100.0	79.0	86.0					10																	14816578		2203	4300	6503	SO:0001583	missense	83641							g.chr10:14816578C>T	AK127413	CCDS7102.1, CCDS60486.1	10p14	2006-01-17	2006-01-17	2005-11-20	ENSG00000065809	ENSG00000065809			23726	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 45"""	C10orf45		11230166	Standard	XM_005252616		Approved	FLJ45505, MGC11034	uc001ina.1	Q9H098	OTTHUMG00000017709	ENST00000181796.2:c.85G>A	10.37:g.14816578C>T	ENSP00000181796:p.Ala29Thr					FAM107B_uc010qbu.1_RNA	p.A29T	NM_031453	NP_113641	Q9H098	F107B_HUMAN			1	319	-			Error:Variant_position_missing_in_Q9H098_after_alignment					A8K1P4|D3DRT2|Q5T9K7|Q5T9K8|Q6ZSI4	Missense_Mutation	SNP	ENST00000181796.2	37	c.85G>A	CCDS7102.1	.	.	.	.	.	.	.	.	.	.	C	6.045	0.376667	0.11466	.	.	ENSG00000065809	ENST00000181796	T	0.51574	0.7	5.85	1.42	0.22433	.	0.267905	0.30159	N	0.010272	T	0.21962	0.0529	N	0.14661	0.345	0.35824	D	0.824792	B	0.12630	0.006	B	0.08055	0.003	T	0.07539	-1.0767	10	0.18710	T	0.47	-3.2653	2.7829	0.05366	0.1991:0.4097:0.0:0.3912	.	29	Q9H098-2	.	T	29	ENSP00000181796:A29T	ENSP00000181796:A29T	A	-	1	0	FAM107B	14856584	0.001000	0.12720	0.027000	0.17364	0.160000	0.22226	-0.266000	0.08631	0.377000	0.24735	-0.137000	0.14449	GCC		0.532	FAM107B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356966.1	NM_031453		5	83	0	0	0	0.001168	0	5	83				
YME1L1	10730	broad.mit.edu	37	10	27437885	27437885	+	Nonsense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr10:27437885G>A	ENST00000326799.3	-	2	266	c.118C>T	c.(118-120)Caa>Taa	p.Q40*	YME1L1_ENST00000376016.3_Nonsense_Mutation_p.Q40*|YME1L1_ENST00000375972.3_Nonsense_Mutation_p.Q40*|YME1L1_ENST00000477432.1_Nonsense_Mutation_p.Q40*	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase	40					cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						TGCTGGTTTTGAGAAACTGAC	0.413																																							uc001iti.2		NA																	0				ovary(1)	1						c.(118-120)CAA>TAA		YME1-like 1 isoform 1							209.0	207.0	208.0					10																	27437885		2203	4300	6503	SO:0001587	stop_gained	10730				protein catabolic process|proteolysis	membrane|mitochondrion	ATP binding|metal ion binding|metalloendopeptidase activity|nucleoside-triphosphatase activity	g.chr10:27437885G>A	AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.118C>T	10.37:g.27437885G>A	ENSP00000318480:p.Gln40*					YME1L1_uc001itj.2_Nonsense_Mutation_p.Q40*|YME1L1_uc010qdl.1_Nonsense_Mutation_p.Q40*|YME1L1_uc009xkv.2_RNA|YME1L1_uc001itk.1_Nonsense_Mutation_p.Q40*	p.Q40*	NM_139312	NP_647473	Q96TA2	YMEL1_HUMAN			2	300	-			40					B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Nonsense_Mutation	SNP	ENST00000326799.3	37	c.118C>T	CCDS7152.1	.	.	.	.	.	.	.	.	.	.	G	34	5.363919	0.95877	.	.	ENSG00000136758	ENST00000376016;ENST00000326799;ENST00000375969;ENST00000375972;ENST00000427324;ENST00000396296	.	.	.	5.49	4.59	0.56863	.	0.713942	0.15141	N	0.278284	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-4.4525	14.0321	0.64622	0.0724:0.0:0.9276:0.0	.	.	.	.	X	40;40;40;40;40;32	.	ENSP00000318480:Q40X	Q	-	1	0	YME1L1	27477891	1.000000	0.71417	0.923000	0.36655	0.846000	0.48090	4.366000	0.59492	1.323000	0.45263	0.655000	0.94253	CAA		0.413	YME1L1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047306.1	NM_139312		50	143	0	0	0	0.01441	0	50	143				
RBP3	5949	broad.mit.edu	37	10	48388984	48388984	+	Missense_Mutation	SNP	A	A	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr10:48388984A>C	ENST00000224600.4	-	1	2007	c.1894T>G	c.(1894-1896)Ttc>Gtc	p.F632V	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	632	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	CTTTGGTGGAACTCCAGCACT	0.672																																							uc001jez.2		NA																	0				large_intestine(1)|central_nervous_system(1)	2						c.(1894-1896)TTC>GTC		retinol-binding protein 3 precursor	Vitamin A(DB00162)						22.0	23.0	22.0					10																	48388984		2188	4256	6444	SO:0001583	missense	5949				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity	g.chr10:48388984A>C	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.1894T>G	10.37:g.48388984A>C	ENSP00000224600:p.Phe632Val						p.F632V	NM_002900	NP_002891	P10745	RET3_HUMAN			1	2008	-			632			4 X approximate tandem repeats.|3.		Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	ENST00000224600.4	37	c.1894T>G	CCDS7218.1	.	.	.	.	.	.	.	.	.	.	A	16.18	3.049764	0.55218	.	.	ENSG00000107618	ENST00000224600	T	0.38077	1.16	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.58595	0.2133	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.62435	-0.6855	10	0.87932	D	0	-41.2256	14.8507	0.70295	1.0:0.0:0.0:0.0	.	632	P10745	RET3_HUMAN	V	632	ENSP00000224600:F632V	ENSP00000224600:F632V	F	-	1	0	RBP3	48008990	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.198000	0.89729	2.124000	0.65301	0.459000	0.35465	TTC		0.672	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900		13	27	0	0	0	0.020292	0	13	27				
ZMIZ1	57178	broad.mit.edu	37	10	81056385	81056385	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr10:81056385C>T	ENST00000334512.5	+	13	1960	c.1388C>T	c.(1387-1389)aCg>aTg	p.T463M	ZMIZ1_ENST00000478357.1_3'UTR	NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	463	Pro-rich.				artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			CCGCCCCCCACGGTCAACATG	0.667																																							uc001kaf.2		NA																	0				ovary(2)|breast(1)|skin(1)	4						c.(1387-1389)ACG>ATG		retinoic acid induced 17							44.0	50.0	48.0					10																	81056385		2203	4300	6503	SO:0001583	missense	57178				transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding	g.chr10:81056385C>T	AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.1388C>T	10.37:g.81056385C>T	ENSP00000334474:p.Thr463Met					ZMIZ1_uc001kag.2_Missense_Mutation_p.T339M|ZMIZ1_uc001kah.1_3'UTR	p.T463M	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)		13	1960	+	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		463			Pro-rich.		Q5JSH9|Q7Z7E6	Missense_Mutation	SNP	ENST00000334512.5	37	c.1388C>T	CCDS7357.1	.	.	.	.	.	.	.	.	.	.	C	19.48	3.835214	0.71373	.	.	ENSG00000108175	ENST00000334512;ENST00000360331;ENST00000372347	T	0.64260	-0.09	4.96	4.96	0.65561	.	0.000000	0.42682	D	0.000668	T	0.50429	0.1615	N	0.14661	0.345	0.80722	D	1	D	0.54207	0.965	P	0.46339	0.513	T	0.58064	-0.7702	10	0.59425	D	0.04	-12.1016	13.8974	0.63781	0.0:0.8474:0.1526:0.0	.	463	Q9ULJ6	ZMIZ1_HUMAN	M	463;393;370	ENSP00000334474:T463M	ENSP00000334474:T463M	T	+	2	0	ZMIZ1	80726391	0.991000	0.36638	0.998000	0.56505	0.917000	0.54804	3.846000	0.55888	2.294000	0.77228	0.561000	0.74099	ACG		0.667	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048944.2	NM_020338		8	61	0	0	0	0.004482	0	8	61				
PPP1R3C	5507	broad.mit.edu	37	10	93389731	93389731	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr10:93389731C>G	ENST00000238994.5	-	2	991	c.907G>C	c.(907-909)Gag>Cag	p.E303Q		NM_005398.5	NP_005389.1			protein phosphatase 1, regulatory subunit 3C											breast(1)|endometrium(1)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(1)	12		Colorectal(252;0.235)				CTCTGCCACTCTGGGAAGAGC	0.507																																							uc001kho.2		NA																	0				breast(1)	1						c.(907-909)GAG>CAG		protein phosphatase 1, regulatory (inhibitor)							91.0	93.0	92.0					10																	93389731		2203	4300	6503	SO:0001583	missense	5507						protein serine/threonine phosphatase activity	g.chr10:93389731C>G	Y18207	CCDS7416.1	10q23-q24	2012-04-17	2011-10-04	2001-08-01	ENSG00000119938	ENSG00000119938		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9293	protein-coding gene	gene with protein product	"""Phosphatase 1, regulatory inhibitor subunit 5"", ""protein targeting to glycogen"""	602999	"""protein phosphatase 1, regulatory (inhibitor) subunit 3C"""	PPP1R5		8985175	Standard	NM_005398		Approved	PTG	uc001kho.3	Q9UQK1	OTTHUMG00000018745	ENST00000238994.5:c.907G>C	10.37:g.93389731C>G	ENSP00000238994:p.Glu303Gln						p.E303Q	NM_005398	NP_005389	Q9UQK1	PPR3C_HUMAN			2	1039	-		Colorectal(252;0.235)	303						Missense_Mutation	SNP	ENST00000238994.5	37	c.907G>C	CCDS7416.1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.071223	0.55646	.	.	ENSG00000119938	ENST00000238994;ENST00000438999;ENST00000500094	T	0.50813	0.73	5.73	5.73	0.89815	.	0.059619	0.64402	D	0.000004	T	0.45418	0.1341	L	0.52126	1.63	0.45172	D	0.99818	B	0.31153	0.31	B	0.30943	0.122	T	0.38542	-0.9656	10	0.46703	T	0.11	-12.9541	16.387	0.83514	0.0:0.8597:0.1403:0.0	.	303	Q9UQK1	PPR3C_HUMAN	Q	303;283;185	ENSP00000238994:E303Q	ENSP00000238994:E303Q	E	-	1	0	PPP1R3C	93379711	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.144000	0.71762	2.699000	0.92147	0.655000	0.94253	GAG		0.507	PPP1R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049372.1	NM_005398		3	105	0	0	0	0.009096	0	3	105				
PKD2L1	9033	broad.mit.edu	37	10	102089819	102089819	+	Missense_Mutation	SNP	C	C	A	rs372584640		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr10:102089819C>A	ENST00000318222.3	-	1	424	c.42G>T	c.(40-42)aaG>aaT	p.K14N	PKD2L1_ENST00000338519.3_Missense_Mutation_p.K14N|PKD2L1_ENST00000353274.3_Missense_Mutation_p.K14N	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	14					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)			NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		CACTCCCCAGCTTTTGCAGCT	0.652																																							uc001kqx.1		NA																	0				ovary(4)	4						c.(40-42)AAG>AAT		polycystic kidney disease 2-like 1							47.0	50.0	49.0					10																	102089819		2203	4299	6502	SO:0001583	missense	9033				signal transduction	integral to membrane	calcium activated cation channel activity|calcium ion binding|cytoskeletal protein binding	g.chr10:102089819C>A	AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.42G>T	10.37:g.102089819C>A	ENSP00000325296:p.Lys14Asn					PKD2L1_uc009xwm.1_5'UTR	p.K14N	NM_016112	NP_057196	Q9P0L9	PK2L1_HUMAN		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)	1	425	-		Colorectal(252;0.117)	14			Cytoplasmic (Potential).		O75972|Q5W039|Q9UP35|Q9UPA2	Missense_Mutation	SNP	ENST00000318222.3	37	c.42G>T	CCDS7492.1	.	.	.	.	.	.	.	.	.	.	c	7.681	0.689007	0.14973	.	.	ENSG00000107593	ENST00000338519;ENST00000353274;ENST00000318222;ENST00000339977	T;T;T	0.59772	0.44;0.24;0.29	5.61	-10.7	0.00240	.	1.542140	0.03408	N	0.204309	T	0.25158	0.0611	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08973	-1.0696	10	0.21014	T	0.42	0.0214	1.3068	0.02090	0.418:0.1842:0.2197:0.1781	.	14	Q9P0L9	PK2L1_HUMAN	N	14	ENSP00000345068:K14N;ENSP00000266049:K14N;ENSP00000325296:K14N	ENSP00000325296:K14N	K	-	3	2	PKD2L1	102079809	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-3.677000	0.00396	-1.645000	0.01515	-0.829000	0.03081	AAG		0.652	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049863.2	NM_016112		9	67	1	0	0.000673444	0.008291	0.000703542	9	67				
DUSP5	1847	broad.mit.edu	37	10	112270036	112270036	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr10:112270036C>G	ENST00000369583.3	+	4	1291	c.1007C>G	c.(1006-1008)tCt>tGt	p.S336C	DUSP5_ENST00000468749.1_3'UTR	NM_004419.3	NP_004410.3	Q16690	DUS5_HUMAN	dual specificity phosphatase 5	336	Tyrosine-protein phosphatase.				endoderm formation (GO:0001706)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			kidney(2)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	13		Breast(234;0.0848)		Epithelial(162;0.000276)|all cancers(201;0.00465)|BRCA - Breast invasive adenocarcinoma(275;0.12)		GCAGCAGGCTCTTCACTGATA	0.607																																							uc001kzd.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(1006-1008)TCT>TGT		dual specificity phosphatase 5							41.0	40.0	41.0					10																	112270036		2203	4300	6503	SO:0001583	missense	1847				endoderm formation|inactivation of MAPK activity	nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity	g.chr10:112270036C>G	U16996	CCDS7566.1	10q25	2011-06-09			ENSG00000138166	ENSG00000138166		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3071	protein-coding gene	gene with protein product		603069				7806236	Standard	NM_004419		Approved	HVH3	uc001kzd.3	Q16690	OTTHUMG00000019040	ENST00000369583.3:c.1007C>G	10.37:g.112270036C>G	ENSP00000358596:p.Ser336Cys						p.S336C	NM_004419	NP_004410	Q16690	DUS5_HUMAN		Epithelial(162;0.000276)|all cancers(201;0.00465)|BRCA - Breast invasive adenocarcinoma(275;0.12)	4	1262	+		Breast(234;0.0848)	336			Tyrosine-protein phosphatase.		Q12997|Q5T603	Missense_Mutation	SNP	ENST00000369583.3	37	c.1007C>G	CCDS7566.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.947408	0.34377	.	.	ENSG00000138166	ENST00000369583	T	0.32272	1.46	5.86	5.86	0.93980	.	0.240151	0.42964	D	0.000636	T	0.23094	0.0558	N	0.14661	0.345	0.28646	N	0.906893	P	0.44344	0.833	B	0.39185	0.293	T	0.12708	-1.0537	10	0.87932	D	0	.	19.1654	0.93555	0.0:1.0:0.0:0.0	.	336	Q16690	DUS5_HUMAN	C	336	ENSP00000358596:S336C	ENSP00000358596:S336C	S	+	2	0	DUSP5	112260026	1.000000	0.71417	0.134000	0.22075	0.456000	0.32438	5.127000	0.64727	2.778000	0.95560	0.655000	0.94253	TCT		0.607	DUSP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050333.1	NM_004419		17	49	0	0	0	0.00499	0	17	49				
FAM196A	642938	broad.mit.edu	37	10	128974492	128974492	+	Silent	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr10:128974492C>T	ENST00000522781.1	-	4	723	c.168G>A	c.(166-168)caG>caA	p.Q56Q	FAM196A_ENST00000424811.2_Silent_p.Q56Q|DOCK1_ENST00000280333.6_Intron	NM_001039762.2	NP_001034851.1	Q6ZSG2	F196A_HUMAN	family with sequence similarity 196, member A	56										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						TCTGCTCATTCTGTGCCTCGC	0.587																																							uc001lju.1		NA																	0				ovary(2)	2						c.(166-168)CAG>CAA		hypothetical protein LOC642938							119.0	116.0	117.0					10																	128974492		2203	4300	6503	SO:0001819	synonymous_variant	642938							g.chr10:128974492C>T		CCDS31312.1	10q26.2	2009-09-11	2009-09-11	2009-09-11		ENSG00000188916			33859	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 141"""	C10orf141			Standard	NM_001039762		Approved	FLJ45557	uc001ljv.1	Q6ZSG2		ENST00000522781.1:c.168G>A	10.37:g.128974492C>T						DOCK1_uc001ljt.2_Intron|DOCK1_uc010qun.1_Intron|FAM196A_uc010quo.1_Silent_p.Q56Q|FAM196A_uc001ljv.1_Silent_p.Q56Q|FAM196A_uc009yap.1_Silent_p.Q56Q	p.Q56Q	NM_001039762	NP_001034851	Q6ZSG2	F196A_HUMAN			1	209	-			56					B2RNT4|B7ZME7	Silent	SNP	ENST00000522781.1	37	c.168G>A	CCDS31312.1																																																																																				0.587	FAM196A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050978.2	NM_001039762		46	108	0	0	0	0.01441	0	46	108				
OR51E2	81285	broad.mit.edu	37	11	4703674	4703674	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr11:4703674C>T	ENST00000396950.3	-	2	507	c.268G>A	c.(268-270)Gag>Aag	p.E90K		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	90					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		AAGCTAATCTCTCGGGAATCA	0.493																																							uc001lzk.2		NA																	0				lung(3)|ovary(2)	5						c.(268-270)GAG>AAG		olfactory receptor, family 51, subfamily E,							79.0	69.0	72.0					11																	4703674		2201	4298	6499	SO:0001583	missense	81285				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4703674C>T	AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.268G>A	11.37:g.4703674C>T	ENSP00000380153:p.Glu90Lys						p.E90K	NM_030774	NP_110401	Q9H255	O51E2_HUMAN		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)	2	512	-		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	90			Extracellular (Potential).		B2RA63|Q6IF94	Missense_Mutation	SNP	ENST00000396950.3	37	c.268G>A	CCDS7751.1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.247827	0.39697	.	.	ENSG00000167332	ENST00000396950	T	0.00547	6.66	5.0	3.1	0.35709	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000252	T	0.00552	0.0018	M	0.64170	1.965	0.09310	N	1	P	0.39920	0.695	B	0.34489	0.184	T	0.51044	-0.8755	10	0.56958	D	0.05	.	4.5438	0.12071	0.1583:0.6049:0.1533:0.0835	.	90	Q9H255	O51E2_HUMAN	K	90	ENSP00000380153:E90K	ENSP00000380153:E90K	E	-	1	0	OR51E2	4660250	0.000000	0.05858	0.164000	0.22755	0.943000	0.58893	0.353000	0.20130	0.678000	0.31325	0.655000	0.94253	GAG		0.493	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257198.1	NM_030774		19	48	0	0	0	0.006122	0	19	48				
OR52E8	390079	broad.mit.edu	37	11	5878253	5878254	+	Missense_Mutation	DNP	AG	AG	GA	rs199919100	byFrequency	TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	AG	AG	-	-	AG	AG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr11:5878253_5878254AG>GA	ENST00000537935.1	-	1	710_711	c.679_680CT>TC	c.(679-681)CTg>TCg	p.L227S	TRIM5_ENST00000380027.1_Intron	NM_001005168.1	NP_001005168.1	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E, member 8	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GACAGCATACAGGATCCTGACA	0.455																																							uc010qzr.1		NA																	0				skin(2)	2						c.(679-681)CTG>TCG		olfactory receptor, family 52, subfamily E,																																				SO:0001583	missense	390079				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5878253_5878254AG>GA	BK004301	CCDS31400.1	11p15.4	2012-08-09	2003-12-15		ENSG00000183269	ENSG00000183269		"""GPCR / Class A : Olfactory receptors"""	15217	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily E, member 8 pseudogene"""				Standard	NM_001005168		Approved		uc010qzr.2	Q6IFG1	OTTHUMG00000168803	ENST00000537935.1:c.679_680delinsGA	11.37:g.5878253_5878254delinsGA	ENSP00000444054:p.Leu227Ser					TRIM5_uc001mbq.1_Intron	p.L227S	NM_001005168	NP_001005168	Q6IFG1	O52E8_HUMAN		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	1	679_680	-		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)	227			Cytoplasmic (Potential).		B9EH38	Missense_Mutation	DNP	ENST00000537935.1	37	c.679_680CT>TC	CCDS31400.1																																																																																				0.455	OR52E8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401145.1	NM_001005168		5	46	0	0	0	0.004672	0	5	46				
KCNC1	3746	broad.mit.edu	37	11	17794091	17794091	+	Missense_Mutation	SNP	C	C	G	rs376505218		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr11:17794091C>G	ENST00000379472.3	+	2	1480	c.1450C>G	c.(1450-1452)Cag>Gag	p.Q484E	KCNC1_ENST00000265969.6_Missense_Mutation_p.Q484E	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	484					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	CCACAGTACTCAGAGTGACAC	0.458																																							uc001mnk.3		NA																	0				upper_aerodigestive_tract(1)	1						c.(1450-1452)CAG>GAG		Shaw-related voltage-gated potassium channel		C	GLU/GLN,GLU/GLN	2,4398	4.2+/-10.8	0,2,2198	56.0	62.0	60.0		1450,1450	5.2	1.0	11		60	0,8586		0,0,4293	no	missense,missense	KCNC1	NM_001112741.1,NM_004976.4	29,29	0,2,6491	GG,GC,CC		0.0,0.0455,0.0154	possibly-damaging,possibly-damaging	484/586,484/512	17794091	2,12984	2200	4293	6493	SO:0001583	missense	3746					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr11:17794091C>G	M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.1450C>G	11.37:g.17794091C>G	ENSP00000368785:p.Gln484Glu					KCNC1_uc009yhc.1_Missense_Mutation_p.Q484E	p.Q484E	NM_004976	NP_004967	P48547	KCNC1_HUMAN			2	1505	+			484			Cytoplasmic (Potential).		K4DI87	Missense_Mutation	SNP	ENST00000379472.3	37	c.1450C>G	CCDS7827.1	.	.	.	.	.	.	.	.	.	.	C	12.92	2.081069	0.36758	4.55E-4	0.0	ENSG00000129159	ENST00000265969;ENST00000379472	D;D	0.97066	-4.23;-4.2	5.24	5.24	0.73138	.	2.078510	0.01879	N	0.037766	D	0.96676	0.8915	M	0.67397	2.05	0.45295	D	0.998293	B;B	0.32893	0.389;0.255	B;B	0.26614	0.071;0.039	T	0.80211	-0.1476	10	0.30078	T	0.28	.	18.8514	0.92232	0.0:1.0:0.0:0.0	.	484;484	Q3KNS8;P48547	.;KCNC1_HUMAN	E	484	ENSP00000265969:Q484E;ENSP00000368785:Q484E	ENSP00000265969:Q484E	Q	+	1	0	KCNC1	17750667	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.346000	0.72999	2.445000	0.82738	0.561000	0.74099	CAG		0.458	KCNC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389389.1	NM_004976		28	80	0	0	0	0.009535	0	28	80				
OR8K1	390157	broad.mit.edu	37	11	56114262	56114262	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr11:56114262C>T	ENST00000279783.2	+	1	842	c.748C>T	c.(748-750)Cat>Tat	p.H250Y		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					CTGTAGCTCTCATCTGACAGT	0.408										HNSCC(65;0.19)																													uc010rjg.1		NA																	0				ovary(1)|pancreas(1)	2						c.(748-750)CAT>TAT		olfactory receptor, family 8, subfamily K,							122.0	106.0	111.0					11																	56114262		2201	4296	6497	SO:0001583	missense	390157				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56114262C>T	AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.748C>T	11.37:g.56114262C>T	ENSP00000279783:p.His250Tyr	HNSCC(65;0.19)					p.H250Y	NM_001002907	NP_001002907	Q8NGG5	OR8K1_HUMAN			1	748	+	Esophageal squamous(21;0.00448)		250			Helical; Name=6; (Potential).		B9EJB1|Q6IFC3|Q96RC1	Missense_Mutation	SNP	ENST00000279783.2	37	c.748C>T	CCDS31528.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502803	0.85176	.	.	ENSG00000150261	ENST00000279783	T	0.00314	8.14	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000109	T	0.01387	0.0045	H	0.97758	4.07	0.52099	D	0.999945	D	0.89917	1.0	D	0.85130	0.997	T	0.42258	-0.9462	10	0.87932	D	0	-13.7143	18.2972	0.90150	0.0:1.0:0.0:0.0	.	250	Q8NGG5	OR8K1_HUMAN	Y	250	ENSP00000279783:H250Y	ENSP00000279783:H250Y	H	+	1	0	OR8K1	55870838	1.000000	0.71417	0.526000	0.27913	0.987000	0.75469	5.598000	0.67585	2.297000	0.77311	0.549000	0.68633	CAT		0.408	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391605.1	NM_001002907		14	55	0	0	0	0.020292	0	14	55				
OR5B3	441608	broad.mit.edu	37	11	58170261	58170261	+	Missense_Mutation	SNP	C	C	T	rs372105081		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr11:58170261C>T	ENST00000309403.2	-	1	621	c.622G>A	c.(622-624)Gct>Act	p.A208T		NM_001005469.1	NP_001005469.1	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B, member 3	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(1)	34	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				ACCAGGAGAGCTATAAAGATA	0.393																																							uc010rkf.1		NA																	0					0						c.(622-624)GCT>ACT		olfactory receptor, family 5, subfamily B,		C	THR/ALA	0,4402		0,0,2201	66.0	64.0	65.0		622	0.8	0.8	11		65	1,8589	1.2+/-3.3	0,1,4294	no	missense	OR5B3	NM_001005469.1	58	0,1,6495	TT,TC,CC		0.0116,0.0,0.0077	benign	208/315	58170261	1,12991	2201	4295	6496	SO:0001583	missense	441608				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:58170261C>T	AB065545	CCDS31549.1	11q12.1	2012-08-09			ENSG00000172769	ENSG00000172769		"""GPCR / Class A : Olfactory receptors"""	8324	protein-coding gene	gene with protein product				OR5B13			Standard	NM_001005469		Approved	OST129	uc010rkf.2	Q8NH48	OTTHUMG00000167516	ENST00000309403.2:c.622G>A	11.37:g.58170261C>T	ENSP00000308270:p.Ala208Thr						p.A208T	NM_001005469	NP_001005469	Q8NH48	OR5B3_HUMAN			1	622	-	Esophageal squamous(5;0.0027)	Breast(21;0.0778)	208			Helical; Name=5; (Potential).		Q6IEV6	Missense_Mutation	SNP	ENST00000309403.2	37	c.622G>A	CCDS31549.1	.	.	.	.	.	.	.	.	.	.	c	0.025	-1.375841	0.01214	0.0	1.16E-4	ENSG00000172769	ENST00000309403	T	0.36699	1.24	4.05	0.82	0.18793	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000214	T	0.08980	0.0222	N	0.01405	-0.89	0.09310	N	1	B	0.26577	0.153	B	0.29267	0.1	T	0.34129	-0.9841	10	0.06236	T	0.91	-31.9939	3.4772	0.07589	0.2867:0.4829:0.1405:0.0899	.	208	Q8NH48	OR5B3_HUMAN	T	208	ENSP00000308270:A208T	ENSP00000308270:A208T	A	-	1	0	OR5B3	57926837	0.000000	0.05858	0.791000	0.31998	0.067000	0.16453	-0.486000	0.06513	0.473000	0.27368	-0.860000	0.03012	GCT		0.393	OR5B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394886.1	NM_001005469		14	40	0	0	0	0.016723	0	14	40				
MARK2	2011	broad.mit.edu	37	11	63665725	63665725	+	Missense_Mutation	SNP	A	A	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr11:63665725A>G	ENST00000509502.2	+	4	674	c.211A>G	c.(211-213)Atg>Gtg	p.M71V	MARK2_ENST00000508192.1_Missense_Mutation_p.M104V|MARK2_ENST00000377810.3_Missense_Mutation_p.M71V|MARK2_ENST00000361128.5_Missense_Mutation_p.M104V|MARK2_ENST00000402010.2_Missense_Mutation_p.M104V|MARK2_ENST00000502399.3_Missense_Mutation_p.M104V|MARK2_ENST00000513765.2_Missense_Mutation_p.M71V|MARK2_ENST00000413835.2_Missense_Mutation_p.M104V|MARK2_ENST00000425897.2_Missense_Mutation_p.M71V|MARK2_ENST00000377809.4_Missense_Mutation_p.M104V|MARK2_ENST00000350490.7_Missense_Mutation_p.M104V|MARK2_ENST00000315032.8_Missense_Mutation_p.M104V|MARK2_ENST00000408948.3_Missense_Mutation_p.M71V	NM_017490.3	NP_059672.2			MAP/microtubule affinity-regulating kinase 2											autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33						AGTAAGAATAATGAAGGTTTT	0.463																																							uc001nxw.2		NA																	0				stomach(1)|ovary(1)|lung(1)	3						c.(310-312)ATG>GTG		MAP/microtubule affinity-regulating kinase 2							193.0	187.0	189.0					11																	63665725		2201	4297	6498	SO:0001583	missense	2011				cell differentiation|establishment or maintenance of epithelial cell apical/basal polarity|intracellular protein kinase cascade|multicellular organismal development|response to oxidative stress	plasma membrane	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr11:63665725A>G	BC008771	CCDS8051.1, CCDS41665.1, CCDS8051.2, CCDS53649.1, CCDS53650.1, CCDS53651.1	11q13.1	2013-06-27	2002-07-26	2002-08-01	ENSG00000072518	ENSG00000072518			3332	protein-coding gene	gene with protein product	"""ELKL motif kinase 1"", ""serine/threonine kinase"", ""protein-serine/threonine kinase"", ""Ser/Thr protein kinase PAR-1B"""	600526	"""ELKL motif kinase"""	EMK1		9730619, 10516437	Standard	NM_017490		Approved	PAR-1, Par1b, PAR-1B	uc001nxw.3	Q7KZI7	OTTHUMG00000160504	ENST00000509502.2:c.211A>G	11.37:g.63665725A>G	ENSP00000423974:p.Met71Val					MARK2_uc001nxx.2_Missense_Mutation_p.M104V|MARK2_uc001nxy.2_Missense_Mutation_p.M104V|MARK2_uc001nxv.3_Missense_Mutation_p.M104V|MARK2_uc001nxz.3_Missense_Mutation_p.M71V|MARK2_uc009yoy.2_Missense_Mutation_p.M71V	p.M104V	NM_001039469	NP_001034558	Q7KZI7	MARK2_HUMAN			4	889	+			104			Protein kinase.			Missense_Mutation	SNP	ENST00000509502.2	37	c.310A>G	CCDS41665.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.419893	0.83559	.	.	ENSG00000072518	ENST00000402010;ENST00000315032;ENST00000377809;ENST00000413835;ENST00000377810;ENST00000508192;ENST00000361128;ENST00000350490;ENST00000502399;ENST00000543220;ENST00000540169;ENST00000509502;ENST00000513765;ENST00000408948;ENST00000425897	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78	5.17	5.17	0.71159	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.46698	0.1406	L	0.58969	1.84	0.80722	D	1	D;D;P;D;D;D	0.67145	0.996;0.991;0.95;0.975;0.995;0.972	D;P;P;D;D;P	0.73708	0.981;0.846;0.719;0.956;0.974;0.827	T	0.46119	-0.9214	10	0.87932	D	0	.	14.1235	0.65205	1.0:0.0:0.0:0.0	.	71;71;104;104;104;104	E7ETY4;Q7KZI7-14;Q7KZI7-15;Q7KZI7-5;Q7KZI7;Q7KZI7-16	.;.;.;.;MARK2_HUMAN;.	V	104;104;104;104;71;104;104;104;104;71;71;71;71;71;71	ENSP00000385751:M104V;ENSP00000326632:M104V;ENSP00000367040:M104V;ENSP00000389184:M104V;ENSP00000367041:M71V;ENSP00000425765:M104V;ENSP00000355091:M104V;ENSP00000294247:M104V;ENSP00000444956:M71V;ENSP00000437509:M71V;ENSP00000423974:M71V;ENSP00000421075:M71V;ENSP00000386128:M71V;ENSP00000415494:M71V	ENSP00000326632:M104V	M	+	1	0	MARK2	63422301	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.117000	0.94347	2.171000	0.68590	0.460000	0.39030	ATG		0.463	MARK2-003	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000360862.2	NM_017490		35	138	0	0	0	0.00623	0	35	138				
MARK2	2011	broad.mit.edu	37	11	63668051	63668051	+	Silent	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr11:63668051G>A	ENST00000509502.2	+	9	1153	c.690G>A	c.(688-690)ctG>ctA	p.L230L	MARK2_ENST00000508192.1_Silent_p.L263L|MARK2_ENST00000377810.3_Silent_p.L230L|MARK2_ENST00000361128.5_Silent_p.L263L|MARK2_ENST00000402010.2_Silent_p.L263L|MARK2_ENST00000502399.3_Silent_p.L263L|MARK2_ENST00000513765.2_Silent_p.L230L|MARK2_ENST00000413835.2_Silent_p.L263L|MARK2_ENST00000425897.2_Silent_p.L230L|MARK2_ENST00000377809.4_Silent_p.L263L|MARK2_ENST00000350490.7_Silent_p.L263L|MARK2_ENST00000315032.8_Silent_p.L263L|MARK2_ENST00000408948.3_Silent_p.L230L	NM_017490.3	NP_059672.2			MAP/microtubule affinity-regulating kinase 2											autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33						AACGGGTACTGAGGGGAAAAT	0.463																																							uc001nxw.2		NA																	0				stomach(1)|ovary(1)|lung(1)	3						c.(787-789)CTG>CTA		MAP/microtubule affinity-regulating kinase 2							147.0	170.0	162.0					11																	63668051		2201	4297	6498	SO:0001819	synonymous_variant	2011				cell differentiation|establishment or maintenance of epithelial cell apical/basal polarity|intracellular protein kinase cascade|multicellular organismal development|response to oxidative stress	plasma membrane	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity	g.chr11:63668051G>A	BC008771	CCDS8051.1, CCDS41665.1, CCDS8051.2, CCDS53649.1, CCDS53650.1, CCDS53651.1	11q13.1	2013-06-27	2002-07-26	2002-08-01	ENSG00000072518	ENSG00000072518			3332	protein-coding gene	gene with protein product	"""ELKL motif kinase 1"", ""serine/threonine kinase"", ""protein-serine/threonine kinase"", ""Ser/Thr protein kinase PAR-1B"""	600526	"""ELKL motif kinase"""	EMK1		9730619, 10516437	Standard	NM_017490		Approved	PAR-1, Par1b, PAR-1B	uc001nxw.3	Q7KZI7	OTTHUMG00000160504	ENST00000509502.2:c.690G>A	11.37:g.63668051G>A						MARK2_uc001nxx.2_Silent_p.L263L|MARK2_uc001nxy.2_Silent_p.L263L|MARK2_uc001nxv.3_Silent_p.L263L|MARK2_uc001nxz.3_Silent_p.L230L|MARK2_uc009yoy.2_Silent_p.L230L	p.L263L	NM_001039469	NP_001034558	Q7KZI7	MARK2_HUMAN			9	1368	+			263			Protein kinase.			Silent	SNP	ENST00000509502.2	37	c.789G>A	CCDS41665.1																																																																																				0.463	MARK2-003	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000360862.2	NM_017490		85	164	0	0	0	0.01441	0	85	164				
NUMA1	4926	broad.mit.edu	37	11	71725332	71725332	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr11:71725332C>T	ENST00000393695.3	-	15	3548	c.3217G>A	c.(3217-3219)Gag>Aag	p.E1073K	RP11-849H4.4_ENST00000502284.1_RNA|NUMA1_ENST00000358965.6_Missense_Mutation_p.E1073K|NUMA1_ENST00000351960.6_Intron	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1											central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						TGGGCTGCCTCCAGACCACGA	0.562			T	RARA	APL																																		uc001orl.1		NA		Dom	yes		11	11q13	4926	T	nuclear mitotic apparatus protein 1			L	RARA		APL		0				ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						c.(3217-3219)GAG>AAG		nuclear mitotic apparatus protein 1							114.0	123.0	120.0					11																	71725332		2200	4293	6493	SO:0001583	missense	4926				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity	g.chr11:71725332C>T	Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.3217G>A	11.37:g.71725332C>T	ENSP00000377298:p.Glu1073Lys					NUMA1_uc009ysw.1_Missense_Mutation_p.E636K|NUMA1_uc001ork.1_Intron|NUMA1_uc001orm.1_Missense_Mutation_p.E1073K|NUMA1_uc001orn.2_Missense_Mutation_p.E636K|NUMA1_uc009ysx.1_Missense_Mutation_p.E1073K|NUMA1_uc001oro.1_Missense_Mutation_p.E1073K	p.E1073K	NM_006185	NP_006176	Q14980	NUMA1_HUMAN			15	3389	-			1073			Potential.			Missense_Mutation	SNP	ENST00000393695.3	37	c.3217G>A	CCDS31633.1	.	.	.	.	.	.	.	.	.	.	C	17.02	3.281127	0.59758	.	.	ENSG00000137497	ENST00000358965;ENST00000393695;ENST00000359652;ENST00000536544	T;T	0.13420	2.59;2.59	4.58	4.58	0.56647	.	0.108699	0.41396	D	0.000888	T	0.30198	0.0757	L	0.47716	1.5	0.47476	D	0.99943	D;D;P;D	0.71674	0.998;0.992;0.93;0.998	D;P;P;D	0.78314	0.991;0.824;0.71;0.991	T	0.01010	-1.1482	9	.	.	.	.	16.3091	0.82863	0.0:1.0:0.0:0.0	.	1079;557;1073;1073	Q4LE64;Q59HB8;Q14980-2;Q14980	.;.;.;NUMA1_HUMAN	K	1073;1073;636;42	ENSP00000351851:E1073K;ENSP00000377298:E1073K	.	E	-	1	0	NUMA1	71402980	0.934000	0.31675	1.000000	0.80357	0.604000	0.37047	1.877000	0.39598	2.389000	0.81357	0.561000	0.74099	GAG		0.562	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1			34	141	0	0	0	0.012213	0	34	141				
GUCY1A2	2977	broad.mit.edu	37	11	106680827	106680827	+	Silent	SNP	A	A	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr11:106680827A>C	ENST00000526355.2	-	5	2052	c.1584T>G	c.(1582-1584)gtT>gtG	p.V528V	GUCY1A2_ENST00000347596.2_Silent_p.V549V|GUCY1A2_ENST00000282249.2_Silent_p.V528V	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	528	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	CTGTGAAGCCAACAATGTCTG	0.448																																							uc001pjg.1		NA																	0				large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8						c.(1582-1584)GTT>GTG		guanylate cyclase 1, soluble, alpha 2							116.0	108.0	110.0					11																	106680827		2201	4298	6499	SO:0001819	synonymous_variant	2977				intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding	g.chr11:106680827A>C	X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.1584T>G	11.37:g.106680827A>C						GUCY1A2_uc010rvo.1_Silent_p.V549V|GUCY1A2_uc009yxn.1_Silent_p.V528V	p.V528V	NM_000855	NP_000846	P33402	GCYA2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	5	1974	-		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)	528			Guanylate cyclase.		A1L4C4|B7ZLT5	Silent	SNP	ENST00000526355.2	37	c.1584T>G	CCDS8335.1																																																																																				0.448	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389003.2			3	64	0	0	0	0.009096	0	3	64				
ATM	472	broad.mit.edu	37	11	108235833	108235833	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr11:108235833G>C	ENST00000452508.2	+	63	9064	c.8875G>C	c.(8875-8877)Gac>Cac	p.D2959H	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.D2959H|ATM_ENST00000525178.1_3'UTR|C11orf65_ENST00000526725.1_Intron			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2959	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TCCACTCTTTGACTGGACCAT	0.373			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													uc001pkb.1		NA	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	D|Mis|N|F|S	ataxia telangiectasia mutated			"""L, O"""		leukemia|lymphoma|medulloblastoma|glioma	T-PLL		0				haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240						c.(8875-8877)GAC>CAC	Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	ataxia telangiectasia mutated isoform 1							96.0	89.0	92.0					11																	108235833		2201	4298	6499	SO:0001583	missense	472	Ataxia_Telangiectasia	Familial Cancer Database	AT, Louis-Bar syndrome	cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding	g.chr11:108235833G>C	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8875G>C	11.37:g.108235833G>C	ENSP00000388058:p.Asp2959His	TSP Lung(14;0.12)				ATM_uc009yxr.1_Missense_Mutation_p.D2959H|C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron|ATM_uc001pke.1_Missense_Mutation_p.D1611H	p.D2959H	NM_000051	NP_000042	Q13315	ATM_HUMAN		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	62	9260	+		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	2959			PI3K/PI4K.		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	c.8875G>C	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.949200	0.92660	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.82619	-1.63;-1.63	5.71	5.71	0.89125	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.92525	0.7626	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.92220	0.5783	10	0.49607	T	0.09	.	19.916	0.97063	0.0:0.0:1.0:0.0	.	2959	Q13315	ATM_HUMAN	H	2959	ENSP00000278616:D2959H;ENSP00000388058:D2959H	ENSP00000278616:D2959H	D	+	1	0	ATM	107741043	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.747000	0.85070	2.711000	0.92665	0.650000	0.86243	GAC		0.373	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051		10	38	0	0	0	0.008291	0	10	38				
