#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
AKR7A3	22977	broad.mit.edu	37	1	19609317	19609317	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr1:19609317C>G	ENST00000361640.4	-	7	1444	c.904G>C	c.(904-906)Gca>Cca	p.A302P		NM_012067.2	NP_036199.2	O95154	ARK73_HUMAN	aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)	302					cellular aldehyde metabolic process (GO:0006081)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)	p.A302P(1)		NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|stomach(2)	13		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;1.78e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00276)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CCTTCCTCTGCCGCTGCCAAG	0.622																																							uc001bbv.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(904-906)GCA>CCA		aldo-keto reductase family 7, member A3							27.0	30.0	29.0					1																	19609317		2193	4287	6480	SO:0001583	missense	22977				cellular aldehyde metabolic process	cytosol	aldo-keto reductase (NADP) activity|electron carrier activity	g.chr1:19609317C>G	AF040639	CCDS193.1	1p36.13	2008-05-14			ENSG00000162482	ENSG00000162482		"""Aldo-keto reductases"""	390	protein-coding gene	gene with protein product		608477				10383892	Standard	NM_012067		Approved		uc001bbv.1	O95154	OTTHUMG00000002523	ENST00000361640.4:c.904G>C	1.37:g.19609317C>G	ENSP00000355377:p.Ala302Pro						p.A302P	NM_012067	NP_036199	O95154	ARK73_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;1.78e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00276)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	7	981	-		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)	302					Q86SR4|Q8IVN6|Q8N5V6|Q8TAX1|Q9NUC3	Missense_Mutation	SNP	ENST00000361640.4	37	c.904G>C	CCDS193.1	.	.	.	.	.	.	.	.	.	.	C	14.85	2.657384	0.47467	.	.	ENSG00000162482	ENST00000361640	T	0.26518	1.73	3.59	-6.31	0.02001	NADP-dependent oxidoreductase domain (3);	1.175910	0.05990	N	0.645793	T	0.34513	0.0900	M	0.84219	2.685	0.09310	N	1	P	0.42692	0.787	P	0.50860	0.652	T	0.45175	-0.9279	10	0.51188	T	0.08	.	0.5679	0.00690	0.246:0.2888:0.1229:0.3423	.	302	O95154	ARK73_HUMAN	P	302	ENSP00000355377:A302P	ENSP00000355377:A302P	A	-	1	0	AKR7A3	19481904	0.000000	0.05858	0.000000	0.03702	0.661000	0.39034	-1.942000	0.01541	-1.184000	0.02720	0.205000	0.17691	GCA		0.622	AKR7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007166.1	NM_012067		8	71	0	0	0	0.006214	0	8	71				
CC2D1B	200014	broad.mit.edu	37	1	52828382	52828382	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr1:52828382G>C	ENST00000371586.2	-	3	244	c.106C>G	c.(106-108)Ctg>Gtg	p.L36V	CC2D1B_ENST00000460261.1_5'Flank|CC2D1B_ENST00000438831.1_5'UTR|CC2D1B_ENST00000284376.3_Missense_Mutation_p.L36V	NM_032449.2	NP_115825.1	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	36						nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.L36V(1)		breast(1)|large_intestine(6)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	27						ATGCCCAGCAGCATGTCCTCA	0.572																																							uc001ctq.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(106-108)CTG>GTG		coiled-coil and C2 domain containing 1B							146.0	144.0	145.0					1																	52828382		2203	4300	6503	SO:0001583	missense	200014							g.chr1:52828382G>C	AB058739	CCDS30714.1	1p32.3	2008-02-05			ENSG00000154222	ENSG00000154222			29386	protein-coding gene	gene with protein product						11347906	Standard	NM_032449		Approved	KIAA1836	uc001ctq.2	Q5T0F9	OTTHUMG00000008102	ENST00000371586.2:c.106C>G	1.37:g.52828382G>C	ENSP00000360642:p.Leu36Val					CC2D1B_uc001cts.2_5'Flank	p.L36V	NM_032449	NP_115825	Q5T0F9	C2D1B_HUMAN			3	244	-			36					Q49AE8|Q5T0F8|Q5T0G0|Q6ZNQ1|Q96AP3|Q96I04|Q96JJ1	Missense_Mutation	SNP	ENST00000371586.2	37	c.106C>G	CCDS30714.1	.	.	.	.	.	.	.	.	.	.	G	10.15	1.272522	0.23221	.	.	ENSG00000154222	ENST00000371586;ENST00000284376;ENST00000371575	T;T	0.24350	1.86;1.86	4.85	0.56	0.17279	.	0.424075	0.21334	N	0.076245	T	0.16854	0.0405	L	0.38531	1.155	0.80722	D	1	B	0.14438	0.01	B	0.11329	0.006	T	0.06499	-1.0823	10	0.39692	T	0.17	-2.8372	6.9323	0.24447	0.0844:0.0:0.4807:0.4349	.	36	Q5T0F9	C2D1B_HUMAN	V	36	ENSP00000360642:L36V;ENSP00000284376:L36V	ENSP00000284376:L36V	L	-	1	2	CC2D1B	52600970	0.983000	0.35010	0.999000	0.59377	0.892000	0.51952	-0.026000	0.12392	0.592000	0.29728	0.655000	0.94253	CTG		0.572	CC2D1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000022189.1	NM_032449		5	87	0	0	0	0.000602	0	5	87				
EPS8L3	79574	broad.mit.edu	37	1	110294652	110294652	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr1:110294652G>A	ENST00000361965.4	-	15	1505	c.1399C>T	c.(1399-1401)Cgg>Tgg	p.R467W	EPS8L3_ENST00000361852.4_Missense_Mutation_p.R437W|RP4-735C1.4_ENST00000431955.1_RNA|EPS8L3_ENST00000369805.3_Missense_Mutation_p.R468W	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	467	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.					cytoplasm (GO:0005737)		p.R468W(1)		breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		GTCAGTTCCCGTGGGTTCCTA	0.602																																							uc001dyr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1399-1401)CGG>TGG		epidermal growth factor receptor pathway							103.0	104.0	104.0					1																	110294652		2203	4300	6503	SO:0001583	missense	79574					cytoplasm	protein binding	g.chr1:110294652G>A	AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.1399C>T	1.37:g.110294652G>A	ENSP00000355255:p.Arg467Trp					EPS8L3_uc001dys.1_Missense_Mutation_p.R437W|EPS8L3_uc001dyq.1_Missense_Mutation_p.R468W|EPS8L3_uc009wfm.1_Missense_Mutation_p.R404W|EPS8L3_uc009wfn.1_Missense_Mutation_p.R412W	p.R467W	NM_133181	NP_573444	Q8TE67	ES8L3_HUMAN		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)	15	1544	-		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)	467			SH3.		A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Missense_Mutation	SNP	ENST00000361965.4	37	c.1399C>T	CCDS814.1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.859636	0.71834	.	.	ENSG00000198758	ENST00000361852;ENST00000369805;ENST00000361965	T;T;T	0.30981	1.51;1.51;1.51	5.57	3.7	0.42460	Src homology-3 domain (4);	0.425012	0.26863	N	0.022112	T	0.36496	0.0969	M	0.76170	2.325	0.33016	D	0.528146	D;D;D	0.89917	1.0;0.999;0.997	P;D;P	0.63192	0.857;0.912;0.648	T	0.42582	-0.9443	10	0.87932	D	0	-7.6284	9.1043	0.36687	0.0:0.1601:0.6735:0.1664	.	437;467;468	Q8TE67-2;Q8TE67;Q8TE67-3	.;ES8L3_HUMAN;.	W	437;468;467	ENSP00000354551:R437W;ENSP00000358820:R468W;ENSP00000355255:R467W	ENSP00000354551:R437W	R	-	1	2	EPS8L3	110096175	0.883000	0.30277	0.854000	0.33618	0.873000	0.50193	1.690000	0.37711	0.712000	0.32039	0.655000	0.94253	CGG		0.602	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032234.1	NM_024526		21	119	0	0	0	0.008871	0	21	119				
SPRR4	163778	broad.mit.edu	37	1	152944414	152944414	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr1:152944414G>T	ENST00000328051.2	+	2	97	c.48G>T	c.(46-48)caG>caT	p.Q16H		NM_173080.1	NP_775103.1	Q96PI1	SPRR4_HUMAN	small proline-rich protein 4	16	Gln-rich.				keratinization (GO:0031424)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)		p.Q16H(1)		lung(1)|prostate(1)	2	Lung NSC(65;1.46e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCCCACCCCAGAGGGCCCAGC	0.582																																							uc001fav.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(46-48)CAG>CAT		small proline-rich protein 4							88.0	86.0	87.0					1																	152944414		2203	4300	6503	SO:0001583	missense	163778				keratinization|peptide cross-linking	cell cortex		g.chr1:152944414G>T	AF335109	CCDS1031.1	1q21.3	2008-02-05	2006-11-29		ENSG00000184148	ENSG00000184148			23173	protein-coding gene	gene with protein product						11719550, 11279051	Standard	NM_173080		Approved		uc001fav.1	Q96PI1	OTTHUMG00000012450	ENST00000328051.2:c.48G>T	1.37:g.152944414G>T	ENSP00000332163:p.Gln16His						p.Q16H	NM_173080	NP_775103	Q96PI1	SPRR4_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)		2	111	+	Lung NSC(65;1.46e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		16			Gln-rich.		Q2M1Y7|Q5T522	Missense_Mutation	SNP	ENST00000328051.2	37	c.48G>T	CCDS1031.1	.	.	.	.	.	.	.	.	.	.	G	3.863	-0.029426	0.07589	.	.	ENSG00000184148	ENST00000328051	T	0.21031	2.03	4.42	2.5	0.30297	.	.	.	.	.	T	0.21761	0.0524	.	.	.	0.24795	N	0.99274	D	0.76494	0.999	D	0.77557	0.99	T	0.04650	-1.0936	8	0.39692	T	0.17	3.1315	5.9286	0.19126	0.2402:0.0:0.7598:0.0	.	16	Q96PI1	SPRR4_HUMAN	H	16	ENSP00000332163:Q16H	ENSP00000332163:Q16H	Q	+	3	2	SPRR4	151211038	0.185000	0.23213	0.277000	0.24703	0.285000	0.27093	1.964000	0.40462	0.464000	0.27142	0.460000	0.39030	CAG		0.582	SPRR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034663.1	NM_173080		7	118	1	0	8.12818e-05	0.001984	9.66761e-05	7	118				
SLC27A3	11000	broad.mit.edu	37	1	153748206	153748206	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr1:153748206G>A	ENST00000368661.3	+	1	439	c.374G>A	c.(373-375)cGc>cAc	p.R125H	SLC27A3_ENST00000271857.2_Missense_Mutation_p.R206H|SLC27A3_ENST00000484014.1_Intron	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3	125					fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)	p.R125H(1)		NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GCCCAGCAGCGCGCCGCGCAC	0.711																																							uc001fcz.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(373-375)CGC>CAC		solute carrier family 27 member 3							8.0	10.0	9.0					1																	153748206		1938	3920	5858	SO:0001583	missense	11000				fatty acid metabolic process	integral to membrane|mitochondrial membrane	ligase activity|nucleotide binding	g.chr1:153748206G>A	BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.374G>A	1.37:g.153748206G>A	ENSP00000357650:p.Arg125His					SLC27A3_uc009won.2_RNA	p.R125H	NM_024330	NP_077306	Q5K4L6	S27A3_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.151)		1	439	+	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		125					Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Missense_Mutation	SNP	ENST00000368661.3	37	c.374G>A	CCDS1053.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667510	0.47677	.	.	ENSG00000143554	ENST00000271857;ENST00000368661	T;T	0.10763	2.84;2.84	3.57	2.63	0.31362	.	0.961284	0.08623	N	0.918126	T	0.01029	0.0034	N	0.14661	0.345	0.09310	N	1	P	0.49783	0.928	B	0.30495	0.116	T	0.22871	-1.0204	10	0.07175	T	0.84	-9.8274	5.9042	0.18984	0.1524:0.0:0.8476:0.0	.	125	Q5K4L6	S27A3_HUMAN	H	206;125	ENSP00000271857:R206H;ENSP00000357650:R125H	ENSP00000271857:R206H	R	+	2	0	SLC27A3	152014830	0.989000	0.36119	0.224000	0.23877	0.288000	0.27193	1.709000	0.37909	0.674000	0.31244	0.462000	0.41574	CGC		0.711	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_024330		11	11	0	0	0	0.00245	0	11	11				
ZBTB7B	51043	broad.mit.edu	37	1	154989004	154989004	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr1:154989004A>G	ENST00000368426.3	+	4	1600	c.1463A>G	c.(1462-1464)aAt>aGt	p.N488S	ZBTB7B_ENST00000417934.2_Missense_Mutation_p.N522S|ZBTB7B_ENST00000535420.1_Missense_Mutation_p.N488S|ZBTB7B_ENST00000292176.2_Missense_Mutation_p.N488S	NM_001256455.1	NP_001243384.1	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	488					cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N488S(1)		endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)	29	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GACCTCTCCAATGGCCACCTG	0.677																																							uc001fgk.3		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1462-1464)AAT>AGT		zinc finger and BTB domain containing 7B							90.0	66.0	75.0					1																	154989004		2203	4300	6503	SO:0001583	missense	51043				cell differentiation|ectoderm development|multicellular organismal development|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding	g.chr1:154989004A>G	AF007833	CCDS1081.1, CCDS58030.1	1q21.2	2013-01-08		2005-04-07	ENSG00000160685	ENSG00000160685		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18668	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 15"""	607646	"""zinc finger protein 67 homolog (mouse)"""	ZFP67		9370309, 7937772	Standard	NR_045515		Approved	ZBTB15, c-Krox, hcKrox, ZNF857B	uc010peq.3	O15156	OTTHUMG00000037414	ENST00000368426.3:c.1463A>G	1.37:g.154989004A>G	ENSP00000357411:p.Asn488Ser					ZBTB7B_uc009wpa.2_Missense_Mutation_p.N488S|ZBTB7B_uc001fgj.3_Missense_Mutation_p.N522S|ZBTB7B_uc010peq.1_Missense_Mutation_p.N522S|ZBTB7B_uc001fgl.3_Missense_Mutation_p.N488S	p.N488S	NM_015872	NP_056956	O15156	ZBT7B_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)		4	1621	+	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		488					B4E3K5|D3DV83|J3KQQ3|Q68DR2|Q96EP2	Missense_Mutation	SNP	ENST00000368426.3	37	c.1463A>G	CCDS1081.1	.	.	.	.	.	.	.	.	.	.	a	11.30	1.598175	0.28445	.	.	ENSG00000160685	ENST00000535420;ENST00000368426;ENST00000417934;ENST00000292176	T;T;T;T	0.08896	3.09;3.09;3.04;3.09	3.82	3.82	0.43975	.	0.281160	0.24262	U	0.040073	T	0.01627	0.0052	N	0.19112	0.55	0.29039	N	0.88522	P;P;P	0.38504	0.634;0.634;0.634	B;B;B	0.30105	0.111;0.111;0.111	T	0.47509	-0.9112	10	0.26408	T	0.33	.	10.8602	0.46823	1.0:0.0:0.0:0.0	.	488;488;522	A8K6F4;O15156;B4E3K5	.;ZBT7B_HUMAN;.	S	488;488;522;488	ENSP00000438647:N488S;ENSP00000357411:N488S;ENSP00000406286:N522S;ENSP00000292176:N488S	ENSP00000292176:N488S	N	+	2	0	ZBTB7B	153255628	0.417000	0.25432	0.990000	0.47175	0.948000	0.59901	1.549000	0.36212	1.723000	0.51488	0.375000	0.23000	AAT		0.677	ZBTB7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091083.1	NM_015872		3	40	0	0	0	0.004672	0	3	40				
CD1E	913	broad.mit.edu	37	1	158325668	158325668	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr1:158325668T>A	ENST00000368167.3	+	4	916	c.677T>A	c.(676-678)cTg>cAg	p.L226Q	CD1E_ENST00000444681.2_Missense_Mutation_p.L127Q|CD1E_ENST00000434258.1_Missense_Mutation_p.L224Q|CD1E_ENST00000368160.3_Missense_Mutation_p.L226Q|CD1E_ENST00000368155.3_Missense_Mutation_p.L136Q|CD1E_ENST00000368163.3_Missense_Mutation_p.L226Q|CD1E_ENST00000368156.1_Missense_Mutation_p.L136Q|CD1E_ENST00000452291.2_Missense_Mutation_p.L37Q|CD1E_ENST00000368165.3_Missense_Mutation_p.L136Q|CD1E_ENST00000368164.3_Missense_Mutation_p.L37Q|CD1E_ENST00000368157.1_Missense_Mutation_p.L37Q|CD1E_ENST00000368166.3_Missense_Mutation_p.L37Q|CD1E_ENST00000368161.3_Missense_Mutation_p.L226Q|CD1E_ENST00000368154.1_Missense_Mutation_p.L37Q	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	226	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)	p.L226Q(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					CCTGGCCGTCTGCAGCTTGTG	0.587																																							uc001fse.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)	3						c.(676-678)CTG>CAG		CD1E antigen isoform a precursor							52.0	53.0	53.0					1																	158325668		2203	4300	6503	SO:0001583	missense	913				antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen		g.chr1:158325668T>A	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.677T>A	1.37:g.158325668T>A	ENSP00000357149:p.Leu226Gln					CD1E_uc010pid.1_Missense_Mutation_p.L224Q|CD1E_uc010pie.1_Missense_Mutation_p.L127Q|CD1E_uc010pif.1_Missense_Mutation_p.L37Q|CD1E_uc001fsd.2_Missense_Mutation_p.L226Q|CD1E_uc001fsk.2_Missense_Mutation_p.L136Q|CD1E_uc001fsj.2_Missense_Mutation_p.L136Q|CD1E_uc001fsc.2_Missense_Mutation_p.L37Q|CD1E_uc010pig.1_RNA|CD1E_uc001fsa.2_Missense_Mutation_p.L37Q|CD1E_uc001fsf.2_Missense_Mutation_p.L226Q|CD1E_uc001fry.2_Missense_Mutation_p.L226Q|CD1E_uc001fsg.2_Missense_Mutation_p.L37Q|CD1E_uc001fsh.2_Missense_Mutation_p.L37Q|CD1E_uc001fsi.2_Missense_Mutation_p.L226Q|CD1E_uc009wsv.2_Missense_Mutation_p.L127Q|CD1E_uc001frz.2_Missense_Mutation_p.L136Q|CD1E_uc009wsw.2_5'UTR	p.L226Q	NM_030893	NP_112155	P15812	CD1E_HUMAN			4	916	+	all_hematologic(112;0.0378)		226			Ig-like.		B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	ENST00000368167.3	37	c.677T>A	CCDS41417.1	.	.	.	.	.	.	.	.	.	.	T	14.19	2.460054	0.43736	.	.	ENSG00000158488	ENST00000434258;ENST00000444681;ENST00000368167;ENST00000452291;ENST00000368165;ENST00000368166;ENST00000368163;ENST00000368164;ENST00000368157;ENST00000368160;ENST00000368161;ENST00000368156;ENST00000368155;ENST00000368154	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.46451	4.14;4.14;4.14;4.14;2.45;4.14;4.14;4.14;4.14;4.14;4.14;2.45;4.14;0.87	4.51	4.51	0.55191	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);Immunoglobulin C1-set (2);	0.000000	0.37261	N	0.002169	T	0.58694	0.2140	M	0.87038	2.855	0.35595	D	0.807377	P;D;D;P;B;D;B;D;P;P;D;B;D;P;D	0.89917	0.8;0.996;0.976;0.933;0.079;0.999;0.315;0.996;0.68;0.827;0.995;0.45;1.0;0.69;0.99	P;P;P;P;B;D;B;D;P;P;D;P;D;B;P	0.97110	0.761;0.901;0.735;0.672;0.185;0.951;0.283;0.984;0.618;0.559;0.95;0.648;1.0;0.333;0.904	T	0.68413	-0.5415	10	0.87932	D	0	-15.136	10.3958	0.44201	0.0:0.0:0.0:1.0	.	37;127;224;127;136;136;37;37;226;226;226;37;37;136;226	B4E057;B4E042;E7ET31;E7EP01;P15812-5;P15812-7;P15812-9;P15812-10;P15812-2;P15812;P15812-3;P15812-8;P15812-11;P15812-6;P15812-4	.;.;.;.;.;.;.;.;.;CD1E_HUMAN;.;.;.;.;.	Q	224;127;226;37;136;37;226;37;37;226;226;136;136;37	ENSP00000401957:L224Q;ENSP00000402906:L127Q;ENSP00000357149:L226Q;ENSP00000416228:L37Q;ENSP00000357147:L136Q;ENSP00000357148:L37Q;ENSP00000357145:L226Q;ENSP00000357146:L37Q;ENSP00000357139:L37Q;ENSP00000357142:L226Q;ENSP00000357143:L226Q;ENSP00000357138:L136Q;ENSP00000357137:L136Q;ENSP00000357136:L37Q	ENSP00000357136:L37Q	L	+	2	0	CD1E	156592292	0.026000	0.19158	0.986000	0.45419	0.820000	0.46376	2.063000	0.41423	2.036000	0.60181	0.460000	0.39030	CTG		0.587	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893		15	63	0	0	0	0.007413	0	15	63				
TNR	7143	broad.mit.edu	37	1	175324639	175324639	+	Splice_Site	SNP	C	C	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr1:175324639C>A	ENST00000367674.2	-	17	3957	c.3249G>T	c.(3247-3249)aaG>aaT	p.K1083N	TNR_ENST00000263525.2_Splice_Site_p.K1083N			Q92752	TENR_HUMAN	tenascin R	1083	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.K1083N(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					AAAATCTCACCTTGCGGCTTC	0.507																																							uc001gkp.1		NA																	1	Substitution - Missense(1)		lung(1)	pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11						c.(3247-3249)AAG>AAT		tenascin R precursor							85.0	84.0	84.0					1																	175324639		2203	4300	6503	SO:0001630	splice_region_variant	7143				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		g.chr1:175324639C>A	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.3249+1G>T	1.37:g.175324639C>A						TNR_uc009wwu.1_Missense_Mutation_p.K1083N	p.K1083N	NM_003285	NP_003276	Q92752	TENR_HUMAN			15	3330	-	Renal(580;0.146)		1083			Fibronectin type-III 9.		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	c.3249G>T	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156481	0.57259	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.54479	0.57;0.57	5.07	2.73	0.32206	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.67524	0.2902	M	0.67569	2.06	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.65384	-0.6181	9	.	.	.	.	12.1502	0.54046	0.0:0.8856:0.0:0.1144	.	1083	Q92752	TENR_HUMAN	N	1083;1083;993	ENSP00000356646:K1083N;ENSP00000263525:K1083N	.	K	-	3	2	TNR	173591262	1.000000	0.71417	1.000000	0.80357	0.506000	0.33950	1.709000	0.37909	0.375000	0.24679	0.555000	0.69702	AAG		0.507	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	Missense_Mutation	6	121	1	0	3.59834e-05	0.001168	4.37937e-05	6	121				
CEP350	9857	broad.mit.edu	37	1	180062865	180062865	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr1:180062865A>G	ENST00000367607.3	+	34	8043	c.7625A>G	c.(7624-7626)tAt>tGt	p.Y2542C	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2542	CAP-Gly. {ECO:0000255|PROSITE- ProRule:PRU00045}.				microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.Y2542C(2)		central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						AATGGAACATATGATGGTATT	0.373																																							uc001gnt.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)	4						c.(7624-7626)TAT>TGT		centrosome-associated protein 350							85.0	95.0	91.0					1																	180062865		2203	4299	6502	SO:0001583	missense	9857					centrosome|nucleus|spindle		g.chr1:180062865A>G	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.7625A>G	1.37:g.180062865A>G	ENSP00000356579:p.Tyr2542Cys					CEP350_uc009wxl.2_Missense_Mutation_p.Y2541C|CEP350_uc001gnv.2_Missense_Mutation_p.Y677C|CEP350_uc001gnw.1_Missense_Mutation_p.Y299C|CEP350_uc001gnx.1_Missense_Mutation_p.Y299C	p.Y2542C	NM_014810	NP_055625	Q5VT06	CE350_HUMAN			34	8008	+			2542			CAP-Gly.		O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	c.7625A>G	CCDS1336.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.74|17.74	3.464853|3.464853	0.63513|0.63513	.|.	.|.	ENSG00000135837|ENSG00000135837	ENST00000429851|ENST00000367607;ENST00000417046	.|D;D	.|0.91521	.|-2.86;-2.86	5.72|5.72	5.72|5.72	0.89469|0.89469	.|Cytoskeleton-associated protein, Gly-rich domain (4);Cytoskeleton-associated protein, Gly-rich conserved site (1);	.|0.000000	.|0.44483	.|D	.|0.000451	D|D	0.95297|0.95297	0.8474|0.8474	M|M	0.79926|0.79926	2.475|2.475	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.87578	.|0.998;0.998	D|D	0.95284|0.95284	0.8389|0.8389	5|9	.|.	.|.	.|.	.|.	15.9769|15.9769	0.80076|0.80076	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|2542;2542	.|E7EU22;Q5VT06	.|.;CE350_HUMAN	M|C	716|2542;6	.|ENSP00000356579:Y2542C;ENSP00000401608:Y6C	.|.	I|Y	+|+	3|2	3|0	CEP350|CEP350	178329488|178329488	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	8.925000|8.925000	0.92832|0.92832	2.169000|2.169000	0.68431|0.68431	0.533000|0.533000	0.62120|0.62120	ATA|TAT		0.373	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810		9	105	0	0	0	0.006214	0	9	105				
TMEM63A	9725	broad.mit.edu	37	1	226048664	226048664	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr1:226048664C>G	ENST00000366835.3	-	14	1389	c.1119G>C	c.(1117-1119)caG>caC	p.Q373H	TMEM63A_ENST00000537914.1_Missense_Mutation_p.Q47H|TMEM63A_ENST00000474478.1_5'UTR	NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A	373					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)	p.Q373H(1)		breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					ACTGAAGGCTCTGACACTTGC	0.537																																							uc001hpm.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(1117-1119)CAG>CAC		transmembrane protein 63A							154.0	143.0	147.0					1																	226048664		2203	4300	6503	SO:0001583	missense	9725					integral to membrane|lysosomal membrane	nucleotide binding	g.chr1:226048664C>G		CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.1119G>C	1.37:g.226048664C>G	ENSP00000355800:p.Gln373His						p.Q373H	NM_014698	NP_055513	O94886	TM63A_HUMAN			14	1369	-	Breast(184;0.197)		373					Q53GI7|Q5TE96|Q8N2U2	Missense_Mutation	SNP	ENST00000366835.3	37	c.1119G>C	CCDS31042.1	.	.	.	.	.	.	.	.	.	.	C	11.50	1.657952	0.29425	.	.	ENSG00000196187	ENST00000366835;ENST00000537914	T	0.19250	2.16	5.77	3.91	0.45181	Domain of unknown function DUF221 (1);Nucleotide-binding, alpha-beta plait (1);	0.209794	0.49305	D	0.000153	T	0.12050	0.0293	N	0.20685	0.6	0.30667	N	0.753838	B	0.23249	0.082	B	0.30572	0.117	T	0.19353	-1.0308	10	0.14656	T	0.56	-30.8396	6.0806	0.19938	0.0:0.6481:0.1404:0.2114	.	373	O94886	TM63A_HUMAN	H	373;47	ENSP00000355800:Q373H	ENSP00000355800:Q373H	Q	-	3	2	TMEM63A	224115287	0.981000	0.34729	1.000000	0.80357	0.580000	0.36256	0.581000	0.23819	1.446000	0.47643	-0.258000	0.10820	CAG		0.537	TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091154.2	NM_014698		6	117	0	0	0	0.004482	0	6	117				
LYST	1130	broad.mit.edu	37	1	235850271	235850271	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr1:235850271G>T	ENST00000389794.3	-	48	10952	c.10778C>A	c.(10777-10779)aCa>aAa	p.T3593K	LYST_ENST00000473037.1_5'UTR|LYST_ENST00000389793.2_Missense_Mutation_p.T3593K			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3593					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.T3593K(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AAATCTGTTTGTGTAGGCTGT	0.453																																							uc001hxj.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|breast(4)|central_nervous_system(2)	12						c.(10777-10779)ACA>AAA		lysosomal trafficking regulator							159.0	146.0	150.0					1																	235850271		2203	4300	6503	SO:0001583	missense	1130	Chediak-Higashsyndrome			defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding	g.chr1:235850271G>T	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.10778C>A	1.37:g.235850271G>T	ENSP00000374444:p.Thr3593Lys					LYST_uc001hxi.2_Missense_Mutation_p.T817K	p.T3593K	NM_000081	NP_000072	Q99698	LYST_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000674)		48	10953	-	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	3593			WD 3.		O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	c.10778C>A	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	G	10.25	1.297436	0.23650	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.27402	1.67;1.67	5.84	4.74	0.60224	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.528653	0.23712	N	0.045312	T	0.12475	0.0303	N	0.11427	0.14	0.80722	D	1	B	0.18968	0.032	B	0.18263	0.021	T	0.16897	-1.0387	10	0.05620	T	0.96	.	6.7596	0.23532	0.2433:0.0:0.7567:0.0	.	3593	Q99698	LYST_HUMAN	K	3593	ENSP00000374444:T3593K;ENSP00000374443:T3593K	ENSP00000374443:T3593K	T	-	2	0	LYST	233916894	0.964000	0.33143	0.341000	0.25589	0.976000	0.68499	3.821000	0.55700	2.764000	0.94973	0.655000	0.94253	ACA		0.453	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5			10	104	1	0	0.000978159	0.010729	0.00111283	10	104				
AKR1C1	1645	broad.mit.edu	37	10	5014469	5014469	+	Missense_Mutation	SNP	A	A	G	rs376003429		TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr10:5014469A>G	ENST00000380872.4	+	6	839	c.647A>G	c.(646-648)tAt>tGt	p.Y216C	AKR1C1_ENST00000477661.1_3'UTR|AKR1C1_ENST00000434459.2_Missense_Mutation_p.Y216C	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	216					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)	p.Y216C(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	CTGGTTGCCTATAGTGCTCTG	0.408																																					Colon(130;2054 2316 13360 15380)	Colon(130;2054 2316 13360 15380)	uc001iho.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(646-648)TAT>TGT		aldo-keto reductase family 1, member C1	NADH(DB00157)	A	CYS/TYR	0,4406		0,0,2203	79.0	77.0	78.0		647	1.8	0.0	10		78	1,8599	1.2+/-3.3	0,1,4299	no	missense	AKR1C1	NM_001353.5	194	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077		216/324	5014469	1,13005	2203	4300	6503	SO:0001583	missense	1645				bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity	g.chr10:5014469A>G	D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.647A>G	10.37:g.5014469A>G	ENSP00000370254:p.Tyr216Cys					AKR1E2_uc001ihl.1_Intron|AKR1C2_uc010qan.1_Intron|AKR1C3_uc001ihr.2_Intron|AKR1C1_uc001ihq.2_Missense_Mutation_p.Y216C	p.Y216C	NM_001353	NP_001344	Q04828	AK1C1_HUMAN			11	1488	+			216					P52896|Q5SR15|Q7M4N2|Q9UCX2	Missense_Mutation	SNP	ENST00000380872.4	37	c.647A>G	CCDS7061.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.42|10.42	1.346142|1.346142	0.24426|0.24426	0.0|0.0	1.16E-4|1.16E-4	ENSG00000187134|ENSG00000187134	ENST00000442997|ENST00000434459;ENST00000380872	.|T;T	.|0.57752	.|0.38;0.38	1.8|1.8	1.8|1.8	0.24995|0.24995	.|NADP-dependent oxidoreductase domain (3);	.|0.105638	.|0.41194	.|D	.|0.000925	T|T	0.76765|0.76765	0.4033|0.4033	H|H	0.96489|0.96489	3.83|3.83	0.34790|0.34790	D|D	0.735614|0.735614	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	T|T	0.82649|0.82649	-0.0353|-0.0353	5|10	.|0.87932	.|D	.|0	.|.	7.5859|7.5859	0.27993|0.27993	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|216	.|Q04828	.|AK1C1_HUMAN	V|C	183|216	.|ENSP00000412248:Y216C;ENSP00000370254:Y216C	.|ENSP00000370254:Y216C	I|Y	+|+	1|2	0|0	AKR1C1|AKR1C1	5004469|5004469	0.841000|0.841000	0.29509|0.29509	0.029000|0.029000	0.17559|0.17559	0.263000|0.263000	0.26337|0.26337	2.278000|2.278000	0.43426|0.43426	1.080000|1.080000	0.41073|0.41073	0.254000|0.254000	0.18369|0.18369	ATA|TAT		0.408	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046523.2	NM_001353		6	68	0	0	0	0.004482	0	6	68				
SH3PXD2A	9644	broad.mit.edu	37	10	105363225	105363226	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr10:105363225_105363226TC>AA	ENST00000369774.4	-	15	2025_2026	c.1749_1750GA>TT	c.(1747-1752)gaGAgg>gaTTgg	p.583_584ER>DW	SH3PXD2A_ENST00000540321.1_Missense_Mutation_p.450_451ER>DW|SH3PXD2A_ENST00000538130.1_Missense_Mutation_p.418_419ER>DW|SH3PXD2A_ENST00000315994.6_5'UTR|SH3PXD2A_ENST00000355946.2_Missense_Mutation_p.555_556ER>DW|SH3PXD2A_ENST00000427662.2_Intron			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	583					superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)	p.E555_R556>DW(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		GCAGGCCGCCTCTCCCCTGAGG	0.639																																							uc001kxj.1		NA																	1	Complex - compound substitution(1)		lung(1)		0						c.(1663-1668)GAGAGG>GATTGG		SH3 multiple domains 1																																				SO:0001583	missense	9644				cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding	g.chr10:105363225_105363226TC>AA	AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.1749_1750delinsAA	10.37:g.105363225_105363226delinsAA	ENSP00000358789:p.E583_R584delinsDW					SH3PXD2A_uc010qqr.1_Intron|SH3PXD2A_uc010qqs.1_Missense_Mutation_p.390_391ER>DW|SH3PXD2A_uc010qqt.1_Missense_Mutation_p.432_433ER>DW|SH3PXD2A_uc009xxn.1_Missense_Mutation_p.390_391ER>DW|SH3PXD2A_uc010qqu.1_Missense_Mutation_p.498_499ER>DW	p.555_556ER>DW	NM_014631	NP_055446	Q5TCZ1	SPD2A_HUMAN		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)	14	1805_1806	-		Colorectal(252;0.0815)|Breast(234;0.131)	583_584					D3DR98|O43302|Q5TCZ2|Q5TDQ8	Missense_Mutation	DNP	ENST00000369774.4	37	c.1665_1666GA>TT																																																																																					0.639	SH3PXD2A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050178.1	NM_014631		5	63	0	0	0	0.004672	0	5	63				
