#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
VPS13D	55187	broad.mit.edu	37	1	12333079	12333079	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:12333079C>A	ENST00000358136.3	+	18	2253	c.2123C>A	c.(2122-2124)aCc>aAc	p.T708N	VPS13D_ENST00000356315.4_Missense_Mutation_p.T708N	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		AAACGATGGACCGTGCGGCTG	0.428																																							uc001atv.2		NA																	0				ovary(4)|pancreas(1)	5						c.(2122-2124)ACC>AAC		vacuolar protein sorting 13D isoform 1							144.0	134.0	137.0					1																	12333079		2203	4300	6503	SO:0001583	missense	55187				protein localization			g.chr1:12333079C>A	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.2123C>A	1.37:g.12333079C>A	ENSP00000350854:p.Thr708Asn					VPS13D_uc001atw.2_Missense_Mutation_p.T708N|VPS13D_uc001atx.2_5'Flank	p.T708N	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)	18	2264	+	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)	708						Missense_Mutation	SNP	ENST00000358136.3	37	c.2123C>A	CCDS30588.1	.	.	.	.	.	.	.	.	.	.	C	10.55	1.380714	0.24944	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.42131	0.98;0.98	5.16	0.627	0.17675	.	0.176098	0.48286	D	0.000185	T	0.27524	0.0676	L	0.39020	1.185	0.80722	D	1	P;B	0.35575	0.51;0.191	B;B	0.32864	0.154;0.073	T	0.04467	-1.0949	10	0.18710	T	0.47	.	11.3336	0.49490	0.0:0.4778:0.4528:0.0694	.	708;708	Q5THJ4-2;Q5THJ4	.;VP13D_HUMAN	N	708	ENSP00000348666:T708N;ENSP00000350854:T708N	ENSP00000348666:T708N	T	+	2	0	VPS13D	12255666	0.995000	0.38212	0.789000	0.31954	0.398000	0.30690	3.158000	0.50723	-0.161000	0.10983	0.585000	0.79938	ACC		0.428	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378		26	56	1	0	1.12875e-08	0.00632	1.55935e-08	26	56				
CROCC	9696	broad.mit.edu	37	1	17296381	17296381	+	Silent	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:17296381G>T	ENST00000375541.5	+	33	5472	c.5403G>T	c.(5401-5403)ctG>ctT	p.L1801L		NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		TGGCTGACCTGGAACTGCAGC	0.662																																							uc001azt.2		NA																	0				ovary(2)|breast(2)|central_nervous_system(1)	5						c.(5401-5403)CTG>CTT		ciliary rootlet coiled-coil							54.0	50.0	51.0					1																	17296381		2203	4300	6503	SO:0001819	synonymous_variant	9696				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity	g.chr1:17296381G>T	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.5403G>T	1.37:g.17296381G>T						CROCC_uc001azu.2_Silent_p.L1104L|CROCC_uc001azv.2_Silent_p.L137L	p.L1801L	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)	33	5472	+		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)	1801						Silent	SNP	ENST00000375541.5	37	c.5403G>T	CCDS30616.1																																																																																				0.662	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675		14	45	1	0	1.05317e-09	0.00245	1.488e-09	14	45				
C1orf94	84970	broad.mit.edu	37	1	34663381	34663381	+	Silent	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:34663381G>T	ENST00000488417.1	+	2	996	c.876G>T	c.(874-876)ctG>ctT	p.L292L	C1orf94_ENST00000373374.3_Silent_p.L102L	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	292										central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				TTCTGCTGCTGCCTCCCCGAC	0.597																																							uc001bxs.3		NA																	0					0						c.(304-306)CTG>CTT		hypothetical protein LOC84970 isoform b							68.0	61.0	63.0					1																	34663381		2203	4300	6503	SO:0001819	synonymous_variant	84970						protein binding	g.chr1:34663381G>T	AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.876G>T	1.37:g.34663381G>T						C1orf94_uc001bxt.2_Silent_p.L292L	p.L102L	NM_032884	NP_116273	Q6P1W5	CA094_HUMAN			2	705	+		Myeloproliferative disorder(586;0.0393)	102					B3KVT1|D3DPR3|E9PJ76|Q96IC8	Silent	SNP	ENST00000488417.1	37	c.306G>T	CCDS44108.1																																																																																				0.597	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036845.2	NM_032884		19	43	1	0	1.56452e-12	0.007413	2.48327e-12	19	43				
THRAP3	9967	broad.mit.edu	37	1	36752483	36752483	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:36752483G>C	ENST00000354618.5	+	4	876	c.652G>C	c.(652-654)Gag>Cag	p.E218Q	THRAP3_ENST00000469141.2_Missense_Mutation_p.E218Q	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	218	Ser-rich.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AAAAGCATCTGAGAGCTCGAA	0.577			T	USP6	aneurysmal bone cysts																																Pancreas(129;785 1795 20938 23278 32581)	Pancreas(129;785 1795 20938 23278 32581)	uc001cae.3		NA		Dom	yes		1	1p34.3	9967	T	thyroid hormone receptor associated protein 3 (TRAP150)			M	USP6		aneurysmal bone cysts		0				ovary(5)|lung(3)|breast(1)	9						c.(652-654)GAG>CAG		thyroid hormone receptor associated protein 3							43.0	46.0	45.0					1																	36752483		2203	4297	6500	SO:0001583	missense	9967				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ATP binding|ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr1:36752483G>C	AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.652G>C	1.37:g.36752483G>C	ENSP00000346634:p.Glu218Gln					THRAP3_uc001caf.3_Missense_Mutation_p.E218Q|THRAP3_uc001cag.1_Missense_Mutation_p.E218Q	p.E218Q	NM_005119	NP_005110	Q9Y2W1	TR150_HUMAN			4	876	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	218			Ser-rich.		D3DPS5|Q5VTK6	Missense_Mutation	SNP	ENST00000354618.5	37	c.652G>C	CCDS405.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.153661	0.57259	.	.	ENSG00000054118	ENST00000354618;ENST00000469141	T;T	0.10668	2.85;2.85	5.89	5.89	0.94794	.	0.142775	0.48286	D	0.000195	T	0.14960	0.0361	L	0.51422	1.61	0.41340	D	0.987296	B	0.18166	0.026	B	0.22152	0.038	T	0.03344	-1.1046	10	0.34782	T	0.22	-4.6517	19.2499	0.93919	0.0:0.0:1.0:0.0	.	218	Q9Y2W1	TR150_HUMAN	Q	218	ENSP00000346634:E218Q;ENSP00000433825:E218Q	ENSP00000346634:E218Q	E	+	1	0	THRAP3	36525070	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.771000	0.62318	2.793000	0.96121	0.655000	0.94253	GAG		0.577	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119		31	75	0	0	0	0.007291	0	31	75				
KANK4	163782	broad.mit.edu	37	1	62703954	62703954	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:62703954G>T	ENST00000371153.4	-	10	3361	c.2983C>A	c.(2983-2985)Ctg>Atg	p.L995M	KANK4_ENST00000354381.3_Missense_Mutation_p.L367M|KANK4_ENST00000371150.1_Missense_Mutation_p.L351M|KANK4_ENST00000317477.4_Missense_Mutation_p.L133M	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	995						cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						AGCCCCTACAGCCCCAGGGAC	0.617																																							uc001dah.3		NA																	0				ovary(3)|skin(2)|lung(1)	6						c.(2983-2985)CTG>ATG		ankyrin repeat domain 38							33.0	34.0	34.0					1																	62703954		2203	4300	6503	SO:0001583	missense	163782							g.chr1:62703954G>T	AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.2983C>A	1.37:g.62703954G>T	ENSP00000360195:p.Leu995Met					KANK4_uc001dai.3_Missense_Mutation_p.L367M|KANK4_uc001daf.3_Missense_Mutation_p.L133M|KANK4_uc001dag.3_Missense_Mutation_p.L351M	p.L995M	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN			10	3360	-			995					B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Missense_Mutation	SNP	ENST00000371153.4	37	c.2983C>A	CCDS620.1	.	.	.	.	.	.	.	.	.	.	G	15.33	2.801299	0.50315	.	.	ENSG00000132854	ENST00000371153;ENST00000317477;ENST00000354381;ENST00000371150	T;T;T;T	0.53423	0.62;0.62;0.71;0.74	5.02	4.09	0.47781	.	0.834985	0.09773	N	0.757732	T	0.39462	0.1079	L	0.36672	1.1	0.19775	N	0.99995	B;B	0.15930	0.006;0.015	B;B	0.11329	0.006;0.004	T	0.25882	-1.0119	10	0.39692	T	0.17	.	10.3733	0.44066	0.0:0.0:0.6437:0.3562	.	367;995	Q5T7N3-2;Q5T7N3	.;KANK4_HUMAN	M	995;133;367;351	ENSP00000360195:L995M;ENSP00000321161:L133M;ENSP00000346352:L367M;ENSP00000360192:L351M	ENSP00000321161:L133M	L	-	1	2	KANK4	62476542	0.810000	0.29049	0.840000	0.33206	0.714000	0.41099	2.189000	0.42621	1.312000	0.45043	0.305000	0.20034	CTG		0.617	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024877.1	NM_181712		8	40	1	0	6.5536e-12	0.00308	1.01854e-11	8	40				
DIRAS3	9077	broad.mit.edu	37	1	68512327	68512327	+	Silent	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:68512327G>A	ENST00000370981.1	-	4	1290	c.654C>T	c.(652-654)acC>acT	p.T218T	GNG12-AS1_ENST00000413628.1_RNA|GNG12-AS1_ENST00000420587.1_RNA|DIRAS3_ENST00000395201.1_Silent_p.T218T			O95661	DIRA3_HUMAN	DIRAS family, GTP-binding RAS-like 3	218					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of gene expression by genetic imprinting (GO:0006349)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GCTTCTCAGTGGTGTTGGGCA	0.507																																							uc001ded.2		NA																	0				skin(1)	1						c.(652-654)ACC>ACT		DIRAS family, GTP-binding RAS-like 3							124.0	123.0	123.0					1																	68512327		2203	4300	6503	SO:0001819	synonymous_variant	9077				regulation of cyclin-dependent protein kinase activity|regulation of gene expression by genetic imprinting|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity	g.chr1:68512327G>A	U96750	CCDS641.1	1p31	2014-05-09		2005-01-27	ENSG00000162595	ENSG00000162595			687	protein-coding gene	gene with protein product		605193	"""ras homolog gene family, member I"""	ARHI		9874798	Standard	XM_006711027		Approved	NOEY2	uc001ded.3	O95661	OTTHUMG00000009544	ENST00000370981.1:c.654C>T	1.37:g.68512327G>A						uc001deb.1_Intron|uc001dec.1_Intron	p.T218T	NM_004675	NP_004666	O95661	DIRA3_HUMAN			2	949	-			218					B3KMP3	Silent	SNP	ENST00000370981.1	37	c.654C>T	CCDS641.1																																																																																				0.507	DIRAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026354.2	NM_004675		48	91	0	0	0	0.00361	0	48	91				
ST6GALNAC3	256435	broad.mit.edu	37	1	77094406	77094406	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:77094406G>T	ENST00000328299.3	+	5	981	c.833G>T	c.(832-834)aGg>aTg	p.R278M		NM_152996.2	NP_694541.2	Q8NDV1	SIA7C_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3	278					glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sialyltransferase activity (GO:0008373)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|ovary(3)|prostate(1)|skin(2)	36						GGGGGTCATAGGTTTATCACT	0.378																																							uc001dhh.2		NA																	0				ovary(3)|skin(2)	5						c.(832-834)AGG>ATG		sialyltransferase 7C isoform 1							139.0	142.0	141.0					1																	77094406		2203	4299	6502	SO:0001583	missense	256435				protein glycosylation	integral to Golgi membrane	sialyltransferase activity	g.chr1:77094406G>T		CCDS672.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000184005	ENSG00000184005		"""Sialyltransferases"""	19343	protein-coding gene	gene with protein product	"""ST6GALNAC III"""	610133	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) C"""	SIAT7C			Standard	NM_152996		Approved		uc001dhh.2	Q8NDV1	OTTHUMG00000009615	ENST00000328299.3:c.833G>T	1.37:g.77094406G>T	ENSP00000329214:p.Arg278Met					ST6GALNAC3_uc010orh.1_Missense_Mutation_p.R177M	p.R278M	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN			5	996	+			278			Lumenal (Potential).		Q6PCE0|Q6UX29|Q8N259	Missense_Mutation	SNP	ENST00000328299.3	37	c.833G>T	CCDS672.1	.	.	.	.	.	.	.	.	.	.	g	19.92	3.916380	0.73098	.	.	ENSG00000184005	ENST00000328299;ENST00000394993;ENST00000415813	T	0.30714	1.52	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.56558	0.1993	M	0.86268	2.805	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.62651	-0.6809	10	0.66056	D	0.02	-11.6428	19.3735	0.94500	0.0:0.0:1.0:0.0	.	177;278	B4DM98;Q8NDV1	.;SIA7C_HUMAN	M	278;277;176	ENSP00000329214:R278M	ENSP00000329214:R278M	R	+	2	0	ST6GALNAC3	76866994	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.398000	0.97281	2.644000	0.89710	0.645000	0.84053	AGG		0.378	ST6GALNAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026501.1	NM_152996		14	36	1	0	1.5842e-08	0.001855	2.18047e-08	14	36				