CD163L1	283316	broad.mit.edu	37	12	7586192	7586192	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr12:7586192C>T	ENST00000313599.3	-	3	280	c.223G>A	c.(223-225)Gat>Aat	p.D75N	CD163L1_ENST00000396630.1_Missense_Mutation_p.D75N|CD163L1_ENST00000416109.2_Missense_Mutation_p.D75N			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	75	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						TTCCACCCATCATCACACACA	0.512																																							uc001qsy.2		NA																	0				ovary(8)|skin(2)|central_nervous_system(1)	11						c.(223-225)GAT>AAT		scavenger receptor cysteine-rich type 1							233.0	171.0	192.0					12																	7586192		2203	4300	6503	SO:0001583	missense	283316					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity	g.chr12:7586192C>T	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.223G>A	12.37:g.7586192C>T	ENSP00000315945:p.Asp75Asn					CD163L1_uc010sge.1_Missense_Mutation_p.D75N	p.D75N	NM_174941	NP_777601	Q9NR16	C163B_HUMAN			3	249	-			75			SRCR 1.|Extracellular (Potential).		B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	c.223G>A	CCDS8577.1	.	.	.	.	.	.	.	.	.	.	C	16.73	3.203331	0.58234	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.32988	1.43;1.43;1.43	2.22	1.26	0.21427	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	0.331491	0.20946	U	0.082823	T	0.45377	0.1339	M	0.67569	2.06	0.22500	N	0.999045	D;D	0.76494	0.999;0.999	D;D	0.67900	0.954;0.954	T	0.18178	-1.0345	10	0.41790	T	0.15	.	7.9213	0.29848	0.0:0.49:0.51:0.0	.	75;75	E7EVK4;Q9NR16	.;C163B_HUMAN	N	75	ENSP00000315945:D75N;ENSP00000393474:D75N;ENSP00000379871:D75N	ENSP00000315945:D75N	D	-	1	0	CD163L1	7477459	0.971000	0.33674	0.002000	0.10522	0.529000	0.34654	1.441000	0.35035	0.436000	0.26393	0.563000	0.77884	GAT		0.512	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941		30	93	0	0	0	0.019004	0	30	93				
RPL13AP20	387841	broad.mit.edu	37	12	13028751	13028751	+	IGR	SNP	G	G	C	rs199863259		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr12:13028751G>C								DDX47 (45836 upstream) : GPRC5A (14964 downstream)																							GGTGTTTGACGGCATCCCACC	0.612																																							uc010sho.1		NA																	0					0						c.(319-321)GGC>CGC		SubName: Full=Ribosomal protein L13a variant; Flags: Fragment;																																				SO:0001628	intergenic_variant	387841							g.chr12:13028751G>C																													12.37:g.13028751G>C							p.G107R	NR_003932						1	341	+									Missense_Mutation	SNP		37	c.319G>C																																																																																				0	0.612									3	32	0	0	0	0.004672	0	3	32				
ALG10	84920	broad.mit.edu	37	12	34179527	34179527	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr12:34179527G>C	ENST00000266483.2	+	3	1418	c.1099G>C	c.(1099-1101)Gaa>Caa	p.E367Q	AC046130.1_ENST00000401300.2_RNA|ALG10_ENST00000538927.1_Intron|RP11-847H18.2_ENST00000501954.2_RNA	NM_032834.3	NP_116223.3	Q5BKT4	AG10A_HUMAN	ALG10, alpha-1,2-glucosyltransferase	367					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)				TCAAAGATATGAAACTGTAAA	0.289																																							uc001rlm.2		NA																	0				skin(1)	1						c.(1099-1101)GAA>CAA		asparagine-linked glycosylation 10 homolog							68.0	73.0	72.0					12																	34179527		2195	4293	6488	SO:0001583	missense	84920				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity	g.chr12:34179527G>C	AJ312278	CCDS41769.1	12p11.21	2013-03-04	2013-03-04		ENSG00000139133	ENSG00000139133	2.4.1.256		23162	protein-coding gene	gene with protein product	"""derepression of ITR1 expression 2 homolog (S. cerevisiae)"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""	603313	"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (yeast)"", ""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)"""				Standard	NM_032834		Approved	FLJ14751, DIE2, ALG10A	uc001rlm.3	Q5BKT4	OTTHUMG00000169285	ENST00000266483.2:c.1099G>C	12.37:g.34179527G>C	ENSP00000266483:p.Glu367Gln						p.E367Q	NM_032834	NP_116223	Q5BKT4	AG10A_HUMAN			3	1418	+	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)	367			Extracellular (Potential).		Q6NS98|Q96DU0|Q96SM6	Missense_Mutation	SNP	ENST00000266483.2	37	c.1099G>C	CCDS41769.1	.	.	.	.	.	.	.	.	.	.	G	3.913	-0.019733	0.07634	.	.	ENSG00000139133	ENST00000266483	T	0.55234	0.53	3.19	2.26	0.28386	.	0.403428	0.30134	N	0.010323	T	0.43100	0.1232	L	0.49640	1.575	0.80722	D	1	B	0.33318	0.408	B	0.38296	0.27	T	0.14671	-1.0464	10	0.15499	T	0.54	.	7.6483	0.28334	0.1361:0.0:0.8638:0.0	.	367	Q5BKT4	AG10A_HUMAN	Q	367	ENSP00000266483:E367Q	ENSP00000266483:E367Q	E	+	1	0	ALG10	34070794	0.998000	0.40836	0.006000	0.13384	0.193000	0.23685	3.594000	0.54008	1.502000	0.48669	0.184000	0.17185	GAA		0.289	ALG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403309.1	NM_032834		24	63	0	0	0	0.01892	0	24	63				
KMT2D	8085	broad.mit.edu	37	12	49425896	49425896	+	Nonsense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr12:49425896G>A	ENST00000301067.7	-	39	12591	c.12592C>T	c.(12592-12594)Cga>Tga	p.R4198*		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4198	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										AGCTGTGCTCGAAGCTGACCC	0.587																																							uc001rta.3		NA								N|F|Mis							medulloblastoma|renal		0				kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						c.(12592-12594)CGA>TGA		myeloid/lymphoid or mixed-lineage leukemia 2							65.0	63.0	64.0					12																	49425896		2074	4213	6287	SO:0001587	stop_gained	8085				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:49425896G>A	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.12592C>T	12.37:g.49425896G>A	ENSP00000301067:p.Arg4198*	HNSCC(34;0.089)					p.R4198*	NM_003482	NP_003473	O14686	MLL2_HUMAN			39	12592	-			4198			Gln-rich.		O14687	Nonsense_Mutation	SNP	ENST00000301067.7	37	c.12592C>T	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	53	20.840130	0.99934	.	.	ENSG00000167548	ENST00000301067	.	.	.	4.89	4.89	0.63831	.	0.000000	0.29838	N	0.011072	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.7009	0.88294	0.0:0.0:1.0:0.0	.	.	.	.	X	4198	.	ENSP00000301067:R4198X	R	-	1	2	MLL2	47712163	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.434000	0.52841	2.662000	0.90505	0.655000	0.94253	CGA		0.587	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			20	63	0	0	0	0.010504	0	20	63				
C1QL4	338761	broad.mit.edu	37	12	49730237	49730237	+	Silent	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr12:49730237G>A	ENST00000334221.3	-	1	734	c.24C>T	c.(22-24)gcC>gcT	p.A8A		NM_001008223.1	NP_001008224.1	Q86Z23	C1QL4_HUMAN	complement component 1, q subcomponent-like 4	8						collagen trimer (GO:0005581)|extracellular region (GO:0005576)				large_intestine(2)|lung(1)|ovary(1)|skin(1)	5						GCAGCGGGATGGCCACCAGCA	0.721																																							uc001rtz.1		NA																	0					0						c.(22-24)GCC>GCT		complement component 1, q subcomponent-like 4							7.0	8.0	8.0					12																	49730237		1928	3806	5734	SO:0001819	synonymous_variant	338761					collagen		g.chr12:49730237G>A		CCDS31793.1	12q13.12	2012-04-12				ENSG00000186897			31416	protein-coding gene	gene with protein product		615229					Standard	NM_001008223		Approved	C1QTNF11, CTRP11	uc001rtz.1	Q86Z23	OTTHUMG00000169515	ENST00000334221.3:c.24C>T	12.37:g.49730237G>A							p.A8A	NM_001008223	NP_001008224	Q86Z23	C1QL4_HUMAN			1	735	-			8						Silent	SNP	ENST00000334221.3	37	c.24C>T	CCDS31793.1																																																																																				0.721	C1QL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404561.1	NM_001008223		10	14	0	0	0	0.008291	0	10	14				
RACGAP1	29127	broad.mit.edu	37	12	50388048	50388048	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr12:50388048C>G	ENST00000427314.2	-	14	1428	c.1205G>C	c.(1204-1206)aGa>aCa	p.R402T	RACGAP1_ENST00000547061.1_5'Flank|RACGAP1_ENST00000434422.1_Missense_Mutation_p.R402T|RACGAP1_ENST00000548961.1_5'Flank|RACGAP1_ENST00000312377.5_Missense_Mutation_p.R402T|RACGAP1_ENST00000454520.2_Missense_Mutation_p.R402T|RACGAP1_ENST00000551016.1_Missense_Mutation_p.R402T|RACGAP1_ENST00000547905.1_Missense_Mutation_p.R402T	NM_013277.3	NP_037409.2			Rac GTPase activating protein 1											cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(6)	14						AGTTTTCACTCTGAGGAATTT	0.413																																							uc001rvt.2		NA																	0				kidney(1)	1						c.(1204-1206)AGA>ACA		Rac GTPase activating protein 1							123.0	126.0	125.0					12																	50388048		2203	4300	6503	SO:0001583	missense	29127				blood coagulation|cytokinesis, actomyosin contractile ring assembly|cytokinesis, initiation of separation|embryo development|microtubule-based movement|neuroblast proliferation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|spermatogenesis|sulfate transport	acrosomal vesicle|cytosol|microtubule|midbody|nucleus|spindle	alpha-tubulin binding|beta-tubulin binding|gamma-tubulin binding|GTPase activator activity|metal ion binding	g.chr12:50388048C>G		CCDS8795.1	12q13	2004-05-17				ENSG00000161800			9804	protein-coding gene	gene with protein product		604980				9497316	Standard	NM_013277		Approved	MgcRacGAP	uc001rvs.2	Q9H0H5		ENST00000427314.2:c.1205G>C	12.37:g.50388048C>G	ENSP00000404190:p.Arg402Thr					RACGAP1_uc009zlm.1_Missense_Mutation_p.R402T|RACGAP1_uc001rvs.2_Missense_Mutation_p.R402T|RACGAP1_uc001rvu.2_Missense_Mutation_p.R402T	p.R402T	NM_013277	NP_037409	Q9H0H5	RGAP1_HUMAN			14	1515	-			402			Rho-GAP.			Missense_Mutation	SNP	ENST00000427314.2	37	c.1205G>C	CCDS8795.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.291870	0.59976	.	.	ENSG00000161800	ENST00000427314;ENST00000312377;ENST00000434422;ENST00000454520;ENST00000551016;ENST00000547905;ENST00000549342	T;T;T;T;T;T;T	0.19532	2.14;2.14;2.14;2.14;2.14;2.14;2.14	5.35	4.45	0.53987	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.047323	0.85682	D	0.000000	T	0.20414	0.0491	L	0.43701	1.375	0.80722	D	1	B	0.22080	0.064	B	0.26969	0.075	T	0.02713	-1.1120	10	0.35671	T	0.21	-9.4692	13.0748	0.59081	0.0:0.9214:0.0:0.0786	.	402	Q9H0H5	RGAP1_HUMAN	T	402;402;402;402;402;402;138	ENSP00000404190:R402T;ENSP00000309871:R402T;ENSP00000413241:R402T;ENSP00000404808:R402T;ENSP00000449374:R402T;ENSP00000449370:R402T;ENSP00000449565:R138T	ENSP00000309871:R402T	R	-	2	0	RACGAP1	48674315	1.000000	0.71417	0.991000	0.47740	0.976000	0.68499	4.903000	0.63272	1.212000	0.43366	0.555000	0.69702	AGA		0.413	RACGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405997.1	NM_013277		3	125	0	0	0	0.004672	0	3	125				
SP1	6667	broad.mit.edu	37	12	53776245	53776245	+	Nonsense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr12:53776245C>T	ENST00000327443.4	+	3	612	c.514C>T	c.(514-516)Cag>Tag	p.Q172*	SP1_ENST00000426431.2_Nonsense_Mutation_p.Q165*	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	172	Transactivation domain A (Gln-rich).				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		GCCTAATATTCAGTATCAAGT	0.517																																							uc001scw.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(514-516)CAG>TAG		Sp1 transcription factor isoform a							81.0	86.0	84.0					12																	53776245		2203	4300	6503	SO:0001587	stop_gained	6667				positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter	cytoplasm	double-stranded DNA binding|histone deacetylase binding|HMG box domain binding|protein C-terminus binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding	g.chr12:53776245C>T	J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.514C>T	12.37:g.53776245C>T	ENSP00000329357:p.Gln172*					SP1_uc010sog.1_Nonsense_Mutation_p.Q165*	p.Q172*	NM_138473	NP_612482	P08047	SP1_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.00527)	3	611	+			172			Transactivation domain A (Gln-rich).		E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Nonsense_Mutation	SNP	ENST00000327443.4	37	c.514C>T	CCDS8857.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.625022	0.66901	.	.	ENSG00000185591	ENST00000327443;ENST00000426431	.	.	.	4.39	4.39	0.52855	.	0.000000	0.53938	D	0.000041	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.2766	0.82646	0.0:1.0:0.0:0.0	.	.	.	.	X	172;165	.	ENSP00000329357:Q172X	Q	+	1	0	SP1	52062512	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.585000	0.82584	2.456000	0.83038	0.467000	0.42956	CAG		0.517	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407044.1			31	85	0	0	0	0.009535	0	31	85				
TMPO	7112	broad.mit.edu	37	12	98938265	98938265	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr12:98938265G>A	ENST00000556029.1	+	6	1185	c.829G>A	c.(829-831)Gag>Aag	p.E277K	TMPO_ENST00000393053.2_Intron|TMPO_ENST00000548223.1_3'UTR|TMPO_ENST00000343315.5_Missense_Mutation_p.E237K	NM_001032283.2	NP_001027454.1	P42167	LAP2B_HUMAN	thymopoietin	277	Nucleoplasmic. {ECO:0000255}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)|lamin binding (GO:0005521)			breast(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						AGTAATTTCAGAGAGTACTCC	0.303																																							uc001tfj.2		NA																	0				ovary(2)	2						c.(829-831)GAG>AAG		thymopoietin isoform beta							41.0	43.0	42.0					12																	98938265		2203	4300	6503	SO:0001583	missense	7112					integral to membrane|nuclear inner membrane	DNA binding|lamin binding	g.chr12:98938265G>A		CCDS9064.1, CCDS31879.1, CCDS31880.1	12q22	2014-09-17			ENSG00000120802	ENSG00000120802			11875	protein-coding gene	gene with protein product	"""LEM domain containing 4"""	188380				7517549	Standard	NM_003276		Approved	TP, LAP2, LEMD4	uc001tfh.2	P42166	OTTHUMG00000170210	ENST00000556029.1:c.829G>A	12.37:g.98938265G>A	ENSP00000450627:p.Glu277Lys					TMPO_uc001tfk.2_Intron|TMPO_uc001tfl.2_RNA	p.E277K	NM_001032283	NP_001027454	P42167	LAP2B_HUMAN			6	1066	+			277			Nucleoplasmic (Potential).		A2T926|Q14861	Missense_Mutation	SNP	ENST00000556029.1	37	c.829G>A	CCDS31879.1	.	.	.	.	.	.	.	.	.	.	G	18.81	3.703190	0.68501	.	.	ENSG00000120802	ENST00000556029;ENST00000343315	T;T	0.66815	-0.17;-0.23	5.64	3.78	0.43462	.	.	.	.	.	T	0.58680	0.2139	L	0.53249	1.67	0.80722	D	1	B	0.27853	0.191	B	0.20577	0.03	T	0.54695	-0.8255	9	0.42905	T	0.14	.	10.9451	0.47296	0.071:0.1412:0.7878:0.0	.	277	P42167	LAP2B_HUMAN	K	277;237	ENSP00000450627:E277K;ENSP00000340251:E237K	ENSP00000340251:E277K	E	+	1	0	TMPO	97462396	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.678000	0.61641	0.704000	0.31869	0.591000	0.81541	GAG		0.303	TMPO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407973.2	NM_003276		8	22	0	0	0	0.00308	0	8	22				
RPH3A	22895	broad.mit.edu	37	12	113303345	113303345	+	Missense_Mutation	SNP	G	G	C	rs189556401		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr12:113303345G>C	ENST00000389385.4	+	6	854	c.357G>C	c.(355-357)aaG>aaC	p.K119N	RPH3A_ENST00000447659.2_Missense_Mutation_p.K70N|RPH3A_ENST00000420983.2_Missense_Mutation_p.K119N|RPH3A_ENST00000543106.2_Missense_Mutation_p.K119N|RPH3A_ENST00000551052.1_Missense_Mutation_p.K115N|RPH3A_ENST00000415485.3_Missense_Mutation_p.K119N|RPH3A_ENST00000548866.1_Missense_Mutation_p.K70N	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	119	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		AGGACTGTAAGAAGGTATCAT	0.562																																							uc010syl.1		NA																	0				ovary(3)|central_nervous_system(2)|skin(2)	7						c.(355-357)AAG>AAC		rabphilin 3A homolog isoform 1							166.0	146.0	153.0					12																	113303345		2203	4300	6503	SO:0001583	missense	22895				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding	g.chr12:113303345G>C	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.357G>C	12.37:g.113303345G>C	ENSP00000374036:p.Lys119Asn					RPH3A_uc001ttz.2_Missense_Mutation_p.K119N|RPH3A_uc001tty.2_Missense_Mutation_p.K115N|RPH3A_uc009zwe.1_Missense_Mutation_p.K115N|RPH3A_uc010sym.1_Missense_Mutation_p.K70N|RPH3A_uc001tua.2_5'Flank	p.K119N	NM_001143854	NP_001137326	Q9Y2J0	RP3A_HUMAN		BRCA - Breast invasive adenocarcinoma(302;0.00453)	6	719	+			119			RabBD.|FYVE-type.		B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	37	c.357G>C	CCDS44979.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.057211	0.55325	.	.	ENSG00000089169	ENST00000543106;ENST00000551593;ENST00000547840;ENST00000547728;ENST00000552667;ENST00000389385;ENST00000447659;ENST00000550901;ENST00000551198;ENST00000551052;ENST00000415485;ENST00000553114;ENST00000548866;ENST00000420983	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08;-1.08;-1.08;-1.08;-1.08;-1.08;-1.08;-1.08;-1.08;-1.08;-1.08	5.51	3.7	0.42460	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000006	T	0.80752	0.4683	L	0.45228	1.405	0.54753	D	0.999989	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.997;0.994;0.994;0.998	T	0.77107	-0.2710	9	.	.	.	.	7.3669	0.26779	0.3269:0.0:0.6731:0.0	.	70;119;119;115	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	N	119;119;119;119;119;119;70;52;119;115;119;119;70;119	ENSP00000440384:K119N;ENSP00000446780:K119N;ENSP00000450382:K119N;ENSP00000449613:K119N;ENSP00000449650:K119N;ENSP00000374036:K119N;ENSP00000413254:K70N;ENSP00000448100:K52N;ENSP00000447083:K119N;ENSP00000448297:K115N;ENSP00000405357:K119N;ENSP00000450216:K119N;ENSP00000450347:K70N;ENSP00000408889:K119N	.	K	+	3	2	RPH3A	111787728	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	1.447000	0.35101	0.695000	0.31675	-0.137000	0.14449	AAG		0.562	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954		15	51	0	0	0	0.003163	0	15	51				
TMEM132B	114795	broad.mit.edu	37	12	125834220	125834220	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr12:125834220C>T	ENST00000299308.3	+	2	283	c.275C>T	c.(274-276)tCa>tTa	p.S92L	TMEM132B_ENST00000418253.2_3'UTR	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	92						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		GGCCCATTTTCAGTGGAGAAG	0.498																																							uc001uhe.1		NA																	0				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19						c.(274-276)TCA>TTA		transmembrane protein 132B							107.0	106.0	106.0					12																	125834220		1872	4103	5975	SO:0001583	missense	114795					integral to membrane		g.chr12:125834220C>T	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.275C>T	12.37:g.125834220C>T	ENSP00000299308:p.Ser92Leu						p.S92L	NM_052907	NP_443139	Q14DG7	T132B_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)	2	283	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		92			Extracellular (Potential).		A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	37	c.275C>T	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.653091	0.47362	.	.	ENSG00000139364	ENST00000299308	T	0.11385	2.78	5.41	1.34	0.21922	.	.	.	.	.	T	0.12347	0.0300	L	0.58510	1.815	0.80722	D	1	B	0.13145	0.007	B	0.14578	0.011	T	0.06570	-1.0819	9	0.66056	D	0.02	.	10.8191	0.46593	0.0:0.5292:0.4013:0.0695	.	92	Q14DG7	T132B_HUMAN	L	92	ENSP00000299308:S92L	ENSP00000299308:S92L	S	+	2	0	TMEM132B	124400173	0.980000	0.34600	0.001000	0.08648	0.832000	0.47134	2.565000	0.45939	0.196000	0.20367	0.591000	0.81541	TCA		0.498	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907		32	136	0	0	0	0.013726	0	32	136				
FREM2	341640	broad.mit.edu	37	13	39454606	39454606	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr13:39454606G>C	ENST00000280481.7	+	24	9408	c.9192G>C	c.(9190-9192)gaG>gaC	p.E3064D		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	3064					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGGCATGGGAGATTGGTGCTG	0.557																																							uc001uwv.2		NA																	0				ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11						c.(9190-9192)GAG>GAC		FRAS1-related extracellular matrix protein 2							128.0	112.0	117.0					13																	39454606		2203	4300	6503	SO:0001583	missense	341640				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr13:39454606G>C	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.9192G>C	13.37:g.39454606G>C	ENSP00000280481:p.Glu3064Asp						p.E3064D	NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)	24	9501	+		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)	3064			Extracellular (Potential).		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	c.9192G>C	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	3.139	-0.176823	0.06380	.	.	ENSG00000150893	ENST00000280481	T	0.18174	2.23	6.04	-4.16	0.03869	.	0.352847	0.32093	N	0.006581	T	0.04543	0.0124	N	0.04669	-0.19	0.36254	D	0.854116	B	0.02656	0.0	B	0.04013	0.001	T	0.46748	-0.9169	10	0.02654	T	1	.	8.1899	0.31361	0.3348:0.3471:0.3181:0.0	.	3064	Q5SZK8	FREM2_HUMAN	D	3064	ENSP00000280481:E3064D	ENSP00000280481:E3064D	E	+	3	2	FREM2	38352606	0.217000	0.23597	0.642000	0.29436	0.618000	0.37518	-0.279000	0.08479	-0.672000	0.05266	-0.471000	0.05019	GAG		0.557	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361		8	77	0	0	0	0.008291	0	8	77				
KLF5	688	broad.mit.edu	37	13	73649905	73649905	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr13:73649905G>C	ENST00000377687.4	+	4	1791	c.1255G>C	c.(1255-1257)Gag>Cag	p.E419Q	KLF5_ENST00000539231.1_Missense_Mutation_p.E328Q	NM_001730.3	NP_001721.2	Q13887	KLF5_HUMAN	Kruppel-like factor 5 (intestinal)	419					angiogenesis (GO:0001525)|cellular response to organic cyclic compound (GO:0071407)|cellular response to peptide (GO:1901653)|intestinal epithelial cell development (GO:0060576)|microvillus assembly (GO:0030033)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of microvillus assembly (GO:0032534)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.E419Q(2)		breast(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		GCGATCGGATGAGCTGACCCG	0.592																																							uc001vje.2		NA																	2	Substitution - Missense(2)		lung(2)	large_intestine(1)|ovary(1)|pancreas(1)	3						c.(1255-1257)GAG>CAG		Kruppel-like factor 5							61.0	60.0	61.0					13																	73649905		2203	4300	6503	SO:0001583	missense	688				transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding	g.chr13:73649905G>C	D14520	CCDS9448.1, CCDS66562.1	13q21.3	2013-01-08			ENSG00000102554	ENSG00000102554		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6349	protein-coding gene	gene with protein product		602903		BTEB2		8479902, 9973612	Standard	NM_001730		Approved	IKLF, CKLF	uc001vje.3	Q13887	OTTHUMG00000017074	ENST00000377687.4:c.1255G>C	13.37:g.73649905G>C	ENSP00000366915:p.Glu419Gln					KLF5_uc001vjd.2_Missense_Mutation_p.E328Q	p.E419Q	NM_001730	NP_001721	Q13887	KLF5_HUMAN		GBM - Glioblastoma multiforme(99;0.0011)	4	1579	+		Prostate(6;0.00187)|Breast(118;0.0735)	419			C2H2-type 2.		L0R3U5|L0R4T9|Q9UHP8	Missense_Mutation	SNP	ENST00000377687.4	37	c.1255G>C	CCDS9448.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.794267	0.90453	.	.	ENSG00000102554	ENST00000539231;ENST00000377687;ENST00000545883	T;T	0.51817	0.69;0.69	5.93	5.93	0.95920	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.57286	0.2043	N	0.16567	0.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62416	-0.6859	10	0.87932	D	0	.	20.3465	0.98790	0.0:0.0:1.0:0.0	.	419	Q13887	KLF5_HUMAN	Q	328;419;399	ENSP00000440407:E328Q;ENSP00000366915:E419Q	ENSP00000366915:E419Q	E	+	1	0	KLF5	72547906	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	9.869000	0.99810	2.798000	0.96311	0.655000	0.94253	GAG		0.592	KLF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045263.1			16	54	0	0	0	0.016522	0	16	54				
COCH	1690	broad.mit.edu	37	14	31355424	31355424	+	Silent	SNP	A	A	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr14:31355424A>C	ENST00000396618.3	+	11	1439	c.1383A>C	c.(1381-1383)atA>atC	p.I461I	COCH_ENST00000216361.4_Silent_p.I461I|COCH_ENST00000475087.1_Silent_p.I461I|RP11-829H16.3_ENST00000468444.2_RNA|COCH_ENST00000382493.4_Silent_p.I312I|COCH_ENST00000460581.2_Silent_p.I349I|RP11-829H16.3_ENST00000556786.1_RNA|RP11-829H16.3_ENST00000555108.1_RNA|RP11-829H16.3_ENST00000555421.1_RNA	NM_004086.2	NP_004077.1	O43405	COCH_HUMAN	cochlin	461	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				defense response to bacterium (GO:0042742)|positive regulation of innate immune response (GO:0045089)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|pancreas(1)|skin(3)	19	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		TTGGCCCTATAAGGGAGAGCC	0.478																																							uc001wqr.2		NA																	0				pancreas(1)|central_nervous_system(1)|skin(1)	3						c.(1381-1383)ATA>ATC		cochlin precursor							102.0	92.0	95.0					14																	31355424		2203	4300	6503	SO:0001819	synonymous_variant	1690				sensory perception of sound	proteinaceous extracellular matrix		g.chr14:31355424A>C		CCDS9640.1	14q11.2-q13	2013-05-01	2013-05-01		ENSG00000100473	ENSG00000100473			2180	protein-coding gene	gene with protein product		603196	"""coagulation factor C (Limulus polyphemus homolog); cochlin"", ""coagulation factor C homolog, cochlin (Limulus polyphemus)"""	DFNA31, DFNA9		9806553	Standard	NM_004086		Approved	COCH-5B2	uc001wqp.2	O43405	OTTHUMG00000029432	ENST00000396618.3:c.1383A>C	14.37:g.31355424A>C						COCH_uc001wqp.2_Silent_p.I461I|COCH_uc001wqq.3_Silent_p.I461I|uc001wqs.2_RNA|COCH_uc001wqt.1_Silent_p.I312I	p.I461I	NM_004086	NP_004077	O43405	COCH_HUMAN	LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)	11	1463	+	Hepatocellular(127;0.0877)|Breast(36;0.148)		461			VWFA 2.		A8K9K9|D3DS84|Q96IU6	Silent	SNP	ENST00000396618.3	37	c.1383A>C	CCDS9640.1	.	.	.	.	.	.	.	.	.	.	A	11.19	1.564508	0.27915	.	.	ENSG00000100473	ENST00000468826	.	.	.	5.89	-0.339	0.12647	.	.	.	.	.	.	.	.	.	.	.	0.43300	D	0.995299	.	.	.	.	.	.	.	.	.	.	.	.	.	5.0978	6.8082	0.23788	0.4614:0.0:0.4313:0.1073	.	.	.	.	S	345	.	.	X	+	2	2	COCH	30425175	0.982000	0.34865	0.552000	0.28243	0.935000	0.57460	0.474000	0.22148	-0.090000	0.12462	-0.385000	0.06624	TAA		0.478	COCH-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276608.1	NM_004086		28	62	0	0	0	0.005443	0	28	62				
HECTD1	25831	broad.mit.edu	37	14	31589063	31589063	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr14:31589063C>G	ENST00000399332.1	-	29	5736	c.5248G>C	c.(5248-5250)Gag>Cag	p.E1750Q	HECTD1_ENST00000553700.1_Missense_Mutation_p.E1750Q	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1750					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		GTTTCGTACTCTTCTTCTTCC	0.368																																							uc001wrc.1		NA																	0				ovary(3)|large_intestine(1)|lung(1)	5						c.(5248-5250)GAG>CAG		HECT domain containing 1							139.0	129.0	132.0					14																	31589063		1894	4113	6007	SO:0001583	missense	25831				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity	g.chr14:31589063C>G	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.5248G>C	14.37:g.31589063C>G	ENSP00000382269:p.Glu1750Gln					HECTD1_uc001wra.1_5'UTR|HECTD1_uc001wrb.1_5'UTR|HECTD1_uc001wrd.1_Missense_Mutation_p.E1218Q	p.E1750Q	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)	29	5737	-	Hepatocellular(127;0.0877)|Breast(36;0.176)		1750					D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	c.5248G>C	CCDS41939.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.155645|5.155645	0.94686|0.94686	.|.	.|.	ENSG00000092148|ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957|ENST00000554882	T;T;T|.	0.14144|.	2.53;2.53;2.53|.	5.61|5.61	5.61|5.61	0.85477|0.85477	.|.	0.000000|.	0.64402|.	U|.	0.000001|.	T|T	0.47857|0.47857	0.1468|0.1468	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	D;D|.	0.57899|.	0.981;0.981|.	D;D|.	0.65140|.	0.932;0.932|.	T|T	0.41448|0.41448	-0.9508|-0.9508	10|5	0.44086|.	T|.	0.13|.	-10.9041|-10.9041	19.9989|19.9989	0.97403|0.97403	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1750;1750|.	D3DS86;Q9ULT8|.	.;HECD1_HUMAN|.	Q|N	1750;1752;1750;1177|115	ENSP00000450697:E1750Q;ENSP00000382269:E1750Q;ENSP00000451860:E1177Q|.	ENSP00000261312:E1752Q|.	E|K	-|-	1|3	0|2	HECTD1|HECTD1	30658814|30658814	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	7.728000|7.728000	0.84847|0.84847	2.805000|2.805000	0.96524|0.96524	0.460000|0.460000	0.39030|0.39030	GAG|AAG		0.368	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1			15	57	0	0	0	0.00499	0	15	57				
CNIH1	10175	broad.mit.edu	37	14	54894543	54894543	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr14:54894543C>A	ENST00000216416.4	-	5	527	c.424G>T	c.(424-426)Gtg>Ttg	p.V142L	CNIH1_ENST00000395573.4_Missense_Mutation_p.V94L|CNIH1_ENST00000553660.1_Missense_Mutation_p.V119L|CNIH1_ENST00000557690.1_Missense_Mutation_p.V158L	NM_005776.2	NP_005767.1	O95406	CNIH1_HUMAN	cornichon family AMPA receptor auxiliary protein 1	142					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											TAAGAGCTCACCAAAACATAG	0.343																																							uc001xat.1		NA																	0					0						c.(424-426)GTG>TTG		cornichon-like							161.0	155.0	157.0					14																	54894543		2203	4300	6503	SO:0001583	missense	10175				immune response|intracellular signal transduction|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane|integral to membrane		g.chr14:54894543C>A	AF031379	CCDS9717.1	14q22.1	2013-08-28	2013-08-28	2013-08-28	ENSG00000100528	ENSG00000100528			19431	protein-coding gene	gene with protein product		611287	"""cornichon homolog (Drosophila)"""	CNIH		10209299	Standard	NM_005776		Approved	TGAM77, CNIL	uc001xat.1	O95406	OTTHUMG00000152335	ENST00000216416.4:c.424G>T	14.37:g.54894543C>A	ENSP00000216416:p.Val142Leu					CNIH_uc001xav.1_Missense_Mutation_p.V94L	p.V142L	NM_005776	NP_005767	O95406	CNIH_HUMAN		GBM - Glioblastoma multiforme(112;0.00341)	5	527	-			142			Helical; (Potential).		Q3SYM7	Missense_Mutation	SNP	ENST00000216416.4	37	c.424G>T	CCDS9717.1	.	.	.	.	.	.	.	.	.	.	C	16.87	3.242013	0.58995	.	.	ENSG00000100528	ENST00000395573;ENST00000216416;ENST00000553660;ENST00000557690	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.74321	0.3701	L	0.50993	1.605	0.80722	D	1	P;P	0.49185	0.92;0.795	D;B	0.65443	0.935;0.232	T	0.66858	-0.5817	9	0.22109	T	0.4	-13.0527	19.8407	0.96681	0.0:1.0:0.0:0.0	.	94;142	A8MVW4;O95406	.;CNIH_HUMAN	L	94;142;119;158	.	ENSP00000216416:V142L	V	-	1	0	CNIH	53964293	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.438000	0.80431	2.677000	0.91161	0.650000	0.86243	GTG		0.343	CNIH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276896.2	NM_005776		14	72	1	0	5.3912e-06	0.006122	5.76089e-06	14	72				
SYNE2	23224	broad.mit.edu	37	14	64522939	64522939	+	Nonsense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr14:64522939C>G	ENST00000344113.4	+	49	10234	c.10022C>G	c.(10021-10023)tCa>tGa	p.S3341*	SYNE2_ENST00000554584.1_Nonsense_Mutation_p.S3374*|SYNE2_ENST00000358025.3_Nonsense_Mutation_p.S3341*|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3341					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.S3341*(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TCTAAGAACTCAGCAATGAAG	0.403																																							uc001xgm.2		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14						c.(10021-10023)TCA>TGA		spectrin repeat containing, nuclear envelope 2							55.0	50.0	52.0					14																	64522939		1857	4089	5946	SO:0001587	stop_gained	23224				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding	g.chr14:64522939C>G	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.10022C>G	14.37:g.64522939C>G	ENSP00000341781:p.Ser3341*					SYNE2_uc001xgl.2_Nonsense_Mutation_p.S3341*|SYNE2_uc010apw.1_Nonsense_Mutation_p.S47*	p.S3341*	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN		all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)	49	10252	+			3341			Cytoplasmic (Potential).|Potential.		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Nonsense_Mutation	SNP	ENST00000344113.4	37	c.10022C>G	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	C	52	19.254165	0.99917	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	.	.	.	5.79	4.91	0.64330	.	0.273101	0.26467	N	0.024219	.	.	.	.	.	.	0.25206	N	0.990018	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	9.6828	0.40080	0.0:0.8015:0.0:0.1985	.	.	.	.	X	3341;3341;3374;3374	.	ENSP00000261678:S3374X	S	+	2	0	SYNE2	63592692	0.002000	0.14202	0.527000	0.27925	0.791000	0.44710	1.368000	0.34216	1.467000	0.48044	0.491000	0.48974	TCA		0.403	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914		10	24	0	0	0	0.010729	0	10	24				
SPTLC2	9517	broad.mit.edu	37	14	78021723	78021723	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr14:78021723C>G	ENST00000216484.2	-	8	1289	c.1096G>C	c.(1096-1098)Gat>Cat	p.D366H	SPTLC2_ENST00000556264.1_5'Flank	NM_004863.3	NP_004854.1	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base subunit 2	366					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(5)	19			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)	TCCTCGGGATCCAGGCCAAAG	0.512																																							uc001xub.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1096-1098)GAT>CAT		serine palmitoyltransferase, long chain base	L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)						125.0	129.0	128.0					14																	78021723		2203	4300	6503	SO:0001583	missense	9517					integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups	g.chr14:78021723C>G	AB011098	CCDS9865.1	14q24.3	2014-09-17			ENSG00000100596	ENSG00000100596	2.3.1.50		11278	protein-coding gene	gene with protein product		605713				8921873, 9363775	Standard	NM_004863		Approved	KIAA0526, LCB2, LCB2A, hLCB2a	uc001xub.3	O15270		ENST00000216484.2:c.1096G>C	14.37:g.78021723C>G	ENSP00000216484:p.Asp366His						p.D366H	NM_004863	NP_004854	O15270	SPTC2_HUMAN	Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	8	1284	-			366					Q16685	Missense_Mutation	SNP	ENST00000216484.2	37	c.1096G>C	CCDS9865.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.58|12.58	1.981936|1.981936	0.34942|0.34942	.|.	.|.	ENSG00000100596|ENSG00000100596	ENST00000216484|ENST00000554901	D|.	0.91237|.	-2.81|.	4.89|4.89	2.01|2.01	0.26516|0.26516	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.251056|.	0.45867|.	D|.	0.000340|.	T|T	0.75265|0.75265	0.3826|0.3826	M|M	0.86573|0.86573	2.825|2.825	0.80722|0.80722	D|D	1|1	B|.	0.21905|.	0.062|.	B|.	0.34873|.	0.191|.	T|T	0.76460|0.76460	-0.2951|-0.2951	10|5	0.51188|.	T|.	0.08|.	-13.9886|-13.9886	10.4852|10.4852	0.44717|0.44717	0.0:0.7029:0.0:0.2971|0.0:0.7029:0.0:0.2971	.|.	366|.	O15270|.	SPTC2_HUMAN|.	H|A	366|302	ENSP00000216484:D366H|.	ENSP00000216484:D366H|.	D|G	-|-	1|2	0|0	SPTLC2|SPTLC2	77091476|77091476	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.754000|0.754000	0.42855|0.42855	1.436000|1.436000	0.34980|0.34980	0.743000|0.743000	0.32719|0.32719	0.650000|0.650000	0.86243|0.86243	GAT|GGA		0.512	SPTLC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414030.1	NM_004863		3	173	0	0	0	0.004672	0	3	173				
PACS2	23241	broad.mit.edu	37	14	105851322	105851322	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr14:105851322G>T	ENST00000325438.8	+	18	2490	c.1986G>T	c.(1984-1986)aaG>aaT	p.K662N	PACS2_ENST00000551743.1_Missense_Mutation_p.K176N|PACS2_ENST00000447393.1_Missense_Mutation_p.K666N|PACS2_ENST00000458164.2_Missense_Mutation_p.K666N|PACS2_ENST00000430725.2_Missense_Mutation_p.K587N|PACS2_ENST00000547217.1_Missense_Mutation_p.K632N			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	662					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		ACAAGCAGAAGAGGTAACGCG	0.662																																							uc001yqt.2		NA																	0				pancreas(1)	1						c.(1984-1986)AAG>AAT		phosphofurin acidic cluster sorting protein 2							63.0	43.0	50.0					14																	105851322		2192	4281	6473	SO:0001583	missense	23241				apoptosis|interspecies interaction between organisms	endoplasmic reticulum lumen|mitochondrion		g.chr14:105851322G>T	AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.1986G>T	14.37:g.105851322G>T	ENSP00000321834:p.Lys662Asn					PACS2_uc001yqs.2_Missense_Mutation_p.K587N|PACS2_uc001yqv.2_Missense_Mutation_p.K666N|PACS2_uc001yqu.2_Missense_Mutation_p.K666N	p.K662N	NM_015197	NP_056012	Q86VP3	PACS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)	18	2161	+		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	662					A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Missense_Mutation	SNP	ENST00000325438.8	37	c.1986G>T	CCDS32168.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.789891	0.50102	.	.	ENSG00000179364	ENST00000430725;ENST00000325438;ENST00000458164;ENST00000447393;ENST00000547217;ENST00000551743	T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79	4.29	4.29	0.51040	.	0.105878	0.64402	D	0.000007	T	0.63965	0.2556	M	0.78049	2.395	0.53688	D	0.999974	D;P;B;D	0.76494	0.996;0.929;0.116;0.999	D;P;B;D	0.74023	0.944;0.729;0.094;0.982	T	0.66420	-0.5928	10	0.59425	D	0.04	-31.2518	7.0787	0.25219	0.1974:0.0:0.8026:0.0	.	666;666;662;663	E9PB38;Q86VP3-2;Q86VP3;Q86VP3-3	.;.;PACS2_HUMAN;.	N	587;662;666;666;632;176	ENSP00000393524:K587N;ENSP00000321834:K662N;ENSP00000399732:K666N;ENSP00000393559:K666N;ENSP00000449525:K632N;ENSP00000449254:K176N	ENSP00000321834:K662N	K	+	3	2	PACS2	104922367	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	2.685000	0.46959	2.098000	0.63641	0.655000	0.94253	AAG		0.662	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000409209.1	XM_377355		3	4	1	0	6.4e-05	0.004672	6.7236e-05	3	4				