KCNK18	338567	broad.mit.edu	37	10	118969399	118969399	+	Silent	SNP	G	G	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr10:118969399G>A	ENST00000334549.1	+	3	744	c.744G>A	c.(742-744)gaG>gaA	p.E248E		NM_181840.1	NP_862823.1	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	248					cellular response to pH (GO:0071467)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)	p.E248E(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	41		Colorectal(252;0.19)		all cancers(201;0.0211)		AAGCCATGGAGAGGAGTAACT	0.532																																							uc010qsr.1		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(742-744)GAG>GAA		potassium channel, subfamily K, member 18							137.0	125.0	129.0					10																	118969399		2203	4300	6503	SO:0001819	synonymous_variant	338567					integral to membrane|plasma membrane		g.chr10:118969399G>A	AB087138	CCDS7598.1	10q26.11	2012-03-07			ENSG00000186795	ENSG00000186795		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	19439	protein-coding gene	gene with protein product	"""TWIK related spinal cord K+ channel"""	613655				16382106	Standard	NM_181840		Approved	K2p18.1, TRESK-2, TRESK2, TRESK, TRIK	uc010qsr.2	Q7Z418	OTTHUMG00000019120	ENST00000334549.1:c.744G>A	10.37:g.118969399G>A							p.E248E	NM_181840	NP_862823	Q7Z418	KCNKI_HUMAN		all cancers(201;0.0211)	3	744	+		Colorectal(252;0.19)	248			Cytoplasmic (Potential).		Q5SQQ8	Silent	SNP	ENST00000334549.1	37	c.744G>A	CCDS7598.1																																																																																				0.532	KCNK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050562.2	NM_181840		4	75	0	0	0	0.009096	0	4	75				
OR4C3	256144	broad.mit.edu	37	11	48347118	48347118	+	Missense_Mutation	SNP	T	T	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr11:48347118T>G	ENST00000319856.4	+	1	647	c.626T>G	c.(625-627)tTg>tGg	p.L209W		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L209W(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						TTGTACCCTTTGCTGGAAGTT	0.522																																							uc010rhv.1		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(625-627)TTG>TGG		olfactory receptor, family 4, subfamily C,							213.0	168.0	183.0					11																	48347118		2201	4298	6499	SO:0001583	missense	256144				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:48347118T>G	AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.626T>G	11.37:g.48347118T>G	ENSP00000321419:p.Leu209Trp						p.L209W	NM_001004702	NP_001004702	Q8NH37	OR4C3_HUMAN			1	626	+			182			Extracellular (Potential).		B2RNF2|Q6IFB3	Missense_Mutation	SNP	ENST00000319856.4	37	c.626T>G	CCDS31489.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.079626	0.76528	.	.	ENSG00000176547	ENST00000319856;ENST00000395239	T	0.00245	8.45	5.78	5.78	0.91487	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38058	N	0.001840	T	0.00967	0.0032	H	0.96301	3.8	0.33399	D	0.57706	D	0.89917	1.0	D	0.91635	0.999	T	0.11108	-1.0601	10	0.87932	D	0	.	14.2031	0.65716	0.0:0.0:0.0:1.0	.	182	Q8NH37	OR4C3_HUMAN	W	209;72	ENSP00000321419:L209W	ENSP00000321419:L209W	L	+	2	0	OR4C3	48303694	0.749000	0.28305	1.000000	0.80357	0.980000	0.70556	4.880000	0.63107	2.245000	0.73994	0.391000	0.25812	TTG		0.522	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390557.1	NM_001004702		9	53	0	0	0	0.010729	0	9	53				
PPP1R32	220004	broad.mit.edu	37	11	61257979	61257980	+	Missense_Mutation	DNP	GA	GA	TG			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr11:61257979_61257980GA>TG	ENST00000338608.2	+	13	1340_1341	c.1215_1216GA>TG	c.(1213-1218)ctGAcc>ctTGcc	p.T406A	PPP1R32_ENST00000366212.4_Missense_Mutation_p.T36A|PPP1R32_ENST00000432063.2_Missense_Mutation_p.T386A|PPP1R32_ENST00000538185.1_Missense_Mutation_p.T83A	NM_145017.2	NP_659454.2	Q7Z5V6	PPR32_HUMAN	protein phosphatase 1, regulatory subunit 32	406							phosphatase binding (GO:0019902)	p.T406A(1)									GCAGAACCCTGACCTCAGCTGA	0.614																																							uc001nru.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1213-1218)CTGACC>CTTGCC		IIIG9 protein																																				SO:0001583	missense	220004							g.chr11:61257979_61257980GA>TG	AK057333	CCDS8008.1, CCDS53641.1	11q12.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000162148	ENSG00000162148		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28869	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 66"""	C11orf66		12477932	Standard	NM_145017		Approved	IIIG9, FLJ32771	uc001nru.2	Q7Z5V6	OTTHUMG00000168176	Exception_encountered	11.37:g.61257979_61257980delinsTG	ENSP00000344140:p.Thr406Ala					C11orf66_uc009ynq.1_Missense_Mutation_p.T386A	p.T406A	NM_145017	NP_659454	Q7Z5V6	CK066_HUMAN			13	1340_1341	+			406					Q4G0P4|Q96M77	Missense_Mutation	DNP	ENST00000338608.2	37	c.1215_1216GA>TG	CCDS8008.1																																																																																				0.614	PPP1R32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398621.1	NM_145017		5	138	0	0	0	0.004672	0	5	138				
VPS51	738	broad.mit.edu	37	11	64878173	64878173	+	Missense_Mutation	SNP	A	A	C			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr11:64878173A>C	ENST00000279281.3	+	9	2100	c.2008A>C	c.(2008-2010)Atg>Ctg	p.M670L	AP003068.9_ENST00000528887.1_RNA|VPS51_ENST00000527646.1_3'UTR|TM7SF2_ENST00000279263.7_5'Flank|TM7SF2_ENST00000345348.5_5'Flank|TM7SF2_ENST00000540748.1_5'Flank	NM_013265.2	NP_037397.2	Q9UID3	VPS51_HUMAN	vacuolar protein sorting 51 homolog (S. cerevisiae)	670					autophagy (GO:0006914)|lipid transport (GO:0006869)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.M670L(1)									CAGTGCCCCGATGGACACCAA	0.562											OREG0021071	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001ocr.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(2008-2010)ATG>CTG		chromosome 11 open reading frame 2							157.0	151.0	153.0					11																	64878173		2201	4297	6498	SO:0001583	missense	738				lipid transport|protein transport	Golgi apparatus|integral to membrane		g.chr11:64878173A>C	AF024631	CCDS8093.1	11q13.1	2012-07-19	2012-07-19	2012-07-19	ENSG00000149823	ENSG00000149823			1172	protein-coding gene	gene with protein product	"""fat-free homolog (zebrafish)"""	615738	"""chromosome 11 open reading frame 3"", ""chromosome 11 open reading frame 2"""	C11orf3, C11orf2		9286704, 20685960	Standard	NM_013265		Approved	ANG2, ANG3, FFR	uc001ocr.2	Q9UID3	OTTHUMG00000165600	ENST00000279281.3:c.2008A>C	11.37:g.64878173A>C	ENSP00000279281:p.Met670Leu		OREG0021071	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1079	TM7SF2_uc001oct.2_5'Flank|TM7SF2_uc010rny.1_5'Flank|TM7SF2_uc001ocu.2_5'Flank|TM7SF2_uc001ocv.2_5'Flank|C11orf2_uc001ocs.1_Missense_Mutation_p.M546L	p.M670L	NM_013265	NP_037397	Q9UID3	FFR_HUMAN			9	2048	+			670					Q6PJV5|Q7L8A6|Q8WZ35|Q96DF4|Q96GR3	Missense_Mutation	SNP	ENST00000279281.3	37	c.2008A>C	CCDS8093.1	.	.	.	.	.	.	.	.	.	.	A	14.73	2.622726	0.46840	.	.	ENSG00000149823	ENST00000279281;ENST00000530673	.	.	.	5.09	5.09	0.68999	.	0.038459	0.85682	D	0.000000	T	0.44414	0.1292	L	0.36672	1.1	0.80722	D	1	B	0.15719	0.014	B	0.14023	0.01	T	0.32693	-0.9897	9	0.09843	T	0.71	-23.7722	12.8575	0.57894	1.0:0.0:0.0:0.0	.	670	Q9UID3	FFR_HUMAN	L	670;44	.	ENSP00000279281:M670L	M	+	1	0	C11orf2	64634749	0.996000	0.38824	0.925000	0.36789	0.949000	0.60115	3.442000	0.52900	2.142000	0.66516	0.459000	0.35465	ATG		0.562	VPS51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385217.1	NM_013265		17	137	0	0	0	0.004007	0	17	137				
C2CD3	26005	broad.mit.edu	37	11	73849825	73849825	+	Missense_Mutation	SNP	T	T	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr11:73849825T>A	ENST00000334126.7	-	5	1121	c.895A>T	c.(895-897)Agt>Tgt	p.S299C	C2CD3_ENST00000539061.1_Missense_Mutation_p.S299C|C2CD3_ENST00000313663.7_Missense_Mutation_p.S299C			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	299					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)		p.S299C(2)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					TCACTGTGACTCTTGGCAACT	0.428																																							uc001ouu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|pancreas(2)|skin(1)	7						c.(895-897)AGT>TGT		C2 calcium-dependent domain containing 3							149.0	133.0	139.0					11																	73849825		2200	4293	6493	SO:0001583	missense	26005					centrosome		g.chr11:73849825T>A	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.895A>T	11.37:g.73849825T>A	ENSP00000334379:p.Ser299Cys					C2CD3_uc001ouv.2_Missense_Mutation_p.S299C	p.S299C	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN			5	1122	-	Breast(11;4.16e-06)		299					C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	37	c.895A>T		.	.	.	.	.	.	.	.	.	.	T	18.56	3.651363	0.67472	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681;ENST00000289350;ENST00000539061	T;T	0.11385	2.78;2.81	5.99	5.99	0.97316	.	0.081614	0.53938	D	0.000055	T	0.30792	0.0776	M	0.67953	2.075	0.38849	D	0.956222	D;D	0.89917	1.0;1.0	D;D	0.71656	0.947;0.974	T	0.03981	-1.0987	10	0.66056	D	0.02	-12.3384	14.0124	0.64505	0.0:0.0:0.0:1.0	.	299;299	Q4AC94;Q4AC94-1	C2CD3_HUMAN;.	C	299	ENSP00000334379:S299C;ENSP00000323339:S299C	ENSP00000289350:S299C	S	-	1	0	C2CD3	73527473	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.020000	0.49643	2.296000	0.77279	0.533000	0.62120	AGT		0.428	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531		7	85	0	0	0	0.006214	0	7	85				
EED	8726	broad.mit.edu	37	11	85961365	85961365	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr11:85961365A>G	ENST00000263360.6	+	2	828	c.142A>G	c.(142-144)Aca>Gca	p.T48A	EED_ENST00000351625.6_Missense_Mutation_p.T48A|EED_ENST00000327320.4_Missense_Mutation_p.T48A|EED_ENST00000528180.1_Missense_Mutation_p.T48A	NM_003797.3	NP_003788.2	O75530	EED_HUMAN	embryonic ectoderm development	48					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K27 methylation (GO:0061087)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|identical protein binding (GO:0042802)	p.T48A(1)		haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	21		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				AGAAAGTGGTACAAACACTGA	0.393																																							uc001pbp.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)|pancreas(1)	2						c.(142-144)ACA>GCA		embryonic ectoderm development isoform a							108.0	95.0	99.0					11																	85961365		2203	4299	6502	SO:0001583	missense	8726				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|identical protein binding	g.chr11:85961365A>G	AF078933	CCDS8273.1, CCDS8274.1	11q14.2-q22.3	2013-01-10			ENSG00000074266	ENSG00000074266		"""WD repeat domain containing"""	3188	protein-coding gene	gene with protein product	"""WD protein associating with integrin cytoplasmic tails 1"""	605984				9765275, 9806832	Standard	NM_003797		Approved	WAIT-1, HEED	uc001pbp.3	O75530	OTTHUMG00000167209	ENST00000263360.6:c.142A>G	11.37:g.85961365A>G	ENSP00000263360:p.Thr48Ala					EED_uc010rtm.1_Missense_Mutation_p.T48A|EED_uc001pbq.2_Missense_Mutation_p.T48A|EED_uc001pbr.2_Missense_Mutation_p.T48A|EED_uc001pbs.2_Missense_Mutation_p.T48A	p.T48A	NM_003797	NP_003788	O75530	EED_HUMAN			2	599	+		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)	48					A8K7V5|O00149|Q6NTH2|Q7LDA5|Q7LDG8|Q86VV2|Q9UNY7	Missense_Mutation	SNP	ENST00000263360.6	37	c.142A>G	CCDS8273.1	.	.	.	.	.	.	.	.	.	.	A	10.69	1.421383	0.25639	.	.	ENSG00000074266	ENST00000263360;ENST00000528180;ENST00000351625;ENST00000327320;ENST00000537092	T;T;T;T	0.79940	-0.82;-1.32;-0.74;-0.75	4.6	3.39	0.38822	.	0.109289	0.64402	D	0.000011	T	0.69033	0.3066	L	0.34521	1.04	0.80722	D	1	B;B;B;B	0.06786	0.0;0.001;0.0;0.001	B;B;B;B	0.06405	0.001;0.002;0.001;0.0	T	0.63418	-0.6642	9	.	.	.	-10.7182	12.4127	0.55476	0.8495:0.1505:0.0:0.0	.	48;48;48;48	O75530-3;E9PJK2;O75530-2;O75530	.;.;.;EED_HUMAN	A	48	ENSP00000263360:T48A;ENSP00000431778:T48A;ENSP00000338186:T48A;ENSP00000315587:T48A	.	T	+	1	0	EED	85639013	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.129000	0.71657	1.699000	0.51192	0.477000	0.44152	ACA		0.393	EED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393733.1	NM_003797		4	47	0	0	0	0.009096	0	4	47				
KDM5A	5927	broad.mit.edu	37	12	463298	463298	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr12:463298G>A	ENST00000399788.2	-	8	1335	c.973C>T	c.(973-975)Cct>Tct	p.P325S	KDM5A_ENST00000382815.4_Missense_Mutation_p.P325S	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	325					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.P325S(2)		NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						GGTAGTGGAGGAATTAGACAA	0.393			T	NUP98	AML																																		uc001qif.1		NA		Dom	yes		12	12p11	5927	T 	"""lysine (K)-specific demethylase 5A, JARID1A"""			L	NUP98		AML		2	Substitution - Missense(2)		lung(2)	skin(2)|ovary(1)	3						c.(973-975)CCT>TCT		retinoblastoma binding protein 2 isoform 1							142.0	138.0	139.0					12																	463298		1935	4140	6075	SO:0001583	missense	5927				chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr12:463298G>A		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.973C>T	12.37:g.463298G>A	ENSP00000382688:p.Pro325Ser					KDM5A_uc001qie.1_Missense_Mutation_p.P325S|KDM5A_uc010sdn.1_Missense_Mutation_p.P284S|KDM5A_uc010sdo.1_Intron	p.P325S	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN			8	1336	-			325			PHD-type 1.		A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	ENST00000399788.2	37	c.973C>T	CCDS41736.1	.	.	.	.	.	.	.	.	.	.	G	31	5.073018	0.93950	.	.	ENSG00000073614	ENST00000399787;ENST00000399788;ENST00000382815	D;D	0.89485	-2.52;-2.52	5.1	5.1	0.69264	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.96402	0.8826	H	0.95402	3.665	0.80722	D	1	D;D;D	0.89917	0.997;0.999;1.0	D;D;D	0.97110	0.985;0.993;1.0	D	0.97527	1.0077	10	0.87932	D	0	-9.9422	18.8719	0.92319	0.0:0.0:1.0:0.0	.	325;325;325	F5H1F7;P29375;P29375-2	.;KDM5A_HUMAN;.	S	284;325;325	ENSP00000382688:P325S;ENSP00000372265:P325S	ENSP00000372265:P325S	P	-	1	0	KDM5A	333559	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.751000	0.98889	2.530000	0.85305	0.467000	0.42956	CCT		0.393	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1	NM_005056		6	53	0	0	0	0.001168	0	6	53				
PZP	5858	broad.mit.edu	37	12	9346702	9346702	+	Missense_Mutation	SNP	T	T	A	rs144906712		TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr12:9346702T>A	ENST00000261336.2	-	11	1253	c.1225A>T	c.(1225-1227)Agt>Tgt	p.S409C	PZP_ENST00000381997.2_Missense_Mutation_p.S278C	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	409					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.S278C(1)|p.S409C(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						ACCGAGATACTGGTAGTATTG	0.378																																					Melanoma(125;1402 1695 4685 34487 38571)	Melanoma(125;1402 1695 4685 34487 38571)	uc001qvl.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						c.(1225-1227)AGT>TGT		pregnancy-zone protein precursor							138.0	137.0	137.0					12																	9346702		2203	4300	6503	SO:0001583	missense	5858							g.chr12:9346702T>A	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.1225A>T	12.37:g.9346702T>A	ENSP00000261336:p.Ser409Cys					PZP_uc009zgl.2_Missense_Mutation_p.S278C	p.S409C	NM_002864	NP_002855					11	1254	-								A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	c.1225A>T	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	T	6.625	0.483805	0.12581	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.35789	1.49;1.29	3.53	1.06	0.20224	.	0.264710	0.24424	U	0.038657	T	0.32882	0.0844	L	0.28400	0.85	0.09310	N	1	D;B	0.58620	0.983;0.001	P;B	0.54346	0.749;0.003	T	0.14924	-1.0455	10	0.56958	D	0.05	.	5.64	0.17559	0.0:0.1087:0.1736:0.7177	.	278;409	P20742-2;P20742	.;PZP_HUMAN	C	409;278	ENSP00000261336:S409C;ENSP00000371427:S278C	ENSP00000261336:S409C	S	-	1	0	PZP	9237969	0.014000	0.17966	0.000000	0.03702	0.000000	0.00434	1.393000	0.34497	-0.191000	0.10448	-1.871000	0.00553	AGT		0.378	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864		10	87	0	0	0	0.006214	0	10	87				
KLRK1	22914	broad.mit.edu	37	12	10525829	10525829	+	Splice_Site	SNP	G	G	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr12:10525829G>T	ENST00000240618.6	-	8	675	c.535C>A	c.(535-537)Cta>Ata	p.L179I	RP11-277P12.20_ENST00000500682.1_RNA|KLRK1_ENST00000540818.1_Splice_Site_p.L179I|KLRC4-KLRK1_ENST00000539300.1_3'UTR	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	179	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.L179I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						ATTATTGTTAGTCTAGAGGAG	0.333																																							uc009zhj.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(535-537)CTA>ATA		NKG2-D type II integral membrane protein							120.0	111.0	114.0					12																	10525829		2203	4300	6503	SO:0001630	splice_region_variant	22914				natural killer cell activation|T cell costimulation	integral to plasma membrane	sugar binding	g.chr12:10525829G>T	AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.534-1C>A	12.37:g.10525829G>T						uc001qya.1_Intron|KLRK1_uc001qyb.2_RNA|KLRK1_uc001qyc.2_Missense_Mutation_p.L179I|KLRK1_uc009zhk.2_Missense_Mutation_p.L179I|KLRK1_uc001qyd.2_Missense_Mutation_p.L179I	p.L179I	NM_007360	NP_031386	P26718	NKG2D_HUMAN			8	699	-			179			Extracellular (Potential).|C-type lectin.		A8K7K5|A8K7P4|Q9NR41	Missense_Mutation	SNP	ENST00000240618.6	37	c.535C>A	CCDS8623.1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631191	0.28978	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	T;T	0.30182	1.54;1.54	5.59	-0.785	0.10950	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.625259	0.14109	N	0.340875	T	0.22781	0.0550	L	0.55017	1.72	0.23602	N	0.997312	B	0.33103	0.397	B	0.37015	0.239	T	0.18808	-1.0325	10	0.29301	T	0.29	.	0.889	0.01250	0.3627:0.1547:0.3239:0.1587	.	179	P26718	NKG2D_HUMAN	I	179	ENSP00000240618:L179I;ENSP00000446003:L179I	ENSP00000240618:L179I	L	-	1	2	KLRK1	10417096	0.391000	0.25221	0.932000	0.37286	0.650000	0.38633	-0.871000	0.04223	-0.200000	0.10300	0.650000	0.86243	CTA		0.333	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400269.1	NM_007360	Missense_Mutation	13	91	1	0	1.36491e-13	0.001855	1.89638e-13	13	91				
CCNT1	904	broad.mit.edu	37	12	49088166	49088166	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr12:49088166C>A	ENST00000261900.3	-	9	1053	c.831G>T	c.(829-831)aaG>aaT	p.K277N		NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1	277					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)	p.K277N(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						GCTCTGAAGTCTTTTCATCTG	0.418																																							uc001rse.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|lung(1)|breast(1)|skin(1)	6						c.(829-831)AAG>AAT		cyclin T1							160.0	144.0	150.0					12																	49088166		2203	4300	6503	SO:0001583	missense	904				cell cycle|cell division|interspecies interaction between organisms|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	DNA binding|protein kinase binding	g.chr12:49088166C>A	AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.831G>T	12.37:g.49088166C>A	ENSP00000261900:p.Lys277Asn					LOC144438_uc001rsd.3_5'Flank|CCNT1_uc009zkz.1_5'UTR	p.K277N	NM_001240	NP_001231	O60563	CCNT1_HUMAN			9	1154	-			277					A9XU13|E7EX76|O60581	Missense_Mutation	SNP	ENST00000261900.3	37	c.831G>T	CCDS8766.1	.	.	.	.	.	.	.	.	.	.	C	0.311	-0.967863	0.02232	.	.	ENSG00000129315	ENST00000261900	T	0.17213	2.29	5.33	1.48	0.22813	.	0.318694	0.35040	N	0.003496	T	0.05593	0.0147	N	0.03608	-0.345	0.19575	N	0.999963	B	0.02656	0.0	B	0.04013	0.001	T	0.42050	-0.9474	10	0.11485	T	0.65	-6.3678	6.5308	0.22326	0.2267:0.1333:0.64:0.0	.	277	O60563	CCNT1_HUMAN	N	277	ENSP00000261900:K277N	ENSP00000261900:K277N	K	-	3	2	CCNT1	47374433	1.000000	0.71417	0.994000	0.49952	0.630000	0.37929	1.731000	0.38135	0.013000	0.14918	-1.362000	0.01212	AAG		0.418	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408853.1	NM_001240		10	137	1	0	0.00829132	0.008291	0.00916716	10	137				
KRT6C	286887	broad.mit.edu	37	12	52862852	52862852	+	Silent	SNP	C	C	T	rs143211712		TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr12:52862852C>T	ENST00000252250.6	-	9	1736	c.1689G>A	c.(1687-1689)aaG>aaA	p.K563K		NM_173086.4	NP_775109.2	P48668	K2C6C_HUMAN	keratin 6C	563	Tail.				intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.K563K(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|prostate(2)|skin(2)	23				BRCA - Breast invasive adenocarcinoma(357;0.0828)		CACTTTAGTGCTTGTAGCTCT	0.607																																							uc001sal.3		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(1687-1689)AAG>AAA		keratin 6C		C		0,4406		0,0,2203	102.0	100.0	101.0		1689	3.6	1.0	12	dbSNP_134	101	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	KRT6C	NM_173086.4		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		563/565	52862852	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	286887				cytoskeleton organization	keratin filament	structural molecule activity	g.chr12:52862852C>T	L42611	CCDS8829.1	12q13.13	2013-01-16	2006-07-17	2006-07-17	ENSG00000170465	ENSG00000170465		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20406	protein-coding gene	gene with protein product		612315	"""keratin 6E"""	KRT6E		7543104, 16831889	Standard	NM_173086		Approved		uc001sal.4	P48668	OTTHUMG00000169596	ENST00000252250.6:c.1689G>A	12.37:g.52862852C>T							p.K563K	NM_173086	NP_775109	P48668	K2C6C_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.0828)	9	1737	-			563			Tail.		A1L4L5|P48666|Q2TAZ9|Q7RTN9	Silent	SNP	ENST00000252250.6	37	c.1689G>A	CCDS8829.1																																																																																				0.607	KRT6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404976.1	NM_173086		7	68	0	0	0	0.001984	0	7	68				
KRT76	51350	broad.mit.edu	37	12	53169354	53169354	+	Silent	SNP	C	C	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr12:53169354C>T	ENST00000332411.2	-	2	686	c.633G>A	c.(631-633)ctG>ctA	p.L211L		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	211	Coil 1A.|Rod.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.L211L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						ACTTGGTCTCCAGGACCTTGT	0.567																																							uc001sax.2		NA																	1	Substitution - coding silent(1)		lung(1)	breast(1)|skin(1)	2						c.(631-633)CTG>CTA		keratin 76							95.0	96.0	96.0					12																	53169354		2203	4300	6503	SO:0001819	synonymous_variant	51350				cytoskeleton organization	keratin filament	structural molecule activity	g.chr12:53169354C>T	M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.633G>A	12.37:g.53169354C>T							p.L211L	NM_015848	NP_056932	Q01546	K22O_HUMAN			2	687	-			211			Coil 1A.|Rod.		B4DRR3|Q7Z795	Silent	SNP	ENST00000332411.2	37	c.633G>A	CCDS8838.1																																																																																				0.567	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405928.1	NM_015848		8	129	0	0	0	0.004482	0	8	129				
POLR3B	55703	broad.mit.edu	37	12	106824084	106824084	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr12:106824084C>G	ENST00000228347.4	+	14	1519	c.1297C>G	c.(1297-1299)Cgc>Ggc	p.R433G	POLR3B_ENST00000539066.1_Missense_Mutation_p.R375G	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	433					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)	p.R433G(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						TAAAATGGACCGCCAGGGTGT	0.433																																							uc001tlp.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1297-1299)CGC>GGC		DNA-directed RNA polymerase III B isoform 1							105.0	113.0	110.0					12																	106824084		2203	4300	6503	SO:0001583	missense	55703				innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding	g.chr12:106824084C>G	AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.1297C>G	12.37:g.106824084C>G	ENSP00000228347:p.Arg433Gly					POLR3B_uc001tlq.2_Missense_Mutation_p.R375G	p.R433G	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN			14	1519	+			433					A8K6H0|B3KV73|F5H1E6|Q9NW59	Missense_Mutation	SNP	ENST00000228347.4	37	c.1297C>G	CCDS9105.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.961684	0.92791	.	.	ENSG00000013503	ENST00000228347;ENST00000551370;ENST00000539066	T;T	0.78246	-1.16;-1.16	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.93533	0.7936	H	0.99042	4.41	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	D	0.95751	0.8792	10	0.87932	D	0	-13.46	19.8449	0.96704	0.0:1.0:0.0:0.0	.	433	Q9NW08	RPC2_HUMAN	G	433;433;375	ENSP00000228347:R433G;ENSP00000445721:R375G	ENSP00000228347:R433G	R	+	1	0	POLR3B	105348214	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.615000	0.67702	2.680000	0.91292	0.655000	0.94253	CGC		0.433	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407166.1	NM_018082		28	163	0	0	0	0.005443	0	28	163				
TNFSF11	8600	broad.mit.edu	37	13	43180954	43180954	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr13:43180954C>T	ENST00000239849.6	+	5	1005	c.854C>T	c.(853-855)tCt>tTt	p.S285F	TNFSF11_ENST00000398795.2_Missense_Mutation_p.S212F|TNFSF11_ENST00000544862.1_Missense_Mutation_p.S212F|TNFSF11_ENST00000358545.2_Missense_Mutation_p.S212F|TNFSF11_ENST00000405262.2_Missense_Mutation_p.S212F			O14788	TNF11_HUMAN	tumor necrosis factor (ligand) superfamily, member 11	285					activation of JUN kinase activity (GO:0007257)|bone resorption (GO:0045453)|calcium ion homeostasis (GO:0055074)|cytokine-mediated signaling pathway (GO:0019221)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|monocyte chemotaxis (GO:0002548)|organ morphogenesis (GO:0009887)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of bone resorption (GO:0045780)|positive regulation of corticotropin-releasing hormone secretion (GO:0051466)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoclast development (GO:2001206)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	cytokine activity (GO:0005125)|tumor necrosis factor receptor binding (GO:0005164)|tumor necrosis factor receptor superfamily binding (GO:0032813)			kidney(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	10		Lung NSC(96;1.11e-05)|Breast(139;0.00868)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000249)|GBM - Glioblastoma multiforme(144;0.00119)|BRCA - Breast invasive adenocarcinoma(63;0.073)	Denosumab(DB06643)|Lenalidomide(DB00480)	AAGTTACGGTCTGGAGAGGAA	0.423																																							uc001uyu.2		NA																	0					0						c.(853-855)TCT>TTT		tumor necrosis factor ligand superfamily, member							94.0	95.0	95.0					13																	43180954		2203	4300	6503	SO:0001583	missense	8600				immune response|monocyte chemotaxis|osteoclast differentiation|positive regulation of bone resorption|positive regulation of corticotropin-releasing hormone secretion|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of homotypic cell-cell adhesion|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell activation	cytoplasm|extracellular space|integral to plasma membrane	cytokine activity|receptor activity|tumor necrosis factor receptor binding	g.chr13:43180954C>T	AF013171	CCDS9384.1, CCDS9385.1	13q14	2008-02-05			ENSG00000120659	ENSG00000120659		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11926	protein-coding gene	gene with protein product		602642				9312132, 9367155	Standard	NM_003701		Approved	TRANCE, RANKL, OPGL, ODF, CD254	uc001uyu.2	O14788	OTTHUMG00000016807	ENST00000239849.6:c.854C>T	13.37:g.43180954C>T	ENSP00000239849:p.Ser285Phe					TNFSF11_uc001uyt.2_Missense_Mutation_p.S212F	p.S285F	NM_003701	NP_003692	O14788	TNF11_HUMAN		OV - Ovarian serous cystadenocarcinoma(117;0.000249)|GBM - Glioblastoma multiforme(144;0.00119)|BRCA - Breast invasive adenocarcinoma(63;0.073)	5	1003	+		Lung NSC(96;1.11e-05)|Breast(139;0.00868)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)	285			Extracellular (Potential).		O14723|Q96Q17|Q9P2Q3	Missense_Mutation	SNP	ENST00000239849.6	37	c.854C>T	CCDS9384.1	.	.	.	.	.	.	.	.	.	.	C	13.90	2.376094	0.42105	.	.	ENSG00000120659	ENST00000358545;ENST00000405262;ENST00000239849;ENST00000398795;ENST00000544862	T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1	5.74	5.74	0.90152	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.320500	0.32503	N	0.006006	T	0.64918	0.2642	L	0.34521	1.04	0.39463	D	0.967607	P	0.44281	0.831	P	0.49252	0.604	T	0.67722	-0.5597	10	0.72032	D	0.01	-19.7585	20.2982	0.98569	0.0:1.0:0.0:0.0	.	285	O14788	TNF11_HUMAN	F	212;212;285;212;212	ENSP00000351347:S212F;ENSP00000384042:S212F;ENSP00000239849:S285F;ENSP00000381775:S212F;ENSP00000444913:S212F	ENSP00000239849:S285F	S	+	2	0	TNFSF11	42078954	0.997000	0.39634	0.986000	0.45419	0.130000	0.20726	3.754000	0.55189	2.873000	0.98535	0.563000	0.77884	TCT		0.423	TNFSF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044702.2			7	120	0	0	0	0.001984	0	7	120				