CLCA4	22802	broad.mit.edu	37	1	87025627	87025627	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:87025627A>T	ENST00000370563.3	+	2	214	c.172A>T	c.(172-174)Aca>Tca	p.T58S	CLCA4_ENST00000263723.5_5'UTR	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	58	Metalloprotease domain. {ECO:0000250|UniProtKB:A8K7I4}.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		TATGGTGACTACAGCTTCTAC	0.343																																							uc009wcs.2		NA																	0				ovary(2)	2						c.(172-174)ACA>TCA		chloride channel accessory 4							144.0	130.0	135.0					1																	87025627		1829	4083	5912	SO:0001583	missense	22802					apical plasma membrane|extracellular region|integral to plasma membrane	chloride channel activity	g.chr1:87025627A>T	AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.172A>T	1.37:g.87025627A>T	ENSP00000359594:p.Thr58Ser					CLCA4_uc009wct.2_5'UTR|CLCA4_uc009wcu.2_5'UTR	p.T58S	NM_012128	NP_036260	Q14CN2	CLCA4_HUMAN		all cancers(265;0.0202)|Epithelial(280;0.0404)	2	216	+		Lung NSC(277;0.238)	58					A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Missense_Mutation	SNP	ENST00000370563.3	37	c.172A>T	CCDS41355.1	.	.	.	.	.	.	.	.	.	.	A	11.90	1.776744	0.31411	.	.	ENSG00000016602	ENST00000370563	T	0.10960	2.82	5.96	-5.84	0.02318	Chloride channel calcium-activated (1);	1.434540	0.04884	N	0.448152	T	0.02533	0.0077	N	0.24115	0.695	0.09310	N	1	B	0.25235	0.121	B	0.32393	0.145	T	0.44667	-0.9313	10	0.38643	T	0.18	-0.3729	10.1206	0.42618	0.2335:0.1752:0.5913:0.0	.	58	Q14CN2	CLCA4_HUMAN	S	58	ENSP00000359594:T58S	ENSP00000359594:T58S	T	+	1	0	CLCA4	86798215	0.000000	0.05858	0.036000	0.18154	0.405000	0.30901	-0.107000	0.10873	-1.032000	0.03304	-0.313000	0.08912	ACA		0.343	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128		42	105	0	0	0	0.009718	0	42	105				
VCAM1	7412	broad.mit.edu	37	1	101194697	101194697	+	Silent	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:101194697C>T	ENST00000294728.2	+	5	1064	c.963C>T	c.(961-963)ccC>ccT	p.P321P	VCAM1_ENST00000370115.1_Intron|VCAM1_ENST00000347652.2_Intron|VCAM1_ENST00000370119.4_Silent_p.P259P	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	321	Ig-like C2-type 4.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	CCCCTGGACCCCGGATTGCTG	0.453																																							uc001dti.2		NA																	0				central_nervous_system(1)	1						c.(961-963)CCC>CCT		vascular cell adhesion molecule 1 isoform a	Carvedilol(DB01136)						104.0	110.0	108.0					1																	101194697		2203	4300	6503	SO:0001819	synonymous_variant	7412				heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding	g.chr1:101194697C>T	M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.963C>T	1.37:g.101194697C>T						VCAM1_uc001dtj.2_Intron|VCAM1_uc010ouj.1_Silent_p.P259P	p.P321P	NM_001078	NP_001069	P19320	VCAM1_HUMAN		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	5	1083	+		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)	321			Ig-like C2-type 4.|Extracellular (Potential).		A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Silent	SNP	ENST00000294728.2	37	c.963C>T	CCDS773.1																																																																																				0.453	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078		48	118	0	0	0	0.00361	0	48	118				
S1PR1	1901	broad.mit.edu	37	1	101704645	101704645	+	Silent	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:101704645G>A	ENST00000305352.6	+	2	480	c.105G>A	c.(103-105)ctG>ctA	p.L35L	RP4-575N6.4_ENST00000432195.1_RNA|S1PR1_ENST00000475821.1_3'UTR	NM_001400.4	NP_001391.2	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	35					actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|brain development (GO:0007420)|cardiac muscle tissue growth involved in heart morphogenesis (GO:0003245)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|chemotaxis (GO:0006935)|endothelial cell differentiation (GO:0045446)|G-protein coupled receptor signaling pathway (GO:0007186)|heart trabecula morphogenesis (GO:0061384)|lamellipodium assembly (GO:0030032)|negative regulation of stress fiber assembly (GO:0051497)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bone mineralization (GO:0030500)|regulation of bone resorption (GO:0045124)|regulation of cell adhesion (GO:0030155)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell migration (GO:0072678)|transmission of nerve impulse (GO:0019226)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|sphingolipid binding (GO:0046625)|sphingosine-1-phosphate receptor activity (GO:0038036)			NS(1)|autonomic_ganglia(1)|breast(1)|large_intestine(7)|lung(23)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	43						CGGGAAAGCTGAATATCAGCG	0.517											OREG0013620	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001dud.2		NA																	0				ovary(2)|lung(1)	3						c.(103-105)CTG>CTA		sphingosine-1-phosphate receptor 1							109.0	103.0	105.0					1																	101704645		2203	4300	6503	SO:0001819	synonymous_variant	1901				cell adhesion	integral to membrane	lysosphingolipid and lysophosphatidic acid receptor activity	g.chr1:101704645G>A	M31210	CCDS777.1	1p21	2012-08-08	2008-04-30	2008-04-30	ENSG00000170989	ENSG00000170989		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"", ""CD molecules"""	3165	protein-coding gene	gene with protein product		601974	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 1"""	EDG1		2160972, 9488656	Standard	NM_001400		Approved	edg-1, D1S3362, CD363	uc001dud.2	P21453	OTTHUMG00000010835	ENST00000305352.6:c.105G>A	1.37:g.101704645G>A			OREG0013620	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1360	S1PR1_uc009weg.2_Silent_p.L35L	p.L35L	NM_001400	NP_001391	P21453	S1PR1_HUMAN			2	619	+			35			Extracellular (By similarity).		D3DT66|Q9BYY4|Q9NYN8	Silent	SNP	ENST00000305352.6	37	c.105G>A	CCDS777.1																																																																																				0.517	S1PR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029908.1	NM_001400		28	60	0	0	0	0.007291	0	28	60				
AMY2A	279	broad.mit.edu	37	1	104160118	104160118	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:104160118C>A	ENST00000414303.2	+	1	120	c.56C>A	c.(55-57)cCa>cAa	p.P19Q		NM_000699.2	NP_000690.1	P04746	AMYP_HUMAN	amylase, alpha 2A (pancreatic)	19					carbohydrate catabolic process (GO:0016052)|carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|calcium ion binding (GO:0005509)|chloride ion binding (GO:0031404)			endometrium(3)|kidney(1)|large_intestine(5)|liver(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Icodextrin(DB00702)|Miglitol(DB00491)	CAGTATTCCCCAAATACACAA	0.398																																							uc001dut.2		NA																	0				ovary(1)|skin(1)	2						c.(55-57)CCA>CAA		pancreatic amylase alpha 2A precursor	Acarbose(DB00284)|Bentiromide(DB00522)|Icodextrin(DB00702)|Miglitol(DB00491)|Pancrelipase(DB00085)						103.0	87.0	92.0					1																	104160118		2200	4257	6457	SO:0001583	missense	279				carbohydrate catabolic process|polysaccharide digestion	extracellular space	alpha-amylase activity|calcium ion binding|chloride ion binding	g.chr1:104160118C>A	BC007060	CCDS783.1	1p21.1	2012-10-02	2007-05-03		ENSG00000243480	ENSG00000243480	3.2.1.1		477	protein-coding gene	gene with protein product		104650	"""amylase, alpha 2A; pancreatic"""	AMY2		3260028	Standard	NM_000699		Approved		uc001dut.3	P04746	OTTHUMG00000011023	ENST00000414303.2:c.56C>A	1.37:g.104160118C>A	ENSP00000397582:p.Pro19Gln					AMY2A_uc010ouq.1_Missense_Mutation_p.P19Q	p.P19Q	NM_000699	NP_000690	P04746	AMYP_HUMAN		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	1	120	+		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)	19					B9EJG1|Q9UBH3	Missense_Mutation	SNP	ENST00000414303.2	37	c.56C>A	CCDS783.1	.	.	.	.	.	.	.	.	.	.	c	13.46	2.243979	0.39697	.	.	ENSG00000243480	ENST00000414303;ENST00000393932	.	.	.	3.22	3.22	0.36961	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.81403	0.4815	M	0.91612	3.225	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.72075	0.976;0.964	D	0.86474	0.1787	9	0.87932	D	0	.	14.5293	0.67912	0.0:1.0:0.0:0.0	.	19;19	B9EJG1;P04746	.;AMYP_HUMAN	Q	19	.	ENSP00000377509:P19Q	P	+	2	0	AMY2A	103961641	1.000000	0.71417	0.027000	0.17364	0.132000	0.20833	7.061000	0.76699	1.784000	0.52394	0.455000	0.32223	CCA		0.398	AMY2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030315.1	NM_000699		62	143	1	0	1.52378e-38	0.00361	2.84184e-38	62	143				
NOTCH2	4853	broad.mit.edu	37	1	120491110	120491110	+	Silent	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:120491110G>T	ENST00000256646.2	-	17	2898	c.2679C>A	c.(2677-2679)ggC>ggA	p.G893G		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	893	EGF-like 23; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACATGTAGCTGCCCTGGGTGT	0.517			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome		OREG0013733	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001eik.2		NA		Dom	yes		1	1p13-p11	4853	N|F|Mis	Notch homolog 2			L			marginal zone lymphoma|DLBCL		0				lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27						c.(2677-2679)GGC>GGA		notch 2 preproprotein							143.0	120.0	128.0					1																	120491110		2203	4300	6503	SO:0001819	synonymous_variant	4853	Alagille_Syndrome	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity	g.chr1:120491110G>T	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.2679C>A	1.37:g.120491110G>T			OREG0013733	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1504	NOTCH2_uc001eil.2_Silent_p.G893G	p.G893G	NM_024408	NP_077719	Q04721	NOTC2_HUMAN		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)	17	2935	-	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)	893			EGF-like 23; calcium-binding (Potential).|Extracellular (Potential).		Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	c.2679C>A	CCDS908.1																																																																																				0.517	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408		9	70	1	0	4.68919e-08	0.008291	6.31432e-08	9	70				
NOTCH2	4853	broad.mit.edu	37	1	120509106	120509106	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:120509106T>A	ENST00000256646.2	-	9	1679	c.1460A>T	c.(1459-1461)aAa>aTa	p.K487I		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	487	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATGCACACCTTTGAAACCTAA	0.398			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																														uc001eik.2		NA		Dom	yes		1	1p13-p11	4853	N|F|Mis	Notch homolog 2			L			marginal zone lymphoma|DLBCL		0				lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27						c.(1459-1461)AAA>ATA		notch 2 preproprotein							160.0	142.0	148.0					1																	120509106		2203	4300	6503	SO:0001583	missense	4853	Alagille_Syndrome	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity	g.chr1:120509106T>A	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.1460A>T	1.37:g.120509106T>A	ENSP00000256646:p.Lys487Ile					NOTCH2_uc001eil.2_Missense_Mutation_p.K487I|NOTCH2_uc001eim.3_Missense_Mutation_p.K404I	p.K487I	NM_024408	NP_077719	Q04721	NOTC2_HUMAN		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)	9	1716	-	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)	487			Extracellular (Potential).|EGF-like 12; calcium-binding (Potential).		Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	c.1460A>T	CCDS908.1	.	.	.	.	.	.	.	.	.	.	T	17.77	3.470228	0.63625	.	.	ENSG00000134250	ENST00000256646;ENST00000539617	D	0.91894	-2.93	5.73	5.73	0.89815	EGF (1);EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.40302	U	0.001129	D	0.88592	0.6478	N	0.04959	-0.14	0.39970	D	0.974772	D;D;P	0.89917	0.999;1.0;0.948	D;D;P	0.83275	0.996;0.995;0.731	D	0.91862	0.5500	10	0.46703	T	0.11	.	15.2141	0.73250	0.0:0.0:0.0:1.0	.	448;487;487	D2WEZ3;Q6IQ50;Q04721	.;.;NOTC2_HUMAN	I	487;448	ENSP00000256646:K487I	ENSP00000256646:K487I	K	-	2	0	NOTCH2	120310629	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.768000	0.26590	2.197000	0.70478	0.533000	0.62120	AAA		0.398	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408		25	52	0	0	0	0.00632	0	25	52				