BAHD1	22893	broad.mit.edu	37	15	40751633	40751633	+	Silent	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr15:40751633C>T	ENST00000416165.1	+	2	1041	c.970C>T	c.(970-972)Ctg>Ttg	p.L324L	BAHD1_ENST00000561234.1_Silent_p.L324L|BAHD1_ENST00000560846.1_Silent_p.L324L	NM_014952.3	NP_055767.3	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	324	Pro-rich.				heterochromatin assembly (GO:0031507)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)	chromatin binding (GO:0003682)			NS(1)|endometrium(6)|kidney(3)|large_intestine(3)|lung(10)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	28		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		ACAGGCGGCTCTGAAGCCGGA	0.667																																							uc001zlu.2		NA																	0					0						c.(970-972)CTG>TTG		bromo adjacent homology domain containing 1							31.0	40.0	37.0					15																	40751633		2201	4298	6499	SO:0001819	synonymous_variant	22893				heterochromatin formation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin silencing complex|chromosome	chromatin binding|DNA binding|protein binding	g.chr15:40751633C>T	AL833923	CCDS10058.1, CCDS73705.1	15q14	2005-11-10			ENSG00000140320	ENSG00000140320			29153	protein-coding gene	gene with protein product		613880				10231032	Standard	XM_005254229		Approved	KIAA0945	uc001zlu.2	Q8TBE0	OTTHUMG00000129982	ENST00000416165.1:c.970C>T	15.37:g.40751633C>T						BAHD1_uc001zlt.2_Silent_p.L324L|BAHD1_uc010bbp.1_Silent_p.L324L|BAHD1_uc001zlv.2_Silent_p.L324L	p.L324L	NM_014952	NP_055767	Q8TBE0	BAHD1_HUMAN		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)	2	1041	+		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)	324			Pro-rich.		Q8NDF7|Q9Y2F4	Silent	SNP	ENST00000416165.1	37	c.970C>T	CCDS10058.1																																																																																				0.667	BAHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252248.1	NM_014952		30	55	0	0	0	0.007291	0	30	55				
CTDSPL2	51496	broad.mit.edu	37	15	44751319	44751319	+	Nonsense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr15:44751319C>G	ENST00000260327.4	+	2	670	c.107C>G	c.(106-108)tCa>tGa	p.S36*	CTDSPL2_ENST00000558966.1_Nonsense_Mutation_p.S36*|CTDSPL2_ENST00000558373.1_Nonsense_Mutation_p.S36*|CTDSPL2_ENST00000396780.1_Nonsense_Mutation_p.S36*	NM_016396.2	NP_057480.2	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2	36							phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	13		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		AGCCTGCCTTCAGGAGGAGAA	0.393																																							uc001ztr.2		NA																	0					0						c.(106-108)TCA>TGA		CTD (carboxy-terminal domain, RNA polymerase II,							103.0	108.0	106.0					15																	44751319		2198	4298	6496	SO:0001587	stop_gained	51496						phosphoprotein phosphatase activity	g.chr15:44751319C>G	AF161478	CCDS10110.1	15q15.3-q21.1	2010-06-21			ENSG00000137770	ENSG00000137770		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	26936	protein-coding gene	gene with protein product							Standard	NM_016396		Approved	HSPC129, FLJ10523	uc001ztr.3	Q05D32	OTTHUMG00000131159	ENST00000260327.4:c.107C>G	15.37:g.44751319C>G	ENSP00000260327:p.Ser36*					CTDSPL2_uc001zts.2_Nonsense_Mutation_p.S36*|CTDSPL2_uc001ztt.2_Nonsense_Mutation_p.S36*|CTDSPL2_uc010bdv.2_Nonsense_Mutation_p.S36*	p.S36*	NM_016396	NP_057480	Q05D32	CTSL2_HUMAN		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)	2	523	+		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)	36					Q3ZTU1|Q6AI06|Q8IYI9|Q9NVT2|Q9NZX8|Q9P030	Nonsense_Mutation	SNP	ENST00000260327.4	37	c.107C>G	CCDS10110.1	.	.	.	.	.	.	.	.	.	.	C	37	6.298089	0.97453	.	.	ENSG00000137770	ENST00000260327;ENST00000396780	.	.	.	5.38	4.46	0.54185	.	1.366100	0.04495	N	0.380280	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-3.505	3.6334	0.08140	0.0:0.545:0.2128:0.2422	.	.	.	.	X	36	.	ENSP00000260327:S36X	S	+	2	0	CTDSPL2	42538611	0.049000	0.20398	1.000000	0.80357	0.998000	0.95712	0.975000	0.29449	2.522000	0.85027	0.650000	0.86243	TCA		0.393	CTDSPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253851.1	NM_016396		30	75	0	0	0	0.015359	0	30	75				
RFX7	64864	broad.mit.edu	37	15	56385610	56385610	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr15:56385610G>A	ENST00000559447.2	-	9	4296	c.4025C>T	c.(4024-4026)tCt>tTt	p.S1342F	RFX7_ENST00000422057.1_Intron|RFX7_ENST00000423270.1_Missense_Mutation_p.S1439F|RFX7_ENST00000317318.6_Intron			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	1342					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						TGAAGTCATAGAATTCATGGA	0.368																																							uc010bfn.2		NA																	0					0						c.(4315-4317)TCT>TTT		regulatory factor X domain containing 2							108.0	97.0	100.0					15																	56385610		1866	4094	5960	SO:0001583	missense	64864				regulation of transcription, DNA-dependent	nucleus	DNA binding	g.chr15:56385610G>A			15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.4025C>T	15.37:g.56385610G>A	ENSP00000453281:p.Ser1342Phe					RFX7_uc010ugk.1_Intron|RFX7_uc002adn.1_Intron	p.S1439F	NM_022841	NP_073752	Q2KHR2	RFX7_HUMAN			9	4316	-			1342					Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Missense_Mutation	SNP	ENST00000559447.2	37	c.4316C>T		.	.	.	.	.	.	.	.	.	.	G	15.35	2.807864	0.50421	.	.	ENSG00000181827	ENST00000423270	T	0.59364	0.27	5.87	5.87	0.94306	.	0.000000	0.36740	U	0.002438	T	0.56016	0.1957	L	0.27053	0.805	0.52099	D	0.999941	P	0.48407	0.91	P	0.47470	0.548	T	0.59484	-0.7446	10	0.87932	D	0	-10.5804	19.5705	0.95413	0.0:0.0:1.0:0.0	.	1342	Q2KHR2	RFX7_HUMAN	F	1439	ENSP00000397644:S1439F	ENSP00000397644:S1439F	S	-	2	0	RFX7	54172902	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.420000	0.97426	2.941000	0.99782	0.655000	0.94253	TCT		0.368	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	protein_coding	OTTHUMT00000418841.3	NM_022841		5	36	0	0	0	0.014758	0	5	36				
RASGRF1	5923	broad.mit.edu	37	15	79323749	79323750	+	Missense_Mutation	DNP	GC	GC	CT			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr15:79323749_79323750GC>CT	ENST00000419573.3	-	8	1528_1529	c.1254_1255GC>AG	c.(1252-1257)gaGCtg>gaAGtg	p.L419V	RASGRF1_ENST00000558480.2_Missense_Mutation_p.L419V|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	419	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CACCTGGACAGCTCCTCCAGTT	0.619																																							uc002beq.2		NA																	0				skin(4)|ovary(1)|central_nervous_system(1)	6						c.(1252-1257)GAGCTG>GAAGTG		Ras protein-specific guanine																																				SO:0001583	missense	5923				activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity	g.chr15:79323749_79323750GC>CT	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.1254_1255delinsCT	15.37:g.79323749_79323750delinsCT	ENSP00000405963:p.Leu419Val					RASGRF1_uc002bep.2_Missense_Mutation_p.L419V|RASGRF1_uc010blm.1_Missense_Mutation_p.L341V|RASGRF1_uc002ber.3_Missense_Mutation_p.L419V	p.L419V	NM_002891	NP_002882	Q13972	RGRF1_HUMAN			8	1629_1630	-			419			DH.		F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	DNP	ENST00000419573.3	37	c.1254_1255GC>AG	CCDS10309.1																																																																																				0.619	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891		6	10	0	0	0	0.004672	0	6	10				
PTX4	390667	broad.mit.edu	37	16	1537675	1537675	+	Silent	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr16:1537675C>T	ENST00000447419.2	-	2	463	c.438G>A	c.(436-438)caG>caA	p.Q146Q	PTX4_ENST00000440447.2_Intron|PTX4_ENST00000293922.1_Silent_p.Q141Q			Q96A99	PTX4_HUMAN	pentraxin 4, long	146						extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						GGGCGTCCCTCTGGGCCTTGT	0.726																																							uc010uvf.1		NA																	0					0						c.(421-423)CAG>CAA		neuronal pentraxin II-like							25.0	31.0	29.0					16																	1537675		2194	4291	6485	SO:0001819	synonymous_variant	390667					extracellular region	metal ion binding	g.chr16:1537675C>T		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.438G>A	16.37:g.1537675C>T							p.Q141Q	NM_001013658	NP_001013680	Q96A99	PTX4_HUMAN			2	423	-			146						Silent	SNP	ENST00000447419.2	37	c.423G>A																																																																																					0.726	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432526.1	NM_001013658		9	40	0	0	0	0.006214	0	9	40				
KIAA0430	9665	broad.mit.edu	37	16	15706555	15706555	+	Silent	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr16:15706555C>G	ENST00000396368.3	-	17	3539	c.3333G>C	c.(3331-3333)ctG>ctC	p.L1111L	KIAA0430_ENST00000548025.1_Silent_p.L1108L|KIAA0430_ENST00000540441.2_Silent_p.L946L|CTB-193M12.1_ENST00000549756.1_RNA|KIAA0430_ENST00000551742.1_Silent_p.L1111L|KIAA0430_ENST00000602337.1_Silent_p.L1108L|KIAA0430_ENST00000344181.3_Silent_p.L713L	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	1111	HTH OST-type 3. {ECO:0000255|PROSITE- ProRule:PRU00975}.				double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						GCTGGCTTTTCAGCAAGTCAA	0.468																																							uc002ddr.2		NA																	0					0						c.(3331-3333)CTG>CTC		limkain b1							221.0	221.0	221.0					16																	15706555		1971	4176	6147	SO:0001819	synonymous_variant	9665					peroxisome	nucleotide binding|RNA binding	g.chr16:15706555C>G	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.3333G>C	16.37:g.15706555C>G						KIAA0430_uc002ddq.2_Silent_p.L945L|KIAA0430_uc010uzv.1_Silent_p.L1107L|KIAA0430_uc010uzw.1_Silent_p.L1110L	p.L1111L	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN			17	3526	-			1110					A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Silent	SNP	ENST00000396368.3	37	c.3333G>C	CCDS10562.2																																																																																				0.468	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252131.2	NM_014647		53	157	0	0	0	0.01441	0	53	157				
DNAH3	55567	broad.mit.edu	37	16	20952856	20952856	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr16:20952856C>T	ENST00000261383.3	-	59	11520	c.11521G>A	c.(11521-11523)Gag>Aag	p.E3841K	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3841					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GCCAACTCCTCAACCACTTCC	0.458																																							uc010vbe.1		NA																	0				ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18						c.(11521-11523)GAG>AAG		dynein, axonemal, heavy chain 3							111.0	104.0	106.0					16																	20952856		2201	4300	6501	SO:0001583	missense	55567				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr16:20952856C>T	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.11521G>A	16.37:g.20952856C>T	ENSP00000261383:p.Glu3841Lys					DNAH3_uc010vbd.1_Missense_Mutation_p.E1276K	p.E3841K	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN		GBM - Glioblastoma multiforme(48;0.207)	59	11521	-			3841					O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	c.11521G>A	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	14.19	2.461932	0.43736	.	.	ENSG00000158486	ENST00000261383	T	0.07021	3.23	5.79	2.65	0.31530	Dynein heavy chain (1);	0.282865	0.32028	N	0.006693	T	0.07593	0.0191	N	0.25992	0.78	0.80722	D	1	B	0.30211	0.273	B	0.37198	0.243	T	0.06954	-1.0798	10	0.05833	T	0.94	.	16.9021	0.86116	0.0:0.6395:0.3605:0.0	.	3841	Q8TD57	DYH3_HUMAN	K	3841	ENSP00000261383:E3841K	ENSP00000261383:E3841K	E	-	1	0	DNAH3	20860357	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	1.895000	0.39778	0.319000	0.23209	0.655000	0.94253	GAG		0.458	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539		42	119	0	0	0	0.010771	0	42	119				
NFAT5	10725	broad.mit.edu	37	16	69726596	69726596	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr16:69726596G>C	ENST00000354436.2	+	12	3132	c.2814G>C	c.(2812-2814)atG>atC	p.M938I	NFAT5_ENST00000432919.1_Missense_Mutation_p.M956I|NFAT5_ENST00000393742.2_Missense_Mutation_p.M862I|NFAT5_ENST00000566899.1_Missense_Mutation_p.M862I|NFAT5_ENST00000567239.1_Missense_Mutation_p.M955I|NFAT5_ENST00000349945.1_Missense_Mutation_p.M862I	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	938					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CTTCTCACATGATGAGTGCAT	0.448																																							uc002exm.1		NA																	0					0						c.(2812-2814)ATG>ATC		nuclear factor of activated T-cells 5 isoform c							122.0	108.0	112.0					16																	69726596		2198	4300	6498	SO:0001583	missense	10725				excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr16:69726596G>C	AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.2814G>C	16.37:g.69726596G>C	ENSP00000346420:p.Met938Ile					NFAT5_uc002exi.2_Missense_Mutation_p.M862I|NFAT5_uc002exj.1_Missense_Mutation_p.M862I|NFAT5_uc002exk.1_Missense_Mutation_p.M862I|NFAT5_uc002exl.1_Missense_Mutation_p.M956I|NFAT5_uc002exn.1_Missense_Mutation_p.M955I|NFAT5_uc002exo.1_5'Flank	p.M938I	NM_006599	NP_006590	O94916	NFAT5_HUMAN			12	4022	+			938					A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	ENST00000354436.2	37	c.2814G>C	CCDS10881.1	.	.	.	.	.	.	.	.	.	.	G	7.555	0.663535	0.14710	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.49	4.53	0.55603	.	0.402668	0.31809	N	0.007032	T	0.23688	0.0573	N	0.17474	0.49	0.32400	N	0.552008	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.24225	-1.0166	10	0.12430	T	0.62	-2.6082	9.7744	0.40609	0.2157:0.0:0.7843:0.0	.	955;938;956	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	I	956;955;862;938;862	ENSP00000396538:M956I;ENSP00000338806:M862I;ENSP00000346420:M938I;ENSP00000377343:M862I	ENSP00000338806:M862I	M	+	3	0	NFAT5	68284097	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.887000	0.28254	1.443000	0.47586	0.655000	0.94253	ATG		0.448	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714		3	85	0	0	0	0.004672	0	3	85				
CHST5	23563	broad.mit.edu	37	16	75563963	75563963	+	Missense_Mutation	SNP	G	G	A	rs577930949		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr16:75563963G>A	ENST00000336257.3	-	3	1714	c.320C>T	c.(319-321)gCg>gTg	p.A107V	RP11-77K12.7_ENST00000460606.1_3'UTR|CHST5_ENST00000541075.1_Missense_Mutation_p.A113V	NM_024533.4	NP_078809.2	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5	107					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)	24						CAGCGTTGCCGCGCTGCCCTG	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		18220	0.001		0.0	False		,,,				2504	0.0						uc002fei.2		NA																	0					0						c.(319-321)GCG>GTG		carbohydrate (N-acetylglucosamine 6-O)							56.0	50.0	52.0					16																	75563963		2198	4300	6498	SO:0001583	missense	23563				N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane	N-acetylglucosamine 6-O-sulfotransferase activity	g.chr16:75563963G>A	AF176839	CCDS10919.1	16q23.1	2008-02-05			ENSG00000135702	ENSG00000135702		"""Sulfotransferases, membrane-bound"""	1973	protein-coding gene	gene with protein product		604817				10491328, 11017086	Standard	NM_024533		Approved	I-GLCNAC-6-ST, FLJ22167	uc002fei.3	Q9GZS9	OTTHUMG00000137610	ENST00000336257.3:c.320C>T	16.37:g.75563963G>A	ENSP00000338783:p.Ala107Val					CHST5_uc002fej.1_Missense_Mutation_p.A113V	p.A107V	NM_024533	NP_078809	Q9GZS9	CHST5_HUMAN			3	1715	-			107			Lumenal (Potential).		B2RV23|Q7LCN3|Q9UBY3	Missense_Mutation	SNP	ENST00000336257.3	37	c.320C>T	CCDS10919.1	.	.	.	.	.	.	.	.	.	.	G	7.819	0.717284	0.15372	.	.	ENSG00000135702	ENST00000336257;ENST00000541075	D;D	0.82711	-1.64;-1.64	2.73	2.73	0.32206	Sulfotransferase domain (1);	0.121556	0.53938	D	0.000051	D	0.89058	0.6607	M	0.86268	2.805	0.18873	N	0.999984	D;D	0.62365	0.988;0.991	P;P	0.58721	0.758;0.844	T	0.81714	-0.0807	10	0.54805	T	0.06	.	12.3965	0.55389	0.0:0.0:1.0:0.0	.	113;107	Q9GZS9-2;Q9GZS9	.;CHST5_HUMAN	V	107;113	ENSP00000338783:A107V;ENSP00000441220:A113V	ENSP00000338783:A107V	A	-	2	0	CHST5	74121464	1.000000	0.71417	0.023000	0.16930	0.024000	0.10985	3.476000	0.53143	1.514000	0.48869	0.313000	0.20887	GCG		0.612	CHST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269025.2	NM_012126		14	56	0	0	0	0.003163	0	14	56				
CDH13	1012	broad.mit.edu	37	16	83816885	83816885	+	Nonsense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr16:83816885C>T	ENST00000566620.1	+	13	2232	c.1942C>T	c.(1942-1944)Caa>Taa	p.Q648*	CDH13_ENST00000268613.10_Nonsense_Mutation_p.Q695*|CDH13_ENST00000428848.3_Nonsense_Mutation_p.Q609*	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	648	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		AAGCCTTCTTCAAAATCTGAA	0.453																																							uc002fgx.2		NA																	0				large_intestine(1)	1						c.(1942-1944)CAA>TAA		cadherin 13 preproprotein							80.0	75.0	76.0					16																	83816885		1958	4144	6102	SO:0001587	stop_gained	1012				adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding	g.chr16:83816885C>T	U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.1942C>T	16.37:g.83816885C>T	ENSP00000454435:p.Gln648*					CDH13_uc010vns.1_Nonsense_Mutation_p.Q695*|CDH13_uc010vnt.1_Nonsense_Mutation_p.Q394*|CDH13_uc010vnu.1_Nonsense_Mutation_p.Q609*	p.Q648*	NM_001257	NP_001248	P55290	CAD13_HUMAN		COAD - Colon adenocarcinoma(5;0.0268)	13	2062	+		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)	648			Cadherin 5.		A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Nonsense_Mutation	SNP	ENST00000566620.1	37	c.1942C>T	CCDS58486.1	.	.	.	.	.	.	.	.	.	.	C	38	6.890294	0.97912	.	.	ENSG00000140945	ENST00000268613;ENST00000428848;ENST00000536143;ENST00000538855;ENST00000539548;ENST00000540531	.	.	.	5.19	5.19	0.71726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.7052	0.88306	0.0:1.0:0.0:0.0	.	.	.	.	X	695;648;609;350;207;338	.	ENSP00000268613:Q695X	Q	+	1	0	CDH13	82374386	1.000000	0.71417	0.946000	0.38457	0.818000	0.46254	6.989000	0.76219	2.410000	0.81850	0.655000	0.94253	CAA		0.453	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432917.1	NM_001257		5	23	0	0	0	0.001168	0	5	23				
RAI1	10743	broad.mit.edu	37	17	17697979	17697979	+	Nonsense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr17:17697979C>T	ENST00000353383.1	+	3	2186	c.1717C>T	c.(1717-1719)Cag>Tag	p.Q573*	RAI1_ENST00000261641.6_Nonsense_Mutation_p.Q573*	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	573					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		CGACTCCTTCCAGAGCCTACA	0.622																																							uc002grm.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1717-1719)CAG>TAG		retinoic acid induced 1							93.0	87.0	89.0					17																	17697979		2202	4300	6502	SO:0001587	stop_gained	10743					cytoplasm|nucleus	zinc ion binding	g.chr17:17697979C>T	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.1717C>T	17.37:g.17697979C>T	ENSP00000323074:p.Gln573*					RAI1_uc002grn.1_Nonsense_Mutation_p.Q573*	p.Q573*	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN		READ - Rectum adenocarcinoma(1115;0.0276)	3	2186	+			573					Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Nonsense_Mutation	SNP	ENST00000353383.1	37	c.1717C>T	CCDS11188.1	.	.	.	.	.	.	.	.	.	.	C	42	9.211897	0.99101	.	.	ENSG00000108557	ENST00000353383;ENST00000395774;ENST00000395776;ENST00000355970;ENST00000261641;ENST00000315321	.	.	.	5.18	5.18	0.71444	.	0.079098	0.53938	D	0.000053	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	18.6855	0.91562	0.0:1.0:0.0:0.0	.	.	.	.	X	573;573;573;573;573;525	.	ENSP00000261641:Q573X	Q	+	1	0	RAI1	17638704	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	6.079000	0.71291	2.423000	0.82170	0.561000	0.74099	CAG		0.622	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665		25	124	0	0	0	0.00632	0	25	124				
EPN2	22905	broad.mit.edu	37	17	19186886	19186886	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr17:19186886G>C	ENST00000314728.5	+	3	938	c.454G>C	c.(454-456)Gag>Cag	p.E152Q	EPN2_ENST00000571254.1_Missense_Mutation_p.E152Q|EPN2_ENST00000395620.2_Missense_Mutation_p.E152Q|EPN2_ENST00000347697.2_Missense_Mutation_p.E152Q|EPN2_ENST00000395626.1_Missense_Mutation_p.E152Q|EPN2_ENST00000395618.3_Intron|EPN2_ENST00000575595.1_Intron	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2	152					embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					CAAAACCAAAGAGCGCATGGC	0.602																																							uc002gvd.3		NA																	0				skin(1)	1						c.(454-456)GAG>CAG		epsin 2 isoform b							50.0	52.0	51.0					17																	19186886		2203	4300	6503	SO:0001583	missense	22905				endocytosis		lipid binding	g.chr17:19186886G>C	AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.454G>C	17.37:g.19186886G>C	ENSP00000320543:p.Glu152Gln					EPN2_uc002gvc.2_Missense_Mutation_p.E152Q|EPN2_uc010vyn.1_Missense_Mutation_p.E152Q|EPN2_uc010cql.1_Intron|EPN2_uc002gve.3_Missense_Mutation_p.E152Q|EPN2_uc002gvf.3_Intron|EPN2_uc010vyo.1_Intron|EPN2_uc002gvg.1_Missense_Mutation_p.E152Q|EPN2_uc010vyp.1_Missense_Mutation_p.E152Q|EPN2_uc010vyq.1_Missense_Mutation_p.E152Q|EPN2_uc002gvh.1_Missense_Mutation_p.E152Q	p.E152Q	NM_014964	NP_055779	O95208	EPN2_HUMAN			3	902	+	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)		152					A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	Missense_Mutation	SNP	ENST00000314728.5	37	c.454G>C	CCDS11203.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.180360	0.78677	.	.	ENSG00000072134	ENST00000347697;ENST00000314728;ENST00000395628;ENST00000395620;ENST00000395626	T;T;T;T;T	0.32515	2.42;2.52;1.45;2.42;1.53	4.96	4.96	0.65561	ENTH/VHS (1);	0.046546	0.85682	D	0.000000	T	0.59865	0.2225	M	0.80616	2.505	0.54753	D	0.999983	D;D;B;D;D;P	0.76494	0.999;0.996;0.351;0.995;0.999;0.71	D;P;B;D;D;B	0.76575	0.988;0.76;0.055;0.974;0.988;0.276	T	0.66143	-0.5997	10	0.87932	D	0	-26.3872	18.5638	0.91110	0.0:0.0:1.0:0.0	.	152;152;152;152;152;152	Q52LD0;B7ZKM5;E9PBC1;E7EMC3;E9PBC2;O95208	.;.;.;.;.;EPN2_HUMAN	Q	152	ENSP00000261495:E152Q;ENSP00000320543:E152Q;ENSP00000378990:E152Q;ENSP00000378982:E152Q;ENSP00000378988:E152Q	ENSP00000320543:E152Q	E	+	1	0	EPN2	19127479	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.637000	0.74304	2.436000	0.82500	0.561000	0.74099	GAG		0.602	EPN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132283.3	NM_014964		23	56	0	0	0	0.01892	0	23	56				
ATAD5	79915	broad.mit.edu	37	17	29219790	29219790	+	Nonsense_Mutation	SNP	T	T	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr17:29219790T>G	ENST00000321990.4	+	20	4802	c.4424T>G	c.(4423-4425)tTa>tGa	p.L1475*		NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1475					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				TCTGAAGACTTATTTTCATTT	0.323																																							uc002hfs.1		NA																	0				ovary(3)	3						c.(4423-4425)TTA>TGA		ATPase family, AAA domain containing 5							135.0	133.0	134.0					17																	29219790		2203	4300	6503	SO:0001587	stop_gained	79915				response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity	g.chr17:29219790T>G		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.4424T>G	17.37:g.29219790T>G	ENSP00000313171:p.Leu1475*						p.L1475*	NM_024857	NP_079133	Q96QE3	ATAD5_HUMAN			20	4770	+		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)	1475					Q05DH0|Q69YR6|Q9H9I1	Nonsense_Mutation	SNP	ENST00000321990.4	37	c.4424T>G	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	T	46	12.115262	0.99637	.	.	ENSG00000176208	ENST00000321990	.	.	.	5.0	5.0	0.66597	.	0.647457	0.15396	N	0.264576	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0255	0.71667	0.0:0.0:0.0:1.0	.	.	.	.	X	1475	.	ENSP00000313171:L1475X	L	+	2	0	ATAD5	26243916	0.992000	0.36948	0.990000	0.47175	0.993000	0.82548	5.087000	0.64480	2.007000	0.58848	0.402000	0.26972	TTA		0.323	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857		25	86	0	0	0	0.021523	0	25	86				
GPATCH8	23131	broad.mit.edu	37	17	42477876	42477876	+	Silent	SNP	C	C	T	rs149798216		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr17:42477876C>T	ENST00000591680.1	-	8	1599	c.1569G>A	c.(1567-1569)ggG>ggA	p.G523G	GPATCH8_ENST00000434000.1_Silent_p.G445G	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	523							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		GGCTTTCTTTCCCTGCTGGGG	0.458											OREG0024461	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002igw.1		NA																	0				ovary(2)|kidney(1)|skin(1)	4						c.(1567-1569)GGG>GGA		G patch domain containing 8		C		1,4405	2.1+/-5.4	0,1,2202	81.0	81.0	81.0		1569	2.9	1.0	17	dbSNP_134	81	0,8600		0,0,4300	no	coding-synonymous	GPATCH8	NM_001002909.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		523/1503	42477876	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23131					intracellular	nucleic acid binding|zinc ion binding	g.chr17:42477876C>T	AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.1569G>A	17.37:g.42477876C>T			OREG0024461	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	909	GPATCH8_uc002igv.1_Silent_p.G445G|GPATCH8_uc010wiz.1_Silent_p.G445G	p.G523G	NM_001002909	NP_001002909	Q9UKJ3	GPTC8_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.206)	8	1633	-		Prostate(33;0.0181)	523					B9EGP9|O60300|Q8TB99	Silent	SNP	ENST00000591680.1	37	c.1569G>A	CCDS32666.1																																																																																				0.458	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1	NM_001002909		19	54	0	0	0	0.007413	0	19	54				
TEX2	55852	broad.mit.edu	37	17	62271034	62271034	+	Silent	SNP	G	G	C	rs370141908		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr17:62271034G>C	ENST00000583097.1	-	4	2233	c.2061C>G	c.(2059-2061)ctC>ctG	p.L687L	TEX2_ENST00000258991.3_Silent_p.L687L|TEX2_ENST00000584379.1_Silent_p.L687L			Q8IWB9	TEX2_HUMAN	testis expressed 2	687					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		CAAAGAGATAGAGTATCTGAT	0.493																																							uc002jec.2		NA																	0				ovary(1)	1						c.(2059-2061)CTC>CTG		testis expressed sequence 2							137.0	132.0	134.0					17																	62271034		2203	4300	6503	SO:0001819	synonymous_variant	55852				signal transduction|sphingolipid metabolic process	integral to membrane		g.chr17:62271034G>C	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.2061C>G	17.37:g.62271034G>C						TEX2_uc002jed.2_Silent_p.L687L|TEX2_uc002jee.2_Silent_p.L687L	p.L687L	NM_018469	NP_060939	Q8IWB9	TEX2_HUMAN	BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)	4	2234	-			687					Q6AHZ5|Q8N3L0|Q9C0C5	Silent	SNP	ENST00000583097.1	37	c.2061C>G																																																																																					0.493	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469		29	104	0	0	0	0.00632	0	29	104				
CLUL1	27098	broad.mit.edu	37	18	633421	633421	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr18:633421C>T	ENST00000400606.2	+	6	1125	c.980C>T	c.(979-981)gCt>gTt	p.A327V	CLUL1_ENST00000579494.1_Missense_Mutation_p.A327V|CLUL1_ENST00000581619.1_Missense_Mutation_p.A352V|CLUL1_ENST00000540035.1_Missense_Mutation_p.A379V|CLUL1_ENST00000338387.7_Missense_Mutation_p.A327V	NM_014410.4	NP_055225.1	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal)	327					cell death (GO:0008219)	extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(5)|large_intestine(5)|liver(2)|lung(7)|ovary(2)|skin(1)	24						AAATGTCAGGCTCACCTATCT	0.353																																							uc002kkp.2		NA																	0				ovary(2)	2						c.(979-981)GCT>GTT		clusterin-like 1 (retinal) precursor							71.0	68.0	69.0					18																	633421		1835	4082	5917	SO:0001583	missense	27098				cell death	extracellular region		g.chr18:633421C>T	D63813	CCDS42405.1, CCDS74187.1	18p11.32	2008-07-28				ENSG00000079101			2096	protein-coding gene	gene with protein product						10675623, 14507903	Standard	NM_199167		Approved		uc002kkq.3	Q15846		ENST00000400606.2:c.980C>T	18.37:g.633421C>T	ENSP00000383449:p.Ala327Val					CLUL1_uc010wys.1_Missense_Mutation_p.A379V|CLUL1_uc002kkq.2_Missense_Mutation_p.A327V	p.A327V	NM_014410	NP_055225	Q15846	CLUL1_HUMAN			6	1125	+			327					A0FDN7	Missense_Mutation	SNP	ENST00000400606.2	37	c.980C>T	CCDS42405.1	.	.	.	.	.	.	.	.	.	.	C	15.87	2.961903	0.53400	.	.	ENSG00000079101	ENST00000400606;ENST00000540035;ENST00000338387	T;T;T	0.23754	1.89;1.89;1.89	5.43	4.28	0.50868	Clusterin, C-terminal (1);	0.289751	0.38605	N	0.001626	T	0.18173	0.0436	N	0.22421	0.69	0.22581	N	0.998965	B;P	0.34780	0.413;0.468	B;B	0.35607	0.131;0.206	T	0.10405	-1.0631	10	0.40728	T	0.16	-8.7456	11.2319	0.48918	0.8388:0.1612:0.0:0.0	.	379;327	F5GWQ8;Q15846	.;CLUL1_HUMAN	V	327;379;327	ENSP00000383449:A327V;ENSP00000441726:A379V;ENSP00000341128:A327V	ENSP00000341128:A327V	A	+	2	0	CLUL1	623421	0.998000	0.40836	0.947000	0.38551	0.868000	0.49771	3.152000	0.50677	0.905000	0.36596	-0.262000	0.10625	GCT		0.353	CLUL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441183.1			3	37	0	0	0	0.014758	0	3	37				
ASXL3	80816	broad.mit.edu	37	18	31322928	31322928	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr18:31322928C>G	ENST00000269197.5	+	12	3116	c.3116C>G	c.(3115-3117)aCt>aGt	p.T1039S		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1039					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CGAGCATCCACTAGCACATCT	0.527																																							uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(3115-3117)ACT>AGT		additional sex combs like 3							31.0	33.0	32.0					18																	31322928		1900	4129	6029	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31322928C>G	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3116C>G	18.37:g.31322928C>G	ENSP00000269197:p.Thr1039Ser					ASXL3_uc002kxq.2_Missense_Mutation_p.T746S	p.T1039S	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN			12	3171	+			1039					Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.3116C>G	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	5.623	0.299675	0.10622	.	.	ENSG00000141431	ENST00000269197	T	0.44482	0.92	5.9	5.9	0.94986	.	1.789350	0.02476	N	0.088044	T	0.22551	0.0544	N	0.00707	-1.245	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39502	-0.9611	10	0.08837	T	0.75	.	20.2861	0.98535	0.0:1.0:0.0:0.0	.	1039	Q9C0F0	ASXL3_HUMAN	S	1039	ENSP00000269197:T1039S	ENSP00000269197:T1039S	T	+	2	0	ASXL3	29576926	0.345000	0.24835	0.346000	0.25655	0.791000	0.44710	2.448000	0.44926	2.786000	0.95864	0.650000	0.86243	ACT		0.527	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			8	20	0	0	0	0.008291	0	8	20				
MAPRE2	10982	broad.mit.edu	37	18	32712020	32712020	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr18:32712020G>C	ENST00000300249.5	+	6	955	c.775G>C	c.(775-777)Gaa>Caa	p.E259Q	MAPRE2_ENST00000413393.1_Missense_Mutation_p.E216Q|MAPRE2_ENST00000436190.2_Missense_Mutation_p.E247Q|MAPRE2_ENST00000538170.2_Missense_Mutation_p.E206Q|MAPRE2_ENST00000589699.1_Missense_Mutation_p.E216Q	NM_014268.3	NP_055083.1	Q15555	MARE2_HUMAN	microtubule-associated protein, RP/EB family, member 2	259	APC-binding.|DCTN1-binding.|EB1 C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00576}.				cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	9						ACTTGCCCTTGAAGGCGTGGA	0.433																																							uc002kyg.2		NA																	0				ovary(1)	1						c.(775-777)GAA>CAA		microtubule-associated protein, RP/EB family,							87.0	80.0	82.0					18																	32712020		2203	4300	6503	SO:0001583	missense	10982				cell division|cell proliferation|mitosis|signal transduction	cytoplasm|microtubule	microtubule binding	g.chr18:32712020G>C	X94232	CCDS11910.1, CCDS45850.1, CCDS45851.1, CCDS58619.1	18q12.1	2013-01-17			ENSG00000166974	ENSG00000166974			6891	protein-coding gene	gene with protein product	"""APC-binding protein EB1"""	605789				9233623, 12475954	Standard	NM_001143826		Approved	RP1, EB1, EB2	uc010xcc.3	Q15555	OTTHUMG00000132551	ENST00000300249.5:c.775G>C	18.37:g.32712020G>C	ENSP00000300249:p.Glu259Gln					MAPRE2_uc010xcb.1_Missense_Mutation_p.E216Q|MAPRE2_uc010xcc.1_Missense_Mutation_p.E247Q|MAPRE2_uc002kyh.2_Missense_Mutation_p.E206Q|MAPRE2_uc010xcd.1_Missense_Mutation_p.E216Q	p.E259Q	NM_014268	NP_055083	Q15555	MARE2_HUMAN			6	955	+			259			DCTN1-binding.|APC-binding.|EB1 C-terminal.		B2RE21|B3KR39|B4DJV4|B7Z2L3|E9PHR3|F5H1V8|G5E9I6|Q9UQ33	Missense_Mutation	SNP	ENST00000300249.5	37	c.775G>C	CCDS11910.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.669860	0.88348	.	.	ENSG00000166974	ENST00000413393;ENST00000436190;ENST00000300249;ENST00000538170	T;T;T;T	0.50277	0.78;0.77;0.76;0.75	5.87	5.87	0.94306	EB1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.63861	0.2547	L	0.49256	1.55	0.80722	D	1	P;D;D	0.67145	0.931;0.994;0.996	P;D;P	0.66602	0.566;0.945;0.882	T	0.57051	-0.7877	10	0.35671	T	0.21	-20.2899	20.2045	0.98273	0.0:0.0:1.0:0.0	.	247;206;259	E9PHR3;F5H1V8;Q15555	.;.;MARE2_HUMAN	Q	216;247;259;206	ENSP00000396074:E216Q;ENSP00000407723:E247Q;ENSP00000300249:E259Q;ENSP00000446343:E206Q	ENSP00000300249:E259Q	E	+	1	0	MAPRE2	30966018	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.827000	0.99397	2.780000	0.95670	0.650000	0.86243	GAA		0.433	MAPRE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255753.2	NM_014268		7	33	0	0	0	0.006214	0	7	33				
SETBP1	26040	broad.mit.edu	37	18	42530706	42530706	+	Silent	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr18:42530706G>A	ENST00000282030.5	+	4	1697	c.1401G>A	c.(1399-1401)ttG>ttA	p.L467L		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	467						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TCCCTAAGTTGAGTAAAATGA	0.478									Schinzel-Giedion syndrome																														uc010dni.2		NA																	0				upper_aerodigestive_tract(2)|large_intestine(1)	3						c.(1399-1401)TTG>TTA		SET binding protein 1 isoform a							85.0	87.0	86.0					18																	42530706		2203	4300	6503	SO:0001819	synonymous_variant	26040	Schinzel-Giedion_syndrome	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome		nucleus	DNA binding	g.chr18:42530706G>A	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.1401G>A	18.37:g.42530706G>A							p.L467L	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN		Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)	4	1697	+			467					A6H8W5|Q6P6C3|Q9UEF3	Silent	SNP	ENST00000282030.5	37	c.1401G>A	CCDS11923.2																																																																																				0.478	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110		25	79	0	0	0	0.004656	0	25	79				
ALPK2	115701	broad.mit.edu	37	18	56171257	56171257	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr18:56171257C>G	ENST00000361673.3	-	11	6366	c.6153G>C	c.(6151-6153)ttG>ttC	p.L2051F		NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	2051	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						ATTCTCTTCTCAAGAAGTTTA	0.478																																							uc002lhj.3		NA																	0				ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						c.(6151-6153)TTG>TTC		heart alpha-kinase							192.0	182.0	185.0					18																	56171257		2203	4300	6503	SO:0001583	missense	115701						ATP binding|protein serine/threonine kinase activity	g.chr18:56171257C>G	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.6153G>C	18.37:g.56171257C>G	ENSP00000354991:p.Leu2051Phe						p.L2051F	NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN			11	6367	-			2051			Alpha-type protein kinase.		Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	c.6153G>C	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	C	18.51	3.638996	0.67130	.	.	ENSG00000198796	ENST00000361673	T	0.14022	2.54	5.63	2.73	0.32206	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.232058	0.27720	N	0.018133	T	0.26557	0.0649	L	0.46157	1.445	0.34413	D	0.696605	D	0.60160	0.987	D	0.68192	0.956	T	0.32214	-0.9915	10	0.72032	D	0.01	-0.7153	10.7523	0.46216	0.0:0.6777:0.2535:0.0688	.	2051	Q86TB3	ALPK2_HUMAN	F	2051	ENSP00000354991:L2051F	ENSP00000354991:L2051F	L	-	3	2	ALPK2	54322237	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	3.807000	0.55591	0.725000	0.32318	0.644000	0.83932	TTG		0.478	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		36	142	0	0	0	0.015359	0	36	142				
ALPK2	115701	broad.mit.edu	37	18	56171311	56171311	+	Silent	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr18:56171311C>G	ENST00000361673.3	-	11	6312	c.6099G>C	c.(6097-6099)ctG>ctC	p.L2033L		NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	2033	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						ATTCTCCAATCAGCTCCTCCT	0.448																																							uc002lhj.3		NA																	0				ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						c.(6097-6099)CTG>CTC		heart alpha-kinase							177.0	171.0	173.0					18																	56171311		2203	4300	6503	SO:0001819	synonymous_variant	115701						ATP binding|protein serine/threonine kinase activity	g.chr18:56171311C>G	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.6099G>C	18.37:g.56171311C>G							p.L2033L	NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN			11	6313	-			2033			Alpha-type protein kinase.		Q6ZUX0|Q8NAT5|Q96L95	Silent	SNP	ENST00000361673.3	37	c.6099G>C	CCDS11966.2																																																																																				0.448	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		41	155	0	0	0	0.01441	0	41	155				
