#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
MFN2	9927	broad.mit.edu	37	1	12058906	12058906	+	Missense_Mutation	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:12058906G>A	ENST00000235329.5	+	7	1001	c.679G>A	c.(679-681)Gcc>Acc	p.A227T	MFN2_ENST00000444836.1_Missense_Mutation_p.A227T	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	227	Dynamin-type G.				apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		TGTGCTGGTGGCCAACTCAGA	0.562																																							uc001atn.3		NA																	0				ovary(1)	1						c.(679-681)GCC>ACC		mitofusin 2							274.0	230.0	245.0					1																	12058906		2203	4300	6503	SO:0001583	missense	9927				blood coagulation|mitochondrial fusion|mitochondrial membrane organization|mitochondrion localization|negative regulation of Ras protein signal transduction|negative regulation of smooth muscle cell proliferation|protein targeting to mitochondrion	cytosol|integral to membrane|intrinsic to mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding	g.chr1:12058906G>A	AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.679G>A	1.37:g.12058906G>A	ENSP00000235329:p.Ala227Thr					MFN2_uc009vni.2_Missense_Mutation_p.A227T	p.A227T	NM_014874	NP_055689	O95140	MFN2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)	7	1132	+	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	227			Cytoplasmic (Potential).		A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Missense_Mutation	SNP	ENST00000235329.5	37	c.679G>A	CCDS30587.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.032071	0.93575	.	.	ENSG00000116688	ENST00000444836;ENST00000235329	D;D	0.95171	-3.63;-3.63	4.9	4.9	0.64082	Dynamin, GTPase domain (1);	0.117788	0.56097	D	0.000026	D	0.94847	0.8335	L	0.52206	1.635	0.80722	D	1	P	0.37955	0.612	P	0.50231	0.635	D	0.93441	0.6794	10	0.27082	T	0.32	-13.1643	17.0951	0.86633	0.0:0.0:1.0:0.0	.	227	O95140	MFN2_HUMAN	T	227	ENSP00000416338:A227T;ENSP00000235329:A227T	ENSP00000235329:A227T	A	+	1	0	MFN2	11981493	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.435000	0.97529	2.274000	0.75844	0.655000	0.94253	GCC		0.562	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006859.2	NM_014874		72	80	0	0	0	0.00361	0	72	80				
ZCCHC11	23318	broad.mit.edu	37	1	52941190	52941190	+	Missense_Mutation	SNP	T	T	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:52941190T>A	ENST00000371544.3	-	13	2303	c.2041A>T	c.(2041-2043)Agg>Tgg	p.R681W	ZCCHC11_ENST00000371541.1_5'UTR|ZCCHC11_ENST00000257177.4_Missense_Mutation_p.R681W	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	681					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						GCAACATTCCTCTTGACTGAA	0.403																																							uc001ctx.2		NA																	0				ovary(2)|skin(1)	3						c.(2041-2043)AGG>TGG		zinc finger, CCHC domain containing 11 isoform							31.0	28.0	29.0					1																	52941190		2201	4300	6501	SO:0001583	missense	23318				miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding	g.chr1:52941190T>A	D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.2041A>T	1.37:g.52941190T>A	ENSP00000360599:p.Arg681Trp					ZCCHC11_uc001cty.2_Missense_Mutation_p.R681W|ZCCHC11_uc001ctz.2_Missense_Mutation_p.R681W|ZCCHC11_uc009vze.1_Missense_Mutation_p.R681W|ZCCHC11_uc009vzf.1_Missense_Mutation_p.R440W|ZCCHC11_uc001cub.2_Missense_Mutation_p.R681W	p.R681W	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN			13	2275	-			681					A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Missense_Mutation	SNP	ENST00000371544.3	37	c.2041A>T	CCDS30716.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.597450	0.87055	.	.	ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000528642;ENST00000484723	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.74824	0.3767	M	0.82193	2.58	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.79004	-0.1980	10	0.66056	D	0.02	.	15.5745	0.76365	0.0:0.0:0.0:1.0	.	440;681;681	E9PKX1;Q5TAX3-2;Q5TAX3	.;.;TUT4_HUMAN	W	681;681;610;440	ENSP00000257177:R681W;ENSP00000360599:R681W;ENSP00000433486:R610W;ENSP00000435256:R440W	ENSP00000257177:R681W	R	-	1	2	ZCCHC11	52713778	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.778000	0.68940	2.084000	0.62774	0.455000	0.32223	AGG		0.403	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022462.1	XM_038288		8	16	0	0	0	0.004482	0	8	16				
SLC44A5	204962	broad.mit.edu	37	1	75684273	75684273	+	Nonsense_Mutation	SNP	G	G	T	rs148196192		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:75684273G>T	ENST00000370855.5	-	17	1544	c.1431C>A	c.(1429-1431)tgC>tgA	p.C477*	SLC44A5_ENST00000535611.1_Nonsense_Mutation_p.C347*|SLC44A5_ENST00000370859.3_Nonsense_Mutation_p.C477*	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	477					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						CAGCAAGGGCGCACTGACCTA	0.438																																							uc001dgu.2		NA																	0				ovary(2)|skin(2)	4						c.(1429-1431)TGC>TGA		solute carrier family 44, member 5 isoform A							143.0	133.0	137.0					1																	75684273		2203	4300	6503	SO:0001587	stop_gained	204962					integral to membrane|plasma membrane	choline transmembrane transporter activity	g.chr1:75684273G>T	BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1431C>A	1.37:g.75684273G>T	ENSP00000359892:p.Cys477*					SLC44A5_uc001dgt.2_Nonsense_Mutation_p.C477*|SLC44A5_uc001dgs.2_Nonsense_Mutation_p.C435*|SLC44A5_uc001dgr.2_Nonsense_Mutation_p.C435*|SLC44A5_uc010oqz.1_Nonsense_Mutation_p.C516*|SLC44A5_uc010ora.1_Nonsense_Mutation_p.C471*|SLC44A5_uc010orb.1_Nonsense_Mutation_p.C347*	p.C477*	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN			17	1575	-			477			Helical; (Potential).		B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Nonsense_Mutation	SNP	ENST00000370855.5	37	c.1431C>A	CCDS667.1	.	.	.	.	.	.	.	.	.	.	G	35	5.449579	0.96205	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535611;ENST00000535790	.	.	.	5.6	1.96	0.26148	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	-15.9113	10.4738	0.44652	0.8036:0.0:0.1964:0.0	.	.	.	.	X	477;516;477;347;470	.	ENSP00000359892:C477X	C	-	3	2	SLC44A5	75456861	1.000000	0.71417	0.887000	0.34795	0.314000	0.28054	2.844000	0.48246	0.481000	0.27557	-0.294000	0.09567	TGC		0.438	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697		19	123	1	0	1.01871e-10	0.008871	1.34864e-10	19	123				
FNBP1L	54874	broad.mit.edu	37	1	94014886	94014886	+	Silent	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:94014886C>T	ENST00000271234.7	+	15	1705	c.1554C>T	c.(1552-1554)ccC>ccT	p.P518P	FNBP1L_ENST00000370253.2_Silent_p.P460P|FNBP1L_ENST00000370256.4_Silent_p.P513P|FNBP1L_ENST00000604705.1_Silent_p.P518P|FNBP1L_ENST00000260506.8_Silent_p.P460P	NM_001164473.2	NP_001157945.1	Q5T0N5	FBP1L_HUMAN	formin binding protein 1-like	518	Interaction with CDC42.				autophagy (GO:0006914)|clathrin-mediated endocytosis (GO:0072583)|membrane budding (GO:0006900)|membrane invagination (GO:0010324)|membrane tubulation (GO:0097320)|positive regulation of filopodium assembly (GO:0051491)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|urinary_tract(1)	11		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)		GTGGGCCACCCCAGCAGCATG	0.418																																							uc001dpw.2		NA																	0					0						c.(1378-1380)CCC>CCT		formin binding protein 1-like isoform 1							110.0	114.0	113.0					1																	94014886		2017	4199	6216	SO:0001819	synonymous_variant	54874				endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	lipid binding	g.chr1:94014886C>T		CCDS53343.1, CCDS53344.1, CCDS60192.1	1p22.1	2008-02-05	2004-11-16	2004-11-17	ENSG00000137942	ENSG00000137942			20851	protein-coding gene	gene with protein product		608848	"""chromosome 1 open reading frame 39"""	C1orf39		14654988	Standard	NM_017737		Approved	TOCA1, FLJ20275	uc010otk.2	Q5T0N5	OTTHUMG00000010863	ENST00000271234.7:c.1554C>T	1.37:g.94014886C>T						FNBP1L_uc001dpv.2_Silent_p.P460P|FNBP1L_uc010otk.1_Silent_p.P338P|FNBP1L_uc010otl.1_Silent_p.P88P	p.P460P	NM_001024948	NP_001020119	Q5T0N5	FBP1L_HUMAN		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)	13	1380	+		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)	518			Interaction with CDC42.		J3QSS4|Q5T0N6|Q6B097|Q6P653|Q6R4Q4|Q9NXG1	Silent	SNP	ENST00000271234.7	37	c.1380C>T	CCDS53343.1																																																																																				0.418	FNBP1L-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_017737		14	30	0	0	0	0.006122	0	14	30				
MAGI3	260425	broad.mit.edu	37	1	114189171	114189171	+	Missense_Mutation	SNP	A	A	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:114189171A>G	ENST00000307546.9	+	12	2137	c.2062A>G	c.(2062-2064)Atg>Gtg	p.M688V	MAGI3_ENST00000369617.4_Missense_Mutation_p.M713V|MAGI3_ENST00000369611.4_Missense_Mutation_p.M688V|MAGI3_ENST00000369615.1_Missense_Mutation_p.M688V	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	713					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCTCAGCCTATGCCTTTTCC	0.373																																							uc001edk.2		NA																	0				lung(3)|ovary(2)|central_nervous_system(1)	6						c.(2062-2064)ATG>GTG		membrane-associated guanylate kinase-related  3							114.0	114.0	114.0					1																	114189171		2203	4300	6503	SO:0001583	missense	260425				apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding	g.chr1:114189171A>G	AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.2062A>G	1.37:g.114189171A>G	ENSP00000304604:p.Met688Val					MAGI3_uc001edh.3_Missense_Mutation_p.M713V|MAGI3_uc001edi.3_Missense_Mutation_p.M688V|MAGI3_uc010owm.1_Missense_Mutation_p.M713V|MAGI3_uc001edj.2_Missense_Mutation_p.M409V	p.M688V	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)	12	2243	+	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)	713					Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Missense_Mutation	SNP	ENST00000307546.9	37	c.2062A>G	CCDS44196.1	.	.	.	.	.	.	.	.	.	.	A	6.522	0.464581	0.12402	.	.	ENSG00000081026	ENST00000369617;ENST00000307546;ENST00000369615;ENST00000369611	T;T;T;T	0.14266	2.72;2.52;2.71;2.71	5.25	2.81	0.32909	.	0.185070	0.51477	D	0.000091	T	0.03477	0.0100	L	0.41236	1.265	0.29576	N	0.84953	B;B;B	0.29988	0.264;0.037;0.002	B;B;B	0.29785	0.107;0.021;0.007	T	0.42032	-0.9475	10	0.29301	T	0.29	-28.4385	7.3923	0.26917	0.581:0.2832:0.0:0.1357	.	688;688;713	Q5TCQ9-4;Q5TCQ9-3;Q5TCQ9-2	.;.;.	V	713;688;688;688	ENSP00000358630:M713V;ENSP00000304604:M688V;ENSP00000358628:M688V;ENSP00000358624:M688V	ENSP00000304604:M688V	M	+	1	0	MAGI3	113990694	0.996000	0.38824	0.998000	0.56505	0.617000	0.37484	1.915000	0.39976	0.271000	0.22005	0.379000	0.24179	ATG		0.373	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000032429.1	NM_152900		34	53	0	0	0	0.007835	0	34	53				
FLG	2312	broad.mit.edu	37	1	152280910	152280910	+	Missense_Mutation	SNP	C	C	T	rs146106776		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:152280910C>T	ENST00000368799.1	-	3	6487	c.6452G>A	c.(6451-6453)gGg>gAg	p.G2151E	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2151	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGGTGGGACCCCTGTCTTCC	0.582									Ichthyosis																														uc001ezu.1		NA																	0				ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16						c.(6451-6453)GGG>GAG		filaggrin							392.0	322.0	346.0					1																	152280910		2203	4300	6503	SO:0001583	missense	2312	Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity	g.chr1:152280910C>T	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6452G>A	1.37:g.152280910C>T	ENSP00000357789:p.Gly2151Glu						p.G2151E	NM_002016	NP_002007	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	6488	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		2151			Ser-rich.		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	c.6452G>A	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	c	6.442	0.449690	0.12223	.	.	ENSG00000143631	ENST00000368799	T	0.00824	5.65	3.02	-4.81	0.03180	.	.	.	.	.	T	0.00271	0.0008	M	0.62154	1.92	0.09310	N	1	B	0.30281	0.275	B	0.20767	0.031	T	0.49908	-0.8889	9	0.02654	T	1	.	4.9068	0.13802	0.0:0.2384:0.1676:0.594	.	2151	P20930	FILA_HUMAN	E	2151	ENSP00000357789:G2151E	ENSP00000357789:G2151E	G	-	2	0	FLG	150547534	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.004000	0.01461	-0.905000	0.03871	0.485000	0.47835	GGG		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016		293	186	0	0	0	0.00361	0	293	186				
PKLR	5313	broad.mit.edu	37	1	155271116	155271116	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:155271116G>T	ENST00000342741.4	-	1	109	c.71C>A	c.(70-72)gCa>gAa	p.A24E	PKLR_ENST00000392414.3_5'Flank	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	24					ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	GATGGACTTTGCTAAGTCTCT	0.537																																							uc001fkb.3		NA																	0				skin(4)|ovary(1)	5						c.(70-72)GCA>GAA		pyruvate kinase, liver and RBC isoform 1	Pyruvic acid(DB00119)						119.0	111.0	114.0					1																	155271116		2203	4300	6503	SO:0001583	missense	5313				endocrine pancreas development|energy reserve metabolic process|glycolysis|positive regulation of cellular metabolic process	cytosol	ATP binding|magnesium ion binding|potassium ion binding|pyruvate kinase activity	g.chr1:155271116G>T	BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.71C>A	1.37:g.155271116G>T	ENSP00000339933:p.Ala24Glu					RAG1AP1_uc010pey.1_Intron|PKLR_uc001fka.3_5'Flank|PKLR_uc010pga.1_5'Flank	p.A24E	NM_000298	NP_000289	P30613	KPYR_HUMAN	Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		1	110	-	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		24					O75758|P11973	Missense_Mutation	SNP	ENST00000342741.4	37	c.71C>A	CCDS1109.1	.	.	.	.	.	.	.	.	.	.	G	17.73	3.460960	0.63513	.	.	ENSG00000143627	ENST00000423816;ENST00000342741	D	0.99719	-6.52	4.74	1.85	0.25348	.	0.659340	0.13371	N	0.392903	D	0.96411	0.8829	N	0.22421	0.69	0.09310	N	1	B	0.23058	0.079	B	0.20955	0.032	D	0.98962	1.0798	10	0.59425	D	0.04	-0.8637	6.3679	0.21465	0.3041:0.0:0.6959:0.0	.	24	P30613	KPYR_HUMAN	E	24	ENSP00000339933:A24E	ENSP00000339933:A24E	A	-	2	0	PKLR	153537740	0.001000	0.12720	0.003000	0.11579	0.837000	0.47467	0.726000	0.25984	0.713000	0.32060	0.462000	0.41574	GCA		0.537	PKLR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000087407.2	NM_000298		67	36	1	0	6.20995e-33	0.00361	1.04849e-32	67	36				
SPTA1	6708	broad.mit.edu	37	1	158653173	158653173	+	Silent	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:158653173G>A	ENST00000368147.4	-	3	558	c.378C>T	c.(376-378)caC>caT	p.H126H		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	126				Missing (in Ref. 3; AAA60575). {ECO:0000305}.	actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCGTTTCTTCGTGGGCAGAAT	0.383																																							uc001fst.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(376-378)CAC>CAT		spectrin, alpha, erythrocytic 1							214.0	189.0	197.0					1																	158653173		1835	4092	5927	SO:0001819	synonymous_variant	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158653173G>A	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.378C>T	1.37:g.158653173G>A							p.H126H	NM_003126	NP_003117	P02549	SPTA1_HUMAN			3	577	-	all_hematologic(112;0.0378)		126	Missing (in Ref. 3; AAA60575).		Spectrin 2.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	c.378C>T	CCDS41423.1																																																																																				0.383	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		80	50	0	0	0	0.00361	0	80	50				
IGSF8	93185	broad.mit.edu	37	1	160061724	160061724	+	Silent	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:160061724C>T	ENST00000368086.1	-	6	1947	c.1731G>A	c.(1729-1731)ctG>ctA	p.L577L	IGSF8_ENST00000460351.1_5'Flank|IGSF8_ENST00000314485.7_Silent_p.L577L			Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	577					cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|nervous system development (GO:0007399)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(19)|pancreas(1)|prostate(1)|skin(1)	33	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			ATAGGGTGTCCAGGGCTGGGG	0.562																																							uc001fva.2		NA																	0					0						c.(1729-1731)CTG>CTA		immunoglobulin superfamily, member 8							79.0	68.0	71.0					1																	160061724		2203	4300	6503	SO:0001819	synonymous_variant	93185				cell proliferation|cellular component movement|nervous system development|single fertilization|skeletal muscle tissue development	integral to membrane	protein binding	g.chr1:160061724C>T	AF407274	CCDS1195.1	1q23.1	2013-01-11			ENSG00000162729	ENSG00000162729		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17813	protein-coding gene	gene with protein product		606644				11504738, 11673522	Standard	NM_001206665		Approved	CD81P3, EWI2, PGRL, CD316	uc009wtf.3	Q969P0	OTTHUMG00000024075	ENST00000368086.1:c.1731G>A	1.37:g.160061724C>T						IGSF8_uc001fuz.2_Silent_p.L577L|IGSF8_uc009wtf.2_Silent_p.L577L	p.L577L	NM_052868	NP_443100	Q969P0	IGSF8_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)		6	1776	-	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		577			Extracellular (Potential).		Q8NG09|Q96DP4|Q9BTG9	Silent	SNP	ENST00000368086.1	37	c.1731G>A	CCDS1195.1																																																																																				0.562	IGSF8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060636.1	NM_052868		29	25	0	0	0	0.00632	0	29	25				
CASQ1	844	broad.mit.edu	37	1	160171074	160171074	+	Silent	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:160171074C>T	ENST00000368078.3	+	11	1295	c.1099C>T	c.(1099-1101)Ctg>Ttg	p.L367L	CASQ1_ENST00000368079.3_Silent_p.L361L|RP11-536C5.7_ENST00000418602.1_RNA|CASQ1_ENST00000467691.1_Silent_p.L88L			P31415	CASQ1_HUMAN	calsequestrin 1 (fast-twitch, skeletal muscle)	367	Asp-rich.				endoplasmic reticulum organization (GO:0007029)|ion transmembrane transport (GO:0034220)|protein polymerization (GO:0051258)|regulation of sequestering of calcium ion (GO:0051282)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to heat (GO:0009408)|response to organic substance (GO:0010033)|sarcomere organization (GO:0045214)|skeletal muscle tissue development (GO:0007519)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna lumen (GO:0014804)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	21	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGAGGAGGACCTGCCTTCTGC	0.547																																							uc010pja.1		NA																	0				central_nervous_system(1)	1						c.(1099-1101)CTG>TTG		calsequestrin 1							208.0	149.0	169.0					1																	160171074		2203	4300	6503	SO:0001819	synonymous_variant	844					mitochondrial matrix|sarcoplasmic reticulum lumen|smooth endoplasmic reticulum	calcium ion binding	g.chr1:160171074C>T	S73775	CCDS1198.1, CCDS1198.2	1q21	2011-10-19			ENSG00000143318	ENSG00000143318		"""Protein disulfide isomerases"""	1512	protein-coding gene	gene with protein product	"""calsequestrin 1, fast-twitch, skeletal muscle"", ""calmitine"""	114250		CASQ		8406504, 2321095	Standard	NM_001231		Approved	PDIB1	uc010pja.2	P31415	OTTHUMG00000031607	ENST00000368078.3:c.1099C>T	1.37:g.160171074C>T							p.L367L	NM_001231	NP_001222	P31415	CASQ1_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)		11	1356	+	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		367			Asp-rich.		B1AKZ2|B2R863|Q8TBW7	Silent	SNP	ENST00000368078.3	37	c.1099C>T	CCDS1198.2																																																																																				0.547	CASQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077412.1	NM_001231		14	9	0	0	0	0.003163	0	14	9				
F11R	50848	broad.mit.edu	37	1	160969998	160969998	+	Missense_Mutation	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:160969998G>A	ENST00000368026.6	-	5	803	c.529C>T	c.(529-531)Ccc>Tcc	p.P177S	F11R_ENST00000472573.1_5'UTR|F11R_ENST00000289779.3_3'UTR|F11R_ENST00000537746.1_Missense_Mutation_p.P128S	NM_016946.4	NP_058642.1	Q9Y624	JAM1_HUMAN	F11 receptor	177	Ig-like V-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|leukocyte migration (GO:0050900)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)	12	all_cancers(52;6.73e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00207)			GTGCTTTTGGGATTCGTAGGC	0.517																																							uc009wtt.2		NA																	0				ovary(2)	2						c.(529-531)CCC>TCC		F11 receptor precursor							150.0	139.0	143.0					1																	160969998		2203	4300	6503	SO:0001583	missense	50848				blood coagulation|inflammatory response|interspecies interaction between organisms|leukocyte migration|tight junction assembly	integral to membrane|tight junction		g.chr1:160969998G>A	AF111713	CCDS1213.1	1q21.2-q21.3	2013-01-29	2003-02-07	2003-02-14	ENSG00000158769	ENSG00000158769		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14685	protein-coding gene	gene with protein product		605721	"""junctional adhesion molecule 1"""	JAM1		10395639, 7646439	Standard	NM_016946		Approved	PAM-1, JCAM, JAM-1, JAM-A, JAMA, CD321	uc009wtt.3	Q9Y624	OTTHUMG00000028602	ENST00000368026.6:c.529C>T	1.37:g.160969998G>A	ENSP00000357005:p.Pro177Ser					F11R_uc010pjv.1_Missense_Mutation_p.P128S|F11R_uc001fxe.3_Missense_Mutation_p.P177S|F11R_uc009wtu.2_Missense_Mutation_p.P177S|F11R_uc010pjw.1_Missense_Mutation_p.P181S|F11R_uc001fxf.3_Missense_Mutation_p.P177S	p.P177S	NM_016946	NP_058642	Q9Y624	JAM1_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00207)		5	799	-	all_cancers(52;6.73e-18)|all_hematologic(112;0.093)		177			Ig-like V-type 2.|Extracellular (Potential).		B7Z941	Missense_Mutation	SNP	ENST00000368026.6	37	c.529C>T	CCDS1213.1	.	.	.	.	.	.	.	.	.	.	G	13.25	2.180367	0.38511	.	.	ENSG00000158769	ENST00000368026;ENST00000335772;ENST00000289779;ENST00000537746;ENST00000436182	T;T;T	0.12255	2.7;2.7;2.7	5.16	4.2	0.49525	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.057014	0.64402	D	0.000001	T	0.10680	0.0261	L	0.39633	1.23	0.42590	D	0.993246	B;P;P;P;P	0.45396	0.29;0.857;0.803;0.803;0.453	B;P;P;P;B	0.51324	0.178;0.666;0.529;0.529;0.238	T	0.04413	-1.0953	10	0.38643	T	0.18	.	13.0494	0.58946	0.0:0.2181:0.7819:0.0	.	181;128;177;177;177	B7Z5W1;B7Z941;Q6FIB4;Q9Y624;D3DVF0	.;.;.;JAM1_HUMAN;.	S	177;177;177;128;181	ENSP00000357005:P177S;ENSP00000440812:P128S;ENSP00000394809:P181S	ENSP00000289779:P177S	P	-	1	0	F11R	159236622	0.998000	0.40836	0.824000	0.32777	0.012000	0.07955	3.100000	0.50275	1.240000	0.43803	0.563000	0.77884	CCC		0.517	F11R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071458.3	NM_016946		38	84	0	0	0	0.004289	0	38	84				
DCAF6	55827	broad.mit.edu	37	1	168032861	168032861	+	Missense_Mutation	SNP	G	G	T	rs370231009		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:168032861G>T	ENST00000312263.6	+	15	2234	c.2030G>T	c.(2029-2031)cGc>cTc	p.R677L	DCAF6_ENST00000432587.2_Missense_Mutation_p.R737L|DCAF6_ENST00000367843.3_Missense_Mutation_p.R697L|DCAF6_ENST00000367840.3_Missense_Mutation_p.R768L	NM_001017977.2	NP_001017977.1	Q58WW2	DCAF6_HUMAN	DDB1 and CUL4 associated factor 6	677	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	36						TCATATAGACGCTCTGCTGTT	0.299																																							uc001gew.2		NA																	0				ovary(1)|central_nervous_system(1)|skin(1)	3						c.(2029-2031)CGC>CTC		IQ motif and WD repeats 1 isoform b							26.0	25.0	25.0					1																	168032861		2201	4297	6498	SO:0001583	missense	55827				positive regulation of transcription from RNA polymerase II promoter	CUL4 RING ubiquitin ligase complex|nucleus	ligand-dependent nuclear receptor transcription coactivator activity	g.chr1:168032861G>T	AL136738	CCDS1267.2, CCDS30933.1, CCDS55657.1, CCDS55658.1	1q23.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000143164	ENSG00000143164		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30002	protein-coding gene	gene with protein product		610494	"""IQ motif and WD repeats 1"""	IQWD1		12032826	Standard	NM_018442		Approved	PC326	uc001gex.3	Q58WW2	OTTHUMG00000034572	ENST00000312263.6:c.2030G>T	1.37:g.168032861G>T	ENSP00000311949:p.Arg677Leu					DCAF6_uc001gev.2_Missense_Mutation_p.R697L|DCAF6_uc001gex.2_Missense_Mutation_p.R768L|DCAF6_uc010plk.1_Missense_Mutation_p.R737L|DCAF6_uc001gey.2_Missense_Mutation_p.R550L|DCAF6_uc001gez.2_5'UTR	p.R677L	NM_001017977	NP_001017977	Q58WW2	DCAF6_HUMAN			15	2272	+			677			IQ.		A2A295|B4DNB8|Q7L8I0|Q8IXH3|Q8TB19	Missense_Mutation	SNP	ENST00000312263.6	37	c.2030G>T	CCDS30933.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.040318	0.93630	.	.	ENSG00000143164	ENST00000367843;ENST00000432587;ENST00000312263;ENST00000367840	D;T;D;D	0.84146	-1.59;0.03;-1.6;-1.81	5.63	5.63	0.86233	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.85106	0.5621	N	0.24115	0.695	0.54753	D	0.999984	D;D;D;D	0.76494	0.995;0.999;0.998;0.999	D;D;D;D	0.77004	0.952;0.971;0.954;0.989	D	0.84012	0.0349	9	0.33940	T	0.23	.	19.6926	0.96008	0.0:0.0:1.0:0.0	.	737;768;677;697	B4DNB8;Q58WW2-3;Q58WW2;Q58WW2-2	.;.;DCAF6_HUMAN;.	L	697;737;677;768	ENSP00000356817:R697L;ENSP00000396238:R737L;ENSP00000311949:R677L;ENSP00000356814:R768L	ENSP00000311949:R677L	R	+	2	0	DCAF6	166299485	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.470000	0.80973	2.676000	0.91093	0.555000	0.69702	CGC		0.299	DCAF6-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083661.2	NM_018442		6	9	1	0	5.9392e-07	0.001168	7.2452e-07	6	9				
KIFAP3	22920	broad.mit.edu	37	1	170015993	170015993	+	Missense_Mutation	SNP	C	C	A	rs200386148		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:170015993C>A	ENST00000361580.2	-	3	406	c.179G>T	c.(178-180)aGt>aTt	p.S60I	KIFAP3_ENST00000367765.1_Missense_Mutation_p.S20I|KIFAP3_ENST00000490550.1_5'UTR|KIFAP3_ENST00000538366.1_5'UTR|KIFAP3_ENST00000367767.1_Missense_Mutation_p.S16I	NM_014970.3	NP_055785.2	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	60					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|membrane organization (GO:0061024)|microtubule-based movement (GO:0007018)|microtubule-based process (GO:0007017)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of calcium-dependent cell-cell adhesion (GO:0046587)|protein complex assembly (GO:0006461)|protein localization (GO:0008104)|signal transduction (GO:0007165)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule cytoskeleton (GO:0015630)	kinesin binding (GO:0019894)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|prostate(2)|skin(3)|urinary_tract(2)	35	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GGCATTGAGACTCTTAAGTCG	0.313																																							uc001ggv.2		NA																	0				skin(1)	1						c.(178-180)AGT>ATT		kinesin-associated protein 3							105.0	92.0	96.0					1																	170015993		2203	4300	6503	SO:0001583	missense	22920				blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding	g.chr1:170015993C>A	U59919	CCDS1288.1, CCDS55659.1, CCDS55660.1, CCDS55661.1	1q24.2	2012-09-20			ENSG00000075945	ENSG00000075945			17060	protein-coding gene	gene with protein product	"""Smg GDS"""	601836				8900189	Standard	NM_014970		Approved	SMAP, KAP3, FLA3, KAP-1	uc001ggv.3	Q92845	OTTHUMG00000035947	ENST00000361580.2:c.179G>T	1.37:g.170015993C>A	ENSP00000354560:p.Ser60Ile					KIFAP3_uc010ply.1_5'UTR|KIFAP3_uc001ggw.1_Missense_Mutation_p.S16I	p.S60I	NM_014970	NP_055785	Q92845	KIFA3_HUMAN			3	450	-	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)		60					B1AKU4|B1AKU5|B2RDL1|B7Z8A3|F5H591|Q8NHU7|Q9H416	Missense_Mutation	SNP	ENST00000361580.2	37	c.179G>T	CCDS1288.1	.	.	.	.	.	.	.	.	.	.	C	32	5.180936	0.94846	.	.	ENSG00000075945	ENST00000361580;ENST00000367765;ENST00000367767	T;T;T	0.56941	0.43;0.43;0.43	5.78	5.78	0.91487	.	0.035605	0.85682	D	0.000000	T	0.66005	0.2746	M	0.71581	2.175	0.80722	D	1	D;D	0.65815	0.995;0.989	D;P	0.63283	0.913;0.773	T	0.62393	-0.6864	9	.	.	.	-12.7922	19.9704	0.97284	0.0:1.0:0.0:0.0	.	16;60	B1AKU5;Q92845	.;KIFA3_HUMAN	I	60;20;16	ENSP00000354560:S60I;ENSP00000356739:S20I;ENSP00000356741:S16I	.	S	-	2	0	KIFAP3	168282617	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.445000	0.80570	2.894000	0.99253	0.591000	0.81541	AGT		0.313	KIFAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087568.1	NM_014970		42	26	1	0	6.1244e-12	0.007835	8.29643e-12	42	26				
MYOC	4653	broad.mit.edu	37	1	171621320	171621320	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:171621320G>T	ENST00000037502.6	-	1	503	c.432C>A	c.(430-432)aaC>aaA	p.N144K		NM_000261.1	NP_000252.1	Q99972	MYOC_HUMAN	myocilin, trabecular meshwork inducible glucocorticoid response	144					bone development (GO:0060348)|clustering of voltage-gated sodium channels (GO:0045162)|ERBB2-ERBB3 signaling pathway (GO:0038133)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neuron projection development (GO:0031175)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of MAPK cascade (GO:0043408)|skeletal muscle hypertrophy (GO:0014734)	cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|node of Ranvier (GO:0033268)|proteinaceous extracellular matrix (GO:0005578)	fibronectin binding (GO:0001968)|frizzled binding (GO:0005109)|myosin light chain binding (GO:0032027)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(1)|urinary_tract(2)	28	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					CTCGGAGGAGGTTGCTGTAGG	0.582																																							uc001ghu.2		NA																	0				lung(1)	1						c.(430-432)AAC>AAA		myocilin precursor							120.0	129.0	126.0					1																	171621320		2203	4300	6503	SO:0001583	missense	4653				anatomical structure morphogenesis	cilium|extracellular space|rough endoplasmic reticulum	structural molecule activity	g.chr1:171621320G>T	BC029261	CCDS1297.1	1q23-q24	2008-02-05			ENSG00000034971	ENSG00000034971			7610	protein-coding gene	gene with protein product		601652		GLC1A		9169133, 9005853	Standard	NM_000261		Approved	TIGR, JOAG1	uc001ghu.3	Q99972	OTTHUMG00000034789	ENST00000037502.6:c.432C>A	1.37:g.171621320G>T	ENSP00000037502:p.Asn144Lys					MYOC_uc010pmk.1_Missense_Mutation_p.N86K	p.N144K	NM_000261	NP_000252	Q99972	MYOC_HUMAN			1	454	-	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)		144			Potential.		B2RD84|O00620|Q7Z6Q9	Missense_Mutation	SNP	ENST00000037502.6	37	c.432C>A	CCDS1297.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.97|12.97	2.098225|2.098225	0.37048|0.37048	.|.	.|.	ENSG00000034971|ENSG00000034971	ENST00000037502;ENST00000536591;ENST00000537133|ENST00000357746	D|.	0.82167|.	-1.58|.	5.77|5.77	1.58|1.58	0.23477|0.23477	.|.	0.382224|.	0.32258|.	N|.	0.006346|.	T|T	0.21227|0.21227	0.0511|0.0511	M|M	0.70595|0.70595	2.14|2.14	0.27737|0.27737	N|N	0.944625|0.944625	B;B|.	0.32781|.	0.146;0.384|.	B;B|.	0.24269|.	0.038;0.052|.	T|T	0.31364|0.31364	-0.9946|-0.9946	10|6	0.56958|0.15952	D|T	0.05|0.53	.|.	4.9366|4.9366	0.13944|0.13944	0.2646:0.194:0.5414:0.0|0.2646:0.194:0.5414:0.0	.|.	86;144|.	B4DV44;Q99972|.	.;MYOC_HUMAN|.	K|R	144;77;144|97	ENSP00000037502:N144K|.	ENSP00000037502:N144K|ENSP00000350381:S97R	N|S	-|-	3|3	2|2	MYOC|MYOC	169887943|169887943	0.391000|0.391000	0.25221|0.25221	0.930000|0.930000	0.37139|0.37139	0.895000|0.895000	0.52256|0.52256	0.199000|0.199000	0.17237|0.17237	0.270000|0.270000	0.21984|0.21984	0.655000|0.655000	0.94253|0.94253	AAC|AGC		0.582	MYOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084178.2	NM_000261		33	139	1	0	3.80469e-20	0.001786	5.71931e-20	33	139				
PAPPA2	60676	broad.mit.edu	37	1	176664879	176664879	+	Nonsense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:176664879C>A	ENST00000367662.3	+	7	3794	c.2630C>A	c.(2629-2631)tCa>tAa	p.S877*		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	877					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CCCAGGGCCTCAGGCAGCTTG	0.537																																							uc001gkz.2		NA																	0				ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						c.(2629-2631)TCA>TAA		pappalysin 2 isoform 1							97.0	98.0	97.0					1																	176664879		2040	4219	6259	SO:0001587	stop_gained	60676				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding	g.chr1:176664879C>A	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2630C>A	1.37:g.176664879C>A	ENSP00000356634:p.Ser877*					PAPPA2_uc009www.2_RNA	p.S877*	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN			7	3794	+			877					A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Nonsense_Mutation	SNP	ENST00000367662.3	37	c.2630C>A	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	C	48	14.490675	0.99798	.	.	ENSG00000116183	ENST00000367662	.	.	.	5.51	2.67	0.31697	.	0.713984	0.14544	N	0.313067	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	-0.0446	9.814	0.40840	0.0:0.7151:0.0:0.2849	.	.	.	.	X	877	.	ENSP00000356634:S877X	S	+	2	0	PAPPA2	174931502	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	0.608000	0.24223	0.310000	0.22990	-0.253000	0.11424	TCA		0.537	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1			88	53	1	0	9.45097e-43	0.00361	1.68097e-42	88	53				
ASPM	259266	broad.mit.edu	37	1	197101446	197101446	+	Missense_Mutation	SNP	T	T	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:197101446T>C	ENST00000367409.4	-	7	2712	c.2456A>G	c.(2455-2457)tAc>tGc	p.Y819C	ASPM_ENST00000294732.7_Missense_Mutation_p.Y819C|ASPM_ENST00000367408.1_Missense_Mutation_p.Y69C	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	819					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						CAAAGGATTGTAGGACAACAG	0.308																																							uc001gtu.2		NA																	0				ovary(4)|central_nervous_system(2)	6						c.(2455-2457)TAC>TGC		asp (abnormal spindle)-like, microcephaly							69.0	63.0	65.0					1																	197101446		2203	4300	6503	SO:0001583	missense	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197101446T>C	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.2456A>G	1.37:g.197101446T>C	ENSP00000356379:p.Tyr819Cys					ASPM_uc001gtv.2_Missense_Mutation_p.Y819C|ASPM_uc001gtw.3_Intron	p.Y819C	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN			7	2713	-			819					Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	c.2456A>G	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	T	19.30	3.800758	0.70567	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408	T;T;T	0.59638	0.25;0.25;0.25	5.38	5.38	0.77491	Calponin homology domain (1);	0.089327	0.48286	D	0.000183	T	0.74779	0.3761	M	0.79258	2.445	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.80764	0.988;0.994	T	0.78237	-0.2282	10	0.87932	D	0	.	12.0098	0.53280	0.1292:0.0:0.0:0.8708	.	819;819	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	C	819;819;69	ENSP00000356379:Y819C;ENSP00000294732:Y819C;ENSP00000356378:Y69C	ENSP00000294732:Y819C	Y	-	2	0	ASPM	195368069	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	5.803000	0.69129	2.176000	0.68965	0.477000	0.44152	TAC		0.308	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		22	45	0	0	0	0.005443	0	22	45				
KDM5B	10765	broad.mit.edu	37	1	202733256	202733256	+	Missense_Mutation	SNP	T	T	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:202733256T>C	ENST00000367265.3	-	6	1893	c.729A>G	c.(727-729)atA>atG	p.I243M	KDM5B_ENST00000367264.2_Missense_Mutation_p.I279M	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	243					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						CCTCGGGTTCTATTTTAATAT	0.333																																							uc001gyf.2		NA																	0				ovary(2)|breast(2)|urinary_tract(1)	5						c.(727-729)ATA>ATG		jumonji, AT rich interactive domain 1B							88.0	80.0	83.0					1																	202733256		2203	4300	6503	SO:0001583	missense	10765				negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding	g.chr1:202733256T>C	AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.729A>G	1.37:g.202733256T>C	ENSP00000356234:p.Ile243Met					KDM5B_uc009xag.2_Missense_Mutation_p.I279M|KDM5B_uc001gyg.1_Missense_Mutation_p.I85M	p.I243M	NM_006618	NP_006609	Q9UGL1	KDM5B_HUMAN			6	845	-			243					O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	ENST00000367265.3	37	c.729A>G	CCDS30974.1	.	.	.	.	.	.	.	.	.	.	T	12.64	1.997728	0.35226	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	D;T;D	0.85484	-1.91;2.27;-1.99	5.42	-3.24	0.05094	.	0.200763	0.50627	D	0.000109	T	0.71341	0.3328	N	0.22421	0.69	0.26716	N	0.970875	P;B	0.42993	0.797;0.04	B;B	0.44315	0.446;0.141	T	0.66436	-0.5924	10	0.48119	T	0.1	-13.4415	4.278	0.10818	0.6009:0.1773:0.0884:0.1334	.	279;243	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	M	243;85;279;85	ENSP00000356234:I243M;ENSP00000356233:I279M;ENSP00000235790:I85M	ENSP00000235790:I85M	I	-	3	3	KDM5B	200999879	0.383000	0.25156	0.951000	0.38953	0.934000	0.57294	-0.792000	0.04594	-0.512000	0.06505	0.533000	0.62120	ATA		0.333	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	NM_006618		10	55	0	0	0	0.000978	0	10	55				
USH2A	7399	broad.mit.edu	37	1	216062172	216062172	+	Nonsense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:216062172C>A	ENST00000307340.3	-	41	8205	c.7819G>T	c.(7819-7821)Gga>Tga	p.G2607*	RP5-1111A8.3_ENST00000414995.1_RNA|USH2A_ENST00000366943.2_Nonsense_Mutation_p.G2607*	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2607	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGGGAACATCCTTTTGAAGTG	0.473										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(7819-7821)GGA>TGA		usherin isoform B							108.0	103.0	105.0					1																	216062172		2203	4300	6503	SO:0001587	stop_gained	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216062172C>A	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7819G>T	1.37:g.216062172C>A	ENSP00000305941:p.Gly2607*	HNSCC(13;0.011)					p.G2607*	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	41	8206	-			2607			Fibronectin type-III 12.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Nonsense_Mutation	SNP	ENST00000307340.3	37	c.7819G>T	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	52	19.780274	0.99923	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	.	.	.	5.84	5.84	0.93424	.	0.000000	0.42682	D	0.000662	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.1551	0.98106	0.0:1.0:0.0:0.0	.	.	.	.	X	2607	.	ENSP00000305941:G2607X	G	-	1	0	USH2A	214128795	1.000000	0.71417	0.921000	0.36526	0.979000	0.70002	7.238000	0.78173	2.760000	0.94817	0.655000	0.94253	GGA		0.473	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		62	37	1	0	5.19286e-32	0.00361	8.70458e-32	62	37				
LEFTY1	10637	broad.mit.edu	37	1	226074602	226074602	+	Missense_Mutation	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:226074602G>A	ENST00000272134.5	-	4	1005	c.926C>T	c.(925-927)cCg>cTg	p.P309L	LEFTY1_ENST00000492457.1_5'Flank|RP4-559A3.7_ENST00000432920.2_3'UTR	NM_020997.3	NP_066277.1	O75610	LFTY1_HUMAN	left-right determination factor 1	309					cell growth (GO:0016049)|determination of left/right symmetry (GO:0007368)|heart morphogenesis (GO:0003007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)				cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	10	Breast(184;0.197)					CCCCAGAAACGGCCACTTGAA	0.667																																							uc001hpo.2		NA																	0					0						c.(925-927)CCG>CTG		left-right determination, factor B							24.0	25.0	25.0					1																	226074602		2203	4300	6503	SO:0001583	missense	10637				cell growth|multicellular organismal development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity|transforming growth factor beta receptor binding	g.chr1:226074602G>A	AF081507	CCDS1548.1	1q42.1	2008-02-05	2004-11-17	2004-11-17	ENSG00000243709	ENSG00000243709			6552	protein-coding gene	gene with protein product		603037	"""left-right determination, factor B"""	LEFTB		10053005, 10886363	Standard	NM_020997		Approved	LEFTYB	uc001hpo.3	O75610	OTTHUMG00000037443	ENST00000272134.5:c.926C>T	1.37:g.226074602G>A	ENSP00000272134:p.Pro309Leu					LEFTY1_uc010pvj.1_3'UTR	p.P309L	NM_020997	NP_066277	O75610	LFTY1_HUMAN			4	996	-	Breast(184;0.197)		309					B2R7U0|Q53H67|Q5TE94	Missense_Mutation	SNP	ENST00000272134.5	37	c.926C>T	CCDS1548.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.950921	0.53186	.	.	ENSG00000243709	ENST00000272134	T	0.69306	-0.39	4.14	3.21	0.36854	Transforming growth factor-beta, C-terminal (2);	0.310440	0.28409	N	0.015448	T	0.78578	0.4305	M	0.74881	2.28	0.36536	D	0.871001	D	0.89917	1.0	D	0.87578	0.998	T	0.81217	-0.1033	10	0.52906	T	0.07	.	9.7922	0.40713	0.1:0.0:0.9:0.0	.	309	O75610	LFTY1_HUMAN	L	309	ENSP00000272134:P309L	ENSP00000272134:P309L	P	-	2	0	LEFTY1	224141225	0.990000	0.36364	0.911000	0.35937	0.734000	0.41952	2.022000	0.41030	0.740000	0.32651	0.313000	0.20887	CCG		0.667	LEFTY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091155.1	NM_020997		4	35	0	0	0	0.000248	0	4	35				
PCNXL2	80003	broad.mit.edu	37	1	233388166	233388166	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:233388166C>A	ENST00000258229.9	-	7	2296	c.2062G>T	c.(2062-2064)Ggg>Tgg	p.G688W	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	688						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				GTTTCAGGCCCACTGATGACT	0.388																																							uc001hvl.2		NA																	0				central_nervous_system(1)|pancreas(1)	2						c.(2062-2064)GGG>TGG		pecanex-like 2							131.0	123.0	126.0					1																	233388166		1906	4121	6027	SO:0001583	missense	80003					integral to membrane		g.chr1:233388166C>A	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.2062G>T	1.37:g.233388166C>A	ENSP00000258229:p.Gly688Trp					PCNXL2_uc009xfu.2_RNA|PCNXL2_uc009xfv.1_RNA|PCNXL2_uc001hvq.1_5'UTR	p.G688W	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN			7	2297	-		all_cancers(173;0.0347)|Prostate(94;0.137)	688					O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	37	c.2062G>T	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843611	0.71488	.	.	ENSG00000135749	ENST00000258229	T	0.39056	1.1	5.35	5.35	0.76521	.	.	.	.	.	T	0.55862	0.1947	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.59156	-0.7507	9	0.87932	D	0	.	19.4403	0.94817	0.0:1.0:0.0:0.0	.	688	A6NKB5	PCX2_HUMAN	W	688	ENSP00000258229:G688W	ENSP00000258229:G688W	G	-	1	0	PCNXL2	231454789	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.528000	0.60580	2.666000	0.90696	0.557000	0.71058	GGG		0.388	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801		16	81	1	0	1.99824e-07	0.00499	2.45047e-07	16	81				
OR2M5	127059	broad.mit.edu	37	1	248308515	248308515	+	Silent	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:248308515C>A	ENST00000366476.1	+	1	66	c.66C>A	c.(64-66)ccC>ccA	p.P22P		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	22						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			ATCACAGCCCCACCCACACCT	0.478																																							uc010pze.1		NA																	0				ovary(2)|kidney(1)	3						c.(64-66)CCC>CCA		olfactory receptor, family 2, subfamily M,							210.0	214.0	212.0					1																	248308515		2203	4300	6503	SO:0001819	synonymous_variant	127059				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248308515C>A		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.66C>A	1.37:g.248308515C>A							p.P22P	NM_001004690	NP_001004690	A3KFT3	OR2M5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0388)		1	66	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		22			Extracellular (Potential).			Silent	SNP	ENST00000366476.1	37	c.66C>A	CCDS31105.1																																																																																				0.478	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097343.1	NM_001004690		227	141	1	0	3.87791e-117	0.00361	7.00429e-117	227	141				
FAM208B	54906	broad.mit.edu	37	10	5790473	5790473	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr10:5790473G>T	ENST00000328090.5	+	15	5714	c.5089G>T	c.(5089-5091)Ggt>Tgt	p.G1697C		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1697																	GCTTAAGAATGGTGAGCCTGA	0.458																																							uc001iij.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(5089-5091)GGT>TGT		hypothetical protein LOC54906							54.0	56.0	55.0					10																	5790473		2129	4249	6378	SO:0001583	missense	54906							g.chr10:5790473G>T	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.5089G>T	10.37:g.5790473G>T	ENSP00000328426:p.Gly1697Cys					C10orf18_uc001iik.2_Missense_Mutation_p.G541C	p.G1697C	NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN			15	5714	+			1697					Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	37	c.5089G>T	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	G	11.94	1.789262	0.31685	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.04551	3.6	4.42	-1.5	0.08691	.	1.519390	0.03498	N	0.217580	T	0.03348	0.0097	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44267	-0.9339	10	0.56958	D	0.05	.	3.4135	0.07366	0.3875:0.0:0.3215:0.291	.	1697	Q5VWN6	F208B_HUMAN	C	1697;892	ENSP00000328426:G1697C	ENSP00000328426:G1697C	G	+	1	0	C10orf18	5830479	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.004000	0.12878	-0.175000	0.10725	-0.471000	0.05019	GGT		0.458	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782		25	37	1	0	7.87624e-14	0.00278	1.11222e-13	25	37				
LRRC37A6P	387646	broad.mit.edu	37	10	27538535	27538535	+	lincRNA	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr10:27538535G>T	ENST00000574842.1	+	0	255				LRRC37A6P_ENST00000284414.4_RNA																							CCTCCGTAGTGGGTTCTGGAG	0.498																																							uc001its.2		NA																	0					0						c.(856-858)CCC>CCA		SubName: Full=cDNA FLJ44924 fis, clone BRAMY3014555;							65.0	55.0	58.0					10																	27538535		692	1591	2283			387646							g.chr10:27538535G>T																													10.37:g.27538535G>T							p.P286P	NR_003525						1	2701	-									Silent	SNP	ENST00000574842.1	37	c.858C>A																																																																																					0.498	RP11-85G18.6-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000436904.1			90	132	1	0	9.24773e-40	0.00361	1.63236e-39	90	132				
ADAMTS14	140766	broad.mit.edu	37	10	72489080	72489080	+	Missense_Mutation	SNP	G	G	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr10:72489080G>C	ENST00000373207.1	+	5	901	c.901G>C	c.(901-903)Ggg>Cgg	p.G301R	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.G301R	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	301	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						TGAGTCCCTGGGGGTTCATAT	0.488																																							uc001jrh.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)	6						c.(901-903)GGG>CGG		ADAM metallopeptidase with thrombospondin type 1							111.0	105.0	107.0					10																	72489080		2203	4300	6503	SO:0001583	missense	140766				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr10:72489080G>C	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.901G>C	10.37:g.72489080G>C	ENSP00000362303:p.Gly301Arg					ADAMTS14_uc001jrg.2_Missense_Mutation_p.G301R|ADAMTS14_uc010qjl.1_RNA	p.G301R	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN			5	901	+			301			Peptidase M12B.		Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	37	c.901G>C	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.832181	0.71258	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	D;D	0.87650	-2.28;-2.28	5.18	5.18	0.71444	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.93239	0.7846	M	0.74467	2.265	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.92972	0.6398	10	0.51188	T	0.08	.	18.4746	0.90788	0.0:0.0:1.0:0.0	.	301;301	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	R	301	ENSP00000362304:G301R;ENSP00000362303:G301R	ENSP00000362303:G301R	G	+	1	0	ADAMTS14	72159086	1.000000	0.71417	0.998000	0.56505	0.253000	0.25986	9.263000	0.95617	2.688000	0.91661	0.655000	0.94253	GGG		0.488	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722		26	52	0	0	0	0.008361	0	26	52				