NOTCH2NL	388677	broad.mit.edu	37	1	145273189	145273189	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:145273189C>G	ENST00000369340.3	+	4	487	c.43C>G	c.(43-45)Cca>Gca	p.P15A	RP11-458D21.5_ENST00000468030.1_Missense_Mutation_p.P15A|NOTCH2NL_ENST00000344859.3_Missense_Mutation_p.P15A|NOTCH2NL_ENST00000362074.6_Missense_Mutation_p.P15A			Q7Z3S9	NT2NL_HUMAN	notch 2 N-terminal like	15	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	27						ATACAGATGTCCAGAAGGCTT	0.463																																							uc001emn.3		NA																	0				ovary(1)	1						c.(43-45)CCA>GCA		Notch homolog 2 N-terminal like protein							19.0	23.0	22.0					1																	145273189		2181	4258	6439	SO:0001583	missense	388677				cell differentiation|multicellular organismal development|Notch signaling pathway	cytoplasm|extracellular region	calcium ion binding	g.chr1:145273189C>G		CCDS72880.1	1q21.2	2010-06-24	2010-06-24		ENSG00000213240	ENSG00000213240			31862	protein-coding gene	gene with protein product			"""Notch homolog 2 (Drosophila) N-terminal like"""			14673143	Standard	NM_203458		Approved	N2N	uc001emn.4	Q7Z3S9	OTTHUMG00000013754	ENST00000369340.3:c.43C>G	1.37:g.145273189C>G	ENSP00000358346:p.Pro15Ala					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_5'UTR|NOTCH2NL_uc001emm.3_Missense_Mutation_p.P15A|NOTCH2NL_uc001emo.2_Missense_Mutation_p.P15A|NOTCH2NL_uc010oyh.1_RNA	p.P15A	NM_203458	NP_982283	Q7Z3S9	NT2NL_HUMAN			3	413	+			15			EGF-like 1.		Q5BKT8|Q5VTG9|Q5XG84|Q6P192|Q8NC23|Q8WUQ9|Q96FY1	Missense_Mutation	SNP	ENST00000369340.3	37	c.43C>G	CCDS909.1	.	.	.	.	.	.	.	.	.	.	C	2.538	-0.307001	0.05458	.	.	ENSG00000213240	ENST00000362074;ENST00000344859;ENST00000369340	T;T;T	0.39787	1.06;1.06;1.06	2.75	2.75	0.32379	EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.11452	0.0279	L	0.35341	1.055	0.21527	N	0.999655	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.001	T	0.22695	-1.0209	9	0.16420	T	0.52	.	7.0326	0.24975	0.2706:0.7294:0.0:0.0	.	15;15	Q7Z3S9-2;Q7Z3S9	.;NT2NL_HUMAN	A	15	ENSP00000354929:P15A;ENSP00000344557:P15A;ENSP00000358346:P15A	ENSP00000344557:P15A	P	+	1	0	NOTCH2NL	143984546	1.000000	0.71417	0.998000	0.56505	0.502000	0.33828	2.067000	0.41461	1.532000	0.49169	0.394000	0.25966	CCA		0.463	NOTCH2NL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038546.1	NM_203458		10	108	0	0	0	0.004007	0	10	108				
MCL1	4170	broad.mit.edu	37	1	150551692	150551692	+	Silent	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:150551692C>A	ENST00000369026.2	-	1	374	c.315G>T	c.(313-315)gcG>gcT	p.A105A	MCL1_ENST00000464132.1_5'Flank|MCL1_ENST00000307940.3_Silent_p.A105A	NM_001197320.1|NM_021960.4	NP_001184249.1|NP_068779.1	Q07820	MCL1_HUMAN	myeloid cell leukemia 1	105	PEST-like.				apoptotic mitochondrial changes (GO:0008637)|cell fate determination (GO:0001709)|cellular homeostasis (GO:0019725)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|protein transmembrane transport (GO:0071806)|regulation of response to DNA damage stimulus (GO:2001020)|response to cytokine (GO:0034097)	Bcl-2 family protein complex (GO:0097136)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	BH3 domain binding (GO:0051434)|protein channel activity (GO:0015266)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)	8	all_cancers(9;1.69e-53)|all_epithelial(9;1.95e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CAAGCGGCGCCGCGCGGCGGG	0.746																																							uc001euz.2		NA																	0					0						c.(313-315)GCG>GCT		myeloid cell leukemia sequence 1 isoform 1							6.0	8.0	8.0					1																	150551692		1790	3815	5605	SO:0001819	synonymous_variant	4170				anti-apoptosis|apoptosis|cell fate determination|cellular homeostasis|multicellular organismal development|response to cytokine stimulus	integral to membrane|mitochondrial outer membrane|nucleoplasm	BH3 domain binding|protein binding|protein channel activity|protein heterodimerization activity	g.chr1:150551692C>A	BC017197	CCDS956.1, CCDS957.1, CCDS72909.1	1q21	2014-03-07	2014-03-07		ENSG00000143384	ENSG00000143384			6943	protein-coding gene	gene with protein product		159552	"""myeloid cell leukemia sequence 1 (BCL2-related)"""			7682708, 7835896	Standard	NM_021960		Approved	BCL2L3, Mcl-1	uc001euz.3	Q07820	OTTHUMG00000034867	ENST00000369026.2:c.315G>T	1.37:g.150551692C>A						MCL1_uc010pch.1_5'UTR|MCL1_uc001eva.2_Silent_p.A105A	p.A105A	NM_021960	NP_068779	Q07820	MCL1_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		1	445	-	all_cancers(9;1.69e-53)|all_epithelial(9;1.95e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		105			PEST-like.		B2R6B2|D3DV03|D3DV04|Q9HD91|Q9NRQ3|Q9NRQ4|Q9UHR7|Q9UHR8|Q9UHR9|Q9UNJ1	Silent	SNP	ENST00000369026.2	37	c.315G>T	CCDS957.1																																																																																				0.746	MCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084402.1	NM_021960		10	16	1	0	2.17888e-05	0.006214	2.60488e-05	10	16				
FLG2	388698	broad.mit.edu	37	1	152327770	152327770	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:152327770G>T	ENST00000388718.5	-	3	2564	c.2492C>A	c.(2491-2493)tCt>tAt	p.S831Y	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	831	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCAAAGCCAGAGGATTGTCC	0.517																																							uc001ezw.3		NA																	0				ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17						c.(2491-2493)TCT>TAT		filaggrin family member 2							313.0	302.0	306.0					1																	152327770		2203	4300	6503	SO:0001583	missense	388698						calcium ion binding|structural molecule activity	g.chr1:152327770G>T	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2492C>A	1.37:g.152327770G>T	ENSP00000373370:p.Ser831Tyr					uc001ezv.2_Intron	p.S831Y	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	2565	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		831			Ser-rich.		Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	c.2492C>A	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	G	11.23	1.578209	0.28180	.	.	ENSG00000143520	ENST00000388718	T	0.04015	3.73	4.72	3.8	0.43715	.	.	.	.	.	T	0.09069	0.0224	M	0.69823	2.125	0.09310	N	1	D	0.69078	0.997	D	0.64042	0.921	T	0.06881	-1.0802	9	0.56958	D	0.05	3.32	12.4267	0.55551	0.0:0.0:0.8307:0.1693	.	831	Q5D862	FILA2_HUMAN	Y	831	ENSP00000373370:S831Y	ENSP00000373370:S831Y	S	-	2	0	FLG2	150594394	0.012000	0.17670	0.006000	0.13384	0.002000	0.02628	0.944000	0.29043	1.130000	0.42092	-0.175000	0.13238	TCT		0.517	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342		135	339	1	0	8.44338e-69	0.00361	1.5906e-68	135	339				
NES	10763	broad.mit.edu	37	1	156640547	156640547	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:156640547C>G	ENST00000368223.3	-	4	3565	c.3433G>C	c.(3433-3435)Gag>Cag	p.E1145Q		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1145	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCTGCCTCCTCTAGGTCCTTT	0.602																																							uc001fpq.2		NA																	0				ovary(6)	6						c.(3433-3435)GAG>CAG		nestin							66.0	68.0	68.0					1																	156640547		2203	4300	6503	SO:0001583	missense	10763				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity	g.chr1:156640547C>G	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.3433G>C	1.37:g.156640547C>G	ENSP00000357206:p.Glu1145Gln						p.E1145Q	NM_006617	NP_006608	P48681	NEST_HUMAN			4	3566	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		1145			Tail.		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	37	c.3433G>C	CCDS1151.1	.	.	.	.	.	.	.	.	.	.	C	10.51	1.370631	0.24771	.	.	ENSG00000132688	ENST00000368223	D	0.85484	-1.99	4.88	-6.78	0.01721	.	1.196880	0.06513	N	0.738378	T	0.58836	0.2150	L	0.38531	1.155	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.58584	-0.7611	10	0.72032	D	0.01	.	7.4553	0.27264	0.0:0.2242:0.3132:0.4626	.	1145	P48681	NEST_HUMAN	Q	1145	ENSP00000357206:E1145Q	ENSP00000357206:E1145Q	E	-	1	0	NES	154907171	0.000000	0.05858	0.000000	0.03702	0.110000	0.19582	-0.338000	0.07842	-0.810000	0.04375	0.557000	0.71058	GAG		0.602	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617		24	70	0	0	0	0.002299	0	24	70				
MRPL24	79590	broad.mit.edu	37	1	156708225	156708225	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:156708225C>A	ENST00000361531.2	-	3	325	c.189G>T	c.(187-189)gaG>gaT	p.E63D	MRPL24_ENST00000368211.4_Missense_Mutation_p.E63D|MRPL24_ENST00000478899.1_5'Flank			Q96A35	RM24_HUMAN	mitochondrial ribosomal protein L24	63	KOW.				translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(1)|lung(4)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTTCTAGGATCTCCACCTGTG	0.572																																							uc001fpw.1		NA																	0					0						c.(187-189)GAG>GAT		mitochondrial ribosomal protein L24 precursor							165.0	155.0	158.0					1																	156708225		2203	4300	6503	SO:0001583	missense	79590				translation	mitochondrion|ribosome	structural constituent of ribosome	g.chr1:156708225C>A	AB051341	CCDS1155.1	1q23.1	2012-11-14			ENSG00000143314	ENSG00000143314		"""Mitochondrial ribosomal proteins / large subunits"""	14037	protein-coding gene	gene with protein product		611836					Standard	NM_145729		Approved	MRP-L18	uc001fpx.1	Q96A35	OTTHUMG00000041296	ENST00000361531.2:c.189G>T	1.37:g.156708225C>A	ENSP00000354525:p.Glu63Asp					MRPL24_uc001fpx.1_Missense_Mutation_p.E63D	p.E63D	NM_024540	NP_078816	Q96A35	RM24_HUMAN			3	328	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		63			KOW.		D3DVC8|Q53G65|Q53HT0|Q5SYZ9|Q5SZ00|Q5SZ02|Q96Q70|Q9H7G3	Missense_Mutation	SNP	ENST00000361531.2	37	c.189G>T	CCDS1155.1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.208989	0.58343	.	.	ENSG00000143314	ENST00000361531;ENST00000368211;ENST00000434558;ENST00000412846;ENST00000420938	.	.	.	5.57	1.71	0.24356	KOW (2);Translation protein SH3-like (1);Ribosomal protein L24/L26, conserved site (1);Ribosomal protein L24, SH3-like (1);	0.100108	0.64402	D	0.000003	T	0.45054	0.1323	M	0.86028	2.79	0.58432	D	0.999997	P	0.38745	0.645	B	0.38683	0.279	T	0.50083	-0.8869	9	0.66056	D	0.02	-17.1346	8.1376	0.31064	0.0:0.5642:0.0:0.4358	.	63	Q96A35	RM24_HUMAN	D	63	.	ENSP00000354525:E63D	E	-	3	2	MRPL24	154974849	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	0.999000	0.29757	0.350000	0.24002	0.650000	0.86243	GAG		0.572	MRPL24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098955.1	NM_145729		38	167	1	0	6.90743e-12	0.003755	1.06907e-11	38	167				
FCRL5	83416	broad.mit.edu	37	1	157508895	157508895	+	Silent	SNP	C	C	A	rs139032379	byFrequency	TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:157508895C>A	ENST00000361835.3	-	7	1540	c.1383G>T	c.(1381-1383)gcG>gcT	p.A461A	FCRL5_ENST00000356953.4_Silent_p.A461A|FCRL5_ENST00000368189.3_Silent_p.A461A|FCRL5_ENST00000368190.3_Silent_p.A461A|FCRL5_ENST00000368191.3_Silent_p.A376A	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	461	Ig-like C2-type 4.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				AGAGGCTCACCGCCTTACTGC	0.582																																							uc001fqu.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)	6						c.(1381-1383)GCG>GCT		Fc receptor-like 5							54.0	46.0	49.0					1																	157508895		2203	4300	6503	SO:0001819	synonymous_variant	83416					integral to membrane|plasma membrane	receptor activity	g.chr1:157508895C>A	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1383G>T	1.37:g.157508895C>A						FCRL5_uc009wsm.2_Silent_p.A461A|FCRL5_uc010phv.1_Silent_p.A461A|FCRL5_uc010phw.1_Silent_p.A376A|FCRL5_uc001fqv.1_Silent_p.A461A|FCRL5_uc010phx.1_Silent_p.A212A	p.A461A	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN			7	1541	-	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)	461			Extracellular (Potential).|Ig-like C2-type 4.		A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Silent	SNP	ENST00000361835.3	37	c.1383G>T	CCDS1165.1																																																																																				0.582	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281		15	43	1	0	2.31682e-05	0.003163	2.76094e-05	15	43				