CHAF1A	10036	broad.mit.edu	37	19	4418063	4418063	+	Missense_Mutation	SNP	G	G	C	rs377259547		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr19:4418063G>C	ENST00000301280.5	+	4	1108	c.1007G>C	c.(1006-1008)aGa>aCa	p.R336T		NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	336	Arg/Glu/Lys-rich.				cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		AACAAGCTCAGACTGCAAAGA	0.363								Chromatin Structure																															uc002mal.2		NA																	0				ovary(1)|skin(1)	2						c.(1006-1008)AGA>ACA	Chromatin_Structure	chromatin assembly factor 1, subunit A (p150)		G	THR/ARG	1,4405	2.1+/-5.4	0,1,2202	92.0	97.0	95.0		1007	-1.1	0.0	19		95	0,8600		0,0,4300	no	missense	CHAF1A	NM_005483.2	71	0,1,6502	CC,CG,GG		0.0,0.0227,0.0077	possibly-damaging	336/957	4418063	1,13005	2203	4300	6503	SO:0001583	missense	10036				cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|WINAC complex	chromatin binding|chromo shadow domain binding|unfolded protein binding	g.chr19:4418063G>C	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.1007G>C	19.37:g.4418063G>C	ENSP00000301280:p.Arg336Thr						p.R336T	NM_005483	NP_005474	Q13111	CAF1A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)	4	1107	+		Hepatocellular(1079;0.137)	336			Arg/Glu/Lys-rich.		Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	ENST00000301280.5	37	c.1007G>C	CCDS32875.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.014322	0.35511	2.27E-4	0.0	ENSG00000167670	ENST00000344143;ENST00000535117;ENST00000301280	T	0.05319	3.46	4.87	-1.06	0.10002	.	.	.	.	.	T	0.08802	0.0218	L	0.50333	1.59	0.22779	N	0.998744	P	0.48162	0.906	P	0.46585	0.521	T	0.21759	-1.0236	9	0.87932	D	0	-8.4094	7.8966	0.29710	0.4364:0.0:0.5636:0.0	.	336	Q13111	CAF1A_HUMAN	T	336	ENSP00000301280:R336T	ENSP00000301280:R336T	R	+	2	0	CHAF1A	4369063	0.836000	0.29430	0.023000	0.16930	0.987000	0.75469	0.181000	0.16880	-0.368000	0.08040	0.563000	0.77884	AGA		0.363	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458310.2	NM_005483		16	60	0	0	0	0.003163	0	16	60				
EMR1	2015	broad.mit.edu	37	19	6937389	6937389	+	Silent	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr19:6937389C>T	ENST00000312053.4	+	19	2554	c.2517C>T	c.(2515-2517)ttC>ttT	p.F839F	EMR1_ENST00000381404.4_Silent_p.F820F|EMR1_ENST00000381407.5_Silent_p.F698F|EMR1_ENST00000450315.3_Silent_p.F662F|EMR1_ENST00000250572.8_Silent_p.F774F	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	839					cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					AGGGGGCCTTCATCTTCCTCA	0.612																																							uc002mfw.2		NA																	0				ovary(3)|lung(1)|skin(1)	5						c.(2515-2517)TTC>TTT		egf-like module containing, mucin-like, hormone							119.0	105.0	110.0					19																	6937389		2203	4300	6503	SO:0001819	synonymous_variant	2015				cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr19:6937389C>T	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.2517C>T	19.37:g.6937389C>T						EMR1_uc010dvc.2_Silent_p.F774F|EMR1_uc010dvb.2_Silent_p.F820F|EMR1_uc010xji.1_Silent_p.F698F|EMR1_uc010xjj.1_Silent_p.F662F	p.F839F	NM_001974	NP_001965	Q14246	EMR1_HUMAN			19	2555	+	all_hematologic(4;0.166)		839			Helical; Name=7; (Potential).		A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Silent	SNP	ENST00000312053.4	37	c.2517C>T	CCDS12175.1																																																																																				0.612	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458485.1			18	95	0	0	0	0.007413	0	18	95				
ATG4D	84971	broad.mit.edu	37	19	10663624	10663624	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr19:10663624C>G	ENST00000309469.4	+	10	1479	c.1306C>G	c.(1306-1308)Cag>Gag	p.Q436E	MIR1238_ENST00000408483.1_RNA|ATG4D_ENST00000540862.1_Missense_Mutation_p.Q103E|RNU7-140P_ENST00000459546.1_RNA	NM_032885.4	NP_116274.3	Q86TL0	ATG4D_HUMAN	autophagy related 4D, cysteine peptidase	436					apoptotic process (GO:0006915)|autophagy (GO:0006914)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	19			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			GGGCCATGCTCAGGACCACAG	0.672																																							uc002mov.2		NA																	0					0						c.(1306-1308)CAG>GAG		APG4 autophagy 4 homolog D							84.0	75.0	78.0					19																	10663624		2203	4300	6503	SO:0001583	missense	84971				autophagy|protein transport	cytoplasm	cysteine-type endopeptidase activity	g.chr19:10663624C>G	AJ312332	CCDS12241.1	19p13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000130734	ENSG00000130734			20789	protein-coding gene	gene with protein product		611340	"""AUT-like 4, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog D (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog D (S. cerevisiae)"""	AUTL4, APG4D		12446702	Standard	NM_032885		Approved	APG4-D	uc002mov.3	Q86TL0	OTTHUMG00000180582	ENST00000309469.4:c.1306C>G	19.37:g.10663624C>G	ENSP00000311318:p.Gln436Glu					ATG4D_uc010xlh.1_Missense_Mutation_p.Q373E|ATG4D_uc010dxh.2_RNA|ATG4D_uc010dxi.2_RNA|ATG4D_uc010dxj.2_Missense_Mutation_p.Q103E	p.Q436E	NM_032885	NP_116274	Q86TL0	ATG4D_HUMAN	Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)		10	1426	+			436					Q969K0	Missense_Mutation	SNP	ENST00000309469.4	37	c.1306C>G	CCDS12241.1	.	.	.	.	.	.	.	.	.	.	C	17.11	3.306585	0.60305	.	.	ENSG00000130734	ENST00000309469;ENST00000540862	.	.	.	4.67	4.67	0.58626	.	0.056570	0.64402	D	0.000001	T	0.54240	0.1846	L	0.49350	1.555	0.54753	D	0.999982	B;B	0.28998	0.23;0.23	B;B	0.31495	0.131;0.131	T	0.51450	-0.8704	9	0.05620	T	0.96	-24.7105	16.83	0.85941	0.0:1.0:0.0:0.0	.	373;436	B4DGM8;Q86TL0	.;ATG4D_HUMAN	E	436;103	.	ENSP00000311318:Q436E	Q	+	1	0	ATG4D	10524624	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	4.832000	0.62759	2.586000	0.87340	0.655000	0.94253	CAG		0.672	ATG4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452022.1	NM_032885		14	90	0	0	0	0.004007	0	14	90				
ZNF382	84911	broad.mit.edu	37	19	37100898	37100898	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr19:37100898C>G	ENST00000292928.2	+	3	195	c.82C>G	c.(82-84)Cag>Gag	p.Q28E	ZNF382_ENST00000439428.1_Missense_Mutation_p.Q27E|ZNF382_ENST00000435416.1_Missense_Mutation_p.Q28E|ZNF382_ENST00000423582.1_Intron	NM_001256838.1|NM_032825.4	NP_001243767.1|NP_116214.2	Q96SR6	ZN382_HUMAN	zinc finger protein 382	28	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.|Mediates interaction with TRIM28. {ECO:0000250}.|Represses transcription. {ECO:0000250}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	34	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			AGACCCTGCTCAGAAGGCGCT	0.478																																							uc002oek.2		NA																	0					0						c.(82-84)CAG>GAG		zinc finger protein 382							156.0	142.0	147.0					19																	37100898		2203	4300	6503	SO:0001583	missense	84911				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37100898C>G	AF513816	CCDS33004.1, CCDS58659.1	19q13.13	2013-01-08			ENSG00000161298	ENSG00000161298		"""Zinc fingers, C2H2-type"", ""-"""	17409	protein-coding gene	gene with protein product		609516					Standard	NM_032825		Approved	FLJ14686, KS1	uc010efb.4	Q96SR6	OTTHUMG00000048153	ENST00000292928.2:c.82C>G	19.37:g.37100898C>G	ENSP00000292928:p.Gln28Glu					ZNF382_uc010efa.2_Intron|ZNF382_uc010efb.2_Missense_Mutation_p.Q27E|ZNF382_uc002oel.2_Missense_Mutation_p.Q28E	p.Q28E	NM_032825	NP_116214	Q96SR6	ZN382_HUMAN	COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)		3	195	+	Esophageal squamous(110;0.198)		28			Mediates interaction with TRIM28 (By similarity).|KRAB.|Represses transcription (By similarity).		A3KMP6|A8MT55|C9K0V5|Q53ZY8|Q5JPJ2	Missense_Mutation	SNP	ENST00000292928.2	37	c.82C>G	CCDS33004.1	.	.	.	.	.	.	.	.	.	.	C	17.56	3.419094	0.62622	.	.	ENSG00000161298	ENST00000292928;ENST00000439428;ENST00000435416	T;T;T	0.09073	3.02;3.02;3.02	4.58	4.58	0.56647	Krueppel-associated box (4);	0.000000	0.40554	N	0.001078	T	0.31765	0.0807	M	0.86805	2.84	0.33123	D	0.542113	D;D;D	0.57257	0.974;0.974;0.979	D;D;D	0.71414	0.953;0.953;0.973	T	0.50110	-0.8866	10	0.72032	D	0.01	.	13.0617	0.59010	0.0:1.0:0.0:0.0	.	27;28;28	Q96SR6-2;Q96SR6-3;Q96SR6	.;.;ZN382_HUMAN	E	28;27;28	ENSP00000292928:Q28E;ENSP00000407593:Q27E;ENSP00000410113:Q28E	ENSP00000292928:Q28E	Q	+	1	0	ZNF382	41792738	0.995000	0.38212	0.992000	0.48379	0.715000	0.41141	4.328000	0.59253	2.531000	0.85337	0.563000	0.77884	CAG		0.478	ZNF382-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109562.2	NM_032825		23	74	0	0	0	0.012319	0	23	74				
SAE1	10055	broad.mit.edu	37	19	47700569	47700569	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr19:47700569G>C	ENST00000270225.7	+	7	881	c.813G>C	c.(811-813)caG>caC	p.Q271H	SAE1_ENST00000540850.1_Missense_Mutation_p.Q97H|SAE1_ENST00000413379.3_Intron|SAE1_ENST00000392776.3_Intron|SAE1_ENST00000598840.1_Missense_Mutation_p.Q190H	NM_005500.2	NP_005491.1	Q9UBE0	SAE1_HUMAN	SUMO1 activating enzyme subunit 1	271					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|regulation of mitotic cell cycle (GO:0007346)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP-dependent protein binding (GO:0043008)|enzyme activator activity (GO:0008047)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|ubiquitin activating enzyme activity (GO:0004839)			endometrium(3)|large_intestine(5)|lung(4)|ovary(1)	13		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.00013)|OV - Ovarian serous cystadenocarcinoma(262;0.000146)|Epithelial(262;0.00697)|GBM - Glioblastoma multiforme(486;0.0278)		TGTTGCTCCAGATACGAAATG	0.423																																							uc002pgc.2		NA																	0				ovary(1)	1						c.(811-813)CAG>CAC		SubName: Full=SUMO-1 activating enzyme subunit 1, isoform CRA_b; SubName: Full=cDNA, FLJ96708, Homo sapiens SUMO-1 activating enzyme subunit 1 (SAE1), mRNA;							244.0	215.0	225.0					19																	47700569		2203	4300	6503	SO:0001583	missense	10055				protein sumoylation|protein ubiquitination	nucleus	ATP-dependent protein binding|enzyme activator activity|ligase activity|protein C-terminus binding|protein heterodimerization activity|ubiquitin activating enzyme activity	g.chr19:47700569G>C	BC018271	CCDS12696.1, CCDS54284.1, CCDS54285.1	19q13.32	2013-09-26				ENSG00000142230		"""Ubiquitin-like modifier activating enzymes"""	30660	protein-coding gene	gene with protein product	"""activator Of sumo 1"""	613294				10187858, 9920803, 10217437	Standard	NM_005500		Approved	AOS1, FLJ3091, Sua1	uc002pgc.3	Q9UBE0		ENST00000270225.7:c.813G>C	19.37:g.47700569G>C	ENSP00000270225:p.Gln271His					SAE1_uc002pgd.2_Intron|SAE1_uc010ekx.2_Intron|SAE1_uc010ekw.2_RNA|SAE1_uc010xyk.1_Missense_Mutation_p.Q97H|SAE1_uc002pge.2_Missense_Mutation_p.Q207H	p.Q271H	NM_016402	NP_057486	Q9UBE0	SAE1_HUMAN		all cancers(93;0.00013)|OV - Ovarian serous cystadenocarcinoma(262;0.000146)|Epithelial(262;0.00697)|GBM - Glioblastoma multiforme(486;0.0278)	7	869	+		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)	271					B2RDP5|B3KMQ2|F5GXX7|G3XAK6|O95717|Q9P020	Missense_Mutation	SNP	ENST00000270225.7	37	c.813G>C	CCDS12696.1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109656	0.37242	.	.	ENSG00000142230	ENST00000270225;ENST00000540850	T;T	0.44083	0.93;0.93	5.95	3.8	0.43715	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.052523	0.85682	D	0.000000	T	0.43964	0.1271	M	0.77103	2.36	0.54753	D	0.999988	B;B	0.11235	0.0;0.004	B;B	0.10450	0.001;0.005	T	0.38394	-0.9663	10	0.48119	T	0.1	.	10.7249	0.46061	0.0719:0.1328:0.7952:0.0	.	97;271	B4DY66;Q9UBE0	.;SAE1_HUMAN	H	271;97	ENSP00000270225:Q271H;ENSP00000440955:Q97H	ENSP00000270225:Q271H	Q	+	3	2	SAE1	52392409	1.000000	0.71417	0.997000	0.53966	0.819000	0.46315	2.702000	0.47102	0.833000	0.34828	0.655000	0.94253	CAG		0.423	SAE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466775.1	NM_005500		17	108	0	0	0	0.007413	0	17	108				
PIH1D1	55011	broad.mit.edu	37	19	49950696	49950696	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr19:49950696G>T	ENST00000262265.5	-	6	745	c.510C>A	c.(508-510)ttC>ttA	p.F170L	PIH1D1_ENST00000602226.1_5'Flank|PIH1D1_ENST00000596049.1_Missense_Mutation_p.F170L	NM_017916.2	NP_060386.1	Q9NWS0	PIHD1_HUMAN	PIH1 domain containing 1	170					box C/D snoRNP assembly (GO:0000492)|epithelial cell differentiation (GO:0030855)	pre-snoRNP complex (GO:0070761)				NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|urinary_tract(1)	11		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)		TGGAGCCCATGAATGGCCGGT	0.637																																							uc002pns.2		NA																	0					0						c.(508-510)TTC>TTA		NOP17							68.0	72.0	71.0					19																	49950696		2203	4300	6503	SO:0001583	missense	55011				box C/D snoRNP assembly	pre-snoRNP complex		g.chr19:49950696G>T	AK000650	CCDS12765.1	19q13.33	2012-07-18	2007-01-31	2007-01-31	ENSG00000104872	ENSG00000104872			26075	protein-coding gene	gene with protein product		611480		NOP17		12477932	Standard	NM_017916		Approved	FLJ20643	uc002pns.2	Q9NWS0		ENST00000262265.5:c.510C>A	19.37:g.49950696G>T	ENSP00000262265:p.Phe170Leu						p.F170L	NM_017916	NP_060386	Q9NWS0	PIHD1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)	6	794	-		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)	170					B4DGN7|B4E2X7|Q9BVL0	Missense_Mutation	SNP	ENST00000262265.5	37	c.510C>A	CCDS12765.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.549211	0.45383	.	.	ENSG00000104872	ENST00000262265	T	0.17213	2.29	4.6	3.57	0.40892	.	0.000000	0.85682	D	0.000000	T	0.35068	0.0919	M	0.65498	2.005	0.46356	D	0.999001	D	0.69078	0.997	D	0.77004	0.989	T	0.05209	-1.0899	10	0.54805	T	0.06	-19.3123	8.4176	0.32681	0.1065:0.0:0.8935:0.0	.	170	Q9NWS0	PIHD1_HUMAN	L	170	ENSP00000262265:F170L	ENSP00000262265:F170L	F	-	3	2	PIH1D1	54642508	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	1.010000	0.29898	1.160000	0.42584	0.655000	0.94253	TTC		0.637	PIH1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465389.2	NM_017916		13	67	1	0	1.5842e-08	0.016723	1.74262e-08	13	67				
KCNF1	3754	broad.mit.edu	37	2	11053443	11053443	+	Silent	SNP	C	C	T	rs559871658		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr2:11053443C>T	ENST00000295082.1	+	1	1381	c.891C>T	c.(889-891)atC>atT	p.I297I		NM_002236.4	NP_002227.2	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F, member 1	297					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(2)|skin(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		TCATGCGCATCGCGCGCATCT	0.647																																							uc002rax.2		NA																	0				ovary(1)	1						c.(889-891)ATC>ATT		potassium voltage-gated channel, subfamily F,							49.0	46.0	47.0					2																	11053443		2203	4300	6503	SO:0001819	synonymous_variant	3754					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr2:11053443C>T	AF033382	CCDS1676.1	2p25	2011-07-05			ENSG00000162975	ENSG00000162975		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6246	protein-coding gene	gene with protein product		603787		KCNF		9434767, 16382104	Standard	NM_002236		Approved	Kv5.1, kH1, IK8	uc002rax.3	Q9H3M0	OTTHUMG00000119054	ENST00000295082.1:c.891C>T	2.37:g.11053443C>T							p.I297I	NM_002236	NP_002227	Q9H3M0	KCNF1_HUMAN		Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)	1	1381	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)		297			Helical; Voltage-sensor; Name=Segment S4; (Potential).		O43527|Q585L3	Silent	SNP	ENST00000295082.1	37	c.891C>T	CCDS1676.1																																																																																				0.647	KCNF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239265.1	NM_002236		4	18	0	0	0	0.009096	0	4	18				
FNDC4	64838	broad.mit.edu	37	2	27720225	27720225	+	5'Flank	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr2:27720225G>A	ENST00000264703.3	-	0	0				GCKR_ENST00000264717.2_Missense_Mutation_p.E59K|GCKR_ENST00000424318.2_5'UTR	NM_022823.2	NP_073734.1	Q9H6D8	FNDC4_HUMAN	fibronectin type III domain containing 4							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|prostate(1)|skin(1)	9	Acute lymphoblastic leukemia(172;0.155)					ATGTGATGCTGAGATCTTCCA	0.537																																							uc002rky.2		NA																	0				ovary(2)	2						c.(175-177)GAG>AAG		glucokinase regulatory protein							124.0	107.0	113.0					2																	27720225		2203	4300	6503	SO:0001631	upstream_gene_variant	2646				carbohydrate metabolic process|glucose transport|negative regulation of glucokinase activity|positive regulation of gene expression|protein import into nucleus, translocation|regulation of glucose transport|response to fructose stimulus|transmembrane transport|triglyceride homeostasis|urate metabolic process	cytosol|nucleoplasm	fructose-6-phosphate binding|protein binding	g.chr2:27720225G>A	AK026015	CCDS1756.1	2p23.3	2013-02-11			ENSG00000115226	ENSG00000115226		"""Fibronectin type III domain containing"""	20239	protein-coding gene	gene with protein product		611905				12384288	Standard	NM_022823		Approved	FLJ22362, FRCP1	uc002rkx.3	Q9H6D8	OTTHUMG00000097787		2.37:g.27720225G>A	Exception_encountered					FNDC4_uc002rkx.2_5'Flank|GCKR_uc010ezd.2_Missense_Mutation_p.E59K|GCKR_uc010ylu.1_5'UTR	p.E59K	NM_001486	NP_001477	Q14397	GCKR_HUMAN			2	241	+	Acute lymphoblastic leukemia(172;0.155)		59					D6W560	Missense_Mutation	SNP	ENST00000264703.3	37	c.175G>A	CCDS1756.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.942997	0.73672	.	.	ENSG00000084734	ENST00000264717;ENST00000453813	D;D	0.85861	-2.04;-2.04	4.51	3.63	0.41609	.	0.080998	0.50627	D	0.000110	T	0.76407	0.3983	L	0.31664	0.95	0.80722	D	1	P;P	0.42518	0.782;0.663	B;B	0.41813	0.367;0.35	T	0.71487	-0.4578	10	0.24483	T	0.36	-12.175	10.2051	0.43107	0.0981:0.0:0.9019:0.0	.	59;59	A8K731;Q14397	.;GCKR_HUMAN	K	59;31	ENSP00000264717:E59K;ENSP00000399463:E31K	ENSP00000264717:E59K	E	+	1	0	GCKR	27573729	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	3.095000	0.50235	1.115000	0.41800	0.462000	0.41574	GAG		0.537	FNDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215031.1	NM_022823		4	63	0	0	0	0.009096	0	4	63				
CCDC88A	55704	broad.mit.edu	37	2	55522976	55522976	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr2:55522976C>T	ENST00000436346.1	-	31	6149	c.5308G>A	c.(5308-5310)Gcg>Acg	p.A1770T	CCDC88A_ENST00000422883.2_Missense_Mutation_p.A271T|CCDC88A_ENST00000263630.8_Missense_Mutation_p.A1742T|CCDC88A_ENST00000413716.2_Intron|CCDC88A_ENST00000336838.6_Missense_Mutation_p.A1769T	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	1770					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						GGTTTTCCCGCAGAACTAATG	0.403																																							uc002ryv.2		NA																	0				ovary(2)|skin(2)	4						c.(5305-5307)GCG>ACG		coiled-coil domain containing 88A isoform 1							88.0	88.0	88.0					2																	55522976		2203	4300	6503	SO:0001583	missense	55704				activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding	g.chr2:55522976C>T	AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.5308G>A	2.37:g.55522976C>T	ENSP00000410608:p.Ala1770Thr					CCDC88A_uc010yoz.1_Missense_Mutation_p.A1742T|CCDC88A_uc010ypa.1_Intron|CCDC88A_uc002ryt.2_Missense_Mutation_p.A60T|CCDC88A_uc010fbw.2_Missense_Mutation_p.A271T|CCDC88A_uc002ryu.2_Missense_Mutation_p.A1024T|CCDC88A_uc002rys.2_Missense_Mutation_p.A727T|CCDC88A_uc002ryw.2_Missense_Mutation_p.A1053T|CCDC88A_uc010fby.1_Missense_Mutation_p.A621T	p.A1769T	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN			31	6147	-			1770					A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	ENST00000436346.1	37	c.5305G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.68|11.68	1.711815|1.711815	0.30322|0.30322	.|.	.|.	ENSG00000115355|ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000422883;ENST00000412148;ENST00000426576|ENST00000456975	T;T;T;T;T|.	0.47869|.	2.36;2.64;2.58;0.83;1.3|.	5.03|5.03	-0.17|-0.17	0.13335|0.13335	.|.	0.688755|.	0.12294|.	U|.	0.481725|.	T|T	0.21841|0.21841	0.0526|0.0526	N|N	0.19112|0.19112	0.55|0.55	0.23056|0.23056	N|N	0.998366|0.998366	B;B;B;B;B;B|.	0.33171|.	0.01;0.025;0.4;0.009;0.026;0.01|.	B;B;B;B;B;B|.	0.30855|.	0.011;0.013;0.121;0.013;0.046;0.011|.	T|T	0.28933|0.28933	-1.0028|-1.0028	10|5	0.38643|.	T|.	0.18|.	0.3477|0.3477	7.0991|7.0991	0.25327|0.25327	0.4417:0.3187:0.2395:0.0|0.4417:0.3187:0.2395:0.0	.|.	1742;1687;271;1770;1769;1741|.	Q3V6T2-2;D6W5D1;B3KW94;Q3V6T2;Q3V6T2-3;Q3V6T2-4|.	.;.;.;GRDN_HUMAN;.;.|.	T|Y	1769;1742;1770;271;787;945|722	ENSP00000338728:A1769T;ENSP00000263630:A1742T;ENSP00000410608:A1770T;ENSP00000390012:A787T;ENSP00000405080:A945T|.	ENSP00000263630:A1742T|.	A|C	-|-	1|2	0|0	CCDC88A|CCDC88A	55376480|55376480	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.980000|0.980000	0.70556|0.70556	0.722000|0.722000	0.25925|0.25925	-0.034000|-0.034000	0.13713|0.13713	0.563000|0.563000	0.77884|0.77884	GCG|TGC		0.403	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571		20	50	0	0	0	0.007413	0	20	50				
ALMS1	7840	broad.mit.edu	37	2	73651739	73651739	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr2:73651739G>A	ENST00000264448.6	+	5	1057	c.946G>A	c.(946-948)Gaa>Aaa	p.E316K	ALMS1_ENST00000377715.1_Missense_Mutation_p.E316K|ALMS1_ENST00000409009.1_Missense_Mutation_p.E274K	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	316					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						TTTACCTTCTGAACAAGGGAA	0.413																																							uc002sje.1		NA																	0				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						c.(949-951)GAA>AAA		Alstrom syndrome 1							82.0	77.0	79.0					2																	73651739		1870	4121	5991	SO:0001583	missense	7840				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole		g.chr2:73651739G>A	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.946G>A	2.37:g.73651739G>A	ENSP00000264448:p.Glu316Lys					ALMS1_uc002sjf.1_Missense_Mutation_p.E274K	p.E317K	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN			6	1060	+			316					Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	c.949G>A	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.990180	0.35131	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.16324	3.24;3.24;2.35	5.03	5.03	0.67393	.	0.194967	0.25194	N	0.032432	T	0.27169	0.0666	N	0.22421	0.69	0.26608	N	0.972894	D;D	0.71674	0.998;0.998	D;D	0.70487	0.969;0.969	T	0.04203	-1.0969	10	0.51188	T	0.08	.	14.5881	0.68342	0.0:0.0:1.0:0.0	.	274;316	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	K	274;316;316	ENSP00000386627:E274K;ENSP00000264448:E316K;ENSP00000366944:E316K	ENSP00000264448:E316K	E	+	1	0	ALMS1	73505247	0.997000	0.39634	0.979000	0.43373	0.851000	0.48451	2.066000	0.41452	2.729000	0.93468	0.460000	0.39030	GAA		0.413	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120		13	33	0	0	0	0.013537	0	13	33				
NCKAP5	344148	broad.mit.edu	37	2	133541059	133541059	+	Missense_Mutation	SNP	C	C	G	rs368039458		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr2:133541059C>G	ENST00000409261.1	-	14	3698	c.3325G>C	c.(3325-3327)Gag>Cag	p.E1109Q	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.E1109Q	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1109	Ser-rich.									NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GATGGTGACTCATTTACCCCT	0.488																																							uc002ttp.2		NA																	0					0						c.(3325-3327)GAG>CAG		Nck-associated protein 5 isoform 1		C	GLN/GLU,	0,4150		0,0,2075	212.0	226.0	221.0		3325,	5.4	0.1	2		221	1,8429		0,1,4214	no	missense,intron	NCKAP5	NM_207363.2,NM_207481.3	29,	0,1,6289	GG,GC,CC		0.0119,0.0,0.0079	probably-damaging,	1109/1910,	133541059	1,12579	2075	4215	6290	SO:0001583	missense	344148						protein binding	g.chr2:133541059C>G	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.3325G>C	2.37:g.133541059C>G	ENSP00000387128:p.Glu1109Gln					NCKAP5_uc002ttq.2_Intron	p.E1109Q	NM_207363	NP_997246	O14513	NCKP5_HUMAN			14	3699	-			1109			Ser-rich.		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	c.3325G>C	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	C	13.22	2.173114	0.38413	0.0	1.19E-4	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.11169	2.8;2.8	5.41	5.41	0.78517	.	0.000000	0.38720	U	0.001581	T	0.18882	0.0453	L	0.34521	1.04	0.80722	D	1	D	0.61080	0.989	P	0.55923	0.787	T	0.00229	-1.1898	10	0.41790	T	0.15	.	17.5577	0.87897	0.0:1.0:0.0:0.0	.	1109	O14513	NCKP5_HUMAN	Q	1109	ENSP00000387128:E1109Q;ENSP00000380603:E1109Q	ENSP00000380603:E1109Q	E	-	1	0	NCKAP5	133257529	0.993000	0.37304	0.104000	0.21259	0.032000	0.12392	4.491000	0.60326	2.826000	0.97356	0.655000	0.94253	GAG		0.488	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		69	232	0	0	0	0.01441	0	69	232				
BAZ2B	29994	broad.mit.edu	37	2	160289747	160289747	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr2:160289747G>T	ENST00000392783.2	-	9	1916	c.1421C>A	c.(1420-1422)aCa>aAa	p.T474K	BAZ2B_ENST00000343439.5_Missense_Mutation_p.T472K|BAZ2B_ENST00000355831.2_Missense_Mutation_p.T474K|BAZ2B_ENST00000392782.1_Missense_Mutation_p.T472K	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	474					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						GTTTTCTAATGTTTGTTTTGG	0.383																																							uc002uao.2		NA																	0				ovary(3)|skin(1)	4						c.(1420-1422)ACA>AAA		bromodomain adjacent to zinc finger domain, 2B							297.0	280.0	285.0					2																	160289747		1875	4101	5976	SO:0001583	missense	29994				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr2:160289747G>T	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.1421C>A	2.37:g.160289747G>T	ENSP00000376534:p.Thr474Lys					BAZ2B_uc002uap.2_Missense_Mutation_p.T472K|BAZ2B_uc002uas.1_Missense_Mutation_p.T411K|BAZ2B_uc002uaq.1_Missense_Mutation_p.T402K|BAZ2B_uc002uar.1_Missense_Mutation_p.T47K	p.T474K	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN			9	1773	-			474					D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	37	c.1421C>A	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	G	12.39	1.925034	0.34002	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000546335	D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36	5.78	2.71	0.32032	.	0.713026	0.11333	U	0.574843	D	0.87063	0.6084	L	0.36672	1.1	0.18873	N	0.999985	P;B;B;B;B	0.52692	0.955;0.018;0.018;0.018;0.01	P;B;B;B;B	0.50270	0.636;0.034;0.032;0.022;0.01	T	0.75728	-0.3216	10	0.46703	T	0.11	0.3936	9.8941	0.41306	0.2435:0.0:0.7565:0.0	.	474;278;472;472;474	Q9UIF8-3;Q9UIF8-4;Q9UIF8-2;Q9UIF8-5;Q9UIF8	.;.;.;.;BAZ2B_HUMAN	K	472;474;474;472;411	ENSP00000376533:T472K;ENSP00000376534:T474K;ENSP00000348087:T474K;ENSP00000339670:T472K	ENSP00000339670:T472K	T	-	2	0	BAZ2B	159997993	1.000000	0.71417	0.264000	0.24511	0.953000	0.61014	2.658000	0.46733	0.250000	0.21479	-0.122000	0.15005	ACA		0.383	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2			66	187	1	0	5.89852e-23	0.01441	6.72575e-23	66	187				
IFIH1	64135	broad.mit.edu	37	2	163133265	163133265	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr2:163133265C>T	ENST00000263642.2	-	11	2631	c.2236G>A	c.(2236-2238)Gaa>Aaa	p.E746K		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	746	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						ACTCCTACTTCAGCAAATTTT	0.418																																							uc002uce.2		NA																	0				ovary(1)	1						c.(2236-2238)GAA>AAA		interferon induced with helicase C domain 1							223.0	219.0	221.0					2																	163133265		2203	4300	6503	SO:0001583	missense	64135				detection of virus|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|regulation of apoptosis	cytosol|nucleus	ATP binding|DNA binding|double-stranded RNA binding|helicase activity|protein binding|ribonucleoprotein binding|zinc ion binding	g.chr2:163133265C>T	AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.2236G>A	2.37:g.163133265C>T	ENSP00000263642:p.Glu746Lys						p.E746K	NM_022168	NP_071451	Q9BYX4	IFIH1_HUMAN			11	2458	-			746			Helicase C-terminal.		Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	ENST00000263642.2	37	c.2236G>A	CCDS2217.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.314863	0.81358	.	.	ENSG00000115267	ENST00000263642;ENST00000543192	T	0.05319	3.46	5.55	4.67	0.58626	Helicase, C-terminal (2);	0.091972	0.85682	D	0.000000	T	0.06600	0.0169	N	0.04245	-0.25	0.51012	D	0.999906	B	0.30511	0.282	B	0.43274	0.414	T	0.53194	-0.8473	10	0.38643	T	0.18	-21.8514	16.5586	0.84534	0.0:0.8694:0.1306:0.0	.	746	Q9BYX4	IFIH1_HUMAN	K	746	ENSP00000263642:E746K	ENSP00000263642:E746K	E	-	1	0	IFIH1	162841511	1.000000	0.71417	0.990000	0.47175	0.983000	0.72400	4.792000	0.62467	1.324000	0.45282	-0.150000	0.13652	GAA		0.418	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255078.2	NM_022168		22	109	0	0	0	0.012319	0	22	109				
SCN7A	6332	broad.mit.edu	37	2	167263076	167263076	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr2:167263076G>A	ENST00000409855.1	-	25	4189	c.4063C>T	c.(4063-4065)Cac>Tac	p.H1355Y		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1355					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	CGCAGCATGTGAATGATCCGT	0.448																																							uc002udu.1		NA																	0				large_intestine(1)	1						c.(4063-4065)CAC>TAC		sodium channel, voltage-gated, type VII, alpha							119.0	113.0	115.0					2																	167263076		1996	4158	6154	SO:0001583	missense	6332				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr2:167263076G>A	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.4063C>T	2.37:g.167263076G>A	ENSP00000386796:p.His1355Tyr						p.H1355Y	NM_002976	NP_002967	Q01118	SCN7A_HUMAN			25	4190	-			1355			Helical; Voltage-sensor; Name=S4 of repeat IV; (By similarity).			Missense_Mutation	SNP	ENST00000409855.1	37	c.4063C>T	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.925528	0.52759	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.98493	-4.96	5.35	5.35	0.76521	Ion transport (1);	0.202066	0.36591	N	0.002519	D	0.98403	0.9469	L	0.54323	1.7	0.40904	D	0.984172	D	0.71674	0.998	D	0.68039	0.955	D	0.99560	1.0968	10	0.87932	D	0	.	16.9412	0.86218	0.0:0.0:1.0:0.0	.	1355	Q01118	SCN7A_HUMAN	Y	1355	ENSP00000386796:H1355Y	ENSP00000259060:H1355Y	H	-	1	0	SCN7A	166971322	1.000000	0.71417	0.999000	0.59377	0.308000	0.27856	5.367000	0.66127	2.941000	0.99782	0.655000	0.94253	CAC		0.448	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1			31	91	0	0	0	0.009535	0	31	91				
KLHL41	10324	broad.mit.edu	37	2	170371130	170371130	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr2:170371130C>T	ENST00000284669.1	+	2	1234	c.1157C>T	c.(1156-1158)tCa>tTa	p.S386L	KLHL41_ENST00000463400.1_3'UTR|BBS5_ENST00000554017.1_Missense_Mutation_p.S324L|RP11-724O16.1_ENST00000513963.1_Missense_Mutation_p.S324L	NM_006063.2	NP_006054.2	O60662	KLH41_HUMAN	kelch-like family member 41	386					myofibril assembly (GO:0030239)|protein ubiquitination (GO:0016567)|regulation of lateral pseudopodium assembly (GO:0031275)|regulation of myoblast differentiation (GO:0045661)|regulation of myoblast proliferation (GO:2000291)|regulation of skeletal muscle cell differentiation (GO:2001014)|skeletal muscle cell differentiation (GO:0035914)|striated muscle contraction (GO:0006941)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|M band (GO:0031430)|pseudopodium (GO:0031143)											CCTCTGCCTTCAGCCAGGTGT	0.433																																							uc002ueu.1		NA																	0					0						c.(1156-1158)TCA>TTA		kelch repeat and BTB (POZ) domain containing 10							101.0	99.0	100.0					2																	170371130		2203	4300	6503	SO:0001583	missense	10324				striated muscle contraction	centrosome|nucleolus|plasma membrane|pseudopodium|ruffle		g.chr2:170371130C>T	AF056929	CCDS2234.1	2q31.1	2013-02-22	2013-02-22	2013-01-08	ENSG00000239474	ENSG00000239474		"""Kelch-like"", ""BTB/POZ domain containing"""	16905	protein-coding gene	gene with protein product	"""sarcomeric muscle protein"""	607701	"""kelch repeat and BTB (POZ) domain containing 10"", ""kelch-like 41 (Drosophila)"""	KBTBD10		9655184	Standard	NM_006063		Approved	SARCOSIN, Krp1	uc002ueu.1	O60662	OTTHUMG00000132205	ENST00000284669.1:c.1157C>T	2.37:g.170371130C>T	ENSP00000284669:p.Ser386Leu					KBTBD10_uc010zdh.1_Missense_Mutation_p.S324L	p.S386L	NM_006063	NP_006054	O60662	KBTBA_HUMAN			2	1234	+			386			Kelch 1.		Q53R42	Missense_Mutation	SNP	ENST00000284669.1	37	c.1157C>T	CCDS2234.1	.	.	.	.	.	.	.	.	.	.	C	35	5.518504	0.96416	.	.	ENSG00000163093;ENSG00000251569;ENSG00000239474	ENST00000554017;ENST00000513963;ENST00000284669	T;T;T	0.66815	-0.23;-0.23;-0.23	6.02	6.02	0.97574	Kelch-type beta propeller (1);	0.121274	0.56097	D	0.000021	T	0.80894	0.4711	M	0.64997	1.995	0.80722	D	1	P;D	0.71674	0.893;0.998	B;D	0.68039	0.14;0.955	T	0.80845	-0.1200	10	0.87932	D	0	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	324;386	E9PBE3;O60662	.;KBTBA_HUMAN	L	324;324;386	ENSP00000452313:S324L;ENSP00000424363:S324L;ENSP00000284669:S386L	ENSP00000284669:S386L	S	+	2	0	BBS5;RP11-724O16.1;KBTBD10	170079376	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.750000	0.85110	2.857000	0.98124	0.650000	0.86243	TCA		0.433	KLHL41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255263.1	NM_006063		16	69	0	0	0	0.004007	0	16	69				
DNAH7	56171	broad.mit.edu	37	2	196892737	196892737	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr2:196892737C>A	ENST00000312428.6	-	6	533	c.433G>T	c.(433-435)Gat>Tat	p.D145Y	DNAH7_ENST00000410072.1_Missense_Mutation_p.D145Y	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	145	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GTGCTTCCATCAGGGACAGCT	0.373																																							uc002utj.3		NA																	0				skin(10)|ovary(2)	12						c.(433-435)GAT>TAT		dynein, axonemal, heavy chain 7							184.0	176.0	179.0					2																	196892737		1846	4089	5935	SO:0001583	missense	56171				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr2:196892737C>A	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.433G>T	2.37:g.196892737C>A	ENSP00000311273:p.Asp145Tyr						p.D145Y	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN			6	534	-			145			Stem (By similarity).		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	c.433G>T	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999441	0.74818	.	.	ENSG00000118997	ENST00000312428;ENST00000410072;ENST00000312446;ENST00000427816	T;T	0.26373	1.74;2.67	5.2	5.2	0.72013	.	3.807880	0.00986	N	0.003442	T	0.32823	0.0842	L	0.43152	1.355	0.41873	D	0.990282	B	0.19331	0.035	B	0.18871	0.023	T	0.09662	-1.0664	10	0.59425	D	0.04	.	15.6544	0.77121	0.0:1.0:0.0:0.0	.	145	Q8WXX0	DYH7_HUMAN	Y	145;145;145;120	ENSP00000311273:D145Y;ENSP00000386260:D145Y	ENSP00000311273:D145Y	D	-	1	0	DNAH7	196600982	0.738000	0.28186	0.201000	0.23476	0.046000	0.14306	3.102000	0.50291	2.415000	0.81967	0.591000	0.81541	GAT		0.373	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897		27	114	1	0	1.2476e-16	0.00632	1.40543e-16	27	114				
TNS1	7145	broad.mit.edu	37	2	218749773	218749773	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr2:218749773C>T	ENST00000171887.4	-	14	1308	c.856G>A	c.(856-858)Gat>Aat	p.D286N	TNS1_ENST00000310858.6_Missense_Mutation_p.D317N|TNS1_ENST00000430930.1_Missense_Mutation_p.D286N|TNS1_ENST00000419504.1_Missense_Mutation_p.D286N	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	286	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		AAAGCATCATCAAGGTCCTCC	0.577																																							uc002vgt.2		NA																	0				ovary(3)|breast(1)	4						c.(856-858)GAT>AAT		tensin							121.0	100.0	107.0					2																	218749773		2203	4300	6503	SO:0001583	missense	7145					cytoplasm|cytoskeleton|focal adhesion	actin binding	g.chr2:218749773C>T	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.856G>A	2.37:g.218749773C>T	ENSP00000171887:p.Asp286Asn					TNS1_uc002vgr.2_Missense_Mutation_p.D286N|TNS1_uc002vgs.2_Missense_Mutation_p.D286N|TNS1_uc010zjv.1_Missense_Mutation_p.D286N|TNS1_uc010fvj.1_Missense_Mutation_p.D354N|TNS1_uc010fvk.1_Missense_Mutation_p.D411N|TNS1_uc002vgu.3_Missense_Mutation_p.D317N|TNS1_uc010fvi.1_5'UTR	p.D286N	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)	14	1254	-		Renal(207;0.0483)|Lung NSC(271;0.213)	286			C2 tensin-type.		Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	37	c.856G>A	CCDS2407.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.037004	0.93630	.	.	ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903;ENST00000413554;ENST00000310858	D;D;D;D;D;D	0.97505	-4.41;-4.41;-4.41;-4.41;-4.41;-4.41	4.82	4.82	0.62117	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.107621	0.64402	D	0.000009	D	0.98804	0.9597	M	0.92691	3.335	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.989;1.0;0.999;1.0	D;D;D;D;D;D	0.97110	0.999;0.997;0.953;1.0;0.997;0.999	D	0.99716	1.1008	10	0.87932	D	0	.	17.7353	0.88391	0.0:1.0:0.0:0.0	.	286;340;317;286;286;286	B2RU35;A1L0S7;Q6IPI5;Q9HBL0;E9PGF5;E9PF55	.;.;.;TENS1_HUMAN;.;.	N	286;286;286;411;354;317	ENSP00000171887:D286N;ENSP00000408724:D286N;ENSP00000406016:D286N;ENSP00000405460:D411N;ENSP00000400383:D354N;ENSP00000308321:D317N	ENSP00000171887:D286N	D	-	1	0	TNS1	218458018	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	7.499000	0.81566	2.491000	0.84063	0.557000	0.71058	GAT		0.577	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648		20	76	0	0	0	0.008871	0	20	76				