RB1	5925	broad.mit.edu	37	13	48941720	48941720	+	Nonsense_Mutation	SNP	C	C	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr13:48941720C>T	ENST00000267163.4	+	10	1168	c.1030C>T	c.(1030-1032)Cag>Tag	p.Q344*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	344					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(7)|p.Q344*(4)|p.D340fs*5(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TAAAACTCTTCAGACTGATTC	0.279		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													uc001vcb.2		6	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	D|Mis|N|F|S	retinoblastoma gene			"""L, E, M, O"""		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung		27	Whole gene deletion(15)|Unknown(7)|Substitution - Nonsense(4)|Deletion - Frameshift(1)	p.?(6)|p.D340fs*5(1)|p.Q344*(1)	bone(11)|breast(5)|lung(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|urinary_tract(1)	lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358	GRCh37	CM040260	RB1	M		c.(1030-1032)CAG>TAG		retinoblastoma 1	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						68.0	81.0	77.0					13																	48941720		2191	4287	6478	SO:0001587	stop_gained	5925	Hereditary_Retinoblastoma	Familial Cancer Database		androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	g.chr13:48941720C>T	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1030C>T	13.37:g.48941720C>T	ENSP00000267163:p.Gln344*	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)				RB1_uc010act.1_Nonsense_Mutation_p.Q45*	p.Q344*	NM_000321	NP_000312	P06400	RB_HUMAN		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	10	1196	+		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)	344					A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	ENST00000267163.4	37	c.1030C>T	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	C	37	6.534393	0.97646	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.43	4.59	0.56863	.	0.364801	0.29892	N	0.010936	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	8.9207	0.35610	0.1473:0.7769:0.0:0.0758	.	.	.	.	X	323;344	.	ENSP00000267163:Q344X	Q	+	1	0	RB1	47839721	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.697000	0.47060	1.272000	0.44329	0.591000	0.81541	CAG		0.279	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1			7	118	0	0	0	0.00308	0	7	118				
PCDH20	64881	broad.mit.edu	37	13	61987635	61987635	+	Silent	SNP	G	G	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr13:61987635G>A	ENST00000409186.1	-	5	2702	c.597C>T	c.(595-597)atC>atT	p.I199I	PCDH20_ENST00000409204.4_Silent_p.I199I			Q8N6Y1	PCD20_HUMAN	protocadherin 20	199	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.I199I(1)|p.I172I(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		TGATGTCTCTGATGGCGATCT	0.517																																							uc001vid.3		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(4)|breast(1)|central_nervous_system(1)	6						c.(595-597)ATC>ATT		protocadherin 20							109.0	92.0	98.0					13																	61987635		2203	4300	6503	SO:0001819	synonymous_variant	64881				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr13:61987635G>A	AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.597C>T	13.37:g.61987635G>A						PCDH20_uc010thj.1_Silent_p.I199I	p.I199I	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN		GBM - Glioblastoma multiforme(99;0.000118)	2	961	-		Breast(118;0.195)|Prostate(109;0.229)	172			Cadherin 1.|Extracellular (Potential).		A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Silent	SNP	ENST00000409186.1	37	c.597C>T	CCDS9442.2																																																																																				0.517	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2	NM_022843		8	77	0	0	0	0.00308	0	8	77				
OR10G2	26534	broad.mit.edu	37	14	22102425	22102425	+	Silent	SNP	G	G	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr14:22102425G>A	ENST00000542433.1	-	1	671	c.574C>T	c.(574-576)Ctg>Ttg	p.L192L		NM_001005466.1	NP_001005466.1	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G, member 2	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L192L(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(2)	22	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)		GCACAGGCCAGTCTCAATACT	0.527																																							uc010tmc.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(574-576)CTG>TTG		olfactory receptor, family 10, subfamily G,							88.0	96.0	93.0					14																	22102425		2203	4300	6503	SO:0001819	synonymous_variant	26534				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:22102425G>A		CCDS32047.1	14q11.2	2013-09-24			ENSG00000255582	ENSG00000255582		"""GPCR / Class A : Olfactory receptors"""	8170	protein-coding gene	gene with protein product						8188290	Standard	NM_001005466		Approved		uc010tmc.2	Q8NGC3	OTTHUMG00000168890	ENST00000542433.1:c.574C>T	14.37:g.22102425G>A							p.L192L	NM_001005466	NP_001005466	Q8NGC3	O10G2_HUMAN		GBM - Glioblastoma multiforme(265;0.0142)	1	574	-	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)	192			Extracellular (Potential).		B2RPD0	Silent	SNP	ENST00000542433.1	37	c.574C>T	CCDS32047.1																																																																																				0.527	OR10G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401525.1			15	99	0	0	0	0.00499	0	15	99				
SOS2	6655	broad.mit.edu	37	14	50667775	50667775	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr14:50667775G>A	ENST00000216373.5	-	3	515	c.241C>T	c.(241-243)Cca>Tca	p.P81S	SOS2_ENST00000543680.1_Missense_Mutation_p.P81S	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	81					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P81S(2)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					TTATCAATTGGGTGAGGAAAG	0.373																																							uc001wxs.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)	2						c.(241-243)CCA>TCA		son of sevenless homolog 2							143.0	132.0	135.0					14																	50667775		2203	4300	6503	SO:0001583	missense	6655				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity	g.chr14:50667775G>A	L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.241C>T	14.37:g.50667775G>A	ENSP00000216373:p.Pro81Ser					SOS2_uc010tql.1_Missense_Mutation_p.P81S	p.P81S	NM_006939	NP_008870	Q07890	SOS2_HUMAN			3	339	-	all_epithelial(31;0.000822)|Breast(41;0.0065)		81					B7ZKT6|D3DSB4|Q15503|Q17RN1	Missense_Mutation	SNP	ENST00000216373.5	37	c.241C>T	CCDS9697.1	.	.	.	.	.	.	.	.	.	.	G	31	5.071910	0.93950	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	D;D	0.83837	-1.77;-1.77	5.34	5.34	0.76211	Histone-fold (2);	0.000000	0.85682	D	0.000000	D	0.91740	0.7388	M	0.82716	2.605	0.80722	D	1	D;D	0.76494	0.999;0.995	D;D	0.69142	0.962;0.936	D	0.92447	0.5967	10	0.72032	D	0.01	.	19.4001	0.94625	0.0:0.0:1.0:0.0	.	81;81	B7ZKT6;Q07890	.;SOS2_HUMAN	S	81	ENSP00000216373:P81S;ENSP00000445328:P81S	ENSP00000216373:P81S	P	-	1	0	SOS2	49737525	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.797000	0.99108	2.658000	0.90341	0.563000	0.77884	CCA		0.373	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276878.2			8	100	0	0	0	0.00308	0	8	100				
HEATR4	399671	broad.mit.edu	37	14	73989316	73989316	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr14:73989316G>C	ENST00000553558.1	-	3	862	c.541C>G	c.(541-543)Cta>Gta	p.L181V	HEATR4_ENST00000560393.1_Missense_Mutation_p.L134V|RP3-414A15.11_ENST00000553394.1_RNA|HEATR4_ENST00000334988.2_Missense_Mutation_p.L181V|RP3-414A15.2_ENST00000555972.2_RNA	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4	181								p.L181V(1)|p.L134V(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		TTCACATCTAGAGAAGGTGGC	0.587																																							uc010tub.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(541-543)CTA>GTA		HEAT repeat containing 4							51.0	48.0	49.0					14																	73989316		2203	4300	6503	SO:0001583	missense	399671							g.chr14:73989316G>C	BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.541C>G	14.37:g.73989316G>C	ENSP00000450444:p.Leu181Val					HEATR4_uc010tua.1_Missense_Mutation_p.L134V	p.L181V	NM_203309	NP_976054				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)	3	863	-								B7Z7V9|E9KL41	Missense_Mutation	SNP	ENST00000553558.1	37	c.541C>G	CCDS9815.2	.	.	.	.	.	.	.	.	.	.	G	12.67	2.006194	0.35415	.	.	ENSG00000187105	ENST00000553558;ENST00000334988;ENST00000556455	T;T	0.42513	0.97;1.94	6.07	3.06	0.35304	.	0.667620	0.14491	N	0.316343	T	0.24699	0.0599	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.15896	-1.0421	10	0.33141	T	0.24	0.0864	9.0437	0.36333	0.0:0.1437:0.5588:0.2975	.	181	Q86WZ0	HEAT4_HUMAN	V	181;134;181	ENSP00000450444:L181V;ENSP00000335447:L134V	ENSP00000335447:L134V	L	-	1	2	HEATR4	73059069	0.016000	0.18221	0.393000	0.26258	0.232000	0.25224	0.834000	0.27518	0.832000	0.34804	0.655000	0.94253	CTA		0.587	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414422.2	NM_203309		7	27	0	0	0	0.001984	0	7	27				
TDP1	55775	broad.mit.edu	37	14	90430011	90430011	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr14:90430011A>G	ENST00000335725.4	+	3	803	c.553A>G	c.(553-555)Atc>Gtc	p.I185V	TDP1_ENST00000393454.2_Missense_Mutation_p.I185V|TDP1_ENST00000393452.3_Missense_Mutation_p.I185V|TDP1_ENST00000555880.1_Missense_Mutation_p.I185V|TDP1_ENST00000555565.1_Intron|TDP1_ENST00000357382.3_5'UTR	NM_018319.3	NP_060789.2	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1	185					cell death (GO:0008219)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	3'-tyrosyl-DNA phosphodiesterase activity (GO:0017005)|double-stranded DNA binding (GO:0003690)|exonuclease activity (GO:0004527)|single-stranded DNA binding (GO:0003697)	p.I185V(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|urinary_tract(1)	25		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		AGCCCTCCACATCAAGGGTAA	0.493								Repair of DNA-protein crosslinks																															uc001xxy.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(553-555)ATC>GTC	Repair_of_DNA-protein_crosslinks	tyrosyl-DNA phosphodiesterase 1							43.0	44.0	44.0					14																	90430011		2203	4300	6503	SO:0001583	missense	55775				cell death|double-strand break repair|single strand break repair	cytoplasm|nucleus	3'-tyrosyl-DNA phosphodiesterase activity|double-stranded DNA binding|exonuclease activity|protein binding|single-stranded DNA binding	g.chr14:90430011A>G	AF182002	CCDS9888.1	14q32.11	2008-08-11				ENSG00000042088			18884	protein-coding gene	gene with protein product		607198				11839309, 12244316	Standard	XM_005267847		Approved	FLJ11090, SCAN1	uc001xxz.3	Q9NUW8		ENST00000335725.4:c.553A>G	14.37:g.90430011A>G	ENSP00000337353:p.Ile185Val					TDP1_uc010atm.2_RNA|TDP1_uc001xxz.2_Missense_Mutation_p.I185V|TDP1_uc010atn.2_Missense_Mutation_p.I185V|TDP1_uc001xya.2_5'UTR|TDP1_uc001xyb.2_RNA|TDP1_uc010ato.2_Missense_Mutation_p.I185V|TDP1_uc001xyc.1_Missense_Mutation_p.I185V	p.I185V	NM_018319	NP_060789	Q9NUW8	TYDP1_HUMAN		COAD - Colon adenocarcinoma(157;0.23)	3	852	+		all_cancers(154;0.185)	185					Q2HXX4|Q86TV8|Q96BK7|Q9NZM7|Q9NZM8	Missense_Mutation	SNP	ENST00000335725.4	37	c.553A>G	CCDS9888.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.632870	0.87660	.	.	ENSG00000042088	ENST00000393452;ENST00000554180;ENST00000393454;ENST00000553617;ENST00000335725;ENST00000555880	T;T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3;1.3	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.60702	0.2289	M	0.76574	2.34	0.80722	D	1	D;P;D;D	0.76494	0.971;0.939;0.999;0.977	P;P;D;P	0.80764	0.644;0.725;0.994;0.757	T	0.63377	-0.6651	10	0.52906	T	0.07	-11.8061	15.714	0.77652	1.0:0.0:0.0:0.0	.	185;185;185;185	G3V2F4;E7EPD8;G3V4W8;Q9NUW8	.;.;.;TYDP1_HUMAN	V	185;185;185;86;185;185	ENSP00000377098:I185V;ENSP00000450872:I185V;ENSP00000377099:I185V;ENSP00000450708:I86V;ENSP00000337353:I185V;ENSP00000450628:I185V	ENSP00000337353:I185V	I	+	1	0	TDP1	89499764	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	8.395000	0.90188	2.099000	0.63709	0.459000	0.35465	ATC		0.493	TDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411239.1	NM_018319		4	79	0	0	0	0.009096	0	4	79				
OR4N4	283694	broad.mit.edu	37	15	22382756	22382756	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr15:22382756G>T	ENST00000328795.4	+	1	375	c.284G>T	c.(283-285)aGa>aTa	p.R95I	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R95I(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		ATCTCCTACAGAGGCTGCATC	0.517																																							uc001yuc.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(1)	5						c.(283-285)AGA>ATA		olfactory receptor, family 4, subfamily N,							47.0	47.0	47.0					15																	22382756		2190	4248	6438	SO:0001583	missense	283694				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22382756G>T	AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.284G>T	15.37:g.22382756G>T	ENSP00000332500:p.Arg95Ile					LOC727924_uc001yub.1_Intron|OR4N4_uc010tzv.1_Missense_Mutation_p.R95I	p.R95I	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	7	1265	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	95			Extracellular (Potential).		Q6IEY3|Q6IF56	Missense_Mutation	SNP	ENST00000328795.4	37	c.284G>T	CCDS32173.1	.	.	.	.	.	.	.	.	.	.	.	6.097	0.386231	0.11524	.	.	ENSG00000183706	ENST00000328795	T	0.00397	7.57	3.2	-1.14	0.09741	GPCR, rhodopsin-like superfamily (1);	0.477946	0.18297	N	0.145530	T	0.00178	0.0005	N	0.14661	0.345	0.09310	N	1	P	0.41393	0.748	B	0.39738	0.308	T	0.50575	-0.8812	10	0.42905	T	0.14	-0.4457	7.0805	0.25229	0.6642:0.0:0.3358:0.0	.	95	Q8N0Y3	OR4N4_HUMAN	I	95	ENSP00000332500:R95I	ENSP00000332500:R95I	R	+	2	0	OR4N4	19884120	0.000000	0.05858	0.874000	0.34290	0.431000	0.31685	-2.187000	0.01250	-0.095000	0.12351	0.184000	0.17185	AGA		0.517	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1			8	176	1	0	5.03518e-11	0.007413	6.81486e-11	8	176				
OR4N3P	390539	broad.mit.edu	37	15	22413745	22413745	+	IGR	SNP	G	G	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr15:22413745G>T								RP11-69H14.6 (29937 upstream) : RP11-2F9.4 (20144 downstream)																							ATCTCCTACAGAGGCTGCATC	0.507																																							uc001yuf.2		NA																	0					0						c.(43-45)AGA>ATA		RecName: Full=Olfactory receptor 4N2; AltName: Full=Olfactory receptor OR14-8; AltName: Full=Olfactory receptor OR14-13;																																				SO:0001628	intergenic_variant	390539							g.chr15:22413745G>T																													15.37:g.22413745G>T							p.R15I	NM_001080841	NP_001074310					1	44	+									Missense_Mutation	SNP		37	c.44G>T																																																																																				0	0.507									7	382	1	0	5.50884e-06	0.013537	6.86419e-06	7	382				
PLIN1	5346	broad.mit.edu	37	15	90213396	90213396	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr15:90213396G>T	ENST00000300055.5	-	5	578	c.413C>A	c.(412-414)aCt>aAt	p.T138N	PLIN1_ENST00000430628.2_Missense_Mutation_p.T138N	NM_002666.4	NP_002657.3	O60240	PLIN1_HUMAN	perilipin 1	138					lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)	lipid binding (GO:0008289)	p.T138N(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(2)	13						CTTGTCTGAAGTGCTCGCGAT	0.627																																							uc010upx.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(412-414)ACT>AAT		perilipin 1							36.0	36.0	36.0					15																	90213396		2200	4299	6499	SO:0001583	missense	5346				triglyceride catabolic process	lipid particle	lipid binding	g.chr15:90213396G>T	AB005293	CCDS10353.1	15q26	2009-08-12	2009-08-12	2009-08-12	ENSG00000166819	ENSG00000166819		"""Perilipins"""	9076	protein-coding gene	gene with protein product		170290	"""perilipin"""	PLIN		9521880, 19638644	Standard	NM_002666		Approved		uc010upx.1	O60240	OTTHUMG00000149813	ENST00000300055.5:c.413C>A	15.37:g.90213396G>T	ENSP00000300055:p.Thr138Asn					PLIN1_uc002boh.2_Missense_Mutation_p.T138N	p.T138N	NM_001145311	NP_001138783	O60240	PLIN1_HUMAN			5	523	-			138					Q8N5Y6	Missense_Mutation	SNP	ENST00000300055.5	37	c.413C>A	CCDS10353.1	.	.	.	.	.	.	.	.	.	.	G	17.52	3.410402	0.62399	.	.	ENSG00000166819	ENST00000300055;ENST00000430628	T;T	0.06608	3.28;3.28	5.21	5.21	0.72293	.	0.391258	0.26428	N	0.024424	T	0.26376	0.0644	M	0.76002	2.32	0.42711	D	0.993641	D	0.89917	1.0	D	0.77557	0.99	T	0.00939	-1.1507	10	0.72032	D	0.01	-17.0934	17.3071	0.87198	0.0:0.0:1.0:0.0	.	138	O60240	PLIN1_HUMAN	N	138	ENSP00000300055:T138N;ENSP00000402167:T138N	ENSP00000300055:T138N	T	-	2	0	PLIN1	88014400	1.000000	0.71417	0.977000	0.42913	0.348000	0.29142	5.663000	0.68038	2.439000	0.82584	0.305000	0.20034	ACT		0.627	PLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313424.2	NM_002666		7	27	1	0	2.0095e-06	0.001984	2.54428e-06	7	27				
SRRM2	23524	broad.mit.edu	37	16	2814127	2814127	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr16:2814127C>A	ENST00000301740.8	+	11	4147	c.3598C>A	c.(3598-3600)Ctg>Atg	p.L1200M		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1200	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)	p.L1200M(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						TGAGTCTTCACTGGTATTCAA	0.473																																							uc002crk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						c.(3598-3600)CTG>ATG		splicing coactivator subunit SRm300							103.0	107.0	106.0					16																	2814127		2198	4300	6498	SO:0001583	missense	23524					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding	g.chr16:2814127C>A	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.3598C>A	16.37:g.2814127C>A	ENSP00000301740:p.Leu1200Met					SRRM2_uc002crj.1_Missense_Mutation_p.L1104M|SRRM2_uc002crl.1_Missense_Mutation_p.L1200M|SRRM2_uc010bsu.1_Missense_Mutation_p.L1104M	p.L1200M	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN			11	4147	+			1200			Ser-rich.		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	c.3598C>A	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	C	3.286	-0.146014	0.06627	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	D	0.93763	-3.28	5.88	3.85	0.44370	.	0.495729	0.20461	N	0.091895	D	0.84433	0.5471	N	0.14661	0.345	0.19300	N	0.999979	B	0.25955	0.138	B	0.25405	0.06	T	0.75249	-0.3384	10	0.59425	D	0.04	-0.1074	4.488	0.11799	0.1678:0.5996:0.1509:0.0818	.	1200	Q9UQ35	SRRM2_HUMAN	M	1200;1200;452	ENSP00000301740:L1200M	ENSP00000301740:L1200M	L	+	1	2	SRRM2	2754128	0.003000	0.15002	0.197000	0.23402	0.113000	0.19764	0.667000	0.25112	0.754000	0.32968	0.561000	0.74099	CTG		0.473	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1			8	136	1	0	0.000442599	0.006214	0.000514727	8	136				
SLC5A11	115584	broad.mit.edu	37	16	24909301	24909301	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr16:24909301G>T	ENST00000347898.3	+	10	1499	c.877G>T	c.(877-879)Gtc>Ttc	p.V293F	SLC5A11_ENST00000424767.2_Missense_Mutation_p.V258F|SLC5A11_ENST00000569071.1_Missense_Mutation_p.C160F|SLC5A11_ENST00000449109.2_Missense_Mutation_p.C160F|SLC5A11_ENST00000568579.1_Missense_Mutation_p.V223F|SLC5A11_ENST00000545376.1_Missense_Mutation_p.V223F|SLC5A11_ENST00000567758.1_Missense_Mutation_p.V258F|SLC5A11_ENST00000539472.1_Missense_Mutation_p.V229F|SLC5A11_ENST00000565769.1_Missense_Mutation_p.V229F	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11									p.V293F(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		CCAGGTGATTGTCCAGCGGAC	0.502																																							uc002dmu.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(877-879)GTC>TTC		solute carrier family 5 (sodium/glucose							209.0	194.0	199.0					16																	24909301		2197	4300	6497	SO:0001583	missense	115584				apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity	g.chr16:24909301G>T	AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.877G>T	16.37:g.24909301G>T	ENSP00000289932:p.Val293Phe					SLC5A11_uc002dms.2_Missense_Mutation_p.V229F|SLC5A11_uc010vcd.1_Missense_Mutation_p.V258F|SLC5A11_uc002dmt.2_Missense_Mutation_p.C160F|SLC5A11_uc010vce.1_Missense_Mutation_p.V223F|SLC5A11_uc010bxt.2_Missense_Mutation_p.V229F	p.V293F	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN		GBM - Glioblastoma multiforme(48;0.0365)	10	1109	+			293			Helical; (Potential).			Missense_Mutation	SNP	ENST00000347898.3	37	c.877G>T	CCDS10625.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.3|28.3	4.904052|4.904052	0.92035|0.92035	.|.	.|.	ENSG00000158865|ENSG00000158865	ENST00000449109|ENST00000347898;ENST00000424767;ENST00000545376;ENST00000539472	D|D;D;D;D	0.83163|0.90324	-1.69|-2.65;-2.65;-2.65;-2.65	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97306|0.97306	0.9119|0.9119	H|H	0.97852|0.97852	4.09|4.09	0.80722|0.80722	D|D	1|1	B|D;D;D	0.27951|0.89917	0.195|1.0;1.0;1.0	B|D;D;D	0.15052|0.85130	0.012|0.997;0.991;0.997	D|D	0.98621|0.98621	1.0667|1.0667	8|10	.|0.87932	.|D	.|0	.|.	16.9482|16.9482	0.86236|0.86236	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	160|223;258;293	Q05BF1|B7Z329;Q8WWX8-2;Q8WWX8	.|.;.;SC5AB_HUMAN	F|F	160|293;258;223;229	ENSP00000389606:C160F|ENSP00000289932:V293F;ENSP00000416782:V258F;ENSP00000441384:V223F;ENSP00000441018:V229F	.|ENSP00000289932:V293F	C|V	+|+	2|1	0|0	SLC5A11|SLC5A11	24816802|24816802	1.000000|1.000000	0.71417|0.71417	0.948000|0.948000	0.38648|0.38648	0.978000|0.978000	0.69477|0.69477	9.678000|9.678000	0.98647|0.98647	2.612000|2.612000	0.88384|0.88384	0.655000|0.655000	0.94253|0.94253	TGT|GTC		0.502	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214091.3	NM_052944		37	210	1	0	5.71845e-15	0.005524	8.01604e-15	37	210				
GSG1L	146395	broad.mit.edu	37	16	27840114	27840114	+	Nonsense_Mutation	SNP	C	C	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr16:27840114C>A	ENST00000447459.2	-	5	910	c.826G>T	c.(826-828)Gag>Tag	p.E276*	GSG1L_ENST00000380898.2_Nonsense_Mutation_p.E121*|GSG1L_ENST00000569166.1_Nonsense_Mutation_p.E121*|GSG1L_ENST00000395724.3_Nonsense_Mutation_p.E225*|GSG1L_ENST00000380897.3_Nonsense_Mutation_p.E121*	NM_001109763.1	NP_001103233.1	Q6UXU4	GSG1L_HUMAN	GSG1-like	276					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	asymmetric synapse (GO:0032279)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E121*(1)|p.E276*(1)		endometrium(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(4)	17						ACTGACCTCTCCCGGAAGTAC	0.602																																							uc002doz.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(1)	1						c.(826-828)GAG>TAG		GSG1-like isoform 1							89.0	78.0	82.0					16																	27840114		2197	4300	6497	SO:0001587	stop_gained	146395					integral to membrane		g.chr16:27840114C>A	AK128775	CCDS10631.1, CCDS45450.1	16p11.2	2014-01-20			ENSG00000169181	ENSG00000169181			28283	protein-coding gene	gene with protein product						22813734	Standard	NM_001109763		Approved	MGC18079, PRO19651, KTSR5831	uc002doz.2	Q6UXU4	OTTHUMG00000131676	ENST00000447459.2:c.826G>T	16.37:g.27840114C>A	ENSP00000394954:p.Glu276*					GSG1L_uc010bya.1_Nonsense_Mutation_p.E225*|GSG1L_uc010bxz.1_Nonsense_Mutation_p.E121*|GSG1L_uc002doy.2_Nonsense_Mutation_p.E121*	p.E276*	NM_001109763	NP_001103233	Q6UXU4	GSG1L_HUMAN			5	911	-			276					Q7Z6F8|Q8TB81	Nonsense_Mutation	SNP	ENST00000447459.2	37	c.826G>T	CCDS45450.1	.	.	.	.	.	.	.	.	.	.	C	37	6.585126	0.97684	.	.	ENSG00000169181	ENST00000447459;ENST00000395724;ENST00000380898;ENST00000380897	.	.	.	5.24	5.24	0.73138	.	0.127144	0.51477	D	0.000086	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	17.5938	0.88005	0.0:1.0:0.0:0.0	.	.	.	.	X	276;225;121;121	.	ENSP00000370282:E121X	E	-	1	0	GSG1L	27747615	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.887000	0.63156	2.455000	0.83008	0.650000	0.86243	GAG		0.602	GSG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433832.2	NM_144675		10	34	1	0	1.58986e-06	0.008291	2.02934e-06	10	34				
CHRNE	1145	broad.mit.edu	37	17	4798435	4798435	+	IGR	SNP	G	G	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr17:4798435G>T	ENST00000293780.4	-	0	2455				MINK1_ENST00000453408.3_Missense_Mutation_p.V975F|MINK1_ENST00000355280.6_Missense_Mutation_p.V995F|MINK1_ENST00000347992.7_Missense_Mutation_p.V966F	NM_000080.3	NP_000071.1	Q04844	ACHE_HUMAN	cholinergic receptor, nicotinic, epsilon (muscle)						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|cation transmembrane transporter activity (GO:0008324)	p.V995F(1)|p.V966F(1)		central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)	12					Galantamine(DB00674)	GGGTTCTGTGGTCAACGTGAA	0.607																																							uc010vsl.1		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)|skin(1)	6						c.(2983-2985)GTC>TTC		misshapen-like kinase 1 isoform 3							553.0	512.0	525.0					17																	4798435		2047	4195	6242	SO:0001628	intergenic_variant	50488				JNK cascade	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chr17:4798435G>T	X66403	CCDS11058.1	17p13.2	2012-02-11	2012-02-07		ENSG00000108556	ENSG00000108556		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1966	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, epsilon (muscle)"""	100725	"""cholinergic receptor, nicotinic, epsilon"""			7688301	Standard	NM_000080		Approved	ACHRE	uc002fzk.1	Q04844	OTTHUMG00000090778		17.37:g.4798435G>T						MINK1_uc010vsk.1_Missense_Mutation_p.V966F|MINK1_uc010vsm.1_Missense_Mutation_p.V975F|MINK1_uc010vsn.1_Missense_Mutation_p.V958F|MINK1_uc010vso.1_Missense_Mutation_p.V903F|MINK1_uc010vsp.1_Missense_Mutation_p.V456F	p.V995F	NM_153827	NP_722549	Q8N4C8	MINK1_HUMAN			25	3179	+			995			Mediates interaction with RAP2A.		D3DTK6	Missense_Mutation	SNP	ENST00000293780.4	37	c.2983G>T	CCDS11058.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.795334	0.90453	.	.	ENSG00000141503	ENST00000355280;ENST00000453408;ENST00000347992	D;D;D	0.82984	-1.67;-1.67;-1.67	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.91489	0.7313	M	0.83384	2.64	0.80722	D	1	D;D;D;D	0.76494	0.999;0.994;0.99;0.994	D;D;D;D	0.79108	0.992;0.986;0.969;0.986	D	0.92320	0.5865	10	0.87932	D	0	.	16.4886	0.84191	0.0:0.0:1.0:0.0	.	958;975;995;966	Q8N4C8-2;Q8N4C8-4;Q8N4C8;Q8N4C8-3	.;.;MINK1_HUMAN;.	F	995;975;966	ENSP00000347427:V995F;ENSP00000406487:V975F;ENSP00000269296:V966F	ENSP00000269296:V966F	V	+	1	0	MINK1	4739211	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.263000	0.95617	2.757000	0.94681	0.655000	0.94253	GTC		0.607	CHRNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207560.3			17	401	1	0	1.02788e-11	0.00499	1.40328e-11	17	401				
EIF4A1	1973	broad.mit.edu	37	17	7480995	7480995	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr17:7480995C>G	ENST00000293831.8	+	8	893	c.877C>G	c.(877-879)Cat>Gat	p.H293D	SENP3-EIF4A1_ENST00000579777.1_RNA|EIF4A1_ENST00000582746.1_Missense_Mutation_p.H293D|CD68_ENST00000250092.6_5'Flank|SNORA48_ENST00000386847.1_RNA|SNORD10_ENST00000459579.1_RNA|CD68_ENST00000380498.6_5'Flank|SNORA67_ENST00000384423.1_RNA|EIF4A1_ENST00000577269.1_Missense_Mutation_p.H293D	NM_001416.3	NP_001407.1	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A1	293	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.H293D(1)		NS(1)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	22						CGAGAAGATGCATGCTCGAGA	0.547																																					Melanoma(120;278 1668 15796 27423 46368)	Melanoma(120;278 1668 15796 27423 46368)	uc002gho.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(877-879)CAT>GAT		eukaryotic translation initiation factor 4A							154.0	142.0	146.0					17																	7480995		2203	4300	6503	SO:0001583	missense	1973				nuclear-transcribed mRNA poly(A) tail shortening	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|mRNA binding|protein binding|RNA cap binding|translation initiation factor activity	g.chr17:7480995C>G	D13748	CCDS11113.1, CCDS58511.1	17p13	2012-02-23	2010-02-10		ENSG00000161960	ENSG00000161960		"""DEAD-boxes"""	3282	protein-coding gene	gene with protein product		602641	"""eukaryotic translation initiation factor 4A, isoform 1"""	EIF4A		8493113, 9790779	Standard	NM_001416		Approved	DDX2A, EIF-4A		P60842	OTTHUMG00000108149	ENST00000293831.8:c.877C>G	17.37:g.7480995C>G	ENSP00000293831:p.His293Asp					EIF4A1_uc002ghr.1_Missense_Mutation_p.H293D|EIF4A1_uc002ghq.1_Missense_Mutation_p.H293D|EIF4A1_uc002ghp.1_Missense_Mutation_p.H293D|SNORA67_uc010cml.1_5'Flank|CD68_uc002ghv.2_5'Flank|CD68_uc002ghu.2_5'Flank	p.H293D	NM_001416	NP_001407	P60842	IF4A1_HUMAN			16	2202	+			293			Helicase C-terminal.		B2R6L8|D3DTP9|J3QLC4|P04765|Q5U018|Q61516	Missense_Mutation	SNP	ENST00000293831.8	37	c.877C>G	CCDS11113.1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.136500	0.37728	.	.	ENSG00000161960	ENST00000293831;ENST00000396527	T	0.74632	-0.86	5.35	5.35	0.76521	Helicase, C-terminal (3);	0.145211	0.64402	D	0.000011	T	0.62563	0.2438	N	0.04508	-0.205	0.80722	D	1	B;B;B	0.32800	0.385;0.383;0.065	B;B;B	0.41236	0.18;0.351;0.18	T	0.69661	-0.5085	10	0.87932	D	0	-24.3773	16.5647	0.84576	0.0:1.0:0.0:0.0	.	293;293;293	A8K7F6;A8K088;P60842	.;.;IF4A1_HUMAN	D	293;116	ENSP00000293831:H293D	ENSP00000293831:H293D	H	+	1	0	EIF4A1	7421719	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.461000	0.80834	2.515000	0.84797	0.561000	0.74099	CAT		0.547	EIF4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226952.6	NM_001416		11	140	0	0	0	0.010729	0	11	140				