SLC29A3	55315	broad.mit.edu	37	10	73082704	73082704	+	Silent	SNP	C	C	T	rs377119158		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr10:73082704C>T	ENST00000373189.5	+	2	245	c.193C>T	c.(193-195)Cta>Tta	p.L65L	snoU13_ENST00000459444.1_RNA	NM_001174098.1|NM_018344.5	NP_001167569.1|NP_060814.4	Q9BZD2	S29A3_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 3	65					transmembrane transport (GO:0055085)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleoside transmembrane transporter activity (GO:0005337)			endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	15						CATTGGCAGTCTACTGCCATG	0.597																																					Esophageal Squamous(200;1319 2142 18949 31248 39672)	Esophageal Squamous(200;1319 2142 18949 31248 39672)	uc001jrr.3		NA																	0					0						c.(193-195)CTA>TTA		solute carrier family 29 (nucleoside		C	,	0,4406		0,0,2203	72.0	69.0	70.0		193,193	1.4	0.0	10		70	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SLC29A3	NM_001174098.1,NM_018344.5	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	65/259,65/476	73082704	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	55315				nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|late endosome membrane|lysosomal membrane	nucleoside transmembrane transporter activity	g.chr10:73082704C>T	AF326987	CCDS7310.1	10q22.2	2013-07-17	2013-07-17		ENSG00000198246	ENSG00000198246		"""Solute carriers"""	23096	protein-coding gene	gene with protein product		612373	"""solute carrier family 29 (nucleoside transporters), member 3"""			11396612	Standard	NM_018344		Approved	ENT3, FLJ11160	uc001jrr.4	Q9BZD2	OTTHUMG00000018424	ENST00000373189.5:c.193C>T	10.37:g.73082704C>T						SLC29A3_uc001jrs.3_Silent_p.L65L|SLC29A3_uc010qjq.1_5'UTR|SLC29A3_uc001jrt.3_5'UTR|SLC29A3_uc001jru.3_Intron	p.L65L	NM_018344	NP_060814	Q9BZD2	S29A3_HUMAN			2	250	+			65			Helical; (Potential).		B2RB50|B4E2Z9|B7ZA37|Q0VAM9|Q5T465|Q7RTT8|Q8IVZ0|Q9BWI2|Q9NUS9	Silent	SNP	ENST00000373189.5	37	c.193C>T	CCDS7310.1																																																																																				0.597	SLC29A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048544.1	NM_018344		5	78	0	0	0	0.001168	0	5	78				
PSAP	5660	broad.mit.edu	37	10	73587857	73587857	+	Missense_Mutation	SNP	C	C	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr10:73587857C>G	ENST00000394936.3	-	6	781	c.634G>C	c.(634-636)Gta>Cta	p.V212L	PSAP_ENST00000394934.1_Missense_Mutation_p.V212L			P07602	SAP_HUMAN	prosaposin	212	Saposin B-type 2. {ECO:0000255|PROSITE- ProRule:PRU00415}.				blood coagulation (GO:0007596)|cellular response to organic substance (GO:0071310)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|glycosphingolipid metabolic process (GO:0006687)|lipid transport (GO:0006869)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catalytic activity (GO:0043085)|prostate gland growth (GO:0060736)|regulation of lipid metabolic process (GO:0019216)|regulation of MAPK cascade (GO:0043408)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|lipid binding (GO:0008289)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	13						TTGGTCCGTACAGCAGTCTGG	0.532																																							uc001jsm.2		NA																	0				ovary(1)	1						c.(634-636)GTA>CTA		prosaposin isoform a preproprotein							189.0	140.0	157.0					10																	73587857		2203	4300	6503	SO:0001583	missense	5660				glycosphingolipid metabolic process|lipid transport|platelet activation|platelet degranulation	extracellular space|Golgi apparatus|integral to membrane|lysosomal lumen	enzyme activator activity|lipid binding	g.chr10:73587857C>G	BC004275	CCDS7311.1	10q21-q22	2014-01-30	2008-07-31		ENSG00000197746	ENSG00000197746		"""Endogenous ligands"""	9498	protein-coding gene	gene with protein product	"""variant Gaucher disease and variant metachromatic leukodystrophy"""	176801	"""sphingolipid activator protein-1"""	SAP1, GLBA		2717620	Standard	NM_001042465		Approved		uc001jsm.3	P07602	OTTHUMG00000018429	ENST00000394936.3:c.634G>C	10.37:g.73587857C>G	ENSP00000378394:p.Val212Leu						p.V212L	NM_002778	NP_002769	P07602	SAP_HUMAN			6	738	-			212			Saposin B-type 2.		P07292|P15793|P78538|P78541|P78546|P78547|P78558|Q53Y86|Q6IBQ6|Q92739|Q92740|Q92741|Q92742	Missense_Mutation	SNP	ENST00000394936.3	37	c.634G>C	CCDS7311.1	.	.	.	.	.	.	.	.	.	.	C	9.959	1.222167	0.22457	.	.	ENSG00000197746	ENST00000394936;ENST00000373120;ENST00000357471;ENST00000394934;ENST00000404083;ENST00000394940	T;T	0.76839	-1.05;-1.05	5.6	1.65	0.23941	Saposin-like (2);Saposin-like type B, 1 (1);Saposin B (2);	0.439512	0.26467	N	0.024208	T	0.57695	0.2071	L	0.34521	1.04	0.30538	N	0.766724	B	0.12013	0.005	B	0.15052	0.012	T	0.47446	-0.9117	10	0.02654	T	1	-20.9454	6.1589	0.20354	0.0:0.5423:0.2496:0.2081	.	212	P07602	SAP_HUMAN	L	212;212;212;212;215;137	ENSP00000378394:V212L;ENSP00000378392:V212L	ENSP00000350063:V212L	V	-	1	0	PSAP	73257863	0.670000	0.27512	0.141000	0.22245	0.906000	0.53458	1.291000	0.33330	0.405000	0.25532	0.542000	0.68232	GTA		0.532	PSAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048553.1	NM_002778		31	57	0	0	0	0.002836	0	31	57				
SFTPA1	653509	broad.mit.edu	37	10	81372125	81372125	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr10:81372125G>T	ENST00000398636.3	+	4	368	c.230G>T	c.(229-231)gGa>gTa	p.G77V	SFTPA1_ENST00000372308.3_Missense_Mutation_p.G77V|SFTPA1_ENST00000419470.2_Missense_Mutation_p.G92V|SFTPA1_ENST00000428376.2_Missense_Mutation_p.G77V|SFTPA1_ENST00000372313.5_Missense_Mutation_p.G18V	NM_001164644.1|NM_001164646.1|NM_005411.4	NP_001158116.1|NP_001158118.1|NP_005402.3	Q8IWL2	SFTA1_HUMAN	surfactant protein A1	77	Collagen-like.				lipid transport (GO:0006869)|respiratory gaseous exchange (GO:0007585)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|lipid transporter activity (GO:0005319)			endometrium(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			GGGCTGCCTGGAGCCCCTGGT	0.612																																							uc001kap.2		NA																	0					0						c.(229-231)GGA>GTA		surfactant protein A1 isoform 1							134.0	145.0	141.0					10																	81372125		2203	4296	6499	SO:0001583	missense	653509				cell junction assembly|respiratory gaseous exchange	collagen|extracellular space	lipid transporter activity|sugar binding	g.chr10:81372125G>T	BC026229	CCDS44444.1, CCDS44445.1, CCDS44444.2	10q22.3	2012-11-02	2008-08-26			ENSG00000122852		"""Collectins"""	10798	protein-coding gene	gene with protein product	"""surfactant, pulmonary-associated protein A1A"""	178630	"""surfactant, pulmonary-associated protein A1"""	SFTP1			Standard	NM_001093770		Approved	SP-A, SP-A1, COLEC4	uc009xry.3	Q8IWL2		ENST00000398636.3:c.230G>T	10.37:g.81372125G>T	ENSP00000381633:p.Gly77Val					SFTPA1_uc001kaq.2_Missense_Mutation_p.G77V|SFTPA1_uc009xry.2_Missense_Mutation_p.G92V|SFTPA1_uc001kar.2_Missense_Mutation_p.G77V|SFTPA1_uc010qlt.1_Missense_Mutation_p.G18V|SFTPA1_uc009xrz.2_Intron|SFTPA1_uc009xsa.2_Missense_Mutation_p.G77V|SFTPA1_uc009xsf.2_5'Flank	p.G77V	NM_005411	NP_005402	Q8IWL2	SFTA1_HUMAN	Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)		4	351	+	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		77			Collagen-like.		A8K3T8|B7ZW50|E3VLD8|E3VLD9|E3VLE0|E3VLE1|G5E9J3|P07714|Q14DV4|Q5RIR5|Q5RIR7|Q6PIT0|Q8TC19	Missense_Mutation	SNP	ENST00000398636.3	37	c.230G>T	CCDS44445.1	.	.	.	.	.	.	.	.	.	.	.	12.14	1.847348	0.32606	.	.	ENSG00000122852	ENST00000372308;ENST00000398636;ENST00000428376;ENST00000372313;ENST00000419470;ENST00000394569;ENST00000429958;ENST00000439264	D;D;D;D;D;D;D	0.99637	-6.29;-6.29;-6.29;-6.0;-6.29;-6.29;-6.29	2.66	2.66	0.31614	.	0.000000	0.64402	D	0.000003	D	0.99729	0.9894	H	0.98594	4.275	0.54753	D	0.999981	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97523	1.0074	10	0.87932	D	0	-6.1529	8.9673	0.35885	0.0:0.0:1.0:0.0	.	92;77	G5E9J3;Q8IWL2	.;SFTA1_HUMAN	V	77;77;77;18;92;77;77;77	ENSP00000361382:G77V;ENSP00000381633:G77V;ENSP00000411102:G77V;ENSP00000361387:G18V;ENSP00000397082:G92V;ENSP00000395527:G77V;ENSP00000401649:G77V	ENSP00000361382:G77V	G	+	2	0	SFTPA1	81042131	0.999000	0.42202	0.977000	0.42913	0.284000	0.27059	2.709000	0.47160	1.804000	0.52760	0.393000	0.25936	GGA		0.612	SFTPA1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_005411		71	130	1	0	8.13855e-26	0.00361	1.32607e-25	71	130				
CRTAC1	55118	broad.mit.edu	37	10	99664469	99664469	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr10:99664469C>A	ENST00000370597.3	-	7	1308	c.953G>T	c.(952-954)cGc>cTc	p.R318L	CRTAC1_ENST00000370591.2_Missense_Mutation_p.R318L|CRTAC1_ENST00000298819.4_Missense_Mutation_p.R318L	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	318						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		CAGATAGAGGCGGTGGGGGCC	0.597																																							uc001kou.1		NA																	0				ovary(4)|pancreas(1)	5						c.(952-954)CGC>CTC		cartilage acidic protein 1 precursor							102.0	103.0	103.0					10																	99664469		2203	4300	6503	SO:0001583	missense	55118					proteinaceous extracellular matrix	calcium ion binding	g.chr10:99664469C>A	AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.953G>T	10.37:g.99664469C>A	ENSP00000359629:p.Arg318Leu					CRTAC1_uc001kov.2_Missense_Mutation_p.R307L|CRTAC1_uc001kot.1_Missense_Mutation_p.R108L	p.R318L	NM_018058	NP_060528	Q9NQ79	CRAC1_HUMAN		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)	7	1309	-		Colorectal(252;0.24)	318			FG-GAP 3; atypical.		B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Missense_Mutation	SNP	ENST00000370597.3	37	c.953G>T	CCDS31266.1	.	.	.	.	.	.	.	.	.	.	C	33	5.196582	0.94960	.	.	ENSG00000095713	ENST00000413387;ENST00000370597;ENST00000298819;ENST00000309155;ENST00000370591	T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.48466	0.1501	M	0.76574	2.34	0.80722	D	1	D;D;D	0.89917	0.994;0.999;1.0	D;D;D	0.78314	0.937;0.922;0.991	T	0.50634	-0.8805	10	0.54805	T	0.06	-20.5098	18.2232	0.89907	0.0:1.0:0.0:0.0	.	318;318;214	Q9NQ79-2;Q9NQ79;Q5T4F6	.;CRAC1_HUMAN;.	L	214;318;318;310;318	ENSP00000408445:R214L;ENSP00000359629:R318L;ENSP00000298819:R318L;ENSP00000310810:R310L;ENSP00000359623:R318L	ENSP00000298819:R318L	R	-	2	0	CRTAC1	99654459	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.619000	0.83057	2.303000	0.77524	0.561000	0.74099	CGC		0.597	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049754.1	NM_018058		39	73	1	0	1.8453e-21	0.002522	2.84738e-21	39	73				
HPSE2	60495	broad.mit.edu	37	10	100481488	100481488	+	Silent	SNP	C	C	A	rs202038196		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr10:100481488C>A	ENST00000370552.3	-	5	941	c.882G>T	c.(880-882)cgG>cgT	p.R294R	HPSE2_ENST00000370546.1_Silent_p.R294R|HPSE2_ENST00000404542.1_Silent_p.R182R|HPSE2_ENST00000370549.1_Silent_p.R236R	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	294					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		TGGAATAAATCCGGATGGGCT	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		14043	0.001		0.0	False		,,,				2504	0.0						uc001kpn.1		NA																	0				ovary(1)	1						c.(880-882)CGG>CGT		heparanase 2							70.0	66.0	67.0					10																	100481488		2203	4300	6503	SO:0001819	synonymous_variant	60495				carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity	g.chr10:100481488C>A	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.882G>T	10.37:g.100481488C>A						HPSE2_uc009xwc.1_Silent_p.R284R|HPSE2_uc001kpo.1_Silent_p.R226R|HPSE2_uc009xwd.1_Silent_p.R172R	p.R294R	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN		Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)	5	942	-			294					Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Silent	SNP	ENST00000370552.3	37	c.882G>T	CCDS7477.1																																																																																				0.493	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828		28	42	1	0	1.17739e-12	0.005443	1.62327e-12	28	42				
FGF8	2253	broad.mit.edu	37	10	103530295	103530295	+	Missense_Mutation	SNP	C	C	T	rs201979353		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr10:103530295C>T	ENST00000344255.3	-	6	492	c.493G>A	c.(493-495)Gag>Aag	p.E165K	FGF8_ENST00000320185.2_Missense_Mutation_p.E176K|FGF8_ENST00000485728.1_5'UTR|FGF8_ENST00000346714.3_Missense_Mutation_p.E136K|FGF8_ENST00000347978.2_Missense_Mutation_p.E147K			P55075	FGF8_HUMAN	fibroblast growth factor 8 (androgen-induced)	165					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|apoptotic process (GO:0006915)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in mesendoderm migration (GO:0090134)|cell proliferation in forebrain (GO:0021846)|corticotropin hormone secreting cell differentiation (GO:0060128)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral axon guidance (GO:0033563)|embryonic hindlimb morphogenesis (GO:0035116)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain morphogenesis (GO:0048853)|forebrain neuron development (GO:0021884)|gastrulation (GO:0007369)|gonad development (GO:0008406)|heart looping (GO:0001947)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|lung morphogenesis (GO:0060425)|male genitalia development (GO:0030539)|MAPK cascade (GO:0000165)|mesodermal cell migration (GO:0008078)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|midbrain-hindbrain boundary development (GO:0030917)|motor neuron axon guidance (GO:0008045)|negative regulation of cardiac muscle tissue development (GO:0055026)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate morphogenesis (GO:0001839)|neuroepithelial cell differentiation (GO:0060563)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|pallium development (GO:0021543)|patterning of blood vessels (GO:0001569)|pharyngeal system development (GO:0060037)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitosis (GO:0045840)|positive regulation of organ growth (GO:0046622)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to oxidative stress (GO:0006979)|signal transduction involved in regulation of gene expression (GO:0023019)|subpallium development (GO:0021544)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|type 1 fibroblast growth factor receptor binding (GO:0005105)|type 2 fibroblast growth factor receptor binding (GO:0005111)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(2)	5		Colorectal(252;0.122)		Epithelial(162;3.94e-09)|all cancers(201;2.13e-07)		TACCAGCCCTCGTACTTGGCA	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		16864	0.001		0.0	False		,,,				2504	0.0						uc001ktp.1		NA																	0					0						c.(493-495)GAG>AAG		fibroblast growth factor 8 isoform E precursor							88.0	67.0	74.0					10																	103530295		2203	4300	6503	SO:0001583	missense	2253				bone development|dopaminergic neuron differentiation|fibroblast growth factor receptor signaling pathway|gastrulation|gonad development|insulin receptor signaling pathway|mesonephros development|metanephros development|negative regulation of cardiac muscle tissue development|neuroepithelial cell differentiation|odontogenesis|positive regulation of cell division|positive regulation of cell proliferation	extracellular region|extracellular space	growth factor activity|growth factor activity|type 1 fibroblast growth factor receptor binding|type 2 fibroblast growth factor receptor binding	g.chr10:103530295C>T	D38752	CCDS7515.1, CCDS7516.1, CCDS7517.1, CCDS7518.1, CCDS73185.1	10q25-q26	2014-01-30			ENSG00000107831	ENSG00000107831		"""Endogenous ligands"""	3686	protein-coding gene	gene with protein product		600483				8595889	Standard	NM_033164		Approved	AIGF	uc001ktq.2	P55075	OTTHUMG00000018940	ENST00000344255.3:c.493G>A	10.37:g.103530295C>T	ENSP00000340039:p.Glu165Lys					FGF8_uc001ktq.1_Missense_Mutation_p.E176K|FGF8_uc001ktr.1_Missense_Mutation_p.E147K|FGF8_uc001kts.1_Missense_Mutation_p.E136K|FGF8_uc009xwr.1_Missense_Mutation_p.E72K	p.E165K	NM_033164	NP_149354	P55075	FGF8_HUMAN		Epithelial(162;3.94e-09)|all cancers(201;2.13e-07)	6	663	-		Colorectal(252;0.122)	165					A1A514|Q14915|Q15766	Missense_Mutation	SNP	ENST00000344255.3	37	c.493G>A	CCDS7517.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	14.26	2.482522	0.44147	.	.	ENSG00000107831	ENST00000344255;ENST00000320185;ENST00000346714;ENST00000347978	T;T;T;T	0.80653	-1.4;-1.4;-1.4;-1.4	3.68	3.68	0.42216	.	0.318671	0.32015	N	0.006720	T	0.67183	0.2866	L	0.35542	1.07	0.58432	D	0.999999	B;B;B;P	0.37997	0.009;0.009;0.003;0.614	B;B;B;B	0.30943	0.004;0.004;0.004;0.122	T	0.65709	-0.6102	10	0.13470	T	0.59	.	15.4236	0.75035	0.0:1.0:0.0:0.0	.	136;147;176;165	P55075-2;P55075-3;P55075-4;P55075	.;.;.;FGF8_HUMAN	K	165;176;136;147	ENSP00000340039:E165K;ENSP00000321797:E176K;ENSP00000344306:E136K;ENSP00000321945:E147K	ENSP00000321797:E176K	E	-	1	0	FGF8	103520285	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	4.617000	0.61204	1.604000	0.50143	0.455000	0.32223	GAG		0.627	FGF8-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049999.1	NM_006119, NM_033165		15	28	0	0	0	0.00499	0	15	28				
FGFR2	2263	broad.mit.edu	37	10	123279634	123279634	+	Silent	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr10:123279634G>A	ENST00000358487.5	-	7	1070	c.798C>T	c.(796-798)gcC>gcT	p.A266A	FGFR2_ENST00000351936.6_Silent_p.A266A|FGFR2_ENST00000346997.2_Silent_p.A266A|FGFR2_ENST00000360144.3_Silent_p.A177A|FGFR2_ENST00000457416.2_Silent_p.A266A|FGFR2_ENST00000369061.4_Intron|FGFR2_ENST00000369059.1_Silent_p.A151A|FGFR2_ENST00000369056.1_Silent_p.A266A|FGFR2_ENST00000357555.5_Silent_p.A177A|FGFR2_ENST00000490349.1_5'UTR|FGFR2_ENST00000356226.4_Silent_p.A151A|FGFR2_ENST00000369060.4_Silent_p.A266A|FGFR2_ENST00000478859.1_Silent_p.A38A	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	266	Ig-like C2-type 3.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)			breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	CCACTGTGGAGGCATTTGCCG	0.577		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																														uc010qtk.1		5		Dom	yes		10	10q26	2263	Mis	fibroblast growth factor receptor 2	yes	Crouzon|Pfeiffer|and Apert syndromes	E			gastric. NSCLC|endometrial		0				endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96						c.(796-798)GCC>GCT		fibroblast growth factor receptor 2 isoform 1	Palifermin(DB00039)						88.0	74.0	79.0					10																	123279634		2203	4300	6503	SO:0001819	synonymous_variant	2263	Apert_syndrome|Saethre-Chotzen_syndrome	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding	g.chr10:123279634G>A	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.798C>T	10.37:g.123279634G>A						FGFR2_uc010qtg.1_Intron|FGFR2_uc010qth.1_Silent_p.A151A|FGFR2_uc010qti.1_Silent_p.A177A|FGFR2_uc010qtj.1_Silent_p.A266A|FGFR2_uc010qtl.1_Silent_p.A266A|FGFR2_uc010qtm.1_Silent_p.A151A|FGFR2_uc001lfl.3_Silent_p.A266A|FGFR2_uc001lfm.2_Silent_p.A177A|FGFR2_uc001lfn.3_RNA|FGFR2_uc010qtn.1_Silent_p.A285A|FGFR2_uc010qto.1_Silent_p.A170A|FGFR2_uc001lfo.1_Silent_p.A285A|FGFR2_uc010qtp.1_Silent_p.A285A|FGFR2_uc001lfg.3_5'Flank	p.A266A	NM_000141	NP_000132	P21802	FGFR2_HUMAN	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	7	1445	-		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	266			Ig-like C2-type 3.|Extracellular (Potential).		B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Silent	SNP	ENST00000358487.5	37	c.798C>T	CCDS31298.1																																																																																				0.577	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050715.1	NM_022976, NM_000141		5	43	0	0	0	0.000602	0	5	43				
DMBT1	1755	broad.mit.edu	37	10	124338238	124338238	+	Missense_Mutation	SNP	T	T	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr10:124338238T>G	ENST00000338354.3	+	9	748	c.642T>G	c.(640-642)agT>agG	p.S214R	DMBT1_ENST00000368909.3_Missense_Mutation_p.S214R|DMBT1_ENST00000368956.2_Missense_Mutation_p.S214R|DMBT1_ENST00000368955.3_Missense_Mutation_p.S214R|DMBT1_ENST00000344338.3_Missense_Mutation_p.S214R|DMBT1_ENST00000330163.4_Missense_Mutation_p.S214R|DMBT1_ENST00000359586.6_Intron			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	214					defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TTACAGAAAGTTGGCCTGTCA	0.448																																					Ovarian(182;93 2026 18125 22222 38972)	Ovarian(182;93 2026 18125 22222 38972)	uc001lgk.1		NA																	0				central_nervous_system(7)	7						c.(640-642)AGT>AGG		deleted in malignant brain tumors 1 isoform b							171.0	161.0	164.0					10																	124338238		1889	4127	6016	SO:0001583	missense	1755				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding	g.chr10:124338238T>G		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.642T>G	10.37:g.124338238T>G	ENSP00000342210:p.Ser214Arg					DMBT1_uc001lgl.1_Missense_Mutation_p.S214R|DMBT1_uc001lgm.1_Missense_Mutation_p.S214R|DMBT1_uc009xzz.1_Missense_Mutation_p.S214R|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yaa.1_Missense_Mutation_p.S66R	p.S214R	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN			9	748	+		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)	214					A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37	c.642T>G		.	.	.	.	.	.	.	.	.	.	t	0.020	-1.434814	0.01108	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956	T;T;T;T;T;T	0.25912	1.82;1.84;1.77;1.82;1.84;1.77	1.79	-3.58	0.04597	.	.	.	.	.	T	0.11324	0.0276	N	0.08118	0	0.09310	N	1	B;B;B;P;B	0.46220	0.103;0.232;0.277;0.874;0.016	B;B;B;P;B	0.47251	0.088;0.113;0.144;0.542;0.007	T	0.04128	-1.0975	9	0.18276	T	0.48	.	0.8877	0.01248	0.3331:0.1695:0.3331:0.1643	.	214;214;214;214;214	Q9UGM3-4;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;DMBT1_HUMAN	R	214	ENSP00000342210:S214R;ENSP00000343175:S214R;ENSP00000327747:S214R;ENSP00000357905:S214R;ENSP00000357951:S214R;ENSP00000357952:S214R	ENSP00000331522:S214R	S	+	3	2	DMBT1	124328228	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.863000	0.04259	-2.123000	0.00823	0.383000	0.25322	AGT		0.448	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406		7	12	0	0	0	0.00308	0	7	12				
MKI67	4288	broad.mit.edu	37	10	129902508	129902508	+	Silent	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr10:129902508G>T	ENST00000368654.3	-	13	7971	c.7596C>A	c.(7594-7596)atC>atA	p.I2532I	MKI67_ENST00000368653.3_Silent_p.I2172I	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2532	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CTGGGTCCAGGATCTGCTTTG	0.512																																							uc001lke.2		NA																	0				ovary(4)|central_nervous_system(2)|skin(1)	7						c.(7594-7596)ATC>ATA		antigen identified by monoclonal antibody Ki-67							145.0	135.0	139.0					10																	129902508		2203	4300	6503	SO:0001819	synonymous_variant	4288				cell proliferation	nucleolus	ATP binding|protein C-terminus binding	g.chr10:129902508G>T	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.7596C>A	10.37:g.129902508G>T						MKI67_uc001lkf.2_Silent_p.I2172I|MKI67_uc009yav.1_Silent_p.I2107I|MKI67_uc009yaw.1_Silent_p.I1682I	p.I2532I	NM_002417	NP_002408	P46013	KI67_HUMAN			13	7791	-		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)	2532			16 X 122 AA approximate repeats.|13.		Q5VWH2	Silent	SNP	ENST00000368654.3	37	c.7596C>A	CCDS7659.1																																																																																				0.512	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417		74	107	1	0	2.08929e-35	0.00361	3.60595e-35	74	107				
MUC6	4588	broad.mit.edu	37	11	1025300	1025300	+	Missense_Mutation	SNP	C	C	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr11:1025300C>G	ENST00000421673.2	-	23	2917	c.2867G>C	c.(2866-2868)gGg>gCg	p.G956A		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	956	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CGGCGTCACCCCGAGCTGCAC	0.642																																							uc001lsw.2		NA																	0				ovary(1)	1						c.(2866-2868)GGG>GCG		mucin 6, gastric							66.0	77.0	73.0					11																	1025300		2118	4221	6339	SO:0001583	missense	4588				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent	g.chr11:1025300C>G	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.2867G>C	11.37:g.1025300C>G	ENSP00000406861:p.Gly956Ala						p.G956A	NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	23	2918	-		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)	956			VWFD 3.		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	c.2867G>C	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	C	0.082	-1.181136	0.01633	.	.	ENSG00000184956	ENST00000421673	T	0.59083	0.29	4.34	0.478	0.16789	von Willebrand factor, type D domain (3);	4.301540	0.01364	U	0.012354	T	0.37652	0.1011	N	0.20986	0.625	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.08146	-1.0736	10	0.08837	T	0.75	.	1.3114	0.02098	0.1606:0.1382:0.1627:0.5385	.	956	Q6W4X9	MUC6_HUMAN	A	956	ENSP00000406861:G956A	ENSP00000406861:G956A	G	-	2	0	MUC6	1015300	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.646000	0.05403	-0.092000	0.12417	0.556000	0.70494	GGG		0.642	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540		10	51	0	0	0	0.006214	0	10	51				
OR2D3	120775	broad.mit.edu	37	11	6942999	6942999	+	Missense_Mutation	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr11:6942999C>T	ENST00000317834.3	+	1	795	c.767C>T	c.(766-768)aCc>aTc	p.T256I		NM_001004684.1	NP_001004684.1	Q8NGH3	OR2D3_HUMAN	olfactory receptor, family 2, subfamily D, member 3	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|prostate(3)|skin(1)|stomach(1)	27		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GCTTTTTCCACCTGTGGCTCC	0.453																																							uc010rav.1		NA																	0					0						c.(766-768)ACC>ATC		olfactory receptor, family 2, subfamily D,							126.0	119.0	122.0					11																	6942999		2201	4296	6497	SO:0001583	missense	120775				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6942999C>T	BK004294	CCDS31417.1	11p15.4	2012-08-09			ENSG00000178358	ENSG00000178358		"""GPCR / Class A : Olfactory receptors"""	15146	protein-coding gene	gene with protein product							Standard	NM_001004684		Approved		uc010rav.2	Q8NGH3	OTTHUMG00000165742	ENST00000317834.3:c.767C>T	11.37:g.6942999C>T	ENSP00000320560:p.Thr256Ile						p.T256I	NM_001004684	NP_001004684	Q8NGH3	OR2D3_HUMAN		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	767	+		Medulloblastoma(188;0.0523)|all_neural(188;0.236)	256			Helical; Name=6; (Potential).		B2RP06|Q6IFG8|Q96R51	Missense_Mutation	SNP	ENST00000317834.3	37	c.767C>T	CCDS31417.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.309230	0.81247	.	.	ENSG00000178358	ENST00000317834	T	0.42513	0.97	5.17	5.17	0.71159	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46145	D	0.000313	T	0.72293	0.3442	M	0.93016	3.37	0.54753	D	0.999982	D	0.71674	0.998	D	0.73380	0.98	T	0.78969	-0.1994	10	0.87932	D	0	-58.4555	16.5766	0.84681	0.0:1.0:0.0:0.0	.	256	Q8NGH3	OR2D3_HUMAN	I	256	ENSP00000320560:T256I	ENSP00000320560:T256I	T	+	2	0	OR2D3	6899575	1.000000	0.71417	0.998000	0.56505	0.944000	0.59088	7.490000	0.81461	2.865000	0.98341	0.655000	0.94253	ACC		0.453	OR2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385987.1	NM_001004684		5	43	0	0	0	0.000602	0	5	43				
CTR9	9646	broad.mit.edu	37	11	10778300	10778300	+	Missense_Mutation	SNP	A	A	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr11:10778300A>C	ENST00000361367.2	+	5	933	c.507A>C	c.(505-507)aaA>aaC	p.K169N		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	169					cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		TTACAGGTAAAGCTTGCATTT	0.333																																							uc001mja.2		NA																	0				ovary(2)	2						c.(505-507)AAA>AAC		SH2 domain binding protein 1							84.0	92.0	89.0					11																	10778300		2201	4294	6495	SO:0001583	missense	9646				histone H2B ubiquitination|histone monoubiquitination	Cdc73/Paf1 complex|nuclear speck		g.chr11:10778300A>C	D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.507A>C	11.37:g.10778300A>C	ENSP00000355013:p.Lys169Asn						p.K169N	NM_014633	NP_055448	Q6PD62	CTR9_HUMAN		all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)	5	656	+			169			TPR 3.		D3DQV8|Q15015	Missense_Mutation	SNP	ENST00000361367.2	37	c.507A>C	CCDS7805.1	.	.	.	.	.	.	.	.	.	.	A	19.93	3.917451	0.73098	.	.	ENSG00000198730	ENST00000361367;ENST00000524523	T;T	0.60797	0.16;1.2	5.8	5.8	0.92144	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.085371	0.85682	D	0.000000	T	0.76758	0.4032	M	0.91196	3.185	0.80722	D	1	D	0.59357	0.985	P	0.62298	0.9	T	0.80982	-0.1139	10	0.62326	D	0.03	-24.138	8.913	0.35565	0.8733:0.0:0.1267:0.0	.	169	Q6PD62	CTR9_HUMAN	N	169;156	ENSP00000355013:K169N;ENSP00000431458:K156N	ENSP00000355013:K169N	K	+	3	2	CTR9	10734876	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.159000	0.64923	2.220000	0.72140	0.383000	0.25322	AAA		0.333	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386215.1	NM_014633		18	49	0	0	0	0.007413	0	18	49				
SOX6	55553	broad.mit.edu	37	11	16010775	16010775	+	Splice_Site	SNP	T	T	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr11:16010775T>G	ENST00000352083.6	-	14	1811	c.1734A>C	c.(1732-1734)ggA>ggC	p.G578G	SOX6_ENST00000528429.1_Splice_Site_p.G578G|SOX6_ENST00000528252.1_Splice_Site_p.G551G|SOX6_ENST00000316399.6_Intron|SOX6_ENST00000527619.1_Splice_Site_p.G554G|SOX6_ENST00000396356.3_Intron			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	578					astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						TTGCTTTACTTCCTGTAATGT	0.502											OREG0020800	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001mme.2		NA																	0				ovary(3)	3						c.(1771-1773)GGA>GGC		SRY (sex determining region Y)-box 6 isoform 4							86.0	84.0	85.0					11																	16010775		1327	2309	3636	SO:0001630	splice_region_variant	55553				muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity	g.chr11:16010775T>G	AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.1733-1A>C	11.37:g.16010775T>G			OREG0020800	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	707	SOX6_uc001mmd.2_Silent_p.G554G|SOX6_uc001mmf.2_Silent_p.G551G|SOX6_uc001mmg.2_Intron	p.G591G	NM_001145819	NP_001139291	P35712	SOX6_HUMAN			14	1806	-			578					Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Silent	SNP	ENST00000352083.6	37	c.1773A>C																																																																																					0.502	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000386811.1	NM_033326	Silent	20	19	0	0	0	0.007413	0	20	19				
PAX6	5080	broad.mit.edu	37	11	31823152	31823152	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr11:31823152C>A	ENST00000379132.3	-	5	594	c.314G>T	c.(313-315)aGa>aTa	p.R105I	PAX6_ENST00000241001.8_Missense_Mutation_p.R105I|PAX6_ENST00000533156.1_5'Flank|PAX6_ENST00000379115.4_Missense_Mutation_p.R119I|PAX6_ENST00000379123.5_Missense_Mutation_p.R105I|PAX6_ENST00000379111.2_Missense_Mutation_p.R105I|PAX6_ENST00000419022.1_Missense_Mutation_p.R119I|PAX6_ENST00000379129.2_Missense_Mutation_p.R119I|PAX6_ENST00000379107.2_Missense_Mutation_p.R119I			P26367	PAX6_HUMAN	paired box 6	105	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					GGACAGTAATCTGTCTCGGAT	0.502									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																														uc001mtd.3		NA																	0				lung(4)|ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	9						c.(313-315)AGA>ATA		paired box gene 6 isoform a							93.0	89.0	90.0					11																	31823152		2202	4299	6501	SO:0001583	missense	5080	Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation	Familial Cancer Database	WAGR syndrome	blood vessel development|central nervous system development|cornea development in camera-type eye|glucose homeostasis|iris morphogenesis|negative regulation of neurogenesis|neuron fate commitment|pancreatic A cell development|positive regulation of transcription, DNA-dependent|response to wounding|visual perception	cytoplasm|nuclear chromatin	R-SMAD binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|ubiquitin-protein ligase activity	g.chr11:31823152C>A	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.314G>T	11.37:g.31823152C>A	ENSP00000368427:p.Arg105Ile					PAX6_uc001mte.3_Missense_Mutation_p.R105I|PAX6_uc001mtg.3_Missense_Mutation_p.R119I|PAX6_uc001mtf.3_Missense_Mutation_p.R105I|PAX6_uc001mth.3_Missense_Mutation_p.R105I|PAX6_uc009yjr.2_Missense_Mutation_p.R105I	p.R105I	NM_001127612	NP_001121084	P26367	PAX6_HUMAN			5	1204	-	Lung SC(675;0.225)		105			Paired.		Q6N006|Q99413	Missense_Mutation	SNP	ENST00000379132.3	37	c.314G>T	CCDS31451.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.412044	0.83340	.	.	ENSG00000007372	ENST00000419022;ENST00000379132;ENST00000379129;ENST00000379107;ENST00000241001;ENST00000379115;ENST00000379111;ENST00000379123;ENST00000379109;ENST00000533333	D;D;D;D;D;D;D;D;D;D	0.99499	-6.02;-6.02;-6.02;-6.02;-6.02;-6.02;-6.02;-6.02;-6.02;-6.02	5.35	5.35	0.76521	Paired box protein, N-terminal (3);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.041840	0.85682	D	0.000000	D	0.99658	0.9873	M	0.92649	3.33	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.997;0.998	D	0.97776	1.0229	10	0.87932	D	0	.	19.0586	0.93078	0.0:1.0:0.0:0.0	.	119;105	F1T0F8;P26367	.;PAX6_HUMAN	I	119;105;119;119;105;119;105;105;105;60	ENSP00000404100:R119I;ENSP00000368427:R105I;ENSP00000368424:R119I;ENSP00000368401:R119I;ENSP00000241001:R105I;ENSP00000368410:R119I;ENSP00000368406:R105I;ENSP00000368418:R105I;ENSP00000368403:R105I;ENSP00000451372:R60I	ENSP00000241001:R105I	R	-	2	0	PAX6	31779728	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.057000	0.71119	2.488000	0.83962	0.650000	0.86243	AGA		0.502	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000099293.4	NM_001604		15	52	1	0	2.23348e-06	0.004007	2.66873e-06	15	52				
LRRC4C	57689	broad.mit.edu	37	11	40136650	40136650	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr11:40136650G>T	ENST00000278198.2	-	2	3156	c.1193C>A	c.(1192-1194)gCg>gAg	p.A398E	LRRC4C_ENST00000528697.1_Missense_Mutation_p.A398E|LRRC4C_ENST00000530763.1_Missense_Mutation_p.A398E|LRRC4C_ENST00000527150.1_Missense_Mutation_p.A398E			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	398	Ig-like C2-type.				regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				CACTTTGTACGCCCCATGTGT	0.463																																							uc001mxa.1		NA																	0				ovary(4)|skin(3)|central_nervous_system(1)	8						c.(1192-1194)GCG>GAG		netrin-G1 ligand precursor							193.0	168.0	176.0					11																	40136650		2203	4300	6503	SO:0001583	missense	57689				regulation of axonogenesis	integral to membrane	protein binding	g.chr11:40136650G>T	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1193C>A	11.37:g.40136650G>T	ENSP00000278198:p.Ala398Glu					LRRC4C_uc001mxc.1_Missense_Mutation_p.A394E|LRRC4C_uc001mxd.1_Missense_Mutation_p.A394E|LRRC4C_uc001mxb.1_Missense_Mutation_p.A394E	p.A398E	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN			2	3157	-		all_lung(304;0.0575)|Lung NSC(402;0.138)	398			Ig-like C2-type.		A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	37	c.1193C>A	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	G	14.28	2.489125	0.44249	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.87	5.87	0.94306	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.054334	0.64402	D	0.000001	T	0.57636	0.2067	L	0.31371	0.925	0.58432	D	0.999998	B	0.22983	0.078	B	0.30716	0.119	T	0.54523	-0.8281	10	0.59425	D	0.04	.	19.2669	0.93990	0.0:0.0:1.0:0.0	.	398	Q9HCJ2	LRC4C_HUMAN	E	398	ENSP00000278198:A398E;ENSP00000436976:A398E;ENSP00000437132:A398E;ENSP00000434761:A398E	ENSP00000278198:A398E	A	-	2	0	LRRC4C	40093226	1.000000	0.71417	0.968000	0.41197	0.847000	0.48162	9.786000	0.99046	2.798000	0.96311	0.650000	0.86243	GCG		0.463	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		55	87	1	0	4.32865e-36	0.00361	7.52668e-36	55	87				
PACSIN3	29763	broad.mit.edu	37	11	47201066	47201066	+	Missense_Mutation	SNP	T	T	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr11:47201066T>A	ENST00000539589.1	-	7	1017	c.675A>T	c.(673-675)gaA>gaT	p.E225D	ARFGAP2_ENST00000419701.2_5'Flank|ARFGAP2_ENST00000395449.3_5'Flank|ARFGAP2_ENST00000426335.2_5'Flank|ARFGAP2_ENST00000524782.1_5'Flank|ARFGAP2_ENST00000319543.6_5'Flank|PACSIN3_ENST00000298838.6_Missense_Mutation_p.E225D	NM_001184975.1	NP_001171904.1	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in neurons 3	225	F-BAR domain. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endocytosis (GO:0045806)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|cytoskeletal protein binding (GO:0008092)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)	11						CAAAGGCCTGTTCCATGTCCT	0.582											OREG0020952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001ndw.2		NA																	0					0						c.(673-675)GAA>GAT		protein kinase C and casein kinase substrate in							77.0	83.0	81.0					11																	47201066		2201	4298	6499	SO:0001583	missense	29763				endocytosis|negative regulation of endocytosis|positive regulation of membrane protein ectodomain proteolysis	cytoplasm|plasma membrane	cytoskeletal protein binding	g.chr11:47201066T>A	AF130979	CCDS31481.1	11p12-p11	2008-02-05				ENSG00000165912			8572	protein-coding gene	gene with protein product	"""syndapin III"""	606513				10531379	Standard	NM_016223		Approved	SDPIII	uc001ndx.3	Q9UKS6		ENST00000539589.1:c.675A>T	11.37:g.47201066T>A	ENSP00000440945:p.Glu225Asp		OREG0020952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	945	ARFGAP2_uc001ndt.2_5'Flank|ARFGAP2_uc010rhb.1_5'Flank|ARFGAP2_uc001ndu.2_5'Flank|ARFGAP2_uc010rhc.1_5'Flank|ARFGAP2_uc010rhd.1_5'Flank|ARFGAP2_uc001ndv.1_5'Flank|PACSIN3_uc001ndx.2_Missense_Mutation_p.E225D|PACSIN3_uc001ndy.2_Missense_Mutation_p.E225D|PACSIN3_uc001ndz.2_RNA|PACSIN3_uc001nea.2_RNA	p.E225D	NM_016223	NP_057307	Q9UKS6	PACN3_HUMAN			7	1013	-			225					A6NH84|Q9H331|Q9NWV9	Missense_Mutation	SNP	ENST00000539589.1	37	c.675A>T	CCDS31481.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.11|16.11	3.029959|3.029959	0.54790|0.54790	.|.	.|.	ENSG00000165912|ENSG00000165912	ENST00000298838;ENST00000539589;ENST00000528462;ENST00000530513;ENST00000528201|ENST00000415232	T;T;T;T;T|.	0.43688|.	0.99;0.99;0.99;2.51;0.94|.	5.4|5.4	0.238|0.238	0.15480|0.15480	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.64800|0.64800	0.2631|0.2631	M|M	0.74258|0.74258	2.255|2.255	0.51482|0.51482	D|D	0.99992|0.99992	P|.	0.42337|.	0.776|.	P|.	0.51453|.	0.67|.	T|T	0.57596|0.57596	-0.7784|-0.7784	10|6	0.23302|0.17832	T|T	0.38|0.49	-31.5041|-31.5041	9.5111|9.5111	0.39078|0.39078	0.0:0.5862:0.0:0.4138|0.0:0.5862:0.0:0.4138	.|.	225|.	Q9UKS6|.	PACN3_HUMAN|.	D|I	225;225;225;5;5|224	ENSP00000298838:E225D;ENSP00000440945:E225D;ENSP00000437252:E225D;ENSP00000431924:E5D;ENSP00000434521:E5D|.	ENSP00000298838:E225D|ENSP00000405352:N224I	E|N	-|-	3|2	2|0	PACSIN3|PACSIN3	47157642|47157642	0.950000|0.950000	0.32346|0.32346	0.998000|0.998000	0.56505|0.56505	0.843000|0.843000	0.47879|0.47879	0.189000|0.189000	0.17037|0.17037	0.026000|0.026000	0.15269|0.15269	-1.017000|-1.017000	0.02453|0.02453	GAA|AAC		0.582	PACSIN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391632.1	NM_016223		19	43	0	0	0	0.001523	0	19	43				
OR4C16	219428	broad.mit.edu	37	11	55340174	55340174	+	Missense_Mutation	SNP	T	T	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr11:55340174T>A	ENST00000314634.3	+	1	571	c.571T>A	c.(571-573)Tat>Aat	p.Y191N		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				TTCAGAAACCTATGTGGTTAA	0.438																																							uc010rih.1		NA																	0				ovary(1)|skin(1)	2						c.(571-573)TAT>AAT		olfactory receptor, family 4, subfamily C,							92.0	88.0	89.0					11																	55340174		2201	4296	6497	SO:0001583	missense	219428				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55340174T>A	AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.571T>A	11.37:g.55340174T>A	ENSP00000324913:p.Tyr191Asn						p.Y191N	NM_001004701	NP_001004701	Q8NGL9	OR4CG_HUMAN			1	571	+		all_epithelial(135;0.0748)	191			Extracellular (Potential).		Q6IEV8	Missense_Mutation	SNP	ENST00000314634.3	37	c.571T>A	CCDS31502.1	.	.	.	.	.	.	.	.	.	.	T	10.24	1.295685	0.23564	.	.	ENSG00000181935	ENST00000314634	T	0.00198	8.57	4.98	3.85	0.44370	GPCR, rhodopsin-like superfamily (1);	0.216928	0.32987	N	0.005417	T	0.00468	0.0015	M	0.76328	2.33	0.09310	N	1	D	0.62365	0.991	D	0.68483	0.958	T	0.41034	-0.9531	10	0.66056	D	0.02	.	9.0374	0.36296	0.0:0.0884:0.0:0.9116	.	191	Q8NGL9	OR4CG_HUMAN	N	191	ENSP00000324913:Y191N	ENSP00000324913:Y191N	Y	+	1	0	OR4C16	55096750	0.000000	0.05858	0.006000	0.13384	0.171000	0.22731	-1.897000	0.01603	0.915000	0.36847	0.448000	0.29417	TAT		0.438	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382627.1	NM_001004701		42	50	0	0	0	0.00361	0	42	50				
PAK1	5058	broad.mit.edu	37	11	77054934	77054934	+	Nonsense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr11:77054934C>A	ENST00000356341.3	-	10	1459	c.928G>T	c.(928-930)Gag>Tag	p.E310*	PAK1_ENST00000525542.1_5'UTR|PAK1_ENST00000530617.1_Nonsense_Mutation_p.E310*|PAK1_ENST00000528203.1_Nonsense_Mutation_p.E212*|PAK1_ENST00000278568.4_Nonsense_Mutation_p.E310*	NM_002576.4	NP_002567.3	Q13153	PAK1_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 1	310	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to insulin stimulus (GO:0032869)|dendrite development (GO:0016358)|exocytosis (GO:0006887)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor clustering (GO:0043113)|response to hypoxia (GO:0001666)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|wound healing (GO:0042060)	axon (GO:0030424)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|Z disc (GO:0030018)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(13)|skin(2)|stomach(1)	29	all_cancers(14;1.75e-18)					ATAATCAGCTCTTTCTTGGGC	0.428																																							uc001oyh.3		NA																	0				skin(2)|stomach(1)|lung(1)	4						c.(928-930)GAG>TAG		p21-activated kinase 1 isoform 2							227.0	196.0	206.0					11																	77054934		2200	4292	6492	SO:0001587	stop_gained	5058				apoptosis|axon guidance|cytoskeleton organization|ER-nucleus signaling pathway|positive regulation of JUN kinase activity|positive regulation of peptidyl-serine phosphorylation|protein autophosphorylation|T cell costimulation|T cell receptor signaling pathway	cytosol|focal adhesion|Golgi apparatus	ATP binding|collagen binding|protein binding|protein serine/threonine kinase activity	g.chr11:77054934C>A	U51120	CCDS8250.1, CCDS44687.1	11q13-q14	2008-06-17	2008-06-17						8590	protein-coding gene	gene with protein product	"""STE20 homolog, yeast"""	602590	"""p21/Cdc42/Rac1-activated kinase 1 (yeast Ste20-related)"", ""p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)"""			8805275, 9533029	Standard	NM_002576		Approved		uc001oyg.4	Q13153		ENST00000356341.3:c.928G>T	11.37:g.77054934C>A	ENSP00000348696:p.Glu310*					PAK1_uc010rso.1_Nonsense_Mutation_p.E212*|PAK1_uc001oyg.3_Nonsense_Mutation_p.E310*|PAK1_uc001oyi.1_Nonsense_Mutation_p.E310*|PAK1_uc010rsn.1_Nonsense_Mutation_p.E23*	p.E310*	NM_002576	NP_002567	Q13153	PAK1_HUMAN			10	1461	-	all_cancers(14;1.75e-18)		310			Protein kinase.		O75561|Q13567|Q32M53|Q32M54|Q86W79	Nonsense_Mutation	SNP	ENST00000356341.3	37	c.928G>T	CCDS8250.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	44|44	11.004728|11.004728	0.99502|0.99502	.|.	.|.	ENSG00000149269|ENSG00000149269	ENST00000356341;ENST00000530617;ENST00000278568;ENST00000528203|ENST00000533285	.|.	.|.	.|.	5.9|5.9	5.9|5.9	0.94986|0.94986	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.80352	.|0.4607	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77869	.|-0.2427	.|3	0.87932|.	D|.	0|.	.|.	20.2789|20.2789	0.98501|0.98501	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|I	310;310;310;212|31	.|.	ENSP00000278568:E310X|.	E|R	-|-	1|2	0|0	PAK1|PAK1	76732582|76732582	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.463000|7.463000	0.80869|0.80869	2.788000|2.788000	0.95919|0.95919	0.650000|0.650000	0.86243|0.86243	GAG|AGA		0.428	PAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382083.2	NM_002576		18	76	1	0	1.2644e-06	0.001523	1.53441e-06	18	76				
TAS2R9	50835	broad.mit.edu	37	12	10962433	10962433	+	Missense_Mutation	SNP	A	A	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr12:10962433A>G	ENST00000240691.2	-	1	334	c.242T>C	c.(241-243)cTa>cCa	p.L81P	TAS2R8_ENST00000240615.2_5'Flank	NM_023917.2	NP_076406.1	Q9NYW1	TA2R9_HUMAN	taste receptor, type 2, member 9	81					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	taste receptor activity (GO:0008527)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						AATGCTTACTAGCACGCTATT	0.398																																							uc001qyx.2		NA																	0				skin(1)	1						c.(241-243)CTA>CCA		taste receptor, type 2, member 9							106.0	102.0	103.0					12																	10962433		2203	4300	6503	SO:0001583	missense	50835				sensory perception of taste	integral to membrane	taste receptor activity	g.chr12:10962433A>G	AF227135	CCDS8633.1	12p13	2012-08-22			ENSG00000121381	ENSG00000121381		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14917	protein-coding gene	gene with protein product		604795				10761934, 10766242	Standard	NM_023917		Approved	T2R9, TRB6	uc001qyx.3	Q9NYW1	OTTHUMG00000168507	ENST00000240691.2:c.242T>C	12.37:g.10962433A>G	ENSP00000240691:p.Leu81Pro					TAS2R8_uc010shh.1_5'Flank	p.L81P	NM_023917	NP_076406	Q9NYW1	TA2R9_HUMAN			1	335	-			81			Extracellular (Potential).		Q502V7|Q50KT0|Q50KT1|Q645W9	Missense_Mutation	SNP	ENST00000240691.2	37	c.242T>C	CCDS8633.1	.	.	.	.	.	.	.	.	.	.	A	12.95	2.089974	0.36855	.	.	ENSG00000121381	ENST00000240691	T	0.42513	0.97	3.81	2.65	0.31530	GPCR, rhodopsin-like superfamily (1);	1.750780	0.04351	U	0.355599	T	0.67154	0.2863	M	0.88640	2.97	0.09310	N	0.999999	D	0.58970	0.984	P	0.60541	0.876	T	0.32295	-0.9912	10	0.62326	D	0.03	.	7.765	0.28974	0.8951:0.0:0.1049:0.0	.	81	Q9NYW1	TA2R9_HUMAN	P	81	ENSP00000240691:L81P	ENSP00000240691:L81P	L	-	2	0	TAS2R9	10853700	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.015000	0.12634	0.809000	0.34255	0.477000	0.44152	CTA		0.398	TAS2R9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399933.1			52	52	0	0	0	0.00361	0	52	52				