SPHKAP	80309	broad.mit.edu	37	2	228886460	228886460	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr2:228886460C>G	ENST00000392056.3	-	6	710	c.664G>C	c.(664-666)Gag>Cag	p.E222Q	SPHKAP_ENST00000344657.5_Missense_Mutation_p.E222Q	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	222						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CTTTCCTCCTCCAAGTGCTCA	0.448																																							uc002vpq.2		NA																	0				skin(5)|ovary(4)|lung(1)	10						c.(664-666)GAG>CAG		sphingosine kinase type 1-interacting protein							95.0	96.0	96.0					2																	228886460		2203	4300	6503	SO:0001583	missense	80309					cytoplasm	protein binding	g.chr2:228886460C>G		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.664G>C	2.37:g.228886460C>G	ENSP00000375909:p.Glu222Gln					SPHKAP_uc002vpp.2_Missense_Mutation_p.E222Q|SPHKAP_uc010zlx.1_Missense_Mutation_p.E222Q	p.E222Q	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)	6	711	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	222					Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	c.664G>C	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.586179	0.86851	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.19806	2.12;2.12	5.79	5.79	0.91817	.	0.048286	0.85682	D	0.000000	T	0.49012	0.1532	M	0.71581	2.175	0.54753	D	0.99998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.982;0.998	T	0.43940	-0.9360	10	0.72032	D	0.01	.	19.0195	0.92908	0.0:1.0:0.0:0.0	.	222;222	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	Q	222	ENSP00000375909:E222Q;ENSP00000339886:E222Q	ENSP00000339886:E222Q	E	-	1	0	SPHKAP	228594704	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	6.774000	0.75012	2.746000	0.94184	0.655000	0.94253	GAG		0.448	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623		15	54	0	0	0	0.020292	0	15	54				
SP140	11262	broad.mit.edu	37	2	231150522	231150522	+	Silent	SNP	T	T	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr2:231150522T>C	ENST00000392045.3	+	17	1734	c.1620T>C	c.(1618-1620)aaT>aaC	p.N540N	SP140_ENST00000343805.6_Silent_p.N480N|SP140_ENST00000350136.5_Silent_p.N409N|SP140_ENST00000486687.2_Silent_p.N464N|SP140_ENST00000420434.3_Silent_p.N513N|SP140_ENST00000417495.3_Silent_p.N426N	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	540					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		CGAACGTGAATCTGAAAGACC	0.453																																							uc002vql.2		NA																	0					0						c.(1618-1620)AAT>AAC		SP140 nuclear body protein isoform 1							158.0	157.0	158.0					2																	231150522		1862	4103	5965	SO:0001819	synonymous_variant	11262				defense response	cytoplasm|nuclear envelope|nucleolus|nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:231150522T>C	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.1620T>C	2.37:g.231150522T>C						SP140_uc010zma.1_RNA|SP140_uc002vqn.2_Silent_p.N426N|SP140_uc002vqm.2_Silent_p.N480N|SP140_uc010fxl.2_Silent_p.N513N	p.N540N	NM_007237	NP_009168	Q13342	LY10_HUMAN		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)	17	1735	+		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)	540					E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Silent	SNP	ENST00000392045.3	37	c.1620T>C	CCDS42831.1																																																																																				0.453	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237		41	104	0	0	0	0.009718	0	41	104				
SIGLEC1	6614	broad.mit.edu	37	20	3675457	3675457	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr20:3675457C>G	ENST00000344754.4	-	11	2796	c.2797G>C	c.(2797-2799)Gat>Cat	p.D933H	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.D933H	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	933	Ig-like C2-type 9.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						GGCTGGCCATCCCGATACCAA	0.617																																							uc002wja.2		NA																	0				pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						c.(2797-2799)GAT>CAT		sialoadhesin precursor							60.0	62.0	61.0					20																	3675457		2203	4300	6503	SO:0001583	missense	6614				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding	g.chr20:3675457C>G	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.2797G>C	20.37:g.3675457C>G	ENSP00000341141:p.Asp933His					SIGLEC1_uc002wjb.1_5'Flank|SIGLEC1_uc002wiz.3_Missense_Mutation_p.D933H	p.D933H	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN			11	2797	-			933			Ig-like C2-type 9.|Extracellular (Potential).		Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	37	c.2797G>C	CCDS13060.1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.182197	0.57800	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.03982	3.74;3.74	4.96	1.89	0.25635	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.361838	0.20251	N	0.096062	T	0.19525	0.0469	M	0.87269	2.87	0.34322	D	0.686651	D;D	0.76494	0.999;0.993	D;D	0.72625	0.978;0.942	T	0.12293	-1.0553	10	0.66056	D	0.02	.	6.5938	0.22661	0.0:0.5922:0.0:0.4078	.	933;933	Q9BZZ2;Q9BZZ2-3	SN_HUMAN;.	H	933	ENSP00000341141:D933H;ENSP00000202578:D933H	ENSP00000202578:D933H	D	-	1	0	SIGLEC1	3623457	0.965000	0.33210	0.821000	0.32701	0.981000	0.71138	0.489000	0.22387	0.251000	0.21505	0.655000	0.94253	GAT		0.617	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068		15	44	0	0	0	0.020292	0	15	44				
PHF20	51230	broad.mit.edu	37	20	34451291	34451291	+	Silent	SNP	A	A	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr20:34451291A>G	ENST00000374012.3	+	6	906	c.777A>G	c.(775-777)aaA>aaG	p.K259K	PHF20_ENST00000439301.1_Missense_Mutation_p.T238A|PHF20_ENST00000481202.1_3'UTR			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	259					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					CCAAAAGAAAACGAGGCAGAC	0.448																																							uc002xek.1		NA																	0				ovary(1)	1						c.(775-777)AAA>AAG		PHD finger protein 20							110.0	120.0	117.0					20																	34451291		2202	4300	6502	SO:0001819	synonymous_variant	51230				regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding	g.chr20:34451291A>G	AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.777A>G	20.37:g.34451291A>G						PHF20_uc002xei.1_Silent_p.K259K|PHF20_uc010gfo.1_Silent_p.K259K|PHF20_uc002xej.1_Silent_p.K143K|PHF20_uc002xel.1_Silent_p.K121K	p.K259K	NM_016436	NP_057520	Q9BVI0	PHF20_HUMAN			6	888	+	Breast(12;0.00631)|all_lung(11;0.0145)		259			A.T hook.		A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Silent	SNP	ENST00000374012.3	37	c.777A>G	CCDS13268.1	.	.	.	.	.	.	.	.	.	.	A	12.72	2.021853	0.35701	.	.	ENSG00000025293	ENST00000439301	T	0.43294	0.95	5.83	2.26	0.28386	.	.	.	.	.	T	0.25717	0.0626	.	.	.	0.24585	N	0.993857	.	.	.	.	.	.	T	0.19484	-1.0304	6	0.11794	T	0.64	.	10.414	0.44311	0.7494:0.0:0.2506:0.0	.	.	.	.	A	238	ENSP00000410373:T238A	ENSP00000410373:T238A	T	+	1	0	PHF20	33914705	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.038000	0.41184	0.962000	0.38057	0.459000	0.35465	ACG		0.448	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078949.2	NM_016436		28	121	0	0	0	0.008361	0	28	121				
B4GALT5	9334	broad.mit.edu	37	20	48330165	48330165	+	Silent	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr20:48330165G>A	ENST00000371711.4	-	1	250	c.63C>T	c.(61-63)ttC>ttT	p.F21F		NM_004776.3	NP_004767.1	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5	21					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			AGAGAGAAAAGAAGAAGAGCG	0.716																																							uc002xuu.3		NA																	0				ovary(1)	1						c.(61-63)TTC>TTT		UDP-Gal:betaGlcNAc beta 1,4-							8.0	11.0	10.0					20																	48330165		2159	4254	6413	SO:0001819	synonymous_variant	9334				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	galactosyltransferase activity|metal ion binding	g.chr20:48330165G>A	AB004550	CCDS13420.1	20q13.1-q13.2	2013-02-19			ENSG00000158470	ENSG00000158470		"""Beta 4-glycosyltransferases"""	928	protein-coding gene	gene with protein product	"""beta4-GalT IV"""	604016				9597550, 9435216	Standard	NM_004776		Approved	beta4GalT-V	uc002xuu.4	O43286	OTTHUMG00000033086	ENST00000371711.4:c.63C>T	20.37:g.48330165G>A							p.F21F	NM_004776	NP_004767	O43286	B4GT5_HUMAN	BRCA - Breast invasive adenocarcinoma(9;2.51e-06)		1	257	-			21			Helical; Signal-anchor for type II membrane protein; (Potential).		E1P625|Q2M394|Q9UJQ8	Silent	SNP	ENST00000371711.4	37	c.63C>T	CCDS13420.1																																																																																				0.716	B4GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080543.3	NM_004776		3	8	0	0	0	0.004672	0	3	8				
STX16	8675	broad.mit.edu	37	20	57227056	57227056	+	5'UTR	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr20:57227056G>A	ENST00000371141.4	+	0	718				STX16-NPEPL1_ENST00000530122.1_5'UTR|STX16_ENST00000355957.5_5'UTR|STX16_ENST00000496003.1_3'UTR|STX16_ENST00000359617.4_Intron|STX16_ENST00000361830.3_5'Flank|STX16_ENST00000358029.4_5'UTR|STX16_ENST00000361770.5_5'UTR|STX16_ENST00000371132.4_5'UTR	NM_001001433.2	NP_001001433.1	O14662	STX16_HUMAN	syntaxin 16						intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			breast(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(1)	17	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			GTCGCAAAGGGTGAGACATGG	0.547																																							uc002xzi.2		NA																	0				ovary(1)	1						c.(-8--4)GGGTG>GGATG		syntaxin 16 isoform a							83.0	85.0	84.0					20																	57227056		2203	4300	6503	SO:0001623	5_prime_UTR_variant	8675				intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|microsome|SNARE complex	SNAP receptor activity	g.chr20:57227056G>A	AF038897	CCDS13468.1, CCDS13469.1, CCDS46619.1, CCDS46620.1, CCDS56199.1	20q13.32	2008-07-02			ENSG00000124222	ENSG00000124222			11431	protein-coding gene	gene with protein product		603666				9464276, 9587053, 15800843	Standard	NM_003763		Approved	hsyn16, SYN16	uc002xzi.3	O14662	OTTHUMG00000033084	ENST00000371141.4:c.-7G>A	20.37:g.57227056G>A						STX16_uc010zzq.1_Intron|STX16_uc002xzk.2_Translation_Start_Site|STX16_uc002xzm.2_Translation_Start_Site|STX16_uc002xzj.2_Translation_Start_Site|STX16_uc002xzl.2_Translation_Start_Site		NM_001001433	NP_001001433	O14662	STX16_HUMAN	BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)		1	729	+	all_lung(29;0.0175)							A6NK32|A6NN69|A8MPP0|B7ZBN1|B7ZBN2|B7ZBN3|E1P5M0|E1P607|O14661|O14663|O60517|Q5W084|Q5W086|Q5W087|Q5XKI6|Q6GMS8|Q9H0Z0|Q9H1T7|Q9H1T8|Q9UIX5	Translation_Start_Site	SNP	ENST00000371141.4	37	c.-6G>A	CCDS13468.1																																																																																				0.547	STX16-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080517.2	NM_001001433		15	62	0	0	0	0.007413	0	15	62				
SLCO4A1	28231	broad.mit.edu	37	20	61300394	61300394	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr20:61300394G>A	ENST00000370507.1	+	10	2085	c.1989G>A	c.(1987-1989)atG>atA	p.M663I	SLCO4A1_ENST00000470412.1_3'UTR|RP11-93B14.5_ENST00000433126.1_RNA|RP11-93B14.5_ENST00000451648.1_RNA|RP11-93B14.5_ENST00000411824.1_RNA|SLCO4A1_ENST00000217159.1_Missense_Mutation_p.M663I			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	663					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	ATTCGGCCATGAGCCGCTACA	0.627											OREG0026115	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(168;741 2006 10379 40139 45334)	Pancreas(168;741 2006 10379 40139 45334)	uc002ydb.1		NA																	0				ovary(1)	1						c.(1987-1989)ATG>ATA		solute carrier organic anion transporter family							48.0	45.0	46.0					20																	61300394		2203	4300	6503	SO:0001583	missense	28231				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity	g.chr20:61300394G>A	AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.1989G>A	20.37:g.61300394G>A	ENSP00000359538:p.Met663Ile		OREG0026115	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1052	SLCO4A1_uc002ydc.1_RNA|LOC100127888_uc002ydd.2_5'Flank|SLCO4A1_uc002yde.1_Missense_Mutation_p.M65I	p.M663I	NM_016354	NP_057438	Q96BD0	SO4A1_HUMAN	BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		11	2194	+	Breast(26;3.65e-08)		663			Extracellular (Potential).		Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Missense_Mutation	SNP	ENST00000370507.1	37	c.1989G>A	CCDS13501.1	.	.	.	.	.	.	.	.	.	.	G	15.31	2.796506	0.50208	.	.	ENSG00000101187	ENST00000217159;ENST00000370512;ENST00000370507;ENST00000342674;ENST00000451793	T;T;T	0.39592	1.07;1.07;1.07	4.77	4.77	0.60923	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.47266	0.1436	M	0.69463	2.115	0.80722	D	1	B	0.29188	0.236	B	0.33960	0.173	T	0.48234	-0.9053	10	0.40728	T	0.16	.	17.7808	0.88522	0.0:0.0:1.0:0.0	.	663	Q96BD0	SO4A1_HUMAN	I	663;663;663;515;92	ENSP00000217159:M663I;ENSP00000359538:M663I;ENSP00000414855:M92I	ENSP00000217159:M663I	M	+	3	0	SLCO4A1	60770839	1.000000	0.71417	0.994000	0.49952	0.064000	0.16182	9.152000	0.94680	2.192000	0.70111	0.491000	0.48974	ATG		0.627	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080048.2	NM_016354		9	50	0	0	0	0.006214	0	9	50				
NRIP1	8204	broad.mit.edu	37	21	16339865	16339865	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr21:16339865C>G	ENST00000400202.1	-	3	1361	c.649G>C	c.(649-651)Gag>Cag	p.E217Q	NRIP1_ENST00000318948.4_Missense_Mutation_p.E217Q|NRIP1_ENST00000400199.1_Missense_Mutation_p.E217Q			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	217	Interaction with ZNF366.|Repression domain 1.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		TGAGGAGACTCTGCAAACCTA	0.393																																							uc002yjx.2		NA																	0					0						c.(649-651)GAG>CAG		nuclear receptor interacting protein 1							157.0	137.0	144.0					21																	16339865		2203	4300	6503	SO:0001583	missense	8204				androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		androgen receptor binding|estrogen receptor binding|glucocorticoid receptor binding|transcription coactivator activity|transcription corepressor activity	g.chr21:16339865C>G	X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.649G>C	21.37:g.16339865C>G	ENSP00000383063:p.Glu217Gln						p.E217Q	NM_003489	NP_003480	P48552	NRIP1_HUMAN		Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)	4	1247	-			217			Repression domain 1.		Q8IWE8	Missense_Mutation	SNP	ENST00000400202.1	37	c.649G>C	CCDS13568.1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.925259	0.34002	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	T;T;T	0.11385	2.78;2.78;2.78	6.01	6.01	0.97437	.	0.000000	0.64402	D	0.000001	T	0.25568	0.0622	L	0.42245	1.32	0.48975	D	0.999734	D	0.56521	0.976	D	0.62955	0.909	T	0.00024	-1.2328	10	0.41790	T	0.15	-11.3854	18.6879	0.91571	0.0:1.0:0.0:0.0	.	217	P48552	NRIP1_HUMAN	Q	217	ENSP00000383060:E217Q;ENSP00000383063:E217Q;ENSP00000327213:E217Q	ENSP00000327213:E217Q	E	-	1	0	NRIP1	15261736	0.998000	0.40836	0.931000	0.37212	0.160000	0.22226	3.706000	0.54830	2.855000	0.98099	0.585000	0.79938	GAG		0.393	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157926.1	NM_003489		7	126	0	0	0	0.001984	0	7	126				
CRYZL1	9946	broad.mit.edu	37	21	34975721	34975721	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr21:34975721C>T	ENST00000381554.3	-	7	539	c.454G>A	c.(454-456)Gat>Aat	p.D152N	CRYZL1_ENST00000381540.3_Missense_Mutation_p.D152N|CRYZL1_ENST00000445393.1_Missense_Mutation_p.D114N|CRYZL1_ENST00000290244.5_Missense_Mutation_p.D137N|CRYZL1_ENST00000361534.2_Missense_Mutation_p.D176N|AP000304.12_ENST00000429238.1_Intron	NM_145858.2	NP_665857.2	O95825	QORL1_HUMAN	crystallin, zeta (quinone reductase)-like 1	152					quinone metabolic process (GO:1901661)	cytosol (GO:0005829)	NADP binding (GO:0050661)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)			lung(1)|prostate(1)|urinary_tract(1)	3						CTTGCTCCATCCATTATCAGC	0.413																																							uc011adw.1		NA																	0					0						c.(454-456)GAT>AAT		crystallin, zeta-like 1							168.0	148.0	155.0					21																	34975721		2203	4300	6503	SO:0001583	missense	9946				quinone cofactor metabolic process	cytosol	NADP binding|NADPH:quinone reductase activity|zinc ion binding	g.chr21:34975721C>T	AF029689	CCDS13633.2	21q22.1	2008-07-31			ENSG00000205758	ENSG00000205758			2420	protein-coding gene	gene with protein product	"""quinone reductase-like 1"""	603920				10191096	Standard	NM_145858		Approved	QOH-1, 4P11	uc021wio.1	O95825	OTTHUMG00000065954	ENST00000381554.3:c.454G>A	21.37:g.34975721C>T	ENSP00000370966:p.Asp152Asn					DONSON_uc002ysn.1_Intron|CRYZL1_uc002ysr.1_Missense_Mutation_p.D176N|CRYZL1_uc002yss.1_RNA|CRYZL1_uc002yst.1_RNA	p.D152N	NM_145858	NP_665857	O95825	QORL1_HUMAN			7	634	-			152					B2RDX1|B3KQ77|Q96DY0|Q9NVY7	Missense_Mutation	SNP	ENST00000381554.3	37	c.454G>A	CCDS13633.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.53|13.53	2.264080|2.264080	0.39995|0.39995	.|.	.|.	ENSG00000205758|ENSG00000205758	ENST00000381554;ENST00000290244;ENST00000381540;ENST00000445393;ENST00000361534;ENST00000452332;ENST00000414079;ENST00000426935;ENST00000431177;ENST00000417979|ENST00000440526	T;T;T;T;T;T;T|.	0.29142|.	1.59;1.59;1.59;1.58;1.59;1.59;2.01|.	5.0|5.0	5.0|5.0	0.66597|0.66597	.|.	0.111129|.	0.64402|.	D|.	0.000008|.	T|T	0.33147|0.33147	0.0853|0.0853	N|N	0.04090|0.04090	-0.28|-0.28	0.80722|0.80722	D|D	1|1	B;B|.	0.19200|.	0.034;0.019|.	B;B|.	0.21917|.	0.037;0.012|.	T|T	0.21042|0.21042	-1.0257|-1.0257	10|5	0.06891|.	T|.	0.86|.	-14.4942|-14.4942	11.7075|11.7075	0.51605|0.51605	0.0:0.9133:0.0:0.0867|0.0:0.9133:0.0:0.0867	.|.	152;176|.	O95825;A6NHJ8|.	QORL1_HUMAN;.|.	N|E	152;137;152;114;176;152;12;100;152;100|95	ENSP00000370966:D152N;ENSP00000290244:D137N;ENSP00000370951:D152N;ENSP00000399730:D114N;ENSP00000355075:D176N;ENSP00000387660:D100N;ENSP00000405510:D152N|.	ENSP00000290244:D137N|.	D|G	-|-	1|2	0|0	CRYZL1|CRYZL1	33897591|33897591	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.407000|4.407000	0.59754|0.59754	2.464000|2.464000	0.83262|0.83262	0.655000|0.655000	0.94253|0.94253	GAT|GGA		0.413	CRYZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141282.2	NM_145858		25	93	0	0	0	0.005443	0	25	93				
UMODL1	89766	broad.mit.edu	37	21	43519164	43519164	+	Missense_Mutation	SNP	A	A	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr21:43519164A>G	ENST00000408910.2	+	7	1060	c.1060A>G	c.(1060-1062)Agg>Ggg	p.R354G	UMODL1_ENST00000408989.2_Missense_Mutation_p.R354G|UMODL1_ENST00000400427.1_Missense_Mutation_p.R282G|UMODL1_ENST00000400424.2_Missense_Mutation_p.R282G	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	354	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						GGAGTTGCTCAGGAGCGCCAG	0.577																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	uc002zaf.1		NA																	0				ovary(2)|skin(1)	3						c.(1060-1062)AGG>GGG		uromodulin-like 1 isoform 1 precursor							67.0	73.0	71.0					21																	43519164		2040	4184	6224	SO:0001583	missense	89766					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity	g.chr21:43519164A>G		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1060A>G	21.37:g.43519164A>G	ENSP00000386147:p.Arg354Gly					UMODL1_uc002zad.1_Missense_Mutation_p.R282G|UMODL1_uc002zae.1_Missense_Mutation_p.R282G|UMODL1_uc002zag.1_Missense_Mutation_p.R354G|UMODL1_uc010gow.1_Missense_Mutation_p.R146G|UMODL1_uc002zai.1_Missense_Mutation_p.R5G|UMODL1_uc010gox.1_RNA|UMODL1_uc010goy.1_Missense_Mutation_p.R5G|UMODL1_uc002zaj.1_RNA|UMODL1_uc010goz.1_Missense_Mutation_p.R99G	p.R354G	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN			7	1060	+			354			Extracellular (Potential).|Fibronectin type-III 1.		C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	37	c.1060A>G	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	A	4.943	0.175181	0.09391	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910;ENST00000380462	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	4.29	0.27	0.15635	Fibronectin, type III (2);	0.555807	0.15871	N	0.240553	T	0.46889	0.1416	L	0.32530	0.975	0.09310	N	1	P;P;B	0.51653	0.551;0.947;0.227	B;P;B	0.58077	0.364;0.832;0.179	T	0.34551	-0.9824	10	0.62326	D	0.03	-14.4179	7.0403	0.25017	0.3777:0.4794:0.0:0.1429	.	282;354;354	Q5DID0-3;Q5DID0-2;Q5DID0	.;.;UROL1_HUMAN	G	282;282;354;354;200	ENSP00000383279:R282G;ENSP00000383276:R282G;ENSP00000386126:R354G;ENSP00000386147:R354G	ENSP00000369829:R200G	R	+	1	2	UMODL1	42392233	0.000000	0.05858	0.008000	0.14137	0.016000	0.09150	0.254000	0.18314	-0.048000	0.13401	-0.327000	0.08410	AGG		0.577	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2			20	70	0	0	0	0.014323	0	20	70				
MIEF1	54471	broad.mit.edu	37	22	39909758	39909758	+	Silent	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr22:39909758C>T	ENST00000325301.2	+	6	1246	c.822C>T	c.(820-822)atC>atT	p.I274I	MIEF1_ENST00000402881.1_Silent_p.I274I|MIEF1_ENST00000404569.1_Silent_p.I274I	NM_019008.4	NP_061881.2	Q9NQG6	MID51_HUMAN	mitochondrial elongation factor 1	274					mitochondrial fission (GO:0000266)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|GDP binding (GO:0019003)|identical protein binding (GO:0042802)										CTGGCTCCATCAATTGGCCAG	0.567											OREG0026577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003axx.2		NA																	0				central_nervous_system(1)	1						c.(820-822)ATC>ATT		hypothetical protein LOC54471							35.0	34.0	34.0					22																	39909758		2203	4300	6503	SO:0001819	synonymous_variant	54471					integral to membrane|mitochondrion		g.chr22:39909758C>T	AL365515	CCDS13995.1	22q13.1	2013-09-23	2013-09-23	2013-09-23	ENSG00000100335	ENSG00000100335			25979	protein-coding gene	gene with protein product		615497	"""Smith-Magenis syndrome chromosome region, candidate 7-like"""	SMCR7L		21508961, 21701560	Standard	NM_019008		Approved	FLJ20232, MiD51	uc003axx.3	Q9NQG6	OTTHUMG00000151105	ENST00000325301.2:c.822C>T	22.37:g.39909758C>T			OREG0026577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	889	SMCR7L_uc003axw.2_Silent_p.I274I|SMCR7L_uc010gxz.1_Silent_p.I96I|SMCR7L_uc003axy.2_Silent_p.I96I	p.I274I	NM_019008	NP_061881	Q9NQG6	SMC7L_HUMAN			6	1320	+	Melanoma(58;0.04)		274					Q7L890|Q9BUI3	Silent	SNP	ENST00000325301.2	37	c.822C>T	CCDS13995.1																																																																																				0.567	MIEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321325.1	NM_019008		15	52	0	0	0	0.003163	0	15	52				
ACR	49	broad.mit.edu	37	22	51183283	51183283	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr22:51183283C>T	ENST00000216139.5	+	5	954	c.914C>T	c.(913-915)cCc>cTc	p.P305L	AC002056.5_ENST00000532913.1_RNA|ACR_ENST00000527761.1_3'UTR	NM_001097.2	NP_001088.2	P10323	ACRO_HUMAN	acrosin	305					acrosome matrix dispersal (GO:0002077)|acrosome reaction (GO:0007340)|activation of adenylate cyclase activity (GO:0007190)|binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|response to steroid hormone (GO:0048545)|single fertilization (GO:0007338)	acrosomal matrix (GO:0043159)|extracellular region (GO:0005576)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|protein complex (GO:0043234)	amidase activity (GO:0004040)|copper ion binding (GO:0005507)|DNA binding (GO:0003677)|drug binding (GO:0008144)|fucose binding (GO:0042806)|mannose binding (GO:0005537)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	7		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;1.1e-06)|LUAD - Lung adenocarcinoma(64;0.247)		CCTCCACCTCCCACCACTCGA	0.597																																							uc003bnh.3		NA																	0					0						c.(913-915)CCC>CTC		acrosin precursor							20.0	18.0	19.0					22																	51183283		2183	4284	6467	SO:0001583	missense	49				acrosome matrix dispersal|activation of adenylate cyclase activity	acrosomal matrix|protein complex	amidase activity|copper ion binding|DNA binding|drug binding|fucose binding|mannose binding|protein binding|serine-type endopeptidase activity|zinc ion binding	g.chr22:51183283C>T	CR456366	CCDS14101.1	22q13.33	2012-10-23	2012-10-23		ENSG00000100312	ENSG00000100312	3.4.21.10		126	protein-coding gene	gene with protein product	"""preproacrosin"", ""acrosin light and heavy chain prepropeptide"""	102480				2298447, 12398221	Standard	NM_001097		Approved		uc003bnh.4	P10323	OTTHUMG00000150155	ENST00000216139.5:c.914C>T	22.37:g.51183283C>T	ENSP00000216139:p.Pro305Leu						p.P305L	NM_001097	NP_001088	P10323	ACRO_HUMAN		BRCA - Breast invasive adenocarcinoma(115;1.1e-06)|LUAD - Lung adenocarcinoma(64;0.247)	5	926	+		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	305					Q6ICK2	Missense_Mutation	SNP	ENST00000216139.5	37	c.914C>T	CCDS14101.1	.	.	.	.	.	.	.	.	.	.	C	12.11	1.840950	0.32513	.	.	ENSG00000100312	ENST00000216139	D	0.88818	-2.43	2.93	2.93	0.34026	.	1.413910	0.04860	N	0.443913	D	0.88228	0.6380	M	0.64404	1.975	0.26389	N	0.976605	D	0.54207	0.965	B	0.42738	0.396	T	0.78580	-0.2149	10	0.54805	T	0.06	-0.7409	9.5466	0.39284	0.0:1.0:0.0:0.0	.	305	P10323	ACRO_HUMAN	L	305	ENSP00000216139:P305L	ENSP00000216139:P305L	P	+	2	0	ACR	49530149	0.026000	0.19158	0.004000	0.12327	0.005000	0.04900	1.855000	0.39378	1.962000	0.57031	0.305000	0.20034	CCC		0.597	ACR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000316605.2	NM_001097		3	7	0	0	0	0.004672	0	3	7				
SCN10A	6336	broad.mit.edu	37	3	38738878	38738878	+	Nonsense_Mutation	SNP	C	C	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr3:38738878C>A	ENST00000449082.2	-	27	5832	c.5833G>T	c.(5833-5835)Gaa>Taa	p.E1945*		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1945					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	CTGGTGGCTTCATCTTCATTT	0.478																																							uc003ciq.2		NA																	0				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10						c.(5833-5835)GAA>TAA		sodium channel, voltage-gated, type X, alpha	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)						141.0	122.0	128.0					3																	38738878		2203	4300	6503	SO:0001587	stop_gained	6336				sensory perception	voltage-gated sodium channel complex		g.chr3:38738878C>A	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.5833G>T	3.37:g.38738878C>A	ENSP00000390600:p.Glu1945*						p.E1945*	NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	27	5833	-			1945					A6NDQ1	Nonsense_Mutation	SNP	ENST00000449082.2	37	c.5833G>T	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	C	42	9.301705	0.99130	.	.	ENSG00000185313	ENST00000449082	.	.	.	5.38	4.52	0.55395	.	0.169107	0.38058	N	0.001826	.	.	.	.	.	.	0.37975	D	0.933403	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	8.2665	0.31817	0.0:0.8263:0.0:0.1737	.	.	.	.	X	1945	.	ENSP00000390600:E1945X	E	-	1	0	SCN10A	38713882	0.001000	0.12720	0.157000	0.22605	0.789000	0.44602	0.513000	0.22770	1.506000	0.48736	-0.137000	0.14449	GAA		0.478	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514		26	73	1	0	4.26978e-12	0.01892	4.78113e-12	26	73				
SETD2	29072	broad.mit.edu	37	3	47079269	47079269	+	Splice_Site	SNP	T	T	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr3:47079269T>A	ENST00000409792.3	-	18	7281		c.e18-2			NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2						angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.?(2)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TGAGTCTGCCTAGAAAGAGAC	0.448			"""N, F, S, Mis"""		clear cell renal carcinoma																																		uc003cqs.2		NA		Rec	yes		3	3p21.31	29072	N|F|S|Mis	SET domain containing 2			E			clear cell renal carcinoma		2	Unknown(2)		kidney(2)	kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32						c.e18-1		SET domain containing 2							87.0	76.0	80.0					3																	47079269		2203	4300	6503	SO:0001630	splice_region_variant	29072				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding	g.chr3:47079269T>A	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.7239-2A>T	3.37:g.47079269T>A						SETD2_uc003cqv.2_Splice_Site_p.R2480_splice|SETD2_uc003cqr.2_Splice_Site_p.L12_splice	p.R2413_splice	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)	18	7292	-		Acute lymphoblastic leukemia(5;0.0169)						O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Splice_Site	SNP	ENST00000409792.3	37	c.7239_splice	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	T	28.5	4.927127	0.92389	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3943	0.83563	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SETD2	47054273	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.922000	0.87538	2.281000	0.76405	0.533000	0.62120	.		0.448	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	Intron	17	37	0	0	0	0.006122	0	17	37				
SLC35A5	55032	broad.mit.edu	37	3	112299881	112299881	+	Nonsense_Mutation	SNP	C	C	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr3:112299881C>A	ENST00000492406.1	+	6	1200	c.917C>A	c.(916-918)tCa>tAa	p.S306*	SLC35A5_ENST00000460713.1_3'UTR	NM_017945.2	NP_060415.1	Q9BS91	S35A5_HUMAN	solute carrier family 35, member A5	306					nucleotide-sugar transport (GO:0015780)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)|sugar:proton symporter activity (GO:0005351)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|skin(1)	11						AGTGCATTTTCAGTAGCCCTT	0.438																																							uc003dze.2		NA																	0				ovary(1)	1						c.(916-918)TCA>TAA		solute carrier family 35, member A5							81.0	78.0	79.0					3																	112299881		2203	4299	6502	SO:0001587	stop_gained	55032					Golgi membrane|integral to membrane	nucleotide-sugar transmembrane transporter activity|sugar:hydrogen symporter activity	g.chr3:112299881C>A	AK000737	CCDS2967.1	3q13.13	2013-05-22			ENSG00000138459	ENSG00000138459		"""Solute carriers"""	20792	protein-coding gene	gene with protein product							Standard	NM_017945		Approved	FLJ20730	uc003dze.4	Q9BS91	OTTHUMG00000159263	ENST00000492406.1:c.917C>A	3.37:g.112299881C>A	ENSP00000417654:p.Ser306*						p.S306*	NM_017945	NP_060415	Q9BS91	S35A5_HUMAN			6	1162	+			306			Helical; (Potential).		D3DN66|Q69YY6|Q6ZMD6|Q9NWM9	Nonsense_Mutation	SNP	ENST00000492406.1	37	c.917C>A	CCDS2967.1	.	.	.	.	.	.	.	.	.	.	C	38	6.991716	0.97987	.	.	ENSG00000138459	ENST00000492406	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.3469	20.1358	0.98028	0.0:1.0:0.0:0.0	.	.	.	.	X	306	.	.	S	+	2	0	SLC35A5	113782571	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.413000	0.59795	2.833000	0.97629	0.585000	0.79938	TCA		0.438	SLC35A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354184.1	NM_017945		18	58	1	0	8.00594e-06	0.007413	8.50631e-06	18	58				
DTX3L	151636	broad.mit.edu	37	3	122288101	122288101	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr3:122288101G>C	ENST00000296161.4	+	3	1354	c.1165G>C	c.(1165-1167)Gaa>Caa	p.E389Q	DTX3L_ENST00000383661.3_Intron	NM_138287.3	NP_612144.1	Q8TDB6	DTX3L_HUMAN	deltex 3 like, E3 ubiquitin ligase	389					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone monoubiquitination (GO:0010390)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0459)		TAAACTTTTAGAAACTGAATT	0.353																																							uc003efk.2		NA																	0				ovary(2)|lung(1)|breast(1)	4						c.(1165-1167)GAA>CAA		deltex 3-like							57.0	60.0	59.0					3																	122288101		2203	4300	6503	SO:0001583	missense	151636				histone monoubiquitination|response to DNA damage stimulus	cytoplasm|nucleus	histone binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr3:122288101G>C		CCDS3015.1	3q21.1	2014-01-28	2014-01-28		ENSG00000163840	ENSG00000163840		"""RING-type (C3HC4) zinc fingers"""	30323	protein-coding gene	gene with protein product	"""rhysin 2"""	613143	"""deltex 3-like (Drosophila)"""			12670957, 22411408	Standard	NM_138287		Approved	BBAP	uc003efk.3	Q8TDB6	OTTHUMG00000159524	ENST00000296161.4:c.1165G>C	3.37:g.122288101G>C	ENSP00000296161:p.Glu389Gln					DTX3L_uc010hrj.2_Intron	p.E389Q	NM_138287	NP_612144	Q8TDB6	DTX3L_HUMAN		GBM - Glioblastoma multiforme(114;0.0459)	3	1254	+			389					B3KWH6|Q53ZZ3|Q5MJP7	Missense_Mutation	SNP	ENST00000296161.4	37	c.1165G>C	CCDS3015.1	.	.	.	.	.	.	.	.	.	.	G	9.727	1.161235	0.21538	.	.	ENSG00000163840	ENST00000296161	T	0.33216	1.42	5.35	3.15	0.36227	.	0.363941	0.23906	N	0.043394	T	0.22399	0.0540	L	0.49350	1.555	0.80722	D	1	P	0.35844	0.524	B	0.28139	0.086	T	0.06373	-1.0830	10	0.51188	T	0.08	-38.2642	7.0167	0.24892	0.1209:0.165:0.7141:0.0	.	389	Q8TDB6	DTX3L_HUMAN	Q	389	ENSP00000296161:E389Q	ENSP00000296161:E389Q	E	+	1	0	DTX3L	123770791	0.100000	0.21855	0.960000	0.40013	0.224000	0.24922	0.552000	0.23376	1.368000	0.46115	0.655000	0.94253	GAA		0.353	DTX3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355966.1	NM_138287		3	107	0	0	0	0.014758	0	3	107				
PLXNA1	5361	broad.mit.edu	37	3	126735843	126735843	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr3:126735843G>A	ENST00000393409.2	+	16	3239	c.3239G>A	c.(3238-3240)cGa>cAa	p.R1080Q	PLXNA1_ENST00000251772.4_Missense_Mutation_p.R1057Q	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1080	IPT/TIG 3.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		CGTGAACCCCGAATCCGGGCC	0.647																																							uc003ejg.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(3169-3171)CGA>CAA		plexin A1							64.0	62.0	62.0					3																	126735843		2203	4300	6503	SO:0001583	missense	5361				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity	g.chr3:126735843G>A	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.3239G>A	3.37:g.126735843G>A	ENSP00000377061:p.Arg1080Gln						p.R1057Q	NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN		GBM - Glioblastoma multiforme(114;0.155)	16	3174	+			1080			Extracellular (Potential).|IPT/TIG 3.			Missense_Mutation	SNP	ENST00000393409.2	37	c.3170G>A	CCDS33847.2	.	.	.	.	.	.	.	.	.	.	G	13.30	2.194858	0.38806	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.75938	-0.98;-0.98	4.08	4.08	0.47627	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.125809	0.36778	N	0.002410	T	0.64271	0.2583	L	0.43701	1.375	0.40468	D	0.980313	B	0.30889	0.299	B	0.33568	0.166	T	0.59721	-0.7401	10	0.17832	T	0.49	.	10.1894	0.43017	0.0915:0.0:0.9085:0.0	.	1080	Q9UIW2	PLXA1_HUMAN	Q	1080;1057	ENSP00000377061:R1080Q;ENSP00000251772:R1057Q	ENSP00000251772:R1057Q	R	+	2	0	PLXNA1	128218533	1.000000	0.71417	0.998000	0.56505	0.843000	0.47879	1.991000	0.40727	2.115000	0.64714	0.491000	0.48974	CGA		0.647	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242		15	41	0	0	0	0.00499	0	15	41				
TPRA1	131601	broad.mit.edu	37	3	127294624	127294624	+	Missense_Mutation	SNP	T	T	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr3:127294624T>C	ENST00000355552.3	-	8	1014	c.638A>G	c.(637-639)aAg>aGg	p.K213R	TPRA1_ENST00000489960.1_Missense_Mutation_p.K213R|TPRA1_ENST00000296210.7_Intron|TPRA1_ENST00000450633.2_Missense_Mutation_p.K213R|TPRA1_ENST00000465915.1_5'Flank	NM_001136053.1	NP_001129525.1	Q86W33	TPRA1_HUMAN	transmembrane protein, adipocyte asscociated 1	213					aging (GO:0007568)|G-protein coupled receptor signaling pathway (GO:0007186)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	9						CAGCGGGGTCTTGGGAAGGAT	0.647																																							uc003ejl.2		NA																	0					0						c.(637-639)AAG>AGG		G protein-coupled receptor 175 isoform 1							52.0	56.0	55.0					3																	127294624		2203	4300	6503	SO:0001583	missense	131601				aging|lipid metabolic process	integral to membrane	G-protein coupled receptor activity	g.chr3:127294624T>C	AK056759	CCDS3042.1, CCDS46899.1	3q21.2	2012-08-22	2009-07-08	2009-07-08	ENSG00000163870	ENSG00000163870		"""GPCR / Unclassified : 7TM orphan receptors"""	30413	protein-coding gene	gene with protein product	"""transmembrane protein 227"""	608336	"""G protein-coupled receptor 175"""	GPR175		10342878	Standard	NM_001136053		Approved	TPRA40, FLJ32197, TMEM227	uc003ejn.3	Q86W33	OTTHUMG00000159639	ENST00000355552.3:c.638A>G	3.37:g.127294624T>C	ENSP00000347748:p.Lys213Arg					TPRA1_uc003ejm.2_Intron|TPRA1_uc003ejo.2_Missense_Mutation_p.K213R|TPRA1_uc010hsk.2_Intron|TPRA1_uc003ejn.2_Missense_Mutation_p.K213R	p.K213R	NM_016372	NP_057456	Q86W33	TPRA1_HUMAN			7	929	-			213					A8MVB8|D3DNA9|Q8WZ24|Q96AJ6|Q9P2R4	Missense_Mutation	SNP	ENST00000355552.3	37	c.638A>G	CCDS3042.1	.	.	.	.	.	.	.	.	.	.	T	12.25	1.880683	0.33255	.	.	ENSG00000163870	ENST00000450633;ENST00000355552;ENST00000489960	.	.	.	4.86	-0.422	0.12329	.	0.147184	0.64402	N	0.000013	T	0.39733	0.1089	L	0.44542	1.39	0.50313	D	0.999866	B	0.11235	0.004	B	0.12156	0.007	T	0.09058	-1.0692	9	0.16896	T	0.51	-12.409	5.4825	0.16731	0.0:0.2216:0.1355:0.6429	.	213	Q86W33	TPRA1_HUMAN	R	213	.	ENSP00000347748:K213R	K	-	2	0	TPRA1	128777314	1.000000	0.71417	0.995000	0.50966	0.739000	0.42172	2.484000	0.45242	-0.330000	0.08514	0.260000	0.18958	AAG		0.647	TPRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356624.1	NM_016372		3	71	0	0	0	0.004672	0	3	71				