MYH13	8735	broad.mit.edu	37	17	10216590	10216590	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr17:10216590C>T	ENST00000418404.3	-	29	4229	c.4066G>A	c.(4066-4068)Gaa>Aaa	p.E1356K	MYH13_ENST00000252172.4_Missense_Mutation_p.E1356K|RP11-401O9.4_ENST00000609088.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1356					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.E1356K(2)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						GCCTTGGCTTCCTGCTCCTCC	0.627																																							uc002gmk.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(2)	6						c.(4066-4068)GAA>AAA		myosin, heavy polypeptide 13, skeletal muscle							149.0	135.0	140.0					17																	10216590		2203	4300	6503	SO:0001583	missense	8735				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10216590C>T	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.4066G>A	17.37:g.10216590C>T	ENSP00000404570:p.Glu1356Lys						p.E1356K	NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN			30	4156	-			1356			Potential.		O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	c.4066G>A	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.031373	0.93575	.	.	ENSG00000006788	ENST00000252172	D	0.81908	-1.55	3.95	3.95	0.45737	Myosin tail (1);	.	.	.	.	D	0.93674	0.7979	H	0.96269	3.795	0.47737	D	0.999509	D	0.57899	0.981	D	0.70935	0.971	D	0.95875	0.8894	9	0.87932	D	0	.	16.5503	0.84471	0.0:1.0:0.0:0.0	.	1356	Q9UKX3	MYH13_HUMAN	K	1356	ENSP00000252172:E1356K	ENSP00000252172:E1356K	E	-	1	0	MYH13	10157315	1.000000	0.71417	0.993000	0.49108	0.885000	0.51271	7.531000	0.81973	2.202000	0.70862	0.455000	0.32223	GAA		0.627	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		14	129	0	0	0	0.001855	0	14	129				
COX10	1352	broad.mit.edu	37	17	14110404	14110404	+	Silent	SNP	C	C	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr17:14110404C>T	ENST00000261643.3	+	7	1283	c.1206C>T	c.(1204-1206)gaC>gaT	p.D402D	COX10_ENST00000536205.1_Silent_p.D210D|COX10_ENST00000537334.1_Silent_p.D185D	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	402					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)	p.D402D(1)		cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		TCTACGTGGACGCAGACCGCA	0.632																																							uc002gof.3		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(1204-1206)GAC>GAT		heme A:farnesyltransferase precursor							101.0	87.0	91.0					17																	14110404		2203	4300	6503	SO:0001819	synonymous_variant	1352				heme a biosynthetic process|heme O biosynthetic process|respiratory chain complex IV assembly	integral to membrane|mitochondrial membrane	protoheme IX farnesyltransferase activity	g.chr17:14110404C>T	U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.1206C>T	17.37:g.14110404C>T						COX10_uc010vvs.1_Silent_p.D185D|COX10_uc010vvt.1_Silent_p.D210D	p.D402D	NM_001303	NP_001294	Q12887	COX10_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)	7	1410	+		all_lung(20;0.06)|Lung SC(565;0.168)	402					B2R6U5|B4DJ50|O15334|Q969F7	Silent	SNP	ENST00000261643.3	37	c.1206C>T	CCDS11166.1																																																																																				0.632	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130003.1	NM_001303		6	72	0	0	0	0.001984	0	6	72				
NCOR1	9611	broad.mit.edu	37	17	15935793	15935793	+	Silent	SNP	T	T	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr17:15935793T>G	ENST00000268712.3	-	46	7397	c.7140A>C	c.(7138-7140)tcA>tcC	p.S2380S	NCOR1_ENST00000395851.1_Silent_p.S2277S|NCOR1_ENST00000395857.3_Silent_p.S964S	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	2380	Interaction with C1D. {ECO:0000250}.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.S2380S(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GAAACTGAGTTGAGCCTGACA	0.428																																							uc002gpo.2		NA																	1	Substitution - coding silent(1)		lung(1)	upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5						c.(7138-7140)TCA>TCC		nuclear receptor co-repressor 1							87.0	81.0	83.0					17																	15935793		2203	4300	6503	SO:0001819	synonymous_variant	9611				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding	g.chr17:15935793T>G	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.7140A>C	17.37:g.15935793T>G						NCOR1_uc002gpn.2_Silent_p.S2277S|NCOR1_uc002gpl.2_Silent_p.S394S|NCOR1_uc002gpm.2_Silent_p.S899S|NCOR1_uc010vwb.1_Silent_p.S964S|NCOR1_uc010coy.2_Silent_p.S1288S	p.S2380S	NM_006311	NP_006302	O75376	NCOR1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)	46	7380	-			2380			Interaction with C1D (By similarity).		B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Silent	SNP	ENST00000268712.3	37	c.7140A>C	CCDS11175.1																																																																																				0.428	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311		4	75	0	0	0	0.000602	0	4	75				
MYO15A	51168	broad.mit.edu	37	17	18052870	18052870	+	Silent	SNP	C	C	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr17:18052870C>T	ENST00000205890.5	+	35	7526	c.7188C>T	c.(7186-7188)gaC>gaT	p.D2396D	snoU13_ENST00000459354.1_RNA	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	2396	Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.D2396D(1)		breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					GCCTCTTTGACCCTGTGCTGT	0.562																																							uc010vxh.1		NA																	1	Substitution - coding silent(1)		lung(1)	skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9						c.(7186-7188)GAC>GAT		myosin XV							94.0	97.0	96.0					17																	18052870		2052	4193	6245	SO:0001819	synonymous_variant	51168				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity	g.chr17:18052870C>T	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.7188C>T	17.37:g.18052870C>T							p.D2396D	NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN			34	7526	+	all_neural(463;0.228)		2396			Tail.		B4DFC7	Silent	SNP	ENST00000205890.5	37	c.7188C>T	CCDS42271.1																																																																																				0.562	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239		5	60	0	0	0	0.000602	0	5	60				
SPECC1	92521	broad.mit.edu	37	17	20013766	20013766	+	Silent	SNP	G	G	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr17:20013766G>A	ENST00000261503.5	+	3	225	c.174G>A	c.(172-174)acG>acA	p.T58T	SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000395529.3_Silent_p.T58T|SPECC1_ENST00000395527.4_Silent_p.T58T	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	58					cell adhesion (GO:0007155)	nucleus (GO:0005634)		p.T58T(1)		breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		GTGAGGACACGCTCAACAAGC	0.577																																							uc002gwq.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(172-174)ACG>ACA		spectrin domain with coiled-coils 1 NSP5b3b							78.0	79.0	78.0					17																	20013766		2203	4300	6503	SO:0001819	synonymous_variant	92521					nucleus		g.chr17:20013766G>A	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.174G>A	17.37:g.20013766G>A						CYTSB_uc010cqx.2_Silent_p.T58T|CYTSB_uc002gwr.2_Silent_p.T58T|CYTSB_uc002gws.2_Silent_p.T58T	p.T58T	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN			3	319	+			58					B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Silent	SNP	ENST00000261503.5	37	c.174G>A	CCDS32590.1																																																																																				0.577	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904		4	91	0	0	0	0.009096	0	4	91				
SPAG5	10615	broad.mit.edu	37	17	26905478	26905478	+	Silent	SNP	G	G	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr17:26905478G>A	ENST00000321765.5	-	21	3599	c.3267C>T	c.(3265-3267)ctC>ctT	p.L1089L	ALDOC_ENST00000226253.4_5'Flank|ALDOC_ENST00000395319.3_5'Flank|ALDOC_ENST00000395321.2_5'Flank	NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	1089					chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)		p.L1089L(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					GGGCCTCCTGGAGCACTTTGG	0.577																																							uc002hbq.2		NA																	1	Substitution - coding silent(1)		lung(1)	central_nervous_system(1)	1						c.(3265-3267)CTC>CTT		sperm associated antigen 5							63.0	67.0	66.0					17																	26905478		2203	4300	6503	SO:0001819	synonymous_variant	10615				cell division|mitosis|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytoplasm|spindle pole	protein binding	g.chr17:26905478G>A	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.3267C>T	17.37:g.26905478G>A						ALDOC_uc002hbp.2_5'Flank|ALDOC_uc010cro.2_5'Flank	p.L1089L	NM_006461	NP_006452	Q96R06	SPAG5_HUMAN			21	3359	-	Lung NSC(42;0.00431)		1089			Potential.		O95213|Q9BWE8|Q9NT17|Q9UFE6	Silent	SNP	ENST00000321765.5	37	c.3267C>T	CCDS32594.1																																																																																				0.577	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2	NM_006461		6	84	0	0	0	0.001984	0	6	84				
NF1	4763	broad.mit.edu	37	17	29528174	29528174	+	Silent	SNP	T	T	C			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr17:29528174T>C	ENST00000358273.4	+	10	1565	c.1182T>C	c.(1180-1182)ttT>ttC	p.F394F	NF1_ENST00000431387.4_Silent_p.F394F|NF1_ENST00000356175.3_Silent_p.F394F	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	394					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(6)|p.F394F(2)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ACCAACACTTTAAGGTGAGAG	0.368			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													uc002hgg.2		NA	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	D|Mis|N|F|S|O	neurofibromatosis type 1 gene			O		neurofibroma|glioma	neurofibroma|glioma		16	Whole gene deletion(8)|Unknown(6)|Substitution - coding silent(2)	p.?(2)	soft_tissue(7)|lung(3)|autonomic_ganglia(3)|central_nervous_system(3)	soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330						c.(1180-1182)TTT>TTC		neurofibromin isoform 1							58.0	55.0	56.0					17																	29528174		2203	4300	6503	SO:0001819	synonymous_variant	4763	Neurofibromatosis_type_1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	g.chr17:29528174T>C		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1182T>C	17.37:g.29528174T>C		TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)				NF1_uc002hge.1_Silent_p.F394F|NF1_uc002hgf.1_Silent_p.F394F|NF1_uc002hgh.2_Silent_p.F394F|NF1_uc010csn.1_Silent_p.F254F	p.F394F	NM_001042492	NP_001035957	P21359	NF1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)	10	1515	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	394					O00662|Q14284|Q14930|Q14931|Q9UMK3	Silent	SNP	ENST00000358273.4	37	c.1182T>C	CCDS42292.1																																																																																				0.368	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267		12	62	0	0	0	0.013537	0	12	62				
KRTAP4-9	100132386	broad.mit.edu	37	17	39262103	39262103	+	Missense_Mutation	SNP	A	A	T	rs374629799	byFrequency	TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr17:39262103A>T	ENST00000391415.1	+	1	520	c.463A>T	c.(463-465)Agc>Tgc	p.S155C		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	155	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						ccccagctgcagcatctccag	0.672													a|||	152	0.0303514	0.0893	0.0216	5008	,	,		18051	0.001		0.0139	False		,,,				2504	0.0041						uc010wfp.1		NA																	0					0						c.(463-465)AGC>TGC		keratin associated protein 4-9							6.0	9.0	8.0					17																	39262103		679	1572	2251	SO:0001583	missense	100132386					keratin filament		g.chr17:39262103A>T	AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.463A>T	17.37:g.39262103A>T	ENSP00000375234:p.Ser155Cys						p.S155C	NM_001146041	NP_001139513	Q9BYQ8	KRA49_HUMAN			1	463	+			155			29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].			Missense_Mutation	SNP	ENST00000391415.1	37	c.463A>T	CCDS54124.1	.	.	.	.	.	.	.	.	.	.	.	0.091	-1.167638	0.01660	.	.	ENSG00000212722	ENST00000377734;ENST00000391415;ENST00000333994	T	0.00584	6.4	3.1	-1.38	0.09027	.	.	.	.	.	T	0.00109	0.0003	N	0.00041	-2.485	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48186	-0.9057	9	0.02654	T	1	.	0.2915	0.00259	0.1968:0.2502:0.1975:0.3554	.	155	Q9BYQ8	KRA49_HUMAN	C	143;155;146	ENSP00000375234:S155C	ENSP00000334461:S146C	S	+	1	0	KRTAP4-9	36515629	0.946000	0.32159	0.002000	0.10522	0.205000	0.24178	1.056000	0.30480	-0.110000	0.12022	-1.044000	0.02363	AGC		0.672	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257688.1	NM_001146041		3	21	0	0	0	0.009096	0	3	21				
STAT3	6774	broad.mit.edu	37	17	40490754	40490754	+	Missense_Mutation	SNP	T	T	C			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr17:40490754T>C	ENST00000264657.5	-	6	857	c.545A>G	c.(544-546)cAa>cGa	p.Q182R	STAT3_ENST00000585517.1_Missense_Mutation_p.Q182R|STAT3_ENST00000404395.3_Missense_Mutation_p.Q182R|STAT3_ENST00000389272.3_Missense_Mutation_p.Q84R|STAT3_ENST00000588969.1_Missense_Mutation_p.Q182R	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	182					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q182R(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		CTTGCCTCCTTGACTCTTGAG	0.328									Hyperimmunoglobulin E Recurrent Infection Syndrome																														uc002hzl.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4						c.(544-546)CAA>CGA		signal transducer and activator of transcription							122.0	123.0	122.0					17																	40490754		2203	4300	6503	SO:0001583	missense	6774	Hyperimmunoglobulin_E_Recurrent_Infection_Syndrome	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	cellular component movement|eating behavior|eye photoreceptor cell differentiation|glucose homeostasis|interleukin-6-mediated signaling pathway|interspecies interaction between organisms|JAK-STAT cascade involved in growth hormone signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein import into nucleus|response to estradiol stimulus|sexual reproduction|temperature homeostasis	cytosol|nucleus|plasma membrane	calcium ion binding|ligand-regulated transcription factor activity|protein dimerization activity|protein kinase binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription factor binding|transcription regulatory region DNA binding	g.chr17:40490754T>C	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.545A>G	17.37:g.40490754T>C	ENSP00000264657:p.Gln182Arg					STAT3_uc002hzk.1_Missense_Mutation_p.Q182R|STAT3_uc002hzm.1_Missense_Mutation_p.Q182R|STAT3_uc010wgh.1_Missense_Mutation_p.Q84R|STAT3_uc002hzn.1_Missense_Mutation_p.Q182R	p.Q182R	NM_139276	NP_644805	P40763	STAT3_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.139)	6	785	-		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)	182					A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	ENST00000264657.5	37	c.545A>G	CCDS32656.1	.	.	.	.	.	.	.	.	.	.	T	9.056	0.993177	0.19043	.	.	ENSG00000168610	ENST00000264657;ENST00000389272;ENST00000404395	T;T;T	0.58652	0.32;0.32;0.32	5.32	5.32	0.75619	STAT transcription factor, all-alpha (2);STAT transcription factor, coiled coil (1);	2.042940	0.01798	N	0.032756	T	0.35740	0.0942	N	0.01048	-1.04	0.33527	D	0.593174	B;B;B	0.27286	0.144;0.174;0.174	B;B;B	0.28139	0.051;0.086;0.086	T	0.22941	-1.0202	10	0.13470	T	0.59	-17.303	15.2948	0.73894	0.0:0.0:0.0:1.0	.	182;182;182	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	R	182;84;182	ENSP00000264657:Q182R;ENSP00000373923:Q84R;ENSP00000384943:Q182R	ENSP00000264657:Q182R	Q	-	2	0	STAT3	37744280	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.011000	0.57124	2.012000	0.59069	0.460000	0.39030	CAA		0.328	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150		29	82	0	0	0	0.00632	0	29	82				
PRKCA	5578	broad.mit.edu	37	17	64684503	64684503	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr17:64684503G>T	ENST00000413366.3	+	7	796	c.770G>T	c.(769-771)gGa>gTa	p.G257V		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	257	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)	p.G257V(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	GACTTCATGGGATCCCTTTCC	0.468																																							uc002jfp.1		NA																	1	Substitution - Missense(1)		lung(1)	central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9						c.(769-771)GGA>GTA		protein kinase C, alpha	Phosphatidylserine(DB00144)|Vitamin E(DB00163)						166.0	143.0	151.0					17																	64684503		2203	4300	6503	SO:0001583	missense	5578				activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding	g.chr17:64684503G>T		CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.770G>T	17.37:g.64684503G>T	ENSP00000408695:p.Gly257Val					PRKCA_uc002jfo.1_Missense_Mutation_p.G128V	p.G257V	NM_002737	NP_002728	P17252	KPCA_HUMAN	BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		7	814	+			257			C2.		B5BU22|Q15137|Q32M72|Q96RE4	Missense_Mutation	SNP	ENST00000413366.3	37	c.770G>T	CCDS11664.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.861427	0.91433	.	.	ENSG00000154229	ENST00000413366;ENST00000284384	T	0.77489	-1.1	5.2	5.2	0.72013	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.93631	0.7966	H	0.99357	4.53	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.994;0.993	D	0.96190	0.9137	10	0.72032	D	0.01	.	19.101	0.93274	0.0:0.0:1.0:0.0	.	257;168	P17252;Q59FI5	KPCA_HUMAN;.	V	257;164	ENSP00000408695:G257V	ENSP00000284384:G164V	G	+	2	0	PRKCA	62114965	1.000000	0.71417	0.986000	0.45419	0.993000	0.82548	9.361000	0.97122	2.580000	0.87095	0.555000	0.69702	GGA		0.468	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446976.1			10	72	1	0	2.17888e-05	0.006214	2.67253e-05	10	72				
C17orf58	284018	broad.mit.edu	37	17	65989196	65989196	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr17:65989196A>G	ENST00000449250.2	-	2	256	c.67T>C	c.(67-69)Tcc>Ccc	p.S23P	C17orf58_ENST00000536693.1_Missense_Mutation_p.S23P|C17orf58_ENST00000334461.7_Missense_Mutation_p.S23P|RP11-855A2.5_ENST00000580729.1_lincRNA			Q2M2W7	CQ058_HUMAN	chromosome 17 open reading frame 58	23								p.S23P(2)		lung(2)	2	all_cancers(12;4.57e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			TTGCAGCTGGAGGAGTCCAGG	0.532																																							uc002jgi.3		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(67-69)TCC>CCC		hypothetical protein LOC284018 isoform a							67.0	69.0	68.0					17																	65989196		1935	4128	6063	SO:0001583	missense	284018							g.chr17:65989196A>G	AK026583	CCDS42375.1, CCDS45765.1	17q24.2	2012-10-11			ENSG00000186665	ENSG00000186665			27568	protein-coding gene	gene with protein product						12477932	Standard	NM_181656		Approved		uc002jgi.4	Q2M2W7	OTTHUMG00000179782	ENST00000449250.2:c.67T>C	17.37:g.65989196A>G	ENSP00000402020:p.Ser23Pro					C17orf58_uc002jgj.3_Missense_Mutation_p.S23P	p.S23P	NM_181655	NP_858041	Q2M2W7	CQ058_HUMAN	BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		2	382	-	all_cancers(12;4.57e-10)		23					A8MQV2	Missense_Mutation	SNP	ENST00000449250.2	37	c.67T>C	CCDS45765.1	.	.	.	.	.	.	.	.	.	.	A	17.87	3.494430	0.64186	.	.	ENSG00000186665	ENST00000449250;ENST00000334461;ENST00000536693	T	0.46451	0.87	4.62	3.5	0.40072	Tissue inhibitor of metalloproteinases-like, OB-fold (1);	0.239643	0.36444	N	0.002591	T	0.56217	0.1970	.	.	.	0.25177	N	0.990236	D;P	0.64830	0.994;0.924	P;P	0.62740	0.906;0.461	T	0.49390	-0.8945	9	0.54805	T	0.06	-15.3699	9.8656	0.41140	0.8276:0.1724:0.0:0.0	.	23;23	Q2M2W7-2;Q2M2W7	.;CQ058_HUMAN	P	23	ENSP00000402020:S23P	ENSP00000334741:S23P	S	-	1	0	C17orf58	63419658	1.000000	0.71417	0.974000	0.42286	0.783000	0.44284	4.094000	0.57721	0.592000	0.29728	0.443000	0.29094	TCC		0.532	C17orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448104.1	NM_181656		3	74	0	0	0	0.004672	0	3	74				
MOCOS	55034	broad.mit.edu	37	18	33785085	33785085	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr18:33785085A>G	ENST00000261326.5	+	6	1085	c.1064A>G	c.(1063-1065)tAt>tGt	p.Y355C		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase									p.Y355C(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						TTGGCTCAGTATACCTACGTG	0.478																																							uc002kzq.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1063-1065)TAT>TGT		molybdenum cofactor sulfurase	Pyridoxal Phosphate(DB00114)						107.0	98.0	101.0					18																	33785085		2203	4300	6503	SO:0001583	missense	55034				Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	lyase activity|Mo-molybdopterin cofactor sulfurase activity|molybdenum ion binding|pyridoxal phosphate binding	g.chr18:33785085A>G	AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.1064A>G	18.37:g.33785085A>G	ENSP00000261326:p.Tyr355Cys						p.Y355C	NM_017947	NP_060417	Q96EN8	MOCOS_HUMAN			6	1087	+			355						Missense_Mutation	SNP	ENST00000261326.5	37	c.1064A>G	CCDS11919.1	.	.	.	.	.	.	.	.	.	.	A	13.71	2.317286	0.40996	.	.	ENSG00000075643	ENST00000261326	T	0.35048	1.33	5.89	4.71	0.59529	Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.062046	0.64402	D	0.000002	T	0.59418	0.2192	M	0.87097	2.86	0.41445	D	0.987943	D	0.55385	0.971	P	0.60609	0.877	T	0.63866	-0.6540	10	0.51188	T	0.08	-19.1802	10.8384	0.46700	0.8589:0.0:0.0:0.1411	.	355	Q96EN8	MOCOS_HUMAN	C	355	ENSP00000261326:Y355C	ENSP00000261326:Y355C	Y	+	2	0	MOCOS	32039083	1.000000	0.71417	0.940000	0.37924	0.026000	0.11368	6.002000	0.70693	1.015000	0.39444	0.523000	0.50628	TAT		0.478	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1			10	65	0	0	0	0.008291	0	10	65				
ZCCHC2	54877	broad.mit.edu	37	18	60241580	60241581	+	Missense_Mutation	DNP	GT	GT	TC	rs532980655		TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	GT	GT	-	-	GT	GT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr18:60241580_60241581GT>TC	ENST00000269499.5	+	13	2684_2685	c.2266_2267GT>TC	c.(2266-2268)GTt>TCt	p.V756S	ZCCHC2_ENST00000586834.1_Missense_Mutation_p.V435S	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	756						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)	p.V756S(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						TCCTAGTCCTGTTGCTATTTCT	0.485																																							uc002lip.3		NA																	1	Substitution - Missense(1)		lung(1)	lung(1)|prostate(1)	2						c.(2266-2268)GTT>TCT		zinc finger, CCHC domain containing 2																																				SO:0001583	missense	54877				cell communication	cytoplasm	nucleic acid binding|phosphatidylinositol binding|zinc ion binding	g.chr18:60241580_60241581GT>TC	AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		Exception_encountered	18.37:g.60241580_60241581delinsTC	ENSP00000269499:p.Val756Ser					ZCCHC2_uc002lio.2_RNA|ZCCHC2_uc002liq.2_Missense_Mutation_p.V226S	p.V756S	NM_017742	NP_060212	Q9C0B9	ZCHC2_HUMAN			13	2266_2267	+			756					B2RPG6|Q8N3S1|Q9NXF6	Missense_Mutation	DNP	ENST00000269499.5	37	c.2266_2267GT>TC	CCDS45880.1																																																																																				0.485	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450083.1	NM_017742		4	70	0	0	0	0.004672	0	4	70				
ZNF407	55628	broad.mit.edu	37	18	72775115	72775115	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr18:72775115C>G	ENST00000299687.5	+	8	5438	c.5438C>G	c.(5437-5439)tCc>tGc	p.S1813C		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1813					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.S1813C(1)		central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GGCATTGTTTCCAAGTCGTAC	0.557																																							uc002llw.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(5437-5439)TCC>TGC		zinc finger protein 407 isoform 1							73.0	82.0	79.0					18																	72775115		2084	4197	6281	SO:0001583	missense	55628				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr18:72775115C>G	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.5438C>G	18.37:g.72775115C>G	ENSP00000299687:p.Ser1813Cys						p.S1813C	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN		BRCA - Breast invasive adenocarcinoma(31;0.184)	8	5495	+		Esophageal squamous(42;0.131)|Prostate(75;0.173)	1813					B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	ENST00000299687.5	37	c.5438C>G	CCDS45885.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.180001	0.78564	.	.	ENSG00000215421	ENST00000299687	T	0.11930	2.73	4.97	4.97	0.65823	.	.	.	.	.	T	0.28599	0.0708	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.02505	-1.1149	9	0.72032	D	0.01	.	16.4342	0.83869	0.0:1.0:0.0:0.0	.	1813	Q9C0G0	ZN407_HUMAN	C	1813	ENSP00000299687:S1813C	ENSP00000299687:S1813C	S	+	2	0	ZNF407	70904103	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.235000	0.78143	1.090000	0.41315	-0.140000	0.14226	TCC		0.557	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757		6	104	0	0	0	0.001984	0	6	104				
ZNF236	7776	broad.mit.edu	37	18	74587576	74587576	+	Nonsense_Mutation	SNP	C	C	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr18:74587576C>T	ENST00000253159.8	+	6	988	c.790C>T	c.(790-792)Cag>Tag	p.Q264*	ZNF236_ENST00000320610.9_Nonsense_Mutation_p.Q266*	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	264					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q264*(2)		NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CGCCTTCTCTCAGAAAGGGAA	0.527											OREG0025069	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002lmi.2		NA																	2	Substitution - Nonsense(2)		lung(2)	ovary(4)	4						c.(790-792)CAG>TAG		zinc finger protein 236							117.0	119.0	118.0					18																	74587576		2021	4180	6201	SO:0001587	stop_gained	7776				cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:74587576C>T	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.790C>T	18.37:g.74587576C>T	ENSP00000253159:p.Gln264*		OREG0025069	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1154	ZNF236_uc002lmj.2_RNA|ZNF236_uc002lmk.1_Nonsense_Mutation_p.Q264*	p.Q264*	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)	6	988	+		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)	264			C2H2-type 8.		B2RTX9|Q9UL37	Nonsense_Mutation	SNP	ENST00000253159.8	37	c.790C>T	CCDS42447.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.820175	0.90873	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	19.782	0.96420	0.0:1.0:0.0:0.0	.	.	.	.	X	264	.	ENSP00000253159:Q264X	Q	+	1	0	ZNF236	72716564	1.000000	0.71417	1.000000	0.80357	0.185000	0.23345	7.488000	0.81441	2.757000	0.94681	0.462000	0.41574	CAG		0.527	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1			10	114	0	0	0	0.006214	0	10	114				
MUC16	94025	broad.mit.edu	37	19	9088564	9088564	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr19:9088564G>T	ENST00000397910.4	-	1	3454	c.3251C>A	c.(3250-3252)cCa>cAa	p.P1084Q		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1084	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P1084Q(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGACTGAGATGGAGATACTGA	0.448																																							uc002mkp.2		NA																	2	Substitution - Missense(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(3250-3252)CCA>CAA		mucin 16							87.0	83.0	84.0					19																	9088564		2004	4188	6192	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9088564G>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.3251C>A	19.37:g.9088564G>T	ENSP00000381008:p.Pro1084Gln						p.P1084Q	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			1	3455	-			1084			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.3251C>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	4.488	0.090565	0.08632	.	.	ENSG00000181143	ENST00000397910	T	0.03272	3.99	1.51	1.51	0.23008	.	.	.	.	.	T	0.02807	0.0084	N	0.08118	0	.	.	.	D	0.58268	0.982	P	0.47673	0.554	T	0.41179	-0.9523	8	0.87932	D	0	.	6.4457	0.21875	0.0:0.0:1.0:0.0	.	1084	B5ME49	.	Q	1084	ENSP00000381008:P1084Q	ENSP00000381008:P1084Q	P	-	2	0	MUC16	8949564	0.003000	0.15002	0.010000	0.14722	0.236000	0.25371	0.857000	0.27831	1.145000	0.42336	0.305000	0.20034	CCA		0.448	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		14	61	1	0	0.000151284	0.001855	0.000178584	14	61				
CEP89	84902	broad.mit.edu	37	19	33424561	33424561	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr19:33424561C>T	ENST00000305768.5	-	8	770	c.682G>A	c.(682-684)Gca>Aca	p.A228T	CEP89_ENST00000590597.2_Missense_Mutation_p.A228T	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	228					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.A228T(1)		breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						CTTTGACGTGCTCTACCAGTT	0.328																																							uc002nty.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(682-684)GCA>ACA		coiled-coil domain containing 123							169.0	160.0	163.0					19																	33424561		2202	4299	6501	SO:0001583	missense	84902					centrosome|spindle pole		g.chr19:33424561C>T	AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.682G>A	19.37:g.33424561C>T	ENSP00000306105:p.Ala228Thr					CCDC123_uc002ntx.2_5'UTR|CCDC123_uc010edg.2_RNA|CCDC123_uc002ntz.1_Missense_Mutation_p.A228T|CCDC123_uc002nua.2_Missense_Mutation_p.A228T	p.A228T	NM_032816	NP_116205	Q96ST8	CEP89_HUMAN			8	771	-	Esophageal squamous(110;0.137)		228					B9EGA6|Q8N5J8	Missense_Mutation	SNP	ENST00000305768.5	37	c.682G>A	CCDS32987.1	.	.	.	.	.	.	.	.	.	.	C	4.445	0.082334	0.08533	.	.	ENSG00000121289	ENST00000305768	T	0.32023	1.47	5.24	-3.78	0.04333	.	1.815510	0.02400	N	0.080545	T	0.15652	0.0377	N	0.04880	-0.145	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.09377	0.001;0.004	T	0.24440	-1.0160	10	0.15499	T	0.54	0.0298	11.5584	0.50761	0.0:0.5024:0.0:0.4976	.	228;228	Q96ST8-3;Q96ST8	.;CEP89_HUMAN	T	228	ENSP00000306105:A228T	ENSP00000306105:A228T	A	-	1	0	CEP89	38116401	0.004000	0.15560	0.001000	0.08648	0.005000	0.04900	-0.404000	0.07205	-1.057000	0.03201	-0.444000	0.05651	GCA		0.328	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2	NM_032816		10	148	0	0	0	0.006214	0	10	148				