HEBP1	50865	broad.mit.edu	37	12	13140126	13140126	+	Missense_Mutation	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr12:13140126C>T	ENST00000014930.4	-	3	516	c.358G>A	c.(358-360)Gtt>Att	p.V120I	HEBP1_ENST00000536942.1_Missense_Mutation_p.V120I|RP11-392P7.6_ENST00000499948.2_RNA	NM_015987.4	NP_057071.2	Q9NRV9	HEBP1_HUMAN	heme binding protein 1	120					circadian rhythm (GO:0007623)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	heme binding (GO:0020037)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	7		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.153)		TCAATCTTAACGCTTTTGTCA	0.488																																							uc001rbd.2		NA																	0				breast(1)	1						c.(358-360)GTT>ATT		heme binding protein 1							170.0	152.0	158.0					12																	13140126		2203	4300	6503	SO:0001583	missense	50865				circadian rhythm	extracellular region		g.chr12:13140126C>T	AF117615	CCDS31749.1	12p13.2	2014-01-30			ENSG00000013583	ENSG00000013583		"""Endogenous ligands"""	17176	protein-coding gene	gene with protein product		605826				10640688	Standard	NM_015987		Approved	HEBP, HBP	uc001rbd.3	Q9NRV9	OTTHUMG00000168771	ENST00000014930.4:c.358G>A	12.37:g.13140126C>T	ENSP00000014930:p.Val120Ile					HEBP1_uc001rbf.2_Missense_Mutation_p.V120I	p.V120I	NM_015987	NP_057071	Q9NRV9	HEBP1_HUMAN		BRCA - Breast invasive adenocarcinoma(232;0.153)	3	531	-		Prostate(47;0.183)	120					A8K1G2|Q9Y5Z5	Missense_Mutation	SNP	ENST00000014930.4	37	c.358G>A	CCDS31749.1	.	.	.	.	.	.	.	.	.	.	C	3.455	-0.111132	0.06881	.	.	ENSG00000013583	ENST00000014930;ENST00000535636;ENST00000536942	T;T;T	0.29917	1.55;1.55;1.55	5.66	-7.55	0.01327	Regulatory factor, effector, bacterial (1);	0.369103	0.32444	N	0.006085	T	0.11410	0.0278	N	0.04768	-0.165	0.24371	N	0.994832	B	0.02656	0.0	B	0.06405	0.002	T	0.11227	-1.0596	10	0.18710	T	0.47	0.2941	15.2409	0.73468	0.0:0.5427:0.0:0.4573	.	120	Q9NRV9	HEBP1_HUMAN	I	120;49;120	ENSP00000014930:V120I;ENSP00000442020:V49I;ENSP00000441678:V120I	ENSP00000014930:V120I	V	-	1	0	HEBP1	13031393	0.971000	0.33674	0.002000	0.10522	0.184000	0.23303	-0.086000	0.11233	-1.632000	0.01541	-0.793000	0.03317	GTT		0.488	HEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401001.1			20	142	0	0	0	0.001523	0	20	142				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr12:25398285C>A	ENST00000256078.4	-	2	97	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	KRAS_ENST00000556131.1_Missense_Mutation_p.G12C|KRAS_ENST00000557334.1_Missense_Mutation_p.G12C|KRAS_ENST00000311936.3_Missense_Mutation_p.G12C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>TGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>T	12.37:g.25398285C>A	ENSP00000256078:p.Gly12Cys	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	p.G12C	NM_033360	NP_203524	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>T	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676185	0.88445	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.91833	0.5477	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	C	12	ENSP00000308495:G12C;ENSP00000452512:G12C;ENSP00000256078:G12C;ENSP00000451856:G12C	ENSP00000256078:G12C	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		12	22	1	0	1.49906e-05	0.00245	1.72911e-05	12	22				
ANO6	196527	broad.mit.edu	37	12	45725191	45725191	+	Silent	SNP	A	A	C	rs373168816		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr12:45725191A>C	ENST00000320560.8	+	3	466	c.264A>C	c.(262-264)acA>acC	p.T88T	ANO6_ENST00000426898.2_3'UTR|ANO6_ENST00000441606.2_Silent_p.T70T|ANO6_ENST00000435642.1_Silent_p.T88T|ANO6_ENST00000425752.2_Silent_p.T88T|ANO6_ENST00000423947.3_Silent_p.T109T	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	88					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						AAAAGGGTACAAATGAAAAAC	0.299																																							uc001roo.2		NA																	0				ovary(1)|kidney(1)	2						c.(262-264)ACA>ACC		anoctamin 6 isoform a							74.0	77.0	76.0					12																	45725191		2202	4300	6502	SO:0001819	synonymous_variant	196527				activation of blood coagulation via clotting cascade|phosphatidylserine exposure on blood platelet	chloride channel complex|plasma membrane	chloride channel activity	g.chr12:45725191A>C	AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.264A>C	12.37:g.45725191A>C						ANO6_uc010sld.1_Silent_p.T88T|ANO6_uc010sle.1_Silent_p.T88T|ANO6_uc010slf.1_Silent_p.T109T|ANO6_uc010slg.1_Silent_p.T70T	p.T88T	NM_001025356	NP_001020527	Q4KMQ2	ANO6_HUMAN			3	599	+			88			Cytoplasmic (Potential).		A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Silent	SNP	ENST00000320560.8	37	c.264A>C	CCDS31782.1																																																																																				0.299	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404822.1	XM_113743		13	24	0	0	0	0.00245	0	13	24				
COL2A1	1280	broad.mit.edu	37	12	48387269	48387269	+	Missense_Mutation	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr12:48387269G>A	ENST00000380518.3	-	15	1105	c.941C>T	c.(940-942)cCg>cTg	p.P314L	COL2A1_ENST00000337299.6_Missense_Mutation_p.P245L	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	314	Triple-helical region.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GTTCTCACCCGGGGAACCACT	0.542																																							uc001rqu.2		NA																	0				ovary(1)|skin(1)	2						c.(940-942)CCG>CTG		collagen, type II, alpha 1 isoform 1 precursor	Collagenase(DB00048)						90.0	83.0	85.0					12																	48387269		2203	4300	6503	SO:0001583	missense	1280				axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding	g.chr12:48387269G>A	X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.941C>T	12.37:g.48387269G>A	ENSP00000369889:p.Pro314Leu					COL2A1_uc001rqv.2_Missense_Mutation_p.P245L	p.P314L	NM_001844	NP_001835	P02458	CO2A1_HUMAN			15	1122	-		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)	314			Triple-helical region.		A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	ENST00000380518.3	37	c.941C>T	CCDS41778.1	.	.	.	.	.	.	.	.	.	.	G	17.51	3.408207	0.62399	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.94184	-3.37;-3.37	4.64	4.64	0.57946	.	0.217348	0.38111	N	0.001804	D	0.94331	0.8178	M	0.88640	2.97	0.51767	D	0.999938	B;B	0.19200	0.027;0.034	B;B	0.22386	0.023;0.039	D	0.93247	0.6631	10	0.72032	D	0.01	.	16.8276	0.85935	0.0:0.0:1.0:0.0	.	245;314	P02458-1;P02458	.;CO2A1_HUMAN	L	314;245;245	ENSP00000369889:P314L;ENSP00000338213:P245L	ENSP00000338213:P245L	P	-	2	0	COL2A1	46673536	0.993000	0.37304	0.989000	0.46669	0.973000	0.67179	7.090000	0.76916	2.583000	0.87209	0.655000	0.94253	CCG		0.542	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844		7	35	0	0	0	0.001984	0	7	35				
EIF4B	1975	broad.mit.edu	37	12	53427616	53427616	+	Missense_Mutation	SNP	C	C	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr12:53427616C>G	ENST00000262056.9	+	9	1332	c.1006C>G	c.(1006-1008)Cta>Gta	p.L336V	EIF4B_ENST00000416762.3_Missense_Mutation_p.L297V|RP11-983P16.4_ENST00000552905.1_RNA|EIF4B_ENST00000420463.3_Missense_Mutation_p.L336V	NM_001417.4	NP_001408.2	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	336					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation initiation factor activity (GO:0003743)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)	22						CAAACTGAATCTAAAGCCTCG	0.458																																							uc001sbh.3		NA																	0				breast(1)|kidney(1)	2						c.(1006-1008)CTA>GTA		eukaryotic translation initiation factor 4B							67.0	63.0	64.0					12																	53427616		1812	4077	5889	SO:0001583	missense	1975				insulin receptor signaling pathway|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	nucleotide binding|translation initiation factor activity	g.chr12:53427616C>G	X55733	CCDS41788.1, CCDS73474.1	12q13.13	2013-02-12			ENSG00000063046	ENSG00000063046		"""RNA binding motif (RRM) containing"""	3285	protein-coding gene	gene with protein product		603928					Standard	XM_005268709		Approved		uc001sbh.4	P23588	OTTHUMG00000169570	ENST00000262056.9:c.1006C>G	12.37:g.53427616C>G	ENSP00000262056:p.Leu336Val					EIF4B_uc010snu.1_Missense_Mutation_p.L336V|EIF4B_uc010snv.1_Missense_Mutation_p.L297V|EIF4B_uc001sbi.2_Missense_Mutation_p.L88V	p.L336V	NM_001417	NP_001408	P23588	IF4B_HUMAN			9	1212	+			336					Q4G0E3|Q53HQ2|Q6GPH5|Q6IB46|Q8WYK5	Missense_Mutation	SNP	ENST00000262056.9	37	c.1006C>G	CCDS41788.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.311216	0.81358	.	.	ENSG00000063046	ENST00000262056;ENST00000420463;ENST00000430205;ENST00000416762;ENST00000549481	D;T;T	0.94092	-3.35;-0.38;0.09	5.0	5.0	0.66597	.	0.162233	0.41396	D	0.000885	D	0.96731	0.8933	M	0.80616	2.505	0.58432	D	0.999998	D;D;D;D	0.76494	0.999;0.997;0.999;0.998	D;D;D;D	0.85130	0.997;0.978;0.99;0.994	D	0.97095	0.9793	10	0.87932	D	0	.	17.7522	0.88438	0.0:1.0:0.0:0.0	.	297;336;312;336	B4DS13;E7EX17;E7EPC9;P23588	.;.;.;IF4B_HUMAN	V	336;336;312;297;291	ENSP00000262056:L336V;ENSP00000388806:L336V;ENSP00000449746:L291V	ENSP00000262056:L336V	L	+	1	2	EIF4B	51713883	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	6.924000	0.75823	2.711000	0.92665	0.460000	0.39030	CTA		0.458	EIF4B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404852.2	NM_001417		13	40	0	0	0	0.001855	0	13	40				
DPY19L2	283417	broad.mit.edu	37	12	64041052	64041052	+	Missense_Mutation	SNP	G	G	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr12:64041052G>C	ENST00000324472.4	-	5	865	c.682C>G	c.(682-684)Cct>Gct	p.P228A	RP11-415I12.3_ENST00000509615.2_RNA	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	228					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		TCATTAAGAGGTTCTATTCTG	0.318																																							uc001srp.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(682-684)CCT>GCT		dpy-19-like 2							36.0	39.0	38.0					12																	64041052		2198	4288	6486	SO:0001583	missense	283417				multicellular organismal development|spermatid development	integral to membrane		g.chr12:64041052G>C		CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.682C>G	12.37:g.64041052G>C	ENSP00000315988:p.Pro228Ala					DPY19L2_uc009zqk.1_RNA	p.P228A	NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)	5	863	-			228					A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	ENST00000324472.4	37	c.682C>G	CCDS31851.1	.	.	.	.	.	.	.	.	.	.	G	7.125	0.578664	0.13686	.	.	ENSG00000177990	ENST00000324472	T	0.39229	1.09	2.35	0.0401	0.14207	.	0.416749	0.23724	U	0.045189	T	0.31638	0.0803	L	0.60455	1.87	0.22066	N	0.999389	B	0.25667	0.131	B	0.29440	0.102	T	0.13926	-1.0491	9	.	.	.	.	3.0816	0.06264	0.1862:0.2891:0.5247:0.0	.	228	Q6NUT2	D19L2_HUMAN	A	228	ENSP00000315988:P228A	.	P	-	1	0	DPY19L2	62327319	0.997000	0.39634	0.884000	0.34674	0.741000	0.42261	0.699000	0.25586	0.309000	0.22966	0.184000	0.17185	CCT		0.318	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400689.2	NM_173812		19	39	0	0	0	0.001523	0	19	39				
PTPRR	5801	broad.mit.edu	37	12	71029742	71029742	+	IGR	SNP	A	A	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr12:71029742A>G	ENST00000283228.2	-	0	3529				PTPRB_ENST00000334414.6_Missense_Mutation_p.W54R|PTPRB_ENST00000538174.2_5'UTR|PTPRR_ENST00000537619.2_5'Flank|PTPRB_ENST00000551525.1_Missense_Mutation_p.W53R|PTPRB_ENST00000550358.1_Missense_Mutation_p.W54R	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R						ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		TCCTCAGTCCACATCCACTGC	0.512																																							uc001swc.3		NA																	0				lung(2)|skin(1)	3						c.(160-162)TGG>CGG		protein tyrosine phosphatase, receptor type, B							90.0	89.0	89.0					12																	71029742		2040	4172	6212	SO:0001628	intergenic_variant	5787				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr12:71029742A>G	D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502		12.37:g.71029742A>G						PTPRB_uc001swa.3_Missense_Mutation_p.W54R|PTPRB_uc001swd.3_Missense_Mutation_p.W53R|PTPRB_uc009zrr.1_Missense_Mutation_p.W54R|PTPRB_uc001swe.2_Missense_Mutation_p.W54R	p.W54R	NM_001109754	NP_001103224	P23467	PTPRB_HUMAN	GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)		2	204	-	Renal(347;0.236)		Error:Variant_position_missing_in_P23467_after_alignment					B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Missense_Mutation	SNP	ENST00000283228.2	37	c.160T>C	CCDS8998.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.988878	0.74589	.	.	ENSG00000127329	ENST00000334414;ENST00000550358;ENST00000544694;ENST00000551525;ENST00000548122	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	6.04	6.04	0.98038	.	.	.	.	.	T	0.44871	0.1314	L	0.29908	0.895	0.80722	D	1	D;D;D;P;P	0.71674	0.974;0.998;0.992;0.928;0.928	P;D;P;P;P	0.69824	0.723;0.966;0.891;0.734;0.734	T	0.39502	-0.9611	9	0.62326	D	0.03	.	16.5885	0.84745	1.0:0.0:0.0:0.0	.	54;54;53;54;54	Q6ZR19;Q6ZTX7;F8VSD5;P23467-3;F8VU56	.;.;.;.;.	R	54;54;54;53;54	ENSP00000334928:W54R;ENSP00000448058:W54R;ENSP00000448349:W53R;ENSP00000446982:W54R	ENSP00000334928:W54R	W	-	1	0	PTPRB	69316009	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	6.778000	0.75043	2.317000	0.78254	0.460000	0.39030	TGG		0.512	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404485.1	NM_002849		8	14	0	0	0	0.004482	0	8	14				
KCNC2	3747	broad.mit.edu	37	12	75601467	75601467	+	Silent	SNP	G	G	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr12:75601467G>C	ENST00000549446.1	-	2	977	c.297C>G	c.(295-297)ggC>ggG	p.G99G	KCNC2_ENST00000393288.2_Silent_p.G99G|KCNC2_ENST00000550433.1_Silent_p.G99G|KCNC2_ENST00000298972.1_Silent_p.G99G|KCNC2_ENST00000350228.2_Silent_p.G99G|KCNC2_ENST00000540018.1_Silent_p.G99G|KCNC2_ENST00000341669.3_Silent_p.G99G|KCNC2_ENST00000548513.1_Silent_p.G99G	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	99	Gly/Pro-rich (insert).				action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	AGAACTCGCGGCCGCCACCGG	0.731																																							uc001sxg.1		NA																	0				breast(2)|pancreas(2)|skin(1)|lung(1)	6						c.(295-297)GGC>GGG		Shaw-related voltage-gated potassium channel							8.0	11.0	10.0					12																	75601467		2188	4283	6471	SO:0001819	synonymous_variant	3747				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr12:75601467G>C	AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.297C>G	12.37:g.75601467G>C						KCNC2_uc009zry.2_Silent_p.G99G|KCNC2_uc001sxe.2_Silent_p.G99G|KCNC2_uc001sxf.2_Silent_p.G99G|KCNC2_uc010stw.1_Silent_p.G99G	p.G99G	NM_139137	NP_631875	Q96PR1	KCNC2_HUMAN			2	841	-			99			Gly/Pro-rich (insert).|Cytoplasmic (Potential).		B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Silent	SNP	ENST00000549446.1	37	c.297C>G	CCDS9007.1																																																																																				0.731	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748		4	6	0	0	0	0.001168	0	4	6				
DNAH10	196385	broad.mit.edu	37	12	124414242	124414242	+	Missense_Mutation	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr12:124414242C>T	ENST00000409039.3	+	71	12219	c.12194C>T	c.(12193-12195)aCg>aTg	p.T4065M	CCDC92_ENST00000544798.1_Intron|DNAH10OS_ENST00000514254.2_3'UTR	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4065					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T4065M(1)|p.T2657M(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		ACGTACTTAACGAAAGCCTTC	0.507																																							uc001uft.3		NA																	2	Substitution - Missense(2)		breast(2)	ovary(3)|skin(2)|central_nervous_system(1)	6						c.(12193-12195)ACG>ATG		dynein, axonemal, heavy chain 10							48.0	46.0	46.0					12																	124414242		1886	4116	6002	SO:0001583	missense	196385				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr12:124414242C>T	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.12194C>T	12.37:g.124414242C>T	ENSP00000386770:p.Thr4065Met					DNAH10_uc001ufu.3_Translation_Start_Site	p.T4065M	NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	71	12219	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		4065					C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	c.12194C>T	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	15.42	2.828216	0.50845	.	.	ENSG00000197653	ENST00000409039	T	0.08896	3.04	5.06	5.06	0.68205	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.26593	0.0650	M	0.67625	2.065	0.80722	D	1	D	0.61697	0.99	P	0.61397	0.888	T	0.00749	-1.1582	10	0.72032	D	0.01	.	18.7829	0.91941	0.0:1.0:0.0:0.0	.	4065	Q8IVF4	DYH10_HUMAN	M	4065	ENSP00000386770:T4065M	ENSP00000386770:T4065M	T	+	2	0	DNAH10	122980195	0.998000	0.40836	0.313000	0.25210	0.127000	0.20565	3.815000	0.55651	2.519000	0.84933	0.655000	0.94253	ACG		0.507	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3			4	23	0	0	0	0.000248	0	4	23				
CDK8	1024	broad.mit.edu	37	13	26974666	26974666	+	Missense_Mutation	SNP	A	A	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr13:26974666A>T	ENST00000381527.3	+	10	1513	c.1010A>T	c.(1009-1011)gAa>gTa	p.E337V	CDK8_ENST00000480323.1_3'UTR|CDK8_ENST00000536792.1_3'UTR	NM_001260.1	NP_001251.1	P49336	CDK8_HUMAN	cyclin-dependent kinase 8	337					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	25	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		TATTTCTTAGAAGACCCACTT	0.423																																							uc001uqr.1		NA																	0				lung(2)|large_intestine(1)|ovary(1)|skin(1)	5						c.(1009-1011)GAA>GTA		cyclin-dependent kinase 8							167.0	155.0	159.0					13																	26974666		2203	4300	6503	SO:0001583	missense	1024				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity	g.chr13:26974666A>T	X85753	CCDS9317.1	13q12	2011-11-08			ENSG00000132964	ENSG00000132964		"""Cyclin-dependent kinases"""	1779	protein-coding gene	gene with protein product		603184				7568034	Standard	NM_001260		Approved	K35	uc001uqr.1	P49336	OTTHUMG00000016617	ENST00000381527.3:c.1010A>T	13.37:g.26974666A>T	ENSP00000370938:p.Glu337Val					CDK8_uc001uqs.1_Missense_Mutation_p.E337V|CDK8_uc001uqt.1_Missense_Mutation_p.E164V	p.E337V	NM_001260	NP_001251	P49336	CDK8_HUMAN		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)	10	1036	+	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)	337					Q5VUF3|Q6ISB5	Missense_Mutation	SNP	ENST00000381527.3	37	c.1010A>T	CCDS9317.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.888359	0.91814	.	.	ENSG00000132964	ENST00000381527	T	0.48522	0.81	5.8	5.8	0.92144	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.70649	0.3248	M	0.80422	2.495	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.80764	0.994;0.986	T	0.74025	-0.3797	10	0.56958	D	0.05	-13.3055	16.1363	0.81491	1.0:0.0:0.0:0.0	.	337;337	P49336-2;P49336	.;CDK8_HUMAN	V	337	ENSP00000370938:E337V	ENSP00000370938:E337V	E	+	2	0	CDK8	25872666	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.904000	0.92590	2.219000	0.72066	0.528000	0.53228	GAA		0.423	CDK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044250.1			47	33	0	0	0	0.00361	0	47	33				
TDRD3	81550	broad.mit.edu	37	13	61103023	61103023	+	Missense_Mutation	SNP	A	A	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr13:61103023A>G	ENST00000196169.3	+	11	2173	c.1385A>G	c.(1384-1386)aAt>aGt	p.N462S	TDRD3_ENST00000377894.2_Missense_Mutation_p.N462S|TDRD3_ENST00000377881.2_Missense_Mutation_p.N462S|TDRD3_ENST00000535286.1_Missense_Mutation_p.N555S	NM_001146071.1|NM_030794.2	NP_001139543.1|NP_110421.1	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3	462					chromatin modification (GO:0016568)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	40		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		CAAACAATAAATAATGAAGCT	0.284																																					Colon(36;164 906 35820 50723)	Colon(36;164 906 35820 50723)	uc001via.2		NA																	0				upper_aerodigestive_tract(1)|skin(1)	2						c.(1384-1386)AAT>AGT		tudor domain containing 3 isoform 2							32.0	37.0	35.0					13																	61103023		2196	4294	6490	SO:0001583	missense	81550				chromatin modification	cytoplasm|nucleus	chromatin binding|methylated histone residue binding|nucleic acid binding|transcription coactivator activity	g.chr13:61103023A>G	AK023578	CCDS9441.1, CCDS53872.1	13q14.3	2013-01-23			ENSG00000083544	ENSG00000083544		"""Tudor domain containing"""	20612	protein-coding gene	gene with protein product		614392					Standard	NM_030794		Approved	FLJ21007	uc010aeg.3	Q9H7E2	OTTHUMG00000017007	ENST00000196169.3:c.1385A>G	13.37:g.61103023A>G	ENSP00000196169:p.Asn462Ser					TDRD3_uc010aef.2_Missense_Mutation_p.N287S|TDRD3_uc001vhz.3_Missense_Mutation_p.N462S|TDRD3_uc010aeg.2_Missense_Mutation_p.N555S|TDRD3_uc001vib.3_Missense_Mutation_p.N461S	p.N462S	NM_030794	NP_110421	Q9H7E2	TDRD3_HUMAN		GBM - Glioblastoma multiforme(99;0.000291)	11	2173	+		Prostate(109;0.173)|Breast(118;0.174)	462					B2MWP9|Q53XA6|Q6P992	Missense_Mutation	SNP	ENST00000196169.3	37	c.1385A>G	CCDS9441.1	.	.	.	.	.	.	.	.	.	.	A	9.909	1.208944	0.22205	.	.	ENSG00000083544	ENST00000196169;ENST00000377881;ENST00000377894;ENST00000535286	D;D;D;D	0.93906	-3.31;-3.31;-3.31;-3.31	5.84	-4.67	0.03319	.	0.739408	0.14277	N	0.329756	D	0.82930	0.5144	N	0.17474	0.49	0.34313	D	0.685712	B;B;B	0.11235	0.004;0.001;0.0	B;B;B	0.13407	0.009;0.004;0.002	T	0.66551	-0.5895	9	.	.	.	-8.0228	10.1926	0.43035	0.3005:0.121:0.5785:0.0	.	555;461;462	Q9H7E2-3;Q9H7E2-2;Q9H7E2	.;.;TDRD3_HUMAN	S	462;462;462;555	ENSP00000196169:N462S;ENSP00000367113:N462S;ENSP00000367126:N462S;ENSP00000440190:N555S	.	N	+	2	0	TDRD3	60001024	0.950000	0.32346	0.884000	0.34674	0.980000	0.70556	-0.026000	0.12392	-0.595000	0.05828	-0.417000	0.06048	AAT		0.284	TDRD3-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045175.2	NM_030794		34	19	0	0	0	0.002836	0	34	19				
SLITRK1	114798	broad.mit.edu	37	13	84454777	84454778	+	Missense_Mutation	DNP	GG	GG	AT	rs202070945		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr13:84454777_84454778GG>AT	ENST00000377084.2	-	1	1750_1751	c.865_866CC>AT	c.(865-867)CCt>ATt	p.P289I		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	289					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.P289H(1)|p.P289L(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TGTCTTGAAAGGAGTTGGCAGG	0.54																																							uc001vlk.2		NA																	2	Substitution - Missense(2)		large_intestine(1)|skin(1)	ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(865-867)CCT>ATT		slit and trk like 1 protein precursor																																				SO:0001583	missense	114798					integral to membrane		g.chr13:84454777_84454778GG>AT	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.865_866delinsAT	13.37:g.84454777_84454778delinsAT	ENSP00000366288:p.Pro289Ile						p.P289I	NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN		GBM - Glioblastoma multiforme(99;0.07)	1	1751_1752	-	Medulloblastoma(90;0.18)	Breast(118;0.212)	289			Extracellular (Potential).		Q5U5I6|Q96SF9	Missense_Mutation	DNP	ENST00000377084.2	37	c.865_866CC>AT	CCDS9464.1																																																																																				0.540	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910		12	15	0	0	0	0.004672	0	12	15				
RABGGTA	5875	broad.mit.edu	37	14	24738879	24738879	+	Missense_Mutation	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr14:24738879C>T	ENST00000399409.3	-	5	932	c.449G>A	c.(448-450)cGg>cAg	p.R150Q	RABGGTA_ENST00000560777.1_5'UTR|RABGGTA_ENST00000559586.1_5'UTR|RABGGTA_ENST00000216840.6_Missense_Mutation_p.R150Q	NM_004581.5	NP_004572.3	Q92696	PGTA_HUMAN	Rab geranylgeranyltransferase, alpha subunit	150					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)	12				GBM - Glioblastoma multiforme(265;0.0184)		GGCCACAAACCGCCGATAGTC	0.582																																							uc001wof.2		NA																	0					0						c.(448-450)CGG>CAG		Rab geranylgeranyltransferase alpha							28.0	37.0	34.0					14																	24738879		2046	4170	6216	SO:0001583	missense	5875				visual perception		Rab geranylgeranyltransferase activity|zinc ion binding	g.chr14:24738879C>T		CCDS45088.1	14q11.2	2011-06-27				ENSG00000100949		"""Prenyltransferase alpha subunit repeat containing"""	9795	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 3"""	601905				8954794	Standard	NM_182836		Approved	PTAR3	uc001wog.4	Q92696		ENST00000399409.3:c.449G>A	14.37:g.24738879C>T	ENSP00000382341:p.Arg150Gln					RABGGTA_uc001woe.2_RNA|RABGGTA_uc001wog.2_Missense_Mutation_p.R150Q|RABGGTA_uc001woh.2_RNA|RABGGTA_uc001woi.2_RNA	p.R150Q	NM_004581	NP_004572	Q92696	PGTA_HUMAN		GBM - Glioblastoma multiforme(265;0.0184)	5	871	-			150			PFTA 3.		A8K5N2|D3DS69	Missense_Mutation	SNP	ENST00000399409.3	37	c.449G>A	CCDS45088.1	.	.	.	.	.	.	.	.	.	.	C	32	5.124558	0.94429	.	.	ENSG00000100949	ENST00000216840;ENST00000399409;ENST00000543002	T;T	0.48522	0.81;0.81	5.41	5.41	0.78517	Protein prenyltransferase (1);	0.000000	0.85682	D	0.000000	T	0.61874	0.2382	L	0.48260	1.515	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	T	0.56220	-0.8015	10	0.30854	T	0.27	-24.6058	17.9632	0.89092	0.0:1.0:0.0:0.0	.	150	Q92696	PGTA_HUMAN	Q	150;150;113	ENSP00000216840:R150Q;ENSP00000382341:R150Q	ENSP00000216840:R150Q	R	-	2	0	RABGGTA	23808719	1.000000	0.71417	0.999000	0.59377	0.955000	0.61496	6.684000	0.74538	2.536000	0.85505	0.462000	0.41574	CGG		0.582	RABGGTA-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415308.5	NM_182836		11	21	0	0	0	0.001368	0	11	21				
AKAP6	9472	broad.mit.edu	37	14	33291383	33291383	+	Missense_Mutation	SNP	G	G	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr14:33291383G>C	ENST00000280979.4	+	13	4534	c.4364G>C	c.(4363-4365)gGa>gCa	p.G1455A	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1455					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GACTGTTTGGGAGAAGAATTA	0.363																																					Melanoma(49;821 1200 7288 13647 42351)	Melanoma(49;821 1200 7288 13647 42351)	uc001wrq.2		NA																	0				breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21						c.(4363-4365)GGA>GCA		A-kinase anchor protein 6							67.0	66.0	67.0					14																	33291383		2203	4300	6503	SO:0001583	missense	9472				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding	g.chr14:33291383G>C	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.4364G>C	14.37:g.33291383G>C	ENSP00000280979:p.Gly1455Ala						p.G1455A	NM_004274	NP_004265	Q13023	AKAP6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)	13	4534	+	Breast(36;0.0388)|Prostate(35;0.15)		1455					A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	37	c.4364G>C	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	G	10.51	1.370666	0.24771	.	.	ENSG00000151320	ENST00000280979	T	0.05081	3.5	5.55	4.55	0.56014	.	0.162086	0.42821	D	0.000642	T	0.05318	0.0141	L	0.51422	1.61	0.80722	D	1	P	0.38195	0.622	B	0.30179	0.112	T	0.17745	-1.0359	10	0.59425	D	0.04	-14.3448	4.2016	0.10469	0.2489:0.0:0.7511:0.0	.	1455	Q13023	AKAP6_HUMAN	A	1455	ENSP00000280979:G1455A	ENSP00000280979:G1455A	G	+	2	0	AKAP6	32361134	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.603000	0.46266	2.606000	0.88127	0.563000	0.77884	GGA		0.363	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274		24	38	0	0	0	0.00278	0	24	38				
MDGA2	161357	broad.mit.edu	37	14	47566205	47566205	+	Silent	SNP	G	G	A	rs377335394		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr14:47566205G>A	ENST00000399232.2	-	6	1204	c.840C>T	c.(838-840)tcC>tcT	p.S280S	MDGA2_ENST00000426342.1_Silent_p.S51S|MDGA2_ENST00000357362.3_Silent_p.S51S|MDGA2_ENST00000439988.3_Silent_p.S349S	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	280	Ig-like 3.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						GAGTCCCAAAGGACCTGACCC	0.468																																							uc001wwj.3		NA																	0				ovary(4)|large_intestine(1)|pancreas(1)	6						c.(838-840)TCC>TCT		MAM domain containing 1 isoform 1		G	,	0,3834		0,0,1917	128.0	123.0	125.0		1047,153	3.8	1.0	14		125	2,8246		0,2,4122	no	coding-synonymous,coding-synonymous	MDGA2	NM_001113498.2,NM_182830.3	,	0,2,6039	AA,AG,GG		0.0242,0.0,0.0166	,	349/1026,51/728	47566205	2,12080	1917	4124	6041	SO:0001819	synonymous_variant	161357				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane		g.chr14:47566205G>A	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.840C>T	14.37:g.47566205G>A						MDGA2_uc001wwi.3_Silent_p.S51S|MDGA2_uc010ani.2_5'UTR	p.S280S	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN			6	1036	-			280			Ig-like 3.		F6W3S7|J3KPX6	Silent	SNP	ENST00000399232.2	37	c.840C>T		.	.	.	.	.	.	.	.	.	.	G	9.529	1.110225	0.20714	0.0	2.42E-4	ENSG00000139915	ENST00000554762	.	.	.	5.65	3.81	0.43845	.	.	.	.	.	T	0.54224	0.1845	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49312	-0.8953	4	.	.	.	.	5.1655	0.15082	0.0744:0.2712:0.5143:0.1402	.	.	.	.	F	55	.	.	L	-	1	0	MDGA2	46635955	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.102000	0.31050	0.838000	0.34948	0.650000	0.86243	CTT		0.468	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830		30	58	0	0	0	0.001786	0	30	58				
RTN1	6252	broad.mit.edu	37	14	60194383	60194384	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr14:60194383_60194384GG>CT	ENST00000267484.5	-	3	1353_1354	c.1018_1019CC>AG	c.(1018-1020)CCa>AGa	p.P340R		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	340					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		TGCAGCAGATGGTTCTGTCGTC	0.53																																							uc001xen.1		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(1018-1020)CCA>AGA		reticulon 1 isoform A																																				SO:0001583	missense	6252				neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity	g.chr14:60194383_60194384GG>CT	L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.1018_1019delinsCT	14.37:g.60194383_60194384delinsCT	ENSP00000267484:p.Pro340Arg					RTN1_uc001xem.1_5'UTR	p.P340R	NM_021136	NP_066959	Q16799	RTN1_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0968)	3	1227_1228	-			340					Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	DNP	ENST00000267484.5	37	c.1018_1019CC>AG	CCDS9740.1																																																																																				0.530	RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2			7	11	0	0	0	0.004672	0	7	11				
ZFYVE26	23503	broad.mit.edu	37	14	68274527	68274527	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr14:68274527C>A	ENST00000347230.4	-	5	612	c.474G>T	c.(472-474)tgG>tgT	p.W158C	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.W158C	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	158					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TCAGGAGATCCCAGAGCACAG	0.602																																							uc001xka.2		NA																	0				ovary(9)|breast(2)	11						c.(472-474)TGG>TGT		zinc finger, FYVE domain containing 26							108.0	109.0	109.0					14																	68274527		2203	4300	6503	SO:0001583	missense	23503				cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding	g.chr14:68274527C>A	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.474G>T	14.37:g.68274527C>A	ENSP00000251119:p.Trp158Cys					ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Missense_Mutation_p.W158C|ZFYVE26_uc010tta.1_Missense_Mutation_p.W158C	p.W158C	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN		all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)	5	613	-			158					B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	c.474G>T	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.238756	0.58995	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.27720	1.8;1.65	5.98	5.98	0.97165	.	0.193873	0.46145	D	0.000303	T	0.44746	0.1308	L	0.60455	1.87	0.52501	D	0.999959	D;D;P	0.71674	0.998;0.996;0.953	P;P;B	0.61592	0.891;0.855;0.43	T	0.38735	-0.9647	10	0.56958	D	0.05	-5.5091	8.0524	0.30585	0.1433:0.7437:0.0:0.113	.	158;158;158	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	C	158	ENSP00000251119:W158C;ENSP00000450603:W158C	ENSP00000251119:W158C	W	-	3	0	ZFYVE26	67344280	1.000000	0.71417	1.000000	0.80357	0.729000	0.41735	1.400000	0.34577	2.837000	0.97791	0.591000	0.81541	TGG		0.602	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346		69	62	1	0	5.80444e-35	0.00361	9.94436e-35	69	62				
FLRT2	23768	broad.mit.edu	37	14	86088584	86088584	+	Silent	SNP	G	G	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr14:86088584G>C	ENST00000330753.4	+	2	1493	c.726G>C	c.(724-726)ctG>ctC	p.L242L	FLRT2_ENST00000554746.1_Silent_p.L242L	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	242					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		GTAATTCGCTGTCCCACCCTC	0.502																																							uc001xvr.2		NA																	0				ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4						c.(724-726)CTG>CTC		fibronectin leucine rich transmembrane protein 2							85.0	84.0	84.0					14																	86088584		2203	4300	6503	SO:0001819	synonymous_variant	23768				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity	g.chr14:86088584G>C	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.726G>C	14.37:g.86088584G>C						FLRT2_uc010atd.2_Silent_p.L242L	p.L242L	NM_013231	NP_037363	O43155	FLRT2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0319)	2	1493	+			242			Extracellular (Potential).|LRR 8.		A0AV84|B7ZLP3	Silent	SNP	ENST00000330753.4	37	c.726G>C	CCDS9877.1																																																																																				0.502	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1			47	61	0	0	0	0.002522	0	47	61				
C14orf159	80017	broad.mit.edu	37	14	91671070	91671070	+	Missense_Mutation	SNP	G	G	A	rs367885678		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr14:91671070G>A	ENST00000523771.1	+	12	2053	c.1450G>A	c.(1450-1452)Gag>Aag	p.E484K	C14orf159_ENST00000521077.2_Intron|C14orf159_ENST00000522322.1_Missense_Mutation_p.E484K|C14orf159_ENST00000428926.2_Missense_Mutation_p.E484K|C14orf159_ENST00000523816.1_Missense_Mutation_p.E484K|C14orf159_ENST00000412671.2_Missense_Mutation_p.E489K|C14orf159_ENST00000518868.1_Missense_Mutation_p.E489K|C14orf159_ENST00000256324.10_Missense_Mutation_p.E489K|C14orf159_ENST00000520328.1_Intron|C14orf159_ENST00000525393.2_Missense_Mutation_p.E360K			Q7Z3D6	CN159_HUMAN	chromosome 14 open reading frame 159	484						mitochondrion (GO:0005739)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		TGGAGGCAACGAGCTTGGGAT	0.602																																							uc001xzb.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(1450-1452)GAG>AAG		hypothetical protein LOC80017 isoform a		G	LYS/GLU,LYS/GLU,LYS/GLU,,LYS/GLU	0,4406		0,0,2203	143.0	92.0	110.0		1450,1450,1465,,1450	3.3	0.6	14		110	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,intron,missense	C14orf159	NM_001102366.1,NM_001102367.1,NM_001102368.1,NM_001102369.1,NM_024952.6	56,56,56,,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,,probably-damaging	484/617,484/617,489/622,,484/617	91671070	1,13005	2203	4300	6503	SO:0001583	missense	80017					mitochondrion		g.chr14:91671070G>A	AK097294	CCDS32141.1, CCDS41979.1, CCDS45150.1, CCDS66693.1, CCDS73677.1	14q32.11	2012-09-26			ENSG00000133943	ENSG00000133943			20498	protein-coding gene	gene with protein product							Standard	NM_001102367		Approved	FLJ39975	uc001xze.2	Q7Z3D6	OTTHUMG00000164980	ENST00000523771.1:c.1450G>A	14.37:g.91671070G>A	ENSP00000429655:p.Glu484Lys					C14orf159_uc001xyx.2_Intron|C14orf159_uc001xyw.2_Missense_Mutation_p.E489K|C14orf159_uc001xzc.2_Missense_Mutation_p.E484K|C14orf159_uc001xza.2_Missense_Mutation_p.E489K|C14orf159_uc001xyv.2_Intron|C14orf159_uc001xyz.2_Missense_Mutation_p.E360K|C14orf159_uc001xze.2_Missense_Mutation_p.E484K	p.E484K	NM_001102366	NP_001095836	Q7Z3D6	CN159_HUMAN		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)	14	2218	+		all_cancers(154;0.0191)|all_epithelial(191;0.241)	484					B3KUI7|Q86SW3|Q86SX8|Q86SX9|Q86T08|Q86TV5|Q96GW5|Q9H7G0|Q9H8Y9|Q9H9W6	Missense_Mutation	SNP	ENST00000523771.1	37	c.1450G>A	CCDS32141.1	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584535	0.65992	0.0	1.16E-4	ENSG00000133943	ENST00000256324;ENST00000518868;ENST00000523816;ENST00000525393;ENST00000428926;ENST00000522322;ENST00000523771;ENST00000412671	T;T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68	5.17	3.33	0.38152	.	0.178338	0.47852	D	0.000202	T	0.61502	0.2352	M	0.92738	3.34	0.44462	D	0.997396	P;D;P	0.57571	0.728;0.98;0.681	B;P;B	0.47673	0.164;0.554;0.102	T	0.69289	-0.5184	10	0.87932	D	0	.	10.4659	0.44607	0.074:0.1344:0.7917:0.0	.	484;360;489	Q7Z3D6;Q8NB88;Q7Z3D6-2	CN159_HUMAN;.;.	K	489;489;484;360;484;484;484;489	ENSP00000256324:E489K;ENSP00000428263:E489K;ENSP00000428974:E484K;ENSP00000435459:E360K;ENSP00000404343:E484K;ENSP00000427953:E484K;ENSP00000429655:E484K;ENSP00000404196:E489K	ENSP00000256324:E489K	E	+	1	0	C14orf159	90740823	1.000000	0.71417	0.587000	0.28692	0.373000	0.29922	5.085000	0.64468	0.568000	0.29311	0.591000	0.81541	GAG		0.602	C14orf159-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381273.1	NM_024952		5	11	0	0	0	0.000602	0	5	11				
SERPINA3	12	broad.mit.edu	37	14	95090116	95090116	+	Missense_Mutation	SNP	T	T	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr14:95090116T>C	ENST00000467132.1	+	5	2385	c.1237T>C	c.(1237-1239)Ttc>Ctc	p.F413L	SERPINA3_ENST00000393080.4_Missense_Mutation_p.F413L|SERPINA3_ENST00000393078.3_Missense_Mutation_p.F413L|RP11-986E7.7_ENST00000553947.1_3'UTR|SERPINA3_ENST00000482740.1_Missense_Mutation_p.F195L			P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	413					acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of endopeptidase activity (GO:0010951)|regulation of lipid metabolic process (GO:0019216)|regulation of proteolysis (GO:0030162)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	DNA binding (GO:0003677)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(17)|ovary(2)|pancreas(1)|skin(3)|stomach(1)	40		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		GAACATCTTCTTCATGAGCAA	0.498																																							uc001ydp.2		NA																	0				ovary(2)|central_nervous_system(2)|large_intestine(1)|skin(1)	6						c.(1237-1239)TTC>CTC		serpin peptidase inhibitor, clade A, member 3							176.0	154.0	161.0					14																	95090116		2203	4300	6503	SO:0001583	missense	12				acute-phase response|maintenance of gastrointestinal epithelium|regulation of lipid metabolic process|regulation of proteolysis	extracellular region|nucleus	DNA binding|protein binding|serine-type endopeptidase inhibitor activity	g.chr14:95090116T>C	K01500	CCDS32150.1	14q32.1	2014-06-03	2005-08-18		ENSG00000196136	ENSG00000196136		"""Serine (or cysteine) peptidase inhibitors"""	16	protein-coding gene	gene with protein product		107280	"""alpha-1-antichymotrypsin"", ""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3"""	AACT		3260956, 24172014	Standard	NM_001085		Approved	ACT, alpha-1-antichymotrypsin	uc001ydp.3	P01011	OTTHUMG00000029851	ENST00000467132.1:c.1237T>C	14.37:g.95090116T>C	ENSP00000450540:p.Phe413Leu					SERPINA3_uc001ydo.3_Missense_Mutation_p.F438L|SERPINA3_uc001ydr.2_RNA|SERPINA3_uc001ydq.2_Missense_Mutation_p.F413L|SERPINA3_uc001yds.2_Missense_Mutation_p.F413L|SERPINA3_uc010avg.2_Missense_Mutation_p.F413L	p.F413L	NM_001085	NP_001076	P01011	AACT_HUMAN		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)	5	1316	+		all_cancers(154;0.0525)|all_epithelial(191;0.179)	413					B3KVQ7|Q13703|Q2TU87|Q2TU88|Q59GP9|Q6LBY8|Q6LDT7|Q6NSC9|Q8N177|Q96DW8|Q9UC47|Q9UNU9	Missense_Mutation	SNP	ENST00000467132.1	37	c.1237T>C	CCDS32150.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.277757	0.80692	.	.	ENSG00000196136	ENST00000553947;ENST00000393078;ENST00000393080;ENST00000467132;ENST00000482740	D;D;D;D;D	0.91577	-2.87;-2.87;-2.87;-2.87;-2.87	4.99	3.82	0.43975	Serpin domain (3);	0.000000	0.64402	D	0.000003	D	0.95818	0.8639	H	0.94808	3.585	0.47153	D	0.999331	P;D	0.63046	0.853;0.992	P;D	0.65773	0.782;0.938	D	0.95411	0.8498	10	0.87932	D	0	.	10.1182	0.42605	0.0:0.0817:0.0:0.9183	.	413;438	P01011;G3V5I3	AACT_HUMAN;.	L	438;413;413;413;195	ENSP00000452367:F438L;ENSP00000376793:F413L;ENSP00000376795:F413L;ENSP00000450540:F413L;ENSP00000451119:F195L	ENSP00000376793:F413L	F	+	1	0	SERPINA3	94159869	1.000000	0.71417	0.048000	0.18961	0.003000	0.03518	7.584000	0.82572	0.819000	0.34492	0.460000	0.39030	TTC		0.498	SERPINA3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268080.3	NM_001085		4	108	0	0	0	0.000602	0	4	108				
CKB	1152	broad.mit.edu	37	14	103988639	103988639	+	Splice_Site	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr14:103988639C>T	ENST00000348956.2	-	2	549	c.192G>A	c.(190-192)ccG>ccA	p.P64P	RP11-600F24.7_ENST00000568177.1_RNA	NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	64	Phosphagen kinase N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00842}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	GTCGCGTACCCGGGTTGTCCA	0.741																																					Esophageal Squamous(186;2492 2823 49929 50127)	Esophageal Squamous(186;2492 2823 49929 50127)	uc001ynf.1		NA																	0					0						c.(190-192)CCG>CCA		brain creatine kinase	Creatine(DB00148)						25.0	27.0	26.0					14																	103988639		2196	4295	6491	SO:0001630	splice_region_variant	1152				creatine metabolic process	cytosol	ATP binding|creatine kinase activity	g.chr14:103988639C>T		CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.193+1G>A	14.37:g.103988639C>T						CKB_uc001yne.1_5'Flank|CKB_uc010awr.1_Intron	p.P64P	NM_001823	NP_001814	P12277	KCRB_HUMAN	Epithelial(46;0.14)		2	272	-		Melanoma(154;0.155)	64			Phosphagen kinase N-terminal.		A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Silent	SNP	ENST00000348956.2	37	c.192G>A	CCDS9981.1																																																																																				0.741	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415111.1		Silent	5	13	0	0	0	0.000602	0	5	13				
ARHGAP11A	9824	broad.mit.edu	37	15	32929215	32929215	+	Missense_Mutation	SNP	C	C	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr15:32929215C>G	ENST00000361627.3	+	12	2963	c.2241C>G	c.(2239-2241)aaC>aaG	p.N747K	ARHGAP11A_ENST00000565905.1_Missense_Mutation_p.N558K|ARHGAP11A_ENST00000543522.1_Missense_Mutation_p.N558K	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	747					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		TGGAAGGTAACTTACCGAAGT	0.383																																					Colon(45;757 1134 30003 36652)	Colon(45;757 1134 30003 36652)	uc001zgy.1		NA																	0				skin(3)|breast(2)|urinary_tract(1)	6						c.(2239-2241)AAC>AAG		Rho GTPase activating protein 11A isoform 1							60.0	58.0	59.0					15																	32929215		2201	4300	6501	SO:0001583	missense	9824				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr15:32929215C>G	D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.2241C>G	15.37:g.32929215C>G	ENSP00000355090:p.Asn747Lys					ARHGAP11A_uc010ubw.1_Missense_Mutation_p.N558K|ARHGAP11A_uc010ubx.1_Missense_Mutation_p.N558K	p.N747K	NM_014783	NP_055598	Q6P4F7	RHGBA_HUMAN		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	12	2963	+		all_lung(180;1.3e-11)	747					B4DZN9|Q6PI96|Q9Y3S6	Missense_Mutation	SNP	ENST00000361627.3	37	c.2241C>G	CCDS10028.1	.	.	.	.	.	.	.	.	.	.	.	2.983	-0.209809	0.06140	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	T	0.09723	2.95	5.01	1.65	0.23941	.	0.373680	0.26082	N	0.026441	T	0.09423	0.0232	L	0.59436	1.845	0.09310	N	1	B	0.17852	0.024	B	0.15484	0.013	T	0.25117	-1.0141	10	0.29301	T	0.29	.	4.5568	0.12140	0.192:0.4938:0.0:0.3143	.	747	Q6P4F7	RHGBA_HUMAN	K	747;558	ENSP00000355090:N747K	ENSP00000355090:N747K	N	+	3	2	ARHGAP11A	30716507	0.001000	0.12720	0.113000	0.21522	0.036000	0.12997	0.322000	0.19576	0.584000	0.29591	0.650000	0.86243	AAC		0.383	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251417.1	NM_014783		22	36	0	0	0	0.001882	0	22	36				
SLC12A1	6557	broad.mit.edu	37	15	48551450	48551450	+	Missense_Mutation	SNP	A	A	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr15:48551450A>T	ENST00000558405.1	+	16	2110	c.2096A>T	c.(2095-2097)gAc>gTc	p.D699V	SLC12A1_ENST00000396577.3_Missense_Mutation_p.D699V|SLC12A1_ENST00000380993.3_Missense_Mutation_p.D699V			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	699					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	GCTCTCCTGGACATAACTCAC	0.502																																							uc001zwn.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2095-2097)GAC>GTC		sodium potassium chloride cotransporter 2	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)						195.0	170.0	178.0					15																	48551450		2198	4297	6495	SO:0001583	missense	6557				potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity	g.chr15:48551450A>T		CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.2096A>T	15.37:g.48551450A>T	ENSP00000453409:p.Asp699Val					SLC12A1_uc010uew.1_Missense_Mutation_p.D505V|SLC12A1_uc010bem.2_Missense_Mutation_p.D699V|SLC12A1_uc001zwq.3_Missense_Mutation_p.D470V|SLC12A1_uc001zwr.3_Missense_Mutation_p.D426V	p.D699V	NM_000338	NP_000329	Q13621	S12A1_HUMAN		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	17	2312	+		all_lung(180;0.00219)	699					A8JYA2|E9PDW4	Missense_Mutation	SNP	ENST00000558405.1	37	c.2096A>T	CCDS10129.2	.	.	.	.	.	.	.	.	.	.	A	24.2	4.507978	0.85282	.	.	ENSG00000074803	ENST00000428362;ENST00000380993;ENST00000396577;ENST00000546071	D;D	0.91407	-2.84;-2.84	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.95332	0.8485	M	0.79693	2.465	0.80722	D	1	D;D	0.89917	1.0;0.984	D;P	0.91635	0.999;0.811	D	0.95881	0.8899	10	0.87932	D	0	.	15.8568	0.78983	1.0:0.0:0.0:0.0	.	699;699	E9PDW4;Q13621	.;S12A1_HUMAN	V	512;699;699;93	ENSP00000370381:D699V;ENSP00000379822:D699V	ENSP00000370381:D699V	D	+	2	0	SLC12A1	46338742	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.263000	0.95617	2.205000	0.71048	0.454000	0.30748	GAC		0.502	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417131.1			34	89	0	0	0	0.004878	0	34	89				