SLC9A9	285195	broad.mit.edu	37	3	143513851	143513851	+	Silent	SNP	G	G	A	rs377682237		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr3:143513851G>A	ENST00000316549.6	-	4	733	c.525C>T	c.(523-525)atC>atT	p.I175I		NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	175					ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)			breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						ACCCTATGACGATGCAGGAGA	0.448																																							uc003evn.2		NA																	0				ovary(2)|skin(1)	3						c.(523-525)ATC>ATT		solute carrier family 9 (sodium/hydrogen		G		1,4405	2.1+/-5.4	0,1,2202	113.0	107.0	109.0		525	-6.5	0.2	3		109	0,8600		0,0,4300	no	coding-synonymous	SLC9A9	NM_173653.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		175/646	143513851	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	285195				regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity	g.chr3:143513851G>A	AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.525C>T	3.37:g.143513851G>A						SLC9A9_uc011bnk.1_Silent_p.I49I	p.I175I	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN			4	707	-			175			Helical; (Potential).		A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Silent	SNP	ENST00000316549.6	37	c.525C>T	CCDS33872.1																																																																																				0.448	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354994.1	NM_173653		25	63	0	0	0	0.005443	0	25	63				
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	Colon(199;1504 1750 3362 26421 31210 32040)	uc003fjk.2	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57		Dom	yes		3	3q26.3	5290	Mis	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			"""E, O"""			colorectal|gastric|gliobastoma|breast		899	Substitution - Missense(899)	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553						c.(1633-1635)GAG>AAG		phosphoinositide-3-kinase, catalytic, alpha							61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	g.chr3:178936091G>A		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	HNSCC(19;0.045)|TSP Lung(28;0.18)					p.E545K	NM_006218	NP_006209	P42336	PK3CA_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		10	1790	+	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		545		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).	PI3K helical.		Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	c.1633G>A	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2			13	45	0	0	0	0.020292	0	13	45				
CCKAR	886	broad.mit.edu	37	4	26483452	26483452	+	Silent	SNP	G	G	T	rs201916972		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr4:26483452G>T	ENST00000295589.3	-	5	1289	c.1095C>A	c.(1093-1095)gtC>gtA	p.V365V		NM_000730.2	NP_000721.1	P32238	CCKAR_HUMAN	cholecystokinin A receptor	365					axonogenesis (GO:0007409)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|feeding behavior (GO:0007631)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to nutrient (GO:0007584)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cholecystokinin receptor activity (GO:0004951)			NS(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|pancreas(1)|skin(1)	29		Breast(46;0.0503)			Ceruletide(DB00403)	TGATGGGGTTGACGCAGGAGG	0.642																																							uc003gse.1		NA																	0				lung(3)|pancreas(1)	4						c.(1093-1095)GTC>GTA		cholecystokinin A receptor	Ceruletide(DB00403)						133.0	124.0	127.0					4																	26483452		2203	4300	6503	SO:0001819	synonymous_variant	886				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration|response to nutrient	integral to plasma membrane	cholecystokinin receptor activity	g.chr4:26483452G>T	L19315	CCDS3438.1	4p15.2	2013-09-20			ENSG00000163394	ENSG00000163394		"""GPCR / Class A : Cholecystokinin receptors"""	1570	protein-coding gene	gene with protein product		118444					Standard	NM_000730		Approved		uc003gse.1	P32238	OTTHUMG00000128567	ENST00000295589.3:c.1095C>A	4.37:g.26483452G>T							p.V365V	NM_000730	NP_000721	P32238	CCKAR_HUMAN			5	1248	-		Breast(46;0.0503)	365			Helical; Name=7; (Potential).		B2R9Z5	Silent	SNP	ENST00000295589.3	37	c.1095C>A	CCDS3438.1																																																																																				0.642	CCKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250418.2			19	89	1	0	5.03518e-11	0.007413	5.60464e-11	19	89				
HELQ	113510	broad.mit.edu	37	4	84374727	84374727	+	Nonsense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr4:84374727C>T	ENST00000295488.3	-	2	831	c.669G>A	c.(667-669)tgG>tgA	p.W223*	MRPS18C_ENST00000295491.4_5'Flank|MRPS18C_ENST00000507349.1_5'Flank|HELQ_ENST00000510985.1_Nonsense_Mutation_p.W223*|HELQ_ENST00000440639.2_5'Flank|MRPS18C_ENST00000507019.1_5'Flank	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	223					double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						AGGATGACTTCCAATCCCTTT	0.393								Other identified genes with known or suspected DNA repair function																															uc003hom.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(667-669)TGG>TGA	Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function	DNA helicase HEL308							120.0	123.0	122.0					4																	84374727		2203	4300	6503	SO:0001587	stop_gained	113510						ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr4:84374727C>T	AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.669G>A	4.37:g.84374727C>T	ENSP00000295488:p.Trp223*					HELQ_uc010ikb.2_Nonsense_Mutation_p.W223*|HELQ_uc003hol.3_RNA|HELQ_uc010ikc.2_RNA|HELQ_uc003hon.1_Nonsense_Mutation_p.W117*|HELQ_uc003hoo.1_Nonsense_Mutation_p.W186*|HELQ_uc003hop.1_Nonsense_Mutation_p.W117*|HELQ_uc003hoq.1_Nonsense_Mutation_p.W223*|MRPS18C_uc003hor.3_5'Flank|MRPS18C_uc011ccu.1_5'Flank	p.W223*	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN			2	848	-			223					Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Nonsense_Mutation	SNP	ENST00000295488.3	37	c.669G>A	CCDS3603.1	.	.	.	.	.	.	.	.	.	.	C	15.90	2.970810	0.53614	.	.	ENSG00000163312	ENST00000295488;ENST00000510985	.	.	.	4.76	-0.498	0.12019	.	1.423560	0.04316	N	0.349793	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-56.2831	6.0924	0.20001	0.0975:0.3021:0.4645:0.1359	.	.	.	.	X	223	.	ENSP00000295488:W223X	W	-	3	0	HELQ	84593751	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.563000	0.05943	0.034000	0.15491	-0.136000	0.14681	TGG		0.393	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252810.1	NM_133636		14	89	0	0	0	0.004007	0	14	89				
MARCH1	55016	broad.mit.edu	37	4	165118814	165118814	+	Intron	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr4:165118814G>C	ENST00000503008.1	-	2	864				MARCH1_ENST00000508725.1_Intron|MARCH1_ENST00000514618.1_Intron	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TTTCACATCAGAGGGCGCCCT	0.502																																							uc011cjk.1		NA																	0					0						c.(49-51)TCT>TGT		acidic nuclear phosphoprotein 32C							125.0	127.0	126.0					4																	165118814		2203	4300	6503	SO:0001627	intron_variant	23520							g.chr4:165118814G>C	AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.113-86000C>G	4.37:g.165118814G>C						MARCH1_uc003iqs.1_Intron	p.S17C	NM_012403	NP_036535	O43423	AN32C_HUMAN		KIRC - Kidney renal clear cell carcinoma(143;0.242)	1	50	-	all_hematologic(180;0.203)	Prostate(90;0.0138)|Melanoma(52;0.18)|all_neural(102;0.223)	17					D3DP29|Q9NWR0	Missense_Mutation	SNP	ENST00000503008.1	37	c.50C>G	CCDS54814.1																																																																																				0.502	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2	NM_017923		39	126	0	0	0	0.006999	0	39	126				
STOX2	56977	broad.mit.edu	37	4	184931234	184931234	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr4:184931234G>A	ENST00000308497.4	+	3	2678	c.1243G>A	c.(1243-1245)Gaa>Aaa	p.E415K	STOX2_ENST00000438269.1_Missense_Mutation_p.E415K	NM_020225.1	NP_064610.1	Q9P2F5	STOX2_HUMAN	storkhead box 2	415					embryo development (GO:0009790)|maternal placenta development (GO:0001893)					breast(1)|endometrium(7)|lung(6)	14		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)		CTTCATCATTGAACACAAAGG	0.493																																							uc003ivz.1		NA																	0					0						c.(1243-1245)GAA>AAA		storkhead box 2							60.0	60.0	60.0					4																	184931234		2035	4183	6218	SO:0001583	missense	56977				embryo development|maternal placenta development			g.chr4:184931234G>A	AB037813	CCDS47167.1	4q35.1	2014-09-11			ENSG00000173320	ENSG00000173320			25450	protein-coding gene	gene with protein product							Standard	XM_005263142		Approved	DKFZp762K222	uc003ivz.1	Q9P2F5	OTTHUMG00000160618	ENST00000308497.4:c.1243G>A	4.37:g.184931234G>A	ENSP00000311257:p.Glu415Lys					STOX2_uc003iwa.1_Missense_Mutation_p.E104K	p.E415K	NM_020225	NP_064610	Q9P2F5	STOX2_HUMAN		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)	3	2678	+		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)	415					A6H8U4|Q9NPS8	Missense_Mutation	SNP	ENST00000308497.4	37	c.1243G>A	CCDS47167.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.873673	0.72180	.	.	ENSG00000173320	ENST00000308497;ENST00000438269	T;T	0.80214	-0.34;-1.35	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.84543	0.5495	L	0.32530	0.975	0.80722	D	1	D;D	0.63880	0.993;0.982	P;D	0.67548	0.84;0.952	T	0.80906	-0.1173	10	0.28530	T	0.3	-26.9373	19.9142	0.97043	0.0:0.0:1.0:0.0	.	415;415	Q9P2F5-2;Q9P2F5	.;STOX2_HUMAN	K	415	ENSP00000311257:E415K;ENSP00000390127:E415K	ENSP00000311257:E415K	E	+	1	0	STOX2	185168228	1.000000	0.71417	0.506000	0.27664	0.495000	0.33615	9.263000	0.95617	2.941000	0.99782	0.655000	0.94253	GAA		0.493	STOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361433.3	NM_020225		5	15	0	0	0	0.014758	0	5	15				
CTNND2	1501	broad.mit.edu	37	5	11364847	11364847	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr5:11364847G>C	ENST00000304623.8	-	8	1522	c.1333C>G	c.(1333-1335)Ctg>Gtg	p.L445V	CTNND2_ENST00000359640.2_Missense_Mutation_p.L445V|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000511377.1_Missense_Mutation_p.L354V|CTNND2_ENST00000503622.1_Missense_Mutation_p.L108V|CTNND2_ENST00000458100.2_Missense_Mutation_p.L12V	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	445					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GCTGGCGGCAGAGGGTCCCCC	0.637																																							uc003jfa.1		NA																	0				large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						c.(1333-1335)CTG>GTG		catenin (cadherin-associated protein), delta 2							37.0	41.0	40.0					5																	11364847		2203	4300	6503	SO:0001583	missense	1501				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding	g.chr5:11364847G>C	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1333C>G	5.37:g.11364847G>C	ENSP00000307134:p.Leu445Val					CTNND2_uc010itt.2_Missense_Mutation_p.L354V|CTNND2_uc011cmy.1_Missense_Mutation_p.L108V|CTNND2_uc011cmz.1_Missense_Mutation_p.L12V|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.L12V	p.L445V	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN			8	1478	-			445					B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	c.1333C>G	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	G	13.93	2.384762	0.42308	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000458100;ENST00000503622;ENST00000502551	T;T;T;T;T	0.77877	-1.04;-1.13;-1.04;-1.11;-1.11	5.47	3.66	0.41972	.	1.083050	0.07184	N	0.854513	T	0.71392	0.3334	L	0.50333	1.59	0.32501	N	0.538819	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.64521	-0.6388	10	0.27082	T	0.32	-4.7423	7.6752	0.28481	0.1428:0.1452:0.712:0.0	.	108;12;445	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	V	445;445;354;12;108;185	ENSP00000307134:L445V;ENSP00000352661:L445V;ENSP00000426510:L354V;ENSP00000391155:L12V;ENSP00000426887:L108V	ENSP00000307134:L445V	L	-	1	2	CTNND2	11417847	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.939000	0.40213	1.300000	0.44818	-0.211000	0.12701	CTG		0.637	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332		7	38	0	0	0	0.004482	0	7	38				
CDH12	1010	broad.mit.edu	37	5	21817092	21817092	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr5:21817092C>T	ENST00000382254.1	-	9	2050	c.964G>A	c.(964-966)Gat>Aat	p.D322N	CDH12_ENST00000522262.1_Missense_Mutation_p.D282N|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000504376.2_Missense_Mutation_p.D322N	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	322	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						GTATCCTCATCTGTGACGATG	0.333										HNSCC(59;0.17)																													uc010iuc.2		NA																	0				ovary(2)	2						c.(964-966)GAT>AAT		cadherin 12, type 2 preproprotein							151.0	150.0	150.0					5																	21817092		2203	4300	6503	SO:0001583	missense	1010				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:21817092C>T	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.964G>A	5.37:g.21817092C>T	ENSP00000371689:p.Asp322Asn	HNSCC(59;0.17)				CDH12_uc011cno.1_Missense_Mutation_p.D282N|CDH12_uc003jgk.2_Missense_Mutation_p.D322N	p.D322N	NM_004061	NP_004052	P55289	CAD12_HUMAN			6	1422	-			322			Extracellular (Potential).|Cadherin 3.		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	c.964G>A	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	C	15.15	2.747591	0.49257	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.52754	0.65;0.65;0.65	5.06	4.19	0.49359	Cadherin (4);Cadherin-like (1);	0.045845	0.85682	D	0.000000	T	0.50735	0.1633	L	0.52206	1.635	0.42107	D	0.991361	B;B	0.27823	0.19;0.0	B;B	0.40375	0.327;0.002	T	0.52881	-0.8516	10	0.46703	T	0.11	.	13.736	0.62817	0.0:0.9252:0.0:0.0748	.	282;322	B7Z2U6;P55289	.;CAD12_HUMAN	N	322;322;282	ENSP00000423577:D322N;ENSP00000371689:D322N;ENSP00000428786:D282N	ENSP00000371689:D322N	D	-	1	0	CDH12	21852849	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	4.488000	0.60300	1.245000	0.43885	0.650000	0.86243	GAT		0.333	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061		20	112	0	0	0	0.016522	0	20	112				
CDH12	1010	broad.mit.edu	37	5	21817190	21817190	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr5:21817190C>T	ENST00000382254.1	-	9	1952	c.866G>A	c.(865-867)gGa>gAa	p.G289E	CDH12_ENST00000522262.1_Missense_Mutation_p.G249E|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000504376.2_Missense_Mutation_p.G289E	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	289	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						TCTTATTCTTCCAATAGCTGA	0.378										HNSCC(59;0.17)																													uc010iuc.2		NA																	0				ovary(2)	2						c.(865-867)GGA>GAA		cadherin 12, type 2 preproprotein							81.0	80.0	81.0					5																	21817190		2203	4300	6503	SO:0001583	missense	1010				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:21817190C>T	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.866G>A	5.37:g.21817190C>T	ENSP00000371689:p.Gly289Glu	HNSCC(59;0.17)				CDH12_uc011cno.1_Missense_Mutation_p.G249E|CDH12_uc003jgk.2_Missense_Mutation_p.G289E	p.G289E	NM_004061	NP_004052	P55289	CAD12_HUMAN			6	1324	-			289			Extracellular (Potential).|Cadherin 3.		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	c.866G>A	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.669142	0.88348	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.53857	0.6;0.6;0.6	4.97	4.97	0.65823	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.78013	0.4217	M	0.89478	3.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.83007	-0.0174	10	0.87932	D	0	.	18.5819	0.91174	0.0:1.0:0.0:0.0	.	249;289	B7Z2U6;P55289	.;CAD12_HUMAN	E	289;289;249	ENSP00000423577:G289E;ENSP00000371689:G289E;ENSP00000428786:G249E	ENSP00000371689:G289E	G	-	2	0	CDH12	21852947	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.314000	0.78988	2.435000	0.82474	0.585000	0.79938	GGA		0.378	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061		11	53	0	0	0	0.010729	0	11	53				
PLCXD3	345557	broad.mit.edu	37	5	41382477	41382477	+	Missense_Mutation	SNP	A	A	G	rs376668812		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr5:41382477A>G	ENST00000377801.3	-	2	337	c.263T>C	c.(262-264)cTa>cCa	p.L88P	PLCXD3_ENST00000328457.3_Missense_Mutation_p.L88P			Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 3	88	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						TCCAGCTCCTAGCTGGCCAGT	0.443																																							uc003jmm.1		NA																	0				skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6						c.(262-264)CTA>CCA		phosphatidylinositol-specific phospholipase C, X		A	PRO/LEU	0,4406		0,0,2203	60.0	65.0	63.0		263	6.1	1.0	5		63	1,8599	1.2+/-3.3	0,1,4299	no	missense	PLCXD3	NM_001005473.2	98	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging	88/322	41382477	1,13005	2203	4300	6503	SO:0001583	missense	345557				intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity	g.chr5:41382477A>G		CCDS34150.1	5p13.1	2004-09-09			ENSG00000182836	ENSG00000182836			31822	protein-coding gene	gene with protein product							Standard	NM_001005473		Approved		uc003jmm.1	Q63HM9	OTTHUMG00000162076	ENST00000377801.3:c.263T>C	5.37:g.41382477A>G	ENSP00000367032:p.Leu88Pro						p.L88P	NM_001005473	NP_001005473	Q63HM9	PLCX3_HUMAN			2	365	-			88			PI-PLC X-box.		A6NL04	Missense_Mutation	SNP	ENST00000377801.3	37	c.263T>C	CCDS34150.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.101231	0.76983	0.0	1.16E-4	ENSG00000182836	ENST00000377801;ENST00000328457	D;D	0.83837	-1.77;-1.77	6.07	6.07	0.98685	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (2);	0.065323	0.64402	D	0.000006	D	0.92795	0.7709	H	0.94847	3.59	0.80722	D	1	D	0.63046	0.992	P	0.59424	0.857	D	0.94538	0.7742	10	0.87932	D	0	-7.5525	16.6406	0.85098	1.0:0.0:0.0:0.0	.	88	Q63HM9	PLCX3_HUMAN	P	88	ENSP00000367032:L88P;ENSP00000333751:L88P	ENSP00000333751:L88P	L	-	2	0	PLCXD3	41418234	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.923000	0.92808	2.326000	0.78906	0.533000	0.62120	CTA		0.443	PLCXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367109.1	XM_293875		16	56	0	0	0	0.006122	0	16	56				
PGGT1B	5229	broad.mit.edu	37	5	114573691	114573691	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr5:114573691G>A	ENST00000419445.1	-	4	363	c.343C>T	c.(343-345)Cat>Tat	p.H115Y	PGGT1B_ENST00000379615.3_Missense_Mutation_p.H115Y	NM_005023.3	NP_005014.2	P53609	PGTB1_HUMAN	protein geranylgeranyltransferase type I, beta subunit	115					negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|protein geranylgeranylation (GO:0018344)|response to cytokine (GO:0034097)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)	CAAX-protein geranylgeranyltransferase activity (GO:0004662)|protein geranylgeranyltransferase activity (GO:0004661)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)	6		all_cancers(142;0.000523)|all_epithelial(76;6.45e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		Epithelial(69;2.95e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.98e-08)|all cancers(49;3.1e-06)		TCATAAGGATGAGCTGTTCCA	0.343																																							uc003kqw.3		NA																	0					0						c.(343-345)CAT>TAT		geranylgeranyltransferase type 1 beta	Pravastatin(DB00175)						54.0	57.0	56.0					5																	114573691		2202	4299	6501	SO:0001583	missense	5229				protein geranylgeranylation	CAAX-protein geranylgeranyltransferase complex	CAAX-protein geranylgeranyltransferase activity	g.chr5:114573691G>A		CCDS4116.1	5q23.1	2008-02-05			ENSG00000164219	ENSG00000164219			8895	protein-coding gene	gene with protein product		602031				8106351	Standard	NM_005023		Approved	GGTI, BGGI	uc003kqw.4	P53609	OTTHUMG00000128893	ENST00000419445.1:c.343C>T	5.37:g.114573691G>A	ENSP00000404676:p.His115Tyr					PGGT1B_uc003kqx.3_5'UTR|PGGT1B_uc010jch.2_Missense_Mutation_p.H115Y	p.H115Y	NM_005023	NP_005014	P53609	PGTB1_HUMAN		Epithelial(69;2.95e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.98e-08)|all cancers(49;3.1e-06)	4	364	-		all_cancers(142;0.000523)|all_epithelial(76;6.45e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)	115					Q5MJP9	Missense_Mutation	SNP	ENST00000419445.1	37	c.343C>T	CCDS4116.1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.894098	0.52121	.	.	ENSG00000164219	ENST00000419445;ENST00000379615	T;T	0.48836	0.87;0.8	5.34	5.34	0.76211	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.188269	0.56097	D	0.000021	T	0.43964	0.1271	L	0.51422	1.61	0.80722	D	1	P;B	0.34615	0.459;0.088	B;B	0.25614	0.062;0.036	T	0.47959	-0.9076	10	0.62326	D	0.03	-15.2769	19.4112	0.94673	0.0:0.0:1.0:0.0	.	115;115	P53609-2;P53609	.;PGTB1_HUMAN	Y	115	ENSP00000404676:H115Y;ENSP00000368935:H115Y	ENSP00000368935:H115Y	H	-	1	0	PGGT1B	114601590	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.740000	0.98839	2.652000	0.90054	0.563000	0.77884	CAT		0.343	PGGT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250855.2	NM_005023		16	53	0	0	0	0.004007	0	16	53				
PCDHA3	56145	broad.mit.edu	37	5	140182415	140182415	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr5:140182415C>G	ENST00000522353.2	+	1	1633	c.1633C>G	c.(1633-1635)Ctg>Gtg	p.L545V	PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.L545V|PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	545	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGCCGCCTCTGGGCAGCAA	0.682																																							uc003lhf.2		NA																	0				ovary(6)|skin(2)	8						c.(1633-1635)CTG>GTG		protocadherin alpha 3 isoform 1 precursor							87.0	88.0	88.0					5																	140182415		2203	4298	6501	SO:0001583	missense	56145				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140182415C>G	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1633C>G	5.37:g.140182415C>G	ENSP00000429808:p.Leu545Val					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.L545V	p.L545V	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1633	+			545			Cadherin 5.|Extracellular (Potential).		O75286	Missense_Mutation	SNP	ENST00000522353.2	37	c.1633C>G	CCDS54915.1	.	.	.	.	.	.	.	.	.	.	c	14.59	2.581043	0.46006	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.55234	0.53;0.53	4.68	4.68	0.58851	Cadherin (4);Cadherin-like (1);	0.000000	0.32836	U	0.005596	T	0.80497	0.4634	H	0.96576	3.845	0.36743	D	0.882344	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.991	D	0.88545	0.3112	10	0.87932	D	0	.	12.5	0.55950	0.0:0.9182:0.0:0.0818	.	545;545	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	V	545	ENSP00000429808:L545V;ENSP00000434086:L545V	ENSP00000429808:L545V	L	+	1	2	PCDHA3	140162599	0.957000	0.32711	0.935000	0.37517	0.311000	0.27955	2.198000	0.42705	2.340000	0.79590	0.306000	0.20318	CTG		0.682	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906		46	136	0	0	0	0.01441	0	46	136				
PCDHB3	56132	broad.mit.edu	37	5	140481005	140481005	+	Missense_Mutation	SNP	A	A	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr5:140481005A>G	ENST00000231130.2	+	1	772	c.772A>G	c.(772-774)Aac>Gac	p.N258D	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	258	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TACCCCCGTTAACTCTGTCAT	0.418																																							uc003lio.2		NA																	0				ovary(1)|pancreas(1)	2						c.(772-774)AAC>GAC		protocadherin beta 3 precursor							71.0	78.0	76.0					5																	140481005		2203	4300	6503	SO:0001583	missense	56132				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140481005A>G	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.772A>G	5.37:g.140481005A>G	ENSP00000231130:p.Asn258Asp					uc003lin.2_Intron	p.N258D	NM_018937	NP_061760	Q9Y5E6	PCDB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	772	+			258			Extracellular (Potential).|Cadherin 3.		B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	c.772A>G	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	a	1.801	-0.477113	0.04414	.	.	ENSG00000113205	ENST00000231130	T	0.60424	0.19	4.93	-4.59	0.03400	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.28962	0.0719	N	0.03304	-0.355	0.09310	N	1	B	0.10296	0.003	B	0.15484	0.013	T	0.19451	-1.0305	9	0.39692	T	0.17	.	8.8431	0.35153	0.291:0.0:0.5858:0.1232	.	258	Q9Y5E6	PCDB3_HUMAN	D	258	ENSP00000231130:N258D	ENSP00000231130:N258D	N	+	1	0	PCDHB3	140461189	0.001000	0.12720	0.000000	0.03702	0.154000	0.21943	1.283000	0.33237	-0.683000	0.05190	-0.989000	0.02550	AAC		0.418	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937		31	85	0	0	0	0.013726	0	31	85				
PCDHB11	56125	broad.mit.edu	37	5	140580847	140580847	+	Silent	SNP	C	C	T	rs561828114		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr5:140580847C>T	ENST00000354757.3	+	1	1500	c.1500C>T	c.(1498-1500)ctC>ctT	p.L500L	PCDHB11_ENST00000536699.1_Silent_p.L135L	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	500	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACCTGCCCCTCGCCTCCCTGG	0.647													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17395	0.0		0.0	False		,,,				2504	0.0						uc003liy.2		NA																	0				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						c.(1498-1500)CTC>CTT		protocadherin beta 11 precursor							114.0	121.0	119.0					5																	140580847		2203	4300	6503	SO:0001819	synonymous_variant	56125				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140580847C>T	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.1500C>T	5.37:g.140580847C>T						PCDHB11_uc011daj.1_Silent_p.L135L	p.L500L	NM_018931	NP_061754	Q9Y5F2	PCDBB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1500	+			500			Extracellular (Potential).|Cadherin 5.		B4DSF7|Q2M223	Silent	SNP	ENST00000354757.3	37	c.1500C>T	CCDS4253.1																																																																																				0.647	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931		76	215	0	0	0	0.01441	0	76	215				
PCDHGB6	56100	broad.mit.edu	37	5	140789016	140789016	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr5:140789016C>A	ENST00000520790.1	+	1	1247	c.1247C>A	c.(1246-1248)cCa>cAa	p.P416Q	PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	416	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGCAGACACCAGAATACAAT	0.463																																							uc003lkj.1		NA																	0					0						c.(1246-1248)CCA>CAA		protocadherin gamma subfamily B, 6 isoform 1							63.0	69.0	67.0					5																	140789016		2054	4198	6252	SO:0001583	missense	56100				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140789016C>A	AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.1247C>A	5.37:g.140789016C>A	ENSP00000428603:p.Pro416Gln					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lki.1_Missense_Mutation_p.P416Q	p.P416Q	NM_018926	NP_061749	Q9Y5F9	PCDGI_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1247	+			416			Extracellular (Potential).|Cadherin 4.		Q9Y5C5	Missense_Mutation	SNP	ENST00000520790.1	37	c.1247C>A	CCDS54929.1	.	.	.	.	.	.	.	.	.	.	c	7.645	0.681612	0.14907	.	.	ENSG00000253305	ENST00000520790	T	0.01725	4.67	5.36	1.44	0.22558	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.07279	0.0184	M	0.79475	2.455	0.09310	N	1	D;D	0.62365	0.98;0.991	D;P	0.63381	0.914;0.861	T	0.15607	-1.0431	9	0.56958	D	0.05	.	7.1942	0.25843	0.0:0.6632:0.1206:0.2162	.	416;416	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	Q	416	ENSP00000428603:P416Q	ENSP00000428603:P416Q	P	+	2	0	PCDHGB6	140769200	0.002000	0.14202	0.004000	0.12327	0.018000	0.09664	1.995000	0.40767	0.223000	0.20920	0.563000	0.77884	CCA		0.463	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374746.1	NM_018926		14	51	1	0	9.31168e-06	0.016723	9.83776e-06	14	51				
PPARGC1B	133522	broad.mit.edu	37	5	149221931	149221931	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr5:149221931G>C	ENST00000309241.5	+	10	2839	c.2807G>C	c.(2806-2808)aGa>aCa	p.R936T	PPARGC1B_ENST00000403750.1_Missense_Mutation_p.R872T|PPARGC1B_ENST00000394320.3_Missense_Mutation_p.R936T|PPARGC1B_ENST00000360453.4_Missense_Mutation_p.R897T	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	936	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			GTGCTGACAAGAAATAGGAGG	0.507																																							uc003lrc.2		NA																	0					0						c.(2806-2808)AGA>ACA		peroxisome proliferator-activated receptor							141.0	128.0	132.0					5																	149221931		2203	4300	6503	SO:0001583	missense	133522				estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity	g.chr5:149221931G>C	AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.2807G>C	5.37:g.149221931G>C	ENSP00000312649:p.Arg936Thr					PPARGC1B_uc003lrb.1_Missense_Mutation_p.R936T|PPARGC1B_uc003lrd.2_Missense_Mutation_p.R897T|PPARGC1B_uc003lrf.2_Missense_Mutation_p.R915T|PPARGC1B_uc003lre.1_Missense_Mutation_p.R915T	p.R936T	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		10	2849	+			936			RRM.		A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	ENST00000309241.5	37	c.2807G>C	CCDS4298.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.94|11.94	1.788126|1.788126	0.31593|0.31593	.|.	.|.	ENSG00000155846|ENSG00000155846	ENST00000434684|ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	.|T;T;T;T	.|0.41065	.|1.01;1.01;1.01;1.01	4.79|4.79	4.79|4.79	0.61399|0.61399	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.139008	.|0.49916	.|D	.|0.000140	T|T	0.62478|0.62478	0.2431|0.2431	M|M	0.76002|0.76002	2.32|2.32	0.38530|0.38530	D|D	0.94894|0.94894	.|P;D;P;P;P	.|0.89917	.|0.562;1.0;0.562;0.616;0.947	.|P;D;P;P;P	.|0.91635	.|0.537;0.999;0.537;0.667;0.699	T|T	0.68435|0.68435	-0.5409|-0.5409	5|10	.|0.66056	.|D	.|0.02	-13.2963|-13.2963	11.689|11.689	0.51503|0.51503	0.0821:0.0:0.9179:0.0|0.0821:0.0:0.9179:0.0	.|.	.|915;915;897;936;936	.|Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3	.|.;.;.;PRGC2_HUMAN;.	N|T	622|897;936;936;872	.|ENSP00000353638:R897T;ENSP00000377855:R936T;ENSP00000312649:R936T;ENSP00000384403:R872T	.|ENSP00000312649:R936T	K|R	+|+	3|2	2|0	PPARGC1B|PPARGC1B	149202124|149202124	1.000000|1.000000	0.71417|0.71417	0.816000|0.816000	0.32577|0.32577	0.019000|0.019000	0.09904|0.09904	3.923000|3.923000	0.56469|0.56469	2.354000|2.354000	0.79902|0.79902	0.462000|0.462000	0.41574|0.41574	AAG|AGA		0.507	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252334.1	NM_133263		13	52	0	0	0	0.016723	0	13	52				
ATXN1	6310	broad.mit.edu	37	6	16327909	16327909	+	Missense_Mutation	SNP	A	A	C	rs59310777	byFrequency	TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr6:16327909A>C	ENST00000244769.4	-	8	1569	c.633T>G	c.(631-633)caT>caG	p.H211Q	ATXN1_ENST00000436367.1_Missense_Mutation_p.H211Q	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	211	Poly-Gln.			H -> HQ (in Ref. 1; CAA55793). {ECO:0000305}.	adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.H209_H211delHQH(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgctgctgatgctgatgct	0.672													A|||	1334	0.266374	0.2897	0.2161	5008	,	,		12493	0.3879		0.0964	False		,,,				2504	0.32						uc003nbt.2		NA																	1	Deletion - In frame(1)		prostate(1)	skin(3)|central_nervous_system(1)	4						c.(631-633)CAT>CAG		ataxin 1							4.0	7.0	6.0					6																	16327909		1575	3495	5070	SO:0001583	missense	6310				cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association	g.chr6:16327909A>C	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.633T>G	6.37:g.16327909A>C	ENSP00000244769:p.His211Gln					ATXN1_uc010jpi.2_Missense_Mutation_p.H211Q|ATXN1_uc010jpj.1_Intron	p.H211Q	NM_000332	NP_000323	P54253	ATX1_HUMAN			8	1604	-	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)	211	H -> HQ (in Ref. 1; CAA55793).		Poly-Gln.		Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	c.633T>G	CCDS34342.1	369	0.16895604395604397	105	0.21341463414634146	59	0.16298342541436464	150	0.26223776223776224	55	0.07255936675461741	A	5.976	0.364085	0.11296	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.50813	0.73;0.73	.	.	.	.	.	.	.	.	T	0.08358	0.0208	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.31223	-0.9951	4	0.15952	T	0.53	.	.	.	.	rs59310777	211	P54253	ATX1_HUMAN	Q	211	ENSP00000244769:H211Q;ENSP00000416360:H211Q	ENSP00000244769:H211Q	H	-	3	2	ATXN1	16435888	0.694000	0.27738	0.023000	0.16930	0.066000	0.16364	1.537000	0.36083	0.000000	0.14550	0.000000	0.15137	CAT		0.672	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332		3	20	0	0	0	0.004672	0	3	20				
BAG6	7917	broad.mit.edu	37	6	31609167	31609167	+	Silent	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr6:31609167G>A	ENST00000375964.6	-	18	2815	c.2502C>T	c.(2500-2502)atC>atT	p.I834I	BAG6_ENST00000404765.2_Silent_p.I864I|BAG6_ENST00000375976.4_Silent_p.I828I|BAG6_ENST00000439687.2_Silent_p.I702I|BAG6_ENST00000362049.6_Silent_p.I828I|BAG6_ENST00000470875.1_5'Flank|BAG6_ENST00000211379.5_Silent_p.I828I	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	834					brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						TTGTCCGGATGATGTCCACAC	0.522																																							uc003nvg.3		NA																	0					0						c.(2500-2502)ATC>ATT		HLA-B associated transcript-3 isoform a							88.0	91.0	90.0					6																	31609167		2203	4300	6503	SO:0001819	synonymous_variant	7917				apoptosis in response to endoplasmic reticulum stress|brain development|cell differentiation|chromatin modification|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|embryo development|internal peptidyl-lysine acetylation|kidney development|lung development|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|protein stabilization|spermatogenesis|synaptonemal complex assembly|tail-anchored membrane protein insertion into ER membrane|transport|ubiquitin-dependent protein catabolic process	BAT3 complex|nucleus	polyubiquitin binding|proteasome binding|ribosome binding	g.chr6:31609167G>A	M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.2502C>T	6.37:g.31609167G>A						BAT3_uc003nvf.3_Silent_p.I828I|BAT3_uc003nvh.3_Silent_p.I828I|BAT3_uc003nvi.3_Silent_p.I828I|BAT3_uc011dnw.1_Silent_p.I828I|BAT3_uc011dnx.1_Silent_p.I702I	p.I834I	NM_004639	NP_004630	P46379	BAG6_HUMAN			18	2816	-			834					A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Silent	SNP	ENST00000375964.6	37	c.2502C>T	CCDS47403.1																																																																																				0.522	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_080703		43	168	0	0	0	0.013114	0	43	168				
MSH5	4439	broad.mit.edu	37	6	31711739	31711739	+	Silent	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr6:31711739C>T	ENST00000375755.3	+	6	760	c.474C>T	c.(472-474)gcC>gcT	p.A158A	MSH5_ENST00000375742.3_Silent_p.A158A|MSH5_ENST00000375750.3_Silent_p.A158A|MSH5-SAPCD1_ENST00000493662.2_Silent_p.A158A|MSH5_ENST00000375740.3_Silent_p.A158A|MSH5_ENST00000482280.1_3'UTR|MSH5_ENST00000375703.3_Silent_p.A158A|MSH5_ENST00000431848.2_5'Flank|MSH5_ENST00000534153.4_Silent_p.A158A	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5	158					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|ovary(2)|skin(2)	5						TCCCAGACGCCATGACTGCCA	0.517								Direct reversal of damage;Mismatch excision repair (MMR)																															uc003nwv.1		NA																	0				ovary(2)|breast(1)	3						c.(472-474)GCC>GCT	Direct_reversal_of_damage|MMR	mutS homolog 5 isoform c							277.0	303.0	294.0					6																	31711739		1511	2709	4220	SO:0001819	synonymous_variant	4439				chiasma assembly|homologous chromosome segregation|meiotic prophase II|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding	g.chr6:31711739C>T	AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.474C>T	6.37:g.31711739C>T						MSH5_uc003nwt.1_Silent_p.A158A|MSH5_uc003nwu.1_Silent_p.A158A|MSH5_uc003nww.1_Silent_p.A158A|MSH5_uc003nwx.1_Silent_p.A158A|MSH5_uc011dof.1_5'Flank	p.A158A	NM_172166	NP_751898	O43196	MSH5_HUMAN			6	553	+			158					B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Silent	SNP	ENST00000375755.3	37	c.474C>T	CCDS4720.1																																																																																				0.517	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076243.4			45	624	0	0	0	0.013114	0	45	624				
HSPA1L	3305	broad.mit.edu	37	6	31779455	31779455	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr6:31779455C>T	ENST00000375654.4	-	2	484	c.295G>A	c.(295-297)Gaa>Aaa	p.E99K	HSPA1L_ENST00000417199.3_Missense_Mutation_p.E99K	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	99					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						TTGCCTCCTTCATTAATCACT	0.413																																							uc003nxh.2		NA																	0				ovary(3)|pleura(1)|kidney(1)|skin(1)	6						c.(295-297)GAA>AAA		heat shock 70kDa protein 1-like							112.0	113.0	113.0					6																	31779455		2203	4300	6503	SO:0001583	missense	3305				response to unfolded protein		ATP binding	g.chr6:31779455C>T	D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.295G>A	6.37:g.31779455C>T	ENSP00000364805:p.Glu99Lys					HSPA1L_uc010jte.2_Missense_Mutation_p.E99K	p.E99K	NM_005527	NP_005518	P34931	HS71L_HUMAN			2	478	-			99					A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	ENST00000375654.4	37	c.295G>A	CCDS34413.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.50|15.50	2.852249|2.852249	0.51270|0.51270	.|.	.|.	ENSG00000204390|ENSG00000204390	ENST00000375653|ENST00000375654;ENST00000417199	.|T;T	.|0.00958	.|5.5;5.5	4.36|4.36	4.36|4.36	0.52297|0.52297	.|.	.|.	.|.	.|.	.|.	.|T	.|0.00300	.|0.0009	N|N	0.01771|0.01771	-0.73|-0.73	0.51012|0.51012	D|D	0.999905|0.999905	.|B	.|0.22909	.|0.077	.|B	.|0.23574	.|0.047	.|T	.|0.63699	.|-0.6578	.|9	.|0.87932	.|D	.|0	.|.	14.4415|14.4415	0.67321|0.67321	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|99	.|P34931	.|HS71L_HUMAN	.|K	-1|99	.|ENSP00000364805:E99K;ENSP00000387691:E99K	.|ENSP00000364805:E99K	.|E	-|-	.|1	.|0	HSPA1L|HSPA1L	31887434|31887434	1.000000|1.000000	0.71417|0.71417	0.977000|0.977000	0.42913|0.42913	0.907000|0.907000	0.53573|0.53573	7.647000|7.647000	0.83462|0.83462	2.239000|2.239000	0.73571|0.73571	0.460000|0.460000	0.39030|0.39030	.|GAA		0.413	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2			25	179	0	0	0	0.004656	0	25	179				