SPTA1	6708	broad.mit.edu	37	1	158609710	158609710	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:158609710G>C	ENST00000368147.4	-	34	5005	c.4825C>G	c.(4825-4827)Caa>Gaa	p.Q1609E		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1609					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AACCTCTGTTGACGACTGGCC	0.463																																							uc001fst.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(4825-4827)CAA>GAA		spectrin, alpha, erythrocytic 1							201.0	185.0	190.0					1																	158609710		1921	4121	6042	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158609710G>C	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4825C>G	1.37:g.158609710G>C	ENSP00000357129:p.Gln1609Glu						p.Q1609E	NM_003126	NP_003117	P02549	SPTA1_HUMAN			34	5024	-	all_hematologic(112;0.0378)		1609			Spectrin 16.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.4825C>G	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.611566	0.87258	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.35236	1.32;1.32	5.53	5.53	0.82687	.	0.000000	0.30742	N	0.008965	T	0.43366	0.1244	M	0.65320	2	0.58432	D	0.999992	D	0.64830	0.994	D	0.64506	0.926	T	0.13495	-1.0507	10	0.10636	T	0.68	.	18.2109	0.89869	0.0:0.0:1.0:0.0	.	1609	P02549	SPTA1_HUMAN	E	1609	ENSP00000357130:Q1609E;ENSP00000357129:Q1609E	ENSP00000357129:Q1609E	Q	-	1	0	SPTA1	156876334	1.000000	0.71417	0.999000	0.59377	0.953000	0.61014	9.025000	0.93694	2.882000	0.98803	0.655000	0.94253	CAA		0.463	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		42	82	0	0	0	0.00623	0	42	82				
MNDA	4332	broad.mit.edu	37	1	158815391	158815391	+	Silent	SNP	G	G	A	rs199559763		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:158815391G>A	ENST00000368141.4	+	5	846	c.585G>A	c.(583-585)caG>caA	p.Q195Q		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	195					B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					AGGAAACCCAGGCCCAACGGC	0.512																																							uc001fsz.1		NA																	0				ovary(2)|skin(2)	4						c.(583-585)CAG>CAA		myeloid cell nuclear differentiation antigen							44.0	45.0	45.0					1																	158815391		2203	4300	6503	SO:0001819	synonymous_variant	4332				B cell receptor signaling pathway|cellular defense response|negative regulation of B cell proliferation|positive regulation of apoptosis|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding	g.chr1:158815391G>A	BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.585G>A	1.37:g.158815391G>A							p.Q195Q	NM_002432	NP_002423	P41218	MNDA_HUMAN			5	785	+	all_hematologic(112;0.0378)		195						Silent	SNP	ENST00000368141.4	37	c.585G>A	CCDS1177.1																																																																																				0.512	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059069.1	NM_002432		14	34	0	0	0	0.00245	0	14	34				
LMX1A	4009	broad.mit.edu	37	1	165179965	165179965	+	Nonsense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:165179965G>A	ENST00000342310.3	-	6	1100	c.718C>T	c.(718-720)Cag>Tag	p.Q240*	RP11-38C18.2_ENST00000457106.1_RNA|LMX1A_ENST00000489443.2_5'UTR|LMX1A_ENST00000294816.2_Nonsense_Mutation_p.Q240*|LMX1A_ENST00000367893.4_Nonsense_Mutation_p.Q240*	NM_177398.3	NP_796372.1	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha	240	Gln-rich.				axon guidance (GO:0007411)|central nervous system neuron differentiation (GO:0021953)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|dopaminergic neuron differentiation (GO:0071542)|midbrain development (GO:0030901)|negative regulation of neuron differentiation (GO:0045665)|regulation of cell growth (GO:0001558)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|central_nervous_system(3)|cervix(2)|endometrium(4)|large_intestine(6)|lung(10)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)	35	all_hematologic(923;0.248)					AACCACACCTGGACGACACGG	0.478																																							uc001gcy.1		NA																	0				central_nervous_system(3)|upper_aerodigestive_tract(1)|pancreas(1)	5						c.(718-720)CAG>TAG		LIM homeobox transcription factor 1, alpha							111.0	86.0	95.0					1																	165179965		2203	4300	6503	SO:0001587	stop_gained	4009					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr1:165179965G>A	AY078391	CCDS1247.1	1q24.1	2011-06-20			ENSG00000162761	ENSG00000162761		"""Homeoboxes / LIM class"""	6653	protein-coding gene	gene with protein product		600298		LMX1		7698771	Standard	NM_177398		Approved	LMX1.1	uc001gcz.2	Q8TE12	OTTHUMG00000034575	ENST00000342310.3:c.718C>T	1.37:g.165179965G>A	ENSP00000340226:p.Gln240*					LMX1A_uc001gcz.1_Nonsense_Mutation_p.Q240*|LMX1A_uc001gcw.1_5'UTR|LMX1A_uc001gcx.1_5'UTR	p.Q240*	NM_177398	NP_796372	Q8TE12	LMX1A_HUMAN			5	939	-	all_hematologic(923;0.248)		240			Homeobox.|Gln-rich.		B3KXP6|Q0VDB5|Q5VWG4|Q8TE11	Nonsense_Mutation	SNP	ENST00000342310.3	37	c.718C>T	CCDS1247.1	.	.	.	.	.	.	.	.	.	.	G	40	8.139745	0.98672	.	.	ENSG00000162761	ENST00000342310;ENST00000294816;ENST00000367893	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.7722	0.91896	0.0:0.0:1.0:0.0	.	.	.	.	X	240	.	ENSP00000294816:Q240X	Q	-	1	0	LMX1A	163446589	1.000000	0.71417	0.987000	0.45799	0.877000	0.50540	9.034000	0.93747	2.793000	0.96121	0.655000	0.94253	CAG		0.478	LMX1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083668.2	NM_177398		10	31	0	0	0	0.008291	0	10	31				
PRRC2C	23215	broad.mit.edu	37	1	171510393	171510393	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:171510393G>T	ENST00000338920.4	+	16	4019	c.3782G>T	c.(3781-3783)cGg>cTg	p.R1261L	PRRC2C_ENST00000367742.3_Missense_Mutation_p.R1263L|PRRC2C_ENST00000426496.2_Missense_Mutation_p.R1261L|PRRC2C_ENST00000392078.3_Missense_Mutation_p.R1263L	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1261					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										AGACGACAGCGGGGTTCAGAG	0.473																																							uc010pmg.1		NA																	0					0						c.(3781-3783)CGG>CTG		HBxAg transactivated protein 2							53.0	54.0	54.0					1																	171510393		2203	4300	6503	SO:0001583	missense	23215						protein C-terminus binding	g.chr1:171510393G>T	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.3782G>T	1.37:g.171510393G>T	ENSP00000343629:p.Arg1261Leu					BAT2L2_uc010pmh.1_Missense_Mutation_p.R238L	p.R1261L	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN			16	4048	+			1261					Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	37	c.3782G>T	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	G	12.09	1.833901	0.32421	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	T;T;T;T	0.04502	3.62;3.61;3.61;3.61	5.66	5.66	0.87406	.	0.000000	0.41194	D	0.000923	T	0.09468	0.0233	M	0.69358	2.11	0.49687	D	0.999812	D	0.67145	0.996	P	0.56788	0.806	T	0.00451	-1.1731	10	0.87932	D	0	.	13.446	0.61140	0.0807:0.0:0.9193:0.0	.	1261	Q9Y520-4	.	L	1263;1262;1261;1263;1261;1018	ENSP00000375928:R1263L;ENSP00000410219:R1261L;ENSP00000356716:R1263L;ENSP00000343629:R1261L	ENSP00000343629:R1261L	R	+	2	0	PRRC2C	169777017	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.540000	0.82074	2.653000	0.90120	0.563000	0.77884	CGG		0.473	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172		11	44	1	0	6.40141e-05	0.000978	7.48504e-05	11	44				
RGS21	431704	broad.mit.edu	37	1	192335252	192335252	+	Nonstop_Mutation	SNP	T	T	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:192335252T>G	ENST00000417209.2	+	5	631	c.457T>G	c.(457-459)Tga>Gga	p.*153G		NM_001039152.3	NP_001034241.1	Q2M5E4	RGS21_HUMAN	regulator of G-protein signaling 21	0					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			NS(1)|endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	15						CCCTTTTTTGTGAGGAAGGTA	0.328																																							uc001gsh.2		NA																	0				ovary(1)|skin(1)	2						c.(457-459)TGA>GGA		regulator of G-protein signaling 21							34.0	33.0	33.0					1																	192335252		1795	4060	5855	SO:0001578	stop_lost	431704				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr1:192335252T>G	AY643711	CCDS41448.1	1q31.2	2013-09-24	2007-08-14		ENSG00000253148	ENSG00000253148		"""Regulators of G-protein signaling"""	26839	protein-coding gene	gene with protein product		612407	"""regulator of G-protein signalling 21"""			15066150	Standard	NM_001039152		Approved		uc001gsh.3	Q2M5E4	OTTHUMG00000035594	ENST00000417209.2:c.457T>G	1.37:g.192335252T>G	ENSP00000428343:p.*153Glyext*3						p.*153G	NM_001039152	NP_001034241	Q2M5E4	RGS21_HUMAN			5	631	+			153						Nonstop_Mutation	SNP	ENST00000417209.2	37	c.457T>G	CCDS41448.1	.	.	.	.	.	.	.	.	.	.	T	11.77	1.737259	0.30774	.	.	ENSG00000253148	ENST00000417209	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.025	0.58810	0.0:0.0:0.0:1.0	.	.	.	.	G	153	.	.	X	+	1	0	RGS21	190601875	1.000000	0.71417	0.999000	0.59377	0.678000	0.39670	4.318000	0.59190	2.099000	0.63709	0.482000	0.46254	TGA		0.328	RGS21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086387.2			8	13	0	0	0	0.006214	0	8	13				
ASPM	259266	broad.mit.edu	37	1	197091620	197091620	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:197091620T>A	ENST00000367409.4	-	14	3752	c.3496A>T	c.(3496-3498)Act>Tct	p.T1166S	ASPM_ENST00000294732.7_Missense_Mutation_p.T1166S|ASPM_ENST00000367408.1_Missense_Mutation_p.T416S	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1166	CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						ACAGTTTGAGTAGTACGCTGA	0.403																																							uc001gtu.2		NA																	0				ovary(4)|central_nervous_system(2)	6						c.(3496-3498)ACT>TCT		asp (abnormal spindle)-like, microcephaly							108.0	94.0	99.0					1																	197091620		2203	4300	6503	SO:0001583	missense	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197091620T>A	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.3496A>T	1.37:g.197091620T>A	ENSP00000356379:p.Thr1166Ser					ASPM_uc001gtv.2_Missense_Mutation_p.T1166S|ASPM_uc001gtw.3_Intron	p.T1166S	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN			14	3753	-			1166			CH 2.		Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	c.3496A>T	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.960465	0.74016	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408	T;T;T	0.63096	-0.02;1.36;1.16	5.96	4.82	0.62117	Calmodulin-regulated spectrin-associated protein, CH domain (1);Calponin homology domain (3);	0.140286	0.49305	N	0.000151	T	0.68714	0.3031	L	0.48877	1.53	0.41902	D	0.990428	P;D	0.69078	0.568;0.997	B;D	0.63283	0.214;0.913	T	0.65109	-0.6248	10	0.25106	T	0.35	.	12.5268	0.56091	0.1251:0.0:0.0:0.8749	.	1166;1166	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	S	1166;1166;416	ENSP00000356379:T1166S;ENSP00000294732:T1166S;ENSP00000356378:T416S	ENSP00000294732:T1166S	T	-	1	0	ASPM	195358243	1.000000	0.71417	0.016000	0.15963	0.935000	0.57460	5.941000	0.70195	1.047000	0.40274	0.477000	0.44152	ACT		0.403	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		9	31	0	0	0	0.006214	0	9	31				
ZBTB41	360023	broad.mit.edu	37	1	197144219	197144219	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:197144219A>G	ENST00000367405.4	-	8	1974	c.1906T>C	c.(1906-1908)Tgt>Cgt	p.C636R	ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	636					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						CATTTTCCACATTCTTCACAC	0.338																																							uc001gtx.1		NA																	0				ovary(1)|skin(1)	2						c.(1906-1908)TGT>CGT		zinc finger and BTB domain containing 41							166.0	158.0	161.0					1																	197144219		2203	4300	6503	SO:0001583	missense	360023				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr1:197144219A>G		CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.1906T>C	1.37:g.197144219A>G	ENSP00000356375:p.Cys636Arg					ZBTB41_uc009wyz.1_RNA	p.C636R	NM_194314	NP_919290	Q5SVQ8	ZBT41_HUMAN			8	1975	-			636			C2H2-type 11.		A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Missense_Mutation	SNP	ENST00000367405.4	37	c.1906T>C	CCDS30960.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.039385	0.75617	.	.	ENSG00000177888	ENST00000367405	D	0.85955	-2.05	5.68	5.68	0.88126	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47852	D	0.000206	D	0.94735	0.8301	H	0.95645	3.7	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.96131	0.9092	10	0.87932	D	0	.	15.9001	0.79365	1.0:0.0:0.0:0.0	.	636	Q5SVQ8	ZBT41_HUMAN	R	636	ENSP00000356375:C636R	ENSP00000356375:C636R	C	-	1	0	ZBTB41	195410842	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.932000	0.92897	2.296000	0.77279	0.482000	0.46254	TGT		0.338	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088249.2	NM_194314		21	56	0	0	0	0.001882	0	21	56				