DENND4A	10260	broad.mit.edu	37	15	65983463	65983463	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr15:65983463C>A	ENST00000431932.2	-	22	3545	c.3337G>T	c.(3337-3339)Gat>Tat	p.D1113Y	DENND4A_ENST00000443035.3_Missense_Mutation_p.D1156Y|DENND4A_ENST00000567323.1_5'Flank	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	1113					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						TCCACTTTATCTGCCAAATAG	0.363																																							uc002aph.2		NA																	0				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						c.(3337-3339)GAT>TAT		DENN/MADD domain containing 4A isoform 2							78.0	72.0	74.0					15																	65983463		1846	4086	5932	SO:0001583	missense	10260				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding	g.chr15:65983463C>A	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.3337G>T	15.37:g.65983463C>A	ENSP00000396830:p.Asp1113Tyr					DENND4A_uc002api.2_Missense_Mutation_p.D1156Y|DENND4A_uc002apj.3_Missense_Mutation_p.D1113Y	p.D1113Y	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN			22	3715	-			1113					E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Missense_Mutation	SNP	ENST00000431932.2	37	c.3337G>T	CCDS45285.1	.	.	.	.	.	.	.	.	.	.	C	18.81	3.704068	0.68615	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	T;T	0.08102	3.13;3.15	5.24	5.24	0.73138	.	0.174294	0.35677	N	0.003052	T	0.27205	0.0667	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71184	0.972;0.972	T	0.00411	-1.1756	10	0.72032	D	0.01	.	19.186	0.93644	0.0:1.0:0.0:0.0	.	1156;1113	E7EPL3;Q7Z401	.;MYCPP_HUMAN	Y	1156;1113	ENSP00000391167:D1156Y;ENSP00000396830:D1113Y	ENSP00000396830:D1113Y	D	-	1	0	DENND4A	63770517	1.000000	0.71417	0.987000	0.45799	0.825000	0.46686	5.062000	0.64326	2.605000	0.88082	0.655000	0.94253	GAT		0.363	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848		9	22	1	0	2.74318e-10	0.006214	3.57073e-10	9	22				
ARNT2	9915	broad.mit.edu	37	15	80847406	80847406	+	Splice_Site	SNP	G	G	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr15:80847406G>C	ENST00000303329.4	+	11	1255	c.1090G>C	c.(1090-1092)Gat>Cat	p.D364H	ARNT2_ENST00000533983.1_Splice_Site_p.D353H|RP11-379K22.2_ENST00000558208.1_RNA|ARNT2_ENST00000527771.1_Splice_Site_p.D353H	NM_014862.3	NP_055677.3	Q9HBZ2	ARNT2_HUMAN	aryl-hydrocarbon receptor nuclear translocator 2	364	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				central nervous system development (GO:0007417)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|pancreas(2)|prostate(2)|skin(1)	35			BRCA - Breast invasive adenocarcinoma(143;0.134)			TTTTATTTAGGATCTTCTGGG	0.398																																							uc002bfr.2		NA																	0				central_nervous_system(3)|ovary(1)|pancreas(1)	5						c.(1090-1092)GAT>CAT		aryl hydrocarbon receptor nuclear translocator							178.0	183.0	182.0					15																	80847406		2203	4300	6503	SO:0001630	splice_region_variant	9915				central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr15:80847406G>C	AB002305	CCDS32307.1	15q25.1	2013-05-21			ENSG00000172379	ENSG00000172379		"""Basic helix-loop-helix proteins"""	16876	protein-coding gene	gene with protein product		606036				11247670	Standard	NM_014862		Approved	KIAA0307, bHLHe1	uc002bfr.3	Q9HBZ2	OTTHUMG00000165478	ENST00000303329.4:c.1090-1G>C	15.37:g.80847406G>C						ARNT2_uc010unm.1_Missense_Mutation_p.D353H|ARNT2_uc002bfs.2_Missense_Mutation_p.D353H	p.D364H	NM_014862	NP_055677	Q9HBZ2	ARNT2_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.134)		11	1256	+			364			PAS 2.		B4DIS7|O15024|Q8IYC2	Missense_Mutation	SNP	ENST00000303329.4	37	c.1090G>C	CCDS32307.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580218	0.86645	.	.	ENSG00000172379	ENST00000360062;ENST00000303329;ENST00000540859	T	0.22945	1.93	4.75	4.75	0.60458	PAS fold-3 (1);PAS (3);	0.097874	0.64402	D	0.000003	T	0.57504	0.2058	M	0.87547	2.89	0.80722	D	1	D	0.71674	0.998	D	0.77557	0.99	T	0.64769	-0.6329	9	.	.	.	.	17.9742	0.89122	0.0:0.0:1.0:0.0	.	364	Q9HBZ2	ARNT2_HUMAN	H	353;364;364	ENSP00000307479:D364H	.	D	+	1	0	ARNT2	78634461	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	8.636000	0.91010	2.455000	0.83008	0.655000	0.94253	GAT		0.398	ARNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384389.2		Missense_Mutation	33	97	0	0	0	0.002836	0	33	97				
FES	2242	broad.mit.edu	37	15	91437239	91437239	+	Silent	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr15:91437239C>T	ENST00000328850.3	+	18	2419	c.2277C>T	c.(2275-2277)tcC>tcT	p.S759S	FES_ENST00000444422.2_Silent_p.S689S|FES_ENST00000450438.2_Silent_p.S631S|FES_ENST00000414248.2_Silent_p.S631S|FES_ENST00000394302.1_Silent_p.S618S|FES_ENST00000394300.3_Silent_p.S701S	NM_002005.3	NP_001996.1	P07332	FES_HUMAN	FES proto-oncogene, tyrosine kinase	759	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of mast cell degranulation (GO:0043304)|regulation of vesicle-mediated transport (GO:0060627)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule cytoskeleton (GO:0015630)	ATP binding (GO:0005524)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol binding (GO:0035091)|protein tyrosine kinase activity (GO:0004713)			lung(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			TGGGGGCCTCCCCCTATCCCA	0.607																																							uc002bpv.2		NA																	0				lung(2)	2						c.(2275-2277)TCC>TCT		feline sarcoma oncogene isoform 1							186.0	199.0	195.0					15																	91437239		2198	4298	6496	SO:0001819	synonymous_variant	2242				axon guidance|cell proliferation|peptidyl-tyrosine phosphorylation	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	g.chr15:91437239C>T	X52192	CCDS10365.1, CCDS45349.1, CCDS45350.1, CCDS45351.1	15q26.1	2014-06-26	2014-06-26		ENSG00000182511	ENSG00000182511	2.7.10.1	"""SH2 domain containing"""	3657	protein-coding gene	gene with protein product	"""Oncogene FES, feline sarcoma virus"", ""c-fes/fps protein"""	190030	"""feline sarcoma (Snyder-Theilen) viral (v-fes)/Fujinami avian sarcoma (PRCII) viral (v-fps) oncogene homolog"", ""feline sarcoma oncogene"""			1870997	Standard	NM_002005		Approved	FPS	uc002bpv.3	P07332	OTTHUMG00000044456	ENST00000328850.3:c.2277C>T	15.37:g.91437239C>T						FES_uc010uqj.1_Silent_p.S631S|FES_uc010uqk.1_Silent_p.S741S|FES_uc002bpw.2_Intron|FES_uc010bny.2_Silent_p.S618S|FES_uc002bpx.2_Silent_p.S689S|FES_uc002bpy.2_Silent_p.S701S	p.S759S	NM_002005	NP_001996	P07332	FES_HUMAN	Lung(145;0.229)		18	2373	+	Lung NSC(78;0.0771)|all_lung(78;0.137)		759	S->F: Reduced autophosphorylation and strongly reduced kinase activity.		Protein kinase.		B2R6E6|B4DUD0|E9PC94|E9PC95|Q2VXS7|Q2VXS8|Q2VXT0|Q6GTU5	Silent	SNP	ENST00000328850.3	37	c.2277C>T	CCDS10365.1																																																																																				0.607	FES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313497.1	NM_002005		84	136	0	0	0	0.00361	0	84	136				
WASH3P	374666	broad.mit.edu	37	15	102515299	102515299	+	RNA	SNP	G	G	A	rs201972834		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr15:102515299G>A	ENST00000557932.1	+	0	1145				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.G374S(10)		central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						TGGGGGCATCGGCAAGGCCAA	0.652																																							uc002cdi.2		NA																	10	Substitution - Missense(10)		kidney(7)|prostate(2)|endometrium(1)		0						c.(523-525)GGC>AGC		RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;																																						374666							g.chr15:102515299G>A			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102515299G>A						WASH3P_uc002cdl.2_Missense_Mutation_p.G175S|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.G175S|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	p.G175S	NR_003659						9	1943	+									Missense_Mutation	SNP	ENST00000557932.1	37	c.523G>A		.	.	.	.	.	.	.	.	.	.	g	2.376	-0.343229	0.05243	.	.	ENSG00000185596	ENST00000338304;ENST00000398121	.	.	.	1.01	1.01	0.19927	.	0.000000	0.85682	D	0.000000	T	0.41926	0.1180	.	.	.	.	.	.	.	.	.	.	.	.	T	0.51044	-0.8755	4	.	.	.	-23.1056	7.9382	0.29941	0.0:0.0:1.0:0.0	.	.	.	.	S	383;374	.	.	G	+	1	0	WASH3P	100332822	1.000000	0.71417	0.997000	0.53966	0.230000	0.25150	8.205000	0.89743	0.863000	0.35553	0.184000	0.17185	GGC		0.652	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417608.1	NM_199163		3	7	0	0	0	0.000602	0	3	7				
SLC6A10P	386757	broad.mit.edu	37	16	32890622	32890622	+	RNA	SNP	T	T	G	rs200656321		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr16:32890622T>G	ENST00000330048.5	-	0	3176					NR_003083.2				solute carrier family 6 (neurotransmitter transporter), member 10, pseudogene																		CGTTGGTGTTTTTGTAGACCA	0.617																																							uc002edh.1		NA																	0					0						c.(262-264)AAA>AAC		RecName: Full=Transporter;																																						386757							g.chr16:32890622T>G	U41163		16p11.2	2013-07-19	2013-07-19	2013-07-19	ENSG00000214617	ENSG00000214617		"""Solute carriers"""	11043	pseudogene	pseudogene	"""creatine transporter-2"""		"""solute carrier family 6 (neurotransmitter transporter, creatine), member 10"""	SLC6A10		9154116	Standard	NR_003083		Approved	CT-2	uc002edh.1		OTTHUMG00000132481		16.37:g.32890622T>G						SLC6A10P_uc002edi.1_RNA	p.K88N							5	440	-									Missense_Mutation	SNP	ENST00000330048.5	37	c.264A>C																																																																																					0.617	SLC6A10P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000432081.2			3	23	0	0	0	0.004672	0	3	23				
HYDIN	54768	broad.mit.edu	37	16	70972618	70972618	+	Silent	SNP	A	A	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr16:70972618A>T	ENST00000393567.2	-	44	7044	c.6894T>A	c.(6892-6894)cgT>cgA	p.R2298R		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2298			R -> G (in dbSNP:rs1774360).		cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGTTTTGGAGACGCTCCTTCT	0.537																																							uc002ezr.2		NA																	0				ovary(1)|skin(1)	2						c.(6889-6891)CGT>CGA		hydrocephalus inducing isoform a							114.0	101.0	105.0					16																	70972618		1936	4150	6086	SO:0001819	synonymous_variant	54768							g.chr16:70972618A>T	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.6894T>A	16.37:g.70972618A>T							p.R2297R	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN			44	7019	-		Ovarian(137;0.0654)	2298			Potential.		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	c.6891T>A	CCDS59269.1																																																																																				0.537	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			13	17	0	0	0	0.003163	0	13	17				
CBFA2T3	863	broad.mit.edu	37	16	88967957	88967957	+	Missense_Mutation	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr16:88967957C>T	ENST00000268679.4	-	2	655	c.259G>A	c.(259-261)Gca>Aca	p.A87T	CBFA2T3_ENST00000448839.1_Intron|CBFA2T3_ENST00000327483.5_Missense_Mutation_p.A26T|CBFA2T3_ENST00000436887.2_Missense_Mutation_p.A87T|CBFA2T3_ENST00000360302.2_Missense_Mutation_p.A26T	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	87	Mediates interaction with PDE7A (in isoform 2).|Mediates localization to the nucleus. {ECO:0000250}.|Pro-rich.|Required for nucleolar targeting (in isoform 1).				cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		CCCTGGGATGCGGCAGGCGGT	0.697			T	RUNX1	AML																																		uc002fmm.1		NA		Dom	yes		16	16q24	863	T	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""			L	RUNX1		AML		0				large_intestine(3)|ovary(1)	4						c.(259-261)GCA>ACA		myeloid translocation gene on chromosome 16							17.0	22.0	20.0					16																	88967957		2179	4284	6463	SO:0001583	missense	863				cell proliferation|granulocyte differentiation	Golgi membrane|nucleolus|nucleoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:88967957C>T	AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.259G>A	16.37:g.88967957C>T	ENSP00000268679:p.Ala87Thr					CBFA2T3_uc002fml.1_Missense_Mutation_p.A26T|CBFA2T3_uc010cif.1_Missense_Mutation_p.A26T|CBFA2T3_uc002fmn.1_Missense_Mutation_p.A87T	p.A87T	NM_005187	NP_005178	O75081	MTG16_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0275)	2	445	-			87			Mediates localization to the nucleus (By similarity).|Pro-rich.|Mediates interaction with PDE7A (in isoform 2).|Required for nucleolar targeting (in isoform 1).		D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Missense_Mutation	SNP	ENST00000268679.4	37	c.259G>A	CCDS10972.1	.	.	.	.	.	.	.	.	.	.	C	4.783	0.145559	0.09134	.	.	ENSG00000129993	ENST00000327483;ENST00000268679;ENST00000436887;ENST00000360302	T;T;T;T	0.44482	1.5;0.97;0.92;1.5	3.95	-4.21	0.03812	.	0.889113	0.09649	N	0.773904	T	0.13670	0.0331	N	0.08118	0	0.09310	N	0.999998	B;B;B;B	0.25312	0.123;0.007;0.003;0.001	B;B;B;B	0.08055	0.003;0.003;0.001;0.001	T	0.23691	-1.0181	10	0.09590	T	0.72	-16.6108	2.0029	0.03471	0.1224:0.4065:0.1141:0.3571	.	87;87;87;26	E7EU24;B2RBQ7;O75081;O75081-2	.;.;MTG16_HUMAN;.	T	26;87;87;26	ENSP00000332122:A26T;ENSP00000268679:A87T;ENSP00000395739:A87T;ENSP00000353449:A26T	ENSP00000268679:A87T	A	-	1	0	CBFA2T3	87495458	0.000000	0.05858	0.000000	0.03702	0.084000	0.17831	0.000000	0.12993	-1.214000	0.02614	-1.629000	0.00783	GCA		0.697	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269545.2	NM_005187		12	19	0	0	0	0.001855	0	12	19				
FANCA	2175	broad.mit.edu	37	16	89858414	89858414	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr16:89858414C>A	ENST00000389301.3	-	13	1176	c.1146G>T	c.(1144-1146)caG>caT	p.Q382H	FANCA_ENST00000568369.1_Missense_Mutation_p.Q382H	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	382					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		AGTGAACCTCCTGCGTTTCCA	0.517			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														uc002fou.1		NA	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	D|Mis|N|F|S	"""Fanconi anemia, complementation group A"""			L		AML|leukemia			0				ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6						c.(1144-1146)CAG>CAT	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group A isoform							118.0	107.0	110.0					16																	89858414		2198	4300	6498	SO:0001583	missense	2175	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding	g.chr16:89858414C>A	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.1146G>T	16.37:g.89858414C>A	ENSP00000373952:p.Gln382His					FANCA_uc010vpn.1_Missense_Mutation_p.Q382H	p.Q382H	NM_000135	NP_000126	O15360	FANCA_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.028)	13	1188	-		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)	382					A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	37	c.1146G>T	CCDS32515.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.198651	0.00299	.	.	ENSG00000187741	ENST00000389301	T	0.61627	0.09	5.49	-8.63	0.00878	.	0.879117	0.09749	N	0.760817	T	0.19886	0.0478	N	0.04508	-0.205	0.80722	D	1	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.003	T	0.25117	-1.0141	10	0.07325	T	0.83	-2.1955	2.2895	0.04135	0.4041:0.2304:0.2363:0.1291	.	382;382	B4DRI7;O15360	.;FANCA_HUMAN	H	382	ENSP00000373952:Q382H	ENSP00000373952:Q382H	Q	-	3	2	FANCA	88385915	0.000000	0.05858	0.007000	0.13788	0.035000	0.12851	-2.838000	0.00739	-1.646000	0.01513	-1.031000	0.02408	CAG		0.517	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1			22	36	1	0	2.70639e-06	0.002299	3.21729e-06	22	36				
MYH13	8735	broad.mit.edu	37	17	10212750	10212750	+	Missense_Mutation	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr17:10212750G>A	ENST00000418404.3	-	34	5133	c.4970C>T	c.(4969-4971)tCc>tTc	p.S1657F	MYH13_ENST00000252172.4_Missense_Mutation_p.S1657F|RP11-401O9.4_ENST00000609088.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1657					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						ATGCAGCTGGGAGTCCTGCAG	0.672																																							uc002gmk.1		NA																	0				ovary(4)|skin(2)	6						c.(4969-4971)TCC>TTC		myosin, heavy polypeptide 13, skeletal muscle							14.0	15.0	15.0					17																	10212750		2087	4225	6312	SO:0001583	missense	8735				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10212750G>A	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.4970C>T	17.37:g.10212750G>A	ENSP00000404570:p.Ser1657Phe						p.S1657F	NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN			35	5060	-			1657			Potential.		O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	c.4970C>T	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	G	13.17	2.157304	0.38119	.	.	ENSG00000006788	ENST00000252172	T	0.77358	-1.09	4.34	4.34	0.51931	Myosin tail (1);	.	.	.	.	T	0.69993	0.3173	N	0.19112	0.55	0.33346	D	0.570459	B	0.30973	0.302	B	0.36335	0.222	T	0.77146	-0.2695	9	0.51188	T	0.08	.	17.4132	0.87492	0.0:0.0:1.0:0.0	.	1657	Q9UKX3	MYH13_HUMAN	F	1657	ENSP00000252172:S1657F	ENSP00000252172:S1657F	S	-	2	0	MYH13	10153475	1.000000	0.71417	0.998000	0.56505	0.657000	0.38888	3.952000	0.56691	2.407000	0.81776	0.655000	0.94253	TCC		0.672	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		3	9	0	0	0	0.004672	0	3	9				
MYH4	4622	broad.mit.edu	37	17	10363356	10363356	+	Silent	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr17:10363356G>A	ENST00000255381.2	-	14	1439	c.1329C>T	c.(1327-1329)gtC>gtT	p.V443V	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	443	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TGATGCGGGTGACCATCCACA	0.473																																							uc002gmn.2		NA																	0				ovary(10)|skin(2)|central_nervous_system(1)	13						c.(1327-1329)GTC>GTT		myosin, heavy polypeptide 4, skeletal muscle							197.0	182.0	187.0					17																	10363356		2203	4300	6503	SO:0001819	synonymous_variant	4622				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	g.chr17:10363356G>A		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.1329C>T	17.37:g.10363356G>A						uc002gml.1_Intron	p.V443V	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN			14	1440	-			443			Myosin head-like.			Silent	SNP	ENST00000255381.2	37	c.1329C>T	CCDS11154.1																																																																																				0.473	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533		77	161	0	0	0	0.00361	0	77	161				
KRT37	8688	broad.mit.edu	37	17	39579093	39579093	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr17:39579093G>T	ENST00000225550.3	-	3	668	c.669C>A	c.(667-669)gaC>gaA	p.D223E	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	223	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				GGGCCTCCAGGTCGGCCTTGG	0.667																																							uc002hwp.1		NA																	0				skin(1)	1						c.(667-669)GAC>GAA		keratin 37							67.0	59.0	61.0					17																	39579093		2203	4300	6503	SO:0001583	missense	8688					intermediate filament	structural molecule activity	g.chr17:39579093G>T	Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.669C>A	17.37:g.39579093G>T	ENSP00000225550:p.Asp223Glu					uc002hwo.1_Intron	p.D223E	NM_003770	NP_003761	O76014	KRT37_HUMAN			3	716	-		Breast(137;0.000496)	223			Rod.|Coil 1B.			Missense_Mutation	SNP	ENST00000225550.3	37	c.669C>A	CCDS32653.1	.	.	.	.	.	.	.	.	.	.	.	29.9	5.044531	0.93685	.	.	ENSG00000108417	ENST00000225550	D	0.90197	-2.63	4.86	4.86	0.63082	Filament (1);	0.000000	0.49305	D	0.000152	D	0.95532	0.8548	M	0.83012	2.62	0.39403	D	0.966615	D	0.89917	1.0	D	0.87578	0.998	D	0.96765	0.9564	10	0.87932	D	0	.	16.9589	0.86267	0.0:0.0:1.0:0.0	.	223	O76014	KRT37_HUMAN	E	223	ENSP00000225550:D223E	ENSP00000225550:D223E	D	-	3	2	KRT37	36832619	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.874000	0.48483	2.253000	0.74438	0.655000	0.94253	GAC		0.667	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257714.2	NM_003770		37	30	1	0	4.00102e-26	0.00623	6.61161e-26	37	30				
SMG8	55181	broad.mit.edu	37	17	57288786	57288786	+	Silent	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr17:57288786G>A	ENST00000543872.2	+	2	1638	c.1374G>A	c.(1372-1374)gtG>gtA	p.V458V	SMG8_ENST00000580498.1_Intron|SMG8_ENST00000300917.5_Silent_p.V458V|SMG8_ENST00000578922.1_Silent_p.V458V|CTD-2510F5.6_ENST00000577660.1_Intron			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	458					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						TGTATGAGGTGGCTATTGATG	0.433																																							uc002ixi.2		NA																	0					0						c.(1372-1374)GTG>GTA		SMG8 protein							58.0	60.0	59.0					17																	57288786		2203	4300	6503	SO:0001819	synonymous_variant	55181				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of protein kinase activity		protein binding	g.chr17:57288786G>A	AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.1374G>A	17.37:g.57288786G>A							p.V458V	NM_018149	NP_060619	Q8ND04	SMG8_HUMAN			1	1416	+	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)		458					Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Silent	SNP	ENST00000543872.2	37	c.1374G>A	CCDS11615.1																																																																																				0.433	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149		40	53	0	0	0	0.00874	0	40	53				
MAP3K3	4215	broad.mit.edu	37	17	61769133	61769133	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr17:61769133C>A	ENST00000361733.3	+	14	1705	c.1385C>A	c.(1384-1386)aCa>aAa	p.T462K	MAP3K3_ENST00000579585.1_Missense_Mutation_p.T493K|MAP3K3_ENST00000361357.3_Missense_Mutation_p.T493K|MAP3K3_ENST00000577395.1_Missense_Mutation_p.T458K|MAP3K3_ENST00000584573.1_Missense_Mutation_p.T489K	NM_002401.3	NP_002392.2	Q99759	M3K3_HUMAN	mitogen-activated protein kinase kinase kinase 3	462	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)			breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	28						GGTGCTCTGACAGAGAGCGTG	0.597																																							uc002jbg.2		NA																	0				lung(3)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)	6						c.(1384-1386)ACA>AAA		mitogen-activated protein kinase kinase kinase 3							162.0	153.0	156.0					17																	61769133		2203	4300	6503	SO:0001583	missense	4215				MAPKKK cascade|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autophosphorylation	cytosol	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding	g.chr17:61769133C>A	U78876	CCDS32701.1, CCDS32702.1	17q	2011-06-09				ENSG00000198909		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6855	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 3"", ""MAPK/ERK kinase kinase 3"""	602539		MEKK3		9006902	Standard	NM_002401		Approved	MAPKKK3	uc002jbf.3	Q99759		ENST00000361733.3:c.1385C>A	17.37:g.61769133C>A	ENSP00000354485:p.Thr462Lys					MAP3K3_uc002jbe.2_Missense_Mutation_p.T493K|MAP3K3_uc002jbf.2_Missense_Mutation_p.T493K|MAP3K3_uc002jbh.2_Missense_Mutation_p.T489K|MAP3K3_uc010wpo.1_Missense_Mutation_p.T377K|MAP3K3_uc010wpp.1_Missense_Mutation_p.T458K	p.T462K	NM_002401	NP_002392	Q99759	M3K3_HUMAN			14	1704	+			462			Protein kinase.		B2RCW2|D3DU15|Q5BKZ6|Q8N3I9	Missense_Mutation	SNP	ENST00000361733.3	37	c.1385C>A	CCDS32702.1	.	.	.	.	.	.	.	.	.	.	C	32	5.146056	0.94603	.	.	ENSG00000198909	ENST00000361357;ENST00000361733	T;T	0.25749	1.78;1.78	5.34	5.34	0.76211	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.100745	0.64402	D	0.000002	T	0.42314	0.1197	L	0.41632	1.29	0.80722	D	1	D;D;P;P	0.76494	0.998;0.999;0.774;0.567	D;D;P;P	0.75020	0.982;0.985;0.766;0.655	T	0.06356	-1.0831	10	0.21540	T	0.41	.	19.0469	0.93025	0.0:1.0:0.0:0.0	.	458;430;462;493	Q1PBM3;Q96HN9;Q99759;Q99759-2	.;.;M3K3_HUMAN;.	K	493;462	ENSP00000354927:T493K;ENSP00000354485:T462K	ENSP00000354927:T493K	T	+	2	0	MAP3K3	59122865	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.818000	0.86416	2.497000	0.84241	0.561000	0.74099	ACA		0.597	MAP3K3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000443867.1	NM_002401		40	157	1	0	1.32136e-16	0.00874	1.93633e-16	40	157				
GGA3	23163	broad.mit.edu	37	17	73242605	73242605	+	Silent	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr17:73242605C>T	ENST00000245541.6	-	3	402	c.186G>A	c.(184-186)gcG>gcA	p.A62A	GGA3_ENST00000582717.1_5'UTR|GGA3_ENST00000537686.1_Silent_p.A62A|GGA3_ENST00000578348.1_5'UTR|GGA3_ENST00000582486.1_5'UTR|GGA3_ENST00000351904.7_Silent_p.A62A|GGA3_ENST00000579743.1_5'UTR|GGA3_ENST00000538886.1_Intron	NM_138619.2	NP_619525.1	Q9NZ52	GGA3_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 3	62	Binds to ARF1 (in long isoform).|VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			breast(2)|endometrium(3)|large_intestine(4)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	20			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			GGGCCTGGAGCGCCTCCCATT	0.627																																							uc002jni.1		NA																	0				ovary(1)|breast(1)	2						c.(184-186)GCG>GCA		ADP-ribosylation factor binding protein 3							73.0	62.0	66.0					17																	73242605		2203	4300	6503	SO:0001819	synonymous_variant	23163				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding	g.chr17:73242605C>T	AF190864	CCDS11716.1, CCDS11717.1, CCDS54164.1, CCDS58597.1	17q25	2010-02-12	2010-02-12			ENSG00000125447			17079	protein-coding gene	gene with protein product		606006				10747089, 10749927	Standard	NR_033345		Approved	KIAA0154	uc002jni.2	Q9NZ52		ENST00000245541.6:c.186G>A	17.37:g.73242605C>T						GGA3_uc002jnj.1_Silent_p.A62A|GGA3_uc010wrw.1_5'UTR|GGA3_uc002jnk.1_5'UTR|GGA3_uc010wrx.1_Intron|GGA3_uc010wry.1_5'UTR|GGA3_uc010wrz.1_Silent_p.A62A	p.A62A	NM_138619	NP_619525	Q9NZ52	GGA3_HUMAN	all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)		3	195	-			62			VHS.|Binds to ARF1 (in long isoform).		B7Z7E2|B7Z7M9|J3KRN0|Q15017|Q6IS16|Q9UJY3	Silent	SNP	ENST00000245541.6	37	c.186G>A	CCDS11717.1																																																																																				0.627	GGA3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446645.1	NM_138619		7	30	0	0	0	0.001984	0	7	30				
ZNF521	25925	broad.mit.edu	37	18	22804959	22804959	+	Missense_Mutation	SNP	T	T	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr18:22804959T>C	ENST00000361524.3	-	4	3071	c.2923A>G	c.(2923-2925)Act>Gct	p.T975A	ZNF521_ENST00000538137.2_Missense_Mutation_p.T975A|ZNF521_ENST00000584787.1_Missense_Mutation_p.T755A|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	975					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TTGTGTTCAGTAAGAGTTAAA	0.483			T	PAX5	ALL																																		uc002kvk.2		NA		Dom	yes		18	18q11.2	25925	T	zinc finger protein 521			L	PAX5		ALL		0				ovary(4)|large_intestine(2)|lung(1)	7						c.(2923-2925)ACT>GCT		zinc finger protein 521							73.0	71.0	72.0					18																	22804959		2203	4300	6503	SO:0001583	missense	25925				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding	g.chr18:22804959T>C	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2923A>G	18.37:g.22804959T>C	ENSP00000354794:p.Thr975Ala					ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.T975A|ZNF521_uc002kvl.2_Missense_Mutation_p.T755A	p.T975A	NM_015461	NP_056276	Q96K83	ZN521_HUMAN			4	3170	-	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)		975			C2H2-type 23.		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	c.2923A>G	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	T	11.49	1.654121	0.29425	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.28069	1.63;1.63	5.97	5.97	0.96955	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.38957	0.1060	N	0.14661	0.345	0.47778	D	0.999518	D	0.71674	0.998	D	0.81914	0.995	T	0.30001	-0.9993	10	0.33141	T	0.24	-21.2139	16.4473	0.83942	0.0:0.0:0.0:1.0	.	975	Q96K83	ZN521_HUMAN	A	975;1009;975	ENSP00000354794:T975A;ENSP00000382352:T975A	ENSP00000354794:T975A	T	-	1	0	ZNF521	21058957	1.000000	0.71417	0.102000	0.21198	0.997000	0.91878	7.698000	0.84413	2.281000	0.76405	0.533000	0.62120	ACT		0.483	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461		41	78	0	0	0	0.002852	0	41	78				
ASXL3	80816	broad.mit.edu	37	18	31226268	31226268	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr18:31226268G>T	ENST00000269197.5	+	4	306	c.306G>T	c.(304-306)ttG>ttT	p.L102F		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	102					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AATCTGAATTGGATGGTACAG	0.383																																							uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(304-306)TTG>TTT		additional sex combs like 3							130.0	130.0	130.0					18																	31226268		1940	4152	6092	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31226268G>T	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.306G>T	18.37:g.31226268G>T	ENSP00000269197:p.Leu102Phe					ASXL3_uc002kxq.2_5'UTR	p.L102F	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN			4	361	+			102					Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.306G>T	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	G	17.40	3.380907	0.61845	.	.	ENSG00000141431	ENST00000269197	T	0.15834	2.39	5.25	3.19	0.36642	.	.	.	.	.	T	0.12902	0.0313	L	0.36672	1.1	0.33282	D	0.562378	P	0.45348	0.856	B	0.42959	0.403	T	0.24728	-1.0152	9	0.51188	T	0.08	.	2.7126	0.05179	0.3529:0.0:0.4272:0.2199	.	102	Q9C0F0	ASXL3_HUMAN	F	102	ENSP00000269197:L102F	ENSP00000269197:L102F	L	+	3	2	ASXL3	29480266	1.000000	0.71417	0.955000	0.39395	0.997000	0.91878	1.951000	0.40333	0.563000	0.29222	0.555000	0.69702	TTG		0.383	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			26	189	1	0	2.12542e-12	0.00632	2.91307e-12	26	189				
SMAD4	4089	broad.mit.edu	37	18	48581339	48581339	+	Missense_Mutation	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr18:48581339C>T	ENST00000342988.3	+	5	1181	c.643C>T	c.(643-645)Ccc>Tcc	p.P215S	SMAD4_ENST00000452201.2_3'UTR|SMAD4_ENST00000398417.2_Missense_Mutation_p.P215S|SMAD4_ENST00000588745.1_Missense_Mutation_p.P215S|RP11-729L2.2_ENST00000590722.2_3'UTR	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	215					atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(3)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TGCCAACTTTCCCAACATTCC	0.463																																							uc010xdp.1		NA																	39	Whole gene deletion(36)|Unknown(3)	p.0?(35)|p.?(3)	pancreas(26)|large_intestine(3)|stomach(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369						c.(643-645)CCC>TCC		mothers against decapentaplegic homolog 4							143.0	119.0	127.0					18																	48581339		2203	4300	6503	SO:0001583	missense	4089	Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia			BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	g.chr18:48581339C>T	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.643C>T	18.37:g.48581339C>T	ENSP00000341551:p.Pro215Ser					SMAD4_uc010xdo.1_RNA|SMAD4_uc002lfb.3_Missense_Mutation_p.P60S	p.P215S	NM_005359	NP_005350	Q13485	SMAD4_HUMAN		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)	5	1181	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	215					A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	c.643C>T	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.592207	0.46214	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	T;T	0.72505	-0.66;-0.66	5.86	5.86	0.93980	.	0.153463	0.64402	D	0.000012	T	0.46034	0.1372	N	0.02854	-0.475	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42965	-0.9420	10	0.26408	T	0.33	.	12.6473	0.56742	0.0:0.9235:0.0:0.0765	.	215	Q13485	SMAD4_HUMAN	S	215	ENSP00000341551:P215S;ENSP00000381452:P215S	ENSP00000341551:P215S	P	+	1	0	SMAD4	46835337	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.143000	0.50608	2.937000	0.99478	0.650000	0.86243	CCC		0.463	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359		49	37	0	0	0	0.00361	0	49	37				
STK11	6794	broad.mit.edu	37	19	1220715	1220715	+	Splice_Site	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:1220715C>T	ENST00000326873.7	+	5	1906	c.733C>T	c.(733-735)Ctc>Ttc	p.L245F		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	245	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> R (in sporadic cancer; somatic mutation; impairs heterotrimeric complex assembly with STRADA and CAB39).		activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(2)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGGTCACCCTGTAAGTGCC	0.706		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													uc002lrl.1		14	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	D|Mis|N|F|S	serine/threonine kinase 11 gene (LKB1)			"""E, M, O"""		jejunal harmartoma|ovarian|testicular|pancreatic	NSCLC|pancreatic		22	Whole gene deletion(20)|Unknown(2)	p.0?(19)|p.?(2)	cervix(14)|lung(4)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266	GRCh37	CD982957	STK11	D		c.(733-735)CTC>TTC		serine/threonine protein kinase 11							22.0	28.0	26.0					19																	1220715		1998	4136	6134	SO:0001630	splice_region_variant	6794	Peutz-Jeghers_syndrome	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr19:1220715C>T	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.734+1C>T	19.37:g.1220715C>T		TSP Lung(3;<1E-08)					p.L245F	NM_000455	NP_000446	Q15831	STK11_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)	5	1848	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)	245		L -> R (in sporadic cancer; somatic mutation; impairs heterotrimeric complex assembly with STRADA and CAB39).	Protein kinase.		B2RBX7|E7EW76	Missense_Mutation	SNP	ENST00000326873.7	37	c.733C>T	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	C	35	5.501239	0.96371	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	T	0.71579	-0.58	5.6	5.6	0.85130	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79482	0.4453	L	0.38649	1.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81044	-0.1111	10	0.87932	D	0	-42.3481	18.5988	0.91240	0.0:1.0:0.0:0.0	.	245	Q15831	STK11_HUMAN	F	245	ENSP00000324856:L245F	ENSP00000324856:L245F	L	+	1	0	STK11	1171715	1.000000	0.71417	0.979000	0.43373	0.809000	0.45718	4.812000	0.62613	2.644000	0.89710	0.561000	0.74099	CTC		0.706	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455	Missense_Mutation	17	9	0	0	0	0.001523	0	17	9				
KHSRP	8570	broad.mit.edu	37	19	6420440	6420440	+	Silent	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:6420440C>A	ENST00000398148.3	-	5	560	c.468G>T	c.(466-468)gtG>gtT	p.V156V		NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein	156	Gly-rich.|KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						CACTCAGGCCCACCATGCCGT	0.592																																					Colon(55;593 1006 2067 9135 22980)	Colon(55;593 1006 2067 9135 22980)	uc002mer.3		NA																	0				skin(1)	1						c.(466-468)GTG>GTT		KH-type splicing regulatory protein							58.0	64.0	62.0					19																	6420440		2040	4191	6231	SO:0001819	synonymous_variant	8570				mRNA processing|mRNA transport|regulation of transcription, DNA-dependent|RNA splicing, via transesterification reactions|transcription, DNA-dependent	cytosol|nucleus	DNA binding|protein binding|RNA binding	g.chr19:6420440C>A	U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945		ENST00000398148.3:c.468G>T	19.37:g.6420440C>A							p.V156V	NM_003685	NP_003676	Q92945	FUBP2_HUMAN			5	578	-			156			Gly-rich.|KH 1.		O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Silent	SNP	ENST00000398148.3	37	c.468G>T	CCDS45936.1																																																																																				0.592	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453305.1			12	10	1	0	1.5842e-08	0.001855	1.9739e-08	12	10				
TNFSF14	8740	broad.mit.edu	37	19	6664944	6664944	+	Missense_Mutation	SNP	A	A	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:6664944A>G	ENST00000599359.1	-	5	1097	c.716T>C	c.(715-717)aTg>aCg	p.M239T	TNFSF14_ENST00000245912.3_Missense_Mutation_p.M203T|TNFSF14_ENST00000326176.9_Missense_Mutation_p.M203T			O43557	TNF14_HUMAN	tumor necrosis factor (ligand) superfamily, member 14	239					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of T cell chemotaxis (GO:0010820)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|receptor binding (GO:0005102)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	18						CCTTCACACCATGAAAGCCCC	0.582																																							uc002mfk.1		NA																	0				skin(1)	1						c.(715-717)ATG>ACG		tumor necrosis factor ligand superfamily, member							195.0	167.0	176.0					19																	6664944		2203	4300	6503	SO:0001583	missense	8740				cellular response to mechanical stimulus|immune response|induction of apoptosis|release of cytoplasmic sequestered NF-kappaB|T cell homeostasis|T cell proliferation	cytoplasm|extracellular space|integral to membrane|plasma membrane	caspase inhibitor activity|cytokine activity|tumor necrosis factor receptor binding	g.chr19:6664944A>G	AF036581	CCDS12171.1, CCDS45939.1	19p13.3	2008-02-05				ENSG00000125735		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11930	protein-coding gene	gene with protein product		604520				9462508	Standard	NM_172014		Approved	LIGHT, LTg, HVEM-L, CD258	uc002mfk.2	O43557		ENST00000599359.1:c.716T>C	19.37:g.6664944A>G	ENSP00000469049:p.Met239Thr					TNFSF14_uc002mfj.1_Missense_Mutation_p.M203T	p.M239T	NM_003807	NP_003798	O43557	TNF14_HUMAN			5	1098	-			239			Extracellular (Potential).		A8K7M2|C9J5H4|O75476|Q6FHA1|Q8WVF8|Q96LD2	Missense_Mutation	SNP	ENST00000599359.1	37	c.716T>C	CCDS12171.1	.	.	.	.	.	.	.	.	.	.	A	14.82	2.650385	0.47362	.	.	ENSG00000125735	ENST00000245912;ENST00000326176	D	0.94537	-3.45	4.46	4.46	0.54185	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.000000	0.85682	D	0.000000	D	0.96682	0.8917	M	0.77313	2.365	0.39846	D	0.973173	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.991	D	0.97117	0.9808	10	0.52906	T	0.07	-17.6747	12.7436	0.57268	1.0:0.0:0.0:0.0	.	239;203	O43557;O43557-2	TNF14_HUMAN;.	T	239;203	ENSP00000326940:M203T	ENSP00000245912:M239T	M	-	2	0	TNFSF14	6615944	1.000000	0.71417	1.000000	0.80357	0.405000	0.30901	3.899000	0.56288	1.659000	0.50751	0.459000	0.35465	ATG		0.582	TNFSF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457863.1			55	40	0	0	0	0.00361	0	55	40				
ZNF560	147741	broad.mit.edu	37	19	9582050	9582050	+	Nonsense_Mutation	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:9582050C>T	ENST00000301480.4	-	6	456	c.243G>A	c.(241-243)tgG>tgA	p.W81*		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	81	KRAB 1. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						GTTTTATTGCCCAGTCTGAAA	0.289																																							uc002mlp.1		NA																	0				skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						c.(241-243)TGG>TGA		zinc finger protein 560							83.0	82.0	82.0					19																	9582050		2203	4299	6502	SO:0001587	stop_gained	147741				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9582050C>T	AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.243G>A	19.37:g.9582050C>T	ENSP00000301480:p.Trp81*					ZNF560_uc010dwr.1_5'UTR	p.W81*	NM_152476	NP_689689	Q96MR9	ZN560_HUMAN			6	453	-			81			KRAB 1.		Q495S9|Q495T1	Nonsense_Mutation	SNP	ENST00000301480.4	37	c.243G>A	CCDS12214.1	.	.	.	.	.	.	.	.	.	.	C	15.71	2.913100	0.52439	.	.	ENSG00000198028	ENST00000301480	.	.	.	2.53	1.43	0.22495	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	6.9971	0.24789	0.2724:0.7276:0.0:0.0	.	.	.	.	X	81	.	ENSP00000301480:W81X	W	-	3	0	ZNF560	9443050	0.000000	0.05858	0.005000	0.12908	0.004000	0.04260	-0.021000	0.12504	0.338000	0.23692	-0.493000	0.04662	TGG		0.289	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476		28	17	0	0	0	0.005443	0	28	17				
ZNF653	115950	broad.mit.edu	37	19	11594670	11594670	+	Missense_Mutation	SNP	C	C	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:11594670C>G	ENST00000293771.5	-	9	1811	c.1675G>C	c.(1675-1677)Gag>Cag	p.E559Q	ELAVL3_ENST00000359227.3_5'Flank|ELAVL3_ENST00000592218.1_5'Flank|CTC-398G3.6_ENST00000585656.1_Intron	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	559					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						CCACAGATCTCGCACCTGCCG	0.701																																					Pancreas(83;980 1446 4542 6441 43352)	Pancreas(83;980 1446 4542 6441 43352)	uc002mrz.1		NA																	0					0						c.(1675-1677)GAG>CAG		zinc finger protein 653							20.0	16.0	18.0					19																	11594670		2198	4290	6488	SO:0001583	missense	115950				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:11594670C>G	AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.1675G>C	19.37:g.11594670C>G	ENSP00000293771:p.Glu559Gln					ELAVL3_uc002mrx.1_5'Flank|ELAVL3_uc002mry.1_5'Flank	p.E559Q	NM_138783	NP_620138	Q96CK0	ZN653_HUMAN			9	1728	-			559			C2H2-type 4.		Q96AS7	Missense_Mutation	SNP	ENST00000293771.5	37	c.1675G>C	CCDS12261.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.011431	0.93346	.	.	ENSG00000161914	ENST00000293771	T	0.07444	3.19	4.13	4.13	0.48395	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.17662	0.0424	L	0.27944	0.81	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.03933	-1.0991	10	0.52906	T	0.07	-21.2655	15.5078	0.75753	0.0:1.0:0.0:0.0	.	559	Q96CK0	ZN653_HUMAN	Q	559	ENSP00000293771:E559Q	ENSP00000293771:E559Q	E	-	1	0	ZNF653	11455670	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.200000	0.77838	2.041000	0.60428	0.455000	0.32223	GAG		0.701	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458836.2	NM_138783		3	7	0	0	0	0.001168	0	3	7				
ZNF442	79973	broad.mit.edu	37	19	12461745	12461745	+	Silent	SNP	A	A	G	rs117398535	byFrequency	TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:12461745A>G	ENST00000242804.4	-	6	1236	c.654T>C	c.(652-654)ttT>ttC	p.F218F	CTD-3105H18.13_ENST00000563695.2_lincRNA|ZNF442_ENST00000438182.1_Silent_p.F149F	NM_030824.2	NP_110451.1	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	218					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	31						TAGGCCAAAAAAAGGCTTTCC	0.403													A|||	10	0.00199681	0.0015	0.0014	5008	,	,		22597	0.0		0.007	False		,,,				2504	0.0						uc002mtr.1		NA																	0				large_intestine(2)|breast(1)|kidney(1)	4						c.(652-654)TTT>TTC		zinc finger protein 442		A		4,4402	8.1+/-20.4	0,4,2199	138.0	134.0	135.0		654	-1.5	0.0	19	dbSNP_132	135	56,8544	35.9+/-90.5	0,56,4244	no	coding-synonymous	ZNF442	NM_030824.2		0,60,6443	GG,GA,AA		0.6512,0.0908,0.4613		218/628	12461745	60,12946	2203	4300	6503	SO:0001819	synonymous_variant	79973				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12461745A>G	AK024418	CCDS12271.1	19p13.13	2013-01-08			ENSG00000198342	ENSG00000198342		"""Zinc fingers, C2H2-type"", ""-"""	20877	protein-coding gene	gene with protein product							Standard	NM_030824		Approved	FLJ14356	uc002mtr.1	Q9H7R0	OTTHUMG00000156411	ENST00000242804.4:c.654T>C	19.37:g.12461745A>G						ZNF442_uc010xmk.1_Silent_p.F149F	p.F218F	NM_030824	NP_110451	Q9H7R0	ZN442_HUMAN			6	1265	-			218			C2H2-type 2.		B4DJ48	Silent	SNP	ENST00000242804.4	37	c.654T>C	CCDS12271.1																																																																																				0.403	ZNF442-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344109.1	NM_030824		5	107	0	0	0	0.000602	0	5	107				
ZNF14	7561	broad.mit.edu	37	19	19824913	19824913	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:19824913C>A	ENST00000344099.3	-	3	316	c.178G>T	c.(178-180)Ggg>Tgg	p.G60W		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	60	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				CGATTTTTCCCCTGGTTTCTG	0.363																																							uc002nnk.1		NA																	0				ovary(3)	3						c.(178-180)GGG>TGG		zinc finger protein 14							114.0	107.0	109.0					19																	19824913		2203	4300	6503	SO:0001583	missense	7561				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:19824913C>A	AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.178G>T	19.37:g.19824913C>A	ENSP00000340514:p.Gly60Trp						p.G60W	NM_021030	NP_066358	P17017	ZNF14_HUMAN			3	332	-		Renal(1328;0.0474)	60			KRAB.		B9EGA4|Q9ULZ5	Missense_Mutation	SNP	ENST00000344099.3	37	c.178G>T	CCDS12409.1	.	.	.	.	.	.	.	.	.	.	C	6.971	0.549096	0.13312	.	.	ENSG00000105708	ENST00000344099	T	0.06142	3.34	1.37	0.279	0.15677	Krueppel-associated box (3);	.	.	.	.	T	0.15825	0.0381	M	0.68952	2.095	0.09310	N	1	D	0.76494	0.999	D	0.68039	0.955	T	0.11641	-1.0579	9	0.56958	D	0.05	.	3.7365	0.08512	0.0:0.7439:0.0:0.2561	.	60	P17017	ZNF14_HUMAN	W	60	ENSP00000340514:G60W	ENSP00000340514:G60W	G	-	1	0	ZNF14	19685913	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.847000	0.04331	0.134000	0.18681	-0.373000	0.07131	GGG		0.363	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030		27	23	1	0	3.11337e-16	0.002836	4.53385e-16	27	23				
ZNF43	7594	broad.mit.edu	37	19	22018896	22018896	+	De_novo_Start_OutOfFrame	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:22018896G>T	ENST00000354959.4	-	0	114				ZNF43_ENST00000598381.1_Intron|ZNF43_ENST00000598288.1_Intron|ZNF43_ENST00000594012.1_Intron|ZNF43_ENST00000595461.1_Intron	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		AATACCCGCAGGTCACAGAGC	0.622																																							uc002nqj.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(-57--53)ACCTG>ACATG		zinc finger protein 43							19.0	20.0	19.0					19																	22018896		692	1591	2283			7594				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:22018896G>T	X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.-56C>A	19.37:g.22018896G>T						ZNF43_uc010ecv.2_Intron|ZNF43_uc002nql.2_Intron|ZNF43_uc002nqm.2_Intron|ZNF43_uc002nqk.2_Translation_Start_Site		NM_003423	NP_003414	P17038	ZNF43_HUMAN		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)	1	75	-		Renal(1328;0.000219)|Hepatocellular(1079;0.121)						A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Translation_Start_Site	SNP	ENST00000354959.4	37	c.-55C>A	CCDS12413.2																																																																																				0.622	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250380.2	NM_003423		13	38	1	0	1.61879e-10	0.001368	2.13095e-10	13	38				
SLC7A10	56301	broad.mit.edu	37	19	33699842	33699842	+	Silent	SNP	T	T	G	rs541216108	byFrequency	TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:33699842T>G	ENST00000253188.4	-	11	1673	c.1527A>C	c.(1525-1527)ccA>ccC	p.P509P	CTD-2540B15.13_ENST00000609744.1_RNA	NM_019849.2	NP_062823.1	Q9NS82	AAA1_HUMAN	solute carrier family 7 (neutral amino acid transporter light chain, asc system), member 10	509					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|D-alanine transport (GO:0042941)|D-serine transport (GO:0042942)|ion transport (GO:0006811)|L-serine transport (GO:0015825)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	18	Esophageal squamous(110;0.137)					GCAGGGAGGGTGGGCAGGGGC	0.547													T|||	4	0.000798722	0.0023	0.0	5008	,	,		10342	0.0		0.0	False		,,,				2504	0.001						uc002num.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1525-1527)CCA>CCC		solute carrier family 7, member 10							32.0	35.0	34.0					19																	33699842		2202	4300	6502	SO:0001819	synonymous_variant	56301				blood coagulation|cellular nitrogen compound metabolic process|ion transport|leukocyte migration	integral to plasma membrane	L-serine transmembrane transporter activity	g.chr19:33699842T>G	AB037670	CCDS12431.1	19q13.11	2013-05-28	2011-07-12		ENSG00000130876	ENSG00000130876		"""Solute carriers"""	11058	protein-coding gene	gene with protein product		607959				10734121, 10863037	Standard	NM_019849		Approved	asc-1	uc002num.2	Q9NS82	OTTHUMG00000180344	ENST00000253188.4:c.1527A>C	19.37:g.33699842T>G						SLC7A10_uc002nul.2_Silent_p.P356P	p.P509P	NM_019849	NP_062823	Q9NS82	AAA1_HUMAN			11	1674	-	Esophageal squamous(110;0.137)		509					B2RE84	Silent	SNP	ENST00000253188.4	37	c.1527A>C	CCDS12431.1																																																																																				0.547	SLC7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450846.2	NM_019849		5	17	0	0	0	0.000978	0	5	17				