GLP1R	2740	broad.mit.edu	37	6	39025255	39025255	+	Silent	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr6:39025255C>T	ENST00000373256.4	+	3	226	c.183C>T	c.(181-183)ttC>ttT	p.F61F		NM_002062.3	NP_002053.3	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor	61					activation of adenylate cyclase activity (GO:0007190)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|learning or memory (GO:0007611)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|transmembrane signaling receptor activity (GO:0004888)			breast(5)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	31					Exenatide(DB01276)|Glucagon recombinant(DB00040)|Liraglutide(DB06655)	CAGACTTGTTCTGCAACCGGA	0.617																																							uc003ooj.3		NA																	0				lung(3)|breast(1)|pancreas(1)	5						c.(181-183)TTC>TTT		glucagon-like peptide 1 receptor precursor	Exenatide(DB01276)|Glucagon recombinant(DB00040)						153.0	122.0	133.0					6																	39025255		2203	4300	6503	SO:0001819	synonymous_variant	2740				activation of adenylate cyclase activity|cAMP-mediated signaling|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	glucagon receptor activity|peptide receptor activity, G-protein coupled	g.chr6:39025255C>T		CCDS4839.1	6p21	2012-08-10			ENSG00000112164	ENSG00000112164		"""GPCR / Class B : Glucagon receptors"""	4324	protein-coding gene	gene with protein product		138032					Standard	NM_002062		Approved		uc003ooj.4	P43220	OTTHUMG00000014638	ENST00000373256.4:c.183C>T	6.37:g.39025255C>T						GLP1R_uc003ooh.2_RNA|GLP1R_uc003ooi.2_RNA	p.F61F	NM_002062	NP_002053	P43220	GLP1R_HUMAN			3	243	+			61			Extracellular (Potential).		Q2M229|Q99669	Silent	SNP	ENST00000373256.4	37	c.183C>T	CCDS4839.1																																																																																				0.617	GLP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040443.1			7	39	0	0	0	0.004482	0	7	39				
ZNF318	24149	broad.mit.edu	37	6	43323114	43323114	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr6:43323114G>A	ENST00000361428.2	-	4	2035	c.1958C>T	c.(1957-1959)tCa>tTa	p.S653L	ZNF318_ENST00000318149.3_Missense_Mutation_p.S653L	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	653					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			GCGGTCAGCTGAGAAGCGGTG	0.537																																							uc003oux.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7						c.(1957-1959)TCA>TTA		zinc finger protein 318							145.0	119.0	128.0					6																	43323114		2203	4300	6503	SO:0001583	missense	24149				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding	g.chr6:43323114G>A	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.1958C>T	6.37:g.43323114G>A	ENSP00000354964:p.Ser653Leu					ZNF318_uc003ouw.2_RNA	p.S653L	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)		4	2036	-			653					O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	37	c.1958C>T	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	G	12.33	1.904184	0.33628	.	.	ENSG00000171467	ENST00000318149;ENST00000361428	T;T	0.38887	1.11;2.18	2.17	2.17	0.27698	.	.	.	.	.	T	0.12817	0.0311	N	0.14661	0.345	0.19575	N	0.999969	P	0.38800	0.648	B	0.41174	0.349	T	0.07158	-1.0787	9	0.39692	T	0.17	.	7.8914	0.29680	0.0:0.0:1.0:0.0	.	653	Q5VUA4	ZN318_HUMAN	L	653	ENSP00000323032:S653L;ENSP00000354964:S653L	ENSP00000323032:S653L	S	-	2	0	ZNF318	43431092	0.021000	0.18746	0.280000	0.24747	0.855000	0.48748	0.240000	0.18042	1.529000	0.49120	0.655000	0.94253	TCA		0.537	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345		27	88	0	0	0	0.007291	0	27	88				
GPRC6A	222545	broad.mit.edu	37	6	117121752	117121752	+	Missense_Mutation	SNP	G	G	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr6:117121752G>T	ENST00000310357.3	-	4	1564	c.1543C>A	c.(1543-1545)Ctt>Att	p.L515I	GPRC6A_ENST00000368549.3_Intron|GPRC6A_ENST00000530250.1_Missense_Mutation_p.L340I	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	515					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		GTTACCTTAAGATTCCTGAAC	0.428																																							uc003pxj.1		NA																	0				ovary(4)|skin(2)	6						c.(1543-1545)CTT>ATT		G protein-coupled receptor, family C, group 6,							163.0	140.0	148.0					6																	117121752		2203	4300	6503	SO:0001583	missense	222545				response to amino acid stimulus		G-protein coupled receptor activity	g.chr6:117121752G>T	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.1543C>A	6.37:g.117121752G>T	ENSP00000309493:p.Leu515Ile					GPRC6A_uc003pxk.1_Missense_Mutation_p.L340I|GPRC6A_uc003pxl.1_Intron	p.L515I	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)	4	1565	-		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)	515			Extracellular (Potential).		Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	37	c.1543C>A	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	G	4.682	0.126738	0.08931	.	.	ENSG00000173612	ENST00000310357;ENST00000530250	D;D	0.90788	-2.49;-2.73	5.35	4.49	0.54785	.	0.000000	0.44483	D	0.000448	T	0.65502	0.2697	N	0.08118	0	0.32382	N	0.554442	B;B	0.31680	0.335;0.168	B;B	0.31751	0.135;0.021	T	0.61831	-0.6982	10	0.37606	T	0.19	.	5.8547	0.18712	0.3116:0.0:0.6884:0.0	.	340;515	Q5T6X5-2;Q5T6X5	.;GPC6A_HUMAN	I	515;340	ENSP00000309493:L515I;ENSP00000433465:L340I	ENSP00000309493:L515I	L	-	1	0	GPRC6A	117228445	1.000000	0.71417	1.000000	0.80357	0.251000	0.25915	2.238000	0.43070	1.498000	0.48600	0.585000	0.79938	CTT		0.428	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2			25	43	1	0	9.57634e-11	0.01892	1.05963e-10	25	43				
GPRC6A	222545	broad.mit.edu	37	6	117121789	117121789	+	Silent	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr6:117121789G>A	ENST00000310357.3	-	4	1527	c.1506C>T	c.(1504-1506)atC>atT	p.I502I	GPRC6A_ENST00000368549.3_Intron|GPRC6A_ENST00000530250.1_Silent_p.I327I	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	502					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		GATCTGGGATGATGAAGACAT	0.393																																							uc003pxj.1		NA																	0				ovary(4)|skin(2)	6						c.(1504-1506)ATC>ATT		G protein-coupled receptor, family C, group 6,							207.0	180.0	189.0					6																	117121789		2203	4300	6503	SO:0001819	synonymous_variant	222545				response to amino acid stimulus		G-protein coupled receptor activity	g.chr6:117121789G>A	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.1506C>T	6.37:g.117121789G>A						GPRC6A_uc003pxk.1_Silent_p.I327I|GPRC6A_uc003pxl.1_Intron	p.I502I	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)	4	1528	-		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)	502			Extracellular (Potential).		Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Silent	SNP	ENST00000310357.3	37	c.1506C>T	CCDS5112.1																																																																																				0.393	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2			33	51	0	0	0	0.019004	0	33	51				
GPRC6A	222545	broad.mit.edu	37	6	117127639	117127639	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr6:117127639C>A	ENST00000310357.3	-	3	1250	c.1229G>T	c.(1228-1230)gGa>gTa	p.G410V	GPRC6A_ENST00000368549.3_Missense_Mutation_p.G410V|GPRC6A_ENST00000530250.1_Intron	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	410					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		ATGAATGAGTCCTGGCTCAGC	0.463																																							uc003pxj.1		NA																	0				ovary(4)|skin(2)	6						c.(1228-1230)GGA>GTA		G protein-coupled receptor, family C, group 6,							124.0	108.0	114.0					6																	117127639		2203	4299	6502	SO:0001583	missense	222545				response to amino acid stimulus		G-protein coupled receptor activity	g.chr6:117127639C>A	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.1229G>T	6.37:g.117127639C>A	ENSP00000309493:p.Gly410Val					GPRC6A_uc003pxk.1_Intron|GPRC6A_uc003pxl.1_Missense_Mutation_p.G410V	p.G410V	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)	3	1251	-		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)	410			Extracellular (Potential).		Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	37	c.1229G>T	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	C	16.34	3.095181	0.56075	.	.	ENSG00000173612	ENST00000310357;ENST00000368549	D;D	0.85955	-1.68;-2.05	5.48	4.62	0.57501	Extracellular ligand-binding receptor (1);	0.000000	0.51477	D	0.000087	D	0.88444	0.6438	M	0.63428	1.95	0.80722	D	1	D;D	0.89917	0.968;1.0	P;D	0.77004	0.586;0.989	D	0.89399	0.3694	10	0.54805	T	0.06	.	14.1978	0.65682	0.0:0.9291:0.0:0.0709	.	410;410	Q5T6X5-3;Q5T6X5	.;GPC6A_HUMAN	V	410	ENSP00000309493:G410V;ENSP00000357537:G410V	ENSP00000309493:G410V	G	-	2	0	GPRC6A	117234332	0.994000	0.37717	0.990000	0.47175	0.864000	0.49448	2.751000	0.47508	1.562000	0.49601	0.650000	0.86243	GGA		0.463	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2			14	28	1	0	3.27435e-08	0.020292	3.55991e-08	14	28				
IFNGR1	3459	broad.mit.edu	37	6	137524823	137524823	+	Splice_Site	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr6:137524823C>G	ENST00000367739.4	-	5	668		c.e5-1		IFNGR1_ENST00000478333.1_5'Flank|IFNGR1_ENST00000367735.2_Nonstop_Mutation_p.*187Y|IFNGR1_ENST00000543628.1_Splice_Site	NM_000416.2	NP_000407.1	P15260	INGR1_HUMAN	interferon gamma receptor 1						cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)|signal transduction (GO:0007165)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|vesicle (GO:0031982)	interferon-gamma receptor activity (GO:0004906)			central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	18	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	TATACTGGATCTAGATGAAAA	0.343																																							uc003qho.2		NA																	0				upper_aerodigestive_tract(1)	1						c.e5-1		interferon gamma receptor 1 precursor	Interferon gamma-1b(DB00033)						61.0	57.0	58.0					6																	137524823		2203	4299	6502	SO:0001630	splice_region_variant	3459				regulation of interferon-gamma-mediated signaling pathway|response to virus	integral to plasma membrane	interferon-gamma receptor activity	g.chr6:137524823C>G		CCDS5185.1	6q23-q24	2014-09-17			ENSG00000027697	ENSG00000027697		"""Interferons"", ""CD molecules"""	5439	protein-coding gene	gene with protein product		107470		IFNGR			Standard	NM_000416		Approved	CD119	uc003qho.2	P15260	OTTHUMG00000015656	ENST00000367739.4:c.547-1G>C	6.37:g.137524823C>G						IFNGR1_uc011edm.1_Splice_Site_p.I155_splice|IFNGR1_uc011edn.1_Nonstop_Mutation_p.*187Y	p.I183_splice	NM_000416	NP_000407	P15260	INGR1_HUMAN		GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	5	650	-	Colorectal(23;0.24)							B4DFT7|E1P587|Q53Y96	Splice_Site	SNP	ENST00000367739.4	37	c.547_splice	CCDS5185.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.556|8.556	0.876702|0.876702	0.17395|0.17395	.|.	.|.	ENSG00000027697|ENSG00000027697	ENST00000367739;ENST00000418947;ENST00000543628;ENST00000458076|ENST00000367735	.|.	.|.	.|.	5.0|5.0	3.92|3.92	0.45320|0.45320	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	9.2141|9.2141	0.37337|0.37337	0.0:0.8837:0.0:0.1163|0.0:0.8837:0.0:0.1163	.|.	.|.	.|.	.|.	.|Y	-1|187	.|.	.|.	.|X	-|-	.|3	.|2	IFNGR1|IFNGR1	137566516|137566516	0.707000|0.707000	0.27866|0.27866	0.053000|0.053000	0.19242|0.19242	0.034000|0.034000	0.12701|0.12701	2.412000|2.412000	0.44609|0.44609	2.342000|2.342000	0.79632|0.79632	0.561000|0.561000	0.74099|0.74099	.|TAG		0.343	IFNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042401.1		Intron	9	22	0	0	0	0.004482	0	9	22				
HIVEP2	3097	broad.mit.edu	37	6	143081564	143081564	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr6:143081564G>C	ENST00000367604.1	-	8	6500	c.5861C>G	c.(5860-5862)cCc>cGc	p.P1954R	HIVEP2_ENST00000367603.2_Missense_Mutation_p.P1954R|HIVEP2_ENST00000012134.2_Missense_Mutation_p.P1954R			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1954					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		AACCCCGTGGGGTACGGCGCC	0.478																																					Esophageal Squamous(107;843 1510 13293 16805 42198)	Esophageal Squamous(107;843 1510 13293 16805 42198)	uc003qjd.2		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(5860-5862)CCC>CGC		human immunodeficiency virus type I enhancer							100.0	98.0	99.0					6																	143081564		1943	4132	6075	SO:0001583	missense	3097				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:143081564G>C	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.5861C>G	6.37:g.143081564G>C	ENSP00000356576:p.Pro1954Arg						p.P1954R	NM_006734	NP_006725	P31629	ZEP2_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)	9	6604	-			1954					Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	37	c.5861C>G	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.591253	0.46214	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02525	4.26;4.26;4.26	6.05	6.05	0.98169	.	0.204928	0.53938	D	0.000057	T	0.01189	0.0039	N	0.19112	0.55	0.32468	N	0.543136	B	0.34103	0.437	B	0.28553	0.091	T	0.59053	-0.7526	10	0.25751	T	0.34	-9.59	20.6087	0.99469	0.0:0.0:1.0:0.0	.	1954	P31629	ZEP2_HUMAN	R	1954	ENSP00000356576:P1954R;ENSP00000356575:P1954R;ENSP00000012134:P1954R	ENSP00000012134:P1954R	P	-	2	0	HIVEP2	143123257	1.000000	0.71417	0.991000	0.47740	0.974000	0.67602	3.885000	0.56182	2.866000	0.98385	0.650000	0.86243	CCC		0.478	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1			15	40	0	0	0	0.00499	0	15	40				
SNX9	51429	broad.mit.edu	37	6	158330983	158330983	+	Nonsense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr6:158330983G>A	ENST00000392185.3	+	9	1046	c.875G>A	c.(874-876)tGg>tAg	p.W292*		NM_016224.3	NP_057308.1	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	292	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|lipid tube assembly (GO:0060988)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein oligomerization (GO:0032461)|receptor-mediated endocytosis (GO:0006898)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	1-phosphatidylinositol binding (GO:0005545)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		CACTTTGACTGGTTATATGAG	0.408																																							uc003qqv.1		NA																	0					0						c.(874-876)TGG>TAG		sorting nexin 9							215.0	224.0	221.0					6																	158330983		2203	4300	6503	SO:0001587	stop_gained	51429				cell communication|intracellular protein transport|lipid tube assembly|positive regulation of GTPase activity|positive regulation of protein oligomerization|receptor-mediated endocytosis	clathrin-coated vesicle|cytoplasmic vesicle membrane|extrinsic to internal side of plasma membrane|ruffle|trans-Golgi network	1-phosphatidylinositol binding|protein homodimerization activity|ubiquitin protein ligase binding	g.chr6:158330983G>A	AF121859	CCDS5253.1	6q25.1-q26	2008-05-22			ENSG00000130340	ENSG00000130340		"""Sorting nexins"""	14973	protein-coding gene	gene with protein product		605952				10531379, 17609109	Standard	NM_016224		Approved	SH3PX1, SDP1, SH3PXD3A	uc003qqv.1	Q9Y5X1	OTTHUMG00000015903	ENST00000392185.3:c.875G>A	6.37:g.158330983G>A	ENSP00000376024:p.Trp292*						p.W292*	NM_016224	NP_057308	Q9Y5X1	SNX9_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)	9	1048	+		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)	292			PX.		Q9BSI7|Q9BVM1|Q9UJH6|Q9UP20	Nonsense_Mutation	SNP	ENST00000392185.3	37	c.875G>A	CCDS5253.1	.	.	.	.	.	.	.	.	.	.	G	44	11.256431	0.99537	.	.	ENSG00000130340	ENST00000539592;ENST00000392185;ENST00000252631	.	.	.	5.56	5.56	0.83823	.	0.054978	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.9892	19.8818	0.96901	0.0:0.0:1.0:0.0	.	.	.	.	X	292;292;92	.	ENSP00000252631:W92X	W	+	2	0	SNX9	158250971	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	9.302000	0.96175	2.773000	0.95371	0.655000	0.94253	TGG		0.408	SNX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042856.1			22	42	0	0	0	0.012319	0	22	42				
LPA	4018	broad.mit.edu	37	6	161032594	161032594	+	Splice_Site	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr6:161032594G>A	ENST00000316300.5	-	16	2647	c.2603C>T	c.(2602-2604)gCt>gTt	p.A868V	LPA_ENST00000447678.1_Splice_Site_p.A868V			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3376	Kringle 8. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	AAAGACATACGCATTTGGGTA	0.468																																							uc003qtl.2		NA																	0				ovary(3)|skin(2)|pancreas(1)	6						c.(2602-2604)GCT>GTT		lipoprotein Lp(a) precursor	Aminocaproic Acid(DB00513)						258.0	299.0	285.0					6																	161032594		1389	2668	4057	SO:0001630	splice_region_variant	4018				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity	g.chr6:161032594G>A	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.2603+1C>T	6.37:g.161032594G>A							p.A868V	NM_005577	NP_005568	P08519	APOA_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	17	2723	-		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)	3376			Kringle 30.		Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	37	c.2603C>T	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	g	12.59	1.983714	0.35036	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.66995	-0.24;-0.24	2.17	2.17	0.27698	Kringle (4);Kringle-like fold (1);	.	.	.	.	T	0.68970	0.3059	M	0.74881	2.28	0.23180	N	0.998167	D	0.69078	0.997	D	0.72625	0.978	T	0.55140	-0.8187	8	.	.	.	.	7.8282	0.29328	0.0:0.0:1.0:0.0	.	3376	P08519	APOA_HUMAN	V	868	ENSP00000321334:A868V;ENSP00000395608:A868V	.	A	-	2	0	LPA	160952584	1.000000	0.71417	0.957000	0.39632	0.409000	0.31022	2.290000	0.43531	1.217000	0.43442	0.194000	0.17425	GCT		0.468	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	Missense_Mutation	115	265	0	0	0	0.01441	0	115	265				
SNX8	29886	broad.mit.edu	37	7	2296529	2296529	+	Nonsense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr7:2296529G>A	ENST00000222990.3	-	10	1306	c.1264C>T	c.(1264-1266)Cag>Tag	p.Q422*		NM_013321.2	NP_037453.1	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	422					early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)	early endosome membrane (GO:0031901)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(2)|skin(3)	26		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		CCTTGGATCTGAGAGTTGACG	0.647																																							uc003slw.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(1264-1266)CAG>TAG		sorting nexin 8							142.0	101.0	115.0					7																	2296529		2203	4300	6503	SO:0001587	stop_gained	29886				cell communication|early endosome to Golgi transport|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding	g.chr7:2296529G>A	AF121858	CCDS5331.1	7p22.3	2010-08-05			ENSG00000106266	ENSG00000106266		"""Sorting nexins"""	14972	protein-coding gene	gene with protein product		614905					Standard	NM_013321		Approved	Mvp1	uc003slw.3	Q9Y5X2	OTTHUMG00000151512	ENST00000222990.3:c.1264C>T	7.37:g.2296529G>A	ENSP00000222990:p.Gln422*						p.Q422*	NM_013321	NP_037453	Q9Y5X2	SNX8_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)	10	1307	-		Ovarian(82;0.11)	422					A4D207|Q96I67	Nonsense_Mutation	SNP	ENST00000222990.3	37	c.1264C>T	CCDS5331.1	.	.	.	.	.	.	.	.	.	.	G	38	7.236890	0.98154	.	.	ENSG00000106266	ENST00000222990	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	19.3776	0.94518	0.0:0.0:1.0:0.0	.	.	.	.	X	422	.	ENSP00000222990:Q422X	Q	-	1	0	SNX8	2263055	1.000000	0.71417	0.958000	0.39756	0.919000	0.55068	9.280000	0.95786	2.594000	0.87642	0.561000	0.74099	CAG		0.647	SNX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322949.2			6	29	0	0	0	0.00308	0	6	29				
USP42	84132	broad.mit.edu	37	7	6189606	6189606	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr7:6189606G>A	ENST00000306177.5	+	13	1937	c.1779G>A	c.(1777-1779)atG>atA	p.M593I		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	593					cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		AGCCCGTGATGAATGGCAAAT	0.537																																							uc011jwo.1		NA																	0				skin(2)|ovary(1)|pancreas(1)|breast(1)	5						c.(1777-1779)ATG>ATA		ubiquitin specific peptidase 42							46.0	50.0	49.0					7																	6189606		1975	4162	6137	SO:0001583	missense	84132				cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity	g.chr7:6189606G>A	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.1779G>A	7.37:g.6189606G>A	ENSP00000301962:p.Met593Ile					USP42_uc010kth.1_Missense_Mutation_p.M526I|USP42_uc011jwp.1_Missense_Mutation_p.M593I|USP42_uc011jwq.1_Missense_Mutation_p.M400I|USP42_uc011jwr.1_Missense_Mutation_p.M438I	p.M593I	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)	13	1902	+		Ovarian(82;0.0423)	593					A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	c.1779G>A	CCDS47535.1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.919482	0.52653	.	.	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.13901	2.55;2.97	5.93	5.03	0.67393	.	0.379780	0.28612	N	0.014722	T	0.16214	0.0390	L	0.57536	1.79	0.32973	D	0.522636	B;B;B;B	0.28933	0.146;0.228;0.146;0.008	B;B;B;B	0.24155	0.034;0.051;0.023;0.004	T	0.09185	-1.0686	10	0.22706	T	0.39	.	17.0529	0.86524	0.0:0.127:0.873:0.0	.	556;593;593;593	A4D2N7;Q9H9J4-2;Q9H9J4;A4D2N6	.;.;UBP42_HUMAN;.	I	593;439	ENSP00000301962:M593I;ENSP00000408217:M439I	ENSP00000301962:M593I	M	+	3	0	USP42	6156132	1.000000	0.71417	0.968000	0.41197	0.577000	0.36160	5.240000	0.65378	1.480000	0.48289	0.591000	0.81541	ATG		0.537	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526		6	28	0	0	0	0.001168	0	6	28				
TYW1B	441250	broad.mit.edu	37	7	72159743	72159743	+	RNA	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr7:72159743G>A	ENST00000435769.2	-	0	1563				TYW1B_ENST00000438125.1_RNA|TYW1B_ENST00000343721.5_RNA			Q6NUM6	TYW1B_HUMAN	tRNA-yW synthesizing protein 1 homolog B (S. cerevisiae)						tRNA processing (GO:0008033)		4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)										GTGGGCGGTCGATTTTCTTCA	0.388																																							uc011kej.1		NA																	0					0						c.(1438-1440)ATC>ATT		tRNA-yW synthesizing protein 1 homolog B isoform							71.0	69.0	70.0					7																	72159743		692	1591	2283			441250				tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity	g.chr7:72159743G>A	BC068520	CCDS69309.1	7q11.23	2011-08-11	2009-07-28		ENSG00000254184	ENSG00000277149			33908	protein-coding gene	gene with protein product	"""radical S-adenosyl methionine and flavodoxin domains 1"", ""non-protein coding RNA 69"", ""long intergenic non-protein coding RNA 69"""		"""tRNA-yW synthesizing protein 1 homolog B (non-protein coding)"""				Standard	NM_001145440		Approved	RSAFD2, MGC87315, NCRNA00069, LINC00069	uc011kej.2	Q6NUM6	OTTHUMG00000157067		7.37:g.72159743G>A						TYW1B_uc011keh.1_Silent_p.I318I|TYW1B_uc011kei.1_Silent_p.I106I	p.I480I	NM_001145440	NP_001138912	Q6NUM6	TYW1B_HUMAN			14	1599	-			480					A6NG09|B4DFY2|Q3KQX2	Silent	SNP	ENST00000435769.2	37	c.1440C>T																																																																																					0.388	TYW1B-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347346.2	NM_001145440		14	35	0	0	0	0.003163	0	14	35				
MUC17	140453	broad.mit.edu	37	7	100687057	100687057	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr7:100687057G>C	ENST00000306151.4	+	3	12424	c.12360G>C	c.(12358-12360)aaG>aaC	p.K4120N		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4120					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CTACAATTAAGAGCAACCCCA	0.463																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(12358-12360)AAG>AAC		mucin 17 precursor							129.0	136.0	133.0					7																	100687057		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100687057G>C	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.12360G>C	7.37:g.100687057G>C	ENSP00000302716:p.Lys4120Asn					MUC17_uc010lho.1_RNA	p.K4120N	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	12413	+	Lung NSC(181;0.136)|all_lung(186;0.182)		4120			Extracellular (Potential).		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.12360G>C	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.786717	0.00628	.	.	ENSG00000169876	ENST00000306151	T	0.01918	4.56	0.461	-0.923	0.10465	.	.	.	.	.	T	0.01092	0.0036	N	0.08118	0	0.09310	N	1	B	0.19200	0.034	B	0.17433	0.018	T	0.47898	-0.9081	8	0.17832	T	0.49	.	.	.	.	.	4120	Q685J3	MUC17_HUMAN	N	4120	ENSP00000302716:K4120N	ENSP00000302716:K4120N	K	+	3	2	MUC17	100473777	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.211000	0.01226	-1.349000	0.02202	-1.389000	0.01157	AAG		0.463	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		4	106	0	0	0	0.009096	0	4	106				
FLNC	2318	broad.mit.edu	37	7	128488927	128488927	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr7:128488927G>C	ENST00000325888.8	+	28	5079	c.4818G>C	c.(4816-4818)atG>atC	p.M1606I	FLNC_ENST00000346177.6_Missense_Mutation_p.M1606I|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1606					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						TGCCGGACATGAGTGGCCGGT	0.602																																							uc003vnz.3		NA																	0				breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						c.(4816-4818)ATG>ATC		gamma filamin isoform a							108.0	129.0	122.0					7																	128488927		2141	4235	6376	SO:0001583	missense	2318				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding	g.chr7:128488927G>C	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.4818G>C	7.37:g.128488927G>C	ENSP00000327145:p.Met1606Ile					FLNC_uc003voa.3_Missense_Mutation_p.M1606I	p.M1606I	NM_001458	NP_001449	Q14315	FLNC_HUMAN			28	5027	+			1606			Filamin 14.		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	c.4818G>C	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	g	11.81	1.749894	0.30955	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.84589	-1.87;-1.87	5.09	4.21	0.49690	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.195780	0.49305	N	0.000151	T	0.71668	0.3367	N	0.11845	0.185	0.29318	N	0.867523	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.64694	-0.6347	10	0.39692	T	0.17	.	10.9885	0.47537	0.1643:0.0:0.8357:0.0	.	1606;1606	Q14315-2;Q14315	.;FLNC_HUMAN	I	1606	ENSP00000327145:M1606I;ENSP00000344002:M1606I	ENSP00000327145:M1606I	M	+	3	0	FLNC	128276163	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	1.735000	0.38176	1.280000	0.44463	-0.119000	0.15052	ATG		0.602	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3			28	70	0	0	0	0.005443	0	28	70				
BRAF	673	broad.mit.edu	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	A	T	rs121913377|rs113488022|rs121913227|rs397516897		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr7:140453136A>T	ENST00000288602.6	-	15	1859	c.1799T>A	c.(1798-1800)gTg>gAg	p.V600E		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions). {ECO:0000269|PubMed:12068308}.|V -> E (in CRC; also found in sarcoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis; loss of regulation by PMRT5). {ECO:0000269|PubMed:12068308, ECO:0000269|PubMed:12198537, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:23263490, ECO:0000269|PubMed:24455489}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V600E(15453)|p.V600K(252)|p.V600R(44)|p.V600D(16)|p.V600A(12)|p.V600_K601>E(12)|p.V600G(11)|p.T599_R603>I(2)|p.V600Q(2)|p.V600_S605>EK(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insDFGLAT(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TCGAGATTTCACTGTAGCTAG	0.368	V600D(K029AX_SKIN)|V600D(WM115_SKIN)|V600D(WM2664_SKIN)|V600E(8505C_THYROID)|V600E(A101D_SKIN)|V600E(A2058_SKIN)|V600E(A375_SKIN)|V600E(A673_BONE)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(BCPAP_THYROID)|V600E(BHT101_THYROID)|V600E(BT474_BREAST)|V600E(C32_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(COLO205_LARGE_INTESTINE)|V600E(COLO679_SKIN)|V600E(COLO741_SKIN)|V600E(COLO783_SKIN)|V600E(COLO800_SKIN)|V600E(COLO818_SKIN)|V600E(COLO829_SKIN)|V600E(COLO849_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(DU4475_BREAST)|V600E(ES2_OVARY)|V600E(G361_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(HS294T_SKIN)|V600E(HS695T_SKIN)|V600E(HS939T_SKIN)|V600E(IGR1_SKIN)|V600E(IGR37_SKIN)|V600E(IGR39_SKIN)|V600E(K029AX_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(LOXIMVI_SKIN)|V600E(MALME3M_SKIN)|V600E(MELHO_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(RKO_LARGE_INTESTINE)|V600E(RPMI7951_SKIN)|V600E(RVH421_SKIN)|V600E(SH4_SKIN)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(SKHEP1_LIVER)|V600E(SKMEL24_SKIN)|V600E(SKMEL28_SKIN)|V600E(SKMEL5_SKIN)|V600E(SW1417_LARGE_INTESTINE)|V600E(UACC257_SKIN)|V600E(UACC62_SKIN)|V600E(WM793_SKIN)|V600E(WM88_SKIN)|V600E(WM983B_SKIN)	61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)	Colon(40;35 892 2973 5743 27438)	uc003vwc.3	V600E(UACC257_SKIN)|V600D(K029AX_SKIN)|V600E(HS695T_SKIN)|V600E(COLO679_SKIN)|V600E(BT474_BREAST)|V600E(IGR39_SKIN)|V600E(A101D_SKIN)|V600E(COLO783_SKIN)|V600E(IGR37_SKIN)|V600E(A375_SKIN)|V600E(WM793_SKIN)|V600E(COLO818_SKIN)|V600E(HS294T_SKIN)|V600E(SKMEL28_SKIN)|V600E(DU4475_BREAST)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(IGR1_SKIN)|V600E(SKHEP1_LIVER)|V600E(WM983B_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(RVH421_SKIN)|V600D(WM2664_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(SKMEL24_SKIN)|V600D(WM115_SKIN)|V600E(MALME3M_SKIN)|V600E(A673_BONE)|V600E(C32_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(COLO800_SKIN)|V600E(COLO741_SKIN)|V600E(HS939T_SKIN)|V600E(COLO205_LARGE_INTESTINE)|V600E(K029AX_SKIN)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(SH4_SKIN)|V600E(WM88_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(COLO849_SKIN)|V600E(MELHO_SKIN)|V600E(BHT101_THYROID)|V600E(G361_SKIN)|V600E(UACC62_SKIN)|V600E(BCPAP_THYROID)|V600E(8505C_THYROID)|V600E(SW1417_LARGE_INTESTINE)|V600E(COLO829_SKIN)|V600E(RKO_LARGE_INTESTINE)|V600E(A2058_SKIN)|V600E(RPMI7951_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(SKMEL5_SKIN)|V600E(ES2_OVARY)|V600E(LOXIMVI_SKIN)	61		Dom	yes		7	7q34	673	Mis|T|O	v-raf murine sarcoma viral oncogene homolog B1	yes	Cardio-facio-cutaneous syndrome	E	AKAP9|KIAA1549		melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	15808	Substitution - Missense(15790)|Complex - deletion inframe(17)|Insertion - In frame(1)	p.V600E(16892)|p.V600?(325)|p.V600K(176)|p.V600R(36)|p.V600M(25)|p.V600A(23)|p.V600D(21)|p.V600G(11)|p.V600_K601>E(8)|p.T599_V600insTT(3)|p.T599_R603>I(2)|p.T599_V600>IAL(2)|p.V600L(2)|p.T599_V600insT(2)|p.V600_W604del(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insV(1)|p.T599_V600insDFGLAT(1)	thyroid(7476)|skin(3822)|large_intestine(3288)|NS(360)|haematopoietic_and_lymphoid_tissue(336)|ovary(211)|lung(58)|eye(57)|central_nervous_system(53)|soft_tissue(30)|biliary_tract(18)|liver(17)|prostate(13)|breast(10)|upper_aerodigestive_tract(9)|endometrium(8)|pancreas(8)|testis(7)|small_intestine(7)|genital_tract(4)|stomach(4)|bone(3)|autonomic_ganglia(2)|oesophagus(2)|urinary_tract(2)|adrenal_gland(2)|pituitary(1)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290						c.(1798-1800)GTG>GAG		B-Raf	Sorafenib(DB00398)						112.0	104.0	107.0					7																	140453136		2203	4300	6503	SO:0001583	missense	673	Cardiofaciocutaneous_syndrome	Familial Cancer Database	CFC, CFCS	activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	g.chr7:140453136A>T	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1799T>A	7.37:g.140453136A>T	ENSP00000288602:p.Val600Glu						p.V600E	NM_004333	NP_004324	P15056	BRAF_HUMAN			15	1860	-	Melanoma(164;0.00956)		600		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions).|V -> E (in sarcoma, colorectal adenocarcinoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis).	Protein kinase.		A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	c.1799T>A	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.0|24.0	4.486113|4.486113	0.84854|0.84854	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000288602|ENST00000496384	D|.	0.81739|.	-1.53|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.61565|.	0.2357|.	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D|.	0.55385|.	0.971|.	D|.	0.66351|.	0.943|.	T|.	0.58160|.	-0.7685|.	10|.	0.87932|.	D|.	0|.	.|.	15.9326|15.9326	0.79675|0.79675	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	600|.	P15056|.	BRAF_HUMAN|.	E|R	600|208	ENSP00000288602:V600E|.	ENSP00000288602:V600E|.	V|X	-|-	2|1	0|0	BRAF|BRAF	140099605|140099605	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.197000|9.197000	0.94985|0.94985	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	GTG|TGA		0.368	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333		15	48	0	0	0	0.003163	0	15	48				
PTPRN2	5799	broad.mit.edu	37	7	157475488	157475488	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr7:157475488G>C	ENST00000389418.4	-	13	1939	c.1930C>G	c.(1930-1932)Cag>Gag	p.Q644E	PTPRN2_ENST00000389416.4_Missense_Mutation_p.Q627E|PTPRN2_ENST00000409483.1_Missense_Mutation_p.Q606E|PTPRN2_ENST00000404321.2_Missense_Mutation_p.Q667E|PTPRN2_ENST00000389413.3_Missense_Mutation_p.Q615E	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	644					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		AGCCTGTGCTGAGAGCTATGG	0.592																																							uc003wno.2		NA																	0				ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7						c.(1930-1932)CAG>GAG		protein tyrosine phosphatase, receptor type, N							92.0	102.0	98.0					7																	157475488		2203	4300	6503	SO:0001583	missense	5799					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr7:157475488G>C	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.1930C>G	7.37:g.157475488G>C	ENSP00000374069:p.Gln644Glu					PTPRN2_uc003wnp.2_Missense_Mutation_p.Q627E|PTPRN2_uc003wnq.2_Missense_Mutation_p.Q615E|PTPRN2_uc003wnr.2_Missense_Mutation_p.Q606E|PTPRN2_uc011kwa.1_Missense_Mutation_p.Q667E	p.Q644E	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)	13	2051	-	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	644			Cytoplasmic (Potential).		E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	ENST00000389418.4	37	c.1930C>G	CCDS5947.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.418083	0.25552	.	.	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	T;T;T;T;T	0.02763	4.18;4.2;4.18;4.18;4.17	4.49	4.49	0.54785	.	0.188785	0.30820	N	0.008806	T	0.03263	0.0095	N	0.19112	0.55	0.27897	N	0.939126	B;B;B;B;B	0.25609	0.122;0.027;0.047;0.13;0.027	B;B;B;B;B	0.28011	0.085;0.024;0.085;0.033;0.024	T	0.36187	-0.9758	10	0.48119	T	0.1	.	17.1926	0.86883	0.0:0.0:1.0:0.0	.	667;606;615;627;644	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	E	606;615;627;644;667	ENSP00000387114:Q606E;ENSP00000374064:Q615E;ENSP00000374067:Q627E;ENSP00000374069:Q644E;ENSP00000385464:Q667E	ENSP00000374064:Q615E	Q	-	1	0	PTPRN2	157168249	1.000000	0.71417	0.019000	0.16419	0.029000	0.11900	8.911000	0.92721	2.020000	0.59435	0.591000	0.81541	CAG		0.592	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1			31	102	0	0	0	0.015359	0	31	102				
MTMR7	9108	broad.mit.edu	37	8	17169138	17169138	+	Nonsense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr8:17169138G>C	ENST00000180173.5	-	9	1017	c.983C>G	c.(982-984)tCa>tGa	p.S328*	MTMR7_ENST00000521857.1_Nonsense_Mutation_p.S328*|MTMR7_ENST00000398099.3_5'UTR	NM_004686.4	NP_004677.3	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7	328	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				inositol phosphate dephosphorylation (GO:0046855)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(8)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	32				Colorectal(111;0.112)		CCCTTCCTCTGACACTGCCTA	0.522																																							uc003wxm.2		NA																	0				skin(1)	1						c.(982-984)TCA>TGA		myotubularin related protein 7							275.0	261.0	266.0					8																	17169138		2203	4300	6503	SO:0001587	stop_gained	9108						protein tyrosine phosphatase activity	g.chr8:17169138G>C	AF073482	CCDS34851.1	8p22	2011-06-09			ENSG00000003987	ENSG00000003987		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7454	protein-coding gene	gene with protein product		603562				9736772, 12890864	Standard	NM_004686		Approved		uc003wxm.3	Q9Y216	OTTHUMG00000163771	ENST00000180173.5:c.983C>G	8.37:g.17169138G>C	ENSP00000180173:p.Ser328*					MTMR7_uc003wxn.2_Nonsense_Mutation_p.S107*|MTMR7_uc011kya.1_5'UTR|MTMR7_uc011kyb.1_5'UTR	p.S328*	NM_004686	NP_004677	Q9Y216	MTMR7_HUMAN		Colorectal(111;0.112)	9	1222	-			328			Myotubularin phosphatase.		A1L4K9|B4DG87|Q68DX4	Nonsense_Mutation	SNP	ENST00000180173.5	37	c.983C>G	CCDS34851.1	.	.	.	.	.	.	.	.	.	.	G	39	7.490706	0.98316	.	.	ENSG00000003987	ENST00000180173;ENST00000521857	.	.	.	4.91	4.91	0.64330	.	1.106060	0.06960	N	0.816263	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	18.6564	0.91455	0.0:0.0:1.0:0.0	.	.	.	.	X	328	.	ENSP00000180173:S328X	S	-	2	0	MTMR7	17213509	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.674000	0.83992	2.721000	0.93114	0.655000	0.94253	TCA		0.522	MTMR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375311.1	NM_004686		102	384	0	0	0	0.01441	0	102	384				