CENPF	1063	broad.mit.edu	37	1	214828619	214828619	+	Silent	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:214828619G>A	ENST00000366955.3	+	17	8526	c.8358G>A	c.(8356-8358)aaG>aaA	p.K2786K		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	2882	Sufficient for centromere localization.|Sufficient for self-association.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.K2786>?(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AGTTGAAGAAGGAAAATGAAC	0.323																																					Colon(80;575 1284 11000 14801 43496)	Colon(80;575 1284 11000 14801 43496)	uc001hkm.2		NA																	1	Complex(1)		lung(1)	ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13						c.(8356-8358)AAG>AAA		centromere protein F							80.0	82.0	81.0					1																	214828619		2203	4300	6503	SO:0001819	synonymous_variant	1063				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding	g.chr1:214828619G>A	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.8358G>A	1.37:g.214828619G>A							p.K2786K	NM_016343	NP_057427	P49454	CENPF_HUMAN		all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)	17	8532	+			2882			Potential.|Sufficient for self-association.|Sufficient for centromere localization.		Q13171|Q13246|Q5VVM7	Silent	SNP	ENST00000366955.3	37	c.8358G>A	CCDS31023.1																																																																																				0.323	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343		6	28	0	0	0	0.001168	0	6	28				
USH2A	7399	broad.mit.edu	37	1	216390770	216390770	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:216390770G>T	ENST00000307340.3	-	15	3502	c.3116C>A	c.(3115-3117)gCa>gAa	p.A1039E	USH2A_ENST00000366942.3_Missense_Mutation_p.A1039E|USH2A_ENST00000366943.2_Missense_Mutation_p.A1039E	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1039	Laminin EGF-like 10. {ECO:0000255|PROSITE-ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CAAGTGGCTTGCACTGGGAAC	0.473										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(3115-3117)GCA>GAA		usherin isoform B							108.0	91.0	97.0					1																	216390770		2203	4300	6503	SO:0001583	missense	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216390770G>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3116C>A	1.37:g.216390770G>T	ENSP00000305941:p.Ala1039Glu	HNSCC(13;0.011)				USH2A_uc001hkv.2_Missense_Mutation_p.A1039E	p.A1039E	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	15	3503	-			1039			Laminin EGF-like 10.|Extracellular (Potential).		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	c.3116C>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.253647	0.80135	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.61510	0.1;0.1;0.1	5.22	5.22	0.72569	EGF-like, laminin (3);	0.000000	0.40554	U	0.001073	T	0.74824	0.3767	M	0.70275	2.135	0.50467	D	0.999879	D;D	0.76494	0.968;0.999	P;D	0.70935	0.84;0.971	T	0.73154	-0.4072	10	0.34782	T	0.22	.	18.78	0.91928	0.0:0.0:1.0:0.0	.	1039;1039	O75445-2;O75445	.;USH2A_HUMAN	E	1039	ENSP00000305941:A1039E;ENSP00000355910:A1039E;ENSP00000355909:A1039E	ENSP00000305941:A1039E	A	-	2	0	USH2A	214457393	1.000000	0.71417	0.983000	0.44433	0.998000	0.95712	8.398000	0.90195	2.443000	0.82685	0.591000	0.81541	GCA		0.473	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		15	19	1	0	7.93312e-07	0.00245	1.00992e-06	15	19				
HHIPL2	79802	broad.mit.edu	37	1	222700353	222700353	+	Missense_Mutation	SNP	T	T	G	rs372392134		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:222700353T>G	ENST00000343410.6	-	7	1821	c.1763A>C	c.(1762-1764)tAt>tCt	p.Y588S	HHIPL2_ENST00000473144.1_5'Flank	NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	588					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		ACGTGGTGCATAGGCACTTGG	0.433																																							uc001hnh.1		NA																	0				ovary(1)	1						c.(1762-1764)TAT>TCT		HHIP-like 2 precursor							94.0	79.0	84.0					1																	222700353		2203	4300	6503	SO:0001583	missense	79802				carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding	g.chr1:222700353T>G	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.1763A>C	1.37:g.222700353T>G	ENSP00000342118:p.Tyr588Ser						p.Y588S	NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN		GBM - Glioblastoma multiforme(131;0.0185)	7	1821	-			588					Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	ENST00000343410.6	37	c.1763A>C	CCDS1530.2	.	.	.	.	.	.	.	.	.	.	T	0.191	-1.053073	0.01965	.	.	ENSG00000143512	ENST00000343410	T	0.12879	2.64	5.05	3.91	0.45181	Six-bladed beta-propeller, TolB-like (1);	0.275510	0.33753	N	0.004588	T	0.15219	0.0367	M	0.66939	2.045	0.33943	D	0.643529	B	0.15141	0.012	B	0.14578	0.011	T	0.13764	-1.0497	10	0.19590	T	0.45	-17.3982	10.8615	0.46829	0.1415:0.0:0.0:0.8585	.	588	Q6UWX4	HIPL2_HUMAN	S	588	ENSP00000342118:Y588S	ENSP00000342118:Y588S	Y	-	2	0	HHIPL2	220766976	0.953000	0.32496	0.587000	0.28692	0.152000	0.21847	1.516000	0.35856	0.730000	0.32425	0.533000	0.62120	TAT		0.433	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746		11	15	0	0	0	0.000978	0	11	15				
LIN9	286826	broad.mit.edu	37	1	226453251	226453251	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:226453251C>G	ENST00000328205.5	-	10	1614	c.1069G>C	c.(1069-1071)Gaa>Caa	p.E357Q	LIN9_ENST00000366801.1_Missense_Mutation_p.E306Q|LIN9_ENST00000481685.1_Missense_Mutation_p.E322Q	NM_173083.3	NP_775106.2	Q5TKA1	LIN9_HUMAN	lin-9 DREAM MuvB core complex component	341					DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|transcriptional repressor complex (GO:0017053)				breast(3)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		ATAAGAAATTCTACTGGAAAA	0.338																																					Ovarian(197;1696 2974 11248 14117)	Ovarian(197;1696 2974 11248 14117)	uc001hqa.2		NA																	0					0						c.(1069-1071)GAA>CAA		lin-9 homolog							65.0	62.0	63.0					1																	226453251		2203	4300	6503	SO:0001583	missense	286826				cell cycle|DNA replication	nucleoplasm		g.chr1:226453251C>G	AY166858	CCDS1553.1	1q42	2014-07-17	2014-07-17		ENSG00000183814	ENSG00000183814			30830	protein-coding gene	gene with protein product	"""TUDOR gene similar"", ""rb related pathway actor"""	609375	"""lin-9 homolog (C. elegans)"""			15538385, 23667535	Standard	NM_173083		Approved	TGS	uc001hqa.3	Q5TKA1	OTTHUMG00000037557	ENST00000328205.5:c.1069G>C	1.37:g.226453251C>G	ENSP00000329102:p.Glu357Gln					LIN9_uc001hqb.2_Missense_Mutation_p.E322Q|LIN9_uc001hqc.2_Missense_Mutation_p.E289Q|LIN9_uc009xel.1_Missense_Mutation_p.E322Q	p.E357Q	NM_173083	NP_775106	Q5TKA1	LIN9_HUMAN		GBM - Glioblastoma multiforme(131;0.131)	10	1379	-	Breast(184;0.158)		341					Q5U5L8|Q5U7E1|Q6PI55|Q6ZTV4|Q7Z3J1	Missense_Mutation	SNP	ENST00000328205.5	37	c.1069G>C	CCDS1553.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.033000	0.54896	.	.	ENSG00000183814	ENST00000460719;ENST00000328205;ENST00000366808;ENST00000366801;ENST00000481685;ENST00000366807	.	.	.	5.96	5.96	0.96718	.	0.046557	0.85682	D	0.000000	T	0.42359	0.1199	N	0.14661	0.345	0.53688	D	0.999971	B;B;B	0.33694	0.167;0.095;0.421	B;B;B	0.30646	0.024;0.013;0.118	T	0.28106	-1.0054	9	0.17369	T	0.5	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	322;341;491	C9J5J4;Q5TKA1;B1ANK3	.;LIN9_HUMAN;.	Q	317;357;412;306;322;491	.	ENSP00000329102:E357Q	E	-	1	0	LIN9	224519874	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.618000	0.67722	2.832000	0.97577	0.655000	0.94253	GAA		0.338	LIN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091523.2	NM_173083		7	12	0	0	0	0.00308	0	7	12				
OBSCN	84033	broad.mit.edu	37	1	228509182	228509182	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:228509182G>T	ENST00000422127.1	+	55	14684	c.14640G>T	c.(14638-14640)caG>caT	p.Q4880H	OBSCN_ENST00000284548.11_Missense_Mutation_p.Q4880H|OBSCN_ENST00000570156.2_Missense_Mutation_p.Q5837H|OBSCN_ENST00000366709.4_Missense_Mutation_p.Q1999H|OBSCN_ENST00000366707.4_Missense_Mutation_p.Q2514H	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4880	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGAAGATCCAGGCTGCCTTTA	0.597																																							uc009xez.1		NA																	0				stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(14638-14640)CAG>CAT		obscurin, cytoskeletal calmodulin and							32.0	38.0	36.0					1																	228509182		2063	4194	6257	SO:0001583	missense	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228509182G>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.14640G>T	1.37:g.228509182G>T	ENSP00000409493:p.Gln4880His					OBSCN_uc001hsn.2_Missense_Mutation_p.Q4880H	p.Q4880H	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN			55	14684	+		Prostate(94;0.0405)	4880			IQ.		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	c.14640G>T	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.533174	0.64972	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1	5.34	4.41	0.53225	.	0.000000	0.64402	D	0.000002	D	0.93331	0.7874	M	0.87381	2.88	0.41539	D	0.9885	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.93432	0.6786	10	0.56958	D	0.05	.	10.8307	0.46659	0.2024:0.0:0.7976:0.0	.	4880;4880	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	H	4880;4880;2514;1999	ENSP00000284548:Q4880H;ENSP00000409493:Q4880H;ENSP00000355668:Q2514H;ENSP00000355670:Q1999H	ENSP00000284548:Q4880H	Q	+	3	2	OBSCN	226575805	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	2.392000	0.44433	1.236000	0.43740	0.655000	0.94253	CAG		0.597	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		7	20	1	0	0.00198382	0.001984	0.00215106	7	20				
NUP133	55746	broad.mit.edu	37	1	229600529	229600529	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:229600529C>A	ENST00000261396.3	-	18	2484	c.2393G>T	c.(2392-2394)cGa>cTa	p.R798L	NUP133_ENST00000537506.1_Missense_Mutation_p.R782L	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	798					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				CACGATGTTTCGGAGGTTGCT	0.493																																							uc001htn.2		NA																	0				breast(4)|skin(2)|ovary(1)	7						c.(2392-2394)CGA>CTA		nucleoporin 133kDa							140.0	107.0	118.0					1																	229600529		2203	4300	6503	SO:0001583	missense	55746				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding	g.chr1:229600529C>A		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.2393G>T	1.37:g.229600529C>A	ENSP00000261396:p.Arg798Leu						p.R798L	NM_018230	NP_060700	Q8WUM0	NU133_HUMAN			18	2485	-	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)	798					B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation	SNP	ENST00000261396.3	37	c.2393G>T	CCDS1579.1	.	.	.	.	.	.	.	.	.	.	C	36	5.635769	0.96682	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	T;T;T	0.35236	1.63;1.32;1.63	6.17	6.17	0.99709	Nucleoporin, Nup133/Nup155-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.64068	0.2565	M	0.81341	2.54	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.55515	-0.8129	10	0.23891	T	0.37	-25.3212	20.8794	0.99867	0.0:1.0:0.0:0.0	.	798	Q8WUM0	NU133_HUMAN	L	798;798;798;782	ENSP00000261396:R798L;ENSP00000355640:R798L;ENSP00000443496:R782L	ENSP00000261396:R798L	R	-	2	0	NUP133	227667152	1.000000	0.71417	0.976000	0.42696	0.958000	0.62258	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	CGA		0.493	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230		19	43	1	0	1.64113e-05	0.010504	1.97466e-05	19	43				