CHST8	64377	broad.mit.edu	37	19	34263411	34263411	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr19:34263411G>A	ENST00000262622.4	+	4	1476	c.718G>A	c.(718-720)Gac>Aac	p.D240N	CHST8_ENST00000438847.3_Missense_Mutation_p.D240N|CHST8_ENST00000434302.1_Missense_Mutation_p.D240N	NM_022467.3	NP_071912.2	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8	240					carbohydrate biosynthetic process (GO:0016051)|central nervous system development (GO:0007417)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)	p.D240N(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(5)	27	Esophageal squamous(110;0.162)					GGACACCTTCGACCGCCAGGG	0.627																																							uc002nus.3		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|large_intestine(1)|ovary(1)	4						c.(718-720)GAC>AAC		carbohydrate (N-acetylgalactosamine 4-0)							99.0	88.0	92.0					19																	34263411		2203	4300	6503	SO:0001583	missense	64377				carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity	g.chr19:34263411G>A	AB047801	CCDS12433.1	19q13.1	2008-02-05				ENSG00000124302		"""Sulfotransferases, membrane-bound"""	15993	protein-coding gene	gene with protein product		610190				10988300, 11001942	Standard	NM_001127895		Approved	GALNAC-4-ST1	uc002nut.4	Q9H2A9		ENST00000262622.4:c.718G>A	19.37:g.34263411G>A	ENSP00000262622:p.Asp240Asn					CHST8_uc002nut.3_Missense_Mutation_p.D240N|CHST8_uc002nuu.2_Missense_Mutation_p.D240N	p.D240N	NM_001127895	NP_001121367	Q9H2A9	CHST8_HUMAN			5	1223	+	Esophageal squamous(110;0.162)		240			Lumenal (Potential).		Q9H3N2	Missense_Mutation	SNP	ENST00000262622.4	37	c.718G>A	CCDS12433.1	.	.	.	.	.	.	.	.	.	.	G	13.87	2.365540	0.41902	.	.	ENSG00000124302	ENST00000434302;ENST00000438847;ENST00000262622	T;T;T	0.73152	-0.72;-0.72;-0.72	4.73	3.7	0.42460	.	0.130282	0.48286	N	0.000193	T	0.60143	0.2246	L	0.41492	1.28	0.34562	D	0.712453	B	0.16603	0.018	B	0.15484	0.013	T	0.63355	-0.6656	10	0.34782	T	0.22	-9.4546	11.729	0.51726	0.0865:0.0:0.9135:0.0	.	240	Q9H2A9	CHST8_HUMAN	N	240	ENSP00000392604:D240N;ENSP00000393879:D240N;ENSP00000262622:D240N	ENSP00000262622:D240N	D	+	1	0	CHST8	38955251	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	2.405000	0.44548	0.967000	0.38186	0.297000	0.19635	GAC		0.627	CHST8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451453.1	NM_022467		5	134	0	0	0	0.000602	0	5	134				
CYP2S1	29785	broad.mit.edu	37	19	41704794	41704794	+	Splice_Site	SNP	G	G	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr19:41704794G>T	ENST00000310054.4	+	5	1050		c.e5+1		CYP2S1_ENST00000542619.1_Intron	NM_030622.6	NP_085125.1	Q96SQ9	CP2S1_HUMAN	cytochrome P450, family 2, subfamily S, polypeptide 1						small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.?(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(2)	14						GATGGCACAGGTGTGGGAAGG	0.627																																							uc002opw.2		NA																	1	Unknown(1)		lung(1)	skin(1)	1						c.e5+1		cytochrome P450, family 2, subfamily S,							51.0	48.0	49.0					19																	41704794		2203	4300	6503	SO:0001630	splice_region_variant	29785				xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity	g.chr19:41704794G>T	AA301039	CCDS12573.1	19q13.2	2013-11-11	2003-01-14		ENSG00000167600	ENSG00000167600		"""Cytochrome P450s"""	15654	protein-coding gene	gene with protein product		611529	"""cytochrome P450, subfamily IIS, polypeptide 1"""			11181079	Standard	NM_030622		Approved		uc002opw.3	Q96SQ9	OTTHUMG00000182721	ENST00000310054.4:c.834+1G>T	19.37:g.41704794G>T						CYP2F1_uc010xvw.1_Intron|CYP2S1_uc010xvx.1_Intron	p.Q278_splice	NM_030622	NP_085125	Q96SQ9	CP2S1_HUMAN			5	889	+								Q9BZ66	Splice_Site	SNP	ENST00000310054.4	37	c.834_splice	CCDS12573.1	.	.	.	.	.	.	.	.	.	.	g	17.85	3.490422	0.64074	.	.	ENSG00000167600	ENST00000301173;ENST00000310054	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3982	0.83630	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CYP2S1	46396634	1.000000	0.71417	0.990000	0.47175	0.777000	0.43975	6.495000	0.73665	2.462000	0.83206	0.461000	0.40582	.		0.627	CYP2S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463287.1		Intron	11	43	1	0	3.07112e-06	0.010729	3.85732e-06	11	43				
PSG11	5680	broad.mit.edu	37	19	43523198	43523198	+	Nonsense_Mutation	SNP	C	C	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr19:43523198C>A	ENST00000401740.1	-	3	536	c.433G>T	c.(433-435)Gag>Tag	p.E145*	PSG11_ENST00000306322.7_Nonsense_Mutation_p.E23*|PSG11_ENST00000595312.1_5'UTR|PSG11_ENST00000403486.1_Nonsense_Mutation_p.E23*|PSG11_ENST00000320078.7_Nonsense_Mutation_p.E145*			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	145					female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.E145*(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				TTGGGAGTCTCCACTGTGCAG	0.507																																							uc002ovm.1		NA																	2	Substitution - Nonsense(2)		lung(2)		0						c.(433-435)GAG>TAG		pregnancy specific beta-1-glycoprotein 11							131.0	137.0	135.0					19																	43523198		2199	4294	6493	SO:0001587	stop_gained	5680				female pregnancy	extracellular region		g.chr19:43523198C>A	U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.433G>T	19.37:g.43523198C>A	ENSP00000384995:p.Glu145*					PSG11_uc002ouw.2_Nonsense_Mutation_p.E151*|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Nonsense_Mutation_p.E151*|PSG11_uc002ovn.1_Nonsense_Mutation_p.E151*|PSG11_uc002ovo.1_Nonsense_Mutation_p.E23*|PSG11_uc002ovp.1_Nonsense_Mutation_p.E23*	p.E145*	NM_002785	NP_002776	Q9UQ72	PSG11_HUMAN			3	540	-		Prostate(69;0.00682)	145					B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Nonsense_Mutation	SNP	ENST00000401740.1	37	c.433G>T	CCDS12614.2	.	.	.	.	.	.	.	.	.	.	c	12.16	1.854771	0.32791	.	.	ENSG00000243130	ENST00000320078;ENST00000403486;ENST00000306322;ENST00000401740	.	.	.	1.13	1.13	0.20643	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	5.5559	0.17115	0.0:1.0:0.0:0.0	.	.	.	.	X	145;23;23;145	.	ENSP00000304913:E23X	E	-	1	0	PSG11	48215038	0.000000	0.05858	0.013000	0.15412	0.098000	0.18820	0.014000	0.13333	0.567000	0.29293	0.184000	0.17185	GAG		0.507	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323079.1	NM_002785		31	301	1	0	3.90053e-15	0.012213	5.51696e-15	31	301				
ARHGAP35	2909	broad.mit.edu	37	19	47422502	47422502	+	Missense_Mutation	SNP	A	A	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr19:47422502A>T	ENST00000404338.3	+	1	570	c.570A>T	c.(568-570)aaA>aaT	p.K190N		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	190					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)	p.K190N(2)									AGCTTGCAAAAACAAAAAAGC	0.418																																							uc010ekv.2		NA																	2	Substitution - Missense(2)		lung(2)	central_nervous_system(1)	1						c.(568-570)AAA>AAT		glucocorticoid receptor DNA binding factor 1							91.0	86.0	87.0					19																	47422502		1892	4104	5996	SO:0001583	missense	2909				axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity	g.chr19:47422502A>T	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.570A>T	19.37:g.47422502A>T	ENSP00000385720:p.Lys190Asn						p.K190N	NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)	1	570	+		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)	190					A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	ENST00000404338.3	37	c.570A>T	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	A	14.74	2.627105	0.46840	.	.	ENSG00000160007	ENST00000317082;ENST00000501576;ENST00000404338	T	0.11385	2.78	5.76	3.54	0.40534	.	0.000000	0.85682	D	0.000000	T	0.31420	0.0796	M	0.84846	2.72	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	T	0.03566	-1.1024	10	0.87932	D	0	-22.6628	6.4723	0.22015	0.6945:0.0:0.3055:0.0	.	190	Q9NRY4-2	.	N	190	ENSP00000385720:K190N	ENSP00000324820:K190N	K	+	3	2	ARHGAP35	52114342	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	0.797000	0.26999	1.025000	0.39708	0.533000	0.62120	AAA		0.418	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491		5	82	0	0	0	0.000602	0	5	82				
KIR3DL1	3811	broad.mit.edu	37	19	55333080	55333080	+	Missense_Mutation	SNP	G	G	A	rs200064560		TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr19:55333080G>A	ENST00000391728.4	+	5	749	c.716G>A	c.(715-717)aGc>aAc	p.S239N	KIR3DL1_ENST00000541392.1_Missense_Mutation_p.S239N|KIR3DL1_ENST00000402254.2_Missense_Mutation_p.S239N|KIR3DL1_ENST00000326542.7_Missense_Mutation_p.S239N|KIR3DL1_ENST00000538269.1_Missense_Mutation_p.S239N|KIR3DL1_ENST00000358178.4_Missense_Mutation_p.S144N	NM_013289.2	NP_037421.2	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1	239	Ig-like C2-type 3.				immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)	p.S239N(2)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		GCAGGAGAGAGCGTGACCTTG	0.587																																							uc002qhk.3		NA																	2	Substitution - Missense(2)		lung(2)	ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5						c.(715-717)AGC>AAC		killer cell immunoglobulin-like receptor, three							37.0	37.0	37.0					19																	55333080		2140	4043	6183	SO:0001583	missense	3811				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity	g.chr19:55333080G>A	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000391728.4:c.716G>A	19.37:g.55333080G>A	ENSP00000375608:p.Ser239Asn					KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Missense_Mutation_p.S181N|KIR3DL1_uc010esf.2_Missense_Mutation_p.S144N|KIR3DL1_uc010yfo.1_Missense_Mutation_p.S181N|KIR3DL1_uc002qhl.3_Missense_Mutation_p.S239N	p.S239N	NM_013289	NP_037421	P43629	KI3L1_HUMAN		GBM - Glioblastoma multiforme(193;0.0192)	5	779	+			239			Extracellular (Potential).|Ig-like C2-type 3.		O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000391728.4	37	c.716G>A	CCDS42621.1	.	.	.	.	.	.	.	.	.	.	-	0.006	-2.069507	0.00382	.	.	ENSG00000167633	ENST00000402254;ENST00000538269;ENST00000541392;ENST00000355608;ENST00000391728;ENST00000326542;ENST00000358178	T;T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78;1.78	1.47	1.47	0.22746	Immunoglobulin subtype (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	11.605700	0.00725	N	0.000918	T	0.06645	0.0170	N	0.00493	-1.44	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.42310	-0.9459	10	0.02654	T	1	.	3.492	0.07641	0.7683:0.0:0.2317:0.0	.	239;144;239;239	Q15702;Q14946;F6QF33;P43629	.;.;.;KI3L1_HUMAN	N	239;239;239;217;239;239;144	ENSP00000384528:S239N;ENSP00000443350:S239N;ENSP00000442355:S239N;ENSP00000375608:S239N;ENSP00000326868:S239N;ENSP00000350901:S144N	ENSP00000326868:S239N	S	+	2	0	KIR3DL1	60024892	0.001000	0.12720	0.006000	0.13384	0.010000	0.07245	-0.005000	0.12855	0.065000	0.16485	-1.451000	0.01035	AGC		0.587	KIR3DL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141238.1	NM_013289		6	131	0	0	0	0.004482	0	6	131				
KIR3DL1	3811	broad.mit.edu	37	19	55351078	55351078	+	Intron	SNP	C	C	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr19:55351078C>G	ENST00000402254.2	+	6	1033				KIR2DS4_ENST00000339924.8_RNA			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)	p.T189R(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		GAGGGACCTACAGATGCTTCG	0.587																																							uc002qhm.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(586-588)TAC>TAG		killer cell immunoglobulin-like receptor, two							206.0	190.0	195.0					19																	55351078		2171	4159	6330	SO:0001627	intron_variant	3809					integral to plasma membrane	receptor activity	g.chr19:55351078C>G	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000402254.2:c.1000+14545C>G	19.37:g.55351078C>G						KIR2DS4_uc010yfj.1_Missense_Mutation_p.T182R|KIR2DS4_uc010yfk.1_RNA|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_Missense_Mutation_p.T189R|KIR2DS4_uc002qhn.1_Intron	p.Y196*	NM_012314	NP_036446	P43632	KI2S4_HUMAN		GBM - Glioblastoma multiforme(193;0.0192)	5	634	+			196			Extracellular (Potential).|Ig-like C2-type 2.		O43473|Q14946|Q16541	Nonsense_Mutation	SNP	ENST00000402254.2	37	c.588C>G																																																																																					0.587	KIR3DL1-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_013289		7	298	0	0	0	0.001984	0	7	298				
DCTN1	1639	broad.mit.edu	37	2	74605276	74605276	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr2:74605276C>G	ENST00000361874.3	-	2	447	c.130G>C	c.(130-132)Gtg>Ctg	p.V44L	DCTN1_ENST00000409868.1_Missense_Mutation_p.V27L|DCTN1_ENST00000409567.3_Missense_Mutation_p.V44L|DCTN1_ENST00000394003.3_Missense_Mutation_p.V44L|DCTN1_ENST00000409240.1_Missense_Mutation_p.V27L	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	44					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)	p.V44L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						ACATAGGCCACAGTGCCTCGG	0.582																																							uc002skx.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(130-132)GTG>CTG		dynactin 1 isoform 1							138.0	119.0	125.0					2																	74605276		2203	4300	6503	SO:0001583	missense	1639				cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	centrosome|cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding	g.chr2:74605276C>G		CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.130G>C	2.37:g.74605276C>G	ENSP00000354791:p.Val44Leu					DCTN1_uc002skw.1_Missense_Mutation_p.V27L|DCTN1_uc010ffd.2_Missense_Mutation_p.V44L|DCTN1_uc002sky.2_Missense_Mutation_p.V27L	p.V44L	NM_004082	NP_004073	Q14203	DCTN1_HUMAN			2	441	-			44					A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	ENST00000361874.3	37	c.130G>C	CCDS1939.1	.	.	.	.	.	.	.	.	.	.	C	31	5.066865	0.93898	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000409240;ENST00000409868;ENST00000409567;ENST00000458655;ENST00000454119;ENST00000417090;ENST00000437375;ENST00000413111;ENST00000421392;ENST00000440727	T;T;T;T;T;T;T;T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31	5.14	5.14	0.70334	Cytoskeleton-associated protein, Gly-rich domain (3);	0.000000	0.39083	N	0.001478	D	0.88258	0.6388	L	0.61387	1.9	0.80722	D	1	D;P;D;P	0.55172	0.97;0.938;0.97;0.936	P;P;D;P	0.71870	0.876;0.863;0.975;0.827	D	0.89277	0.3609	10	0.72032	D	0.01	-11.7762	17.3563	0.87336	0.0:1.0:0.0:0.0	.	44;27;44;44	E9PGE1;E9PFS5;Q14203;A8MY36	.;.;DCTN1_HUMAN;.	L	44;44;27;27;27;44;51;27;48;27;27;27;27	ENSP00000354791:V44L;ENSP00000377571:V44L;ENSP00000386406:V27L;ENSP00000387327:V27L;ENSP00000386843:V44L;ENSP00000414315:V51L;ENSP00000404038:V27L;ENSP00000402509:V48L;ENSP00000395312:V27L;ENSP00000413268:V27L;ENSP00000409363:V27L;ENSP00000400059:V27L	ENSP00000354791:V44L	V	-	1	0	DCTN1	74458784	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	7.724000	0.84798	2.392000	0.81423	0.455000	0.32223	GTG		0.582	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3	NM_004082		11	104	0	0	0	0.010729	0	11	104				
TTL	150465	broad.mit.edu	37	2	113260740	113260740	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr2:113260740A>G	ENST00000233336.6	+	5	1048	c.857A>G	c.(856-858)cAa>cGa	p.Q286R		NM_153712.4	NP_714923.1	Q8NG68	TTL_HUMAN	tubulin tyrosine ligase	286	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)|microtubule cytoskeleton organization (GO:0000226)|regulation of axon extension (GO:0030516)		ATP binding (GO:0005524)|tubulin-tyrosine ligase activity (GO:0004835)	p.Q286R(1)		breast(1)|large_intestine(2)|ovary(1)	4		Ovarian(717;0.024)		BRCA - Breast invasive adenocarcinoma(221;6.17e-07)|STAD - Stomach adenocarcinoma(1183;0.00644)		ATCTTACTACAAATCAAACAT	0.333			T	ETV6	ALL																																		uc002thu.2		NA		Dom	yes		2	2q13	150465	T	tubulin tyrosine ligase			L	ETV6		ALL		1	Substitution - Missense(1)		lung(1)		0						c.(856-858)CAA>CGA		tubulin tyrosine ligase							48.0	51.0	50.0					2																	113260740		2203	4300	6503	SO:0001583	missense	150465				protein modification process		ATP binding|tubulin-tyrosine ligase activity	g.chr2:113260740A>G		CCDS2096.1	2q13	2010-04-21			ENSG00000114999	ENSG00000114999	6.3.2.25		21586	protein-coding gene	gene with protein product		608291				11431336	Standard	NM_153712		Approved	MGC46235	uc002thu.3	Q8NG68	OTTHUMG00000131316	ENST00000233336.6:c.857A>G	2.37:g.113260740A>G	ENSP00000233336:p.Gln286Arg					TTL_uc010fkm.1_RNA	p.Q286R	NM_153712	NP_714923	Q8NG68	TTL_HUMAN		BRCA - Breast invasive adenocarcinoma(221;6.17e-07)|STAD - Stomach adenocarcinoma(1183;0.00644)	5	1036	+		Ovarian(717;0.024)	286			TTL.		Q585T3|Q7Z302|Q8N426	Missense_Mutation	SNP	ENST00000233336.6	37	c.857A>G	CCDS2096.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.309627	0.81247	.	.	ENSG00000114999	ENST00000233336	T	0.05382	3.45	5.6	5.6	0.85130	.	0.113259	0.64402	D	0.000008	T	0.15003	0.0362	L	0.31578	0.945	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.09509	-1.0671	10	0.32370	T	0.25	.	14.765	0.69632	1.0:0.0:0.0:0.0	.	286	Q8NG68	TTL_HUMAN	R	286	ENSP00000233336:Q286R	ENSP00000233336:Q286R	Q	+	2	0	TTL	112977211	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.816000	0.91979	2.124000	0.65301	0.533000	0.62120	CAA		0.333	TTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254085.2	NM_153712		9	67	0	0	0	0.004482	0	9	67				
RBMS1	5937	broad.mit.edu	37	2	161223815	161223815	+	Nonsense_Mutation	SNP	C	C	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr2:161223815C>A	ENST00000348849.3	-	2	593	c.163G>T	c.(163-165)Gga>Tga	p.G55*	RBMS1_ENST00000474820.1_5'UTR|RBMS1_ENST00000409289.2_Nonsense_Mutation_p.G22*|RBMS1_ENST00000409972.1_Nonsense_Mutation_p.G22*|RBMS1_ENST00000409075.1_Nonsense_Mutation_p.G22*|RBMS1_ENST00000392753.3_Nonsense_Mutation_p.G55*	NM_002897.4|NM_016836.3	NP_002888.1|NP_058520.1	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting protein 1	55					DNA replication (GO:0006260)|RNA processing (GO:0006396)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.G55*(1)	PLA2R1/RBMS1(2)								TGATCCCATCCTGAgttgcta	0.552																																							uc002ubo.2		NA																	1	Substitution - Nonsense(1)		lung(1)		0						c.(163-165)GGA>TGA		RNA binding motif, single stranded interacting							150.0	132.0	138.0					2																	161223815		2203	4300	6503	SO:0001587	stop_gained	5937				DNA replication|RNA processing	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding|single-stranded DNA binding	g.chr2:161223815C>A	D28482	CCDS2213.1	2q24.2	2013-02-12			ENSG00000153250	ENSG00000153250		"""RNA binding motif (RRM) containing"""	9907	protein-coding gene	gene with protein product	"""suppressor of cdc 2 (cdc13) with RNA binding motif 2"", ""c-myc gene single strand binding protein 2"""	602310	"""chromosome 2 open reading frame 12"""	C2orf12		8041632, 8134115, 7838710	Standard	NM_016836		Approved	SCR2, MSSP-1, MSSP-2, MSSP-3, YC1, HCC-4, DKFZp564H0764	uc002ubo.3	P29558	OTTHUMG00000132031	ENST00000348849.3:c.163G>T	2.37:g.161223815C>A	ENSP00000294904:p.Gly55*					RBMS1_uc002ubj.2_Nonsense_Mutation_p.G22*|RBMS1_uc002ubk.2_Nonsense_Mutation_p.G22*|RBMS1_uc002ubl.2_Nonsense_Mutation_p.G53*|RBMS1_uc002ubn.2_Nonsense_Mutation_p.G55*|RBMS1_uc002ubi.3_Nonsense_Mutation_p.G55*|RBMS1_uc002ubm.2_Nonsense_Mutation_p.G22*|RBMS1_uc002ubp.2_Nonsense_Mutation_p.G55*|RBMS1_uc010fox.2_Nonsense_Mutation_p.G55*	p.G55*	NM_016836	NP_058520	P29558	RBMS1_HUMAN			2	607	-			55					Q14869|Q15433|Q53P46|Q53QX8|Q53RG6|Q8WV20	Nonsense_Mutation	SNP	ENST00000348849.3	37	c.163G>T	CCDS2213.1	.	.	.	.	.	.	.	.	.	.	C	36	5.877109	0.97055	.	.	ENSG00000153250	ENST00000348849;ENST00000409075;ENST00000409289;ENST00000392753;ENST00000409972;ENST00000428519	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.6217	0.95660	0.0:1.0:0.0:0.0	.	.	.	.	X	55;22;22;55;22;22	.	ENSP00000294904:G55X	G	-	1	0	RBMS1	160932061	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.701000	0.68325	2.795000	0.96236	0.655000	0.94253	GGA		0.552	RBMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255043.4	NM_016836		11	107	1	0	3.86212e-05	0.008291	4.62865e-05	11	107				
ITGA6	3655	broad.mit.edu	37	2	173344444	173344444	+	Silent	SNP	G	G	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr2:173344444G>A	ENST00000264106.6	+	11	1784	c.1581G>A	c.(1579-1581)gcG>gcA	p.A527A	ITGA6_ENST00000409532.1_Silent_p.A369A|ITGA6_ENST00000343713.4_Silent_p.A483A|ITGA6_ENST00000375221.2_Silent_p.A527A|ITGA6_ENST00000409080.1_Silent_p.A488A|ITGA6_ENST00000264107.7_Silent_p.A488A|AC093818.1_ENST00000442417.1_RNA			P23229	ITA6_HUMAN	integrin, alpha 6	527					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.A488A(2)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			AGAAAACAGCGTGTGGGGCGC	0.488																																							uc002uhp.1		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(1)|lung(1)	2						c.(1462-1464)GCG>GCA		integrin alpha chain, alpha 6 isoform a							124.0	131.0	129.0					2																	173344444		2203	4300	6503	SO:0001819	synonymous_variant	3655				blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity	g.chr2:173344444G>A		CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.1581G>A	2.37:g.173344444G>A						ITGA6_uc010zdy.1_Silent_p.A369A|ITGA6_uc002uho.1_Silent_p.A488A|ITGA6_uc010fqm.1_Silent_p.A134A	p.A488A	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0979)		10	1667	+			527			Extracellular (Potential).		B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Silent	SNP	ENST00000264106.6	37	c.1464G>A																																																																																					0.488	ITGA6-201	KNOWN	basic	protein_coding	protein_coding				26	208	0	0	0	0.003954	0	26	208				
HOXD10	3236	broad.mit.edu	37	2	176983731	176983731	+	Silent	SNP	T	T	C			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr2:176983731T>C	ENST00000249501.4	+	2	1050	c.795T>C	c.(793-795)agT>agC	p.S265S	HOXD-AS2_ENST00000440016.2_RNA|HOXD10_ENST00000490088.2_3'UTR	NM_002148.3	NP_002139.2	P28358	HXD10_HUMAN	homeobox D10	265					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|neuromuscular process (GO:0050905)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		CTGCAAAGAGTGGCAGAAAGA	0.423																																							uc002ukj.2		NA																	0				ovary(1)	1						c.(793-795)AGT>AGC		homeobox D10							71.0	75.0	74.0					2																	176983731		2203	4300	6503	SO:0001819	synonymous_variant	3236					nucleus	sequence-specific DNA binding	g.chr2:176983731T>C		CCDS2266.1	2q31.1	2014-09-17	2005-12-22		ENSG00000128710	ENSG00000128710		"""Homeoboxes / ANTP class : HOXL subclass"""	5133	protein-coding gene	gene with protein product		142984	"""homeo box D10"""	HOX4, HOX4D		1973146, 1358459	Standard	NM_002148		Approved		uc002ukj.3	P28358	OTTHUMG00000132511	ENST00000249501.4:c.795T>C	2.37:g.176983731T>C							p.S265S	NM_002148	NP_002139	P28358	HXD10_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)	2	865	+			265					Q6NT10	Silent	SNP	ENST00000249501.4	37	c.795T>C	CCDS2266.1																																																																																				0.423	HOXD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255692.2			5	69	0	0	0	0.001168	0	5	69				
FRG1B	284802	broad.mit.edu	37	20	29625885	29625885	+	Missense_Mutation	SNP	A	A	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr20:29625885A>T	ENST00000278882.3	+	5	509	c.129A>T	c.(127-129)aaA>aaT	p.K43N	FRG1B_ENST00000439954.2_Missense_Mutation_p.K48N|FRG1B_ENST00000358464.4_Missense_Mutation_p.K43N			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	43								p.K43N(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TCGCCCTGAAATCTGGCTATG	0.353																																							uc010ztl.1		NA																	2	Substitution - Missense(2)		prostate(2)		0						c.(37-39)AAA>AAT		Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.																																				SO:0001583	missense	284802							g.chr20:29625885A>T			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.129A>T	20.37:g.29625885A>T	ENSP00000278882:p.Lys43Asn					FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron	p.K13N							2	71	+								C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37	c.39A>T		.	.	.	.	.	.	.	.	.	.	a	10.23	1.292024	0.23564	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.62364	0.03	1.68	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.74145	0.3678	.	.	.	0.48762	D	0.999701	D	0.71674	0.998	D	0.79784	0.993	T	0.74598	-0.3612	9	0.87932	D	0	.	7.3757	0.26827	1.0:0.0:0.0:0.0	.	48	F5H5R5	.	N	43;48;43	ENSP00000408863:K48N	ENSP00000278882:K43N	K	+	3	2	FRG1B	28239546	1.000000	0.71417	1.000000	0.80357	0.064000	0.16182	0.595000	0.24029	1.028000	0.39785	0.155000	0.16302	AAA		0.353	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579		5	100	0	0	0	0.00308	0	5	100				
LAMA5	3911	broad.mit.edu	37	20	60904066	60904066	+	Silent	SNP	G	G	C			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr20:60904066G>C	ENST00000252999.3	-	34	4347	c.4281C>G	c.(4279-4281)ctC>ctG	p.L1427L		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1427	Domain IV 1 (domain IV B).				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)	p.L1427L(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			AGAAGAGGGAGAGGGAAGCAG	0.652																																							uc002ycq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)|skin(1)	3						c.(4279-4281)CTC>CTG		laminin alpha 5 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						53.0	57.0	56.0					20																	60904066		2203	4300	6503	SO:0001819	synonymous_variant	3911				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding	g.chr20:60904066G>C	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.4281C>G	20.37:g.60904066G>C							p.L1427L	NM_005560	NP_005551	O15230	LAMA5_HUMAN	BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		34	4348	-	Breast(26;1.57e-08)		1427			Domain IV 1 (domain IV B).		Q8TDF8|Q8WZA7|Q9H1P1	Silent	SNP	ENST00000252999.3	37	c.4281C>G	CCDS33502.1																																																																																				0.652	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560		7	51	0	0	0	0.001984	0	7	51				
TOM1	10043	broad.mit.edu	37	22	35728979	35728979	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr22:35728979A>G	ENST00000449058.2	+	9	1030	c.905A>G	c.(904-906)gAa>gGa	p.E302G	TOM1_ENST00000425375.1_Missense_Mutation_p.E257G|TOM1_ENST00000382034.5_3'UTR|TOM1_ENST00000411850.1_Missense_Mutation_p.E302G|TOM1_ENST00000436462.2_Missense_Mutation_p.E264G|MIR3909_ENST00000579518.1_RNA|TOM1_ENST00000447733.1_Missense_Mutation_p.E269G	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	302	GAT. {ECO:0000255|PROSITE- ProRule:PRU00373}.				endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)	p.E302G(1)		NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						TGTAGGTTTGAACGGTTCCGA	0.507																																							uc003ann.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(904-906)GAA>GGA		target of myb1 isoform 1							206.0	155.0	172.0					22																	35728979		2203	4300	6503	SO:0001583	missense	10043				endocytosis|endosome transport|intracellular protein transport	cytosol|early endosome|membrane	protein binding	g.chr22:35728979A>G	AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.905A>G	22.37:g.35728979A>G	ENSP00000394466:p.Glu302Gly					TOM1_uc011ami.1_Missense_Mutation_p.E269G|TOM1_uc011amj.1_Missense_Mutation_p.E145G|TOM1_uc003ans.2_Missense_Mutation_p.E145G|TOM1_uc011amk.1_Missense_Mutation_p.E264G|TOM1_uc003anp.2_Missense_Mutation_p.E302G|TOM1_uc011aml.1_Missense_Mutation_p.E257G|TOM1_uc003ano.2_RNA|TOM1_uc003anq.2_Missense_Mutation_p.E296G|TOM1_uc003anr.2_Missense_Mutation_p.E145G	p.E302G	NM_005488	NP_005479	O60784	TOM1_HUMAN			9	1030	+			302			GAT.		B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Missense_Mutation	SNP	ENST00000449058.2	37	c.905A>G	CCDS13913.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.495510	0.85069	.	.	ENSG00000100284	ENST00000447733;ENST00000456128;ENST00000449058;ENST00000411850;ENST00000425375;ENST00000412456;ENST00000451197;ENST00000436462	T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87	4.99	4.99	0.66335	GAT (2);	0.175329	0.53938	D	0.000051	T	0.64929	0.2643	M	0.83012	2.62	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;0.996;0.998;0.993	D;D;D;D;D	0.80764	0.994;0.974;0.983;0.94;0.965	T	0.65747	-0.6093	10	0.30854	T	0.27	-10.9932	13.5883	0.61944	1.0:0.0:0.0:0.0	.	257;264;311;302;302	O60784-3;E7EPD0;B4DKQ5;O60784-2;O60784	.;.;.;.;TOM1_HUMAN	G	269;296;302;302;257;39;311;264	ENSP00000398876:E269G;ENSP00000393714:E296G;ENSP00000394466:E302G;ENSP00000413697:E302G;ENSP00000394924:E257G;ENSP00000402556:E264G	ENSP00000413697:E302G	E	+	2	0	TOM1	34058979	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.119000	0.71590	2.016000	0.59253	0.533000	0.62120	GAA		0.507	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320641.1	NM_005488		6	98	0	0	0	0.001984	0	6	98				