SPTBN4	57731	broad.mit.edu	37	19	41019317	41019317	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:41019317G>T	ENST00000352632.3	+	14	2707	c.2621G>T	c.(2620-2622)cGc>cTc	p.R874L	SPTBN4_ENST00000344104.3_Missense_Mutation_p.R874L|SPTBN4_ENST00000595535.1_Missense_Mutation_p.R874L|SPTBN4_ENST00000598249.1_Missense_Mutation_p.R874L|SPTBN4_ENST00000338932.3_Missense_Mutation_p.R874L			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	874					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.R874H(1)		breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCGCTGAGGCGCCAGTGGCTG	0.667																																							uc002ony.2		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(3)|central_nervous_system(1)|skin(1)	5						c.(2620-2622)CGC>CTC		spectrin, beta, non-erythrocytic 4 isoform							20.0	21.0	20.0					19																	41019317		2200	4295	6495	SO:0001583	missense	57731				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton	g.chr19:41019317G>T	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.2621G>T	19.37:g.41019317G>T	ENSP00000263373:p.Arg874Leu					SPTBN4_uc002onx.2_Missense_Mutation_p.R874L|SPTBN4_uc002onz.2_Missense_Mutation_p.R874L|SPTBN4_uc010egx.2_5'UTR	p.R874L	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)		14	2707	+			874			Spectrin 6.		E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	c.2621G>T	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	G	13.67	2.305800	0.40795	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.53857	0.6;0.6;0.6	3.39	3.39	0.38822	.	0.425366	0.21347	N	0.076021	T	0.48909	0.1526	L	0.27053	0.805	0.80722	D	1	D;B	0.52996	0.957;0.064	P;B	0.50754	0.649;0.03	T	0.53472	-0.8434	10	0.51188	T	0.08	.	14.0505	0.64732	0.0:0.0:1.0:0.0	.	874;874	Q9H254;Q71S06	SPTN4_HUMAN;.	L	874	ENSP00000263373:R874L;ENSP00000340345:R874L;ENSP00000340741:R874L	ENSP00000340345:R874L	R	+	2	0	SPTBN4	45711157	0.001000	0.12720	1.000000	0.80357	0.510000	0.34073	0.974000	0.29436	1.918000	0.55548	0.313000	0.20887	CGC		0.667	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2			6	5	1	0	0.00198382	0.001984	0.00226583	6	5				
SIGLEC9	27180	broad.mit.edu	37	19	51630302	51630302	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:51630302G>T	ENST00000250360.3	+	4	831	c.764G>T	c.(763-765)gGa>gTa	p.G255V	SIGLEC9_ENST00000440804.3_Missense_Mutation_p.G255V	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	255	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		ACAGTCTTGGGAAATGGCTCA	0.507																																							uc002pvu.2		NA																	0				skin(1)	1						c.(763-765)GGA>GTA		sialic acid binding Ig-like lectin 9 precursor							87.0	87.0	87.0					19																	51630302		2203	4300	6503	SO:0001583	missense	27180				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding	g.chr19:51630302G>T	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.764G>T	19.37:g.51630302G>T	ENSP00000250360:p.Gly255Val					SIGLEC9_uc010yct.1_Missense_Mutation_p.G255V	p.G255V	NM_014441	NP_055256	Q9Y336	SIGL9_HUMAN		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)	4	831	+		all_neural(266;0.0529)	255			Extracellular (Potential).|Ig-like C2-type 2.		Q6GTU4|Q9BYI9	Missense_Mutation	SNP	ENST00000250360.3	37	c.764G>T	CCDS12825.1	.	.	.	.	.	.	.	.	.	.	.	10.35	1.326583	0.24080	.	.	ENSG00000129450	ENST00000440804;ENST00000250360	T;T	0.13538	2.58;2.79	2.71	-1.07	0.09968	Immunoglobulin-like (1);	1.588610	0.04421	N	0.367668	T	0.35653	0.0939	M	0.89658	3.05	0.09310	N	1	P	0.47191	0.891	P	0.57960	0.83	T	0.25222	-1.0138	10	0.54805	T	0.06	.	2.8881	0.05668	0.4039:0.2582:0.3379:0.0	.	255	Q9Y336	SIGL9_HUMAN	V	255	ENSP00000413861:G255V;ENSP00000250360:G255V	ENSP00000250360:G255V	G	+	2	0	SIGLEC9	56322114	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-1.376000	0.02561	0.192000	0.20272	-0.481000	0.04817	GGA		0.507	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441		22	70	1	0	5.26018e-13	0.001882	7.29537e-13	22	70				
SIGLEC14	100049587	broad.mit.edu	37	19	52146834	52146834	+	Silent	SNP	A	A	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:52146834A>C	ENST00000360844.6	-	6	1145	c.1104T>G	c.(1102-1104)gcT>gcG	p.A368A	SIGLEC5_ENST00000534261.2_Intron|SIGLEC5_ENST00000599649.1_Intron|SIGLEC5_ENST00000429354.3_Intron|SIGLEC5_ENST00000222107.4_Intron	NM_001098612.1	NP_001092082.1	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14	368					cell adhesion (GO:0007155)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		GGAGGAAGCCAGCCCCCATGA	0.597																																							uc002pxf.3		NA																	0				ovary(1)	1						c.(1102-1104)GCT>GCG		sialic acid binding Ig-like lectin 14 precursor							51.0	60.0	57.0					19																	52146834		1799	3997	5796	SO:0001819	synonymous_variant	100049587				cell adhesion	integral to membrane|plasma membrane	protein binding|sugar binding	g.chr19:52146834A>C	AY854038	CCDS42604.1	19q13.41	2013-01-29			ENSG00000254415	ENSG00000254415		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32926	protein-coding gene	gene with protein product						17012248	Standard	NM_001098612		Approved		uc002pxf.4	Q08ET2	OTTHUMG00000165511	ENST00000360844.6:c.1104T>G	19.37:g.52146834A>C							p.A368A	NM_001098612	NP_001092082	Q08ET2	SIG14_HUMAN		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)	6	1224	-		all_neural(266;0.0299)	368			Helical; (Potential).		Q6UXG0	Silent	SNP	ENST00000360844.6	37	c.1104T>G	CCDS42604.1																																																																																				0.597	SIGLEC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466899.2	NM_001098612		26	40	0	0	0	0.004656	0	26	40				
ZNF816	125893	broad.mit.edu	37	19	53459279	53459280	+	Splice_Site	DNP	CC	CC	AA			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:53459279_53459280CC>AA	ENST00000357666.4	-	3	363_364	c.63_64GG>TT	c.(61-66)caGGga>caTTga	p.21_22QG>H*	ZNF816_ENST00000391786.2_Splice_Site_p.21_22QG>H*|CTD-2620I22.1_ENST00000600068.1_RNA|ZNF816_ENST00000444460.2_Splice_Site_p.21_22QG>H*|ZNF816_ENST00000438970.2_Splice_Site_p.21_22QG>H*|ZNF816_ENST00000270457.4_Splice_Site_p.21_22QG>H*|ZNF816_ENST00000434371.2_Splice_Site_p.21_22QG>H*|ZNF816_ENST00000535506.1_Splice_Site_p.21_22QG>H*|ZNF321P_ENST00000391777.3_Splice_Site_p.21_22QG>H*	NM_001031665.2	NP_001026835.1	Q0VGE8	ZN816_HUMAN	zinc finger protein 816	21					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(10)|lung(9)|stomach(1)|urinary_tract(2)	27						ATATCACTTACCTGAGGAAGAG	0.431																																							uc002qal.1		NA																	0					0						c.e3+1		zinc finger protein 816A																																				SO:0001630	splice_region_variant	125893				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53459279_53459280CC>AA	BC063805	CCDS33096.1	19q13.41	2013-01-08	2010-07-23	2010-07-23		ENSG00000180257		"""Zinc fingers, C2H2-type"", ""-"""	26995	protein-coding gene	gene with protein product			"""zinc finger protein 816A"""	ZNF816A			Standard	NM_001031665		Approved		uc002qam.2	Q0VGE8		ENST00000357666.4:c.63_64delinsAA	19.37:g.53459279_53459280delinsAA						ZNF321_uc010eqj.2_Splice_Site_p.Q5_splice|ZNF321_uc002qak.1_Splice_Site_p.Q5_splice|ZNF816A_uc002qam.1_Splice_Site_p.Q5_splice	p.Q21_splice	NM_001031665	NP_001026835	Q0VGE8	ZN816_HUMAN		GBM - Glioblastoma multiforme(134;0.0313)	3	364	-								A8K7H5|Q3KR39|Q659B3	Splice_Site	DNP	ENST00000357666.4	37	c.63_splice	CCDS33096.1																																																																																				0.431	ZNF816-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396132.1	NM_001031665	Nonsense_Mutation	36	71	0	0	0	0.004672	0	36	71				
VN1R4	317703	broad.mit.edu	37	19	53770108	53770108	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:53770108C>A	ENST00000311170.4	-	1	864	c.811G>T	c.(811-813)Gcc>Tcc	p.A271S	CTD-2245F17.9_ENST00000599803.1_lincRNA	NM_173857.2	NP_776256.2	Q7Z5H5	VN1R4_HUMAN	vomeronasal 1 receptor 4	271					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	22				GBM - Glioblastoma multiforme(134;0.00294)		CTCATTAAGGCTGAAGTGTTC	0.438										HNSCC(26;0.072)																													uc010ydu.1		NA																	0				ovary(2)	2						c.(811-813)GCC>TCC		vomeronasal 1 receptor 4							72.0	66.0	68.0					19																	53770108		2203	4300	6503	SO:0001583	missense	317703				response to pheromone	actin cytoskeleton|cytoplasm|integral to membrane|plasma membrane	pheromone receptor activity	g.chr19:53770108C>A	AY114733	CCDS33099.1	19q13.42	2012-08-22			ENSG00000228567	ENSG00000228567		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19871	protein-coding gene	gene with protein product						12123587	Standard	NM_173857		Approved	V1RL4	uc010ydu.2	Q7Z5H5		ENST00000311170.4:c.811G>T	19.37:g.53770108C>A	ENSP00000310856:p.Ala271Ser	HNSCC(26;0.072)					p.A271S	NM_173857	NP_776256	Q7Z5H5	VN1R4_HUMAN		GBM - Glioblastoma multiforme(134;0.00294)	1	811	-			271			Helical; Name=7; (Potential).		Q2M3E2|Q7Z5H6|Q7Z5H7|Q8TDU2	Missense_Mutation	SNP	ENST00000311170.4	37	c.811G>T	CCDS33099.1	.	.	.	.	.	.	.	.	.	.	C	6.074	0.381898	0.11524	.	.	ENSG00000228567	ENST00000311170	T	0.09538	2.97	2.29	-4.57	0.03421	GPCR, rhodopsin-like superfamily (1);	0.759301	0.10772	N	0.635857	T	0.05410	0.0143	N	0.20881	0.62	0.09310	N	1	B	0.21225	0.053	B	0.27500	0.08	T	0.39231	-0.9624	10	0.37606	T	0.19	.	0.8882	0.01249	0.1541:0.1906:0.3034:0.3519	.	271	Q7Z5H5	VN1R4_HUMAN	S	271	ENSP00000310856:A271S	ENSP00000310856:A271S	A	-	1	0	VN1R4	58461920	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.649000	0.05384	-1.300000	0.02341	-0.272000	0.10252	GCC		0.438	VN1R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464287.1	NM_173857		23	40	1	0	3.83957e-06	0.00278	4.54122e-06	23	40				
LILRB4	11006	broad.mit.edu	37	19	55175722	55175722	+	Silent	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:55175722G>A	ENST00000391736.1	+	6	756	c.441G>A	c.(439-441)cgG>cgA	p.R147R	LILRB4_ENST00000391733.3_Silent_p.R147R|LILRB4_ENST00000391734.3_Silent_p.R147R|LILRB4_ENST00000270452.2_Silent_p.R147R|LILRB4_ENST00000430952.2_Silent_p.R147R	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	147	Ig-like C2-type 2.				immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		GTCAGTCACGGAGCCCAATGG	0.572																																							uc002qgp.2		NA																	0				ovary(3)	3						c.(439-441)CGG>CGA		leukocyte immunoglobulin-like receptor,							105.0	95.0	98.0					19																	55175722		2203	4300	6503	SO:0001819	synonymous_variant	11006					integral to membrane|plasma membrane	antigen binding|receptor activity	g.chr19:55175722G>A	U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.441G>A	19.37:g.55175722G>A						LILRB4_uc002qgq.2_Silent_p.R147R|LILRB4_uc010ers.1_Silent_p.R60R|LILRB4_uc002qgr.2_Silent_p.R188R|LILRB4_uc010ert.2_Silent_p.R188R|LILRB4_uc010eru.2_Silent_p.R176R	p.R147R	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN		GBM - Glioblastoma multiforme(193;0.035)	4	803	+			147			Ig-like C2-type 2.|Extracellular (Potential).		A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Silent	SNP	ENST00000391736.1	37	c.441G>A	CCDS12902.1																																																																																				0.572	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3			36	71	0	0	0	0.003271	0	36	71				
NLRP7	199713	broad.mit.edu	37	19	55453058	55453058	+	Missense_Mutation	SNP	A	A	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:55453058A>T	ENST00000590030.1	-	1	62	c.22T>A	c.(22-24)Tgg>Agg	p.W8R	NLRP7_ENST00000588756.1_Missense_Mutation_p.W8R|NLRP7_ENST00000446217.1_Missense_Mutation_p.W36R|NLRP7_ENST00000340844.2_Missense_Mutation_p.W8R|NLRP7_ENST00000448121.2_Missense_Mutation_p.W8R|NLRP7_ENST00000592784.1_Missense_Mutation_p.W8R|NLRP7_ENST00000328092.5_Missense_Mutation_p.W8R			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	8	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.						ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		TGCAGAGTCCACTCTAGCTGG	0.478																																							uc002qih.3		NA																	0				large_intestine(1)|breast(1)|central_nervous_system(1)	3						c.(22-24)TGG>AGG		NACHT, leucine rich repeat and PYD containing 7							37.0	37.0	37.0					19																	55453058		2203	4300	6503	SO:0001583	missense	199713						ATP binding	g.chr19:55453058A>T	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.22T>A	19.37:g.55453058A>T	ENSP00000465520:p.Trp8Arg					NLRP7_uc002qig.3_Missense_Mutation_p.W8R|NLRP7_uc002qii.3_Missense_Mutation_p.W8R|NLRP7_uc010esk.2_Missense_Mutation_p.W8R|NLRP7_uc010esl.2_Missense_Mutation_p.W36R	p.W8R	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN		GBM - Glioblastoma multiforme(193;0.0325)	2	98	-			8			DAPIN.		E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	ENST00000590030.1	37	c.22T>A	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	A	10.28	1.307897	0.23821	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	1.53	0.476	0.16779	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.27063	0.0663	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.28667	0.219;0.219;0.219;0.184	B;B;B;B	0.21360	0.034;0.034;0.034;0.013	T	0.23976	-1.0173	9	0.87932	D	0	.	3.3416	0.07120	0.7627:0.0:0.2373:0.0	.	36;8;8;8	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	R	8;8;8;36;8	ENSP00000329568:W8R;ENSP00000409137:W8R;ENSP00000339491:W8R;ENSP00000414273:W36R	ENSP00000329568:W8R	W	-	1	0	NLRP7	60144870	0.002000	0.14202	0.000000	0.03702	0.006000	0.05464	0.892000	0.28322	0.072000	0.16694	0.260000	0.18958	TGG		0.478	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176		18	23	0	0	0	0.007413	0	18	23				
GP6	51206	broad.mit.edu	37	19	55543711	55543711	+	Nonsense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:55543711C>A	ENST00000417454.1	-	3	148	c.121G>T	c.(121-123)Gag>Tag	p.E41*	GP6_ENST00000333884.2_Nonsense_Mutation_p.E41*|GP6_ENST00000310373.3_Nonsense_Mutation_p.E41*|CTC-550B14.7_ENST00000586845.1_RNA|CTC-550B14.6_ENST00000585492.1_RNA|CTC-550B14.7_ENST00000586961.1_RNA|CTC-550B14.7_ENST00000593060.1_RNA	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)	41	Ig-like C2-type 1.				blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		ACTGGCTTCTCCAGGGGCACC	0.682																																							uc002qik.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(121-123)GAG>TAG		glycoprotein VI (platelet) isoform 2							22.0	25.0	24.0					19																	55543711		1958	4131	6089	SO:0001587	stop_gained	51206				enzyme linked receptor protein signaling pathway|leukocyte migration|platelet activation	integral to plasma membrane	collagen binding|transmembrane receptor activity	g.chr19:55543711C>A	AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.121G>T	19.37:g.55543711C>A	ENSP00000394922:p.Glu41*					GP6_uc002qil.2_Nonsense_Mutation_p.E41*|GP6_uc010esq.2_Nonsense_Mutation_p.E41*|RDH13_uc010esr.1_Intron	p.E41*	NM_016363	NP_057447	Q9HCN6	GPVI_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)	3	149	-			41			Ig-like C2-type 1.|Extracellular (Potential).		Q9HCN7|Q9UIF2	Nonsense_Mutation	SNP	ENST00000417454.1	37	c.121G>T	CCDS46184.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.166615	0.78339	.	.	ENSG00000088053	ENST00000417454;ENST00000310373;ENST00000333884	.	.	.	3.96	-2.22	0.06952	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	4.0387	0.09741	0.0:0.3767:0.1813:0.442	.	.	.	.	X	41	.	ENSP00000308782:E41X	E	-	1	0	GP6	60235523	0.000000	0.05858	0.074000	0.20217	0.969000	0.65631	-1.427000	0.02441	-0.133000	0.11537	-0.258000	0.10820	GAG		0.682	GP6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357006.1			17	14	1	0	9.16793e-09	0.00499	1.14846e-08	17	14				
KLF11	8462	broad.mit.edu	37	2	10186425	10186425	+	Missense_Mutation	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr2:10186425G>A	ENST00000305883.1	+	2	353	c.191G>A	c.(190-192)gGt>gAt	p.G64D	KLF11_ENST00000540845.1_Missense_Mutation_p.G47D|KLF11_ENST00000535335.1_Missense_Mutation_p.G47D	NM_003597.4	NP_003588.1	O14901	KLF11_HUMAN	Kruppel-like factor 11	64					apoptotic process (GO:0006915)|cellular response to peptide (GO:1901653)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		TCCCAGAAAGGTGACCTGTTG	0.527																																					Melanoma(56;431 1507 23687 50789)	Melanoma(56;431 1507 23687 50789)	uc002raf.1		NA																	0				ovary(2)	2						c.(190-192)GGT>GAT		Kruppel-like factor 11							107.0	101.0	103.0					2																	10186425		2203	4300	6503	SO:0001583	missense	8462				apoptosis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|regulation of transcription involved in S phase of mitotic cell cycle	nucleus	sequence-specific DNA binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr2:10186425G>A	AF028008	CCDS1668.1, CCDS54333.1	2p25	2013-01-08	2004-11-29	2004-12-01	ENSG00000172059	ENSG00000172059		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11811	protein-coding gene	gene with protein product		603301	"""TGFB inducible early growth response 2"""	TIEG2		9748269, 11087666	Standard	NM_001177716		Approved	Tieg3, MODY7	uc002raf.1	O14901	OTTHUMG00000119004	ENST00000305883.1:c.191G>A	2.37:g.10186425G>A	ENSP00000307023:p.Gly64Asp					KLF11_uc010yjc.1_Missense_Mutation_p.G47D	p.G64D	NM_003597	NP_003588	O14901	KLF11_HUMAN		Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)	2	353	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		64					B4DZE7|Q9EPF4	Missense_Mutation	SNP	ENST00000305883.1	37	c.191G>A	CCDS1668.1	.	.	.	.	.	.	.	.	.	.	G	9.245	1.039249	0.19669	.	.	ENSG00000172059	ENST00000401510;ENST00000305883;ENST00000448523;ENST00000540845;ENST00000440320;ENST00000535335	T;T;T;T;T;T	0.64085	-0.05;2.55;-0.08;2.54;-0.05;2.54	5.03	3.18	0.36537	.	0.559900	0.18810	N	0.130551	T	0.54854	0.1884	M	0.65498	2.005	0.35178	D	0.772176	B	0.21381	0.055	B	0.17433	0.018	T	0.56798	-0.7919	10	0.22706	T	0.39	.	8.1252	0.30995	0.1428:0.131:0.7261:0.0	.	64	O14901	KLF11_HUMAN	D	47;64;47;47;47;47	ENSP00000386058:G47D;ENSP00000307023:G64D;ENSP00000387866:G47D;ENSP00000444690:G47D;ENSP00000388263:G47D;ENSP00000442722:G47D	ENSP00000307023:G64D	G	+	2	0	KLF11	10103876	0.247000	0.23920	0.086000	0.20670	0.643000	0.38383	1.432000	0.34936	1.085000	0.41206	0.462000	0.41574	GGT		0.527	KLF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000239202.3	NM_003597		17	24	0	0	0	0.006122	0	17	24				
XDH	7498	broad.mit.edu	37	2	31602826	31602826	+	Silent	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr2:31602826G>A	ENST00000379416.3	-	13	1197	c.1149C>T	c.(1147-1149)gtC>gtT	p.V383V		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	383	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	GGTCCATCTGGACAGTTCTCC	0.552																																					Colon(66;682 1445 30109 40147)	Colon(66;682 1445 30109 40147)	uc002rnv.1		NA																	0				skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8						c.(1147-1149)GTC>GTT		xanthine dehydrogenase	Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)						87.0	87.0	87.0					2																	31602826		2203	4300	6503	SO:0001819	synonymous_variant	7498				purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity	g.chr2:31602826G>A	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.1149C>T	2.37:g.31602826G>A							p.V383V	NM_000379	NP_000370	P47989	XDH_HUMAN			13	1228	-	Acute lymphoblastic leukemia(172;0.155)		383			FAD-binding PCMH-type.		Q16681|Q16712|Q4PJ16	Silent	SNP	ENST00000379416.3	37	c.1149C>T	CCDS1775.1																																																																																				0.552	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379		36	51	0	0	0	0.00623	0	36	51				
DHX57	90957	broad.mit.edu	37	2	39088534	39088534	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr2:39088534C>A	ENST00000295373.6	-	5	1144	c.1018G>T	c.(1018-1020)Gat>Tat	p.D340Y	DHX57_ENST00000479345.2_5'UTR|AC018693.6_ENST00000442829.1_RNA	NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	340							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				AGATGAGAATCATCTACACTT	0.343																																					Melanoma(191;1090 2095 4375 23729 47341)	Melanoma(191;1090 2095 4375 23729 47341)	uc002rrf.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(1018-1020)GAT>TAT		DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57							53.0	53.0	53.0					2																	39088534		2203	4300	6503	SO:0001583	missense	90957						ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding	g.chr2:39088534C>A	AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.1018G>T	2.37:g.39088534C>A	ENSP00000295373:p.Asp340Tyr					DHX57_uc002rre.2_5'UTR|DHX57_uc002rrg.2_Missense_Mutation_p.D340Y	p.D340Y	NM_198963	NP_945314	Q6P158	DHX57_HUMAN			5	1117	-		all_hematologic(82;0.248)	340					A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Missense_Mutation	SNP	ENST00000295373.6	37	c.1018G>T	CCDS1800.1	.	.	.	.	.	.	.	.	.	.	C	18.67	3.672975	0.67928	.	.	ENSG00000163214	ENST00000295373;ENST00000355320	T	0.03386	3.95	5.78	5.78	0.91487	Ubiquitin-conjugating enzyme/RWD-like (1);RWD domain (1);	0.000000	0.56097	D	0.000021	T	0.11367	0.0277	L	0.34521	1.04	0.46298	D	0.998976	D;D	0.69078	0.995;0.997	D;D	0.64506	0.926;0.924	T	0.01287	-1.1395	10	0.72032	D	0.01	.	18.1945	0.89817	0.0:1.0:0.0:0.0	.	340;340	Q6P158-2;Q6P158	.;DHX57_HUMAN	Y	340;238	ENSP00000295373:D340Y	ENSP00000295373:D340Y	D	-	1	0	DHX57	38942038	.	.	1.000000	0.80357	0.992000	0.81027	.	.	2.724000	0.93272	0.563000	0.77884	GAT		0.343	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646		14	28	1	0	9.31168e-06	0.001855	1.07941e-05	14	28				
EHBP1	23301	broad.mit.edu	37	2	62974575	62974575	+	Silent	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr2:62974575G>A	ENST00000263991.5	+	3	632	c.150G>A	c.(148-150)agG>agA	p.R50R	EHBP1_ENST00000405289.1_Silent_p.R50R|EHBP1_ENST00000405015.3_Silent_p.R50R|EHBP1_ENST00000354487.3_Silent_p.R50R|EHBP1_ENST00000431489.1_Silent_p.R50R	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	50						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			GAAGCCGAAGGAAGTCTTCTA	0.299																																							uc002sby.2		NA																	0				ovary(1)|breast(1)	2						c.(148-150)AGG>AGA		EH domain binding protein 1 isoform 1							105.0	117.0	113.0					2																	62974575		2203	4300	6503	SO:0001819	synonymous_variant	23301	Hereditary_Prostate_Cancer				cytoplasm|membrane		g.chr2:62974575G>A	AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.150G>A	2.37:g.62974575G>A						EHBP1_uc010fcp.2_Silent_p.R50R|EHBP1_uc010fcq.1_Silent_p.R50R|EHBP1_uc002sbx.2_Silent_p.R50R|EHBP1_uc002sbz.2_Silent_p.R50R|EHBP1_uc002scb.2_Silent_p.R50R|EHBP1_uc002sca.2_Silent_p.R50R	p.R50R	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)		3	632	+	Lung NSC(7;0.0951)|all_lung(7;0.169)		50					O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Silent	SNP	ENST00000263991.5	37	c.150G>A	CCDS1872.1																																																																																				0.299	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251616.1	NM_015252		18	83	0	0	0	0.001523	0	18	83				
REG3G	130120	broad.mit.edu	37	2	79255050	79255050	+	Missense_Mutation	SNP	A	A	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr2:79255050A>G	ENST00000272324.5	+	5	635	c.451A>G	c.(451-453)Aga>Gga	p.R151G	REG3G_ENST00000409471.1_Missense_Mutation_p.R105G|REG3G_ENST00000393897.2_Missense_Mutation_p.R151G	NM_001008387.2	NP_001008388.1	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma	151	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|defense response to Gram-positive bacterium (GO:0050830)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(27)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GAGCCTGTCAAGAAGCACAGG	0.478																																							uc002snw.2		NA																	0					0						c.(451-453)AGA>GGA		regenerating islet-derived 3 gamma precursor							98.0	101.0	100.0					2																	79255050		2203	4300	6503	SO:0001583	missense	130120				acute-phase response	extracellular region	sugar binding	g.chr2:79255050A>G	AY359047	CCDS1962.1, CCDS58714.1	2p12	2005-02-11			ENSG00000143954	ENSG00000143954			29595	protein-coding gene	gene with protein product		609933				12975309	Standard	NM_001008387		Approved	UNQ429, LPPM429, PAP1B	uc002snx.4	Q6UW15	OTTHUMG00000130018	ENST00000272324.5:c.451A>G	2.37:g.79255050A>G	ENSP00000272324:p.Arg151Gly					REG3G_uc002snx.2_Missense_Mutation_p.R151G|REG3G_uc010ffu.2_Missense_Mutation_p.R105G	p.R151G	NM_198448	NP_940850	Q6UW15	REG3G_HUMAN			5	536	+			151			C-type lectin.		A8K980|D6W5J6|Q3SYE4|Q3SYE6|Q6FH18	Missense_Mutation	SNP	ENST00000272324.5	37	c.451A>G	CCDS1962.1	.	.	.	.	.	.	.	.	.	.	A	12.72	2.022397	0.35701	.	.	ENSG00000143954	ENST00000393897;ENST00000272324;ENST00000409471	T;T;T	0.19669	2.13;2.13;2.13	4.73	-9.46	0.00597	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	1.491390	0.04317	N	0.349975	T	0.15825	0.0381	L	0.49126	1.545	0.09310	N	1	B;B	0.20368	0.044;0.0	B;B	0.24848	0.056;0.008	T	0.10474	-1.0628	10	0.25751	T	0.34	.	5.684	0.17792	0.4868:0.1215:0.3228:0.0689	.	105;151	Q3SYE6;Q6UW15	.;REG3G_HUMAN	G	151;151;105	ENSP00000377475:R151G;ENSP00000272324:R151G;ENSP00000387105:R105G	ENSP00000272324:R151G	R	+	1	2	REG3G	79108558	0.000000	0.05858	0.000000	0.03702	0.145000	0.21501	-2.212000	0.01225	-2.861000	0.00327	0.528000	0.53228	AGA		0.478	REG3G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328247.1	NM_198448		37	47	0	0	0	0.006999	0	37	47				
CNGA3	1261	broad.mit.edu	37	2	99012950	99012950	+	Silent	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr2:99012950G>T	ENST00000272602.2	+	7	1356	c.1317G>T	c.(1315-1317)cgG>cgT	p.R439R	CNGA3_ENST00000436404.2_Silent_p.R421R|CNGA3_ENST00000393504.1_Silent_p.R439R|CNGA3_ENST00000409937.1_Silent_p.R443R			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	439			R -> W (in ACHM2; also found in patients with cone-rod dystrophy; does not reveal any detectable calcium influx upon agonist application at 37 degrees Celsius). {ECO:0000269|PubMed:18521937, ECO:0000269|PubMed:24903488}.		cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						GGGTTATCCGGTGGTTTGACT	0.547																																							uc002syt.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)	6						c.(1315-1317)CGG>CGT		cyclic nucleotide gated channel alpha 3 isoform							65.0	66.0	65.0					2																	99012950		2203	4300	6503	SO:0001819	synonymous_variant	1261				signal transduction|visual perception	integral to membrane	cGMP binding	g.chr2:99012950G>T	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1317G>T	2.37:g.99012950G>T						CNGA3_uc002syu.2_Silent_p.R421R|CNGA3_uc010fij.2_Silent_p.R443R	p.R439R	NM_001298	NP_001289	Q16281	CNGA3_HUMAN			8	1734	+			439		R -> W (in ACHM2; does not reveal any detectable calcium influx upon agonist application at 37 degrees Celsius; the channel function could be restored by incubating the transfected cells at 27 degrees Celsius; the dose-response relationship for cGMP-activation is shifted toward a lower cGMP concentration; the dose-response relationship of the mutant CNGA3 + CNGB3 is similar to that of the wild-type protein; coexpression of the CNGB3 subunit compensate completely for the slightly higher apparent cGMP sensitivity of homomers; the channel density into the cell membrane is considerably improved by decreasing the cultivation temparature).			E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Silent	SNP	ENST00000272602.2	37	c.1317G>T	CCDS2034.1																																																																																				0.547	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298		16	32	1	0	1.3612e-06	0.003163	1.64332e-06	16	32				
TGFBRAP1	9392	broad.mit.edu	37	2	105897176	105897176	+	Missense_Mutation	SNP	C	C	A	rs56016004	byFrequency	TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr2:105897176C>A	ENST00000393359.2	-	6	1552	c.1126G>T	c.(1126-1128)Ggc>Tgc	p.G376C	TGFBRAP1_ENST00000258449.1_Missense_Mutation_p.G376C			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	376					intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						TCAAGCTGGCCGCTTCTGCAA	0.542																																					Esophageal Squamous(183;794 2019 9730 21801 48859)	Esophageal Squamous(183;794 2019 9730 21801 48859)	uc002tcq.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1126-1128)GGC>TGC		transforming growth factor, beta receptor							66.0	66.0	66.0					2																	105897176		2203	4300	6503	SO:0001583	missense	9392				regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding	g.chr2:105897176C>A	AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.1126G>T	2.37:g.105897176C>A	ENSP00000377027:p.Gly376Cys					TGFBRAP1_uc010fjc.2_Missense_Mutation_p.G146C|TGFBRAP1_uc002tcr.3_Missense_Mutation_p.G376C	p.G376C	NM_004257	NP_004248	Q8WUH2	TGFA1_HUMAN			6	1210	-			376					A8K5R7|D3DVJ8|O60466	Missense_Mutation	SNP	ENST00000393359.2	37	c.1126G>T	CCDS2067.1	.	.	.	.	.	.	.	.	.	.	C	15.63	2.890896	0.52014	.	.	ENSG00000135966	ENST00000393359;ENST00000258449	T;T	0.47528	0.84;0.84	5.29	2.48	0.30137	.	0.104171	0.64402	D	0.000003	T	0.52885	0.1762	L	0.45581	1.43	0.45205	D	0.998214	D	0.57571	0.98	P	0.62885	0.908	T	0.45702	-0.9243	10	0.38643	T	0.18	-28.2668	7.5973	0.28056	0.0:0.6708:0.0:0.3292	.	376	Q8WUH2	TGFA1_HUMAN	C	376	ENSP00000377027:G376C;ENSP00000258449:G376C	ENSP00000258449:G376C	G	-	1	0	TGFBRAP1	105263608	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	3.361000	0.52306	0.592000	0.29728	0.650000	0.86243	GGC		0.542	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253354.2	NM_004257		8	14	1	0	5.18039e-06	0.00308	6.03516e-06	8	14				
KCNJ3	3760	broad.mit.edu	37	2	155711687	155711687	+	Silent	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr2:155711687C>T	ENST00000295101.2	+	3	1845	c.1368C>T	c.(1366-1368)acC>acT	p.T456T		NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	456					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	CTAAAACCACCAAGATGTTAT	0.468																																							uc002tyv.1		NA																	0				upper_aerodigestive_tract(1)|pancreas(1)	2						c.(1366-1368)ACC>ACT		potassium inwardly-rectifying channel J3	Halothane(DB01159)						49.0	51.0	51.0					2																	155711687		2203	4300	6503	SO:0001819	synonymous_variant	3760				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding	g.chr2:155711687C>T	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.1368C>T	2.37:g.155711687C>T						KCNJ3_uc010zce.1_3'UTR	p.T456T	NM_002239	NP_002230	P48549	IRK3_HUMAN			3	1563	+			456			Cytoplasmic (By similarity).		B4DEW7|Q8TBI0	Silent	SNP	ENST00000295101.2	37	c.1368C>T	CCDS2200.1																																																																																				0.468	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239		30	37	0	0	0	0.008361	0	30	37				
CPS1	1373	broad.mit.edu	37	2	211503873	211503873	+	Splice_Site	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr2:211503873G>T	ENST00000233072.5	+	23	3025		c.e23-1		CPS1_ENST00000430249.2_Splice_Site|CPS1_ENST00000497121.1_Splice_Site|CPS1_ENST00000451903.2_Splice_Site	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial						anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TTCTCTTACAGATTGATACAC	0.303																																							uc002vee.3		NA																	0				ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13						c.e23-1		carbamoyl-phosphate synthetase 1 isoform b							51.0	48.0	49.0					2																	211503873		2203	4300	6503	SO:0001630	splice_region_variant	1373				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity	g.chr2:211503873G>T	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.2830-1G>T	2.37:g.211503873G>T						CPS1_uc010fur.2_Splice_Site_p.I950_splice|CPS1_uc010fus.2_Splice_Site_p.I493_splice	p.I944_splice	NM_001875	NP_001866	P31327	CPSM_HUMAN		Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	23	2962	+								B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Splice_Site	SNP	ENST00000233072.5	37	c.2830_splice	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.014432	0.75161	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9023	0.92448	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CPS1	211212118	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	8.727000	0.91480	2.537000	0.85549	0.650000	0.86243	.		0.303	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		Intron	10	18	1	0	1.58986e-06	0.008291	1.90948e-06	10	18				
SIRPG	55423	broad.mit.edu	37	20	1617082	1617082	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr20:1617082G>T	ENST00000303415.3	-	3	564	c.500C>A	c.(499-501)aCc>aAc	p.T167N	SIRPG_ENST00000381583.2_Missense_Mutation_p.T167N|RP11-77C3.3_ENST00000437384.1_RNA|RP11-77C3.3_ENST00000456177.1_RNA|SIRPG_ENST00000344103.4_Intron|SIRPG_ENST00000381580.1_Missense_Mutation_p.T134N|SIRPG_ENST00000216927.4_Missense_Mutation_p.T167N	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	167	Ig-like C1-type 1.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						GGACTCACAGGTGAAACTCAC	0.542																																							uc002wfm.1		NA																	0				ovary(1)	1						c.(499-501)ACC>AAC		signal-regulatory protein gamma isoform 1							139.0	124.0	129.0					20																	1617082		2203	4300	6503	SO:0001583	missense	55423				blood coagulation|cell adhesion|cell junction assembly|cell-cell signaling|intracellular signal transduction|leukocyte migration|negative regulation of cell proliferation|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to membrane|intracellular|plasma membrane	protein binding	g.chr20:1617082G>T	AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.500C>A	20.37:g.1617082G>T	ENSP00000305529:p.Thr167Asn					SIRPG_uc002wfn.1_Missense_Mutation_p.T167N|SIRPG_uc002wfo.1_Intron|uc002wfp.1_Intron	p.T167N	NM_018556	NP_061026	Q9P1W8	SIRPG_HUMAN			3	565	-			167			Extracellular (Potential).|Ig-like C1-type 1.		B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	ENST00000303415.3	37	c.500C>A	CCDS13020.2	.	.	.	.	.	.	.	.	.	.	.	8.794	0.931205	0.18131	.	.	ENSG00000089012	ENST00000381580;ENST00000303415;ENST00000381583;ENST00000216927	T;T;T;T	0.03330	3.97;3.97;3.97;3.97	2.09	1.05	0.20165	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000009	T	0.11196	0.0273	M	0.85299	2.745	0.19775	N	0.999952	B;P	0.46706	0.348;0.883	B;P	0.52793	0.199;0.709	T	0.04128	-1.0975	10	0.87932	D	0	.	6.3817	0.21538	0.0:0.3119:0.6881:0.0	.	167;167	Q9P1W8-4;Q9P1W8	.;SIRPG_HUMAN	N	134;167;167;167	ENSP00000370992:T134N;ENSP00000305529:T167N;ENSP00000370995:T167N;ENSP00000216927:T167N	ENSP00000216927:T167N	T	-	2	0	SIRPG	1565082	1.000000	0.71417	0.027000	0.17364	0.002000	0.02628	3.833000	0.55790	0.179000	0.19938	-0.714000	0.03626	ACC		0.542	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077566.2	NM_018556		41	81	1	0	2.66277e-13	0.006999	3.71512e-13	41	81				
SEMG1	6406	broad.mit.edu	37	20	43837137	43837137	+	Missense_Mutation	SNP	G	G	C	rs147894843	byFrequency	TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr20:43837137G>C	ENST00000372781.3	+	2	1256	c.1199G>C	c.(1198-1200)gGt>gCt	p.G400A	SEMG1_ENST00000244069.6_Missense_Mutation_p.G340A	NM_003007.3	NP_002998.1	P04279	SEMG1_HUMAN	semenogelin I	400	Repeat-rich region. {ECO:0000250}.				insemination (GO:0007320)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.0122)				CCATGGCATGGTGAAAATGCA	0.438																																							uc002xni.2		NA																	0				skin(2)	2						c.(1198-1200)GGT>GCT		semenogelin I preproprotein							73.0	66.0	68.0					20																	43837137		2203	4300	6503	SO:0001583	missense	6406				insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity	g.chr20:43837137G>C		CCDS13345.1	20q12-q13.2	2009-08-06			ENSG00000124233	ENSG00000124233			10742	protein-coding gene	gene with protein product	"""semen coagulating protein"", ""cancer/testis antigen 103"""	182140		SEMG		2912989, 15563730	Standard	NM_003007		Approved	CT103		P04279	OTTHUMG00000032565	ENST00000372781.3:c.1199G>C	20.37:g.43837137G>C	ENSP00000361867:p.Gly400Ala					SEMG1_uc002xnj.2_Missense_Mutation_p.G340A|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Missense_Mutation_p.G340A	p.G400A	NM_003007	NP_002998	P04279	SEMG1_HUMAN			2	1256	+		Myeloproliferative disorder(115;0.0122)	400					Q53ZV0|Q53ZV1|Q53ZV2|Q6X4I9|Q6Y809|Q6Y822|Q6Y823|Q86U64|Q96QM3	Missense_Mutation	SNP	ENST00000372781.3	37	c.1199G>C	CCDS13345.1	.	.	.	.	.	.	.	.	.	.	G	5.029	0.191025	0.09547	.	.	ENSG00000124233	ENST00000244069;ENST00000372781	T;T	0.18338	2.22;2.22	1.02	0.00876	0.14076	.	.	.	.	.	T	0.32526	0.0832	M	0.80183	2.485	0.09310	N	1	P;P;B	0.49961	0.454;0.93;0.223	B;P;B	0.59889	0.176;0.865;0.102	T	0.13926	-1.0491	9	0.62326	D	0.03	.	3.3236	0.07059	0.3027:0.0:0.6973:0.0	.	340;400;340	P04279-2;P04279;E7EPD3	.;SEMG1_HUMAN;.	A	340;400	ENSP00000244069:G340A;ENSP00000361867:G400A	ENSP00000244069:G340A	G	+	2	0	SEMG1	43270551	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.205000	0.09411	0.005000	0.14708	-0.259000	0.10710	GGT		0.438	SEMG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079416.3	NM_003007		35	34	0	0	0	0.002445	0	35	34				
KRTAP19-5	337972	broad.mit.edu	37	21	31874354	31874354	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr21:31874354C>A	ENST00000334151.2	-	1	81	c.55G>T	c.(55-57)Gat>Tat	p.D19Y		NM_181611.1	NP_853642.1	Q3LI72	KR195_HUMAN	keratin associated protein 19-5	19						intermediate filament (GO:0005882)				endometrium(1)|large_intestine(5)|lung(4)|pancreas(1)|prostate(1)	12						CCCAGGTCATCGAAGCCTCCG	0.587																																							uc011ada.1		NA																	0					0						c.(55-57)GAT>TAT		keratin associated protein 19-5							145.0	124.0	131.0					21																	31874354		2203	4300	6503	SO:0001583	missense	337972					intermediate filament	protein binding	g.chr21:31874354C>A	AP001708	CCDS13597.1	21q22.1	2006-03-13			ENSG00000186977	ENSG00000186977		"""Keratin associated proteins"""	18940	protein-coding gene	gene with protein product						12359730	Standard	NM_181611		Approved	KAP19.5	uc011ada.2	Q3LI72	OTTHUMG00000057774	ENST00000334151.2:c.55G>T	21.37:g.31874354C>A	ENSP00000334985:p.Asp19Tyr						p.D19Y	NM_181611	NP_853642	Q3LI72	KR195_HUMAN			1	55	-			19					A4IF22	Missense_Mutation	SNP	ENST00000334151.2	37	c.55G>T	CCDS13597.1	.	.	.	.	.	.	.	.	.	.	C	4.083	0.013410	0.07912	.	.	ENSG00000186977	ENST00000334151	T	0.09911	2.93	4.78	0.712	0.18167	.	0.769363	0.10852	U	0.627086	T	0.08223	0.0205	.	.	.	0.09310	N	1	B	0.26041	0.14	B	0.17722	0.019	T	0.31081	-0.9956	9	0.87932	D	0	1.5908	7.0385	0.25006	0.0:0.5687:0.0:0.4313	.	19	Q3LI72	KR195_HUMAN	Y	19	ENSP00000334985:D19Y	ENSP00000334985:D19Y	D	-	1	0	KRTAP19-5	30796225	0.000000	0.05858	0.000000	0.03702	0.443000	0.32047	0.204000	0.17335	0.010000	0.14839	-0.229000	0.12294	GAT		0.587	KRTAP19-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128226.2			47	69	1	0	1.61863e-15	0.00361	2.32803e-15	47	69				
UMODL1	89766	broad.mit.edu	37	21	43491428	43491428	+	Start_Codon_SNP	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr21:43491428G>A	ENST00000408910.2	+	1	3	c.3G>A	c.(1-3)atG>atA	p.M1I	UMODL1_ENST00000400424.2_Intron|UMODL1_ENST00000400427.1_Intron|UMODL1_ENST00000408989.2_Start_Codon_SNP_p.M1I	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	1					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						GCCGGACGATGCTCAGGACCT	0.662																																					Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	uc002zaf.1		NA																	0				ovary(2)|skin(1)	3						c.(1-3)ATG>ATA		uromodulin-like 1 isoform 1 precursor							25.0	30.0	29.0					21																	43491428		2002	4161	6163	SO:0001582	initiator_codon_variant	89766					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity	g.chr21:43491428G>A		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.3G>A	21.37:g.43491428G>A	ENSP00000386147:p.Met1Ile					UMODL1_uc002zad.1_Intron|UMODL1_uc002zae.1_Intron|UMODL1_uc002zag.1_Missense_Mutation_p.M1I	p.M1I	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN			1	3	+			1					C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	37	c.3G>A	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.880129	0.33162	.	.	ENSG00000177398	ENST00000408989;ENST00000408910	T;T	0.74209	-0.82;-0.79	3.47	3.47	0.39725	.	0.547078	0.15432	N	0.262645	T	0.74207	0.3686	.	.	.	0.80722	D	1	P;P	0.50528	0.936;0.895	P;B	0.47744	0.556;0.354	T	0.77357	-0.2618	9	0.87932	D	0	-17.0817	10.7679	0.46305	0.0:0.0:1.0:0.0	.	1;1	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	I	1	ENSP00000386126:M1I;ENSP00000386147:M1I	ENSP00000386147:M1I	M	+	3	0	UMODL1	42364497	0.931000	0.31567	0.052000	0.19188	0.004000	0.04260	3.404000	0.52623	2.243000	0.73865	0.462000	0.41574	ATG		0.662	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		Missense_Mutation	6	10	0	0	0	0.001168	0	6	10				
PHF21B	112885	broad.mit.edu	37	22	45309877	45309877	+	Nonsense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr22:45309877G>T	ENST00000313237.5	-	5	806	c.656C>A	c.(655-657)tCa>tAa	p.S219*	PHF21B_ENST00000403565.1_Intron|PHF21B_ENST00000396103.3_Intron|PHF21B_ENST00000404079.2_Intron|PHF21B_ENST00000447824.3_Intron	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	219							zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		aggggacagtgatggggaggg	0.647																																							uc003bfn.2		NA																	0				ovary(2)|skin(1)	3						c.(655-657)TCA>TAA		PHD finger protein 21B isoform 1							39.0	39.0	39.0					22																	45309877		2202	4300	6502	SO:0001587	stop_gained	112885						zinc ion binding	g.chr22:45309877G>T	AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.656C>A	22.37:g.45309877G>T	ENSP00000324403:p.Ser219*					PHF21B_uc003bfm.2_Intron|PHF21B_uc011aqk.1_Intron|PHF21B_uc011aql.1_Intron|PHF21B_uc011aqm.1_Intron	p.S219*	NM_138415	NP_612424	Q96EK2	PF21B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)	5	807	-		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)	219					B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Nonsense_Mutation	SNP	ENST00000313237.5	37	c.656C>A	CCDS14061.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.271890	0.40194	.	.	ENSG00000056487	ENST00000313237	.	.	.	2.52	2.52	0.30459	.	1.230130	0.06141	N	0.672420	.	.	.	.	.	.	0.22811	N	0.99871	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.7924	8.6515	0.34038	0.0:0.0:1.0:0.0	.	.	.	.	X	219	.	.	S	-	2	0	PHF21B	43688541	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.390000	0.07332	1.691000	0.51100	0.655000	0.94253	TCA		0.647	PHF21B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321731.2	NM_138415		24	30	1	0	1.10923e-09	0.00278	1.42006e-09	24	30				
PPP6R2	9701	broad.mit.edu	37	22	50832508	50832508	+	Silent	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr22:50832508G>A	ENST00000216061.5	+	4	541	c.171G>A	c.(169-171)ctG>ctA	p.L57L	PPP6R2_ENST00000359139.3_Silent_p.L57L|PPP6R2_ENST00000395741.3_Silent_p.L57L|PPP6R2_ENST00000395744.3_Silent_p.L57L			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	57						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						TGGAGGAGCTGGTGAGCCTCA	0.557																																							uc003blb.1		NA																	0					0						c.(169-171)CTG>CTA		SAPS domain family, member 2							131.0	120.0	124.0					22																	50832508		2203	4300	6503	SO:0001819	synonymous_variant	9701					cytoplasm|intracellular membrane-bounded organelle	protein binding	g.chr22:50832508G>A	AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.171G>A	22.37:g.50832508G>A						SAPS2_uc003bky.1_Silent_p.L57L|SAPS2_uc003bkz.1_Silent_p.L57L|SAPS2_uc003blc.2_Silent_p.L57L|SAPS2_uc003bla.1_Silent_p.L57L	p.L57L	NM_014678	NP_055493	O75170	PP6R2_HUMAN		BRCA - Breast invasive adenocarcinoma(115;0.222)	4	593	+		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)	57					A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Silent	SNP	ENST00000216061.5	37	c.171G>A																																																																																					0.557	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316809.1	NM_014678		22	111	0	0	0	0.002299	0	22	111				
SLC4A7	9497	broad.mit.edu	37	3	27442272	27442272	+	Nonsense_Mutation	SNP	T	T	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr3:27442272T>A	ENST00000295736.5	-	16	2453	c.2383A>T	c.(2383-2385)Aga>Tga	p.R795*	SLC4A7_ENST00000428386.1_Nonsense_Mutation_p.R671*|SLC4A7_ENST00000440156.1_Nonsense_Mutation_p.R791*|SLC4A7_ENST00000445684.1_Nonsense_Mutation_p.R791*|SLC4A7_ENST00000425128.2_3'UTR|SLC4A7_ENST00000388777.4_Nonsense_Mutation_p.R345*|SLC4A7_ENST00000435667.2_Nonsense_Mutation_p.R680*|SLC4A7_ENST00000437179.1_Nonsense_Mutation_p.R676*|SLC4A7_ENST00000455077.1_Nonsense_Mutation_p.R676*|SLC4A7_ENST00000446700.1_Nonsense_Mutation_p.R787*|SLC4A7_ENST00000454389.1_Nonsense_Mutation_p.R804*	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	795					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	GTAAGATTTCTCCAGGAAATA	0.328																																							uc003cdv.2		NA																	0				ovary(3)|central_nervous_system(1)|skin(1)	5						c.(2383-2385)AGA>TGA		solute carrier family 4, sodium bicarbonate							133.0	134.0	134.0					3																	27442272		2203	4296	6499	SO:0001587	stop_gained	9497					apical plasma membrane|basolateral plasma membrane|integral to membrane|stereocilium	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity	g.chr3:27442272T>A	AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.2383A>T	3.37:g.27442272T>A	ENSP00000295736:p.Arg795*					SLC4A7_uc011awu.1_RNA|SLC4A7_uc011awv.1_RNA|SLC4A7_uc003cdu.3_Nonsense_Mutation_p.R676*|SLC4A7_uc011aww.1_Nonsense_Mutation_p.R804*|SLC4A7_uc011awx.1_Nonsense_Mutation_p.R791*|SLC4A7_uc011awy.1_Nonsense_Mutation_p.R787*|SLC4A7_uc011awz.1_RNA|SLC4A7_uc011axa.1_Nonsense_Mutation_p.R676*|SLC4A7_uc011axb.1_Nonsense_Mutation_p.R791*|SLC4A7_uc010hfl.2_Nonsense_Mutation_p.R345*|SLC4A7_uc003cdw.2_Nonsense_Mutation_p.R671*	p.R795*	NM_003615	NP_003606	Q9Y6M7	S4A7_HUMAN			16	2454	-			795			Extracellular (Potential).		A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Nonsense_Mutation	SNP	ENST00000295736.5	37	c.2383A>T	CCDS33721.1	.	.	.	.	.	.	.	.	.	.	T	48	14.339822	0.99791	.	.	ENSG00000033867	ENST00000419036;ENST00000295736;ENST00000428386;ENST00000454389;ENST00000440156;ENST00000437179;ENST00000446700;ENST00000455077;ENST00000445684;ENST00000435667;ENST00000388777;ENST00000428179	.	.	.	5.43	2.63	0.31362	.	0.457875	0.25349	N	0.031302	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	9.1764	0.37114	0.0:0.6717:0.0:0.3283	.	.	.	.	X	346;795;671;804;791;676;787;676;791;680;345;691	.	ENSP00000295736:R795X	R	-	1	2	SLC4A7	27417276	0.035000	0.19736	0.845000	0.33349	0.311000	0.27955	0.347000	0.20014	0.259000	0.21709	-0.456000	0.05471	AGA		0.328	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341230.2	NM_003615		52	49	0	0	0	0.00361	0	52	49				