B3GALNT2	148789	broad.mit.edu	37	1	235629009	235629009	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:235629009T>A	ENST00000366600.3	-	7	1013	c.785A>T	c.(784-786)cAt>cTt	p.H262L	B3GALNT2_ENST00000313984.3_Missense_Mutation_p.H303L	NM_152490.2	NP_689703.1	Q8NCR0	B3GL2_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 2	262					protein glycosylation (GO:0006486)|protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|acetylglucosaminyltransferase activity (GO:0008375)|galactosyltransferase activity (GO:0008378)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)			CAAGAATTCATGAGGCAATGC	0.358																																							uc001hxc.2		NA																	0				breast(1)	1						c.(784-786)CAT>CTT		beta-1,3-N-acetylgalactosaminyltransferase 2							100.0	102.0	101.0					1																	235629009		2203	4300	6503	SO:0001583	missense	148789				protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity	g.chr1:235629009T>A	BC029564	CCDS1606.1, CCDS60453.1	1q42.3	2013-02-19	2006-06-14		ENSG00000162885	ENSG00000162885		"""Beta 3-glycosyltransferases"""	28596	protein-coding gene	gene with protein product		610194	"""UDP-GalNAc:betaGlcNAc beta-1,3-galactosaminyltransferase, polypeptide 2"""			14724282	Standard	NM_001277155		Approved	MGC39558	uc001hxc.3	Q8NCR0	OTTHUMG00000040468	ENST00000366600.3:c.785A>T	1.37:g.235629009T>A	ENSP00000355559:p.His262Leu					B3GALNT2_uc001hxd.1_Missense_Mutation_p.H303L	p.H262L	NM_152490	NP_689703	Q8NCR0	B3GL2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000117)		7	1014	-	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	262			Lumenal (Potential).		Q59GR3|Q5TCI3|Q96AL7	Missense_Mutation	SNP	ENST00000366600.3	37	c.785A>T	CCDS1606.1	.	.	.	.	.	.	.	.	.	.	T	11.81	1.748527	0.30955	.	.	ENSG00000162885	ENST00000366599;ENST00000366600;ENST00000313984	T;T	0.58652	0.32;1.25	5.95	-2.62	0.06152	.	0.281067	0.45126	D	0.000399	T	0.36608	0.0973	L	0.27053	0.805	0.32403	N	0.551728	B;B	0.30634	0.288;0.002	B;B	0.28139	0.086;0.004	T	0.18116	-1.0347	10	0.62326	D	0.03	-2.5202	8.0959	0.30829	0.0:0.1288:0.4578:0.4134	.	303;262	Q8NCR0-2;Q8NCR0	.;B3GL2_HUMAN	L	303;262;303	ENSP00000355559:H262L;ENSP00000315678:H303L	ENSP00000315678:H303L	H	-	2	0	B3GALNT2	233695632	0.998000	0.40836	0.939000	0.37840	0.908000	0.53690	0.811000	0.27198	-0.737000	0.04824	0.402000	0.26972	CAT		0.358	B3GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097376.1	NM_152490		4	90	0	0	0	0.000602	0	4	90				
RYR2	6262	broad.mit.edu	37	1	237941996	237941996	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:237941996G>T	ENST00000366574.2	+	88	12123	c.11806G>T	c.(11806-11808)Gca>Tca	p.A3936S	RYR2_ENST00000360064.6_Missense_Mutation_p.A3942S|RYR2_ENST00000542537.1_Missense_Mutation_p.A3920S|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3936					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ACAGAGTTTGGCACACAGCAG	0.448																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(11806-11808)GCA>TCA		cardiac muscle ryanodine receptor							107.0	105.0	106.0					1																	237941996		1903	4123	6026	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237941996G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11806G>T	1.37:g.237941996G>T	ENSP00000355533:p.Ala3936Ser					RYR2_uc010pya.1_Missense_Mutation_p.A351S	p.A3936S	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		88	11926	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	3936					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.11806G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.865950	0.91511	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.95690	-3.78;-3.78;-3.78	5.76	5.76	0.90799	RyR/IP3R Homology associated domain (1);	0.000000	0.64402	D	0.000010	D	0.97495	0.9180	M	0.68728	2.09	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.982	D	0.97820	1.0256	10	0.87932	D	0	-12.3603	19.9731	0.97292	0.0:0.0:1.0:0.0	.	910;3936	B4DGV4;Q92736	.;RYR2_HUMAN	S	3936;3942;3920;910	ENSP00000355533:A3936S;ENSP00000353174:A3942S;ENSP00000443798:A3920S	ENSP00000353174:A3942S	A	+	1	0	RYR2	236008619	1.000000	0.71417	1.000000	0.80357	0.705000	0.40729	9.813000	0.99286	2.715000	0.92844	0.563000	0.77884	GCA		0.448	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		19	51	1	0	6.44725e-10	0.002299	9.21389e-10	19	51				
OR2C3	81472	broad.mit.edu	37	1	247694869	247694869	+	Silent	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:247694869G>T	ENST00000366487.3	-	2	1306	c.945C>A	c.(943-945)ggC>ggA	p.G315G	GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000366489.1_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	315						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			GCGCCAGCTTGCCTGCAGAGC	0.522																																							uc009xgy.2		NA																	0				ovary(1)|skin(1)	2						c.(943-945)GGC>GGA		olfactory receptor, family 2, subfamily C,							58.0	54.0	56.0					1																	247694869		2203	4300	6503	SO:0001819	synonymous_variant	81472				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247694869G>T	BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.945C>A	1.37:g.247694869G>T						C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron|LOC148824_uc001idd.2_5'Flank	p.G315G	NM_198074	NP_932340	Q8N628	OR2C3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0241)		2	1307	-	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	315			Cytoplasmic (Potential).		Q5JQS4|Q6IEZ1|Q8NGW7	Silent	SNP	ENST00000366487.3	37	c.945C>A	CCDS1634.2																																																																																				0.522	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097626.2	NM_198074		20	35	1	0	4.96729e-08	0.008871	6.66475e-08	20	35				
TUBB8	347688	broad.mit.edu	37	10	94813	94813	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr10:94813C>A	ENST00000309812.4	-	2	159	c.97G>T	c.(97-99)Gct>Tct	p.A33S	TUBB8_ENST00000447903.2_5'UTR|TUBB8_ENST00000332708.5_Intron|TUBB8_ENST00000413237.3_5'UTR	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	33					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		TAGGTGCCAGCGGAGTCGATG	0.652																																					Pancreas(192;2041 3010 9013 18103)	Pancreas(192;2041 3010 9013 18103)	uc001ifi.2		NA																	0				ovary(1)	1						c.(97-99)GCT>TCT		tubulin, beta 8 isoform 1							22.0	19.0	20.0					10																	94813		2194	4285	6479	SO:0001583	missense	347688				microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr10:94813C>A	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.97G>T	10.37:g.94813C>A	ENSP00000311042:p.Ala33Ser					TUBB8_uc009xhe.2_Missense_Mutation_p.A33S|TUBB8_uc010pzs.1_5'UTR	p.A33S	NM_177987	NP_817124	Q3ZCM7	TBB8_HUMAN		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)	2	97	-		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)	33					Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	37	c.97G>T	CCDS7051.1	.	.	.	.	.	.	.	.	.	.	C	4.578	0.107405	0.08780	.	.	ENSG00000173876	ENST00000440680;ENST00000328974;ENST00000309812	T	0.66638	-0.22	0.109	0.109	0.14578	Tubulin/FtsZ, GTPase domain (3);	0.334274	0.22027	U	0.065641	T	0.28267	0.0698	N	0.00637	-1.305	0.80722	D	1	B;B	0.28055	0.199;0.008	B;B	0.30105	0.111;0.007	T	0.07888	-1.0749	10	0.87932	D	0	.	2.6667	0.05054	0.0:0.5259:0.0:0.4741	.	33;33	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	S	33	ENSP00000311042:A33S	ENSP00000311042:A33S	A	-	1	0	RP11-631M21.2	84813	0.998000	0.40836	0.048000	0.18961	0.048000	0.14542	3.802000	0.55553	0.181000	0.19994	0.184000	0.17185	GCT		0.652	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987		4	6	1	0	0.00024832	0.009096	0.000284121	4	6				
ITIH5	80760	broad.mit.edu	37	10	7608307	7608307	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr10:7608307C>A	ENST00000256861.6	-	13	2291	c.2213G>T	c.(2212-2214)cGc>cTc	p.R738L	ITIH5_ENST00000446830.2_Missense_Mutation_p.R520L|ITIH5_ENST00000397146.2_Intron|ITIH5_ENST00000298441.6_Missense_Mutation_p.R524L	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	738					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CAAGTAAGTGCGCTGTTTCTT	0.502																																							uc001ijq.2		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(2212-2214)CGC>CTC		inter-alpha trypsin inhibitor heavy chain							107.0	95.0	99.0					10																	7608307		2203	4300	6503	SO:0001583	missense	80760				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chr10:7608307C>A			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2213G>T	10.37:g.7608307C>A	ENSP00000256861:p.Arg738Leu					ITIH5_uc001ijp.2_Missense_Mutation_p.R524L	p.R738L	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN			13	2292	-			738					Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37	c.2213G>T		.	.	.	.	.	.	.	.	.	.	C	31	5.069172	0.93950	.	.	ENSG00000123243	ENST00000256861;ENST00000298441;ENST00000446830	T;T;T	0.12672	2.66;2.66;2.66	5.84	5.84	0.93424	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.42832	0.1220	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.21895	-1.0232	9	0.66056	D	0.02	-35.5312	20.1165	0.97939	0.0:1.0:0.0:0.0	.	738;524	Q86UX2;Q86UX2-3	ITIH5_HUMAN;.	L	738;524;520	ENSP00000256861:R738L;ENSP00000298441:R524L;ENSP00000387969:R520L	ENSP00000256861:R738L	R	-	2	0	ITIH5	7648313	1.000000	0.71417	1.000000	0.80357	0.674000	0.39518	7.356000	0.79445	2.746000	0.94184	0.655000	0.94253	CGC		0.502	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569		12	50	1	0	2.27111e-07	0.001368	2.9414e-07	12	50				
ITIH5	80760	broad.mit.edu	37	10	7627984	7627984	+	Missense_Mutation	SNP	G	G	T	rs185410360	byFrequency	TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr10:7627984G>T	ENST00000256861.6	-	8	1066	c.988C>A	c.(988-990)Cgt>Agt	p.R330S	ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000446830.2_Missense_Mutation_p.R112S|ITIH5_ENST00000397145.2_Missense_Mutation_p.R330S|ITIH5_ENST00000397146.2_Missense_Mutation_p.R330S|ITIH5_ENST00000298441.6_Missense_Mutation_p.R116S	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	330	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						ATACTGAAACGGTCCTGGGGT	0.468																																							uc001ijq.2		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(988-990)CGT>AGT		inter-alpha trypsin inhibitor heavy chain							144.0	124.0	131.0					10																	7627984		2203	4300	6503	SO:0001583	missense	80760				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chr10:7627984G>T			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.988C>A	10.37:g.7627984G>T	ENSP00000256861:p.Arg330Ser					ITIH5_uc001ijp.2_Missense_Mutation_p.R116S|ITIH5_uc001ijr.1_Missense_Mutation_p.R330S	p.R330S	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN			8	1067	-			330			VWFA.		Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37	c.988C>A		.	.	.	.	.	.	.	.	.	.	G	14.41	2.526533	0.44969	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	D;D;D;D;D	0.86432	-2.12;-2.12;-2.12;-2.12;-2.12	5.3	4.33	0.51752	von Willebrand factor, type A (3);	0.446927	0.26623	N	0.023357	T	0.80954	0.4723	.	.	.	0.28258	N	0.92495	B;B;B	0.34200	0.076;0.441;0.387	B;B;B	0.35655	0.207;0.206;0.13	T	0.72527	-0.4266	9	0.22706	T	0.39	-5.4197	14.704	0.69174	0.0:0.0:0.8544:0.1456	.	330;330;116	G5E9D8;Q86UX2;Q86UX2-3	.;ITIH5_HUMAN;.	S	330;330;116;112;330	ENSP00000256861:R330S;ENSP00000380333:R330S;ENSP00000298441:R116S;ENSP00000387969:R112S;ENSP00000380332:R330S	ENSP00000256861:R330S	R	-	1	0	ITIH5	7667990	0.995000	0.38212	0.336000	0.25522	0.759000	0.43091	5.021000	0.64072	2.474000	0.83562	0.561000	0.74099	CGT		0.468	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569		6	36	1	0	0.00116845	0.001168	0.00127809	6	36				
MTPAP	55149	broad.mit.edu	37	10	30653638	30653638	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr10:30653638C>A	ENST00000358107.4	-	2	543	c.544G>T	c.(544-546)Ggt>Tgt	p.G182C	RN7SL241P_ENST00000482973.2_RNA|MTPAP_ENST00000488290.1_5'UTR|AL161651.1_ENST00000408070.1_RNA			Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	52					cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						TACTCACCACCCTGCTTGTCA	0.647																																							uc001ivb.3		NA																	0				ovary(1)	1						c.(544-546)GGT>TGT		PAP associated domain containing 1 precursor																																				SO:0001583	missense	55149				cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding	g.chr10:30653638C>A	AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000358107.4:c.544G>T	10.37:g.30653638C>A	ENSP00000350820:p.Gly182Cys					LOC729668_uc001ivd.2_RNA|uc001ive.1_5'Flank	p.G182C	NM_018109	NP_060579	Q9NVV4	PAPD1_HUMAN			9	1916	-			Error:Variant_position_missing_in_Q9NVV4_after_alignment					D3DRX0|Q659E3|Q6P7E5|Q9HA74	Missense_Mutation	SNP	ENST00000358107.4	37	c.544G>T		.	.	.	.	.	.	.	.	.	.	.	0.687	-0.795918	0.02862	.	.	ENSG00000107951	ENST00000358107	T	0.22134	1.97	0.436	-0.871	0.10642	.	0.424311	0.18892	U	0.128276	T	0.10423	0.0255	.	.	.	0.09310	N	1	P	0.35894	0.526	B	0.16722	0.016	T	0.11251	-1.0595	9	0.72032	D	0.01	.	3.6414	0.08169	0.0:0.5028:0.2544:0.2428	.	182	Q9NVV4-2	.	C	182	ENSP00000350820:G182C	ENSP00000350820:G182C	G	-	1	0	MTPAP	30693644	0.984000	0.35163	0.000000	0.03702	0.012000	0.07955	-0.015000	0.12634	-1.847000	0.01173	-1.087000	0.02190	GGT		0.647	MTPAP-201	KNOWN	basic	protein_coding	protein_coding		NM_018109		7	16	1	0	8.12818e-05	0.001984	9.4449e-05	7	16				