EFCAB6	64800	broad.mit.edu	37	22	43996129	43996129	+	Missense_Mutation	SNP	C	C	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr22:43996129C>A	ENST00000262726.7	-	23	2949	c.2696G>T	c.(2695-2697)gGa>gTa	p.G899V	EFCAB6_ENST00000396231.2_Missense_Mutation_p.G747V	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	899	EF-hand 10. {ECO:0000255|PROSITE- ProRule:PRU00448}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.G899V(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				GTGCCCTTTTCCCTCGGTGTC	0.428																																							uc003bdy.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7						c.(2695-2697)GGA>GTA		CAP-binding protein complex interacting protein							118.0	122.0	121.0					22																	43996129		2203	4300	6503	SO:0001583	missense	64800				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding	g.chr22:43996129C>A	Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.2696G>T	22.37:g.43996129C>A	ENSP00000262726:p.Gly899Val					EFCAB6_uc003bdz.1_Missense_Mutation_p.G747V|EFCAB6_uc010gzi.1_Missense_Mutation_p.G747V|EFCAB6_uc010gzj.1_Missense_Mutation_p.G125V	p.G899V	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN			23	2911	-		Ovarian(80;0.0247)|all_neural(38;0.025)	899			EF-hand 10.		A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	ENST00000262726.7	37	c.2696G>T	CCDS14049.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.786537	0.49997	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	T;T	0.10573	2.86;2.86	5.0	3.93	0.45458	EF-hand-like domain (1);	0.261522	0.31145	N	0.008165	T	0.21841	0.0526	L	0.53249	1.67	0.29534	N	0.852576	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.974	T	0.02491	-1.1151	10	0.59425	D	0.04	-31.0659	5.5648	0.17165	0.0:0.6869:0.2047:0.1084	.	747;899	Q5THR3-2;Q5THR3	.;EFCB6_HUMAN	V	747;899	ENSP00000379533:G747V;ENSP00000262726:G899V	ENSP00000262726:G899V	G	-	2	0	EFCAB6	42327462	0.078000	0.21339	0.994000	0.49952	0.818000	0.46254	0.221000	0.17680	2.595000	0.87683	0.655000	0.94253	GGA		0.428	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785		24	99	1	0	5.35356e-11	0.00278	7.18383e-11	24	99				
RFTN1	23180	broad.mit.edu	37	3	16411656	16411656	+	Silent	SNP	T	T	C			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr3:16411656T>C	ENST00000334133.4	-	6	1229	c.957A>G	c.(955-957)ttA>ttG	p.L319L	RFTN1_ENST00000432519.1_Silent_p.L283L|RFTN1_ENST00000483671.1_5'UTR	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	319					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)	p.L319L(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						TCATGTGCTCTAACCAGTTGG	0.517																																							uc003cay.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(955-957)TTA>TTG		raft-linking protein							202.0	186.0	191.0					3																	16411656		2203	4300	6503	SO:0001819	synonymous_variant	23180					plasma membrane		g.chr3:16411656T>C	D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.957A>G	3.37:g.16411656T>C						RFTN1_uc010hes.2_Silent_p.L283L	p.L319L	NM_015150	NP_055965	Q14699	RFTN1_HUMAN			6	1239	-			319					Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Silent	SNP	ENST00000334133.4	37	c.957A>G	CCDS33712.1																																																																																				0.517	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346908.1	NM_015150		29	170	0	0	0	0.009535	0	29	170				
USP4	7375	broad.mit.edu	37	3	49335338	49335338	+	Silent	SNP	A	A	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr3:49335338A>T	ENST00000265560.4	-	13	1702	c.1656T>A	c.(1654-1656)ggT>ggA	p.G552G	USP4_ENST00000351842.4_Silent_p.G505G|USP4_ENST00000488520.1_5'Flank	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	552	USP.|Ubiquitin-like 2.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.G552G(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		TGTGGTTTAAACCTTCATCCA	0.433																																							uc003cwq.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)|urinary_tract(1)|lung(1)	4						c.(1654-1656)GGT>GGA		ubiquitin specific protease 4 isoform a							155.0	132.0	140.0					3																	49335338		2203	4300	6503	SO:0001819	synonymous_variant	7375				negative regulation of protein ubiquitination|protein deubiquitination|protein localization at cell surface|regulation of protein stability|ubiquitin-dependent protein catabolic process	lysosome|nucleus	adenosine receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chr3:49335338A>T	U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.1656T>A	3.37:g.49335338A>T						USP4_uc003cwo.2_Silent_p.G264G|USP4_uc003cwp.2_Silent_p.G282G|USP4_uc003cwr.2_Silent_p.G505G	p.G552G	NM_003363	NP_003354	Q13107	UBP4_HUMAN		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)	13	1735	-		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)	552					A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Silent	SNP	ENST00000265560.4	37	c.1656T>A	CCDS2793.1	.	.	.	.	.	.	.	.	.	.	A	10.59	1.392632	0.25118	.	.	ENSG00000114316	ENST00000431357	.	.	.	5.6	3.21	0.36854	.	.	.	.	.	T	0.55178	0.1904	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46247	-0.9205	4	.	.	.	-17.716	6.8174	0.23839	0.6011:0.322:0.0769:0.0	.	.	.	.	I	291	.	.	F	-	1	0	USP4	49310342	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.250000	0.32850	0.404000	0.25506	0.528000	0.53228	TTT		0.433	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346069.1	NM_199443		8	47	0	0	0	0.004482	0	8	47				
DNAH1	25981	broad.mit.edu	37	3	52416426	52416426	+	Silent	SNP	G	G	A	rs199613124		TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr3:52416426G>A	ENST00000420323.2	+	50	8157	c.7896G>A	c.(7894-7896)gcG>gcA	p.A2632A		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2632	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.A2632A(2)		cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TGCTCAAGGCGGGCCTACAGA	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		20323	0.0		0.001	False		,,,				2504	0.0						uc011bef.1		NA																	2	Substitution - coding silent(2)		lung(2)	large_intestine(3)	3						c.(7894-7896)GCG>GCA		dynein, axonemal, heavy chain 1		G		1,4235		0,1,2117	172.0	179.0	177.0		7896	-6.3	0.9	3		177	3,8461		0,3,4229	yes	coding-synonymous	DNAH1	NM_015512.4		0,4,6346	AA,AG,GG		0.0354,0.0236,0.0315		2632/4266	52416426	4,12696	2118	4232	6350	SO:0001819	synonymous_variant	25981				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr3:52416426G>A	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.7896G>A	3.37:g.52416426G>A						DNAH1_uc003ddv.2_5'Flank	p.A2632A	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	50	8157	+			2632			AAA 4 (By similarity).		B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Silent	SNP	ENST00000420323.2	37	c.7896G>A	CCDS46842.1																																																																																				0.592	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512		16	134	0	0	0	0.003163	0	16	134				
EPHA6	285220	broad.mit.edu	37	3	96533506	96533506	+	Silent	SNP	G	G	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr3:96533506G>T	ENST00000389672.5	+	1	77	c.39G>T	c.(37-39)ccG>ccT	p.P13P	EPHA6_ENST00000542517.1_5'Flank|EPHA6_ENST00000470610.2_Silent_p.P13P	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	0						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)	p.P13P(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						GGAGCTCCCCGGCGCCGCAGG	0.721																																							uc010how.1		NA																	1	Substitution - coding silent(1)		lung(1)	stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						c.(37-39)CCG>CCT		EPH receptor A6 isoform a							17.0	22.0	20.0					3																	96533506		2062	4181	6243	SO:0001819	synonymous_variant	285220					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr3:96533506G>T	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.39G>T	3.37:g.96533506G>T						EPHA6_uc003drp.1_Silent_p.P13P	p.P13P	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN			1	82	+			Error:Variant_position_missing_in_Q9UF33_after_alignment					D6RAL5	Silent	SNP	ENST00000389672.5	37	c.39G>T	CCDS46876.1																																																																																				0.721	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3	NM_001080448		5	31	1	0	0.000602214	0.000602	0.000695203	5	31				
CCDC14	64770	broad.mit.edu	37	3	123633720	123633720	+	Missense_Mutation	SNP	C	C	A	rs148584055	byFrequency	TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr3:123633720C>A	ENST00000488653.2	-	13	2858	c.2768G>T	c.(2767-2769)cGt>cTt	p.R923L	CCDC14_ENST00000433542.2_Missense_Mutation_p.R882L|CCDC14_ENST00000485727.1_Missense_Mutation_p.R723L|CCDC14_ENST00000483247.1_5'UTR|CCDC14_ENST00000489746.1_Missense_Mutation_p.R723L|CCDC14_ENST00000310351.4_Missense_Mutation_p.R763L			Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	923					substantia nigra development (GO:0021762)	centrosome (GO:0005813)		p.R763L(1)|p.R882L(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)	21		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		TTGTTCATCACGAGAAGTGAA	0.433																																							uc011bjx.1		NA																	2	Substitution - Missense(2)		lung(2)		0						c.(2767-2769)CGT>CTT		coiled-coil domain containing 14							54.0	51.0	52.0					3																	123633720		2203	4300	6503	SO:0001583	missense	64770					centrosome		g.chr3:123633720C>A	AL122079	CCDS3025.2	3q21.1	2014-03-20			ENSG00000175455	ENSG00000175455			25766	protein-coding gene	gene with protein product						12477932	Standard	NM_022757		Approved	FLJ12892, DKFZp434L1050	uc010hrt.3	Q49A88	OTTHUMG00000153005	ENST00000488653.2:c.2768G>T	3.37:g.123633720C>A	ENSP00000420180:p.Arg923Leu					CCDC14_uc003egv.3_Missense_Mutation_p.R564L|CCDC14_uc003egx.3_Missense_Mutation_p.R723L|CCDC14_uc010hrt.2_Missense_Mutation_p.R882L|CCDC14_uc003egy.3_Missense_Mutation_p.R723L|CCDC14_uc003egz.2_3'UTR	p.R923L	NM_022757	NP_073594	Q49A88	CCD14_HUMAN		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)	13	2859	-		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)	923					B7Z2T2|B8ZZ41|B8ZZ58|D3DN98|Q7Z3N3|Q86T30|Q8IWF8|Q8WUJ8|Q96K47|Q9H9A3|Q9UFH0	Missense_Mutation	SNP	ENST00000488653.2	37	c.2768G>T		.	.	.	.	.	.	.	.	.	.	C	13.73	2.324456	0.41197	.	.	ENSG00000175455	ENST00000488653;ENST00000310351;ENST00000485727;ENST00000489746;ENST00000433542;ENST00000409697	T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77	5.04	1.05	0.20165	.	0.482438	0.21925	N	0.067108	T	0.37433	0.1003	L	0.53249	1.67	0.28153	N	0.929298	B;B;B	0.22080	0.064;0.064;0.037	B;B;B	0.22601	0.04;0.04;0.04	T	0.30387	-0.9980	10	0.51188	T	0.08	.	5.3343	0.15949	0.2527:0.5457:0.0:0.2017	.	923;882;764	Q49A88;Q49A88-6;Q49A88-5	CCD14_HUMAN;.;.	L	923;763;723;723;882;904	ENSP00000420180:R923L;ENSP00000312031:R763L;ENSP00000418002:R723L;ENSP00000418403:R723L;ENSP00000395706:R882L;ENSP00000386866:R904L	ENSP00000312031:R763L	R	-	2	0	CCDC14	125116410	0.017000	0.18338	0.997000	0.53966	0.946000	0.59487	-0.217000	0.09253	0.332000	0.23536	0.585000	0.79938	CGT		0.433	CCDC14-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_022757		5	28	1	0	0.00116845	0.001168	0.00131033	5	28				
HTRA3	94031	broad.mit.edu	37	4	8307713	8307713	+	Silent	SNP	T	T	C			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr4:8307713T>C	ENST00000307358.2	+	9	1416	c.1212T>C	c.(1210-1212)gaT>gaC	p.D404D		NM_053044.3	NP_444272.1	P83110	HTRA3_HUMAN	HtrA serine peptidase 3	404	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.D404D(1)		central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|prostate(1)|urinary_tract(1)	18						GCATCCAAGATGGTGACATCA	0.652																																							uc003gla.2		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1210-1212)GAT>GAC		HtrA serine peptidase 3 precursor							106.0	93.0	98.0					4																	8307713		2203	4300	6503	SO:0001819	synonymous_variant	94031				proteolysis|regulation of cell growth	extracellular region	insulin-like growth factor binding|serine-type endopeptidase activity	g.chr4:8307713T>C	AY040094	CCDS3400.1, CCDS75105.1	4p16.1	2008-02-05			ENSG00000170801	ENSG00000170801			30406	protein-coding gene	gene with protein product	"""pregnancy-related serine protease"""	608785				12513693, 14500695	Standard	XM_005248040		Approved	Tasp, Prsp	uc003gla.3	P83110	OTTHUMG00000090561	ENST00000307358.2:c.1212T>C	4.37:g.8307713T>C							p.D404D	NM_053044	NP_444272	P83110	HTRA3_HUMAN			9	1416	+			404			PDZ.		Q7Z7A2	Silent	SNP	ENST00000307358.2	37	c.1212T>C	CCDS3400.1																																																																																				0.652	HTRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092669.1	NM_053044		4	73	0	0	0	0.001168	0	4	73				
ENAM	10117	broad.mit.edu	37	4	71510435	71510435	+	Missense_Mutation	SNP	G	G	C			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr4:71510435G>C	ENST00000396073.3	+	9	3573	c.3292G>C	c.(3292-3294)Gag>Cag	p.E1098Q	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	1098					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)		p.E1098Q(1)		haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			CACATTGGTTGAGTTAGCTAC	0.428																																							uc011caw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(3292-3294)GAG>CAG		enamelin precursor							102.0	99.0	100.0					4																	71510435		2203	4300	6503	SO:0001583	missense	10117				bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel	g.chr4:71510435G>C	AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.3292G>C	4.37:g.71510435G>C	ENSP00000379383:p.Glu1098Gln						p.E1098Q	NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	Lung(101;0.235)		9	3573	+			1098					Q17RI5|Q9H3D1	Missense_Mutation	SNP	ENST00000396073.3	37	c.3292G>C	CCDS3544.2	.	.	.	.	.	.	.	.	.	.	G	10.31	1.313725	0.23908	.	.	ENSG00000132464	ENST00000396073	T	0.32515	1.45	5.65	4.78	0.61160	.	0.626507	0.15042	N	0.283809	T	0.43299	0.1241	M	0.65498	2.005	0.22552	N	0.998994	P	0.51791	0.948	P	0.54270	0.747	T	0.25293	-1.0136	10	0.27082	T	0.32	-0.1312	10.0934	0.42460	0.0968:0.0:0.9032:0.0	.	1098	Q9NRM1	ENAM_HUMAN	Q	1098	ENSP00000379383:E1098Q	ENSP00000379383:E1098Q	E	+	1	0	ENAM	71729299	0.007000	0.16637	0.551000	0.28230	0.085000	0.17905	1.433000	0.34947	1.460000	0.47911	0.655000	0.94253	GAG		0.428	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	NM_031889		6	78	0	0	0	0.001168	0	6	78				
HSP90AB3P	3327	broad.mit.edu	37	4	88814431	88814431	+	IGR	SNP	A	A	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr4:88814431A>T								MEPE (46462 upstream) : SPP1 (82387 downstream)																							AAGGAGACACAGAAGTCCACC	0.522																																							uc010iko.1		NA																	0					NA						c.(1057-1059)CAG>CTG		SubName: Full=Heat shock protein 90kDa alpha (Cytosolic), class B member 1, isoform CRA_a; SubName: Full=cDNA, FLJ92550, Homo sapiens heat shock 90kDa protein 1, beta (HSPCB), mRNA;																																				SO:0001628	intergenic_variant	0							g.chr4:88814431A>T																													4.37:g.88814431A>T							p.Q353L							4	1058	+									Missense_Mutation	SNP		37	c.1058A>T																																																																																				0	0.522									6	89	0	0	0	0.001168	0	6	89				
TBCK	93627	broad.mit.edu	37	4	106967751	106967751	+	Silent	SNP	G	G	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr4:106967751G>A	ENST00000273980.5	-	27	3105	c.2658C>T	c.(2656-2658)ctC>ctT	p.L886L	TBCK_ENST00000394706.3_Silent_p.L847L|TBCK_ENST00000394708.2_Silent_p.L886L|TBCK_ENST00000361687.4_Silent_p.L823L|TBCK_ENST00000432496.2_Silent_p.L886L					TBC1 domain containing kinase									p.L886L(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						ATGGGATGGTGAGGAGGCCTG	0.423																																							uc010ilv.2		NA																	1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5						c.(2656-2658)CTC>CTT		TBC domain-containing protein kinase-like							124.0	120.0	121.0					4																	106967751		2203	4300	6503	SO:0001819	synonymous_variant	93627					intracellular	Rab GTPase activator activity	g.chr4:106967751G>A		CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.2658C>T	4.37:g.106967751G>A						TBCK_uc003hyb.2_Silent_p.L629L|TBCK_uc003hye.2_Silent_p.L847L|TBCK_uc003hyc.2_Silent_p.L823L|TBCK_uc003hyd.2_Silent_p.L714L|TBCK_uc003hyf.2_Silent_p.L886L	p.L886L	NM_001163435	NP_001156907	Q8TEA7	TBCK_HUMAN			26	3023	-			886			Rhodanese.			Silent	SNP	ENST00000273980.5	37	c.2658C>T	CCDS54788.1																																																																																				0.423	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	NM_033115		7	54	0	0	0	0.001984	0	7	54				
RXFP1	59350	broad.mit.edu	37	4	159572994	159572994	+	Silent	SNP	A	A	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr4:159572994A>T	ENST00000307765.5	+	18	2312	c.2061A>T	c.(2059-2061)ccA>ccT	p.P687P	RXFP1_ENST00000448688.2_Silent_p.P582P|RXFP1_ENST00000343542.5_Silent_p.P639P|RXFP1_ENST00000470033.1_Silent_p.P654P|RXFP1_ENST00000460056.2_Silent_p.P606P	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	687					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)	p.P687P(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		CCACAAGACCATTTAAAGAAA	0.363																																							uc003ipz.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(2059-2061)CCA>CCT		relaxin/insulin-like family peptide receptor 1							97.0	89.0	91.0					4																	159572994		1850	4089	5939	SO:0001819	synonymous_variant	59350					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding	g.chr4:159572994A>T	AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.2061A>T	4.37:g.159572994A>T						RXFP1_uc011cja.1_Silent_p.P582P|RXFP1_uc010iqo.2_Silent_p.P639P|RXFP1_uc011cjb.1_Silent_p.P585P|RXFP1_uc010iqk.2_Silent_p.P555P|RXFP1_uc011cjc.1_Silent_p.P606P|RXFP1_uc011cjd.1_Silent_p.P606P|RXFP1_uc010iql.2_Silent_p.P531P|RXFP1_uc011cje.1_Silent_p.P714P|RXFP1_uc010iqm.2_Silent_p.P654P|RXFP1_uc011cjf.1_Silent_p.P556P|RXFP1_uc010iqn.2_Silent_p.P632P	p.P687P	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN		COAD - Colon adenocarcinoma(41;0.0219)	18	2143	+	all_hematologic(180;0.24)	Renal(120;0.0854)	687			Cytoplasmic (Potential).		B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Silent	SNP	ENST00000307765.5	37	c.2061A>T	CCDS43276.1																																																																																				0.363	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314865.1	NM_021634		12	79	0	0	0	0.010729	0	12	79				
CASP3	836	broad.mit.edu	37	4	185552921	185552921	+	Nonsense_Mutation	SNP	G	G	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr4:185552921G>A	ENST00000308394.4	-	6	743	c.481C>T	c.(481-483)Cag>Tag	p.Q161*	CASP3_ENST00000393588.4_Nonsense_Mutation_p.Q161*|CASP3_ENST00000523916.1_Nonsense_Mutation_p.Q161*|CASP3_ENST00000393585.2_Nonsense_Mutation_p.Q161*|CASP3_ENST00000517513.1_Nonsense_Mutation_p.Q161*	NM_004346.3	NP_004337.2	P42574	CASP3_HUMAN	caspase 3, apoptosis-related cysteine peptidase	161					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell homeostasis (GO:0001782)|cell fate commitment (GO:0045165)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte differentiation (GO:0030218)|execution phase of apoptosis (GO:0097194)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glial cell apoptotic process (GO:0034349)|heart development (GO:0007507)|hippo signaling (GO:0035329)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|keratinocyte differentiation (GO:0030216)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|proteolysis (GO:0006508)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|release of cytochrome c from mitochondria (GO:0001836)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:0097200)|peptidase activity (GO:0008233)	p.Q161*(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	12		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00139)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.057)|all_hematologic(60;0.0592)		all cancers(43;2.05e-27)|Epithelial(43;4.27e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.04e-11)|Colorectal(24;2e-05)|STAD - Stomach adenocarcinoma(60;2.35e-05)|GBM - Glioblastoma multiforme(59;4.94e-05)|COAD - Colon adenocarcinoma(29;0.00017)|BRCA - Breast invasive adenocarcinoma(30;0.000218)|LUSC - Lung squamous cell carcinoma(40;0.00904)|READ - Rectum adenocarcinoma(43;0.161)	Minocycline(DB01017)	GACATTACCTGAATAATGAAA	0.338																																							uc003iwh.2		NA																	1	Substitution - Nonsense(1)		lung(1)	kidney(1)	1						c.(481-483)CAG>TAG		caspase 3 preproprotein	Melatonin(DB01065)|Minocycline(DB01017)|Simvastatin(DB00641)						60.0	59.0	59.0					4																	185552921		2203	4300	6503	SO:0001587	stop_gained	836				activation of caspase activity by cytochrome c|DNA fragmentation involved in apoptotic nuclear change|negative regulation of apoptosis|nerve growth factor receptor signaling pathway|nuclear fragmentation involved in apoptotic nuclear change|proteolysis|response to tumor necrosis factor	cytosol|mitochondrion|nucleoplasm|plasma membrane	cysteine-type endopeptidase activity|protein binding	g.chr4:185552921G>A	BC016926	CCDS3836.1	4q34	2008-02-05	2005-08-17		ENSG00000164305	ENSG00000164305		"""Caspases"""	1504	protein-coding gene	gene with protein product		600636	"""caspase 3, apoptosis-related cysteine protease"""			8780721	Standard	NM_004346		Approved	CPP32, CPP32B, Yama, apopain	uc003iwi.3	P42574	OTTHUMG00000133681	ENST00000308394.4:c.481C>T	4.37:g.185552921G>A	ENSP00000311032:p.Gln161*					CASP3_uc003iwg.2_Nonsense_Mutation_p.Q161*|CASP3_uc003iwi.2_Nonsense_Mutation_p.Q161*	p.Q161*	NM_004346	NP_004337	P42574	CASP3_HUMAN		all cancers(43;2.05e-27)|Epithelial(43;4.27e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.04e-11)|Colorectal(24;2e-05)|STAD - Stomach adenocarcinoma(60;2.35e-05)|GBM - Glioblastoma multiforme(59;4.94e-05)|COAD - Colon adenocarcinoma(29;0.00017)|BRCA - Breast invasive adenocarcinoma(30;0.000218)|LUSC - Lung squamous cell carcinoma(40;0.00904)|READ - Rectum adenocarcinoma(43;0.161)	6	744	-		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00139)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.057)|all_hematologic(60;0.0592)	161					A8K5M2|D3DP53|Q96AN1|Q96KP2	Nonsense_Mutation	SNP	ENST00000308394.4	37	c.481C>T	CCDS3836.1	.	.	.	.	.	.	.	.	.	.	G	38	7.015468	0.98002	.	.	ENSG00000164305	ENST00000308394;ENST00000393585;ENST00000523916;ENST00000517513;ENST00000393588	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.918	0.97070	0.0:0.0:1.0:0.0	.	.	.	.	X	161	.	ENSP00000311032:Q161X	Q	-	1	0	CASP3	185789915	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.823000	0.99369	2.716000	0.92895	0.561000	0.74099	CAG		0.338	CASP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257885.2	NM_004346		6	65	0	0	0	0.001984	0	6	65				
TRIO	7204	broad.mit.edu	37	5	14387678	14387678	+	Silent	SNP	G	G	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr5:14387678G>A	ENST00000344204.4	+	22	3726	c.3702G>A	c.(3700-3702)cgG>cgA	p.R1234R	TRIO_ENST00000537187.1_Silent_p.R1234R|TRIO_ENST00000509967.2_Silent_p.R1185R	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1234					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					TCTCTCTGCGGATGGAGAAGT	0.438																																							uc003jff.2		NA																	0				skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18						c.(3700-3702)CGG>CGA		triple functional domain (PTPRF interacting)							115.0	130.0	125.0					5																	14387678		2203	4300	6503	SO:0001819	synonymous_variant	7204				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	g.chr5:14387678G>A	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.3702G>A	5.37:g.14387678G>A						TRIO_uc003jfg.2_RNA|TRIO_uc011cna.1_Silent_p.R1185R|TRIO_uc003jfh.1_Silent_p.R883R	p.R1234R	NM_007118	NP_009049	O75962	TRIO_HUMAN			22	3708	+	Lung NSC(4;0.000742)		1234					D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	ENST00000344204.4	37	c.3702G>A	CCDS3883.1																																																																																				0.438	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118		4	131	0	0	0	0.009096	0	4	131				
CDH10	1008	broad.mit.edu	37	5	24488011	24488011	+	Missense_Mutation	SNP	C	C	T	rs560951980		TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr5:24488011C>T	ENST00000264463.4	-	12	2635	c.2128G>A	c.(2128-2130)Gtc>Atc	p.V710I	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	710					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V710I(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		AAATCCCGGACGTCCGTGTTA	0.468										HNSCC(23;0.051)			C|||	1	0.000199681	0.0	0.0	5008	,	,		16043	0.001		0.0	False		,,,				2504	0.0						uc003jgr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(6)|pancreas(4)|breast(2)	12						c.(2128-2130)GTC>ATC		cadherin 10, type 2 preproprotein							84.0	89.0	87.0					5																	24488011		2203	4300	6503	SO:0001583	missense	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24488011C>T	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.2128G>A	5.37:g.24488011C>T	ENSP00000264463:p.Val710Ile	HNSCC(23;0.051)				CDH10_uc011cnu.1_RNA	p.V710I	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	12	2460	-			710			Cytoplasmic (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.2128G>A	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.187302	0.78789	.	.	ENSG00000040731	ENST00000264463	T	0.77877	-1.13	5.41	5.41	0.78517	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	T	0.71178	0.3309	N	0.12502	0.225	0.50467	D	0.99987	D	0.61080	0.989	P	0.51918	0.684	T	0.69847	-0.5034	10	0.21540	T	0.41	.	18.1996	0.89833	0.0:1.0:0.0:0.0	.	710	Q9Y6N8	CAD10_HUMAN	I	710	ENSP00000264463:V710I	ENSP00000264463:V710I	V	-	1	0	CDH10	24523768	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	5.980000	0.70516	2.544000	0.85801	0.655000	0.94253	GTC		0.468	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727		11	96	0	0	0	0.008291	0	11	96				
CDH6	1004	broad.mit.edu	37	5	31316327	31316327	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr5:31316327A>G	ENST00000265071.2	+	9	1668	c.1403A>G	c.(1402-1404)cAa>cGa	p.Q468R	CDH6_ENST00000514738.1_Missense_Mutation_p.Q413R	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	468	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q468R(1)		NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						AATCCAAAGCAAAGTAGTCGA	0.373																																							uc003jhe.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|large_intestine(1)	7						c.(1402-1404)CAA>CGA		cadherin 6, type 2 preproprotein							56.0	58.0	57.0					5																	31316327		2203	4300	6503	SO:0001583	missense	1004				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding	g.chr5:31316327A>G	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.1403A>G	5.37:g.31316327A>G	ENSP00000265071:p.Gln468Arg					CDH6_uc003jhd.1_Missense_Mutation_p.Q468R	p.Q468R	NM_004932	NP_004923	P55285	CADH6_HUMAN			9	1729	+			468			Extracellular (Potential).|Cadherin 4.		A8K5H5|Q9BWS0	Missense_Mutation	SNP	ENST00000265071.2	37	c.1403A>G	CCDS3894.1	.	.	.	.	.	.	.	.	.	.	A	18.97	3.736229	0.69189	.	.	ENSG00000113361	ENST00000514738;ENST00000265071	T;T	0.50001	0.76;0.76	5.02	5.02	0.67125	Cadherin (4);Cadherin-like (1);	0.228471	0.45361	D	0.000363	T	0.50257	0.1605	L	0.33137	0.985	0.40547	D	0.981082	P;P	0.51791	0.872;0.948	P;P	0.52823	0.71;0.578	T	0.56086	-0.8037	10	0.72032	D	0.01	.	15.1838	0.72982	1.0:0.0:0.0:0.0	.	468;468	P55285;P55285-2	CADH6_HUMAN;.	R	413;468	ENSP00000424843:Q413R;ENSP00000265071:Q468R	ENSP00000265071:Q468R	Q	+	2	0	CDH6	31352084	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.817000	0.75252	2.228000	0.72767	0.482000	0.46254	CAA		0.373	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932		7	64	0	0	0	0.00308	0	7	64				
PCDHGA8	9708	broad.mit.edu	37	5	140772817	140772817	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr5:140772817C>T	ENST00000398604.2	+	1	437	c.437C>T	c.(436-438)gCg>gTg	p.A146V	PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	146	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A146V(1)		endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACGAAATCGCGGTTCCTGGA	0.448																																							uc003lkd.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(436-438)GCG>GTG		protocadherin gamma subfamily A, 8 isoform 1							52.0	56.0	54.0					5																	140772817		1933	4151	6084	SO:0001583	missense	9708				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140772817C>T	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.437C>T	5.37:g.140772817C>T	ENSP00000381605:p.Ala146Val					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Missense_Mutation_p.A146V	p.A146V	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1335	+			146			Extracellular (Potential).|Cadherin 2.		A7MCZ4|O15039	Missense_Mutation	SNP	ENST00000398604.2	37	c.437C>T	CCDS47291.1	.	.	.	.	.	.	.	.	.	.	.	12.60	1.987214	0.35036	.	.	ENSG00000253767	ENST00000398604	T	0.55588	0.51	5.41	5.41	0.78517	Cadherin (3);Cadherin-like (1);	0.699665	0.10826	U	0.629889	T	0.52370	0.1730	L	0.48935	1.535	0.26103	N	0.980788	B;B	0.22604	0.072;0.054	B;B	0.21151	0.033;0.016	T	0.47129	-0.9141	10	0.46703	T	0.11	.	18.8047	0.92032	0.0:1.0:0.0:0.0	.	146;146	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	V	146	ENSP00000381605:A146V	ENSP00000381605:A146V	A	+	2	0	PCDHGA8	140753001	0.051000	0.20477	0.873000	0.34254	0.683000	0.39861	3.317000	0.51968	2.552000	0.86080	0.655000	0.94253	GCG		0.448	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	NM_032088		5	93	0	0	0	0.001168	0	5	93				