DHX30	22907	broad.mit.edu	37	3	47887703	47887703	+	Missense_Mutation	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr3:47887703G>A	ENST00000445061.1	+	11	1548	c.1141G>A	c.(1141-1143)Gat>Aat	p.D381N	DHX30_ENST00000348968.4_Missense_Mutation_p.D353N|DHX30_ENST00000446256.2_Missense_Mutation_p.D342N|DHX30_ENST00000457607.1_Missense_Mutation_p.D409N	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	381						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GCTGCAGAGTGATGACATCTT	0.542																																							uc003cru.2		NA																	0				ovary(2)|skin(2)	4						c.(1141-1143)GAT>AAT		DEAH (Asp-Glu-Ala-His) box polypeptide 30							100.0	107.0	104.0					3																	47887703		2203	4300	6503	SO:0001583	missense	22907					mitochondrial nucleoid	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding	g.chr3:47887703G>A	AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.1141G>A	3.37:g.47887703G>A	ENSP00000405620:p.Asp381Asn					DHX30_uc003crt.2_Missense_Mutation_p.D342N	p.D381N	NM_138615	NP_619520	Q7L2E3	DHX30_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)	11	1567	+			381					A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Missense_Mutation	SNP	ENST00000445061.1	37	c.1141G>A	CCDS2759.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.788582	0.49997	.	.	ENSG00000132153	ENST00000446256;ENST00000445061;ENST00000348968;ENST00000457607	T;T;T;T	0.03212	4.02;4.01;4.02;4.01	5.36	4.48	0.54585	.	0.562913	0.18977	N	0.125965	T	0.03434	0.0099	L	0.36672	1.1	0.35586	D	0.806677	B;B	0.31193	0.312;0.023	B;B	0.24394	0.053;0.022	T	0.46857	-0.9161	10	0.16896	T	0.51	.	11.6325	0.51185	0.0824:0.0:0.9176:0.0	.	381;342	Q7L2E3;Q7L2E3-3	DHX30_HUMAN;.	N	342;381;353;409	ENSP00000392601:D342N;ENSP00000405620:D381N;ENSP00000343442:D353N;ENSP00000394682:D409N	ENSP00000343442:D353N	D	+	1	0	DHX30	47862707	1.000000	0.71417	0.901000	0.35422	0.983000	0.72400	4.821000	0.62679	1.251000	0.43983	0.655000	0.94253	GAT		0.542	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615		28	126	0	0	0	0.004656	0	28	126				
DHX30	22907	broad.mit.edu	37	3	47887817	47887817	+	Missense_Mutation	SNP	G	G	C	rs71328953		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr3:47887817G>C	ENST00000445061.1	+	11	1662	c.1255G>C	c.(1255-1257)Gaa>Caa	p.E419Q	DHX30_ENST00000348968.4_Missense_Mutation_p.E391Q|DHX30_ENST00000446256.2_Missense_Mutation_p.E380Q|DHX30_ENST00000457607.1_Missense_Mutation_p.E447Q	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	419						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GAGTCTGCTAGAACTGTGGCG	0.632																																							uc003cru.2		NA																	0				ovary(2)|skin(2)	4						c.(1255-1257)GAA>CAA		DEAH (Asp-Glu-Ala-His) box polypeptide 30							70.0	74.0	73.0					3																	47887817		2203	4300	6503	SO:0001583	missense	22907					mitochondrial nucleoid	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding	g.chr3:47887817G>C	AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.1255G>C	3.37:g.47887817G>C	ENSP00000405620:p.Glu419Gln					DHX30_uc003crt.2_Missense_Mutation_p.E380Q	p.E419Q	NM_138615	NP_619520	Q7L2E3	DHX30_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)	11	1681	+			419					A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Missense_Mutation	SNP	ENST00000445061.1	37	c.1255G>C	CCDS2759.1	.	.	.	.	.	.	.	.	.	.	G	12.52	1.961376	0.34565	.	.	ENSG00000132153	ENST00000446256;ENST00000445061;ENST00000348968;ENST00000457607	T;T;T;T	0.03413	3.96;3.95;3.95;3.94	5.09	5.09	0.68999	.	0.538758	0.19975	N	0.101885	T	0.03348	0.0097	N	0.19112	0.55	0.28366	N	0.920243	B;B	0.33073	0.396;0.027	B;B	0.25759	0.063;0.037	T	0.39522	-0.9610	10	0.33940	T	0.23	.	17.4887	0.87696	0.0:0.0:1.0:0.0	.	419;380	Q7L2E3;Q7L2E3-3	DHX30_HUMAN;.	Q	380;419;391;447	ENSP00000392601:E380Q;ENSP00000405620:E419Q;ENSP00000343442:E391Q;ENSP00000394682:E447Q	ENSP00000343442:E391Q	E	+	1	0	DHX30	47862821	1.000000	0.71417	0.935000	0.37517	0.782000	0.44232	2.547000	0.45786	2.348000	0.79779	0.655000	0.94253	GAA		0.632	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615		23	86	0	0	0	0.00278	0	23	86				
DHX30	22907	broad.mit.edu	37	3	47887871	47887871	+	Missense_Mutation	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr3:47887871G>A	ENST00000445061.1	+	11	1716	c.1309G>A	c.(1309-1311)Gac>Aac	p.D437N	DHX30_ENST00000348968.4_Missense_Mutation_p.D409N|DHX30_ENST00000446256.2_Missense_Mutation_p.D398N|DHX30_ENST00000457607.1_Missense_Mutation_p.D465N	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	437						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GCTACCTGTGGACCCACATCG	0.657																																							uc003cru.2		NA																	0				ovary(2)|skin(2)	4						c.(1309-1311)GAC>AAC		DEAH (Asp-Glu-Ala-His) box polypeptide 30							59.0	61.0	60.0					3																	47887871		2203	4300	6503	SO:0001583	missense	22907					mitochondrial nucleoid	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding	g.chr3:47887871G>A	AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.1309G>A	3.37:g.47887871G>A	ENSP00000405620:p.Asp437Asn					DHX30_uc003crt.2_Missense_Mutation_p.D398N	p.D437N	NM_138615	NP_619520	Q7L2E3	DHX30_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)	11	1735	+			437					A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Missense_Mutation	SNP	ENST00000445061.1	37	c.1309G>A	CCDS2759.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.970281	0.53614	.	.	ENSG00000132153	ENST00000446256;ENST00000445061;ENST00000348968;ENST00000457607	T;T;T;T	0.08634	3.07;3.07;3.07;3.07	5.09	5.09	0.68999	DEAD-like helicase (1);	0.000000	0.85682	D	0.000000	T	0.13157	0.0319	L	0.29908	0.895	0.80722	D	1	D;B	0.54601	0.967;0.135	P;B	0.52823	0.71;0.241	T	0.11397	-1.0589	10	0.28530	T	0.3	.	17.4887	0.87696	0.0:0.0:1.0:0.0	.	437;398	Q7L2E3;Q7L2E3-3	DHX30_HUMAN;.	N	398;437;409;465	ENSP00000392601:D398N;ENSP00000405620:D437N;ENSP00000343442:D409N;ENSP00000394682:D465N	ENSP00000343442:D409N	D	+	1	0	DHX30	47862875	1.000000	0.71417	0.959000	0.39883	0.729000	0.41735	7.621000	0.83083	2.348000	0.79779	0.655000	0.94253	GAC		0.657	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615		13	60	0	0	0	0.00245	0	13	60				
FLNB	2317	broad.mit.edu	37	3	58140628	58140628	+	Missense_Mutation	SNP	G	G	T	rs144963323		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr3:58140628G>T	ENST00000295956.4	+	40	6910	c.6745G>T	c.(6745-6747)Ggt>Tgt	p.G2249C	FLNB_ENST00000490882.1_Missense_Mutation_p.G2280C|FLNB_ENST00000358537.3_Missense_Mutation_p.G2225C|FLNB_ENST00000357272.4_3'UTR|FLNB_ENST00000419752.2_Missense_Mutation_p.G2069C|FLNB_ENST00000493452.1_Missense_Mutation_p.G2056C|FLNB_ENST00000429972.2_Missense_Mutation_p.G2238C|FLNB_ENST00000348383.5_Missense_Mutation_p.G2208C	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	2249	Interaction with INPPL1.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		TGGGTCGTGCGGTGTATCTTA	0.488																																							uc003djj.2		NA																	0				breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19						c.(6745-6747)GGT>TGT		filamin B isoform 2							75.0	74.0	75.0					3																	58140628		2203	4300	6503	SO:0001583	missense	2317				actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding	g.chr3:58140628G>T	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.6745G>T	3.37:g.58140628G>T	ENSP00000295956:p.Gly2249Cys					FLNB_uc010hne.2_Missense_Mutation_p.G2280C|FLNB_uc003djk.2_Missense_Mutation_p.G2238C|FLNB_uc010hnf.2_Missense_Mutation_p.G2225C|FLNB_uc003djl.2_Missense_Mutation_p.G2069C|FLNB_uc003djm.2_Missense_Mutation_p.G2056C	p.G2249C	NM_001457	NP_001448	O75369	FLNB_HUMAN		BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)	40	6910	+			2249			Interaction with INPPL1.|Filamin 21.		B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	37	c.6745G>T	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.955922	0.92726	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89;-1.89;-1.89;-1.89	5.53	5.53	0.82687	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.93494	0.7924	M	0.84948	2.725	0.80722	D	1	P;D;D;D;D;D	0.89917	0.457;0.994;1.0;1.0;1.0;1.0	P;D;D;D;D;D	0.87578	0.547;0.95;0.998;0.994;0.997;0.995	D	0.93850	0.7144	10	0.87932	D	0	.	19.8408	0.96685	0.0:0.0:1.0:0.0	.	2225;2280;2056;2069;2238;2249	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	C	2249;2280;2225;2238;2208;2056;2069	ENSP00000295956:G2249C;ENSP00000420213:G2280C;ENSP00000351339:G2225C;ENSP00000415599:G2238C;ENSP00000232447:G2208C;ENSP00000418510:G2056C;ENSP00000414532:G2069C	ENSP00000295956:G2249C	G	+	1	0	FLNB	58115668	1.000000	0.71417	0.990000	0.47175	0.945000	0.59286	9.869000	0.99810	2.768000	0.95171	0.655000	0.94253	GGT		0.488	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457		22	34	1	0	5.35356e-11	0.00278	7.16884e-11	22	34				
FOXP1	27086	broad.mit.edu	37	3	71027060	71027060	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr3:71027060C>A	ENST00000318789.4	-	15	1792	c.1267G>T	c.(1267-1269)Gtc>Ttc	p.V423F	FOXP1_ENST00000475937.1_Missense_Mutation_p.V423F|FOXP1_ENST00000468577.1_Missense_Mutation_p.V423F|FOXP1_ENST00000484350.1_Missense_Mutation_p.V347F|FOXP1_ENST00000493089.1_Missense_Mutation_p.V423F|FOXP1_ENST00000491238.1_Missense_Mutation_p.V425F|FOXP1_ENST00000498215.1_Missense_Mutation_p.V423F	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1	423					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		GTTGTGATGACAGAGGGGCCT	0.577			T	PAX5	ALL																																		uc003dol.2		NA		Dom	yes		3	3p14.1	27086	T	forkhead box P1			L	PAX5		ALL		0				ovary(1)|lung(1)	2						c.(1267-1269)GTC>TTC		forkhead box P1 isoform 1							156.0	149.0	151.0					3																	71027060		2203	4300	6503	SO:0001583	missense	27086				cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding	g.chr3:71027060C>A	AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.1267G>T	3.37:g.71027060C>A	ENSP00000318902:p.Val423Phe					FOXP1_uc003dom.2_Missense_Mutation_p.V347F|FOXP1_uc003don.2_RNA|FOXP1_uc003doo.2_Missense_Mutation_p.V423F|FOXP1_uc003dop.2_Missense_Mutation_p.V423F|FOXP1_uc003doq.1_Missense_Mutation_p.V422F|FOXP1_uc003doi.2_Missense_Mutation_p.V323F|FOXP1_uc003doj.2_Missense_Mutation_p.V323F|FOXP1_uc003dok.2_Missense_Mutation_p.V236F|FOXP1_uc003dor.1_Missense_Mutation_p.V201F	p.V423F	NM_032682	NP_116071	Q9H334	FOXP1_HUMAN		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)	11	1590	-		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)	423					A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	Missense_Mutation	SNP	ENST00000318789.4	37	c.1267G>T	CCDS2914.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.7|23.7	4.444346|4.444346	0.83993|0.83993	.|.	.|.	ENSG00000114861|ENSG00000114861	ENST00000318796|ENST00000318789;ENST00000358280;ENST00000475937;ENST00000339693;ENST00000497355;ENST00000491238;ENST00000493089;ENST00000498215;ENST00000484350;ENST00000468577	.|T;T;T;T;T;T;T;T	.|0.41065	.|1.01;1.01;1.01;1.01;1.01;1.01;1.01;1.01	6.03|6.03	6.03|6.03	0.97812|0.97812	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.66479|0.66479	0.2793|0.2793	M|M	0.73217|0.73217	2.22|2.22	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|0.994;0.998;1.0;0.994;0.994	.|P;D;D;D;P	.|0.85130	.|0.885;0.991;0.997;0.921;0.76	T|T	0.61417|0.61417	-0.7067|-0.7067	5|10	.|0.40728	.|T	.|0.16	.|.	20.5666|20.5666	0.99351|0.99351	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|423;422;423;347;423	.|B3KV70;A3KMG1;G5E9V8;Q8NAN6;Q9H334	.|.;.;.;.;FOXP1_HUMAN	F|F	322|423;235;423;423;319;425;423;423;347;423	.|ENSP00000318902:V423F;ENSP00000419393:V423F;ENSP00000418225:V319F;ENSP00000420736:V425F;ENSP00000418524:V423F;ENSP00000418102:V423F;ENSP00000417857:V347F;ENSP00000418883:V423F	.|ENSP00000318902:V423F	C|V	-|-	2|1	0|0	FOXP1|FOXP1	71109750|71109750	1.000000|1.000000	0.71417|0.71417	0.978000|0.978000	0.43139|0.43139	0.909000|0.909000	0.53808|0.53808	5.761000|5.761000	0.68801|0.68801	2.854000|2.854000	0.98071|0.98071	0.655000|0.655000	0.94253|0.94253	TGT|GTC		0.577	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352250.1	NM_032682		23	74	1	0	2.21704e-12	0.00278	3.02087e-12	23	74				
FAM86DP	692099	broad.mit.edu	37	3	75475685	75475685	+	RNA	SNP	A	A	G	rs11128433	byFrequency	TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr3:75475685A>G	ENST00000459803.1	-	0	844					NR_024241.1				family with sequence similarity 86, member D, pseudogene																		TGGTGCTCCCAGCAGGCAGCC	0.602													.|||	1858	0.371006	0.6104	0.2767	5008	,	,		13934	0.3065		0.2465	False		,,,				2504	0.3088						uc003dpp.3		NA																	0					0						c.(553-555)TGG>CGG		RecName: Full=Protein FAM86B1;																																						692099							g.chr3:75475685A>G	BC016686		3p12.3	2010-06-04	2010-06-04	2010-06-04	ENSG00000244026	ENSG00000244026			32659	pseudogene	pseudogene			"""family with sequence similarity 86, member D"""	FAM86D			Standard	NR_024241		Approved		uc003dpp.4		OTTHUMG00000158855		3.37:g.75475685A>G						FAM86D_uc003dpo.3_RNA|FAM86D_uc003dps.3_RNA|FAM86D_uc003dpq.3_Missense_Mutation_p.W93R|FAM86D_uc003dpr.3_RNA	p.W185R	NR_024241						7	912	-									Missense_Mutation	SNP	ENST00000459803.1	37	c.553T>C																																																																																					0.602	FAM86DP-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000352425.1	NR_024241		3	48	0	0	0	0.000602	0	3	48				
ROBO1	6091	broad.mit.edu	37	3	78685076	78685076	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr3:78685076C>A	ENST00000464233.1	-	23	3333	c.3220G>T	c.(3220-3222)Gcc>Tcc	p.A1074S	ROBO1_ENST00000495273.1_Missense_Mutation_p.A1029S|ROBO1_ENST00000467549.1_Missense_Mutation_p.A974S|ROBO1_ENST00000436010.2_Missense_Mutation_p.A1035S	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1074					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TGAGTGGTGGCGTAAGGAGTA	0.488																																							uc003dqe.2		NA																	0				large_intestine(2)	2						c.(3220-3222)GCC>TCC		roundabout 1 isoform a							176.0	179.0	178.0					3																	78685076		2139	4251	6390	SO:0001583	missense	6091				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding	g.chr3:78685076C>A	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3220G>T	3.37:g.78685076C>A	ENSP00000420321:p.Ala1074Ser					ROBO1_uc003dqb.2_Missense_Mutation_p.A1035S|ROBO1_uc003dqc.2_Missense_Mutation_p.A974S|ROBO1_uc003dqd.2_Missense_Mutation_p.A1029S|ROBO1_uc010hoh.2_Missense_Mutation_p.A266S|ROBO1_uc011bgl.1_Missense_Mutation_p.A646S	p.A1074S	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)	23	3428	-		Lung SC(41;0.0257)|Lung NSC(201;0.0439)	1074			Cytoplasmic (Potential).		B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	c.3220G>T	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631699	0.87660	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.76968	-1.01;-1.06;-0.39;-0.41	6.05	6.05	0.98169	.	0.044496	0.85682	D	0.000000	D	0.87414	0.6171	M	0.61703	1.905	0.80722	D	1	B;P;D;P;D	0.89917	0.284;0.458;1.0;0.576;0.986	B;B;D;B;P	0.85130	0.331;0.119;0.997;0.074;0.753	D	0.84976	0.0885	9	.	.	.	.	20.6087	0.99469	0.0:1.0:0.0:0.0	.	1038;1074;1029;974;1035	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	S	1035;1029;1074;1029;974;1078	ENSP00000406043:A1035S;ENSP00000420321:A1074S;ENSP00000420637:A1029S;ENSP00000417992:A974S	.	A	-	1	0	ROBO1	78767766	1.000000	0.71417	0.988000	0.46212	0.901000	0.52897	7.484000	0.81180	2.866000	0.98385	0.650000	0.86243	GCC		0.488	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941		18	69	1	0	3.62473e-10	0.001882	4.66609e-10	18	69				
ZMAT3	64393	broad.mit.edu	37	3	178785396	178785396	+	Missense_Mutation	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr3:178785396C>T	ENST00000311417.2	-	2	886	c.145G>A	c.(145-147)Ggg>Agg	p.G49R	ZMAT3_ENST00000432729.1_Missense_Mutation_p.G49R	NM_022470.3	NP_071915.1			zinc finger, matrin-type 3											breast(1)|endometrium(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(1)|skin(1)	14	all_cancers(143;3.31e-18)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;6.74e-27)|GBM - Glioblastoma multiforme(14;0.00448)|BRCA - Breast invasive adenocarcinoma(182;0.0527)			TCTTCTTCCCCTGCAAGAGGC	0.557																																							uc003fjg.2		NA																	0				ovary(2)	2						c.(145-147)GGG>AGG		p53 target zinc finger protein isoform 1							117.0	112.0	114.0					3																	178785396		2203	4300	6503	SO:0001583	missense	64393				apoptosis|protein transport|regulation of growth|response to DNA damage stimulus|transmembrane transport	nucleolus	RNA binding|zinc ion binding	g.chr3:178785396C>T	AK122768	CCDS3224.1, CCDS46962.1	3q26.32	2012-10-05	2010-09-15		ENSG00000172667	ENSG00000172667		"""Zinc fingers, matrin-type"""	29983	protein-coding gene	gene with protein product		606452				9400996, 11689294	Standard	NM_022470		Approved	WIG1, MGC10613, FLJ12296, WIG-1, PAG608	uc003fjg.3	Q9HA38	OTTHUMG00000157290	ENST00000311417.2:c.145G>A	3.37:g.178785396C>T	ENSP00000311221:p.Gly49Arg					ZMAT3_uc010hxa.2_Missense_Mutation_p.G49R|ZMAT3_uc003fji.2_Missense_Mutation_p.G49R	p.G49R	NM_022470	NP_071915	Q9HA38	ZMAT3_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;6.74e-27)|GBM - Glioblastoma multiforme(14;0.00448)|BRCA - Breast invasive adenocarcinoma(182;0.0527)		2	404	-	all_cancers(143;3.31e-18)|Ovarian(172;0.00769)|Breast(254;0.155)		49						Missense_Mutation	SNP	ENST00000311417.2	37	c.145G>A	CCDS3224.1	.	.	.	.	.	.	.	.	.	.	C	6.817	0.519912	0.13005	.	.	ENSG00000172667	ENST00000311417;ENST00000432729;ENST00000414084	T;T;T	0.44881	0.95;0.95;0.91	5.86	4.81	0.61882	.	0.520189	0.22044	N	0.065410	T	0.22704	0.0548	N	0.12182	0.205	0.39762	D	0.972044	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.002	T	0.10590	-1.0623	10	0.20046	T	0.44	-31.5315	9.4728	0.38853	0.0:0.654:0.2579:0.0881	.	49;49	Q9HA38-2;Q9HA38	.;ZMAT3_HUMAN	R	49	ENSP00000311221:G49R;ENSP00000396506:G49R;ENSP00000398920:G49R	ENSP00000311221:G49R	G	-	1	0	ZMAT3	180268090	0.996000	0.38824	0.999000	0.59377	0.987000	0.75469	2.980000	0.49321	2.771000	0.95319	0.563000	0.77884	GGG		0.557	ZMAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348336.2	NM_152240		39	26	0	0	0	0.004289	0	39	26				
CTBP1	1487	broad.mit.edu	37	4	1244578	1244578	+	5'Flank	SNP	A	A	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr4:1244578A>G	ENST00000290921.6	-	0	0				CTBP1-AS2_ENST00000581398.1_RNA|CTBP1-AS2_ENST00000357591.2_RNA|CTBP1-AS2_ENST00000514984.1_RNA|CTBP1-AS2_ENST00000505364.1_RNA|CTBP1-AS2_ENST00000578730.1_RNA|CTBP1-AS2_ENST00000507044.1_RNA|CTBP1_ENST00000382952.3_5'Flank	NM_001328.2	NP_001319.1	Q13363	CTBP1_HUMAN	C-terminal binding protein 1						Golgi organization (GO:0007030)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone deacetylation (GO:0031065)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of transcription by chromatin organization (GO:0034401)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		TAATGGAGAGACTTCTGGGGA	0.562																																							uc003gcz.1		NA																	0				ovary(1)	1						c.(217-219)ACT>GCT		hypothetical protein LOC92070							64.0	67.0	66.0					4																	1244578		2203	4300	6503	SO:0001631	upstream_gene_variant	92070							g.chr4:1244578A>G	U37408	CCDS3348.1, CCDS43203.1	4p16	2008-02-05			ENSG00000159692	ENSG00000159692			2494	protein-coding gene	gene with protein product	"""brefeldin A-ribosylated substrate"""	602618				9479502	Standard	XM_005272261		Approved	BARS	uc003gcv.1	Q13363	OTTHUMG00000089259		4.37:g.1244578A>G	Exception_encountered					CTBP1_uc003gcu.1_5'Flank|CTBP1_uc003gcv.1_5'Flank|C4orf42_uc003gcy.1_RNA	p.T73A	NM_052861	NP_443093			OV - Ovarian serous cystadenocarcinoma(23;0.0101)	Colorectal(103;0.188)	1	402	+								Q4W5N3|Q7Z2Q5	Missense_Mutation	SNP	ENST00000290921.6	37	c.217A>G	CCDS3348.1	.	.	.	.	.	.	.	.	.	.	a	1.231	-0.624140	0.03636	.	.	ENSG00000196810	ENST00000357591	.	.	.	1.13	-2.27	0.06846	.	.	.	.	.	T	0.25680	0.0625	.	.	.	0.22226	N	0.999279	B	0.02656	0.0	B	0.01281	0.0	T	0.20306	-1.0279	6	0.87932	D	0	.	1.9898	0.03444	0.4296:0.0:0.3092:0.2611	.	73	Q0VAR9	CD042_HUMAN	A	73	.	ENSP00000350204:T73A	T	+	1	0	C4orf42	1234578	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.355000	0.07671	-1.096000	0.03046	-0.400000	0.06385	ACT		0.562	CTBP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000202938.1	NM_001328		23	30	0	0	0	0.002299	0	23	30				
RHOH	399	broad.mit.edu	37	4	40245368	40245368	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr4:40245368G>T	ENST00000381799.5	+	3	1086	c.362G>T	c.(361-363)cGg>cTg	p.R121L	RHOH_ENST00000505618.1_Missense_Mutation_p.R121L	NM_001278363.1|NM_001278365.1|NM_001278366.1|NM_001278367.1|NM_001278369.1|NM_004310.4	NP_001265292.1|NP_001265294.1|NP_001265295.1|NP_001265296.1|NP_001265298.1|NP_004301.1	Q15669	RHOH_HUMAN	ras homolog family member H	121					mast cell activation (GO:0045576)|negative regulation of catalytic activity (GO:0043086)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of phosphorylation (GO:0042326)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase inhibitor activity (GO:0005095)|kinase inhibitor activity (GO:0019210)|Rho GTPase binding (GO:0017048)			kidney(1)|large_intestine(3)|lung(7)|ovary(1)	12						ACTGACCAGCGGGAGATGGGG	0.567																																							uc003guz.2		NA																	0				ovary(1)|lung(1)	2						c.(361-363)CGG>CTG		ras homolog gene family, member H precursor							56.0	56.0	56.0					4																	40245368		2203	4300	6503	SO:0001583	missense	399				negative regulation of I-kappaB kinase/NF-kappaB cascade|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|T cell differentiation	cytosol|mitochondrion|plasma membrane	GTP binding|GTPase inhibitor activity|kinase inhibitor activity|Rho GTPase binding	g.chr4:40245368G>T	Z35227	CCDS3458.1	4p13	2014-09-17	2012-02-27	2004-03-24	ENSG00000168421	ENSG00000168421			686	protein-coding gene	gene with protein product		602037	"""ras homolog gene family, member H"""	ARHH		7784061	Standard	NM_001278359		Approved	RhoH, TTF	uc003guz.2	Q15669	OTTHUMG00000099373	ENST00000381799.5:c.362G>T	4.37:g.40245368G>T	ENSP00000371219:p.Arg121Leu						p.R121L	NM_004310	NP_004301	Q15669	RHOH_HUMAN			3	1086	+			121						Missense_Mutation	SNP	ENST00000381799.5	37	c.362G>T	CCDS3458.1	.	.	.	.	.	.	.	.	.	.	g	33	5.289245	0.95517	.	.	ENSG00000168421	ENST00000505618;ENST00000381799	T;T	0.77620	-1.11;-1.11	5.92	5.92	0.95590	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90889	0.7137	M	0.90252	3.1	0.80722	D	1	D	0.69078	0.997	D	0.79784	0.993	D	0.91721	0.5389	10	0.87932	D	0	.	20.33	0.98713	0.0:0.0:1.0:0.0	.	121	Q15669	RHOH_HUMAN	L	121	ENSP00000425010:R121L;ENSP00000371219:R121L	ENSP00000371219:R121L	R	+	2	0	RHOH	39921763	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.810000	0.96702	0.585000	0.79938	CGG		0.567	RHOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216820.3	NM_004310		8	23	1	0	5.18039e-06	0.00308	6.03516e-06	8	23				
TECRL	253017	broad.mit.edu	37	4	65188467	65188467	+	Silent	SNP	T	T	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr4:65188467T>A	ENST00000381210.3	-	4	485	c.375A>T	c.(373-375)gcA>gcT	p.A125A	TECRL_ENST00000507440.1_Silent_p.A125A|TECRL_ENST00000513125.1_5'Flank	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	125					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						TGGAGGAAGCTGCAATACTTT	0.318																																							uc003hcv.2		NA																	0					0						c.(373-375)GCA>GCT		steroid 5 alpha-reductase 2-like 2							79.0	78.0	79.0					4																	65188467		2203	4300	6503	SO:0001819	synonymous_variant	253017				lipid metabolic process	cytoplasm|integral to membrane	oxidoreductase activity, acting on the CH-CH group of donors	g.chr4:65188467T>A	AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.375A>T	4.37:g.65188467T>A						TECRL_uc003hcw.2_Silent_p.A125A	p.A125A	NM_001010874	NP_001010874	Q5HYJ1	TECRL_HUMAN			4	484	-			125						Silent	SNP	ENST00000381210.3	37	c.375A>T	CCDS33990.1																																																																																				0.318	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4	NM_001010874		7	25	0	0	0	0.00308	0	7	25				
CXCL1	2919	broad.mit.edu	37	4	74735447	74735447	+	Silent	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr4:74735447C>T	ENST00000395761.3	+	2	229	c.162C>T	c.(160-162)ccC>ccT	p.P54P	CXCL1_ENST00000509101.1_3'UTR	NM_001511.3	NP_001502.1	P09341	GROA_HUMAN	chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)	54					actin cytoskeleton organization (GO:0030036)|cell chemotaxis (GO:0060326)|cell proliferation (GO:0008283)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|positive regulation of catalytic activity (GO:0043085)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|enzyme activator activity (GO:0008047)|receptor binding (GO:0005102)			lung(2)	2	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			GAATTCACCCCAAGAACATCC	0.627																																							uc003hhh.1		NA																	0					0						c.(160-162)CCC>CCT		chemokine (C-X-C motif) ligand 1							91.0	106.0	101.0					4																	74735447		2203	4300	6503	SO:0001819	synonymous_variant	2919				actin cytoskeleton organization|cell proliferation|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response|intracellular signal transduction|negative regulation of cell proliferation|nervous system development	extracellular space|intracellular	chemokine activity|enzyme activator activity|growth factor activity	g.chr4:74735447C>T	J03561	CCDS47074.1	4q13.3	2013-02-25	2002-08-22	2002-08-23		ENSG00000163739		"""Endogenous ligands"""	4602	protein-coding gene	gene with protein product		155730	"""GRO1 oncogene (melanoma growth stimulating activity, alpha)"", ""fibroblast secretory protein"""	MGSA, GRO1, FSP		2217207	Standard	NM_001511		Approved	SCYB1, GROa, MGSA-a, NAP-3	uc003hhh.3	P09341		ENST00000395761.3:c.162C>T	4.37:g.74735447C>T							p.P54P	NM_001511	NP_001502	P09341	GROA_HUMAN	all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)		2	241	+	Breast(15;0.00102)		54					Q9UCR7	Silent	SNP	ENST00000395761.3	37	c.162C>T	CCDS47074.1																																																																																				0.627	CXCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362734.1			31	61	0	0	0	0.008361	0	31	61				
SNCA	6622	broad.mit.edu	37	4	90756779	90756779	+	Missense_Mutation	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr4:90756779C>T	ENST00000394986.1	-	2	461	c.40G>A	c.(40-42)Gga>Aga	p.G14R	SNCA_ENST00000345009.4_Missense_Mutation_p.G14R|SNCA_ENST00000394989.2_Missense_Mutation_p.G14R|SNCA_ENST00000394991.3_Missense_Mutation_p.G14R|SNCA_ENST00000508895.1_Missense_Mutation_p.G14R|SNCA_ENST00000336904.3_Missense_Mutation_p.G14R|SNCA_ENST00000502987.1_Missense_Mutation_p.G14R|SNCA_ENST00000420646.2_Missense_Mutation_p.G14R|RP11-67M1.1_ENST00000501215.1_RNA|RP11-67M1.1_ENST00000513653.1_RNA|SNCA_ENST00000505199.1_Missense_Mutation_p.G14R|SNCA_ENST00000506244.1_Missense_Mutation_p.G14R			P37840	SYUA_HUMAN	synuclein, alpha (non A4 component of amyloid precursor)	14					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|adult locomotory behavior (GO:0008344)|aging (GO:0007568)|behavioral response to cocaine (GO:0048148)|cellular response to copper ion (GO:0071280)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to oxidative stress (GO:0034599)|dopamine biosynthetic process (GO:0042416)|dopamine uptake involved in synaptic transmission (GO:0051583)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|long-term synaptic potentiation (GO:0060291)|microglial cell activation (GO:0001774)|mitochondrial ATP synthesis coupled electron transport (GO:0042775)|mitochondrial membrane organization (GO:0007006)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dopamine metabolic process (GO:0045963)|negative regulation of dopamine uptake involved in synaptic transmission (GO:0051585)|negative regulation of exocytosis (GO:0045920)|negative regulation of histone acetylation (GO:0035067)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of monooxygenase activity (GO:0032769)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of norepinephrine uptake (GO:0051622)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of serotonin uptake (GO:0051612)|negative regulation of thrombin receptor signaling pathway (GO:0070495)|negative regulation of transporter activity (GO:0032410)|neutral lipid metabolic process (GO:0006638)|oxidation-reduction process (GO:0055114)|phospholipid metabolic process (GO:0006644)|positive regulation of endocytosis (GO:0045807)|positive regulation of glutathione peroxidase activity (GO:1903284)|positive regulation of hydrogen peroxide catabolic process (GO:1903285)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of receptor recycling (GO:0001921)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein destabilization (GO:0031648)|receptor internalization (GO:0031623)|regulation of acyl-CoA biosynthetic process (GO:0050812)|regulation of dopamine secretion (GO:0014059)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of glutamate secretion (GO:0014048)|regulation of locomotion (GO:0040012)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of macrophage activation (GO:0043030)|regulation of neuron death (GO:1901214)|regulation of phospholipase activity (GO:0010517)|response to drug (GO:0042493)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|response to iron(II) ion (GO:0010040)|response to lipopolysaccharide (GO:0032496)|response to magnesium ion (GO:0032026)|synapse organization (GO:0050808)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular region (GO:0005576)|fibril (GO:0043205)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nuclear outer membrane (GO:0005640)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ribosome (GO:0005840)|rough endoplasmic reticulum (GO:0005791)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	alpha-tubulin binding (GO:0043014)|calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|dynein binding (GO:0045502)|ferrous iron binding (GO:0008198)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinesin binding (GO:0019894)|magnesium ion binding (GO:0000287)|oxidoreductase activity (GO:0016491)|phospholipid binding (GO:0005543)|phosphoprotein binding (GO:0051219)|tau protein binding (GO:0048156)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)	8		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.42e-05)		GCCACAACTCCCTCCTTGGCC	0.423																																							uc003hsq.2		NA																	0					0						c.(40-42)GGA>AGA		alpha-synuclein isoform NACP140	Melatonin(DB01065)						135.0	124.0	128.0					4																	90756779		2203	4300	6503	SO:0001583	missense	6622				activation of caspase activity|anti-apoptosis|negative regulation of dopamine uptake|negative regulation of exocytosis|negative regulation of histone acetylation|negative regulation of microtubule polymerization|negative regulation of monooxygenase activity|negative regulation of norepinephrine uptake|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of serotonin uptake|negative regulation of thrombin receptor signaling pathway|negative regulation of transporter activity|positive regulation of endocytosis|positive regulation of inositol phosphate biosynthetic process|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein serine/threonine kinase activity|positive regulation of receptor recycling|positive regulation of release of sequestered calcium ion into cytosol|receptor internalization|regulation of phospholipase activity|response to interferon-gamma|response to interleukin-1|response to iron(II) ion|response to lipopolysaccharide|response to magnesium ion|synaptic vesicle endocytosis	actin cytoskeleton|axon|cell cortex|cell junction|cytosol|fibril|growth cone|nucleus|synapse	alpha-tubulin binding|calcium ion binding|caspase inhibitor activity|dynein binding|ferrous iron binding|histone binding|Hsp70 protein binding|kinesin binding|magnesium ion binding|phosphoprotein binding|tau protein binding|zinc ion binding	g.chr4:90756779C>T	L08850	CCDS3634.1, CCDS43252.1	4q21.3-q22	2014-05-22			ENSG00000145335	ENSG00000145335		"""Parkinson disease"""	11138	protein-coding gene	gene with protein product		163890	"""Parkinson disease (autosomal dominant, Lewy body) 4"""	PARK1, PARK4		8248242, 14593171	Standard	NM_000345		Approved	NACP, PD1, alpha-synuclein	uc003hsr.3	P37840	OTTHUMG00000130948	ENST00000394986.1:c.40G>A	4.37:g.90756779C>T	ENSP00000378437:p.Gly14Arg					SNCA_uc010ikt.2_Missense_Mutation_p.G14R|SNCA_uc003hso.2_Missense_Mutation_p.G14R|SNCA_uc003hsp.2_Missense_Mutation_p.G14R|SNCA_uc003hsr.2_Missense_Mutation_p.G14R|uc003hss.1_5'Flank	p.G14R	NM_001146054	NP_001139526	P37840	SYUA_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;7.42e-05)	2	299	-		Hepatocellular(203;0.114)	14					A8K2A4|Q13701|Q4JHI3|Q6IAU6	Missense_Mutation	SNP	ENST00000394986.1	37	c.40G>A	CCDS3634.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.991397	0.93106	.	.	ENSG00000145335	ENST00000394989;ENST00000420646;ENST00000345009;ENST00000394986;ENST00000394991;ENST00000336904;ENST00000508895;ENST00000506244;ENST00000505199;ENST00000502987;ENST00000506691	D;D;D;D;D;D;D;D;D;D;D	0.92048	-2.96;-2.96;-2.96;-2.96;-2.96;-2.96;-2.96;-2.96;-2.96;-2.96;-2.96	4.28	4.28	0.50868	.	0.000000	0.64402	D	0.000001	D	0.95623	0.8577	M	0.70595	2.14	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.95931	0.8938	10	0.87932	D	0	-4.8285	18.1022	0.89509	0.0:1.0:0.0:0.0	.	14;14;14	P37840-3;P37840;P37840-2	.;SYUA_HUMAN;.	R	14	ENSP00000378440:G14R;ENSP00000396241:G14R;ENSP00000343683:G14R;ENSP00000378437:G14R;ENSP00000378442:G14R;ENSP00000338345:G14R;ENSP00000426955:G14R;ENSP00000422238:G14R;ENSP00000421485:G14R;ENSP00000426034:G14R;ENSP00000423445:G14R	ENSP00000338345:G14R	G	-	1	0	SNCA	90975802	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.755000	0.68750	2.701000	0.92244	0.644000	0.83932	GGA		0.423	SNCA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253547.2			17	43	0	0	0	0.00499	0	17	43				
TLL1	7092	broad.mit.edu	37	4	166935588	166935588	+	Splice_Site	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr4:166935588G>T	ENST00000061240.2	+	8	1565	c.918G>T	c.(916-918)agG>agT	p.R306S	TLL1_ENST00000513213.1_Splice_Site_p.R306S|TLL1_ENST00000507499.1_Splice_Site_p.R306S	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	306	Metalloprotease. {ECO:0000250}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TTTTTTTCAGGGGGATGTTTC	0.413																																							uc003irh.1		NA																	0				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7						c.(916-918)AGG>AGT		tolloid-like 1 precursor							235.0	236.0	236.0					4																	166935588		2203	4300	6503	SO:0001630	splice_region_variant	7092				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr4:166935588G>T	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.918-1G>T	4.37:g.166935588G>T						TLL1_uc011cjn.1_Missense_Mutation_p.R306S|TLL1_uc011cjo.1_Missense_Mutation_p.R130S	p.R306S	NM_012464	NP_036596	O43897	TLL1_HUMAN		GBM - Glioblastoma multiforme(119;0.103)	8	1565	+	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)	306			Metalloprotease (By similarity).		B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	c.918G>T	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	G	18.91	3.722644	0.68959	.	.	ENSG00000038295	ENST00000061240;ENST00000507499;ENST00000513213	T;T;T	0.62639	0.01;0.01;0.01	4.96	4.1	0.47936	Peptidase M12A, astacin (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	U	0.000000	T	0.67608	0.2911	L	0.31752	0.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	T	0.65372	-0.6184	9	.	.	.	.	13.7131	0.62680	0.077:0.0:0.923:0.0	.	306;306	E9PD25;O43897	.;TLL1_HUMAN	S	306	ENSP00000061240:R306S;ENSP00000426082:R306S;ENSP00000422937:R306S	.	R	+	3	2	TLL1	167155038	1.000000	0.71417	0.997000	0.53966	0.965000	0.64279	0.880000	0.28159	1.033000	0.39918	0.557000	0.71058	AGG		0.413	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		Missense_Mutation	29	116	1	0	2.2171e-23	0.001786	3.51418e-23	29	116				
SDHA	6389	broad.mit.edu	37	5	256470	256470	+	Missense_Mutation	SNP	G	G	T	rs3211483		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr5:256470G>T	ENST00000264932.6	+	15	2045	c.1930G>T	c.(1930-1932)Gtg>Ttg	p.V644L	SDHA_ENST00000507522.1_3'UTR|SDHA_ENST00000504309.1_Missense_Mutation_p.V563L|SDHA_ENST00000510361.1_Missense_Mutation_p.V596L	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	644					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	ATATAGACCCGTGATCGACAA	0.428									Familial Paragangliomas																														uc003jao.3		NA																	0					0						c.(1930-1932)GTG>TTG		succinate dehydrogenase complex, subunit A,	Succinic acid(DB00139)						91.0	104.0	99.0					5																	256470		2203	4300	6503	SO:0001583	missense	6389	Familial_Paragangliomas	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity	g.chr5:256470G>T	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1930G>T	5.37:g.256470G>T	ENSP00000264932:p.Val644Leu					SDHA_uc011clw.1_Missense_Mutation_p.V596L|SDHA_uc003jap.3_Missense_Mutation_p.V563L|SDHA_uc003jaq.3_Missense_Mutation_p.V419L|SDHA_uc003jar.3_Missense_Mutation_p.V238L	p.V644L	NM_004168	NP_004159	P31040	DHSA_HUMAN	Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		15	2045	+			644					A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	c.1930G>T	CCDS3853.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	N|N	16.94|16.94	3.260911|3.260911	0.59431|0.59431	.|.	.|.	ENSG00000073578|ENSG00000073578	ENST00000515815|ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361	.|D;D;D	.|0.83419	.|-1.72;-1.72;-1.72	4.12|4.12	4.12|4.12	0.48240|0.48240	.|Fumarate reductase/succinate dehydrogenase flavoprotein-like, C-terminal (1);Fumarate reductase/succinate dehydrogenase flavoprotein, C-terminal (1);	.|0.000000	.|0.64402	.|U	.|0.000002	D|D	0.89722|0.89722	0.6797|0.6797	M|M	0.69523|0.69523	2.12|2.12	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;0.999;0.967;0.999	.|D;D;D;D	.|0.97110	.|1.0;0.92;0.964;0.942	D|D	0.91028|0.91028	0.4862|0.4862	5|10	.|0.87932	.|D	.|0	.|.	13.8591|13.8591	0.63548|0.63548	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|596;238;563;644	.|E9PBJ5;B3KYA5;D6RFM5;P31040	.|.;.;.;DHSA_HUMAN	L|L	126|644;499;563;596	.|ENSP00000264932:V644L;ENSP00000426514:V563L;ENSP00000427703:V596L	.|ENSP00000264932:V644L	R|V	+|+	2|1	0|0	SDHA|SDHA	309470|309470	1.000000|1.000000	0.71417|0.71417	0.642000|0.642000	0.29436|0.29436	0.242000|0.242000	0.25591|0.25591	8.735000|8.735000	0.91549|0.91549	1.861000|1.861000	0.53984|0.53984	0.305000|0.305000	0.20034|0.20034	CGT|GTG		0.428	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168		7	101	1	0	0.00307968	0.00308	0.00350032	7	101				
DNAH5	1767	broad.mit.edu	37	5	13864539	13864539	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr5:13864539C>A	ENST00000265104.4	-	28	4667	c.4563G>T	c.(4561-4563)gaG>gaT	p.E1521D	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1521	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GAAGAGGTGCCTCCATGATAT	0.408									Kartagener syndrome																														uc003jfd.2		NA																	0				ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31						c.(4561-4563)GAG>GAT		dynein, axonemal, heavy chain 5							76.0	78.0	78.0					5																	13864539		2203	4300	6503	SO:0001583	missense	1767	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr5:13864539C>A	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.4563G>T	5.37:g.13864539C>A	ENSP00000265104:p.Glu1521Asp						p.E1521D	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN			28	4605	-	Lung NSC(4;0.00476)		1521			Stem (By similarity).		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	c.4563G>T	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	10.78	1.445607	0.25987	.	.	ENSG00000039139	ENST00000265104	T	0.60299	0.2	5.27	-0.471	0.12119	Dynein heavy chain, domain-2 (1);	0.220459	0.45126	D	0.000399	T	0.35566	0.0936	L	0.31065	0.9	0.39895	D	0.973823	B	0.02656	0.0	B	0.16289	0.015	T	0.05115	-1.0905	10	0.38643	T	0.18	.	2.5452	0.04736	0.1312:0.392:0.0975:0.3793	.	1521	Q8TE73	DYH5_HUMAN	D	1521	ENSP00000265104:E1521D	ENSP00000265104:E1521D	E	-	3	2	DNAH5	13917539	0.905000	0.30787	0.997000	0.53966	0.971000	0.66376	-0.017000	0.12590	-0.020000	0.14032	-0.151000	0.13558	GAG		0.408	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369		27	33	1	0	2.79863e-10	0.004656	3.62267e-10	27	33				
PRDM9	56979	broad.mit.edu	37	5	23522875	23522875	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr5:23522875C>A	ENST00000296682.3	+	8	945	c.763C>A	c.(763-765)Cag>Aag	p.Q255K		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	255	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AGGCATCCCTCAGGCTGGGCT	0.572										HNSCC(3;0.000094)																													uc003jgo.2		NA																	0				ovary(3)|large_intestine(2)|pancreas(1)	6						c.(763-765)CAG>AAG		PR domain containing 9							60.0	57.0	58.0					5																	23522875		2203	4300	6503	SO:0001583	missense	56979				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding	g.chr5:23522875C>A	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.763C>A	5.37:g.23522875C>A	ENSP00000296682:p.Gln255Lys	HNSCC(3;0.000094)					p.Q255K	NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN			8	945	+			255			SET.		B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	c.763C>A	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	C	13.60	2.286974	0.40494	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.47528	0.84	4.14	2.29	0.28610	SET domain (1);	0.220893	0.22891	N	0.054393	T	0.24314	0.0589	N	0.12746	0.255	0.21445	N	0.999688	B	0.12013	0.005	B	0.06405	0.002	T	0.09907	-1.0653	10	0.37606	T	0.19	-16.2204	5.1034	0.14772	0.1308:0.2608:0.6083:0.0	.	255	Q9NQV7	PRDM9_HUMAN	K	255;49	ENSP00000296682:Q255K	ENSP00000253473:Q49K	Q	+	1	0	PRDM9	23558632	0.000000	0.05858	0.999000	0.59377	0.946000	0.59487	-0.285000	0.08410	0.856000	0.35383	0.597000	0.82753	CAG		0.572	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227		19	31	1	0	2.37509e-13	0.001523	3.33371e-13	19	31				
AFF4	27125	broad.mit.edu	37	5	132232907	132232907	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr5:132232907C>A	ENST00000265343.5	-	11	1794	c.1415G>T	c.(1414-1416)tGg>tTg	p.W472L	AFF4_ENST00000378595.3_Missense_Mutation_p.W472L	NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	472					spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)		SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ATCAAGTTGCCATTTGTTTGT	0.413																																					Ovarian(126;889 1733 2942 10745 11605)	Ovarian(126;889 1733 2942 10745 11605)	uc003kyd.2		NA																	0				ovary(2)|kidney(2)|skin(1)	5						c.(1414-1416)TGG>TTG		ALL1 fused gene from 5q31							108.0	114.0	112.0					5																	132232907		2203	4300	6503	SO:0001583	missense	27125				transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity	g.chr5:132232907C>A	AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.1415G>T	5.37:g.132232907C>A	ENSP00000265343:p.Trp472Leu					AFF4_uc011cxk.1_Missense_Mutation_p.W150L|AFF4_uc003kye.1_Missense_Mutation_p.W472L	p.W472L	NM_014423	NP_055238	Q9UHB7	AFF4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		11	1823	-		all_cancers(142;0.145)|Breast(839;0.198)	472					B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Missense_Mutation	SNP	ENST00000265343.5	37	c.1415G>T	CCDS4164.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.3|26.3	4.728996|4.728996	0.89390|0.89390	.|.	.|.	ENSG00000072364|ENSG00000072364	ENST00000425658|ENST00000265343;ENST00000378595	.|D;D	.|0.81659	.|-1.52;-1.52	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.90058|0.90058	0.6895|0.6895	M|M	0.85945|0.85945	2.785|2.785	0.80722|0.80722	D|D	1|1	.|D;D	.|0.71674	.|0.998;0.997	.|D;D	.|0.81914	.|0.994;0.995	D|D	0.86173|0.86173	0.1601|0.1601	5|10	.|0.11182	.|T	.|0.66	-4.1681|-4.1681	20.0522|20.0522	0.97631|0.97631	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|472;472	.|Q9UHB7-2;Q9UHB7	.|.;AFF4_HUMAN	C|L	168|472	.|ENSP00000265343:W472L;ENSP00000367858:W472L	.|ENSP00000265343:W472L	G|W	-|-	1|2	0|0	AFF4|AFF4	132260806|132260806	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.228000|7.228000	0.78079|0.78079	2.737000|2.737000	0.93849|0.93849	0.563000|0.563000	0.77884|0.77884	GGC|TGG		0.413	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133049.1	NM_014423		29	105	1	0	3.80469e-20	0.001786	5.71931e-20	29	105				
PCDHA10	56139	broad.mit.edu	37	5	140237891	140237891	+	Missense_Mutation	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr5:140237891G>A	ENST00000307360.5	+	1	2258	c.2258G>A	c.(2257-2259)cGg>cAg	p.R753Q	PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	753	6 X 4 AA repeats of P-X-X-P.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCAGAGGCGGCAGAGGGTG	0.672																																							uc003lhx.2		NA																	0				ovary(2)|skin(2)|breast(1)	5						c.(2257-2259)CGG>CAG		protocadherin alpha 10 isoform 1 precursor							50.0	57.0	54.0					5																	140237891		1322	2289	3611	SO:0001583	missense	56139				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140237891G>A	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.2258G>A	5.37:g.140237891G>A	ENSP00000304234:p.Arg753Gln					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc011dad.1_Missense_Mutation_p.R753Q	p.R753Q	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2258	+			753			6 X 4 AA repeats of P-X-X-P.|Cytoplasmic (Potential).		A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	ENST00000307360.5	37	c.2258G>A	CCDS54921.1	.	.	.	.	.	.	.	.	.	.	G	5.800	0.331998	0.10956	.	.	ENSG00000250120	ENST00000307360	T	0.14022	2.54	3.79	0.935	0.19483	.	.	.	.	.	T	0.07369	0.0186	L	0.28776	0.89	0.09310	N	0.999999	B;B	0.31413	0.322;0.216	B;B	0.21708	0.036;0.024	T	0.38286	-0.9668	9	0.21014	T	0.42	.	4.4399	0.11568	0.3879:0.1603:0.4518:0.0	.	753;753	Q9Y5I2-3;Q9Y5I2	.;PCDAA_HUMAN	Q	753	ENSP00000304234:R753Q	ENSP00000304234:R753Q	R	+	2	0	PCDHA10	140218075	0.000000	0.05858	0.761000	0.31378	0.599000	0.36880	0.435000	0.21510	0.059000	0.16252	0.462000	0.41574	CGG		0.672	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901		14	12	0	0	0	0.00245	0	14	12				
PCDHB10	56126	broad.mit.edu	37	5	140568980	140568980	+	5'Flank	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr5:140568980G>T	ENST00000239446.4	+	0	0					NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10						calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTTGGCCTCGGTGTCTTCGCT	0.716																																							uc003liw.1		NA																	0					0						c.(2089-2091)GTG>TTG		protocadherin beta 9 precursor							55.0	62.0	59.0					5																	140568980		2182	4241	6423	SO:0001631	upstream_gene_variant	56127				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140568980G>T	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626		5.37:g.140568980G>T	Exception_encountered					PCDHB10_uc003lix.2_5'Flank	p.V697L	NM_019119	NP_061992	Q9Y5E1	PCDB9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		3	2089	+			697			Helical; (Potential).		Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	c.2089G>T	CCDS4252.1																																																																																				0.716	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		25	159	1	0	3.21987e-24	0.00361	5.174e-24	25	159				