ARFGEF1	10565	broad.mit.edu	37	8	68150629	68150629	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr8:68150629G>A	ENST00000262215.3	-	22	3627	c.3238C>T	c.(3238-3240)Ctt>Ttt	p.L1080F	ARFGEF1_ENST00000520381.1_Missense_Mutation_p.L534F|ARFGEF1_ENST00000518230.1_5'UTR	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1080					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GTTCCAGTAAGAGATCCTTCT	0.408																																							uc003xxo.1		NA																	0				ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8						c.(3238-3240)CTT>TTT		brefeldin A-inhibited guanine							101.0	93.0	95.0					8																	68150629		2203	4300	6503	SO:0001583	missense	10565				exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding	g.chr8:68150629G>A	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.3238C>T	8.37:g.68150629G>A	ENSP00000262215:p.Leu1080Phe					ARFGEF1_uc003xxl.1_Missense_Mutation_p.L534F|ARFGEF1_uc003xxn.1_Missense_Mutation_p.L63F	p.L1080F	NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)		22	3628	-	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	1080					Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	37	c.3238C>T	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.374714	0.24857	.	.	ENSG00000066777	ENST00000520381;ENST00000262215	T;T	0.67523	-0.27;2.0	5.48	2.26	0.28386	Armadillo-type fold (1);	0.244121	0.41097	N	0.000948	T	0.40171	0.1106	N	0.16478	0.41	0.80722	D	1	B;B;B	0.33135	0.0;0.078;0.399	B;B;B	0.35182	0.001;0.13;0.197	T	0.12192	-1.0557	10	0.09843	T	0.71	.	2.0105	0.03486	0.4012:0.0:0.3505:0.2483	.	1080;558;534	Q9Y6D6;Q59FY5;E5RIF2	BIG1_HUMAN;.;.	F	534;1080	ENSP00000428429:L534F;ENSP00000262215:L1080F	ENSP00000262215:L1080F	L	-	1	0	ARFGEF1	68313183	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.623000	0.46435	0.668000	0.31126	-0.911000	0.02809	CTT		0.408	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421		17	55	0	0	0	0.006122	0	17	55				
CA3	761	broad.mit.edu	37	8	86352077	86352077	+	Missense_Mutation	SNP	G	G	C			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr8:86352077G>C	ENST00000285381.2	+	2	254	c.171G>C	c.(169-171)aaG>aaC	p.K57N	RP11-317J10.2_ENST00000517697.1_RNA|RP11-317J10.2_ENST00000521761.1_RNA	NM_005181.3	NP_005172.1	P07451	CAH3_HUMAN	carbonic anhydrase III, muscle specific	57					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|response to ethanol (GO:0045471)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	carbonate dehydratase activity (GO:0004089)|nickel cation binding (GO:0016151)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23					Acetazolamide(DB00819)|Zonisamide(DB00909)	GCTCTGCCAAGACCATCCTGA	0.458																																							uc003ydj.2		NA																	0					0						c.(169-171)AAG>AAC		carbonic anhydrase III							111.0	95.0	100.0					8																	86352077		2203	4300	6503	SO:0001583	missense	761				one-carbon metabolic process	cytoplasm	carbonate dehydratase activity|zinc ion binding	g.chr8:86352077G>C	AJ006473	CCDS6238.1	8q21.2	2012-10-02					4.2.1.1	"""Carbonic anhydrases"""	1374	protein-coding gene	gene with protein product		114750				6221502	Standard	NM_005181		Approved	Car3, CAIII	uc003ydj.3	P07451		ENST00000285381.2:c.171G>C	8.37:g.86352077G>C	ENSP00000285381:p.Lys57Asn					CA13_uc003ydf.1_RNA|CA3_uc011lfv.1_RNA	p.K57N	NM_005181	NP_005172	P07451	CAH3_HUMAN			2	254	+			57					B2R867|B3KUC8|O60842	Missense_Mutation	SNP	ENST00000285381.2	37	c.171G>C	CCDS6238.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.123082	0.56613	.	.	ENSG00000164879	ENST00000285381;ENST00000426378	T	0.68765	-0.35	5.81	4.94	0.65067	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.087162	0.85682	D	0.000000	T	0.77384	0.4122	M	0.81682	2.555	0.58432	D	0.999991	D	0.76494	0.999	D	0.64776	0.929	T	0.75548	-0.3279	10	0.18710	T	0.47	-28.1727	9.3783	0.38297	0.22:0.0:0.78:0.0	.	57	P07451	CAH3_HUMAN	N	57;41	ENSP00000285381:K57N	ENSP00000285381:K57N	K	+	3	2	CA3	86539329	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	0.793000	0.26944	1.462000	0.47948	0.650000	0.86243	AAG		0.458	CA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381090.1	NM_005181		13	52	0	0	0	0.016723	0	13	52				
PTDSS1	9791	broad.mit.edu	37	8	97311998	97311998	+	Missense_Mutation	SNP	A	A	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr8:97311998A>G	ENST00000517309.1	+	6	1003	c.677A>G	c.(676-678)aAt>aGt	p.N226S	PTDSS1_ENST00000518776.1_3'UTR|PTDSS1_ENST00000455950.2_Missense_Mutation_p.N80S|PTDSS1_ENST00000522072.1_Missense_Mutation_p.N23S	NM_014754.1	NP_055569.1	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	226					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|stomach(1)	29	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	CTGTTGTGCAATGGCGGTGGC	0.493																																							uc003yht.1		NA																	0				ovary(1)	1						c.(676-678)AAT>AGT		phosphatidylserine synthase 1	Phosphatidylserine(DB00144)						219.0	196.0	204.0					8																	97311998		2203	4300	6503	SO:0001583	missense	9791				phosphatidylserine biosynthetic process	integral to membrane	transferase activity	g.chr8:97311998A>G	D14694	CCDS6271.1	8q22	2008-05-02			ENSG00000156471	ENSG00000156471			9587	protein-coding gene	gene with protein product		612792					Standard	NM_014754		Approved	KIAA0024, PSSA, PSS1	uc003yht.1	P48651	OTTHUMG00000164687	ENST00000517309.1:c.677A>G	8.37:g.97311998A>G	ENSP00000430548:p.Asn226Ser					PTDSS1_uc003yhu.1_Missense_Mutation_p.N80S	p.N226S	NM_014754	NP_055569	P48651	PTSS1_HUMAN			6	779	+	Breast(36;6.18e-05)		226			Helical; (Potential).		E5RFC5|Q9BUQ5	Missense_Mutation	SNP	ENST00000517309.1	37	c.677A>G	CCDS6271.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.688971	0.88735	.	.	ENSG00000156471	ENST00000517309;ENST00000455950;ENST00000522072	T;T;T	0.81330	-1.48;-1.03;-1.14	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	D	0.89543	0.6745	H	0.94385	3.53	0.80722	D	1	P	0.51240	0.943	P	0.51999	0.687	D	0.92250	0.5808	10	0.87932	D	0	-13.9063	13.5966	0.61994	1.0:0.0:0.0:0.0	.	226	P48651	PTSS1_HUMAN	S	226;80;23	ENSP00000430548:N226S;ENSP00000401248:N80S;ENSP00000430928:N23S	ENSP00000401248:N80S	N	+	2	0	PTDSS1	97381174	1.000000	0.71417	0.886000	0.34754	0.927000	0.56198	9.283000	0.95860	1.960000	0.56953	0.528000	0.53228	AAT		0.493	PTDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379743.2			38	162	0	0	0	0.017118	0	38	162				
HAS2	3037	broad.mit.edu	37	8	122626891	122626891	+	Missense_Mutation	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr8:122626891G>A	ENST00000303924.4	-	4	1654	c.1117C>T	c.(1117-1119)Cac>Tac	p.H373Y		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	373					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			ATCCACAAGTGATGTTTGTGA	0.433																																							uc003yph.2		NA																HAS2/PLAG1(10)	0				soft_tissue(10)|ovary(5)	15						c.(1117-1119)CAC>TAC		hyaluronan synthase 2							173.0	149.0	157.0					8																	122626891		2203	4300	6503	SO:0001583	missense	3037					integral to plasma membrane	hyaluronan synthase activity	g.chr8:122626891G>A	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.1117C>T	8.37:g.122626891G>A	ENSP00000306991:p.His373Tyr						p.H373Y	NM_005328	NP_005319	Q92819	HAS2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00503)		4	1655	-	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		373			Cytoplasmic (Potential).		Q32MM3	Missense_Mutation	SNP	ENST00000303924.4	37	c.1117C>T	CCDS6335.1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.164496	0.57476	.	.	ENSG00000170961	ENST00000303924	T	0.56941	0.43	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.63558	0.2521	M	0.77616	2.38	0.80722	D	1	P	0.35307	0.494	B	0.39935	0.314	T	0.65158	-0.6236	10	0.66056	D	0.02	-21.9382	20.5385	0.99246	0.0:0.0:1.0:0.0	.	373	Q92819	HAS2_HUMAN	Y	373	ENSP00000306991:H373Y	ENSP00000306991:H373Y	H	-	1	0	HAS2	122696072	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.846000	0.99502	2.863000	0.98299	0.549000	0.68633	CAC		0.433	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328		4	139	0	0	0	0.009096	0	4	139				
FER1L6	654463	broad.mit.edu	37	8	124968250	124968250	+	Silent	SNP	G	G	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr8:124968250G>A	ENST00000522917.1	+	2	218	c.12G>A	c.(10-12)ctG>ctA	p.L4L	FER1L6_ENST00000399018.1_Silent_p.L4L	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	4						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TGTTTGGGCTGAAGGTGAAGA	0.443																																							uc003yqw.2		NA																	0				ovary(5)|skin(5)|central_nervous_system(1)	11						c.(10-12)CTG>CTA		fer-1-like 6							48.0	48.0	48.0					8																	124968250		1874	4104	5978	SO:0001819	synonymous_variant	654463					integral to membrane		g.chr8:124968250G>A	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.12G>A	8.37:g.124968250G>A							p.L4L	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)		2	218	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		4			Cytoplasmic (Potential).			Silent	SNP	ENST00000522917.1	37	c.12G>A	CCDS43767.1																																																																																				0.443	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		3	24	0	0	0	0.001168	0	3	24				
TNC	3371	broad.mit.edu	37	9	117808761	117808761	+	Nonsense_Mutation	SNP	C	C	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr9:117808761C>A	ENST00000350763.4	-	17	5464	c.5053G>T	c.(5053-5055)Gaa>Taa	p.E1685*	TNC_ENST00000423613.2_Intron|TNC_ENST00000537320.1_Intron|TNC_ENST00000535648.1_Nonsense_Mutation_p.E1230*|TNC_ENST00000481475.1_5'Flank|TNC_ENST00000341037.4_Nonsense_Mutation_p.E1503*|TNC_ENST00000345230.3_Intron|TNC_ENST00000340094.3_Nonsense_Mutation_p.E1321*|TNC_ENST00000346706.3_Nonsense_Mutation_p.E1139*|TNC_ENST00000542877.1_Nonsense_Mutation_p.E1322*	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1685	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						ATTTCGTATTCAGTAGCCTCT	0.443																																							uc004bjj.3		NA																	0				central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						c.(5053-5055)GAA>TAA		tenascin C precursor							216.0	204.0	208.0					9																	117808761		2203	4300	6503	SO:0001587	stop_gained	3371				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding	g.chr9:117808761C>A		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.5053G>T	9.37:g.117808761C>A	ENSP00000265131:p.Glu1685*					TNC_uc010mvf.2_Intron	p.E1685*	NM_002160	NP_002151	P24821	TENA_HUMAN			17	5415	-			1685			Fibronectin type-III 12.		C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Nonsense_Mutation	SNP	ENST00000350763.4	37	c.5053G>T	CCDS6811.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	42|42	9.317270|9.317270	0.99135|0.99135	.|.	.|.	ENSG00000041982|ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000350763;ENST00000341037;ENST00000542877|ENST00000544972	.|.	.|.	.|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.13108|.	T|.	0.6|.	.|.	20.0674|20.0674	0.97707|0.97707	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	1321;1230;1139;1685;1503;1322|247	.|.	ENSP00000344400:E1321X|.	E|X	-|-	1|2	0|2	TNC|TNC	116848582|116848582	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	5.770000|5.770000	0.68873|0.68873	2.735000|2.735000	0.93741|0.93741	0.563000|0.563000	0.77884|0.77884	GAA|TGA		0.443	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160		72	146	1	0	1.93348e-29	0.01441	2.21816e-29	72	146				
DENND1A	57706	broad.mit.edu	37	9	126214606	126214606	+	Silent	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr9:126214606C>T	ENST00000373624.2	-	17	1449	c.1248G>A	c.(1246-1248)ctG>ctA	p.L416L	DENND1A_ENST00000394215.2_Silent_p.L386L|DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000373620.3_Silent_p.L416L|DENND1A_ENST00000373618.1_Silent_p.L384L|DENND1A_ENST00000542603.1_Silent_p.L158L|DENND1A_ENST00000394219.3_Silent_p.L384L	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	416					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						TTACAGTATTCAGAATTGCTC	0.418																																							uc004bnz.1		NA																	0				ovary(2)	2						c.(1246-1248)CTG>CTA		DENN/MADD domain containing 1A isoform 1							171.0	150.0	157.0					9																	126214606		2203	4300	6503	SO:0001819	synonymous_variant	57706					cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity	g.chr9:126214606C>T	AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.1248G>A	9.37:g.126214606C>T						DENND1A_uc011lzl.1_Silent_p.L191L|DENND1A_uc004bny.1_Silent_p.L155L|DENND1A_uc011lzm.1_Silent_p.L384L|DENND1A_uc004boa.1_Silent_p.L416L|DENND1A_uc004bob.1_Silent_p.L386L|DENND1A_uc004boc.2_Silent_p.L384L	p.L416L	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN			17	1481	-			416					A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Silent	SNP	ENST00000373624.2	37	c.1248G>A	CCDS35133.1																																																																																				0.418	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	NM_024820		13	47	0	0	0	0.016723	0	13	47				
SPTAN1	6709	broad.mit.edu	37	9	131344062	131344062	+	Splice_Site	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr9:131344062C>T	ENST00000372731.4	+	12	1573	c.1463C>T	c.(1462-1464)gCg>gTg	p.A488V	SPTAN1_ENST00000372739.3_Splice_Site_p.A488V|SPTAN1_ENST00000358161.5_Splice_Site_p.A488V	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	488					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						TTTGGCAAGGCGTTCCTGTTG	0.413																																					NSCLC(120;833 1744 2558 35612 37579)	NSCLC(120;833 1744 2558 35612 37579)	uc004bvl.3		NA																	0				breast(5)|ovary(4)|pancreas(1)	10						c.(1462-1464)GCG>GTG		spectrin, alpha, non-erythrocytic 1							252.0	251.0	251.0					9																	131344062		2203	4300	6503	SO:0001630	splice_region_variant	6709				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton	g.chr9:131344062C>T	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.1462-1C>T	9.37:g.131344062C>T						SPTAN1_uc011mbg.1_Missense_Mutation_p.A488V|SPTAN1_uc011mbh.1_Missense_Mutation_p.A500V|SPTAN1_uc004bvm.3_Missense_Mutation_p.A488V|SPTAN1_uc004bvn.3_Missense_Mutation_p.A488V	p.A488V	NM_003127	NP_003118	Q13813	SPTA2_HUMAN			12	1576	+			488			Spectrin 6.		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	c.1463C>T	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.081214	0.76528	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.52526	0.66;0.66;0.66	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.68723	0.3032	M	0.80028	2.48	0.80722	D	1	D;D;D;P;D	0.71674	0.998;0.998;0.992;0.811;0.997	P;P;P;B;P	0.62560	0.772;0.904;0.538;0.117;0.874	T	0.74047	-0.3790	10	0.66056	D	0.02	.	17.4303	0.87537	0.0:1.0:0.0:0.0	.	488;488;488;488;488	A6NG51;B4DTV8;Q13813-3;Q13813-2;Q13813	.;.;.;.;SPTA2_HUMAN	V	488	ENSP00000350882:A488V;ENSP00000361816:A488V;ENSP00000361824:A488V	ENSP00000350882:A488V	A	+	2	0	SPTAN1	130383883	1.000000	0.71417	0.995000	0.50966	0.955000	0.61496	7.437000	0.80417	2.357000	0.79964	0.563000	0.77884	GCG		0.413	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	Missense_Mutation	44	184	0	0	0	0.01441	0	44	184				
SERPINA7	6906	broad.mit.edu	37	X	105280592	105280592	+	Missense_Mutation	SNP	A	A	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chrX:105280592A>T	ENST00000327674.4	-	1	793	c.458T>A	c.(457-459)cTc>cAc	p.L153H	SERPINA7_ENST00000372563.1_Missense_Mutation_p.L153H|SERPINA7_ENST00000487487.1_5'Flank			P05543	THBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7	153					aging (GO:0007568)|negative regulation of endopeptidase activity (GO:0010951)|post-embryonic development (GO:0009791)|regulation of proteolysis (GO:0030162)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to peptide hormone (GO:0043434)|response to prostaglandin E (GO:0034695)|response to vitamin A (GO:0033189)|thyroid hormone transport (GO:0070327)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hormone binding (GO:0042562)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|skin(3)	24					Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	AGTCTCATAGAGGGTCTTGAC	0.428																																							uc004eme.1		NA																	0					0						c.(457-459)CTC>CAC		serine (or cysteine) proteinase inhibitor, clade	Levothyroxine(DB00451)|Liothyronine(DB00279)						168.0	160.0	163.0					X																	105280592		2203	4300	6503	SO:0001583	missense	6906				regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity	g.chrX:105280592A>T	M14091	CCDS14518.1	Xq21-q22	2014-02-18	2005-08-18		ENSG00000123561	ENSG00000123561		"""Serine (or cysteine) peptidase inhibitors"""	11583	protein-coding gene	gene with protein product	"""thyroxin-binding globulin"", ""thyroxine-binding globulin"", ""alpha-1 antiproteinase, antitrypsin"""	314200	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7"""	TBG		24172014	Standard	NM_000354		Approved		uc004eme.2	P05543	OTTHUMG00000022144	ENST00000327674.4:c.458T>A	X.37:g.105280592A>T	ENSP00000329374:p.Leu153His					SERPINA7_uc010npd.2_Missense_Mutation_p.L153H|SERPINA7_uc010npe.1_Missense_Mutation_p.L153H	p.L153H	NM_000354	NP_000345	P05543	THBG_HUMAN			1	474	-			153					D3DUX1	Missense_Mutation	SNP	ENST00000327674.4	37	c.458T>A	CCDS14518.1	.	.	.	.	.	.	.	.	.	.	A	7.811	0.715736	0.15306	.	.	ENSG00000123561	ENST00000327674;ENST00000372563	D;D	0.85556	-2.0;-2.0	4.7	4.7	0.59300	Serpin domain (3);	0.440036	0.21452	N	0.074308	D	0.88596	0.6479	L	0.58510	1.815	0.09310	N	1	D	0.76494	0.999	D	0.68483	0.958	T	0.80430	-0.1386	10	0.87932	D	0	.	6.9431	0.24504	0.7931:0.0:0.0:0.2069	.	153	P05543	THBG_HUMAN	H	153	ENSP00000329374:L153H;ENSP00000361644:L153H	ENSP00000329374:L153H	L	-	2	0	SERPINA7	105167248	0.051000	0.20477	0.254000	0.24359	0.147000	0.21601	3.233000	0.51311	1.855000	0.53841	0.481000	0.45027	CTC		0.428	SERPINA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057790.1	NM_000354		56	176	0	0	0	0.01441	0	56	176				
CUL4B	8450	broad.mit.edu	37	X	119678408	119678408	+	Silent	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chrX:119678408C>T	ENST00000404115.3	-	8	1466	c.1065G>A	c.(1063-1065)gaG>gaA	p.E355E	CUL4B_ENST00000336592.6_Silent_p.E342E|CUL4B_ENST00000371322.5_Silent_p.E337E|snoU13_ENST00000605987.1_RNA	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	355					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TCCTTTCCCTCTCAATCAAGA	0.363																																							uc004esw.2		NA																	0				lung(1)|central_nervous_system(1)|pancreas(1)	3						c.(1063-1065)GAG>GAA		cullin 4B isoform 1							114.0	103.0	107.0					X																	119678408		2203	4300	6503	SO:0001819	synonymous_variant	8450				cell cycle|DNA repair|ubiquitin-dependent protein catabolic process	Cul4B-RING ubiquitin ligase complex|nucleus	protein binding|ubiquitin protein ligase binding	g.chrX:119678408C>T	U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.1065G>A	X.37:g.119678408C>T						CUL4B_uc010nqq.2_Silent_p.E54E|CUL4B_uc004esv.2_Silent_p.E337E	p.E355E	NM_003588	NP_003579	Q13620	CUL4B_HUMAN			8	1502	-			355					B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Silent	SNP	ENST00000404115.3	37	c.1065G>A	CCDS35379.1																																																																																				0.363	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058103.1	NM_003588		21	70	0	0	0	0.012319	0	21	70				
USP26	83844	broad.mit.edu	37	X	132159788	132159788	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chrX:132159788C>T	ENST00000511190.1	-	6	2930	c.2461G>A	c.(2461-2463)Gat>Aat	p.D821N	USP26_ENST00000406273.1_Missense_Mutation_p.D821N|USP26_ENST00000370832.1_Missense_Mutation_p.D821N	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	821	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					TAGGTATGATCTCCCTTATCA	0.383																																					NSCLC(104;342 1621 36940 47097 52632)	NSCLC(104;342 1621 36940 47097 52632)	uc010nrm.1		NA																	0				lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8						c.(2461-2463)GAT>AAT		ubiquitin-specific protease 26							180.0	162.0	168.0					X																	132159788		2203	4300	6503	SO:0001583	missense	83844				protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	g.chrX:132159788C>T	AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.2461G>A	X.37:g.132159788C>T	ENSP00000423390:p.Asp821Asn					USP26_uc011mvf.1_Missense_Mutation_p.D821N	p.D821N	NM_031907	NP_114113	Q9BXU7	UBP26_HUMAN			6	2931	-	Acute lymphoblastic leukemia(192;0.000127)		821					B9WRT6|Q5H9H4	Missense_Mutation	SNP	ENST00000511190.1	37	c.2461G>A	CCDS14635.1	.	.	.	.	.	.	.	.	.	.	C	5.692	0.312238	0.10789	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.30981	1.51;1.51;1.51	3.75	-1.72	0.08107	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.423691	0.17322	N	0.178451	T	0.23451	0.0567	L	0.45137	1.4	0.09310	N	1	P	0.36753	0.568	B	0.42214	0.38	T	0.19679	-1.0298	10	0.26408	T	0.33	-1.2334	5.5652	0.17167	0.0:0.2941:0.4861:0.2197	.	821	Q9BXU7	UBP26_HUMAN	N	821	ENSP00000359869:D821N;ENSP00000423390:D821N;ENSP00000384360:D821N	ENSP00000359869:D821N	D	-	1	0	USP26	131987454	0.001000	0.12720	0.000000	0.03702	0.028000	0.11728	0.050000	0.14120	-0.547000	0.06207	-0.355000	0.07637	GAT		0.383	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907		23	98	0	0	0	0.014323	0	23	98				
MAGEA11	4110	broad.mit.edu	37	X	148798344	148798344	+	Missense_Mutation	SNP	C	C	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chrX:148798344C>A	ENST00000355220.5	+	5	1300	c.1198C>A	c.(1198-1200)Ctt>Att	p.L400I	MAGEA11_ENST00000333104.4_Missense_Mutation_p.L371I	NM_005366.4	NP_005357.2	P43364	MAGAB_HUMAN	melanoma antigen family A, 11	400	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	9	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					GATGAAAGTTCTTGAGTACAT	0.537																																							uc004fdq.2		NA																	0				ovary(2)	2						c.(1198-1200)CTT>ATT		melanoma antigen family A, 11 isoform a							162.0	131.0	142.0					X																	148798344		2203	4300	6503	SO:0001583	missense	4110					cytoplasm|nucleus	protein binding	g.chrX:148798344C>A		CCDS48180.1	Xq28	2009-03-13			ENSG00000185247	ENSG00000185247			6798	protein-coding gene	gene with protein product	"""MAGE-11 antigen"", ""melanoma-associated antigen 11"", ""cancer/testis antigen family 1, member 11"""	300344		MAGE11		8575766	Standard	NM_001011544		Approved	MAGE-11, MAGEA-11, MGC10511, CT1.11	uc004fdq.3	P43364	OTTHUMG00000022633	ENST00000355220.5:c.1198C>A	X.37:g.148798344C>A	ENSP00000347358:p.Leu400Ile					HSFX2_uc004fdl.2_Intron|HSFX1_uc004fdm.2_Intron|MAGEA11_uc004fdr.2_Missense_Mutation_p.L371I	p.L400I	NM_005366	NP_005357	P43364	MAGAB_HUMAN			5	1300	+	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)		400			MAGE.		Q5ETU4|Q6ZRZ5	Missense_Mutation	SNP	ENST00000355220.5	37	c.1198C>A	CCDS48180.1	.	.	.	.	.	.	.	.	.	.	N	12.71	2.019392	0.35606	.	.	ENSG00000185247	ENST00000333104;ENST00000355220	T;T	0.06371	3.31;3.39	0.976	0.976	0.19727	.	.	.	.	.	T	0.18341	0.0440	M	0.88570	2.965	0.09310	N	1	P;P	0.47106	0.89;0.825	P;P	0.53035	0.716;0.524	T	0.06481	-1.0824	8	.	.	.	.	4.9662	0.14091	0.0:1.0:0.0:0.0	.	371;400	G5E962;P43364	.;MAGAB_HUMAN	I	371;400	ENSP00000328177:L371I;ENSP00000347358:L400I	.	L	+	1	0	MAGEA11	148576061	0.003000	0.15002	0.087000	0.20705	0.302000	0.27658	-0.159000	0.10056	0.761000	0.33130	0.429000	0.28392	CTT		0.537	MAGEA11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058725.4	NM_005366		49	168	1	0	1.86633e-21	0.01441	2.11518e-21	49	168				
MAGEA11	4110	broad.mit.edu	37	X	148798377	148798377	+	Missense_Mutation	SNP	C	C	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chrX:148798377C>T	ENST00000355220.5	+	5	1333	c.1231C>T	c.(1231-1233)Ccc>Tcc	p.P411S	MAGEA11_ENST00000333104.4_Missense_Mutation_p.P382S	NM_005366.4	NP_005357.2	P43364	MAGAB_HUMAN	melanoma antigen family A, 11	411	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	9	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					TGGGAGGGATCCCACTTCTTA	0.547																																							uc004fdq.2		NA																	0				ovary(2)	2						c.(1231-1233)CCC>TCC		melanoma antigen family A, 11 isoform a							144.0	110.0	122.0					X																	148798377		2203	4300	6503	SO:0001583	missense	4110					cytoplasm|nucleus	protein binding	g.chrX:148798377C>T		CCDS48180.1	Xq28	2009-03-13			ENSG00000185247	ENSG00000185247			6798	protein-coding gene	gene with protein product	"""MAGE-11 antigen"", ""melanoma-associated antigen 11"", ""cancer/testis antigen family 1, member 11"""	300344		MAGE11		8575766	Standard	NM_001011544		Approved	MAGE-11, MAGEA-11, MGC10511, CT1.11	uc004fdq.3	P43364	OTTHUMG00000022633	ENST00000355220.5:c.1231C>T	X.37:g.148798377C>T	ENSP00000347358:p.Pro411Ser					HSFX2_uc004fdl.2_Intron|HSFX1_uc004fdm.2_Intron|MAGEA11_uc004fdr.2_Missense_Mutation_p.P382S	p.P411S	NM_005366	NP_005357	P43364	MAGAB_HUMAN			5	1333	+	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)		411			MAGE.		Q5ETU4|Q6ZRZ5	Missense_Mutation	SNP	ENST00000355220.5	37	c.1231C>T	CCDS48180.1	.	.	.	.	.	.	.	.	.	.	N	8.611	0.889232	0.17540	.	.	ENSG00000185247	ENST00000333104;ENST00000355220	T;T	0.02446	4.29;4.33	0.976	0.0433	0.14221	.	.	.	.	.	T	0.07188	0.0182	M	0.82193	2.58	0.09310	N	1	P;P	0.45672	0.864;0.604	P;B	0.48815	0.591;0.418	T	0.18461	-1.0336	8	.	.	.	.	3.205	0.06662	0.0:0.6714:0.0:0.3286	.	382;411	G5E962;P43364	.;MAGAB_HUMAN	S	382;411	ENSP00000328177:P382S;ENSP00000347358:P411S	.	P	+	1	0	MAGEA11	148576028	0.002000	0.14202	0.000000	0.03702	0.005000	0.04900	0.410000	0.21098	-0.054000	0.13266	0.429000	0.28392	CCC		0.547	MAGEA11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058725.4	NM_005366		39	129	0	0	0	0.005524	0	39	129				
MAGEA3	4102	broad.mit.edu	37	X	151935914	151935914	+	Missense_Mutation	SNP	C	C	G			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chrX:151935914C>G	ENST00000393902.3	-	3	820	c.253G>C	c.(253-255)Gag>Cag	p.E85Q	MAGEA3_ENST00000370278.3_Missense_Mutation_p.E85Q			P43357	MAGA3_HUMAN	melanoma antigen family A, 3	85										endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)	15	Acute lymphoblastic leukemia(192;6.56e-05)					CTGGAGTCCTCATAGGATTGG	0.597																																							uc004fgp.2		NA																	0					0						c.(253-255)GAG>CAG		melanoma antigen family A, 3							58.0	54.0	56.0					X																	151935914		2202	4286	6488	SO:0001583	missense	4102							g.chrX:151935914C>G		CCDS76045.1	Xq28	2009-03-13			ENSG00000221867	ENSG00000221867			6801	protein-coding gene	gene with protein product	"""melanoma-associated antigen 3"", ""antigen MZ2-D"", ""MAGE-3 antigen"", ""cancer/testis antigen family 1, member 3"""	300174		MAGE3		1840703, 8575766	Standard	NM_005362		Approved	HYPD, HIP8, MGC14613, CT1.3	uc004fgp.3	P43357	OTTHUMG00000022640	ENST00000393902.3:c.253G>C	X.37:g.151935914C>G	ENSP00000377480:p.Glu85Gln						p.E85Q	NM_005362	NP_005353	P43357	MAGA3_HUMAN			3	462	-	Acute lymphoblastic leukemia(192;6.56e-05)		85					Q6FHI6	Missense_Mutation	SNP	ENST00000393902.3	37	c.253G>C	CCDS14715.1	.	.	.	.	.	.	.	.	.	.	c	11.01	1.512498	0.27123	.	.	ENSG00000221867	ENST00000370278;ENST00000393902;ENST00000417212	T;T;T	0.09350	2.99;2.99;2.99	1.1	0.0402	0.14208	Melanoma associated antigen, MAGE, N-terminal (1);	1.724340	0.02882	N	0.132901	T	0.36880	0.0983	M	0.88979	2.995	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.05683	-1.0870	10	0.62326	D	0.03	.	4.6597	0.12636	0.0:0.5967:0.4033:0.0	.	85	P43357	MAGA3_HUMAN	Q	85	ENSP00000359301:E85Q;ENSP00000377480:E85Q;ENSP00000392758:E85Q	ENSP00000359301:E85Q	E	-	1	0	MAGEA3	151686570	0.001000	0.12720	0.001000	0.08648	0.005000	0.04900	1.397000	0.34543	-0.038000	0.13624	0.358000	0.22013	GAG		0.597	MAGEA3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058744.1	NM_005362		26	74	0	0	0	0.008361	0	26	74				
IL32	9235	broad.mit.edu	37	16	3119304	3119305	+	Frame_Shift_Ins	INS	-	-	G	rs398100042|rs2981599		TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr16:3119304_3119305insG	ENST00000534507.1	+	6	864_865	c.653_654insG	c.(652-657)gacaagfs	p.DK218fs	IL32_ENST00000396887.3_Frame_Shift_Ins_p.DK115fs|IL32_ENST00000440815.3_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000552356.1_Frame_Shift_Ins_p.DK152fs|IL32_ENST00000444393.3_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000008180.9_Frame_Shift_Ins_p.DK152fs|IL32_ENST00000530890.1_Frame_Shift_Ins_p.DK152fs|IL32_ENST00000548652.1_Frame_Shift_Ins_p.DK163fs|IL32_ENST00000552664.1_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000551122.1_Frame_Shift_Ins_p.DK115fs|RNU1-125P_ENST00000516752.1_RNA|IL32_ENST00000529550.1_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000551513.1_Frame_Shift_Ins_p.DK209fs|IL32_ENST00000525643.2_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000533097.2_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000552936.1_Frame_Shift_Ins_p.DK196fs|IL32_ENST00000530538.2_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000526464.2_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000528163.2_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000548476.1_Frame_Shift_Ins_p.DK218fs|IL32_ENST00000529699.1_Frame_Shift_Ins_p.DK152fs|IL32_ENST00000531965.1_Frame_Shift_Ins_p.DK162fs|IL32_ENST00000325568.5_Frame_Shift_Ins_p.DK172fs|IL32_ENST00000548246.1_Frame_Shift_Ins_p.DK132fs|IL32_ENST00000396890.2_Frame_Shift_Ins_p.DK218fs|IL32_ENST00000382213.3_Frame_Shift_Ins_p.DK163fs|IL32_ENST00000549213.1_Frame_Shift_Ins_p.DK115fs			P24001	IL32_HUMAN	interleukin 32	218					cell adhesion (GO:0007155)|defense response (GO:0006952)|immune response (GO:0006955)	extracellular space (GO:0005615)|membrane (GO:0016020)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	15						CCACGGGGGGACAAGGAGGAGC	0.574																																							uc002cto.2		NA																	0				pancreas(1)	1						c.(652-654)GACfs		interleukin 32 isoform B																																				SO:0001589	frameshift_variant	9235				cell adhesion|defense response|immune response	extracellular space	cytokine activity	g.chr16:3119304_3119305insG	M59807	CCDS32377.1, CCDS32378.1, CCDS32379.1, CCDS45394.1	16p13.3	2011-07-21			ENSG00000008517	ENSG00000008517		"""Interleukins and interleukin receptors"""	16830	protein-coding gene	gene with protein product	"""natural killer cell transcript 4"""	606001				1729377, 9653642	Standard	XM_005255686		Approved	NK4, TAIF, TAIFb, TAIFd	uc002ctn.3	P24001	OTTHUMG00000167498	Exception_encountered	16.37:g.3119304_3119305insG	ENSP00000431775:p.Asp218fs					IL32_uc002ctk.2_Frame_Shift_Ins_p.D115fs|IL32_uc010uwp.1_Frame_Shift_Ins_p.D152fs|IL32_uc010btb.2_Frame_Shift_Ins_p.D162fs|IL32_uc002ctl.2_Frame_Shift_Ins_p.D172fs|IL32_uc002ctm.2_Frame_Shift_Ins_p.D172fs|IL32_uc002ctn.2_Frame_Shift_Ins_p.D172fs|IL32_uc002cts.3_Frame_Shift_Ins_p.D172fs|IL32_uc002ctp.2_Frame_Shift_Ins_p.D152fs|IL32_uc002ctq.2_Frame_Shift_Ins_p.D218fs|IL32_uc002ctr.2_Frame_Shift_Ins_p.D152fs|IL32_uc002ctt.2_Frame_Shift_Ins_p.D172fs|IL32_uc010uwr.1_Frame_Shift_Ins_p.D132fs|IL32_uc002ctu.2_Frame_Shift_Ins_p.D163fs	p.D218fs	NM_004221	NP_004212	P24001	IL32_HUMAN			6	864_865	+			218					A6NNM0|A8MPX0|B4DJM1|B8Q191|D3DUB0|D3DUB2|Q5VFH7|Q5VFH8|Q8WV38|Q96GK9	Frame_Shift_Ins	INS	ENST00000534507.1	37	c.653_654insG																																																																																					0.574	IL32-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000394812.2	NM_004221		7	235	NA	NA	NA	NA	NA	7	235	---	---	---	---
CBX4	8535	broad.mit.edu	37	17	77808163	77808164	+	Frame_Shift_Ins	INS	-	-	T			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr17:77808163_77808164insT	ENST00000269397.4	-	5	1454_1455	c.1277_1278insA	c.(1276-1278)aagfs	p.K426fs		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	426	Interaction with BMI1.				chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CAGTCAGCCGCTTCTTGCAGGG	0.738																																							uc002jxe.2		NA																	0				skin(2)	2						c.(1276-1278)AAGfs		chromobox homolog 4																																				SO:0001589	frameshift_variant	8535				anti-apoptosis|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|PcG protein complex	enzyme binding|transcription corepressor activity	g.chr17:77808163_77808164insT	AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.1278dupA	17.37:g.77808165_77808165dupT	ENSP00000269397:p.Lys426fs						p.K426fs	NM_003655	NP_003646	O00257	CBX4_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)		5	1440_1441	-			426			Interaction with BMI1.		B1PJR7|Q6TPI8|Q96C04	Frame_Shift_Ins	INS	ENST00000269397.4	37	c.1277_1278insA	CCDS32758.1																																																																																				0.738	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318007.1	NM_003655		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
KLC3	147700	broad.mit.edu	37	19	45849956	45849956	+	Frame_Shift_Del	DEL	C	C	-			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr19:45849956delC	ENST00000391946.2	+	3	515	c.413delC	c.(412-414)gccfs	p.A138fs	KLC3_ENST00000470402.1_Frame_Shift_Del_p.A152fs|KLC3_ENST00000585434.1_Frame_Shift_Del_p.A138fs	NM_177417.2	NP_803136.2	Q6P597	KLC3_HUMAN	kinesin light chain 3	138					axon cargo transport (GO:0008088)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|motile cilium (GO:0031514)|neuron projection (GO:0043005)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		GAGTCCGTGGCCCAGCTGGAG	0.731																																							uc002pbf.1		NA																	0				ovary(1)	1						c.(412-414)GCCfs		kinesin light chain 3							5.0	7.0	6.0					19																	45849956		2065	4185	6250	SO:0001589	frameshift_variant	147700					cytoplasm|kinesin complex|microtubule	microtubule motor activity	g.chr19:45849956delC	AK092481	CCDS12660.2	19q13	2013-01-10			ENSG00000104892	ENSG00000104892		"""Tetratricopeptide (TTC) repeat domain containing"""	20717	protein-coding gene	gene with protein product		601334					Standard	XM_005258536		Approved	KLC2L, KNS2B, KLCt	uc002pbf.1	Q6P597	OTTHUMG00000143722	ENST00000391946.2:c.413delC	19.37:g.45849956delC	ENSP00000375810:p.Ala138fs					KLC3_uc002pbe.2_Frame_Shift_Del_p.A138fs|KLC3_uc010ejy.1_Frame_Shift_Del_p.A138fs|KLC3_uc002pbg.1_Frame_Shift_Del_p.A152fs	p.A138fs	NM_177417	NP_803136	Q6P597	KLC3_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0226)	3	528	+		Ovarian(192;0.0728)|all_neural(266;0.112)	138			Potential.		A0AVM3|A2RUT6|Q6GMU2|Q8NAL1|Q8WWJ9	Frame_Shift_Del	DEL	ENST00000391946.2	37	c.413delC	CCDS12660.2																																																																																				0.731	KLC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289776.1	NM_145275		2	4	NA	NA	NA	NA	NA	2	4	---	---	---	---
PNISR	25957	broad.mit.edu	37	6	99849436	99849437	+	Frame_Shift_Ins	INS	-	-	A			TCGA-80-5607-01A-31D-1945-08	TCGA-80-5607-10A-01D-1946-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	5dc36fad-2325-4794-9e3a-2394ba3f0932	6117e1f9-4015-49f5-aff3-6022fbd0bb3e	g.chr6:99849436_99849437insA	ENST00000369239.5	-	12	1601_1602	c.1397_1398insT	c.(1396-1398)ttafs	p.L466fs	PNISR_ENST00000438806.1_Frame_Shift_Ins_p.L466fs	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	466						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						CTAGTAGTGATAAACTATTTTG	0.332																																							uc003ppo.3		NA																	0					0						c.(1396-1398)TTAfs		splicing factor, arginine/serine-rich 130																																				SO:0001589	frameshift_variant	25957					nuclear speck		g.chr6:99849436_99849437insA	AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.1398dupT	6.37:g.99849439_99849439dupA	ENSP00000358242:p.Leu466fs					SFRS18_uc003ppl.2_Frame_Shift_Ins_p.L12fs|SFRS18_uc003ppp.3_Frame_Shift_Ins_p.L466fs|SFRS18_uc011eag.1_Frame_Shift_Ins_p.L466fs	p.L466fs	NM_032870	NP_116259	Q8TF01	PNISR_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0631)	12	1625_1626	-		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)	466					A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Frame_Shift_Ins	INS	ENST00000369239.5	37	c.1397_1398insT	CCDS5043.1																																																																																				0.332	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041598.1	NM_032870		16	46	NA	NA	NA	NA	NA	16	46	---	---	---	---