KIF4B	285643	broad.mit.edu	37	5	154396603	154396603	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr5:154396603G>T	ENST00000435029.4	+	1	3344	c.3184G>T	c.(3184-3186)Ggc>Tgc	p.G1062C		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	1062	Globular. {ECO:0000250}.|Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)	p.G1062C(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			tgatggtgatggcgacagtga	0.458																																							uc010jih.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(3184-3186)GGC>TGC		kinesin family member 4B							120.0	111.0	114.0					5																	154396603		2203	4300	6503	SO:0001583	missense	285643				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity	g.chr5:154396603G>T	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.3184G>T	5.37:g.154396603G>T	ENSP00000387875:p.Gly1062Cys						p.G1062C	NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		1	3344	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	1062			Interaction with PRC1 (By similarity).|Globular (By similarity).			Missense_Mutation	SNP	ENST00000435029.4	37	c.3184G>T	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	G	3.920	-0.018334	0.07681	.	.	ENSG00000226650	ENST00000435029	T	0.68331	-0.32	0.852	0.852	0.18995	.	.	.	.	.	T	0.53948	0.1828	L	0.43152	1.355	0.09310	N	1	D	0.57899	0.981	B	0.43413	0.419	T	0.45011	-0.9290	9	0.38643	T	0.18	.	5.0117	0.14315	0.0:0.0:1.0:0.0	.	1062	Q2VIQ3	KIF4B_HUMAN	C	1062	ENSP00000387875:G1062C	ENSP00000387875:G1062C	G	+	1	0	KIF4B	154376796	0.017000	0.18338	0.265000	0.24526	0.589000	0.36550	0.915000	0.28638	0.744000	0.32741	0.462000	0.41574	GGC		0.458	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1			10	46	1	0	0.000442599	0.006214	0.000514727	10	46				
HIVEP1	3096	broad.mit.edu	37	6	12125124	12125124	+	Missense_Mutation	SNP	A	A	C			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr6:12125124A>C	ENST00000379388.2	+	4	5428	c.5096A>C	c.(5095-5097)aAc>aCc	p.N1699T	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1699					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N1699T(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				GCTTTGCCAAACCCAGAGAAG	0.368																																							uc003nac.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6						c.(5095-5097)AAC>ACC		human immunodeficiency virus type I enhancer							76.0	72.0	73.0					6																	12125124		1830	4085	5915	SO:0001583	missense	3096				transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding	g.chr6:12125124A>C	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.5096A>C	6.37:g.12125124A>C	ENSP00000368698:p.Asn1699Thr					HIVEP1_uc011diq.1_RNA	p.N1699T	NM_002114	NP_002105	P15822	ZEP1_HUMAN			4	5275	+	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)	1699					B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	c.5096A>C	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	A	1.836	-0.468525	0.04445	.	.	ENSG00000095951	ENST00000379388	T	0.08634	3.07	5.44	0.335	0.15953	.	0.550372	0.13957	N	0.351086	T	0.01523	0.0049	N	0.21097	0.63	0.47065	D	0.999306	B	0.18863	0.031	B	0.11329	0.006	T	0.43081	-0.9413	9	.	.	.	-15.2476	5.845	0.18661	0.5758:0.1367:0.2875:0.0	.	1699	P15822	ZEP1_HUMAN	T	1699	ENSP00000368698:N1699T	.	N	+	2	0	HIVEP1	12233110	1.000000	0.71417	0.954000	0.39281	0.913000	0.54294	1.813000	0.38962	0.043000	0.15746	0.459000	0.35465	AAC		0.368	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114		3	102	0	0	0	0.004672	0	3	102				
RGL2	5863	broad.mit.edu	37	6	33260318	33260318	+	Missense_Mutation	SNP	T	T	C			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr6:33260318T>C	ENST00000497454.1	-	17	2506	c.2011A>G	c.(2011-2013)Aca>Gca	p.T671A	PFDN6_ENST00000463584.1_Intron|RGL2_ENST00000437840.2_5'UTR	NM_001243738.1|NM_004761.4	NP_001230667.1|NP_004752.1	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation stimulator-like 2	671	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.T671A(1)		breast(2)|cervix(2)|endometrium(7)|kidney(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	34						TCCTGGCTTGTCACCTGGCAG	0.483																																							uc003odv.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(3)|lung(1)|breast(1)|pancreas(1)	6						c.(2011-2013)ACA>GCA		ral guanine nucleotide dissociation							97.0	89.0	91.0					6																	33260318		2203	4300	6503	SO:0001583	missense	5863				Ras protein signal transduction|regulation of small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity	g.chr6:33260318T>C		CCDS4774.1	6p21.3	2010-02-17	2004-06-11	2004-06-16	ENSG00000237441	ENSG00000237441			9769	protein-coding gene	gene with protein product		602306	"""RAB2, member RAS oncogene family-like"""	RAB2L		8976381	Standard	NM_001243738		Approved	KE1.5, HKE1.5	uc003odv.3	O15211	OTTHUMG00000031072	ENST00000497454.1:c.2011A>G	6.37:g.33260318T>C	ENSP00000420211:p.Thr671Ala					RGL2_uc003odu.2_Missense_Mutation_p.T231A|RGL2_uc010jur.2_Missense_Mutation_p.T231A|RGL2_uc003odw.2_Missense_Mutation_p.T589A	p.T671A	NM_004761	NP_004752	O15211	RGL2_HUMAN			17	2144	-			671			Ras-associating.		B4DG72|Q5STK0|Q9Y3F3	Missense_Mutation	SNP	ENST00000497454.1	37	c.2011A>G	CCDS4774.1	.	.	.	.	.	.	.	.	.	.	T	18.73	3.685478	0.68157	.	.	ENSG00000237441	ENST00000497454;ENST00000421215	T	0.18016	2.24	4.83	4.83	0.62350	Ras-association (3);	0.000000	0.85682	D	0.000000	T	0.25827	0.0629	L	0.57536	1.79	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.02031	-1.1226	10	0.87932	D	0	.	10.7459	0.46181	0.0:0.0:0.0:1.0	.	671	O15211	RGL2_HUMAN	A	671;535	ENSP00000420211:T671A	ENSP00000400083:T535A	T	-	1	0	RGL2	33368296	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.263000	0.72521	2.028000	0.59812	0.523000	0.50628	ACA		0.483	RGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076098.2			9	88	0	0	0	0.004482	0	9	88				
DST	667	broad.mit.edu	37	6	56504285	56504285	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr6:56504285C>G	ENST00000361203.3	-	17	2196	c.2189G>C	c.(2188-2190)aGa>aCa	p.R730T	DST_ENST00000370754.5_Missense_Mutation_p.R908T|DST_ENST00000370769.4_Missense_Mutation_p.R730T|DST_ENST00000244364.6_Missense_Mutation_p.R404T|DST_ENST00000518935.1_Missense_Mutation_p.R404T|DST_ENST00000370788.2_Missense_Mutation_p.R730T|DST_ENST00000446842.2_Missense_Mutation_p.R404T|DST_ENST00000312431.6_Missense_Mutation_p.R730T|DST_ENST00000370765.6_Missense_Mutation_p.R404T|DST_ENST00000421834.2_Missense_Mutation_p.R730T			Q03001	DYST_HUMAN	dystonin	730					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.R404T(6)|p.R730T(2)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GTTGGTGTTTCTCTCACTCCA	0.353																																							uc003pdf.2		NA																	8	Substitution - Missense(8)		lung(8)	ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14						c.(2722-2724)AGA>ACA		dystonin isoform 2							123.0	123.0	123.0					6																	56504285		2203	4300	6503	SO:0001583	missense	667				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	g.chr6:56504285C>G	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.2189G>C	6.37:g.56504285C>G	ENSP00000354508:p.Arg730Thr					DST_uc003pcz.3_Missense_Mutation_p.R730T|DST_uc011dxj.1_Missense_Mutation_p.R759T|DST_uc011dxk.1_Missense_Mutation_p.R770T|DST_uc011dxl.1_Missense_Mutation_p.R759T|DST_uc003pcy.3_Missense_Mutation_p.R404T|DST_uc003pdb.2_Missense_Mutation_p.R404T|DST_uc003pdc.3_Missense_Mutation_p.R404T|DST_uc003pdd.3_Missense_Mutation_p.R404T|DST_uc003pde.2_Missense_Mutation_p.R846T	p.R908T	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)		20	2751	-	Lung NSC(77;0.103)		730			Spectrin 1.		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37	c.2723G>C		.	.	.	.	.	.	.	.	.	.	C	20.8	4.052677	0.75960	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935	T;D;D;T;D;T;T;D;T;T;T;T	0.92446	0.87;-3.04;-3.04;0.87;-3.04;0.87;0.87;-3.04;0.87;0.87;0.87;0.87	5.34	4.47	0.54385	.	0.000000	0.56097	D	0.000022	D	0.93128	0.7812	L	0.59436	1.845	0.34160	D	0.668618	D;P;D;P;D;P;D;D;P;B	0.76494	0.993;0.698;0.976;0.804;0.995;0.534;0.968;0.999;0.517;0.305	D;B;B;B;D;B;P;D;B;B	0.74023	0.977;0.142;0.445;0.142;0.982;0.091;0.614;0.971;0.04;0.039	D	0.93097	0.6505	9	0.44086	T	0.13	.	14.0017	0.64437	0.0:0.9276:0.0:0.0724	.	759;730;730;908;846;404;404;404;730;404	B4DGY0;Q5TBT1;E7ERU2;E9PEB9;Q03001-13;Q6P0N6;Q03001-3;Q03001-9;Q03001;Q03001-8	.;.;.;.;.;.;.;.;DYST_HUMAN;.	T	404;908;730;730;404;730;730;730;404;770;404;404	ENSP00000244364:R404T;ENSP00000359790:R908T;ENSP00000359805:R730T;ENSP00000400883:R730T;ENSP00000393645:R404T;ENSP00000307959:R730T;ENSP00000359824:R730T;ENSP00000354508:R730T;ENSP00000404924:R404T;ENSP00000431030:R770T;ENSP00000359801:R404T;ENSP00000431003:R404T	ENSP00000244364:R404T	R	-	2	0	DST	56612244	1.000000	0.71417	0.999000	0.59377	0.887000	0.51463	5.932000	0.70121	1.478000	0.48253	0.650000	0.86243	AGA		0.353	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723		22	125	0	0	0	0.014323	0	22	125				
LCA5	167691	broad.mit.edu	37	6	80198869	80198869	+	Missense_Mutation	SNP	C	C	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr6:80198869C>G	ENST00000392959.1	-	8	1774	c.1163G>C	c.(1162-1164)aGa>aCa	p.R388T	LCA5_ENST00000369846.4_Missense_Mutation_p.R388T|LCA5_ENST00000467898.3_Missense_Mutation_p.R388T	NM_181714.3	NP_859065.2	Q86VQ0	LCA5_HUMAN	Leber congenital amaurosis 5	388					intraciliary transport (GO:0042073)|photoreceptor cell maintenance (GO:0045494)|protein transport (GO:0015031)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein complex binding (GO:0032403)	p.R388T(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	32		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)		BRCA - Breast invasive adenocarcinoma(397;0.0657)		TTTTTCTTCTCTTTCCATAAT	0.358																																							uc003pix.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(1162-1164)AGA>ACA		Leber congenital amaurosis 5							159.0	149.0	152.0					6																	80198869		2202	4300	6502	SO:0001583	missense	167691				protein transport	cilium axoneme|microtubule basal body	protein binding	g.chr6:80198869C>G		CCDS4990.1	6q14	2014-01-28			ENSG00000135338	ENSG00000135338			31923	protein-coding gene	gene with protein product	"""lebercilin"""	611408	"""chromosome 6 open reading frame 152"""	C6orf152		10631161, 17546029	Standard	NM_181714		Approved		uc003pix.3	Q86VQ0	OTTHUMG00000015080	ENST00000392959.1:c.1163G>C	6.37:g.80198869C>G	ENSP00000376686:p.Arg388Thr					LCA5_uc003piy.2_Missense_Mutation_p.R388T	p.R388T	NM_001122769	NP_001116241	Q86VQ0	LCA5_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0657)	7	1598	-		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)	388					E1P542|Q9BWX7	Missense_Mutation	SNP	ENST00000392959.1	37	c.1163G>C	CCDS4990.1	.	.	.	.	.	.	.	.	.	.	C	13.68	2.309881	0.40895	.	.	ENSG00000135338	ENST00000369846;ENST00000392959	T;T	0.35048	1.33;1.33	5.24	0.83	0.18854	.	0.667804	0.15222	N	0.273844	T	0.11367	0.0277	L	0.46157	1.445	0.25210	N	0.989983	P	0.41848	0.763	B	0.36186	0.219	T	0.08617	-1.0713	10	0.66056	D	0.02	-1.5738	5.0012	0.14266	0.0:0.5552:0.1578:0.287	.	388	Q86VQ0	LCA5_HUMAN	T	388	ENSP00000358861:R388T;ENSP00000376686:R388T	ENSP00000358861:R388T	R	-	2	0	LCA5	80255588	0.177000	0.23109	0.808000	0.32385	0.720000	0.41350	-0.545000	0.06069	0.212000	0.20703	0.655000	0.94253	AGA		0.358	LCA5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259269.1	NM_181714		17	89	0	0	0	0.004007	0	17	89				
SMPD2	6610	broad.mit.edu	37	6	109764084	109764084	+	Silent	SNP	C	C	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr6:109764084C>T	ENST00000258052.3	+	7	980	c.621C>T	c.(619-621)ttC>ttT	p.F207F	PPIL6_ENST00000424445.2_5'Flank|PPIL6_ENST00000521072.2_5'Flank|PPIL6_ENST00000440797.2_5'Flank	NM_003080.2	NP_003071.2	O60906	NSMA_HUMAN	sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase)	207					apoptotic signaling pathway (GO:0097190)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|neurotrophin TRK receptor signaling pathway (GO:0048011)|response to mechanical stimulus (GO:0009612)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin metabolic process (GO:0006684)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)	p.F207F(1)		endometrium(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.0137)|all cancers(137;0.0188)|OV - Ovarian serous cystadenocarcinoma(136;0.0228)|BRCA - Breast invasive adenocarcinoma(108;0.0566)		CTCGGGACTTCAAGGTGAGGA	0.542																																							uc003pti.2		NA																	1	Substitution - coding silent(1)		lung(1)		0						c.(619-621)TTC>TTT		sphingomyelin phosphodiesterase 2, neutral							167.0	125.0	139.0					6																	109764084		2203	4300	6503	SO:0001819	synonymous_variant	6610				induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|sphingomyelin metabolic process	integral to plasma membrane	metal ion binding|sphingomyelin phosphodiesterase activity	g.chr6:109764084C>T	AJ222801	CCDS5075.1	6q21	2009-10-23			ENSG00000135587	ENSG00000135587	3.1.4.12		11121	protein-coding gene	gene with protein product		603498				9520418	Standard	XM_005267109		Approved	nSMase, ISC1	uc003pti.3	O60906	OTTHUMG00000015348	ENST00000258052.3:c.621C>T	6.37:g.109764084C>T						PPIL6_uc003ptg.3_5'Flank|PPIL6_uc010kdo.2_5'Flank|PPIL6_uc010kdp.2_5'Flank|PPIL6_uc003pth.1_5'Flank	p.F207F	NM_003080	NP_003071	O60906	NSMA_HUMAN		Epithelial(106;0.0137)|all cancers(137;0.0188)|OV - Ovarian serous cystadenocarcinoma(136;0.0228)|BRCA - Breast invasive adenocarcinoma(108;0.0566)	7	1015	+		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)	207					Q5TED1|Q9BWR3	Silent	SNP	ENST00000258052.3	37	c.621C>T	CCDS5075.1	.	.	.	.	.	.	.	.	.	.	C	2.779	-0.253897	0.05829	.	.	ENSG00000135587	ENST00000458487	.	.	.	5.95	-0.464	0.12160	.	.	.	.	.	T	0.42787	0.1218	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40924	-0.9537	4	.	.	.	-16.8106	9.8974	0.41327	0.0:0.4002:0.0:0.5998	.	.	.	.	L	104	.	.	S	+	2	0	SMPD2	109870777	0.668000	0.27493	0.918000	0.36340	0.473000	0.32948	-0.363000	0.07593	-0.157000	0.11059	-0.140000	0.14226	TCA		0.542	SMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041755.1			15	79	0	0	0	0.003163	0	15	79				
AKAP12	9590	broad.mit.edu	37	6	151673899	151673899	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr6:151673899C>T	ENST00000253332.1	+	3	4562	c.4373C>T	c.(4372-4374)tCt>tTt	p.S1458F	AKAP12_ENST00000354675.6_Missense_Mutation_p.S1360F|AKAP12_ENST00000402676.2_Missense_Mutation_p.S1458F|AKAP12_ENST00000359755.5_Missense_Mutation_p.S1353F			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	1458					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)	p.S1458F(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		GAGAAATCCTCTGAAAAAAAT	0.478																																					Melanoma(141;1616 1805 10049 24534 51979)	Melanoma(141;1616 1805 10049 24534 51979)	uc011eep.1		NA																	1	Substitution - Missense(1)		lung(1)	large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	8						c.(4372-4374)TCT>TTT		A kinase (PRKA) anchor protein 12 isoform 1							66.0	72.0	70.0					6																	151673899		2203	4300	6503	SO:0001583	missense	9590				G-protein coupled receptor protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting	cell cortex|cytoskeleton|plasma membrane	adenylate cyclase binding|protein kinase A binding	g.chr6:151673899C>T	U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.4373C>T	6.37:g.151673899C>T	ENSP00000253332:p.Ser1458Phe					AKAP12_uc003qoe.2_Missense_Mutation_p.S1458F|AKAP12_uc003qof.2_Missense_Mutation_p.S1360F|AKAP12_uc010kim.2_Intron|AKAP12_uc003qog.2_Missense_Mutation_p.S1353F	p.S1458F	NM_005100	NP_005091	Q02952	AKA12_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)	4	4613	+		Ovarian(120;0.125)	1458					O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Missense_Mutation	SNP	ENST00000253332.1	37	c.4373C>T	CCDS5229.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239425	0.58995	.	.	ENSG00000131016	ENST00000402676;ENST00000253332;ENST00000354675;ENST00000359755	T;T;T;T	0.14640	2.49;2.49;2.52;2.52	5.0	3.23	0.37069	.	0.883929	0.09257	N	0.827112	T	0.10895	0.0266	L	0.36672	1.1	0.09310	N	1	D;D;D	0.57571	0.98;0.98;0.966	P;P;P	0.55965	0.788;0.788;0.618	T	0.23904	-1.0175	10	0.62326	D	0.03	.	11.4148	0.49945	0.0:0.8532:0.0:0.1468	.	1353;1360;1458	Q02952-3;Q02952-2;Q02952	.;.;AKA12_HUMAN	F	1458;1458;1360;1353	ENSP00000384537:S1458F;ENSP00000253332:S1458F;ENSP00000346702:S1360F;ENSP00000352794:S1353F	ENSP00000253332:S1458F	S	+	2	0	AKAP12	151715592	0.063000	0.20901	0.001000	0.08648	0.242000	0.25591	2.699000	0.47077	0.629000	0.30376	0.650000	0.86243	TCT		0.478	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1			4	76	0	0	0	0.009096	0	4	76				
THSD7A	221981	broad.mit.edu	37	7	11464415	11464415	+	Nonsense_Mutation	SNP	G	G	C	rs571423710		TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr7:11464415G>C	ENST00000423059.4	-	16	3542	c.3291C>G	c.(3289-3291)taC>taG	p.Y1097*	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1097	TSP type-1 11. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Y1097*(1)		NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TGACCCATAGGTACTGGTTGC	0.512										HNSCC(18;0.044)																													uc003ssf.3		NA																	1	Substitution - Nonsense(1)		lung(1)	ovary(3)	3						c.(3289-3291)TAC>TAG		thrombospondin, type I, domain containing 7A							144.0	135.0	138.0					7																	11464415		2027	4198	6225	SO:0001587	stop_gained	221981					integral to membrane		g.chr7:11464415G>C		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.3291C>G	7.37:g.11464415G>C	ENSP00000406482:p.Tyr1097*	HNSCC(18;0.044)					p.Y1097*	NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.163)	15	3543	-			1097			TSP type-1 11.|Extracellular (Potential).			Nonsense_Mutation	SNP	ENST00000423059.4	37	c.3291C>G	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	G	43	10.403972	0.99399	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	.	.	.	5.85	4.04	0.47022	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.159	0.42840	0.2053:0.0:0.7947:0.0	.	.	.	.	X	1097	.	ENSP00000262042:Y1097X	Y	-	3	2	THSD7A	11430940	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	1.168000	0.31859	1.485000	0.48380	0.655000	0.94253	TAC		0.512	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2		11	148	0	0	0	0.008291	0	11	148				
PRPS1L1	221823	broad.mit.edu	37	7	18066750	18066750	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr7:18066750A>G	ENST00000506618.2	-	1	736	c.656T>C	c.(655-657)gTa>gCa	p.V219A		NM_175886.2	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like 1	219	Binding of phosphoribosylpyrophosphate. {ECO:0000255}.				5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|nucleotide biosynthetic process (GO:0009165)|ribonucleoside monophosphate biosynthetic process (GO:0009156)		ATP binding (GO:0005524)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)	p.V219A(2)		endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)	18	Lung NSC(10;0.0385)|all_lung(11;0.0736)					CATGTCATCTACAAGGATAGC	0.448																																							uc003stz.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(655-657)GTA>GCA		phosphoribosyl pyrophosphate synthetase 1-like							120.0	116.0	117.0					7																	18066750		2203	4300	6503	SO:0001583	missense	221823				nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity	g.chr7:18066750A>G	M57423	CCDS47552.1	7p21.1	2010-12-10			ENSG00000229937	ENSG00000229937			9463	protein-coding gene	gene with protein product		611566		PRPSL		2168892	Standard	NM_175886		Approved	PRPS3	uc003stz.3	P21108	OTTHUMG00000152742	ENST00000506618.2:c.656T>C	7.37:g.18066750A>G	ENSP00000424595:p.Val219Ala						p.V219A	NM_175886	NP_787082	P21108	PRPS3_HUMAN			1	737	-	Lung NSC(10;0.0385)|all_lung(11;0.0736)		219			Binding of phosphoribosylpyrophosphate (Potential).		Q6P5P6	Missense_Mutation	SNP	ENST00000506618.2	37	c.656T>C	CCDS47552.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.942552	0.73672	.	.	ENSG00000229937	ENST00000506618	T	0.77620	-1.11	4.4	4.4	0.53042	Phosphoribosyltransferase (1);	.	.	.	.	D	0.88588	0.6477	M	0.88979	2.995	.	.	.	D	0.60575	0.988	D	0.72338	0.977	D	0.92581	0.6074	8	0.87932	D	0	.	11.9016	0.52687	1.0:0.0:0.0:0.0	.	219	P21108	PRPS3_HUMAN	A	219	ENSP00000424595:V219A	ENSP00000424595:V219A	V	-	2	0	PRPS1L1	18033275	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.663000	0.74431	1.984000	0.57885	0.528000	0.53228	GTA		0.448	PRPS1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327667.1	NM_175886		20	97	0	0	0	0.010504	0	20	97				
FKBP9	11328	broad.mit.edu	37	7	33044805	33044805	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr7:33044805G>A	ENST00000242209.4	+	10	1724	c.1555G>A	c.(1555-1557)Gcc>Acc	p.A519T	FKBP9_ENST00000538443.1_Missense_Mutation_p.A381T|AVL9_ENST00000404479.1_Intron|FKBP9_ENST00000490776.2_Missense_Mutation_p.A287T|FKBP9_ENST00000538336.1_Missense_Mutation_p.A572T	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	519	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.A519T(2)|p.A287T(2)		central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			GTACATTCACGCCCAGGTGGC	0.537																																							uc003tdh.2		NA																	4	Substitution - Missense(4)		lung(2)|endometrium(2)	central_nervous_system(13)|ovary(1)	14						c.(1555-1557)GCC>ACC		FK506 binding protein 9 precursor							46.0	45.0	45.0					7																	33044805		2203	4297	6500	SO:0001583	missense	11328				protein folding	endoplasmic reticulum|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity	g.chr7:33044805G>A	AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.1555G>A	7.37:g.33044805G>A	ENSP00000242209:p.Ala519Thr					AVL9_uc011kai.1_Intron|FKBP9_uc011kak.1_RNA|FKBP9_uc011kal.1_Missense_Mutation_p.A572T|FKBP9_uc011kam.1_Missense_Mutation_p.A287T	p.A519T	NM_007270	NP_009201	O95302	FKBP9_HUMAN	GBM - Glioblastoma multiforme(11;0.0156)		10	1736	+			519			EF-hand 1.		B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Missense_Mutation	SNP	ENST00000242209.4	37	c.1555G>A	CCDS5439.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210625	0.39102	.	.	ENSG00000122642	ENST00000242209;ENST00000538336;ENST00000538443;ENST00000490776	T;T;T;T	0.55234	0.53;0.53;0.53;2.25	5.07	5.07	0.68467	EF-hand-like domain (1);	0.271361	0.37348	N	0.002127	T	0.39410	0.1077	L	0.29908	0.895	0.32052	N	0.596862	B;B;B	0.26400	0.004;0.148;0.051	B;B;B	0.14578	0.001;0.011;0.006	T	0.46884	-0.9159	10	0.32370	T	0.25	-10.8601	13.7806	0.63081	0.0761:0.0:0.9239:0.0	.	287;572;519	B7Z1G9;B7Z6H3;O95302	.;.;FKBP9_HUMAN	T	519;572;381;287	ENSP00000242209:A519T;ENSP00000439250:A572T;ENSP00000437504:A381T;ENSP00000441317:A287T	ENSP00000242209:A519T	A	+	1	0	FKBP9	33011330	0.934000	0.31675	0.976000	0.42696	0.969000	0.65631	3.364000	0.52328	2.371000	0.80710	0.555000	0.69702	GCC		0.537	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215137.1	NM_007270		4	83	0	0	0	0.004482	0	4	83				
POLD2	5425	broad.mit.edu	37	7	44157303	44157303	+	Silent	SNP	T	T	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr7:44157303T>A	ENST00000406581.2	-	5	1030	c.381A>T	c.(379-381)atA>atT	p.I127I	POLD2_ENST00000223361.3_Silent_p.I127I|POLD2_ENST00000452185.1_Silent_p.I127I	NM_001256879.1	NP_001243808.1	P49005	DPOD2_HUMAN	polymerase (DNA directed), delta 2, accessory subunit	127					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	delta DNA polymerase complex (GO:0043625)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)	p.I127I(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	12						CATCTGGGTGTATGTATTTAC	0.522																																							uc010kxz.2		NA																	2	Substitution - coding silent(2)		lung(2)	ovary(2)	2						c.(379-381)ATA>ATT		DNA-directed DNA polymerase delta 2							77.0	67.0	70.0					7																	44157303		2203	4300	6503	SO:0001819	synonymous_variant	5425				base-excision repair|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	DNA binding|DNA-directed DNA polymerase activity|protein binding	g.chr7:44157303T>A		CCDS5477.1, CCDS75586.1	7p13	2012-05-18	2012-05-18		ENSG00000106628	ENSG00000106628		"""DNA polymerases"""	9176	protein-coding gene	gene with protein product	"""Pol delta B subunit (p50)"", ""DNA polymerase delta subunit p50"""	600815	"""polymerase (DNA directed), delta 2, regulatory subunit (50kD)"", ""polymerase (DNA directed), delta 2, regulatory subunit 50kDa"""			8530069	Standard	NM_001127218		Approved		uc003tkf.5	P49005	OTTHUMG00000022909	ENST00000406581.2:c.381A>T	7.37:g.44157303T>A						POLD2_uc003tke.3_Silent_p.I127I|POLD2_uc010kya.2_Silent_p.I127I|POLD2_uc003tkf.3_Silent_p.I127I	p.I127I	NM_006230	NP_006221	P49005	DPOD2_HUMAN			5	1031	-			127					A4D2J4|B2R5S4	Silent	SNP	ENST00000406581.2	37	c.381A>T	CCDS5477.1																																																																																				0.522	POLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250994.2	NM_001127218		5	24	0	0	0	0.001168	0	5	24				
EGFR	1956	broad.mit.edu	37	7	55259515	55259515	+	Missense_Mutation	SNP	T	T	G	rs121434568		TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr7:55259515T>G	ENST00000275493.2	+	21	2750	c.2573T>G	c.(2572-2574)cTg>cGg	p.L858R	EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000442591.1_Intron|EGFR_ENST00000455089.1_Missense_Mutation_p.L813R|EGFR_ENST00000454757.2_Missense_Mutation_p.L805R	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	858	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> M (found in a lung cancer sample). {ECO:0000269|PubMed:16533793}.|L -> R (found in a lung cancer sample; somatic mutation; constitutively activated enzyme with strongly increased kinase activity; more sensitive to gefitinib than wild-type; dbSNP:rs121434568). {ECO:0000269|PubMed:15118125, ECO:0000269|PubMed:15623594, ECO:0000269|PubMed:16533793}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.L858R(1489)|p.L858Q(1)|p.L858K(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	GATTTTGGGCTGGCCAAACTG	0.537	L858R(NCIH1975_LUNG)	8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													uc003tqk.2	L858R(NCIH1975_LUNG)	8	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	A|O|Mis	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""			"""E, O"""		NSCLC	glioma|NSCLC		1491	Substitution - Missense(1491)	p.L858R(3429)|p.L858L(4)|p.L858M(4)|p.L858Q(3)|p.L858A(2)|p.L858W(1)|p.L858P(1)|p.L858K(1)|p.L858G(1)	lung(1475)|upper_aerodigestive_tract(5)|thyroid(4)|large_intestine(2)|peritoneum(1)|stomach(1)|thymus(1)|breast(1)|ovary(1)	lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571						c.(2572-2574)CTG>CGG		epidermal growth factor receptor isoform a	Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)						105.0	98.0	101.0					7																	55259515		2203	4300	6503	SO:0001583	missense	1956	Lung_Cancer_Familial_Clustering_of	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	g.chr7:55259515T>G		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2573T>G	7.37:g.55259515T>G	ENSP00000275493:p.Leu858Arg	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)				EGFR_uc010kzg.1_Missense_Mutation_p.L813R|EGFR_uc011kco.1_Missense_Mutation_p.L805R|uc003tqo.2_5'Flank	p.L858R	NM_005228	NP_005219	P00533	EGFR_HUMAN	GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		21	2819	+	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		858		L -> R (found in a lung cancer sample; somatic mutation; constitutively activated enzyme with strongly increased kinase activity).|L -> M (found in a lung cancer sample).	Cytoplasmic (Potential).|Protein kinase.		O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	c.2573T>G	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.601026	0.87055	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	D;D;D	0.91351	-2.83;-2.83;-2.83	5.71	5.71	0.89125	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.137592	0.50627	D	0.000117	D	0.96340	0.8806	M	0.92555	3.32	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.91635	0.956;0.999	D	0.97213	0.9872	10	0.87932	D	0	.	14.8112	0.69996	0.0:0.0:0.0:1.0	.	813;858	Q504U8;P00533	.;EGFR_HUMAN	R	813;728;858;805	ENSP00000415559:L813R;ENSP00000275493:L858R;ENSP00000395243:L805R	ENSP00000275493:L858R	L	+	2	0	EGFR	55227009	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.890000	0.87313	2.176000	0.68965	0.528000	0.53228	CTG		0.537	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228		12	93	0	0	0	0.001855	0	12	93				
FKBP9P1	360132	broad.mit.edu	37	7	55750500	55750500	+	RNA	SNP	C	C	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr7:55750500C>T	ENST00000455909.1	-	0	717					NR_027340.1|NR_027342.1		Q75LS8	FKB9L_HUMAN							protein folding (GO:0006457)		calcium ion binding (GO:0005509)	p.A91T(1)		endometrium(1)|kidney(1)|lung(3)	5						GCCACCTGGGCGTGAATGTAC	0.532																																							uc010kzl.2		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(604-606)GCC>ACC		SubName: Full=cDNA, FLJ79189, highly similar to FK506-binding protein 9 (EC 5.2.1.8);							44.0	43.0	43.0					7																	55750500		692	1590	2282			360132							g.chr7:55750500C>T																													7.37:g.55750500C>T						FKBP9L_uc010kzk.2_Missense_Mutation_p.A91T|FKBP9L_uc003tqt.2_Missense_Mutation_p.A91T|FKBP9L_uc011kcs.1_Missense_Mutation_p.A91T	p.A202T	NR_003949						6	704	-								B2R7H1	Missense_Mutation	SNP	ENST00000455909.1	37	c.604G>A																																																																																					0.532	FKBP9L-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000251473.2			10	38	0	0	0	0.001855	0	10	38				