PCDHB10	56126	broad.mit.edu	37	5	140574220	140574220	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr5:140574220G>T	ENST00000239446.4	+	1	2279	c.2095G>T	c.(2095-2097)Gtg>Ttg	p.V699L		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	699					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTTGGCCTCGGTGTCTTCGCT	0.716																																							uc003lix.2		NA																	0				ovary(1)|skin(1)	2						c.(2095-2097)GTG>TTG		protocadherin beta 10 precursor							32.0	41.0	38.0					5																	140574220		2155	4174	6329	SO:0001583	missense	56126				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140574220G>T	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.2095G>T	5.37:g.140574220G>T	ENSP00000239446:p.Val699Leu						p.V699L	NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2269	+			699			Helical; (Potential).		Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	c.2095G>T	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	g	21.4	4.142915	0.77888	.	.	ENSG00000120324	ENST00000239446	T	0.12039	2.72	3.1	3.1	0.35709	.	.	.	.	.	T	0.44371	0.1290	H	0.94306	3.52	0.35828	D	0.82509	D	0.89917	1.0	D	0.85130	0.997	T	0.61362	-0.7078	9	0.87932	D	0	.	8.4806	0.33040	0.1128:0.0:0.8872:0.0	.	699	Q9UN67	PCDBA_HUMAN	L	699	ENSP00000239446:V699L	ENSP00000239446:V699L	V	+	1	0	PCDHB10	140554404	0.547000	0.26465	0.965000	0.40720	0.263000	0.26337	1.711000	0.37930	1.742000	0.51746	0.298000	0.19748	GTG		0.716	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		21	62	1	0	3.86903e-22	0.002836	6.05023e-22	21	62				
PCDHGA6	56109	broad.mit.edu	37	5	140755487	140755487	+	Nonsense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr5:140755487G>T	ENST00000517434.1	+	1	1837	c.1837G>T	c.(1837-1839)Gag>Tag	p.E613*	PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	613	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAGGCCAGCGAGCCAGGACT	0.687																																							uc003ljy.1		NA																	0				breast(1)	1						c.(1837-1839)GAG>TAG		protocadherin gamma subfamily A, 6 isoform 1							42.0	50.0	47.0					5																	140755487		2202	4299	6501	SO:0001587	stop_gained	56109				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140755487G>T	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.1837G>T	5.37:g.140755487G>T	ENSP00000429601:p.Glu613*					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Nonsense_Mutation_p.E613*	p.E613*	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1837	+			613			Extracellular (Potential).|Cadherin 6.		A6H8K7|B2RN55|Q9Y5D1	Nonsense_Mutation	SNP	ENST00000517434.1	37	c.1837G>T	CCDS54926.1	.	.	.	.	.	.	.	.	.	.	.	28.5	4.924794	0.92319	.	.	ENSG00000253731	ENST00000517434	.	.	.	4.85	4.85	0.62838	.	0.000000	0.31301	U	0.007895	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.5941	0.91224	0.0:0.0:1.0:0.0	.	.	.	.	X	613	.	ENSP00000429601:E613X	E	+	1	0	PCDHGA6	140735671	1.000000	0.71417	0.966000	0.40874	0.172000	0.22775	6.520000	0.73773	2.700000	0.92200	0.558000	0.71614	GAG		0.687	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919		28	34	1	0	8.58068e-18	0.007291	1.26538e-17	28	34				
PCDHGB7	56099	broad.mit.edu	37	5	140798727	140798727	+	Missense_Mutation	SNP	C	C	T	rs577323909		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr5:140798727C>T	ENST00000398594.2	+	1	1301	c.1301C>T	c.(1300-1302)tCc>tTc	p.S434F	PCDHGA9_ENST00000573521.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA4_ENST00000571252.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGB2_ENST00000522605.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	434	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGTTATCCTCCAGCAAAACC	0.552																																							uc003lkn.1		NA																	0				ovary(2)	2						c.(1300-1302)TCC>TTC		protocadherin gamma subfamily B, 7 isoform 1							50.0	58.0	55.0					5																	140798727		2145	4231	6376	SO:0001583	missense	56099				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140798727C>T	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1301C>T	5.37:g.140798727C>T	ENSP00000381594:p.Ser434Phe					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkm.2_Missense_Mutation_p.S434F|PCDHGA11_uc003lko.1_5'Flank|PCDHGA11_uc003lkp.1_5'Flank|PCDHGA11_uc003lkq.1_5'Flank	p.S434F	NM_018927	NP_061750	Q9Y5F8	PCDGJ_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1446	+			434			Extracellular (Potential).|Cadherin 4.		Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	37	c.1301C>T	CCDS47293.1	.	.	.	.	.	.	.	.	.	.	c	13.49	2.253110	0.39797	.	.	ENSG00000254122	ENST00000398594	T	0.01871	4.59	5.48	5.48	0.80851	Cadherin (5);Cadherin-like (1);	0.644150	0.11416	U	0.566258	T	0.17365	0.0417	H	0.94306	3.52	0.25675	N	0.985853	D;P	0.56746	0.977;0.949	D;P	0.65323	0.934;0.815	T	0.25187	-1.0139	10	0.87932	D	0	.	9.8593	0.41105	0.0:0.7859:0.1402:0.0738	.	434;434	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	F	434	ENSP00000381594:S434F	ENSP00000381594:S434F	S	+	2	0	PCDHGB7	140778911	0.000000	0.05858	0.987000	0.45799	0.562000	0.35680	0.258000	0.18387	2.572000	0.86782	0.491000	0.48974	TCC		0.552	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927		5	41	0	0	0	0.001168	0	5	41				
FAT2	2196	broad.mit.edu	37	5	150911504	150911504	+	Missense_Mutation	SNP	A	A	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr5:150911504A>C	ENST00000261800.5	-	13	9467	c.9455T>G	c.(9454-9456)cTg>cGg	p.L3152R		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3152	Cadherin 28. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGAATCCGGCAGAGAGTAAAC	0.642																																							uc003lue.3		NA																	0				ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6						c.(9454-9456)CTG>CGG		FAT tumor suppressor 2 precursor							52.0	58.0	56.0					5																	150911504		2192	4285	6477	SO:0001583	missense	2196				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding	g.chr5:150911504A>C	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.9455T>G	5.37:g.150911504A>C	ENSP00000261800:p.Leu3152Arg					GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_5'UTR	p.L3152R	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		13	9468	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	3152			Extracellular (Potential).|Cadherin 28.		O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	c.9455T>G	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	A	19.23	3.788499	0.70337	.	.	ENSG00000086570	ENST00000261800	T	0.56776	0.44	5.43	5.43	0.79202	Cadherin (4);Cadherin-like (1);	0.000000	0.47093	D	0.000246	T	0.80308	0.4599	H	0.95780	3.72	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86224	0.1633	10	0.87932	D	0	.	14.0632	0.64812	1.0:0.0:0.0:0.0	.	3152	Q9NYQ8	FAT2_HUMAN	R	3152	ENSP00000261800:L3152R	ENSP00000261800:L3152R	L	-	2	0	FAT2	150891697	1.000000	0.71417	0.919000	0.36401	0.490000	0.33462	8.977000	0.93446	2.068000	0.61886	0.455000	0.32223	CTG		0.642	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		16	50	0	0	0	0.00499	0	16	50				
SOX30	11063	broad.mit.edu	37	5	157078524	157078524	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr5:157078524G>T	ENST00000265007.6	-	1	904	c.563C>A	c.(562-564)gCg>gAg	p.A188E	SOX30_ENST00000519442.1_Intron|SOX30_ENST00000311371.5_Missense_Mutation_p.A188E	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	188					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GACCTCCTCCGCCTCCAGCTT	0.642																																					Esophageal Squamous(31;525 799 19355 21125 41744)	Esophageal Squamous(31;525 799 19355 21125 41744)	uc003lxb.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(562-564)GCG>GAG		SRY (sex determining region Y)-box 30 isoform a							53.0	62.0	59.0					5																	157078524		2202	4299	6501	SO:0001583	missense	11063				regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|response to corticosteroid stimulus|transcription, DNA-dependent	nucleus|nucleus	sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity	g.chr5:157078524G>T	AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.563C>A	5.37:g.157078524G>T	ENSP00000265007:p.Ala188Glu					SOX30_uc003lxc.1_Missense_Mutation_p.A188E|SOX30_uc011dds.1_Intron	p.A188E	NM_178424	NP_848511	O94993	SOX30_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		1	905	-	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	188					O94995|Q8IYX6	Missense_Mutation	SNP	ENST00000265007.6	37	c.563C>A	CCDS4339.1	.	.	.	.	.	.	.	.	.	.	G	9.975	1.226659	0.22542	.	.	ENSG00000039600	ENST00000311371;ENST00000265007	D;D	0.99005	-5.32;-4.79	4.23	1.49	0.22878	.	0.853988	0.09931	N	0.737238	D	0.97532	0.9192	L	0.27053	0.805	0.34674	D	0.72397	P;P	0.49783	0.928;0.807	P;B	0.52386	0.697;0.213	D	0.95138	0.8261	10	0.72032	D	0.01	.	7.7529	0.28907	0.2624:0.0:0.7376:0.0	.	188;188	O94993-2;O94993	.;SOX30_HUMAN	E	188	ENSP00000309343:A188E;ENSP00000265007:A188E	ENSP00000265007:A188E	A	-	2	0	SOX30	157011102	0.000000	0.05858	0.162000	0.22713	0.026000	0.11368	-0.334000	0.07883	0.106000	0.17784	0.305000	0.20034	GCG		0.642	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252571.2	NM_007017		77	50	1	0	3.76054e-38	0.00361	6.58801e-38	77	50				
GABRA6	2559	broad.mit.edu	37	5	161116287	161116287	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr5:161116287G>T	ENST00000274545.5	+	5	907	c.474G>T	c.(472-474)atG>atT	p.M158I	RP11-348M17.2_ENST00000521984.1_RNA|GABRA6_ENST00000523217.1_Missense_Mutation_p.M148I			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	158					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	ACTGTCCCATGAGGCTGGTTA	0.408										TCGA Ovarian(5;0.080)																													uc003lyu.2		NA																	0				ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.(472-474)ATG>ATT		gamma-aminobutyric acid A receptor, alpha 6	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						150.0	135.0	140.0					5																	161116287		2203	4300	6503	SO:0001583	missense	2559				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity	g.chr5:161116287G>T		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.474G>T	5.37:g.161116287G>T	ENSP00000274545:p.Met158Ile	TCGA Ovarian(5;0.080)				GABRA6_uc003lyv.2_5'Flank	p.M158I	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		5	812	+	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	158			Extracellular (Probable).		A8K096|Q4VAV2	Missense_Mutation	SNP	ENST00000274545.5	37	c.474G>T	CCDS4356.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.6|28.6	4.935361|4.935361	0.92458|0.92458	.|.	.|.	ENSG00000145863|ENSG00000145863	ENST00000274545;ENST00000523217;ENST00000517823;ENST00000523691|ENST00000520000	T;T;T;T|.	0.78003|.	-1.14;-1.14;-1.14;-1.14|.	5.74|5.74	5.74|5.74	0.90152|0.90152	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.87378|.	0.6162|.	M|M	0.94101|0.94101	3.495|3.495	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.91635|.	0.999|.	D|.	0.89894|.	0.4039|.	10|.	0.87932|.	D;D|.	0;0|.	.|.	19.9254|19.9254	0.97100|0.97100	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	158|.	Q16445|.	GBRA6_HUMAN|.	I|L	158;148;105;53|98	ENSP00000274545:M158I;ENSP00000430527:M148I;ENSP00000430212:M105I;ENSP00000427989:M53I|.	ENSP00000274545:M158I;ENSP00000274545:M158I|.	M|X	+|+	3|2	0|2	GABRA6|GABRA6	161048865|161048865	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.751000|9.751000	0.98889|0.98889	2.710000|2.710000	0.92621|0.92621	0.655000|0.655000	0.94253|0.94253	ATG|TGA		0.408	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2			40	39	1	0	2.35958e-20	0.002222	3.59335e-20	40	39				
BOD1	91272	broad.mit.edu	37	5	173036425	173036425	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr5:173036425C>A	ENST00000311086.4	-	3	598	c.375G>T	c.(373-375)ttG>ttT	p.L125F	BOD1_ENST00000285908.5_Intron|BOD1_ENST00000471339.1_5'Flank|BOD1_ENST00000480951.1_Intron	NM_138369.2	NP_612378.1	Q96IK1	BOD1_HUMAN	biorientation of chromosomes in cell division 1	125					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|kinetochore (GO:0000776)				endometrium(1)|large_intestine(2)|lung(2)|ovary(2)	7						CTCCAGCTTCCAACATCCCTG	0.448																																							uc003mcq.2		NA																	0				ovary(2)	2						c.(373-375)TTG>TTT		biorientation of chromosomes in cell division 1							124.0	114.0	118.0					5																	173036425		2203	4300	6503	SO:0001583	missense	91272				cell division|mitosis	condensed chromosome kinetochore|microtubule organizing center		g.chr5:173036425C>A	AY303777	CCDS4389.1, CCDS54951.1	5q35.2	2013-10-11	2009-03-04	2009-03-04	ENSG00000145919	ENSG00000145919			25114	protein-coding gene	gene with protein product	"""biorientation defective 1"""		"""family with sequence similarity 44, member B"""	FAM44B		17938248	Standard	NM_138369		Approved		uc003mcq.2	Q96IK1	OTTHUMG00000130540	ENST00000311086.4:c.375G>T	5.37:g.173036425C>A	ENSP00000309644:p.Leu125Phe					BOD1_uc003mcr.2_Intron	p.L125F	NM_138369	NP_612378	Q96IK1	BOD1_HUMAN			3	602	-			125					B4DXH8|Q9BTW1	Missense_Mutation	SNP	ENST00000311086.4	37	c.375G>T	CCDS4389.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.2|27.2	4.809308|4.809308	0.90707|0.90707	.|.	.|.	ENSG00000145919|ENSG00000145919	ENST00000477985|ENST00000311086;ENST00000462674	.|.	.|.	.|.	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.76278	.|0.3965	L|L	0.51914|0.51914	1.62|1.62	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.77004	.|0.989	.|T	.|0.76348	.|-0.2992	.|9	.|0.59425	.|D	.|0.04	-20.0824|-20.0824	19.7198|19.7198	0.96137|0.96137	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|125	.|Q96IK1	.|BOD1_HUMAN	X|F	58|125;20	.|.	.|ENSP00000309644:L125F	G|L	-|-	1|3	0|2	BOD1|BOD1	172969031|172969031	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.688000|4.688000	0.61715|0.61715	2.668000|2.668000	0.90789|0.90789	0.655000|0.655000	0.94253|0.94253	GGA|TTG		0.448	BOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252963.1	NM_138369		23	102	1	0	1.96895e-08	0.00278	2.44024e-08	23	102				
SNCB	6620	broad.mit.edu	37	5	176056582	176056582	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr5:176056582C>A	ENST00000310112.3	-	3	324	c.74G>T	c.(73-75)gGg>gTg	p.G25V	SNCB_ENST00000510387.1_Missense_Mutation_p.G25V|EIF4E1B_ENST00000318682.6_5'Flank|SNCB_ENST00000506696.1_Missense_Mutation_p.G25V|SNCB_ENST00000393693.2_Missense_Mutation_p.G25V|MIR4281_ENST00000580852.1_RNA	NM_001001502.1	NP_001001502.1	Q16143	SYUB_HUMAN	synuclein, beta	25	4 X 11 AA tandem repeats of [EGS]-K-T-K- [EQ]-[GQ]-V-X(4).				dopamine metabolic process (GO:0042417)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|inclusion body (GO:0016234)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)|phospholipase inhibitor activity (GO:0004859)			breast(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	10	all_cancers(89;0.00222)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCGGTGACCCCCTGCTTGGT	0.672																																							uc003mep.2		NA																	0				ovary(1)	1						c.(73-75)GGG>GTG		beta-synuclein							50.0	39.0	43.0					5																	176056582		2203	4300	6503	SO:0001583	missense	6620						calcium ion binding|phospholipase inhibitor activity	g.chr5:176056582C>A	AF053134	CCDS4406.1	5q35	2008-07-18			ENSG00000074317	ENSG00000074317			11140	protein-coding gene	gene with protein product		602569				7558013, 9806846	Standard	NM_003085		Approved		uc003meq.3	Q16143	OTTHUMG00000130661	ENST00000310112.3:c.74G>T	5.37:g.176056582C>A	ENSP00000308057:p.Gly25Val					SNCB_uc003meq.2_Missense_Mutation_p.G25V|SNCB_uc010jke.1_Missense_Mutation_p.G25V|hsa-mir-4281|MI0015885_5'Flank|EIF4E1B_uc010jkf.1_5'Flank	p.G25V	NM_001001502	NP_001001502	Q16143	SYUB_HUMAN	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		3	517	-	all_cancers(89;0.00222)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	25			1.|4 X 11 AA tandem repeats of [EGS]-K-T-K- [EQ]-[GQ]-V-X(4).		Q6IAX7	Missense_Mutation	SNP	ENST00000310112.3	37	c.74G>T	CCDS4406.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455738	0.84209	.	.	ENSG00000074317	ENST00000310112;ENST00000393693;ENST00000510387;ENST00000506696	D;D;D;D	0.92099	-2.97;-2.97;-2.97;-2.97	3.37	3.37	0.38596	.	0.000000	0.85682	D	0.000000	D	0.95472	0.8529	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.95966	0.8966	10	0.87932	D	0	-23.5231	14.0226	0.64565	0.0:1.0:0.0:0.0	.	25;25	G4Y815;Q16143	.;SYUB_HUMAN	V	25	ENSP00000308057:G25V;ENSP00000377296:G25V;ENSP00000424073:G25V;ENSP00000422223:G25V	ENSP00000308057:G25V	G	-	2	0	SNCB	175989188	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.278000	0.78587	1.879000	0.54435	0.462000	0.41574	GGG		0.672	SNCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253152.2	NM_001001502		7	14	1	0	0.00448238	0.004482	0.00506988	7	14				
HK3	3101	broad.mit.edu	37	5	176309050	176309050	+	Missense_Mutation	SNP	A	A	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr5:176309050A>T	ENST00000292432.5	-	16	2223	c.2132T>A	c.(2131-2133)aTc>aAc	p.I711N		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	711	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCCATGTTGATGCACATGCG	0.627																																							uc003mfa.2		NA																	0				ovary(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	7						c.(2131-2133)ATC>AAC		hexokinase 3							69.0	67.0	67.0					5																	176309050		2203	4300	6503	SO:0001583	missense	3101				glucose transport|glycolysis|transmembrane transport	cytosol|membrane	ATP binding|glucokinase activity	g.chr5:176309050A>T		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.2132T>A	5.37:g.176309050A>T	ENSP00000292432:p.Ile711Asn					HK3_uc003mez.2_Missense_Mutation_p.I267N	p.I711N	NM_002115	NP_002106	P52790	HXK3_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		16	2224	-	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	711			Catalytic.		Q8N1E7	Missense_Mutation	SNP	ENST00000292432.5	37	c.2132T>A	CCDS4407.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.609584	0.87258	.	.	ENSG00000160883	ENST00000292432;ENST00000514058	D;D	0.99113	-5.44;-4.71	5.06	5.06	0.68205	Hexokinase, C-terminal (1);	0.235789	0.29972	N	0.010734	D	0.99533	0.9833	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98038	1.0380	10	0.87932	D	0	-23.3366	14.9385	0.70975	1.0:0.0:0.0:0.0	.	711	P52790	HXK3_HUMAN	N	711;101	ENSP00000292432:I711N;ENSP00000424632:I101N	ENSP00000292432:I711N	I	-	2	0	HK3	176241656	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	9.139000	0.94554	2.246000	0.74042	0.533000	0.62120	ATC		0.627	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253428.1			36	35	0	0	0	0.003271	0	36	35				
ADAMTS2	9509	broad.mit.edu	37	5	178634557	178634557	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr5:178634557C>A	ENST00000251582.7	-	4	949	c.848G>T	c.(847-849)gGg>gTg	p.G283V	ADAMTS2_ENST00000274609.5_Missense_Mutation_p.G283V	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	283	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GTGCTCCTTCCCGTGGAACTG	0.632																																							uc003mjw.2		NA																	0				large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(847-849)GGG>GTG		ADAM metallopeptidase with thrombospondin type 1							163.0	136.0	145.0					5																	178634557		2203	4300	6503	SO:0001583	missense	9509				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:178634557C>A	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.848G>T	5.37:g.178634557C>A	ENSP00000251582:p.Gly283Val					ADAMTS2_uc011dgm.1_Missense_Mutation_p.G283V	p.G283V	NM_014244	NP_055059	O95450	ATS2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)	4	848	-	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	283			Peptidase M12B.			Missense_Mutation	SNP	ENST00000251582.7	37	c.848G>T	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.711802	0.89112	.	.	ENSG00000087116	ENST00000251582;ENST00000274609	D;D	0.89343	-2.5;-2.5	5.69	5.69	0.88448	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.380247	0.22015	N	0.065812	D	0.96207	0.8763	M	0.93763	3.455	0.80722	D	1	D;D	0.89917	1.0;0.981	D;D	0.97110	1.0;0.912	D	0.96830	0.9610	10	0.87932	D	0	.	18.7934	0.91983	0.0:1.0:0.0:0.0	.	283;283	O95450-2;O95450	.;ATS2_HUMAN	V	283	ENSP00000251582:G283V;ENSP00000274609:G283V	ENSP00000251582:G283V	G	-	2	0	ADAMTS2	178567163	1.000000	0.71417	0.998000	0.56505	0.933000	0.57130	4.766000	0.62279	2.688000	0.91661	0.561000	0.74099	GGG		0.632	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244		45	61	1	0	1.21353e-23	0.00361	1.93667e-23	45	61				
HIST1H3B	8358	broad.mit.edu	37	6	26032019	26032019	+	Silent	SNP	C	C	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr6:26032019C>T	ENST00000244661.2	-	1	269	c.270G>A	c.(268-270)gtG>gtA	p.V90V		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	90					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						GCAGCGCCATCACCGCAGAGC	0.557																																							uc003nfs.1		NA																	0				ovary(2)	2						c.(268-270)GTG>GTA		histone cluster 1, H3b							71.0	73.0	72.0					6																	26032019		2203	4300	6503	SO:0001819	synonymous_variant	8358				blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding	g.chr6:26032019C>T	X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.270G>A	6.37:g.26032019C>T							p.V90V	NM_003537	NP_003528	P68431	H31_HUMAN			1	270	-			90					A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000244661.2	37	c.270G>A	CCDS4573.1																																																																																				0.557	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040077.1	NM_003537		21	70	0	0	0	0.001882	0	21	70				
GCM1	8521	broad.mit.edu	37	6	52993452	52993452	+	Missense_Mutation	SNP	T	T	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr6:52993452T>A	ENST00000259803.7	-	6	1074	c.863A>T	c.(862-864)tAc>tTc	p.Y288F	RP11-506E9.3_ENST00000566420.1_RNA	NM_003643.3	NP_003634.2	Q9NP62	GCM1_HUMAN	glial cells missing homolog 1 (Drosophila)	288					anatomical structure morphogenesis (GO:0009653)|astrocyte fate commitment (GO:0060018)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell differentiation involved in embryonic placenta development (GO:0060706)|positive regulation of syncytium formation by plasma membrane fusion (GO:0060143)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|skin(1)	24	Lung NSC(77;0.0755)					ATGATCAGAGTAGACTCCGGA	0.473																																							uc003pbp.2		NA																	0				central_nervous_system(1)	1						c.(862-864)TAC>TTC		glial cells missing homolog a							86.0	87.0	86.0					6																	52993452		2203	4300	6503	SO:0001583	missense	8521					transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding	g.chr6:52993452T>A	D88613	CCDS4950.1	6p21-p12	2008-08-29	2001-11-28	2002-09-27	ENSG00000137270	ENSG00000137270			4197	protein-coding gene	gene with protein product		603715	"""glial cells missing (Drosophila) homolog a"""	GCMA		8962155	Standard	NM_003643		Approved	hGCMa	uc003pbp.3	Q9NP62	OTTHUMG00000014871	ENST00000259803.7:c.863A>T	6.37:g.52993452T>A	ENSP00000259803:p.Tyr288Phe						p.Y288F	NM_003643	NP_003634	Q9NP62	GCM1_HUMAN			6	1072	-	Lung NSC(77;0.0755)		288					Q4VAQ7|Q5T0X0|Q99468|Q9P1X3	Missense_Mutation	SNP	ENST00000259803.7	37	c.863A>T	CCDS4950.1	.	.	.	.	.	.	.	.	.	.	T	5.076	0.199684	0.09652	.	.	ENSG00000137270	ENST00000259803	T	0.74947	-0.89	5.5	1.75	0.24633	.	0.524413	0.18750	N	0.132219	T	0.24699	0.0599	N	0.05124	-0.11	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.22521	-1.0214	10	0.26408	T	0.33	-12.6495	4.3967	0.11367	0.4174:0.0962:0.0:0.4864	.	288	Q9NP62	GCM1_HUMAN	F	288	ENSP00000259803:Y288F	ENSP00000259803:Y288F	Y	-	2	0	GCM1	53101411	0.011000	0.17503	0.002000	0.10522	0.192000	0.23643	1.388000	0.34442	0.350000	0.24002	0.482000	0.46254	TAC		0.473	GCM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040953.1			21	36	0	0	0	0.001523	0	21	36				
PRIM2	5558	broad.mit.edu	37	6	57512612	57512612	+	3'UTR	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr6:57512612C>A	ENST00000389488.2	+	0	1527				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TCCAGAAAACCAAGGATGCAT	0.403																																							uc003pdx.2		NA																	0					0						c.(1438-1440)ACC>ACA		DNA primase polypeptide 2							418.0	398.0	404.0					6																	57512612		1963	4157	6120	SO:0001624	3_prime_UTR_variant	5558				DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding	g.chr6:57512612C>A		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1524C>A	6.37:g.57512612C>A							p.T480T	NM_000947	NP_000938	P49643	PRI2_HUMAN		Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)	15	1527	+			480					Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Silent	SNP	ENST00000389488.2	37	c.1440C>A																																																																																					0.403	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	protein_coding	OTTHUMT00000043468.3	NM_000947		63	317	1	0	3.86002e-21	0.00361	5.917e-21	63	317				
TTK	7272	broad.mit.edu	37	6	80715587	80715587	+	Silent	SNP	A	A	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr6:80715587A>G	ENST00000369798.2	+	2	138	c.27A>G	c.(25-27)agA>agG	p.R9R	TTK_ENST00000509894.1_Silent_p.R9R|TTK_ENST00000230510.3_Silent_p.R9R	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	9					chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		TAAGTGGCAGAGAATTGACAA	0.299																																							uc003pjc.2		NA																	0				ovary(4)|stomach(2)|lung(2)|large_intestine(2)|pancreas(1)	11						c.(25-27)AGA>AGG		TTK protein kinase							82.0	87.0	85.0					6																	80715587		2203	4300	6503	SO:0001819	synonymous_variant	7272				mitotic cell cycle spindle assembly checkpoint|mitotic spindle organization|positive regulation of cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation	spindle	ATP binding|identical protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr6:80715587A>G		CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.27A>G	6.37:g.80715587A>G						TTK_uc003pjb.3_Silent_p.R9R	p.R9R	NM_003318	NP_003309	P33981	TTK_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0321)	2	101	+		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)	9					A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Silent	SNP	ENST00000369798.2	37	c.27A>G	CCDS4993.1																																																																																				0.299	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041316.2			15	14	0	0	0	0.003163	0	15	14				
RFX6	222546	broad.mit.edu	37	6	117248302	117248302	+	Silent	SNP	A	A	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr6:117248302A>C	ENST00000332958.2	+	17	2014	c.1998A>C	c.(1996-1998)ccA>ccC	p.P666P		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	666					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						GGAGGCCCCCAAGTGTGGGCC	0.522																																							uc003pxm.2		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(1996-1998)CCA>CCC		regulatory factor X, 6							138.0	131.0	133.0					6																	117248302		2203	4300	6503	SO:0001819	synonymous_variant	222546				glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding	g.chr6:117248302A>C	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.1998A>C	6.37:g.117248302A>C							p.P666P	NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN			17	2061	+			666					Q5T6B3	Silent	SNP	ENST00000332958.2	37	c.1998A>C	CCDS5113.1																																																																																				0.522	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560		59	42	0	0	0	0.00361	0	59	42				
TXLNB	167838	broad.mit.edu	37	6	139591688	139591688	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr6:139591688C>A	ENST00000358430.3	-	4	824	c.592G>T	c.(592-594)Gac>Tac	p.D198Y	RP11-445F6.2_ENST00000441249.1_RNA	NM_153235.3	NP_694967.3	Q8N3L3	TXLNB_HUMAN	taxilin beta	198						cytoplasm (GO:0005737)				breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		TGTAACTGGTCCTTTTCTTTT	0.443																																							uc011eds.1		NA																	0				large_intestine(1)|ovary(1)	2						c.(592-594)GAC>TAC		taxilin beta							207.0	199.0	202.0					6																	139591688		2203	4300	6503	SO:0001583	missense	167838					cytoplasm		g.chr6:139591688C>A		CCDS34545.1	6q23.3	2008-02-05	2005-07-29	2005-07-29	ENSG00000164440	ENSG00000164440			21617	protein-coding gene	gene with protein product		611438	"""chromosome 6 open reading frame 198"""	C6orf198		15184072	Standard	NM_153235		Approved	DKFZp451A175, MDP77, dJ522B19.2	uc021zfy.1	Q8N3L3	OTTHUMG00000015688	ENST00000358430.3:c.592G>T	6.37:g.139591688C>A	ENSP00000351206:p.Asp198Tyr						p.D198Y	NM_153235	NP_694967	Q8N3L3	TXLNB_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)	4	757	-			198			Potential.		Q5VTF3|Q76L25|Q86T52|Q8N3S2	Missense_Mutation	SNP	ENST00000358430.3	37	c.592G>T	CCDS34545.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.797552	0.90538	.	.	ENSG00000164440	ENST00000358430	T	0.34275	1.37	5.6	5.6	0.85130	.	0.042298	0.85682	D	0.000000	T	0.59985	0.2234	M	0.84219	2.685	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.60782	-0.7195	9	.	.	.	-31.5144	19.9884	0.97356	0.0:1.0:0.0:0.0	.	198	Q8N3L3	TXLNB_HUMAN	Y	198	ENSP00000351206:D198Y	.	D	-	1	0	TXLNB	139633381	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	6.026000	0.70873	2.809000	0.96659	0.655000	0.94253	GAC		0.443	TXLNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042458.1	NM_153235		28	18	1	0	8.24728e-16	0.004656	1.19355e-15	28	18				
ERMARD	55780	broad.mit.edu	37	6	170169675	170169675	+	Missense_Mutation	SNP	C	C	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr6:170169675C>G	ENST00000366773.3	+	12	1132	c.1099C>G	c.(1099-1101)Cgc>Ggc	p.R367G	ERMARD_ENST00000392095.4_Missense_Mutation_p.R241G|ERMARD_ENST00000588451.1_Missense_Mutation_p.R231G|ERMARD_ENST00000418781.3_Missense_Mutation_p.R367G|ERMARD_ENST00000366772.2_Missense_Mutation_p.R367G|RP1-266L20.9_ENST00000586101.1_RNA	NM_001278532.1|NM_018341.1	NP_001265461.1|NP_060811.1	Q5T6L9	EMARD_HUMAN	ER membrane-associated RNA degradation	367					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GGAGGGTCCCCGCATAAGAGA	0.408																																							uc003qxg.1		NA																	0				ovary(1)	1						c.(1099-1101)CGC>GGC		hypothetical protein LOC55780							50.0	48.0	48.0					6																	170169675		2203	4300	6503	SO:0001583	missense	55780					integral to membrane		g.chr6:170169675C>G	AK002014	CCDS34576.1, CCDS64572.1, CCDS64573.1, CCDS64574.1	6q27	2013-08-28	2013-08-28	2013-08-28	ENSG00000130023	ENSG00000130023			21056	protein-coding gene	gene with protein product		615532	"""chromosome 6 open reading frame 70"""	C6orf70		23768067	Standard	NM_018341		Approved	FLJ11152, dJ266L20.3	uc003qxg.1	Q5T6L9	OTTHUMG00000016067	ENST00000366773.3:c.1099C>G	6.37:g.170169675C>G	ENSP00000355735:p.Arg367Gly					C6orf70_uc011ehb.1_Missense_Mutation_p.R241G|C6orf70_uc003qxh.1_Missense_Mutation_p.R367G|C6orf70_uc010kky.1_Missense_Mutation_p.R241G|C6orf70_uc003qxi.1_Missense_Mutation_p.R15G	p.R367G	NM_018341	NP_060811	Q5T6L9	CF070_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.2e-22)|BRCA - Breast invasive adenocarcinoma(81;1.49e-07)|GBM - Glioblastoma multiforme(31;0.00191)	12	1132	+		Breast(66;5.08e-05)|Ovarian(120;0.208)	367					B4DFH0|F8WAF1|Q3ZCS8|Q5T6L8|Q9NUT5|Q9NVU2	Missense_Mutation	SNP	ENST00000366773.3	37	c.1099C>G	CCDS34576.1	.	.	.	.	.	.	.	.	.	.	.	18.93	3.728690	0.69074	.	.	ENSG00000130023	ENST00000366773;ENST00000366772;ENST00000418781;ENST00000392095;ENST00000366771	T;T	0.69306	-0.39;-0.36	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000008	T	0.81964	0.4934	M	0.84846	2.72	0.39342	D	0.965592	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	D	0.84593	0.0668	10	0.66056	D	0.02	.	18.7053	0.91635	0.0:1.0:0.0:0.0	.	367;367;367	Q5T6L9-3;Q5T6L9-2;Q5T6L9	.;.;CF070_HUMAN	G	367;367;367;241;15	ENSP00000355735:R367G;ENSP00000375945:R241G	ENSP00000355733:R15G	R	+	1	0	C6orf70	169911600	0.995000	0.38212	0.977000	0.42913	0.650000	0.38633	3.193000	0.50997	2.524000	0.85096	0.644000	0.83932	CGC		0.408	ERMARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043238.2	NM_018341		12	6	0	0	0	0.001368	0	12	6				
HOXA13	3209	broad.mit.edu	37	7	27238817	27238817	+	Nonsense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr7:27238817C>A	ENST00000222753.4	-	1	908	c.880G>T	c.(880-882)Gag>Tag	p.E294*	HOTTIP_ENST00000421733.1_RNA|HOTTIP_ENST00000472494.1_RNA|HOTTIP_ENST00000521028.2_RNA|HOTTIP_ENST00000605136.1_RNA	NM_000522.4	NP_000513.2	P31271	HXA13_HUMAN	homeobox A13	294					artery morphogenesis (GO:0048844)|branching involved in prostate gland morphogenesis (GO:0060442)|embryonic forelimb morphogenesis (GO:0035115)|endothelial cell fate specification (GO:0060847)|endothelial cell morphogenesis (GO:0001886)|inner ear development (GO:0048839)|male genitalia development (GO:0030539)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of BMP signaling pathway (GO:0030510)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|ventricular septum development (GO:0003281)	intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	6						TGCGCCTGCTCTTTGGGGCAG	0.637			T	NUP98	AML																																		uc003szb.1		NA		Dom	yes		7	7p15-p14.2	3209	T	homeo box A13			L	NUP98		AML		0				breast(1)	1						c.(880-882)GAG>TAG		homeobox A13							54.0	55.0	54.0					7																	27238817		2203	4300	6503	SO:0001587	stop_gained	3209				skeletal system development	nucleus	sequence-specific DNA binding	g.chr7:27238817C>A		CCDS5412.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106031	ENSG00000106031		"""Homeoboxes / ANTP class : HOXL subclass"""	5102	protein-coding gene	gene with protein product		142959	"""homeo box A13"""	HOX1J, HOX1		1973146, 1358459	Standard	NM_000522		Approved		uc003szb.1	P31271	OTTHUMG00000023438	ENST00000222753.4:c.880G>T	7.37:g.27238817C>A	ENSP00000222753:p.Glu294*					uc003szc.1_5'Flank	p.E294*	NM_000522	NP_000513	P31271	HXA13_HUMAN			1	909	-			294					A4D188|O43371	Nonsense_Mutation	SNP	ENST00000222753.4	37	c.880G>T	CCDS5412.1	.	.	.	.	.	.	.	.	.	.	C	37	6.286986	0.97444	.	.	ENSG00000106031	ENST00000222753	.	.	.	5.04	5.04	0.67666	.	0.107320	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.3495	0.87320	0.0:1.0:0.0:0.0	.	.	.	.	X	294	.	ENSP00000222753:E294X	E	-	1	0	HOXA13	27205342	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.459000	0.80802	2.322000	0.78497	0.462000	0.41574	GAG		0.637	HOXA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358752.3			15	31	1	0	4.7546e-09	0.004007	6.02078e-09	15	31				
INMT	11185	broad.mit.edu	37	7	30793497	30793497	+	Missense_Mutation	SNP	C	C	A	rs201521957		TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr7:30793497C>A	ENST00000013222.5	+	2	321	c.305C>A	c.(304-306)cCg>cAg	p.P102Q	INMT_ENST00000409539.1_Missense_Mutation_p.P101Q|INMT_ENST00000484180.1_3'UTR|INMT-FAM188B_ENST00000458257.1_Missense_Mutation_p.P101Q	NM_001199219.1|NM_006774.4	NP_001186148.1|NP_006765.4	O95050	INMT_HUMAN	indolethylamine N-methyltransferase	102					amine metabolic process (GO:0009308)|methylation (GO:0032259)|response to toxic substance (GO:0009636)	cytosol (GO:0005829)	amine N-methyltransferase activity (GO:0030748)|thioether S-methyltransferase activity (GO:0004790)			kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|stomach(1)	23						AAGAAGGAGCCGGGGGCCTAT	0.572																																							uc003tbs.1		NA																	0					0						c.(304-306)CCG>CAG		indolethylamine N-methyltransferase							94.0	102.0	99.0					7																	30793497		2203	4300	6503	SO:0001583	missense	11185					cytoplasm	amine N-methyltransferase activity	g.chr7:30793497C>A		CCDS5430.1, CCDS56479.1	7p14.3	2011-08-30			ENSG00000241644	ENSG00000241644	2.1.1.49		6069	protein-coding gene	gene with protein product		604854				10552930	Standard	NM_001199219		Approved		uc003tbs.1	O95050	OTTHUMG00000167163	ENST00000013222.5:c.305C>A	7.37:g.30793497C>A	ENSP00000013222:p.Pro102Gln					FAM188B_uc010kwe.2_5'UTR|INMT_uc010kwc.1_RNA|INMT_uc010kwd.1_Missense_Mutation_p.P101Q	p.P102Q	NM_006774	NP_006765	O95050	INMT_HUMAN			2	321	+			102					B8ZZ69|Q3KP49|Q9P1Y2|Q9UBY4|Q9UHQ0	Missense_Mutation	SNP	ENST00000013222.5	37	c.305C>A	CCDS5430.1	.	.	.	.	.	.	.	.	.	.	C	13.12	2.142764	0.37825	.	.	ENSG00000241644	ENST00000013222;ENST00000409539	T;T	0.10382	2.88;2.88	3.69	2.8	0.32819	.	0.345849	0.22714	N	0.056532	T	0.30166	0.0756	M	0.84846	2.72	0.26787	N	0.969488	D;D	0.53462	0.96;0.96	D;D	0.64237	0.923;0.923	T	0.04678	-1.0934	10	0.40728	T	0.16	-14.5855	9.1878	0.37180	0.0:0.8891:0.0:0.1109	.	101;102	B8ZZ69;O95050	.;INMT_HUMAN	Q	102;101	ENSP00000013222:P102Q;ENSP00000386961:P101Q	ENSP00000013222:P102Q	P	+	2	0	INMT	30760022	0.005000	0.15991	0.650000	0.29550	0.268000	0.26511	1.017000	0.29989	0.878000	0.35920	0.561000	0.74099	CCG		0.572	INMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214993.3	NM_006774		56	93	1	0	1.39843e-22	0.00361	2.20158e-22	56	93				
CAMK2B	816	broad.mit.edu	37	7	44283039	44283039	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr7:44283039G>T	ENST00000395749.2	-	7	578	c.502C>A	c.(502-504)Cag>Aag	p.Q168K	CAMK2B_ENST00000502837.2_Missense_Mutation_p.Q39K|CAMK2B_ENST00000395747.2_Missense_Mutation_p.Q168K|CAMK2B_ENST00000440254.2_Missense_Mutation_p.Q168K|CAMK2B_ENST00000350811.3_Missense_Mutation_p.Q168K|CAMK2B_ENST00000353625.4_Missense_Mutation_p.Q168K|CAMK2B_ENST00000347193.4_Missense_Mutation_p.Q168K|CAMK2B_ENST00000258682.6_Missense_Mutation_p.Q168K|CAMK2B_ENST00000457475.1_Missense_Mutation_p.Q168K|CAMK2B_ENST00000358707.3_Missense_Mutation_p.Q168K|CAMK2B_ENST00000346990.4_Missense_Mutation_p.Q168K	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta	168	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						CATGCCTGCTGGTCCCCCTGC	0.632																																							uc003tkq.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(502-504)CAG>AAG		calcium/calmodulin-dependent protein kinase II							138.0	116.0	123.0					7																	44283039		2203	4300	6503	SO:0001583	missense	816				interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity	g.chr7:44283039G>T	U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.502C>A	7.37:g.44283039G>T	ENSP00000379098:p.Gln168Lys					CAMK2B_uc003tkp.2_Missense_Mutation_p.Q168K|CAMK2B_uc003tkx.2_Missense_Mutation_p.Q168K|CAMK2B_uc010kyd.2_RNA|CAMK2B_uc003tkr.2_Missense_Mutation_p.Q168K|CAMK2B_uc003tks.2_Missense_Mutation_p.Q168K|CAMK2B_uc003tku.2_Missense_Mutation_p.Q168K|CAMK2B_uc003tkv.2_Missense_Mutation_p.Q168K|CAMK2B_uc003tkt.2_Missense_Mutation_p.Q168K|CAMK2B_uc003tkw.2_Missense_Mutation_p.Q168K|CAMK2B_uc010kyc.2_Missense_Mutation_p.Q168K	p.Q168K	NM_001220	NP_001211	Q13554	KCC2B_HUMAN			7	712	-			168			Protein kinase.		A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	Missense_Mutation	SNP	ENST00000395749.2	37	c.502C>A	CCDS5483.1	.	.	.	.	.	.	.	.	.	.	G	17.32	3.358565	0.61403	.	.	ENSG00000058404	ENST00000350811;ENST00000457475;ENST00000395749;ENST00000502837;ENST00000440254;ENST00000358707;ENST00000353625;ENST00000347193;ENST00000346990;ENST00000258682;ENST00000395747	T;T;T;T;T;T;T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11;-0.11	4.13	4.13	0.48395	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.60301	0.2258	N	0.12887	0.27	0.80722	D	1	B;D;B;P;P;B;B;D;D	0.76494	0.159;0.957;0.062;0.953;0.863;0.191;0.136;0.99;0.999	B;P;B;P;B;B;B;P;P	0.61592	0.038;0.802;0.022;0.655;0.228;0.064;0.022;0.831;0.891	T	0.63116	-0.6709	9	0.33940	T	0.23	.	16.2039	0.82108	0.0:0.0:1.0:0.0	.	168;168;168;168;168;168;168;168;168	Q13554-8;Q13554-7;Q13554-4;Q13554-3;Q13554-6;A4D2K5;Q13554-5;Q13554;Q13554-2	.;.;.;.;.;.;.;KCC2B_HUMAN;.	K	168;168;168;39;168;168;168;168;168;168;168	ENSP00000326375:Q168K;ENSP00000390292:Q168K;ENSP00000379098:Q168K;ENSP00000422416:Q39K;ENSP00000397937:Q168K;ENSP00000351542:Q168K;ENSP00000326427:Q168K;ENSP00000326544:Q168K;ENSP00000326518:Q168K;ENSP00000258682:Q168K;ENSP00000379096:Q168K	ENSP00000258682:Q168K	Q	-	1	0	CAMK2B	44249564	1.000000	0.71417	1.000000	0.80357	0.030000	0.12068	5.377000	0.66184	2.132000	0.65825	0.650000	0.86243	CAG		0.632	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251138.2	NM_172084		20	51	1	0	1.33834e-09	0.007413	1.704e-09	20	51				
MYO1G	64005	broad.mit.edu	37	7	45010484	45010484	+	Nonsense_Mutation	SNP	T	T	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr7:45010484T>A	ENST00000258787.7	-	8	1157	c.1021A>T	c.(1021-1023)Aag>Tag	p.K341*		NM_033054.2	NP_149043.2	B0I1T2	MYO1G_HUMAN	myosin IG	341	Myosin motor.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|skin(4)	28						GTGTGGCCCTTCTCTATGAGT	0.662																																							uc003tmh.2		NA																	0				breast(2)|ovary(1)|pancreas(1)	4						c.(1021-1023)AAG>TAG		myosin IG							49.0	44.0	46.0					7																	45010484		2203	4300	6503	SO:0001587	stop_gained	64005					myosin complex|plasma membrane	actin binding|ATP binding|calmodulin binding|motor activity	g.chr7:45010484T>A	AF380932	CCDS34629.1	7p13-p11.2	2011-09-27			ENSG00000136286	ENSG00000136286		"""Myosins / Myosin superfamily : Class I"""	13880	protein-coding gene	gene with protein product	"""minor histocompatibility antigen HA-2"""	600642					Standard	NM_033054		Approved	HA-2	uc003tmh.2	B0I1T2	OTTHUMG00000155821	ENST00000258787.7:c.1021A>T	7.37:g.45010484T>A	ENSP00000258787:p.Lys341*					MYO1G_uc003tmf.2_5'Flank|MYO1G_uc003tmg.2_Nonsense_Mutation_p.K103*|MYO1G_uc010kym.2_Nonsense_Mutation_p.K226*|MYO1G_uc003tmi.1_Nonsense_Mutation_p.K253*|MYO1G_uc003tmj.2_Nonsense_Mutation_p.K103*	p.K341*	NM_033054	NP_149043	B0I1T2	MYO1G_HUMAN			8	1165	-			341			Myosin head-like.		Q8TEI9|Q8TES2|Q96BE2|Q96RI5|Q96RI6	Nonsense_Mutation	SNP	ENST00000258787.7	37	c.1021A>T	CCDS34629.1	.	.	.	.	.	.	.	.	.	.	T	39	7.684639	0.98431	.	.	ENSG00000136286	ENST00000258787	.	.	.	5.3	5.3	0.74995	.	0.000000	0.42682	D	0.000668	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.5014	0.61457	0.0:0.0:0.0:1.0	.	.	.	.	X	341	.	ENSP00000258787:K341X	K	-	1	0	MYO1G	44977009	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.279000	0.78599	2.139000	0.66308	0.533000	0.62120	AAG		0.662	MYO1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341832.2			12	28	0	0	0	0.001855	0	12	28				
ASNS	440	broad.mit.edu	37	7	97488526	97488526	+	Splice_Site	SNP	T	T	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr7:97488526T>G	ENST00000394309.3	-	5	1143	c.672A>C	c.(670-672)ccA>ccC	p.P224P	ASNS_ENST00000444334.1_Splice_Site_p.P203P|ASNS_ENST00000422745.1_Splice_Site_p.P203P|ASNS_ENST00000394308.3_Splice_Site_p.P224P|ASNS_ENST00000175506.4_Splice_Site_p.P224P|ASNS_ENST00000437628.1_Splice_Site_p.P141P|ASNS_ENST00000455086.1_Splice_Site_p.P141P	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	224	Asparagine synthetase.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	GTCTGCTACCTGGAAAGAGTT	0.433																																					Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	uc003uot.3		NA																	0				ovary(1)	1						c.(670-672)CCA>CCC		asparagine synthetase	Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)						88.0	91.0	90.0					7																	97488526		2203	4300	6503	SO:0001630	splice_region_variant	440				cellular response to glucose starvation|glutamine metabolic process|negative regulation of apoptosis|positive regulation of mitotic cell cycle	cytosol|soluble fraction	asparagine synthase (glutamine-hydrolyzing) activity|ATP binding	g.chr7:97488526T>G	M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.673+1A>C	7.37:g.97488526T>G						ASNS_uc011kin.1_Silent_p.P141P|ASNS_uc003uou.3_Silent_p.P224P|ASNS_uc003uov.3_Silent_p.P224P|ASNS_uc011kio.1_Silent_p.P203P|ASNS_uc003uow.3_Silent_p.P203P|ASNS_uc003uox.3_Silent_p.P141P	p.P224P	NM_133436	NP_597680	P08243	ASNS_HUMAN			5	1178	-	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)		224			Asparagine synthetase.		A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Silent	SNP	ENST00000394309.3	37	c.672A>C	CCDS5652.1																																																																																				0.433	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1	NM_001673, NM_183356	Silent	11	64	0	0	0	0.001855	0	11	64				
MUC17	140453	broad.mit.edu	37	7	100676675	100676675	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr7:100676675G>T	ENST00000306151.4	+	3	2042	c.1978G>T	c.(1978-1980)Gtg>Ttg	p.V660L		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	660	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAACACTCCTGTGACCACTTC	0.468																																							uc003uxp.1		NA																	0				ovary(14)|skin(8)|breast(3)|lung(2)	27						c.(1978-1980)GTG>TTG		mucin 17 precursor							270.0	275.0	273.0					7																	100676675		2203	4300	6503	SO:0001583	missense	140453					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity	g.chr7:100676675G>T	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.1978G>T	7.37:g.100676675G>T	ENSP00000302716:p.Val660Leu					MUC17_uc010lho.1_RNA	p.V660L	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN			3	2031	+	Lung NSC(181;0.136)|all_lung(186;0.182)		660			Extracellular (Potential).|9.|59 X approximate tandem repeats.|Ser-rich.		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	c.1978G>T	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	2.827	-0.243541	0.05906	.	.	ENSG00000169876	ENST00000306151	T	0.02446	4.29	1.12	-1.83	0.07833	.	.	.	.	.	T	0.01661	0.0053	L	0.27053	0.805	0.09310	N	1	B	0.32409	0.37	B	0.21546	0.035	T	0.47169	-0.9138	9	0.25106	T	0.35	.	3.2111	0.06682	0.1917:0.0:0.5594:0.2489	.	660	Q685J3	MUC17_HUMAN	L	660	ENSP00000302716:V660L	ENSP00000302716:V660L	V	+	1	0	MUC17	100463395	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.713000	0.01883	-0.486000	0.06744	-0.883000	0.02948	GTG		0.468	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105		106	491	1	0	4.10028e-47	0.00361	7.34896e-47	106	491				