FRMPD2	143162	broad.mit.edu	37	10	49450362	49450362	+	Silent	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr10:49450362G>A	ENST00000374201.3	-	5	711	c.409C>T	c.(409-411)Ctg>Ttg	p.L137L	FRMPD2_ENST00000305531.3_Silent_p.L113L|FRMPD2_ENST00000407470.4_Silent_p.L106L	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	137	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		ATGGTCAGCAGGATGGAGTGC	0.612																																							uc001jgi.2		NA																	0				large_intestine(1)	1						c.(409-411)CTG>TTG		FERM and PDZ domain containing 2 isoform 3							67.0	66.0	66.0					10																	49450362		2203	4300	6503	SO:0001819	synonymous_variant	143162				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding	g.chr10:49450362G>A	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.409C>T	10.37:g.49450362G>A						FRMPD2_uc001jgh.2_Silent_p.L106L|FRMPD2_uc001jgj.2_Silent_p.L115L	p.L137L	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN		Kidney(211;0.201)	5	516	-			137			KIND.		B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Silent	SNP	ENST00000374201.3	37	c.409C>T	CCDS31195.1																																																																																				0.612	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428		20	61	0	0	0	0.010504	0	20	61				
LZTS2	84445	broad.mit.edu	37	10	102762640	102762640	+	Silent	SNP	A	A	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr10:102762640A>C	ENST00000370220.1	+	1	3408	c.345A>C	c.(343-345)gcA>gcC	p.A115A	LZTS2_ENST00000370223.3_Silent_p.A115A					leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		AGCAGCGGGCACACAATGCCC	0.602																																					Esophageal Squamous(8;38 437 13604 19902 37640)	Esophageal Squamous(8;38 437 13604 19902 37640)	uc001ksj.2		NA																	0				ovary(2)|large_intestine(1)|breast(1)	4						c.(343-345)GCA>GCC		leucine zipper, putative tumor suppressor 2							54.0	57.0	56.0					10																	102762640		2203	4300	6503	SO:0001819	synonymous_variant	84445				cell division|mitosis|Wnt receptor signaling pathway	membrane|microtubule|microtubule organizing center		g.chr10:102762640A>C	AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.345A>C	10.37:g.102762640A>C						LZTS2_uc010qpw.1_Silent_p.A115A|LZTS2_uc001ksk.2_Silent_p.A115A|LZTS2_uc001ksl.2_Silent_p.A115A|LZTS2_uc001ksm.2_RNA	p.A115A	NM_032429	NP_115805	Q9BRK4	LZTS2_HUMAN		Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)	2	414	+			115			Required for centrosomal localization (By similarity).			Silent	SNP	ENST00000370220.1	37	c.345A>C	CCDS7507.1																																																																																				0.602	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743		14	71	0	0	0	0.003163	0	14	71				
BTRC	8945	broad.mit.edu	37	10	103190200	103190200	+	Silent	SNP	A	A	T	rs368314946		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr10:103190200A>T	ENST00000370187.3	+	2	265	c.147A>T	c.(145-147)acA>acT	p.T49T	BTRC_ENST00000408038.2_Intron|BTRC_ENST00000393441.4_Silent_p.T34T	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	49					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		GCGCACTCACAGCTTTCCAGG	0.522																																							uc001kta.2		NA																	0				ovary(1)	1						c.(145-147)ACA>ACT		beta-transducin repeat containing protein							120.0	102.0	109.0					10																	103190200		2203	4300	6503	SO:0001819	synonymous_variant	8945				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex		g.chr10:103190200A>T	Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.147A>T	10.37:g.103190200A>T						BTRC_uc001ksz.1_Intron|BTRC_uc001ktb.2_Intron|BTRC_uc001ktc.2_Silent_p.T49T	p.T49T	NM_033637	NP_378663	Q9Y297	FBW1A_HUMAN		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)	2	260	+		Colorectal(252;0.234)	49					B5MD49|Q5W141|Q5W142|Q9Y213	Silent	SNP	ENST00000370187.3	37	c.147A>T	CCDS7512.1																																																																																				0.522	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637		17	34	0	0	0	0.006122	0	17	34				
SORCS1	114815	broad.mit.edu	37	10	108924037	108924037	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr10:108924037C>T	ENST00000263054.6	-	1	255	c.248G>A	c.(247-249)gGg>gAg	p.G83E	SORCS1_ENST00000344440.6_Missense_Mutation_p.G83E	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	83					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CGCTCGGTCCCCGGGGGCCAC	0.726																																							uc001kym.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(247-249)GGG>GAG		SORCS receptor 1 isoform a							8.0	9.0	9.0					10																	108924037		2181	4263	6444	SO:0001583	missense	114815					integral to membrane	neuropeptide receptor activity|protein binding	g.chr10:108924037C>T	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.248G>A	10.37:g.108924037C>T	ENSP00000263054:p.Gly83Glu					SORCS1_uc001kyl.2_Missense_Mutation_p.G83E|SORCS1_uc009xxs.2_Missense_Mutation_p.G83E|SORCS1_uc001kyn.1_Missense_Mutation_p.G83E|SORCS1_uc001kyo.2_Missense_Mutation_p.G83E	p.G83E	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN		Epithelial(162;1.66e-05)|all cancers(201;0.000689)	1	256	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	83			Lumenal (Potential).		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	c.248G>A	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.425369	0.43020	.	.	ENSG00000108018	ENST00000263054;ENST00000344440	T;T	0.30182	1.54;1.61	4.23	4.23	0.50019	.	0.195609	0.25372	N	0.031148	T	0.17109	0.0411	N	0.08118	0	0.29174	N	0.876926	P;P;P;P;P	0.42518	0.675;0.782;0.782;0.675;0.782	B;B;B;B;B	0.42995	0.228;0.404;0.404;0.228;0.404	T	0.04400	-1.0954	9	.	.	.	-13.1123	10.0673	0.42311	0.0:0.795:0.205:0.0	.	83;83;83;83;83	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	E	83	ENSP00000263054:G83E;ENSP00000345964:G83E	.	G	-	2	0	SORCS1	108914027	0.992000	0.36948	1.000000	0.80357	0.279000	0.26890	2.589000	0.46145	2.169000	0.68431	0.591000	0.81541	GGG		0.726	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918		12	14	0	0	0	0.000978	0	12	14				
GPAM	57678	broad.mit.edu	37	10	113933468	113933468	+	Silent	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr10:113933468C>A	ENST00000348367.4	-	7	746	c.549G>T	c.(547-549)ccG>ccT	p.P183P	GPAM_ENST00000423155.1_Silent_p.P183P|GPAM_ENST00000369425.1_Silent_p.P183P			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	183					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		TGATCATTGCCGGTGAGACAG	0.403																																					Ovarian(161;1017 2606 18293 52943)	Ovarian(161;1017 2606 18293 52943)	uc009xxy.1		NA																	0				ovary(1)|skin(1)	2						c.(547-549)CCG>CCT		mitochondrial glycerol 3-phosphate							153.0	133.0	140.0					10																	113933468		2203	4300	6503	SO:0001819	synonymous_variant	57678				phospholipid biosynthetic process|triglyceride biosynthetic process	integral to membrane|mitochondrial outer membrane	glycerol-3-phosphate O-acyltransferase activity	g.chr10:113933468C>A	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.549G>T	10.37:g.113933468C>A						GPAM_uc001kzp.2_Silent_p.P183P|GPAM_uc001kzq.1_Silent_p.P183P	p.P183P	NM_020918	NP_065969	Q9HCL2	GPAT1_HUMAN		Epithelial(162;0.0306)|all cancers(201;0.123)	7	747	-			183					Q5VW51|Q86TA3	Silent	SNP	ENST00000348367.4	37	c.549G>T	CCDS7570.1																																																																																				0.403	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918		14	52	1	0	1.49906e-05	0.00245	1.80954e-05	14	52				
OR52K2	119774	broad.mit.edu	37	11	4470638	4470638	+	Silent	SNP	A	A	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr11:4470638A>G	ENST00000325719.4	+	1	114	c.69A>G	c.(67-69)gaA>gaG	p.E23E	AC010930.1_ENST00000408103.1_RNA	NM_001005172.2	NP_001005172.2	Q8NGK3	O52K2_HUMAN	olfactory receptor, family 52, subfamily K, member 2	23						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|skin(6)	25		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAGGCCTGGAACACCTGCACA	0.517																																							uc001lyz.1		NA																	0				skin(2)	2						c.(67-69)GAA>GAG		olfactory receptor, family 52, subfamily K,							156.0	134.0	142.0					11																	4470638		2201	4298	6499	SO:0001819	synonymous_variant	119774				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4470638A>G	AB065791	CCDS31351.1	11p15.4	2012-08-09			ENSG00000181963	ENSG00000181963		"""GPCR / Class A : Olfactory receptors"""	15223	protein-coding gene	gene with protein product							Standard	NM_001005172		Approved		uc001lyz.2	Q8NGK3	OTTHUMG00000165703	ENST00000325719.4:c.69A>G	11.37:g.4470638A>G							p.E23E	NM_001005172	NP_001005172	Q8NGK3	O52K2_HUMAN		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	69	+		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	23			Extracellular (Potential).		A8MUY8|B2RP35|Q6IFK4	Silent	SNP	ENST00000325719.4	37	c.69A>G	CCDS31351.1																																																																																				0.517	OR52K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385844.1	NM_001005172		38	64	0	0	0	0.005524	0	38	64				
OR52J3	119679	broad.mit.edu	37	11	5068235	5068235	+	Silent	SNP	C	C	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr11:5068235C>G	ENST00000380370.1	+	1	480	c.480C>G	c.(478-480)ccC>ccG	p.P160P		NM_001001916.2	NP_001001916.2	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J, member 3	160						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(6)|large_intestine(6)|lung(19)|ovary(1)|skin(2)	36		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTACACTTCCCATGGTCTATC	0.463																																							uc010qyv.1		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(478-480)CCC>CCG		olfactory receptor, family 52, subfamily J,							188.0	133.0	152.0					11																	5068235		2201	4298	6499	SO:0001819	synonymous_variant	119679				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5068235C>G	AB065530	CCDS31370.1	11p15.4	2012-08-09			ENSG00000205495	ENSG00000205495		"""GPCR / Class A : Olfactory receptors"""	14799	protein-coding gene	gene with protein product							Standard	NM_001001916		Approved		uc010qyv.2	Q8NH60	OTTHUMG00000066600	ENST00000380370.1:c.480C>G	11.37:g.5068235C>G							p.P160P	NM_001001916	NP_001001916	Q8NH60	O52J3_HUMAN		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)	1	480	+		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)	160			Helical; Name=4; (Potential).		Q6IFE4	Silent	SNP	ENST00000380370.1	37	c.480C>G	CCDS31370.1																																																																																				0.463	OR52J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142807.1	NM_001001916		17	59	0	0	0	0.004007	0	17	59				