TRIM56	81844	broad.mit.edu	37	7	100732051	100732051	+	Silent	SNP	C	C	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr7:100732051C>G	ENST00000306085.6	+	3	1755	c.1458C>G	c.(1456-1458)ggC>ggG	p.G486G		NM_030961.1	NP_112223.1	Q9BRZ2	TRI56_HUMAN	tripartite motif containing 56	486					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of type I interferon production (GO:0032481)|protein K63-linked ubiquitination (GO:0070534)|regulation of type I interferon production (GO:0032479)|response to type I interferon (GO:0034340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	Lung NSC(181;0.136)|all_lung(186;0.182)					ACGGCTCTGGCCTCCTCCCCA	0.632																																					Ovarian(89;1092 1379 22756 38989 39611)	Ovarian(89;1092 1379 22756 38989 39611)	uc003uxq.2		NA																	0				kidney(1)|central_nervous_system(1)|skin(1)	3						c.(1456-1458)GGC>GGG		tripartite motif-containing 56							63.0	73.0	70.0					7																	100732051		1934	4130	6064	SO:0001819	synonymous_variant	81844				defense response to virus|interferon-beta production|protein K63-linked ubiquitination|response to type I interferon	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding	g.chr7:100732051C>G	BK000511	CCDS43625.1	7q11.2	2013-01-09	2011-01-25		ENSG00000169871	ENSG00000169871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19028	protein-coding gene	gene with protein product			"""tripartite motif-containing 56"""				Standard	NM_030961		Approved	RNF109	uc003uxq.3	Q9BRZ2	OTTHUMG00000157032	ENST00000306085.6:c.1458C>G	7.37:g.100732051C>G						TRIM56_uc003uxr.2_Intron	p.G486G	NM_030961	NP_112223	Q9BRZ2	TRI56_HUMAN			3	1689	+	Lung NSC(181;0.136)|all_lung(186;0.182)		486					Q6PJS5|Q86VT6|Q8N2H8|Q8NAC0|Q9H031	Silent	SNP	ENST00000306085.6	37	c.1458C>G	CCDS43625.1																																																																																				0.632	TRIM56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347185.1	NM_030961		6	140	0	0	0	0.00308	0	6	140				
LAMB1	3912	broad.mit.edu	37	7	107600230	107600230	+	Silent	SNP	G	G	A	rs371396695		TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr7:107600230G>A	ENST00000222399.6	-	19	2594	c.2364C>T	c.(2362-2364)aaC>aaT	p.N788N	LAMB1_ENST00000393561.1_Silent_p.N812N|LAMB1_ENST00000393560.1_Silent_p.N788N	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	788	Laminin EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.N788N(1)|p.N788K(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						ACTGGCCTCCGTTGGGATCAC	0.562																																							uc003vew.2		NA																	2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8						c.(2362-2364)AAC>AAT		laminin, beta 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	G		0,4406		0,0,2203	54.0	47.0	49.0		2364	-0.9	0.7	7		49	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	LAMB1	NM_002291.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		788/1787	107600230	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3912				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent	g.chr7:107600230G>A	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.2364C>T	7.37:g.107600230G>A						LAMB1_uc003vev.2_Silent_p.N812N|LAMB1_uc003vex.2_Silent_p.N788N	p.N788N	NM_002291	NP_002282	P07942	LAMB1_HUMAN			19	2699	-			788			Laminin EGF-like 6.		Q14D91	Silent	SNP	ENST00000222399.6	37	c.2364C>T	CCDS5750.1																																																																																				0.562	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		4	37	0	0	0	0.000602	0	4	37				
UBN2	254048	broad.mit.edu	37	7	138943367	138943367	+	Missense_Mutation	SNP	C	C	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr7:138943367C>T	ENST00000473989.3	+	4	797	c.797C>T	c.(796-798)cCc>cTc	p.P266L	UBN2_ENST00000288561.8_Missense_Mutation_p.P183L	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	266	Lys-rich.					extracellular space (GO:0005615)|nucleus (GO:0005634)		p.P183L(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						CACAAGCCACCCAAGGTGAGT	0.363																																							uc011kqr.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(796-798)CCC>CTC		ubinuclein 2							97.0	85.0	89.0					7																	138943367		1847	4116	5963	SO:0001583	missense	254048							g.chr7:138943367C>T	AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.797C>T	7.37:g.138943367C>T	ENSP00000418648:p.Pro266Leu					UBN2_uc003vuv.2_5'UTR	p.P266L	NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN			4	797	+			266			Lys-rich.		A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Missense_Mutation	SNP	ENST00000473989.3	37	c.797C>T	CCDS43655.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.12|17.12	3.308729|3.308729	0.60305|0.60305	.|.	.|.	ENSG00000157741|ENSG00000157741	ENST00000486663;ENST00000473989;ENST00000288561|ENST00000483726	T;T;T|T	0.21734|0.20332	1.99;1.99;1.99|2.08	5.4|5.4	4.52|4.52	0.55395|0.55395	.|.	0.391742|0.391742	0.29080|0.29080	N|N	0.013208|0.013208	T|T	0.37156|0.37156	0.0993|0.0993	M|M	0.65498|0.65498	2.005|2.005	0.49051|0.49051	D|D	0.999748|0.999748	P|.	0.44734|.	0.842|.	B|.	0.34536|.	0.185|.	T|T	0.09640|0.09640	-1.0665|-1.0665	10|8	0.66056|0.41790	D|T	0.02|0.15	-1.6134|-1.6134	14.172|14.172	0.65514|0.65514	0.0:0.9278:0.0:0.0722|0.0:0.9278:0.0:0.0722	.|.	266|.	Q6ZU65|.	UBN2_HUMAN|.	L|S	89;266;183|35	ENSP00000417849:P89L;ENSP00000418648:P266L;ENSP00000288561:P183L|ENSP00000417846:P35S	ENSP00000288561:P183L|ENSP00000417846:P35S	P|P	+|+	2|1	0|0	UBN2|UBN2	138593907|138593907	0.981000|0.981000	0.34729|0.34729	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	2.153000|2.153000	0.42282|0.42282	1.417000|1.417000	0.47077|0.47077	0.557000|0.557000	0.71058|0.71058	CCC|CCA		0.363	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349272.3	NM_173569		4	50	0	0	0	0.009096	0	4	50				
DLC1	10395	broad.mit.edu	37	8	13251147	13251148	+	Missense_Mutation	DNP	CG	CG	AA	rs377063736		TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	CG	CG	-	-	CG	CG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr8:13251147_13251148CG>AA	ENST00000276297.4	-	4	1637_1638	c.1228_1229CG>TT	c.(1228-1230)CGa>TTa	p.R410L	DLC1_ENST00000316609.5_Missense_Mutation_p.R410L|DLC1_ENST00000511869.1_Missense_Mutation_p.R410L	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	410					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.R410L(3)|p.R410*(2)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						CAAATTTACTCGTGTCTGATTT	0.421																																							uc003wwm.2		NA																	5	Substitution - Missense(3)|Substitution - Nonsense(2)		lung(3)|large_intestine(2)	ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						c.(1228-1230)CGA>TTA		deleted in liver cancer 1 isoform 1																																				SO:0001583	missense	10395				actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding	g.chr8:13251147_13251148CG>AA	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.1228_1229delinsAA	8.37:g.13251147_13251148delinsAA	ENSP00000276297:p.Arg410Leu					DLC1_uc003wwn.2_Missense_Mutation_p.R410L|DLC1_uc011kxy.1_Missense_Mutation_p.R410L	p.R410L	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN			4	1672_1673	-			410					B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	DNP	ENST00000276297.4	37	c.1228_1229CG>TT	CCDS5989.1																																																																																				0.421	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094		9	95	0	0	0	0.004672	0	9	95				
CLVS1	157807	broad.mit.edu	37	8	62289213	62289213	+	Silent	SNP	C	C	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr8:62289213C>T	ENST00000519846.1	+	4	977	c.505C>T	c.(505-507)Cta>Tta	p.L169L	CLVS1_ENST00000518592.1_5'UTR|CLVS1_ENST00000325897.4_Silent_p.L169L			Q8IUQ0	CLVS1_HUMAN	clavesin 1	169	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)	p.L169L(1)		endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						ATTGGAAGTCCTAATCGAAGA	0.443																																							uc003xuh.2		NA																	1	Substitution - coding silent(1)		lung(1)	skin(4)|ovary(1)	5						c.(505-507)CTA>TTA		retinaldehyde binding protein 1-like 1							117.0	110.0	112.0					8																	62289213		2203	4300	6503	SO:0001819	synonymous_variant	157807				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity	g.chr8:62289213C>T	AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.505C>T	8.37:g.62289213C>T						CLVS1_uc003xug.2_Silent_p.S167S|CLVS1_uc003xui.2_RNA|CLVS1_uc010lyp.2_Silent_p.L169L	p.L169L	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN			3	829	+			169			CRAL-TRIO.		B2R7M5|C8UZT3|Q8NB32	Silent	SNP	ENST00000519846.1	37	c.505C>T	CCDS6176.1																																																																																				0.443	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378323.1	NM_173519		14	73	0	0	0	0.001855	0	14	73				
CSMD3	114788	broad.mit.edu	37	8	113585738	113585738	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr8:113585738A>G	ENST00000297405.5	-	24	4278	c.4034T>C	c.(4033-4035)gTg>gCg	p.V1345A	CSMD3_ENST00000455883.2_Missense_Mutation_p.V1241A|CSMD3_ENST00000352409.3_Missense_Mutation_p.V1345A|CSMD3_ENST00000343508.3_Missense_Mutation_p.V1305A	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1345	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V1305A(1)|p.V1345A(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACTGGTATACACAAGTTGAAA	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(4033-4035)GTG>GCG		CUB and Sushi multiple domains 3 isoform 1							113.0	116.0	115.0					8																	113585738		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113585738A>G	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4034T>C	8.37:g.113585738A>G	ENSP00000297405:p.Val1345Ala	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Missense_Mutation_p.V617A|CSMD3_uc003ynt.2_Missense_Mutation_p.V1305A|CSMD3_uc011lhx.1_Missense_Mutation_p.V1241A	p.V1345A	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			24	4193	-			1345			Extracellular (Potential).|CUB 7.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.4034T>C	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	A	11.89	1.774439	0.31411	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31	4.71	4.71	0.59529	CUB (5);	0.255981	0.31519	N	0.007502	T	0.09686	0.0238	N	0.16037	0.36	0.52099	D	0.999943	B;B;B	0.33266	0.013;0.016;0.404	B;B;B	0.32090	0.02;0.034;0.14	T	0.14420	-1.0473	10	0.08599	T	0.76	.	14.334	0.66576	1.0:0.0:0.0:0.0	.	1241;1345;1305	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	A	1305;1345;685;1241;1345	ENSP00000345799:V1305A;ENSP00000297405:V1345A;ENSP00000341558:V685A;ENSP00000412263:V1241A;ENSP00000343124:V1345A	ENSP00000297405:V1345A	V	-	2	0	CSMD3	113654914	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	4.217000	0.58547	1.946000	0.56461	0.482000	0.46254	GTG		0.368	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		10	64	0	0	0	0.008291	0	10	64				
KLHL38	340359	broad.mit.edu	37	8	124664241	124664241	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr8:124664241G>T	ENST00000325995.7	-	1	949	c.926C>A	c.(925-927)aCc>aAc	p.T309N	CTD-2552K11.2_ENST00000524355.1_RNA	NM_001081675.2	NP_001075144.2	Q2WGJ6	KLH38_HUMAN	kelch-like family member 38	309								p.T309N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(16)|pancreas(1)|prostate(3)|stomach(1)	38						CCATTGGCCGGTCTGTTTGCT	0.577																																							uc003yqs.1		NA																	1	Substitution - Missense(1)		lung(1)		0						c.(925-927)ACC>AAC		kelch-like 38							83.0	88.0	86.0					8																	124664241		2029	4185	6214	SO:0001583	missense	340359							g.chr8:124664241G>T		CCDS43766.1	8q24.13	2013-02-22	2013-02-22		ENSG00000175946	ENSG00000175946		"""Kelch-like"", ""BTB/POZ domain containing"""	34435	protein-coding gene	gene with protein product			"""kelch-like 38 (Drosophila)"""				Standard	NM_001081675		Approved	C8ORFK36	uc003yqs.1	Q2WGJ6	OTTHUMG00000164983	ENST00000325995.7:c.926C>A	8.37:g.124664241G>T	ENSP00000321475:p.Thr309Asn						p.T309N	NM_001081675	NP_001075144	Q2WGJ6	KLH38_HUMAN			1	950	-			309			Kelch 1.		A0PK12	Missense_Mutation	SNP	ENST00000325995.7	37	c.926C>A	CCDS43766.1	.	.	.	.	.	.	.	.	.	.	G	11.94	1.789376	0.31685	.	.	ENSG00000175946	ENST00000325995	T	0.68479	-0.33	5.18	2.16	0.27623	Kelch-type beta propeller (1);	0.136959	0.64402	N	0.000003	T	0.70307	0.3209	M	0.88181	2.935	0.46131	D	0.998887	B	0.28998	0.23	B	0.30716	0.119	T	0.69566	-0.5111	10	0.66056	D	0.02	.	11.4478	0.50134	0.0:0.2555:0.6121:0.1325	.	309	Q2WGJ6	KLH38_HUMAN	N	309	ENSP00000321475:T309N	ENSP00000321475:T309N	T	-	2	0	KLHL38	124733422	1.000000	0.71417	0.011000	0.14972	0.068000	0.16541	3.894000	0.56250	0.200000	0.20447	0.561000	0.74099	ACC		0.577	KLHL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381288.1			8	60	1	0	0.00307968	0.00308	0.00342915	8	60				
RABEPK	10244	broad.mit.edu	37	9	127969979	127969979	+	Missense_Mutation	SNP	G	G	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr9:127969979G>T	ENST00000373538.3	+	3	500	c.190G>T	c.(190-192)Gac>Tac	p.D64Y	RABEPK_ENST00000394124.4_Missense_Mutation_p.D64Y|RABEPK_ENST00000394125.4_Missense_Mutation_p.D64Y|RABEPK_ENST00000259460.8_Missense_Mutation_p.D64Y|RABEPK_ENST00000373544.1_Missense_Mutation_p.D64Y	NM_005833.3	NP_005824.2	Q7Z6M1	RABEK_HUMAN	Rab9 effector protein with kelch motifs	64					receptor-mediated endocytosis (GO:0006898)|vesicle docking involved in exocytosis (GO:0006904)	endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)		p.D64Y(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15						AAGCTTCTCAGACGTGCACAC	0.522																																							uc004bpi.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(190-192)GAC>TAC		Rab9 effector protein with kelch motifs							135.0	119.0	124.0					9																	127969979		2203	4300	6503	SO:0001583	missense	10244				receptor-mediated endocytosis|vesicle docking involved in exocytosis	endosome membrane|plasma membrane		g.chr9:127969979G>T	BC000503	CCDS6862.1, CCDS55341.1	9q33.1-q33.3	2010-04-19			ENSG00000136933	ENSG00000136933			16896	protein-coding gene	gene with protein product		605962				9230071	Standard	NM_005833		Approved	RAB9P40, bA65N13.1	uc004bpi.3	Q7Z6M1	OTTHUMG00000020674	ENST00000373538.3:c.190G>T	9.37:g.127969979G>T	ENSP00000362639:p.Asp64Tyr					RABEPK_uc004bph.1_Missense_Mutation_p.D64Y|RABEPK_uc004bpj.2_Missense_Mutation_p.D64Y|RABEPK_uc004bpk.2_Missense_Mutation_p.D64Y|RABEPK_uc004bpl.1_Missense_Mutation_p.D64Y|RABEPK_uc004bpm.2_Missense_Mutation_p.D64Y	p.D64Y	NM_005833	NP_005824	Q7Z6M1	RABEK_HUMAN			4	363	+			64			Kelch 1.		A8K403|O00568|Q69YR2|Q6FHA4|Q6IBG7|Q6P092|Q86Y76|Q9BWB1	Missense_Mutation	SNP	ENST00000373538.3	37	c.190G>T	CCDS6862.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.393403	0.83011	.	.	ENSG00000136933	ENST00000394125;ENST00000259460;ENST00000373544;ENST00000394124;ENST00000373538;ENST00000416065	T;T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87;1.87	5.72	5.72	0.89469	Galactose oxidase, beta-propeller (1);	0.154165	0.56097	D	0.000036	T	0.49406	0.1555	L	0.59436	1.845	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.988;1.0;1.0	T	0.43605	-0.9381	10	0.72032	D	0.01	-14.8833	17.3903	0.87428	0.0:0.0:1.0:0.0	.	64;64;64;64	A8K403;Q7Z6M1-2;Q7Z6M1;Q5T1S4	.;.;RABEK_HUMAN;.	Y	64;64;64;64;64;147	ENSP00000377683:D64Y;ENSP00000259460:D64Y;ENSP00000362645:D64Y;ENSP00000377682:D64Y;ENSP00000362639:D64Y;ENSP00000402234:D147Y	ENSP00000259460:D64Y	D	+	1	0	RABEPK	127009800	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	7.300000	0.78841	2.717000	0.92951	0.655000	0.94253	GAC		0.522	RABEPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054064.1	NM_005833		29	104	1	0	3.73148e-12	0.007291	5.13896e-12	29	104				
SETX	23064	broad.mit.edu	37	9	135205442	135205442	+	Missense_Mutation	SNP	T	T	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr9:135205442T>G	ENST00000224140.5	-	10	1725	c.1543A>C	c.(1543-1545)Aca>Cca	p.T515P	SETX_ENST00000393220.1_Missense_Mutation_p.T515P|SETX_ENST00000372169.2_Missense_Mutation_p.T515P	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	515					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.T515P(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		ATCATTGCTGTTCCTTTGGAG	0.438																																							uc004cbk.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(1543-1545)ACA>CCA		senataxin							122.0	126.0	124.0					9																	135205442		2203	4300	6503	SO:0001583	missense	23064				cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity	g.chr9:135205442T>G	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.1543A>C	9.37:g.135205442T>G	ENSP00000224140:p.Thr515Pro					SETX_uc004cbj.2_Missense_Mutation_p.T134P|SETX_uc010mzt.2_Missense_Mutation_p.T134P	p.T515P	NM_015046	NP_055861	Q7Z333	SETX_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)	10	1726	-		Myeloproliferative disorder(178;0.204)	515					A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	37	c.1543A>C	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	T	15.35	2.808221	0.50421	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	T;T;T	0.81078	-1.45;-1.45;-1.45	5.82	-0.962	0.10333	.	0.732984	0.12535	N	0.460451	T	0.71013	0.3290	N	0.24115	0.695	0.09310	N	1	D;P;D	0.53151	0.958;0.93;0.958	P;P;P	0.51229	0.563;0.543;0.663	T	0.62101	-0.6925	10	0.72032	D	0.01	.	4.3921	0.11346	0.2432:0.3082:0.0:0.4485	.	515;515;515	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	P	515	ENSP00000224140:T515P;ENSP00000361242:T515P;ENSP00000376913:T515P	ENSP00000224140:T515P	T	-	1	0	SETX	134195263	0.000000	0.05858	0.064000	0.19789	0.971000	0.66376	-0.448000	0.06820	-0.120000	0.11809	0.528000	0.53228	ACA		0.438	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046		14	156	0	0	0	0.00245	0	14	156				
ZFX	7543	broad.mit.edu	37	X	24228471	24228471	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chrX:24228471A>G	ENST00000379177.1	+	11	1823	c.1396A>G	c.(1396-1398)Aac>Gac	p.N466D	ZFX_ENST00000379188.3_Missense_Mutation_p.N466D|ZFX_ENST00000539115.1_Missense_Mutation_p.N237D|ZFX_ENST00000304543.5_Missense_Mutation_p.N466D|ZFX_ENST00000540034.1_Missense_Mutation_p.N505D|ZFX_ENST00000338565.3_Missense_Mutation_p.N416D	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	466					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)	p.N466D(1)		cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						TTACACTACCAACAAGAAGAT	0.448																																					Esophageal Squamous(20;306 562 7346 32868 37983)	Esophageal Squamous(20;306 562 7346 32868 37983)	uc004dbf.2		NA																	1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1396-1398)AAC>GAC		zinc finger protein, X-linked							140.0	115.0	123.0					X																	24228471		2203	4300	6503	SO:0001583	missense	7543				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding	g.chrX:24228471A>G		CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.1396A>G	X.37:g.24228471A>G	ENSP00000368475:p.Asn466Asp					ZFX_uc004dbe.2_3'UTR|ZFX_uc011mjv.1_Missense_Mutation_p.N505D|ZFX_uc010nfz.2_Missense_Mutation_p.N122D	p.N466D	NM_003410	NP_003401	P17010	ZFX_HUMAN			9	1654	+			466			C2H2-type 2.		B9EG97|O43668|Q8WYJ8	Missense_Mutation	SNP	ENST00000379177.1	37	c.1396A>G	CCDS14211.1	.	.	.	.	.	.	.	.	.	.	A	19.14	3.769411	0.69992	.	.	ENSG00000005889	ENST00000539115;ENST00000379188;ENST00000535562;ENST00000379177;ENST00000304543;ENST00000540034;ENST00000338565	T;T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61;1.61	5.31	5.31	0.75309	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.64402	D	0.000001	T	0.43986	0.1272	L	0.42245	1.32	0.54753	D	0.999986	P;P;P	0.50710	0.938;0.527;0.689	P;P;P	0.58620	0.842;0.724;0.532	T	0.38693	-0.9649	10	0.72032	D	0.01	-5.2085	14.352	0.66708	1.0:0.0:0.0:0.0	.	505;188;466	B9EG97;F5GYV7;P17010	.;.;ZFX_HUMAN	D	237;466;188;466;466;505;416	ENSP00000438233:N237D;ENSP00000368486:N466D;ENSP00000368475:N466D;ENSP00000304985:N466D;ENSP00000441382:N505D;ENSP00000343384:N416D	ENSP00000304985:N466D	N	+	1	0	ZFX	24138392	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.576000	0.82467	1.768000	0.52137	0.486000	0.48141	AAC		0.448	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056084.1	NM_003410		15	80	0	0	0	0.003163	0	15	80				
ATRX	546	broad.mit.edu	37	X	76776888	76776888	+	Missense_Mutation	SNP	G	G	A			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chrX:76776888G>A	ENST00000373344.5	-	33	7278	c.7064C>T	c.(7063-7065)tCa>tTa	p.S2355L	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.S2317L	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	2355					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.S2355L(2)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TACTACAGCTGAAATTATATC	0.373			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																uc004ecp.3		NA		Rec	yes		X	Xq21.1	546	Mis|F|N	alpha thalassemia/mental retardation syndrome X-linked	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E			Pancreatic neuroendocrine tumors		2	Substitution - Missense(2)		lung(2)	haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30						c.(7063-7065)TCA>TTA		transcriptional regulator ATRX isoform 1	Phosphatidylserine(DB00144)						148.0	123.0	131.0					X																	76776888		2202	4296	6498	SO:0001583	missense	546				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	g.chrX:76776888G>A	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.7064C>T	X.37:g.76776888G>A	ENSP00000362441:p.Ser2355Leu					ATRX_uc004ecq.3_Missense_Mutation_p.S2317L|ATRX_uc004eco.3_Missense_Mutation_p.S2140L	p.S2355L	NM_000489	NP_000480	P46100	ATRX_HUMAN			33	7296	-			2355					D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	c.7064C>T	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.023808	0.54683	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.92446	-3.03;-3.04	5.06	5.06	0.68205	.	0.083458	0.50627	D	0.000105	D	0.92344	0.7571	L	0.29908	0.895	0.80722	D	1	D;P	0.58268	0.982;0.9	P;B	0.58077	0.832;0.438	D	0.93358	0.6724	10	0.59425	D	0.04	.	17.6045	0.88034	0.0:0.0:1.0:0.0	.	2317;2355	P46100-4;P46100	.;ATRX_HUMAN	L	2355;2317	ENSP00000362441:S2355L;ENSP00000378967:S2317L	ENSP00000362441:S2355L	S	-	2	0	ATRX	76663544	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.059000	0.57470	2.086000	0.62901	0.513000	0.50165	TCA		0.373	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		4	81	0	0	0	0.000602	0	4	81				
COL4A5	1287	broad.mit.edu	37	X	107911555	107911555	+	Missense_Mutation	SNP	A	A	G			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chrX:107911555A>G	ENST00000361603.2	+	41	3855	c.3611A>G	c.(3610-3612)aAg>aGg	p.K1204R	COL4A5_ENST00000328300.6_Missense_Mutation_p.K1204R	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1204	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.K1204R(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						ATAGGCCAAAAGGGTGATGGA	0.448									Alport syndrome with Diffuse Leiomyomatosis																														uc004enz.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(1)	4						c.(3610-3612)AAG>AGG		type IV collagen alpha 5 isoform 2 precursor							56.0	54.0	54.0					X																	107911555		2203	4300	6503	SO:0001583	missense	1287	Alport_syndrome_with_Diffuse_Leiomyomatosis	Familial Cancer Database		axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding	g.chrX:107911555A>G	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.3611A>G	X.37:g.107911555A>G	ENSP00000354505:p.Lys1204Arg					COL4A5_uc011mso.1_Missense_Mutation_p.K1204R	p.K1204R	NM_033380	NP_203699	P29400	CO4A5_HUMAN			41	3813	+			1204			Triple-helical region.		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	c.3611A>G	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	A	17.42	3.384996	0.61956	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.93659	-3.24;-3.26	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.94301	0.8169	L	0.33189	0.99	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	D	0.93607	0.6935	10	0.33141	T	0.24	.	15.3078	0.74008	1.0:0.0:0.0:0.0	.	1204;1204	E7EVY4;P29400	.;CO4A5_HUMAN	R	1204	ENSP00000331902:K1204R;ENSP00000354505:K1204R	ENSP00000331902:K1204R	K	+	2	0	COL4A5	107798211	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	8.829000	0.92055	1.999000	0.58509	0.481000	0.45027	AAG		0.448	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2			3	63	0	0	0	0.009096	0	3	63				
SPANXN1	494118	broad.mit.edu	37	X	144337280	144337280	+	Silent	SNP	C	C	T			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chrX:144337280C>T	ENST00000370493.3	+	2	924	c.165C>T	c.(163-165)tgC>tgT	p.C55C		NM_001009614.2	NP_001009614.1	Q5VSR9	SPXN1_HUMAN	SPANX family, member N1	55								p.C55C(2)		endometrium(2)|kidney(2)|lung(8)|prostate(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;6.56e-05)					TAGCGTTTTGCTACAGGAAAG	0.433																																							uc004fcb.2		NA																	2	Substitution - coding silent(2)		lung(2)		0						c.(163-165)TGC>TGT		SPANX-N1 protein							181.0	156.0	164.0					X																	144337280		2203	4297	6500	SO:0001819	synonymous_variant	494118							g.chrX:144337280C>T		CCDS35421.1	Xq27.3	2009-03-25				ENSG00000203923			33174	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 6"""	300664				14973187, 17012309	Standard	NM_001009614		Approved	SPANX-N1, CT11.6	uc004fcb.2	Q5VSR9		ENST00000370493.3:c.165C>T	X.37:g.144337280C>T							p.C55C	NM_001009614	NP_001009614	Q5VSR9	SPXN1_HUMAN			2	165	+	Acute lymphoblastic leukemia(192;6.56e-05)		55						Silent	SNP	ENST00000370493.3	37	c.165C>T	CCDS35421.1																																																																																				0.433	SPANXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058631.2	NM_001009614		13	141	0	0	0	0.001855	0	13	141				
OR6C65	403282	broad.mit.edu	37	12	55794772	55794773	+	Frame_Shift_Ins	INS	-	-	T	rs558561555		TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr12:55794772_55794773insT	ENST00000379665.2	+	1	559_560	c.460_461insT	c.(460-462)attfs	p.I154fs		NM_001005518.1	NP_001005518.1	A6NJZ3	O6C65_HUMAN	olfactory receptor, family 6, subfamily C, member 65	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(3)|lung(9)	15						TTTTCTCATTATTTTTCCCCCC	0.436																																							uc010spl.1		NA																	0					0						c.(460-462)ATTfs		olfactory receptor, family 6, subfamily C,																																				SO:0001589	frameshift_variant	403282				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr12:55794772_55794773insT		CCDS31821.1	12q13.2	2013-09-23			ENSG00000205328	ENSG00000205328		"""GPCR / Class A : Olfactory receptors"""	31295	protein-coding gene	gene with protein product							Standard	NM_001005518		Approved		uc010spl.2	A6NJZ3	OTTHUMG00000169955	ENST00000379665.2:c.465dupT	12.37:g.55794777_55794777dupT	ENSP00000368986:p.Ile154fs						p.I154fs	NM_001005518	NP_001005518	A6NJZ3	O6C65_HUMAN			1	460_461	+			154			Helical; Name=4; (Potential).		B2RNH9	Frame_Shift_Ins	INS	ENST00000379665.2	37	c.460_461insT	CCDS31821.1																																																																																				0.436	OR6C65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406674.1			7	313	NA	NA	NA	NA	NA	7	313	---	---	---	---
MYL1	4632	broad.mit.edu	37	2	211179668	211179668	+	Frame_Shift_Del	DEL	G	G	-			TCGA-91-6835-01A-11D-1855-08	TCGA-91-6835-11A-01D-1855-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8120c5eb-2917-4053-a5e5-aad53ff45da9	46fde1ad-2cea-483b-ae64-f1226a732b9a	g.chr2:211179668delG	ENST00000352451.3	-	1	246	c.99delC	c.(97-99)cccfs	p.P33fs		NM_079420.2	NP_524144.1	P05976	MYL1_HUMAN	myosin, light chain 1, alkali; skeletal, fast	33					cardiac muscle contraction (GO:0060048)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|sarcomere (GO:0030017)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	16				Epithelial(149;0.00573)|Lung(261;0.0422)|LUSC - Lung squamous cell carcinoma(261;0.0444)|all cancers(144;0.057)		TTTCTTCTTTGGGTTTggctg	0.507																																							uc002vec.2		NA																	0				ovary(1)	1						c.(97-99)CCCfs		fast skeletal myosin alkali light chain 1							117.0	137.0	130.0					2																	211179668		2203	4300	6503	SO:0001589	frameshift_variant	4632				muscle filament sliding|muscle organ development	cytosol|muscle myosin complex|sarcomere	calcium ion binding|structural constituent of muscle	g.chr2:211179668delG		CCDS2390.1, CCDS2391.1	2q33-q34	2013-01-10	2006-09-29		ENSG00000168530	ENSG00000168530		"""Myosins / Light chain"", ""EF-hand domain containing"""	7582	protein-coding gene	gene with protein product		160780	"""myosin, light polypeptide 1, alkali; skeletal, fast"""			2304459, 3422212	Standard	NM_079422		Approved		uc002vec.3	P05976	OTTHUMG00000132992	ENST00000352451.3:c.99delC	2.37:g.211179668delG	ENSP00000307280:p.Pro33fs						p.P33fs	NM_079420	NP_524144	P05976	MYL1_HUMAN		Epithelial(149;0.00573)|Lung(261;0.0422)|LUSC - Lung squamous cell carcinoma(261;0.0444)|all cancers(144;0.057)	1	228	-			33					B2R4N6|B2R4T6|P06741|Q6IBD5	Frame_Shift_Del	DEL	ENST00000352451.3	37	c.99delC	CCDS2390.1																																																																																				0.507	MYL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256566.2	NM_079420		39	314	NA	NA	NA	NA	NA	39	314	---	---	---	---