LAMB1	3912	broad.mit.edu	37	7	107615715	107615715	+	Missense_Mutation	SNP	A	A	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr7:107615715A>G	ENST00000222399.6	-	11	1563	c.1333T>C	c.(1333-1335)Tat>Cat	p.Y445H	LAMB1_ENST00000393561.1_Missense_Mutation_p.Y469H|LAMB1_ENST00000393560.1_Missense_Mutation_p.Y445H	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	445	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CTTAAATCATAGAAGCCTTCT	0.363																																							uc003vew.2		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8						c.(1333-1335)TAT>CAT		laminin, beta 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						106.0	100.0	102.0					7																	107615715		2203	4300	6503	SO:0001583	missense	3912				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent	g.chr7:107615715A>G	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.1333T>C	7.37:g.107615715A>G	ENSP00000222399:p.Tyr445His					LAMB1_uc003vev.2_Missense_Mutation_p.Y469H|LAMB1_uc003vex.2_Missense_Mutation_p.Y445H|LAMB1_uc010ljn.1_Missense_Mutation_p.Y531H	p.Y445H	NM_002291	NP_002282	P07942	LAMB1_HUMAN			11	1668	-			445			Laminin EGF-like 3.		Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	c.1333T>C	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.330032	0.81690	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	T;T;T	0.63913	-0.07;-0.07;-0.07	5.78	5.78	0.91487	EGF-like, laminin (4);	.	.	.	.	T	0.71459	0.3342	M	0.77820	2.39	0.58432	D	0.999996	B;P;P	0.46020	0.044;0.871;0.796	B;P;B	0.49252	0.037;0.604;0.397	T	0.71862	-0.4464	9	0.34782	T	0.22	.	16.1138	0.81283	1.0:0.0:0.0:0.0	.	445;445;469	E7EPA6;P07942;G3XAI2	.;LAMB1_HUMAN;.	H	469;445;445	ENSP00000377191:Y469H;ENSP00000222399:Y445H;ENSP00000377190:Y445H	ENSP00000222399:Y445H	Y	-	1	0	LAMB1	107402951	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.317000	0.96327	2.220000	0.72140	0.533000	0.62120	TAT		0.363	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		36	58	0	0	0	0.002522	0	36	58				
FAM3C	10447	broad.mit.edu	37	7	120991230	120991230	+	Silent	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr7:120991230C>A	ENST00000359943.3	-	9	774	c.561G>T	c.(559-561)ggG>ggT	p.G187G		NM_001040020.1|NM_014888.2	NP_001035109.1|NP_055703.1	Q92520	FAM3C_HUMAN	family with sequence similarity 3, member C	187					multicellular organismal development (GO:0007275)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	cytokine activity (GO:0005125)			kidney(1)|lung(8)	9	all_neural(327;0.117)					TAATGCCCTTCCCACCACAGA	0.418																																							uc003vjx.2		NA																	0					0						c.(559-561)GGG>GGT		family with sequence similarity 3, member C							82.0	79.0	80.0					7																	120991230		2203	4300	6503	SO:0001819	synonymous_variant	10447				multicellular organismal development	cytoplasmic membrane-bounded vesicle|extracellular region	cytokine activity	g.chr7:120991230C>A	D87120	CCDS5782.1	7q22.1-q31.1	2014-08-14			ENSG00000196937	ENSG00000196937			18664	protein-coding gene	gene with protein product	"""predicted osteoblast protein"", ""interleukin-like EMT inducer"", ""interleukin-like epithelial-mesenchymal transition inducer"""	608618				12160727	Standard	NM_014888		Approved	GS3876, ILEI	uc010lkm.3	Q92520	OTTHUMG00000156979	ENST00000359943.3:c.561G>T	7.37:g.120991230C>A						FAM3C_uc010lkm.2_Silent_p.G187G	p.G187G	NM_014888	NP_055703	Q92520	FAM3C_HUMAN			9	809	-	all_neural(327;0.117)		187					A6NDN2|A8K3R7	Silent	SNP	ENST00000359943.3	37	c.561G>T	CCDS5782.1																																																																																				0.418	FAM3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346945.1	NM_001040020		26	64	1	0	2.16457e-27	0.008361	3.60247e-27	26	64				
FAM3C	10447	broad.mit.edu	37	7	120991242	120991242	+	Silent	SNP	G	G	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr7:120991242G>C	ENST00000359943.3	-	9	762	c.549C>G	c.(547-549)gtC>gtG	p.V183V		NM_001040020.1|NM_014888.2	NP_001035109.1|NP_055703.1	Q92520	FAM3C_HUMAN	family with sequence similarity 3, member C	183					multicellular organismal development (GO:0007275)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	cytokine activity (GO:0005125)			kidney(1)|lung(8)	9	all_neural(327;0.117)					CACCACAGAAGACCCAGTTGT	0.428																																							uc003vjx.2		NA																	0					0						c.(547-549)GTC>GTG		family with sequence similarity 3, member C							80.0	78.0	79.0					7																	120991242		2203	4300	6503	SO:0001819	synonymous_variant	10447				multicellular organismal development	cytoplasmic membrane-bounded vesicle|extracellular region	cytokine activity	g.chr7:120991242G>C	D87120	CCDS5782.1	7q22.1-q31.1	2014-08-14			ENSG00000196937	ENSG00000196937			18664	protein-coding gene	gene with protein product	"""predicted osteoblast protein"", ""interleukin-like EMT inducer"", ""interleukin-like epithelial-mesenchymal transition inducer"""	608618				12160727	Standard	NM_014888		Approved	GS3876, ILEI	uc010lkm.3	Q92520	OTTHUMG00000156979	ENST00000359943.3:c.549C>G	7.37:g.120991242G>C						FAM3C_uc010lkm.2_Silent_p.V183V	p.V183V	NM_014888	NP_055703	Q92520	FAM3C_HUMAN			9	797	-	all_neural(327;0.117)		183					A6NDN2|A8K3R7	Silent	SNP	ENST00000359943.3	37	c.549C>G	CCDS5782.1																																																																																				0.428	FAM3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346945.1	NM_001040020		24	60	0	0	0	0.00278	0	24	60				
GRM8	2918	broad.mit.edu	37	7	126746607	126746607	+	Missense_Mutation	SNP	C	C	G			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr7:126746607C>G	ENST00000339582.2	-	3	1478	c.670G>C	c.(670-672)Gag>Cag	p.E224Q	GRM8_ENST00000480995.1_5'UTR|GRM8_ENST00000444921.2_Missense_Mutation_p.E224Q|GRM8_ENST00000405249.1_Missense_Mutation_p.E224Q|GRM8_ENST00000358373.3_Missense_Mutation_p.E224Q			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	224					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				TAGTTCCCCTCAGAAGCCAGT	0.498										HNSCC(24;0.065)																													uc003vlr.2		NA																	0				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23						c.(670-672)GAG>CAG		glutamate receptor, metabotropic 8 isoform a	L-Glutamic Acid(DB00142)						127.0	108.0	114.0					7																	126746607		2203	4300	6503	SO:0001583	missense	2918				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane		g.chr7:126746607C>G		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.670G>C	7.37:g.126746607C>G	ENSP00000344173:p.Glu224Gln	HNSCC(24;0.065)				GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.E224Q|GRM8_uc010lkz.1_RNA|GRM8_uc003vlu.1_5'UTR	p.E224Q	NM_000845	NP_000836	O00222	GRM8_HUMAN			2	981	-		Prostate(267;0.186)	224			Extracellular (Potential).		A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	37	c.670G>C	CCDS5794.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.460200	0.84317	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249;ENST00000457830;ENST00000465844	D;D;D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11;-2.11;-2.11	4.97	4.97	0.65823	Extracellular ligand-binding receptor (1);	0.064052	0.64402	D	0.000010	D	0.95191	0.8441	M	0.93854	3.465	0.58432	D	0.999999	D;P	0.67145	0.996;0.949	D;P	0.78314	0.991;0.566	D	0.96490	0.9363	10	0.87932	D	0	.	17.2524	0.87046	0.0:1.0:0.0:0.0	.	224;224	O00222-2;O00222	.;GRM8_HUMAN	Q	224;224;224;224;224;34	ENSP00000344173:E224Q;ENSP00000409790:E224Q;ENSP00000351142:E224Q;ENSP00000385731:E224Q;ENSP00000415522:E224Q;ENSP00000418255:E34Q	ENSP00000344173:E224Q	E	-	1	0	GRM8	126533843	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	7.818000	0.86416	2.298000	0.77334	0.563000	0.77884	GAG		0.498	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4			22	29	0	0	0	0.00278	0	22	29				
GIMAP7	168537	broad.mit.edu	37	7	150217516	150217516	+	Missense_Mutation	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr7:150217516G>A	ENST00000313543.4	+	2	611	c.454G>A	c.(454-456)Ggc>Agc	p.G152S		NM_153236.3	NP_694968.1	Q8NHV1	GIMA7_HUMAN	GTPase, IMAP family member 7	152	AIG1-type G.				GTP catabolic process (GO:0006184)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)			breast(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	17			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGCGGATGTGGGCCTAAAAAG	0.502																																							uc003whk.2		NA																	0				pancreas(1)|skin(1)	2						c.(454-456)GGC>AGC		GTPase, IMAP family member 7							74.0	64.0	67.0					7																	150217516		2203	4300	6503	SO:0001583	missense	168537						GTP binding	g.chr7:150217516G>A	BC027613	CCDS5903.1	7q36.1	2014-04-04			ENSG00000179144	ENSG00000179144		"""GTPases, IMAP"""	22404	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 7"""					15474311	Standard	NM_153236		Approved	MGC27027, IAN7	uc003whk.3	Q8NHV1	OTTHUMG00000157626	ENST00000313543.4:c.454G>A	7.37:g.150217516G>A	ENSP00000315474:p.Gly152Ser						p.G152S	NM_153236	NP_694968	Q8NHV1	GIMA7_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	2	584	+			152						Missense_Mutation	SNP	ENST00000313543.4	37	c.454G>A	CCDS5903.1	.	.	.	.	.	.	.	.	.	.	G	9.994	1.231603	0.22626	.	.	ENSG00000179144	ENST00000313543	T	0.04970	3.52	5.09	1.45	0.22620	AIG1 (1);	1.466250	0.04595	N	0.397467	T	0.02970	0.0088	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.42430	-0.9452	10	0.09084	T	0.74	.	6.6061	0.22726	0.7185:0.0:0.2815:0.0	.	152	Q8NHV1	GIMA7_HUMAN	S	152	ENSP00000315474:G152S	ENSP00000315474:G152S	G	+	1	0	GIMAP7	149848449	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.763000	0.26517	0.110000	0.17919	-0.238000	0.12139	GGC		0.502	GIMAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349277.1	NM_153236		14	23	0	0	0	0.001855	0	14	23				
GIMAP4	55303	broad.mit.edu	37	7	150269373	150269373	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr7:150269373G>T	ENST00000255945.2	+	3	390	c.215G>T	c.(214-216)cGc>cTc	p.R72L	GIMAP4_ENST00000494750.1_3'UTR|GIMAP4_ENST00000461940.1_Missense_Mutation_p.R86L	NM_018326.2	NP_060796.1	Q9NUV9	GIMA4_HUMAN	GTPase, IMAP family member 4	72	AIG1-type G.					cytosol (GO:0005829)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(82;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGTGAGAAACGCAGCAGCTCA	0.483																																							uc003whl.2		NA																	0				ovary(1)	1						c.(214-216)CGC>CTC		GTPase, IMAP family member 4							107.0	92.0	97.0					7																	150269373		2203	4300	6503	SO:0001583	missense	55303						GTP binding	g.chr7:150269373G>T	AK001972	CCDS5904.1	7q36.1	2014-04-04			ENSG00000133574	ENSG00000133574		"""GTPases, IMAP"""	21872	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 1"""	608087				15474311, 18701445	Standard	NM_018326		Approved	HIMAP4, FLJ11110, IMAP4, IAN1	uc003whl.3	Q9NUV9	OTTHUMG00000157475	ENST00000255945.2:c.215G>T	7.37:g.150269373G>T	ENSP00000255945:p.Arg72Leu					GIMAP4_uc011kuu.1_Intron|GIMAP4_uc011kuv.1_Missense_Mutation_p.R86L	p.R72L	NM_018326	NP_060796	Q9NUV9	GIMA4_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	3	297	+			72						Missense_Mutation	SNP	ENST00000255945.2	37	c.215G>T	CCDS5904.1	.	.	.	.	.	.	.	.	.	.	G	11.20	1.567627	0.28003	.	.	ENSG00000133574	ENST00000255945;ENST00000461940;ENST00000479232	T;T;T	0.60920	0.15;0.15;0.15	4.61	-4.08	0.03963	AIG1 (1);	1.439610	0.04402	N	0.364450	T	0.39200	0.1069	L	0.39085	1.19	0.09310	N	1	B;B	0.26845	0.161;0.04	B;B	0.25405	0.06;0.01	T	0.11941	-1.0567	10	0.31617	T	0.26	.	0.3197	0.00301	0.2414:0.2458:0.2624:0.2504	.	86;72	G5E9W9;Q9NUV9	.;GIMA4_HUMAN	L	72;86;86	ENSP00000255945:R72L;ENSP00000419545:R86L;ENSP00000418615:R86L	ENSP00000255945:R72L	R	+	2	0	GIMAP4	149900306	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.343000	0.02642	-0.651000	0.05415	-0.889000	0.02933	CGC		0.483	GIMAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348927.1	NM_018326		14	32	1	0	6.72482e-11	0.003163	8.95362e-11	14	32				
COPS5	10987	broad.mit.edu	37	8	67974210	67974210	+	Missense_Mutation	SNP	T	T	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr8:67974210T>C	ENST00000357849.4	-	1	342	c.22A>G	c.(22-24)Atg>Gtg	p.M8V	COPS5_ENST00000519963.1_5'UTR|CSPP1_ENST00000412460.1_5'Flank|AC109335.1_ENST00000578628.1_RNA|COPS5_ENST00000517736.1_Intron|CSPP1_ENST00000262210.5_5'Flank	NM_006837.2	NP_006828.2	Q92905	CSN5_HUMAN	COP9 signalosome subunit 5	8					cullin deneddylation (GO:0010388)|exosomal secretion (GO:1990182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein deneddylation (GO:0000338)|protein deubiquitination (GO:0016579)|regulation of cell cycle (GO:0051726)|regulation of JNK cascade (GO:0046328)|transcription from RNA polymerase II promoter (GO:0006366)|translation (GO:0006412)|translational initiation (GO:0006413)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|eukaryotic translation initiation factor 3 complex (GO:0005852)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|transcription coactivator activity (GO:0003713)|translation initiation factor activity (GO:0003743)|ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(3)	14	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)			TTCTGGGCCATACCGCTCCCG	0.537																																							uc003xxe.2		NA																	0				ovary(1)|skin(1)	2						c.(22-24)ATG>GTG		COP9 signalosome subunit 5							93.0	86.0	88.0					8																	67974210		2203	4300	6503	SO:0001583	missense	10987				cullin deneddylation|transcription from RNA polymerase II promoter	eukaryotic translation initiation factor 3 complex|signalosome	metal ion binding|metallopeptidase activity|protein binding|transcription coactivator activity|translation initiation factor activity	g.chr8:67974210T>C	U65928	CCDS6198.1	8q13.1	2013-03-14	2013-03-14		ENSG00000121022	ENSG00000121022			2240	protein-coding gene	gene with protein product		604850	"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 5"", ""COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)"""			8837781, 9341143	Standard	NM_006837		Approved	JAB1, SGN5, MOV-34, CSN5	uc003xxe.3	Q92905	OTTHUMG00000164563	ENST00000357849.4:c.22A>G	8.37:g.67974210T>C	ENSP00000350512:p.Met8Val					CSPP1_uc003xxg.1_5'Flank|CSPP1_uc003xxh.1_5'Flank|CSPP1_uc003xxi.2_5'Flank|CSPP1_uc003xxj.2_5'Flank|COPS5_uc003xxd.2_5'UTR|COPS5_uc003xxf.2_Silent_p.V36V|COPS5_uc010lyv.1_Missense_Mutation_p.M8V	p.M8V	NM_006837	NP_006828	Q92905	CSN5_HUMAN	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)		1	353	-	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	8					O15386|Q6AW95|Q86WQ4|Q9BQ17	Missense_Mutation	SNP	ENST00000357849.4	37	c.22A>G	CCDS6198.1	.	.	.	.	.	.	.	.	.	.	T	15.07	2.723080	0.48728	.	.	ENSG00000121022	ENST00000357849	.	.	.	5.77	4.55	0.56014	.	0.146637	0.85682	D	0.000000	T	0.44808	0.1311	L	0.49513	1.565	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.31943	-0.9925	9	0.14252	T	0.57	-19.1305	6.8304	0.23907	0.0:0.0758:0.1531:0.7711	.	8	Q92905	CSN5_HUMAN	V	8	.	ENSP00000350512:M8V	M	-	1	0	COPS5	68136764	1.000000	0.71417	0.994000	0.49952	0.976000	0.68499	4.619000	0.61218	2.326000	0.78906	0.533000	0.62120	ATG		0.537	COPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379245.2			46	163	0	0	0	0.003214	0	46	163				
LRRCC1	85444	broad.mit.edu	37	8	86035739	86035739	+	Missense_Mutation	SNP	A	A	C			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr8:86035739A>C	ENST00000360375.3	+	7	1171	c.1022A>C	c.(1021-1023)aAa>aCa	p.K341T	LRRCC1_ENST00000414626.2_Missense_Mutation_p.K321T	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	341					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						GGAAACAGAAAAGAATGCAAT	0.323																																							uc003ycw.2		NA																	0					0						c.(1021-1023)AAA>ACA		sodium channel associated protein 2 isoform a							83.0	82.0	82.0					8																	86035739		1811	4072	5883	SO:0001583	missense	85444				cell division|mitosis	centriole|nucleus		g.chr8:86035739A>C	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.1022A>C	8.37:g.86035739A>C	ENSP00000353538:p.Lys341Thr					LRRCC1_uc010lzz.1_Intron|LRRCC1_uc010maa.1_Missense_Mutation_p.K42T|LRRCC1_uc003ycx.2_Missense_Mutation_p.K248T|LRRCC1_uc003ycy.2_Missense_Mutation_p.K321T	p.K341T	NM_033402	NP_208325	Q9C099	LRCC1_HUMAN			7	1176	+			341					B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	ENST00000360375.3	37	c.1022A>C	CCDS43750.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.231687	0.79688	.	.	ENSG00000133739	ENST00000360375;ENST00000414626	T;T	0.45276	0.9;0.9	5.83	3.39	0.38822	.	0.176032	0.27486	N	0.019141	T	0.56470	0.1987	M	0.66939	2.045	0.44241	D	0.997089	D;D;D;D	0.65815	0.992;0.993;0.992;0.995	D;P;D;P	0.65323	0.934;0.885;0.934;0.886	T	0.51188	-0.8737	10	0.36615	T	0.2	-23.9321	10.4437	0.44481	0.8666:0.0:0.1334:0.0	.	248;321;248;341	B4DV06;Q9C099-2;E9PE41;Q9C099	.;.;.;LRCC1_HUMAN	T	341;321	ENSP00000353538:K341T;ENSP00000394695:K321T	ENSP00000353538:K341T	K	+	2	0	LRRCC1	86222991	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.535000	0.60629	0.443000	0.26582	0.528000	0.53228	AAA		0.323	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1	NM_033402		20	144	0	0	0	0.008871	0	20	144				
GDF6	392255	broad.mit.edu	37	8	97157010	97157010	+	Silent	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr8:97157010G>A	ENST00000287020.5	-	2	1248	c.1149C>T	c.(1147-1149)tgC>tgT	p.C383C		NM_001001557.2	NP_001001557.1	Q6KF10	GDF6_HUMAN	growth differentiation factor 6	383					activin receptor signaling pathway (GO:0032924)|apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|growth (GO:0040007)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal cell apoptotic process (GO:1990009)	extracellular space (GO:0005615)				breast(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27	Breast(36;2.67e-05)					ATACACCCTCGCAGTGATAGG	0.637																																							uc003yhp.2		NA																	0				ovary(1)|breast(1)|pancreas(1)	3						c.(1147-1149)TGC>TGT		growth differentiation factor 6 precursor							118.0	101.0	107.0					8																	97157010		2203	4300	6503	SO:0001819	synonymous_variant	392255				activin receptor signaling pathway|BMP signaling pathway|growth|pathway-restricted SMAD protein phosphorylation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity	g.chr8:97157010G>A		CCDS34926.1	8q22.1	2014-01-29			ENSG00000156466	ENSG00000156466			4221	protein-coding gene	gene with protein product		601147	"""segmentation syndrome 1"""	SGM1		10022976, 18425797	Standard	NM_001001557		Approved	BMP13, KFS, KFS1	uc003yhp.3	Q6KF10	OTTHUMG00000164710	ENST00000287020.5:c.1149C>T	8.37:g.97157010G>A							p.C383C	NM_001001557	NP_001001557	Q6KF10	GDF6_HUMAN			2	1249	-	Breast(36;2.67e-05)		383					Q6PI58	Silent	SNP	ENST00000287020.5	37	c.1149C>T	CCDS34926.1	.	.	.	.	.	.	.	.	.	.	G	8.912	0.958871	0.18507	.	.	ENSG00000156466	ENST00000435084	.	.	.	4.72	3.85	0.44370	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	11.8931	0.52641	0.0858:0.0:0.9142:0.0	.	.	.	.	X	300	.	ENSP00000412749:R300X	R	-	1	2	GDF6	97226186	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.412000	0.52679	1.213000	0.43380	-0.262000	0.10625	CGA		0.637	GDF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379862.2	NM_001001557		8	27	0	0	0	0.004482	0	8	27				
TYRP1	7306	broad.mit.edu	37	9	12695518	12695518	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr9:12695518G>T	ENST00000388918.5	+	3	518	c.389G>T	c.(388-390)aGg>aTg	p.R130M	TYRP1_ENST00000381137.2_5'UTR|TYRP1_ENST00000381136.2_5'Flank	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	130					acetoacetic acid metabolic process (GO:0043438)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen (GO:0016716)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		CCTAAAGTCAGGAGAAATCTT	0.433									Oculocutaneous Albinism																														uc003zkv.3		NA																	0				lung(1)	1						c.(388-390)AGG>ATG		tyrosinase-related protein 1 precursor							56.0	55.0	56.0					9																	12695518		2203	4300	6503	SO:0001583	missense	7306	Oculocutaneous_Albinism	Familial Cancer Database		melanin biosynthetic process	clathrin-coated endocytic vesicle membrane|endosome membrane|integral to membrane|melanosome membrane	copper ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen|protein heterodimerization activity|protein homodimerization activity	g.chr9:12695518G>T	L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165			12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2		9434945	Standard	NM_000550		Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.389G>T	9.37:g.12695518G>T	ENSP00000373570:p.Arg130Met						p.R130M	NM_000550	NP_000541	P17643	TYRP1_HUMAN		GBM - Glioblastoma multiforme(50;9.85e-06)	3	567	+		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)	130			Lumenal, melanosome (Potential).		P78468|P78469|Q13721|Q15679	Missense_Mutation	SNP	ENST00000388918.5	37	c.389G>T	CCDS34990.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.635485	0.87760	.	.	ENSG00000107165	ENST00000388918	D	0.99868	-7.32	5.36	5.36	0.76844	Uncharacterised domain, di-copper centre (2);	0.845084	0.10842	N	0.628148	D	0.99910	0.9957	M	0.93241	3.395	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97974	1.0345	10	0.87932	D	0	-0.708	19.4447	0.94841	0.0:0.0:1.0:0.0	.	130	P17643	TYRP1_HUMAN	M	130	ENSP00000373570:R130M	ENSP00000373570:R130M	R	+	2	0	TYRP1	12685518	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.374000	0.97172	2.658000	0.90341	0.467000	0.42956	AGG		0.433	TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055502.3	NM_000550		29	18	1	0	8.88839e-20	0.002096	1.32756e-19	29	18				
PCSK5	5125	broad.mit.edu	37	9	78965780	78965780	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr9:78965780G>T	ENST00000545128.1	+	35	5460	c.4922G>T	c.(4921-4923)aGt>aTt	p.S1641I		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	1641	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						TGTGTGTGGAGTTACCACCTC	0.483																																							uc004akc.1		NA																	0					NA						c.(1177-1179)AGT>ATT		Homo sapiens cDNA FLJ16215 fis, clone CTONG2025610, moderately similar to PC6B.							192.0	179.0	183.0					9																	78965780		876	1991	2867	SO:0001583	missense	0							g.chr9:78965780G>T		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.4922G>T	9.37:g.78965780G>T	ENSP00000446280:p.Ser1641Ile						p.S393I							8	1398	+								F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	c.1178G>T	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.693117	0.68271	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000424854	T;T	0.64260	-0.09;-0.09	5.87	2.04	0.26737	.	0.224131	0.48767	D	0.000176	T	0.76018	0.3929	M	0.87682	2.9	0.41402	D	0.987689	.	.	.	.	.	.	T	0.77284	-0.2645	8	0.66056	D	0.02	-10.3306	11.0574	0.47927	0.1999:0.0:0.8001:0.0	.	.	.	.	I	1641;1371;1341	ENSP00000446280:S1641I;ENSP00000411654:S1341I	ENSP00000365945:S1371I	S	+	2	0	PCSK5	78155600	0.999000	0.42202	0.998000	0.56505	0.982000	0.71751	1.237000	0.32695	0.171000	0.19730	-0.140000	0.14226	AGT		0.483	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				25	78	1	0	5.24475e-26	0.004656	8.60582e-26	25	78				
CRB2	286204	broad.mit.edu	37	9	126125191	126125191	+	Missense_Mutation	SNP	G	G	A	rs200283870	byFrequency	TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr9:126125191G>A	ENST00000373631.3	+	2	143	c.142G>A	c.(142-144)Gct>Act	p.A48T	CRB2_ENST00000359999.3_Missense_Mutation_p.A48T	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	48					cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						AGACCCGTGCGCTCCAGGGAC	0.647													G|||	8	0.00159744	0.0	0.0072	5008	,	,		15121	0.0		0.003	False		,,,				2504	0.0						uc004bnx.1		NA																	0				ovary(1)	1						c.(142-144)GCT>ACT		crumbs homolog 2 precursor		G	THR/ALA	0,4402		0,0,2201	53.0	58.0	56.0		142	-3.5	0.0	9		56	1,8599		0,1,4299	yes	missense	CRB2	NM_173689.5	58	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	48/1286	126125191	1,13001	2201	4300	6501	SO:0001583	missense	286204					extracellular region|integral to membrane|plasma membrane	calcium ion binding	g.chr9:126125191G>A	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.142G>A	9.37:g.126125191G>A	ENSP00000362734:p.Ala48Thr					CRB2_uc004bnw.1_Missense_Mutation_p.A48T	p.A48T	NM_173689	NP_775960	Q5IJ48	CRUM2_HUMAN			2	234	+			48			Extracellular (Potential).		A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	37	c.142G>A	CCDS6852.2	5	0.0022893772893772895	0	0.0	2	0.0055248618784530384	0	0.0	3	0.00395778364116095	G	9.760	1.169846	0.21621	0.0	1.16E-4	ENSG00000148204	ENST00000359999;ENST00000373631	D;D	0.86164	-2.08;-1.98	4.7	-3.47	0.04753	.	1.081410	0.07287	N	0.871681	T	0.64681	0.2620	N	0.21448	0.665	0.09310	N	0.999999	B;B	0.24132	0.003;0.098	B;B	0.14578	0.002;0.011	T	0.53669	-0.8406	10	0.22109	T	0.4	.	2.0912	0.03657	0.2872:0.2155:0.3876:0.1097	.	48;48	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	T	48	ENSP00000353092:A48T;ENSP00000362734:A48T	ENSP00000353092:A48T	A	+	1	0	CRB2	125165012	0.000000	0.05858	0.004000	0.12327	0.449000	0.32228	-0.193000	0.09573	-0.285000	0.09089	-0.480000	0.04831	GCT		0.647	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689		92	21	0	0	0	0.00361	0	92	21				
MED27	9442	broad.mit.edu	37	9	134738450	134738450	+	Splice_Site	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr9:134738450C>A	ENST00000292035.5	-	7	864	c.801G>T	c.(799-801)atG>atT	p.M267I	MED27_ENST00000357028.2_Splice_Site_p.M231I	NM_004269.3	NP_004260.2	Q6P2C8	MED27_HUMAN	mediator complex subunit 27	267					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	18		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		AGCCACTTACCATGAAGGATC	0.537																																					Colon(41;784 923 6932 42329 52483)	Colon(41;784 923 6932 42329 52483)	uc004cbe.1		NA																	0				skin(1)	1						c.(799-801)ATG>ATT		mediator complex subunit 27							65.0	60.0	62.0					9																	134738450		2203	4300	6503	SO:0001630	splice_region_variant	9442				regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleolus|transcription factor complex	protein binding|transcription coactivator activity	g.chr9:134738450C>A	AF104252	CCDS6945.1, CCDS59153.1, CCDS69689.1	9q34.13	2008-02-05	2007-07-30	2007-07-30	ENSG00000160563	ENSG00000160563			2377	protein-coding gene	gene with protein product		605044	"""cofactor required for Sp1 transcriptional activation, subunit 8, 34kDa"""	CRSP8		9989412	Standard	NM_004269		Approved	TRAP37, CRSP34	uc004cbe.2	Q6P2C8	OTTHUMG00000020833	ENST00000292035.5:c.801+1G>T	9.37:g.134738450C>A						MED27_uc004cbf.1_Missense_Mutation_p.M231I	p.M267I	NM_004269	NP_004260	Q6P2C8	MED27_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)	7	823	-		Myeloproliferative disorder(178;0.206)	267					O95401|Q4F964|Q5VTA4|Q5VTA5|Q9BU57|Q9NYR4|V9GYV9	Missense_Mutation	SNP	ENST00000292035.5	37	c.801G>T	CCDS6945.1	.	.	.	.	.	.	.	.	.	.	c	16.86	3.240356	0.58995	.	.	ENSG00000160563	ENST00000292035;ENST00000357028;ENST00000372184	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.56978	0.2022	N	0.25890	0.77	0.80722	D	1	P;B	0.39044	0.656;0.261	P;B	0.48627	0.584;0.163	T	0.51196	-0.8736	8	.	.	.	-1.6389	18.4234	0.90600	0.0:1.0:0.0:0.0	.	231;267	Q6P2C8-2;Q6P2C8	.;MED27_HUMAN	I	267;193;231	.	.	M	-	3	0	MED27	133728271	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	7.765000	0.85310	2.575000	0.86900	0.556000	0.70494	ATG		0.537	MED27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054770.2	NM_004269	Missense_Mutation	24	8	1	0	4.72057e-08	0.003954	5.81954e-08	24	8				
GTF3C4	9329	broad.mit.edu	37	9	135553983	135553983	+	Missense_Mutation	SNP	G	G	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr9:135553983G>A	ENST00000372146.4	+	2	1541	c.977G>A	c.(976-978)cGa>cAa	p.R326Q	GTF3C4_ENST00000483873.2_Intron	NM_012204.2	NP_036336.2	Q9UKN8	TF3C4_HUMAN	general transcription factor IIIC, polypeptide 4, 90kDa	326					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|positive regulation of catalytic activity (GO:0043085)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)|enzyme activator activity (GO:0008047)|histone acetyltransferase activity (GO:0004402)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)		CACAATAATCGAAAAATGAGT	0.413																																					Pancreas(142;417 1875 11086 31973 47667)	Pancreas(142;417 1875 11086 31973 47667)	uc010mzv.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(976-978)CGA>CAA		general transcription factor IIIC 4							163.0	156.0	159.0					9																	135553983		2203	4300	6503	SO:0001583	missense	9329				transcription initiation from RNA polymerase III promoter	transcription factor TFIIIC complex	DNA binding|enzyme activator activity|histone acetyltransferase activity|protein binding	g.chr9:135553983G>A	AF142328	CCDS6953.1	9q34.3	2011-07-01	2002-08-29		ENSG00000125484	ENSG00000125484		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""General transcription factors"""	4667	protein-coding gene	gene with protein product		604892	"""general transcription factor IIIC, polypeptide 4 (90kD)"""			10523658	Standard	NM_012204		Approved	TFIIIC90, KAT12	uc010mzv.3	Q9UKN8	OTTHUMG00000020842	ENST00000372146.4:c.977G>A	9.37:g.135553983G>A	ENSP00000361219:p.Arg326Gln					GTF3C4_uc010mzw.2_RNA	p.R326Q	NM_012204	NP_036336	Q9UKN8	TF3C4_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)	2	1235	+			326					Q5VZJ7	Missense_Mutation	SNP	ENST00000372146.4	37	c.977G>A	CCDS6953.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.687506	0.88639	.	.	ENSG00000125484	ENST00000372146	T	0.63096	-0.02	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.69717	0.3142	N	0.24115	0.695	0.58432	D	0.999999	D	0.89917	1.0	D	0.80764	0.994	T	0.71928	-0.4444	10	0.59425	D	0.04	-34.8235	18.671	0.91512	0.0:0.0:1.0:0.0	.	326	Q9UKN8	TF3C4_HUMAN	Q	326	ENSP00000361219:R326Q	ENSP00000361219:R326Q	R	+	2	0	GTF3C4	134543804	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.408000	0.80041	2.756000	0.94617	0.561000	0.74099	CGA		0.413	GTF3C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054792.1			98	34	0	0	0	0.00361	0	98	34				
FAM47B	170062	broad.mit.edu	37	X	34962130	34962130	+	Missense_Mutation	SNP	G	G	T			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chrX:34962130G>T	ENST00000329357.5	+	1	1218	c.1182G>T	c.(1180-1182)atG>atT	p.M394I		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	394								p.M394I(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						AGAGTCGGATGCCCCATCTCC	0.582																																							uc004ddi.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|breast(1)	4						c.(1180-1182)ATG>ATT		hypothetical protein LOC170062							59.0	53.0	55.0					X																	34962130		2202	4300	6502	SO:0001583	missense	170062							g.chrX:34962130G>T	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1182G>T	X.37:g.34962130G>T	ENSP00000328307:p.Met394Ile						p.M394I	NM_152631	NP_689844	Q8NA70	FA47B_HUMAN			1	1200	+			394					Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	c.1182G>T	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	G	2.269	-0.367390	0.05069	.	.	ENSG00000189132	ENST00000329357	T	0.11821	2.74	0.401	-0.634	0.11516	.	.	.	.	.	T	0.08582	0.0213	L	0.39898	1.24	0.09310	N	1	B	0.26081	0.141	B	0.20577	0.03	T	0.41466	-0.9507	8	0.17369	T	0.5	.	.	.	.	.	394	Q8NA70	FA47B_HUMAN	I	394	ENSP00000328307:M394I	ENSP00000328307:M394I	M	+	3	0	FAM47B	34872051	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.022000	0.13511	-0.478000	0.06823	-0.472000	0.04984	ATG		0.582	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631		24	5	1	0	1.1804e-14	0.003954	1.67703e-14	24	5				
NAP1L2	4674	broad.mit.edu	37	X	72434052	72434052	+	Missense_Mutation	SNP	C	C	A			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chrX:72434052C>A	ENST00000373517.3	-	1	632	c.277G>T	c.(277-279)Ggt>Tgt	p.G93C	NAP1L2_ENST00000536638.1_Intron	NM_021963.3	NP_068798.1	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	93					nucleosome assembly (GO:0006334)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of neuron differentiation (GO:0045666)|regulation of stem cell division (GO:2000035)	nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(12)|skin(3)	29	Renal(35;0.156)					AAAACATAACCGATAAGTCCT	0.448																																							uc004ebi.2		NA																	0				lung(1)	1						c.(277-279)GGT>TGT		nucleosome assembly protein 1-like 2							139.0	118.0	125.0					X																	72434052		2203	4300	6503	SO:0001583	missense	4674				nucleosome assembly	chromatin assembly complex		g.chrX:72434052C>A	AF136178	CCDS14423.1	Xq13	2008-02-05			ENSG00000186462	ENSG00000186462			7638	protein-coding gene	gene with protein product		300026				8789438	Standard	NM_021963		Approved	BPX, MGC26243	uc004ebi.3	Q9ULW6	OTTHUMG00000021827	ENST00000373517.3:c.277G>T	X.37:g.72434052C>A	ENSP00000362616:p.Gly93Cys					NAP1L2_uc011mqj.1_Intron	p.G93C	NM_021963	NP_068798	Q9ULW6	NP1L2_HUMAN			1	633	-	Renal(35;0.156)		93					B2RE61|B4E161|Q8TAN6	Missense_Mutation	SNP	ENST00000373517.3	37	c.277G>T	CCDS14423.1	.	.	.	.	.	.	.	.	.	.	c	16.31	3.087731	0.55968	.	.	ENSG00000186462	ENST00000373517	D	0.91631	-2.88	3.31	3.31	0.37934	.	0.000000	0.85682	U	0.000000	D	0.91168	0.7218	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91030	0.4863	10	0.87932	D	0	0.3499	9.1816	0.37146	0.0:1.0:0.0:0.0	.	93	Q9ULW6	NP1L2_HUMAN	C	93	ENSP00000362616:G93C	ENSP00000362616:G93C	G	-	1	0	NAP1L2	72350777	0.648000	0.27313	0.895000	0.35142	0.984000	0.73092	0.548000	0.23314	1.903000	0.55091	0.600000	0.82982	GGT		0.448	NAP1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057225.1	NM_021963		42	19	1	0	2.54354e-34	0.002222	4.32587e-34	42	19				
ESPNP	284729	broad.mit.edu	37	1	17034125	17034126	+	RNA	INS	-	-	AGCT	rs141324796|rs79472512	byFrequency	TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr1:17034125_17034126insAGCT	ENST00000492551.1	-	0	477_478					NR_026567.1				espin pseudogene																		CAGCAGCAGCCAGCTGAGCACC	0.718														1500	0.299521	0.1188	0.3444	5008	,	,		24180	0.4177		0.3101	False		,,,				2504	0.3793						uc001azn.1		NA																	0					0						c.(364-366)TGGfs		RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;																																						284729							g.chr1:17034125_17034126insAGCT	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17034126_17034129dupAGCT						ESPNP_uc010ocj.1_Frame_Shift_Ins_p.W52fs	p.W122fs	NR_026567						3	478_479	-									Frame_Shift_Ins	INS	ENST00000492551.1	37	c.364_365insAGCT																																																																																					0.718	ESPNP-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000326311.1			4	3	NA	NA	NA	NA	NA	4	3	---	---	---	---
SLIT1	6585	broad.mit.edu	37	10	98799774	98799774	+	Frame_Shift_Del	DEL	G	G	-			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr10:98799774delG	ENST00000266058.4	-	21	2513	c.2268delC	c.(2266-2268)cccfs	p.P756fs	ARHGAP19-SLIT1_ENST00000453547.2_3'UTR|SLIT1_ENST00000371070.4_Frame_Shift_Del_p.P756fs	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	756	LRRNT 4.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		GAATGCCCTTGGGCAGGGCCC	0.652																																							uc001kmw.2		NA																	0				ovary(4)	4						c.(2266-2268)CCCfs		slit homolog 1 precursor							64.0	56.0	59.0					10																	98799774		2203	4300	6503	SO:0001589	frameshift_variant	6585				axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding	g.chr10:98799774delG	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.2268delC	10.37:g.98799774delG	ENSP00000266058:p.Pro756fs					SLIT1_uc009xvh.1_Frame_Shift_Del_p.P766fs	p.P756fs	NM_003061	NP_003052	O75093	SLIT1_HUMAN		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)	21	2520	-		Colorectal(252;0.162)	756			LRRNT 4.		Q5T0V1|Q8WWZ2|Q9UIL7	Frame_Shift_Del	DEL	ENST00000266058.4	37	c.2268delC	CCDS7453.1																																																																																				0.652	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061		17	41	NA	NA	NA	NA	NA	17	41	---	---	---	---
ZNF592	9640	broad.mit.edu	37	15	85341834	85341834	+	Frame_Shift_Del	DEL	C	C	-			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr15:85341834delC	ENST00000560079.2	+	8	3040	c.2752delC	c.(2752-2754)cccfs	p.P918fs	ZNF592_ENST00000299927.3_Frame_Shift_Del_p.P918fs	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	918					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CCACGGTGTTCCCCGAAATGT	0.607																																							uc002bld.2		NA																	0				ovary(4)|skin(2)	6						c.(2752-2754)CCCfs		zinc finger protein 592							50.0	50.0	50.0					15																	85341834		2203	4299	6502	SO:0001589	frameshift_variant	9640				cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr15:85341834delC	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.2752delC	15.37:g.85341834delC	ENSP00000452877:p.Pro918fs					ZNF592_uc010upb.1_RNA	p.P918fs	NM_014630	NP_055445	Q92610	ZN592_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		8	3088	+			918					Q2M1T2|Q504Y9	Frame_Shift_Del	DEL	ENST00000560079.2	37	c.2752delC	CCDS32317.1																																																																																				0.607	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630		23	42	NA	NA	NA	NA	NA	23	42	---	---	---	---
HYDIN	54768	broad.mit.edu	37	16	70975590	70975590	+	Frame_Shift_Del	DEL	G	G	-			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr16:70975590delG	ENST00000393567.2	-	43	6952	c.6802delC	c.(6802-6804)cagfs	p.Q2268fs		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2268					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GCGTAATCCTGGGCCATGTTG	0.527																																							uc002ezr.2		NA																	0				ovary(1)|skin(1)	2						c.(6799-6801)CAGfs		hydrocephalus inducing isoform a							111.0	109.0	110.0					16																	70975590		1963	4147	6110	SO:0001589	frameshift_variant	54768							g.chr16:70975590delG	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.6802delC	16.37:g.70975590delG	ENSP00000377197:p.Gln2268fs						p.Q2267fs	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN			43	6927	-		Ovarian(137;0.0654)	2268			Potential.		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Frame_Shift_Del	DEL	ENST00000393567.2	37	c.6799delC	CCDS59269.1																																																																																				0.527	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3			15	196	NA	NA	NA	NA	NA	15	196	---	---	---	---
KANSL1	284058	broad.mit.edu	37	17	44172067	44172067	+	Splice_Site	DEL	C	C	-			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr17:44172067delC	ENST00000262419.6	-	3	1760	c.1290delG	c.(1288-1290)ctg>ct	p.L430fs	KANSL1_ENST00000572904.1_Splice_Site_p.L430fs|KANSL1_ENST00000432791.1_Splice_Site_p.L430fs|KANSL1_ENST00000393476.3_5'UTR|KANSL1_ENST00000574590.1_Splice_Site_p.L430fs|KANSL1_ENST00000575318.1_Splice_Site_p.L430fs	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	430					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											ACCTGCGTCTCCTAAAAGGAA	0.463																																							uc002ikb.2		NA																	0				skin(2)	2						c.(1288-1290)CTGfs		hypothetical protein LOC284058							77.0	95.0	89.0					17																	44172067		2203	4300	6503	SO:0001630	splice_region_variant	284058					MLL1 complex	protein binding	g.chr17:44172067delC	BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.1290-1G>-	17.37:g.44172067delC						KIAA1267_uc002ikc.2_Frame_Shift_Del_p.L430fs|KIAA1267_uc002ikd.2_Frame_Shift_Del_p.L430fs|KIAA1267_uc010dav.2_Frame_Shift_Del_p.L430fs	p.L430fs	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN			2	1375	-		Melanoma(429;0.211)	430					A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Frame_Shift_Del	DEL	ENST00000262419.6	37	c.1290delG	CCDS11503.1																																																																																				0.463	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1	NM_015443	Frame_Shift_Del	42	112	NA	NA	NA	NA	NA	42	112	---	---	---	---
ZNF331	55422	broad.mit.edu	37	19	54080642	54080653	+	In_Frame_Del	DEL	TGGGAAGGCTTT	TGGGAAGGCTTT	-			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	TGGGAAGGCTTT	TGGGAAGGCTTT	-	-	TGGGAAGGCTTT	TGGGAAGGCTTT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr19:54080642_54080653delTGGGAAGGCTTT	ENST00000253144.9	+	7	2161_2172	c.828_839delTGGGAAGGCTTT	c.(826-840)tgtgggaaggctttt>tgt	p.GKAF277del	ZNF331_ENST00000513999.1_In_Frame_Del_p.GKAF277del|ZNF331_ENST00000411977.2_In_Frame_Del_p.GKAF277del|ZNF331_ENST00000512387.1_In_Frame_Del_p.GKAF277del|ZNF331_ENST00000511154.1_In_Frame_Del_p.GKAF277del|ZNF331_ENST00000511593.2_In_Frame_Del_p.GKAF277del|ZNF331_ENST00000513265.1_Intron|ZNF331_ENST00000449416.1_In_Frame_Del_p.GKAF277del	NM_001253801.1|NM_018555.5	NP_001240730.1|NP_061025.5	Q9NQX6	ZN331_HUMAN	zinc finger protein 331	277					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	10				GBM - Glioblastoma multiforme(134;0.00555)		GTAAAGACTGTGGGAAGGCTTTTATTTGTGGT	0.42			T	?	follicular thyroid adenoma																																		uc002qbx.1		NA		Dom	yes		19	19q13.3-q13.4	55422	T	zinc finger protein 331			E	?		follicular thyroid adenoma		0				skin(3)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)	6						c.(826-840)TGTGGGAAGGCTTTT>TGT		zinc finger protein 331																																				SO:0001651	inframe_deletion	55422				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:54080642_54080653delTGGGAAGGCTTT	AF251515	CCDS33102.1	19q13	2013-12-10				ENSG00000130844		"""Zinc fingers, C2H2-type"", ""-"""	15489	protein-coding gene	gene with protein product	"""rearranged in thyroid adenomas"""	606043					Standard	NM_001079906		Approved	RITA, ZNF463, ZNF361	uc021uzh.1	Q9NQX6		ENST00000253144.9:c.828_839delTGGGAAGGCTTT	19.37:g.54080642_54080653delTGGGAAGGCTTT	ENSP00000253144:p.Gly277_Phe280del					ZNF331_uc002qby.1_In_Frame_Del_p.GKAF277del|ZNF331_uc002qbz.1_In_Frame_Del_p.GKAF277del|ZNF331_uc002qca.1_In_Frame_Del_p.GKAF277del|ZNF331_uc010eqr.1_In_Frame_Del_p.GKAF277del|ZNF331_uc002qcb.1_In_Frame_Del_p.GKAF277del|ZNF331_uc002qcc.1_In_Frame_Del_p.GKAF277del|ZNF331_uc002qcd.1_In_Frame_Del_p.GKAF277del	p.GKAF277del	NM_018555	NP_061025	Q9NQX6	ZN331_HUMAN		GBM - Glioblastoma multiforme(134;0.00555)	7	2262_2273	+			277_280			C2H2-type 6.		Q96GJ4	In_Frame_Del	DEL	ENST00000253144.9	37	c.828_839delTGGGAAGGCTTT	CCDS33102.1																																																																																				0.420	ZNF331-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371366.1	NM_018555		18	48	NA	NA	NA	NA	NA	18	48	---	---	---	---
REG3G	130120	broad.mit.edu	37	2	79255038	79255038	+	Frame_Shift_Del	DEL	G	G	-			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr2:79255038delG	ENST00000272324.5	+	5	623	c.439delG	c.(439-441)gggfs	p.G147fs	REG3G_ENST00000409471.1_Frame_Shift_Del_p.G101fs|REG3G_ENST00000393897.2_Frame_Shift_Del_p.G147fs	NM_001008387.2	NP_001008388.1	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma	147	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|defense response to Gram-positive bacterium (GO:0050830)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.G147W(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(27)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TGGCCACTGTGGGAGCCTGTC	0.488																																							uc002snw.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(439-441)GGGfs		regenerating islet-derived 3 gamma precursor							106.0	109.0	108.0					2																	79255038		2203	4300	6503	SO:0001589	frameshift_variant	130120				acute-phase response	extracellular region	sugar binding	g.chr2:79255038delG	AY359047	CCDS1962.1, CCDS58714.1	2p12	2005-02-11			ENSG00000143954	ENSG00000143954			29595	protein-coding gene	gene with protein product		609933				12975309	Standard	NM_001008387		Approved	UNQ429, LPPM429, PAP1B	uc002snx.4	Q6UW15	OTTHUMG00000130018	ENST00000272324.5:c.439delG	2.37:g.79255038delG	ENSP00000272324:p.Gly147fs					REG3G_uc002snx.2_Frame_Shift_Del_p.G147fs|REG3G_uc010ffu.2_Frame_Shift_Del_p.G101fs	p.G147fs	NM_198448	NP_940850	Q6UW15	REG3G_HUMAN			5	524	+			147			C-type lectin.		A8K980|D6W5J6|Q3SYE4|Q3SYE6|Q6FH18	Frame_Shift_Del	DEL	ENST00000272324.5	37	c.439delG	CCDS1962.1																																																																																				0.488	REG3G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328247.1	NM_198448		30	74	NA	NA	NA	NA	NA	30	74	---	---	---	---
XRN1	54464	broad.mit.edu	37	3	142123826	142123826	+	Frame_Shift_Del	DEL	C	C	-			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr3:142123826delC	ENST00000264951.4	-	16	1923	c.1806delG	c.(1804-1806)tggfs	p.W602fs	RNU6-1294P_ENST00000515995.1_RNA|XRN1_ENST00000392981.2_Frame_Shift_Del_p.W602fs	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	602					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						CTCTATCATACCAGCACATTA	0.403																																							uc003eus.2		NA																	0				ovary(3)	3						c.(1804-1806)TGGfs		5'-3' exoribonuclease 1 isoform a							169.0	150.0	157.0					3																	142123826		2203	4300	6503	SO:0001589	frameshift_variant	54464				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding	g.chr3:142123826delC	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.1806delG	3.37:g.142123826delC	ENSP00000264951:p.Trp602fs					XRN1_uc010huu.2_Frame_Shift_Del_p.W68fs|XRN1_uc003eut.2_Frame_Shift_Del_p.W602fs|XRN1_uc003euu.2_Frame_Shift_Del_p.W602fs|XRN1_uc003euv.1_Frame_Shift_Del_p.W463fs	p.W602fs	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN			16	1873	-			602					Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Frame_Shift_Del	DEL	ENST00000264951.4	37	c.1806delG	CCDS3123.1																																																																																				0.403	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001		38	19	NA	NA	NA	NA	NA	38	19	---	---	---	---
KIAA1045	23349	broad.mit.edu	37	9	34972519	34972519	+	Frame_Shift_Del	DEL	C	C	-			TCGA-86-7713-01A-11D-2063-08	TCGA-86-7713-10A-01D-2063-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	1416b4c9-f535-4611-b4b9-85fbd0f7b0a4	4929c3d1-f4da-4766-9d13-85b5c7babf4c	g.chr9:34972519delC	ENST00000242315.3	+	3	637	c.555delC	c.(553-555)tgcfs	p.C185fs	KIAA1045_ENST00000544237.1_Frame_Shift_Del_p.C185fs|KIAA1045_ENST00000476115.2_3'UTR	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	185							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			GCTGGAGCTGCCACTACTGTG	0.557																																							uc003zvq.2		NA																	0				skin(1)	1						c.(553-555)TGCfs		hypothetical protein LOC23349							46.0	59.0	55.0					9																	34972519		2034	4167	6201	SO:0001589	frameshift_variant	23349						calcium ion binding	g.chr9:34972519delC	AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.555delC	9.37:g.34972519delC	ENSP00000242315:p.Cys185fs					KIAA1045_uc003zvr.2_Frame_Shift_Del_p.C185fs	p.C185fs	NM_015297	NP_056112	Q9UPV7	K1045_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00575)		3	733	+			185			PHD-type.		B7Z253|Q58FE9|Q5T662	Frame_Shift_Del	DEL	ENST00000242315.3	37	c.555delC	CCDS43796.1																																																																																				0.557	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052256.2	XM_048592		23	18	NA	NA	NA	NA	NA	23	18	---	---	---	---