OR10A4	283297	broad.mit.edu	37	11	6898520	6898520	+	Silent	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr11:6898520G>T	ENST00000379829.2	+	1	665	c.642G>T	c.(640-642)ctG>ctT	p.L214L		NM_207186.2	NP_997069.2	Q9H209	O10A4_HUMAN	olfactory receptor, family 10, subfamily A, member 4	214					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(2)|liver(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CTTTCTTGCTGATCCTGGGAT	0.527																																							uc010rat.1		NA																	0				ovary(1)	1						c.(640-642)CTG>CTT		olfactory receptor, family 10, subfamily A,							181.0	139.0	153.0					11																	6898520		2201	4296	6497	SO:0001819	synonymous_variant	283297				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6898520G>T	AF209506	CCDS7774.1	11p15.4	2012-08-09	2002-11-13	2004-03-10	ENSG00000170782	ENSG00000170782		"""GPCR / Class A : Olfactory receptors"""	15130	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily A, member 4 pseudogene"""	OR10A4P			Standard	NM_207186		Approved		uc010rat.2	Q9H209	OTTHUMG00000165740	ENST00000379829.2:c.642G>T	11.37:g.6898520G>T							p.L214L	NM_207186	NP_997069	Q9H209	O10A4_HUMAN		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	642	+		Medulloblastoma(188;0.0523)|all_neural(188;0.236)	214			Helical; Name=5; (Potential).		B2RNP5|B9EH36|Q96R20	Silent	SNP	ENST00000379829.2	37	c.642G>T	CCDS7774.1																																																																																				0.527	OR10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385985.1	NM_207186		15	56	1	0	7.93312e-07	0.00245	1.00992e-06	15	56				
COPB1	1315	broad.mit.edu	37	11	14479392	14479392	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr11:14479392G>A	ENST00000249923.3	-	22	3140	c.2840C>T	c.(2839-2841)tCa>tTa	p.S947L	COPB1_ENST00000439561.2_Missense_Mutation_p.S947L	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	947					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						TTTCTTCTGTGACAAGTTGAT	0.294																																							uc001mli.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2839-2841)TCA>TTA		coatomer protein complex, subunit beta 1							38.0	42.0	41.0					11																	14479392		2199	4287	6486	SO:0001583	missense	1315				COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|ER-Golgi intermediate compartment|plasma membrane	protein binding|structural molecule activity	g.chr11:14479392G>A	BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.2840C>T	11.37:g.14479392G>A	ENSP00000249923:p.Ser947Leu					COPB1_uc001mlg.2_Missense_Mutation_p.S947L|COPB1_uc001mlh.2_Missense_Mutation_p.S947L	p.S947L	NM_016451	NP_057535	P53618	COPB_HUMAN			22	3147	-			947					D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	ENST00000249923.3	37	c.2840C>T	CCDS7815.1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.321664	0.41096	.	.	ENSG00000129083	ENST00000249923;ENST00000439561	T;T	0.39997	1.05;1.05	5.76	5.76	0.90799	.	0.046391	0.85682	D	0.000000	T	0.29524	0.0736	N	0.08118	0	0.80722	D	1	B	0.24132	0.098	B	0.32090	0.14	T	0.12091	-1.0561	10	0.15066	T	0.55	.	19.9813	0.97326	0.0:0.0:1.0:0.0	.	947	P53618	COPB_HUMAN	L	947	ENSP00000249923:S947L;ENSP00000397873:S947L	ENSP00000249923:S947L	S	-	2	0	COPB1	14435968	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.929000	0.92859	2.726000	0.93360	0.655000	0.94253	TCA		0.294	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386410.1	NM_016451		4	16	0	0	0	0.009096	0	4	16				
LRRC4C	57689	broad.mit.edu	37	11	40136549	40136549	+	Missense_Mutation	SNP	C	C	A	rs368163511		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr11:40136549C>A	ENST00000278198.2	-	2	3257	c.1294G>T	c.(1294-1296)Gtt>Ttt	p.V432F	LRRC4C_ENST00000527150.1_Missense_Mutation_p.V432F|LRRC4C_ENST00000530763.1_Missense_Mutation_p.V432F|LRRC4C_ENST00000528697.1_Missense_Mutation_p.V432F			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	432	Ig-like C2-type.				regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				GTATTCCCAACGGAATTACTC	0.438																																							uc001mxa.1		NA																	0				ovary(4)|skin(3)|central_nervous_system(1)	8						c.(1294-1296)GTT>TTT		netrin-G1 ligand precursor							189.0	168.0	175.0					11																	40136549		2203	4300	6503	SO:0001583	missense	57689				regulation of axonogenesis	integral to membrane	protein binding	g.chr11:40136549C>A	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1294G>T	11.37:g.40136549C>A	ENSP00000278198:p.Val432Phe					LRRC4C_uc001mxc.1_Missense_Mutation_p.V428F|LRRC4C_uc001mxd.1_Missense_Mutation_p.V428F|LRRC4C_uc001mxb.1_Missense_Mutation_p.V428F	p.V432F	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN			2	3258	-		all_lung(304;0.0575)|Lung NSC(402;0.138)	432			Ig-like C2-type.		A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	37	c.1294G>T	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.005732	0.35415	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	5.84	5.84	0.93424	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.060136	0.64402	D	0.000003	T	0.53302	0.1788	N	0.17345	0.48	0.51233	D	0.999915	B	0.28082	0.2	B	0.28465	0.09	T	0.47971	-0.9075	10	0.20519	T	0.43	.	19.1433	0.93455	0.0:1.0:0.0:0.0	.	432	Q9HCJ2	LRC4C_HUMAN	F	432	ENSP00000278198:V432F;ENSP00000436976:V432F;ENSP00000437132:V432F;ENSP00000434761:V432F	ENSP00000278198:V432F	V	-	1	0	LRRC4C	40093125	1.000000	0.71417	0.998000	0.56505	0.608000	0.37181	4.897000	0.63231	2.760000	0.94817	0.655000	0.94253	GTT		0.438	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		35	114	1	0	2.80507e-11	0.002445	4.236e-11	35	114				
LRRC4C	57689	broad.mit.edu	37	11	40136878	40136878	+	Nonsense_Mutation	SNP	G	G	T	rs202082491		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr11:40136878G>T	ENST00000278198.2	-	2	2928	c.965C>A	c.(964-966)tCg>tAg	p.S322*	LRRC4C_ENST00000527150.1_Nonsense_Mutation_p.S322*|LRRC4C_ENST00000530763.1_Nonsense_Mutation_p.S322*|LRRC4C_ENST00000528697.1_Nonsense_Mutation_p.S322*			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	322	LRRCT.				regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				AGCTGTGTTCGAGGGGGCCAT	0.498																																							uc001mxa.1		NA																	0				ovary(4)|skin(3)|central_nervous_system(1)	8						c.(964-966)TCG>TAG		netrin-G1 ligand precursor							96.0	84.0	88.0					11																	40136878		2203	4300	6503	SO:0001587	stop_gained	57689				regulation of axonogenesis	integral to membrane	protein binding	g.chr11:40136878G>T	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.965C>A	11.37:g.40136878G>T	ENSP00000278198:p.Ser322*					LRRC4C_uc001mxc.1_Nonsense_Mutation_p.S318*|LRRC4C_uc001mxd.1_Nonsense_Mutation_p.S318*|LRRC4C_uc001mxb.1_Nonsense_Mutation_p.S318*	p.S322*	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN			2	2929	-		all_lung(304;0.0575)|Lung NSC(402;0.138)	322			LRRCT.		A8K0T1|Q7L0N3	Nonsense_Mutation	SNP	ENST00000278198.2	37	c.965C>A	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	G	40	8.224862	0.98714	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	.	.	.	5.76	5.76	0.90799	.	0.112194	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.9619	0.92680	0.0:0.0:1.0:0.0	.	.	.	.	X	322	.	ENSP00000278198:S322X	S	-	2	0	LRRC4C	40093454	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.787000	0.85759	2.732000	0.93576	0.655000	0.94253	TCG		0.498	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929		17	48	1	0	2.23348e-06	0.004007	2.82403e-06	17	48				
ZNF408	79797	broad.mit.edu	37	11	46726982	46726982	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr11:46726982C>T	ENST00000311764.2	+	5	1962	c.1732C>T	c.(1732-1734)Ccc>Tcc	p.P578S		NM_001184751.1|NM_024741.2	NP_001171680.1|NP_079017.1	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	578					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CGGAGAGAGGCCCTTTCCCTG	0.667																																					Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)	Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)	uc001nde.1		NA																	0					0						c.(1732-1734)CCC>TCC		zinc finger protein 408							24.0	25.0	24.0					11																	46726982		2201	4297	6498	SO:0001583	missense	79797				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|identical protein binding|zinc ion binding	g.chr11:46726982C>T	AF346626	CCDS7923.1	11p11.2	2008-02-05			ENSG00000175213	ENSG00000175213		"""Zinc fingers, C2H2-type"""	20041	protein-coding gene	gene with protein product						15231747	Standard	NM_024741		Approved	FLJ12827	uc010rgw.2	Q9H9D4	OTTHUMG00000166568	ENST00000311764.2:c.1732C>T	11.37:g.46726982C>T	ENSP00000309606:p.Pro578Ser					ZNF408_uc010rgw.1_Missense_Mutation_p.P570S	p.P578S	NM_024741	NP_079017	Q9H9D4	ZN408_HUMAN			5	1962	+			578						Missense_Mutation	SNP	ENST00000311764.2	37	c.1732C>T	CCDS7923.1	.	.	.	.	.	.	.	.	.	.	C	19.23	3.788214	0.70337	.	.	ENSG00000175213	ENST00000311764	T	0.28454	1.61	5.23	4.32	0.51571	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42548	D	0.000683	T	0.48892	0.1525	M	0.74258	2.255	0.54753	D	0.999981	D;D	0.67145	0.996;0.996	P;P	0.60345	0.873;0.873	T	0.52245	-0.8601	10	0.87932	D	0	-21.1365	9.9684	0.41738	0.1379:0.789:0.0:0.0731	.	570;578	B4DXY4;Q9H9D4	.;ZN408_HUMAN	S	578	ENSP00000309606:P578S	ENSP00000309606:P578S	P	+	1	0	ZNF408	46683558	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	3.310000	0.51911	1.205000	0.43262	0.462000	0.41574	CCC		0.667	ZNF408-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390485.2	NM_024741		7	37	0	0	0	0.001984	0	7	37				
OR4C16	219428	broad.mit.edu	37	11	55340160	55340160	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr11:55340160C>G	ENST00000314634.3	+	1	557	c.557C>G	c.(556-558)gCc>gGc	p.A186G		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				TTGAAACAAGCCTGTTCAGAA	0.428																																							uc010rih.1		NA																	0				ovary(1)|skin(1)	2						c.(556-558)GCC>GGC		olfactory receptor, family 4, subfamily C,							101.0	96.0	98.0					11																	55340160		2201	4296	6497	SO:0001583	missense	219428				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55340160C>G	AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.557C>G	11.37:g.55340160C>G	ENSP00000324913:p.Ala186Gly						p.A186G	NM_001004701	NP_001004701	Q8NGL9	OR4CG_HUMAN			1	557	+		all_epithelial(135;0.0748)	186			Extracellular (Potential).		Q6IEV8	Missense_Mutation	SNP	ENST00000314634.3	37	c.557C>G	CCDS31502.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.937848	0.52972	.	.	ENSG00000181935	ENST00000314634	T	0.00231	8.49	4.98	4.98	0.66077	GPCR, rhodopsin-like superfamily (1);	0.095306	0.46145	D	0.000313	T	0.00845	0.0028	H	0.98111	4.15	0.30019	N	0.814496	P	0.37708	0.606	P	0.51016	0.656	T	0.00011	-1.2435	10	0.72032	D	0.01	.	15.7881	0.78326	0.0:1.0:0.0:0.0	.	186	Q8NGL9	OR4CG_HUMAN	G	186	ENSP00000324913:A186G	ENSP00000324913:A186G	A	+	2	0	OR4C16	55096736	0.021000	0.18746	0.875000	0.34327	0.317000	0.28152	2.911000	0.48774	2.595000	0.87683	0.549000	0.68633	GCC		0.428	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382627.1	NM_001004701		21	74	0	0	0	0.010504	0	21	74				
OR5B12	390191	broad.mit.edu	37	11	58207463	58207463	+	Silent	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr11:58207463G>A	ENST00000302572.2	-	1	183	c.162C>T	c.(160-162)caC>caT	p.H54H		NM_001004733.2	NP_001004733.1	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B, member 12	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(6)|liver(1)|lung(28)|ovary(1)|prostate(3)|skin(1)	40	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				ACATGGGGGTGTGGAGACAGG	0.493																																							uc010rkh.1		NA																	0					0						c.(160-162)CAC>CAT		olfactory receptor, family 5, subfamily B,							66.0	71.0	69.0					11																	58207463		2201	4295	6496	SO:0001819	synonymous_variant	390191				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:58207463G>A	AB065851	CCDS31551.1	11q12.1	2012-08-09		2004-03-10	ENSG00000172362	ENSG00000172362		"""GPCR / Class A : Olfactory receptors"""	15432	protein-coding gene	gene with protein product				OR5B12P, OR5B16		12213199	Standard	NM_001004733		Approved	OST743	uc010rkh.2	Q96R08	OTTHUMG00000167543	ENST00000302572.2:c.162C>T	11.37:g.58207463G>A							p.H54H	NM_001004733	NP_001004733	Q96R08	OR5BC_HUMAN			1	162	-	Esophageal squamous(5;0.0027)	Breast(21;0.0778)	54			Helical; Name=2; (Potential).		B2RNL2|Q6IEV5	Silent	SNP	ENST00000302572.2	37	c.162C>T	CCDS31551.1																																																																																				0.493	OR5B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394987.1	NM_001004733		11	49	0	0	0	0.008291	0	11	49				
NRXN2	9379	broad.mit.edu	37	11	64434943	64434943	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr11:64434943G>T	ENST00000377551.1	-	8	1788	c.1577C>A	c.(1576-1578)cCc>cAc	p.P526H	NRXN2_ENST00000377559.3_Missense_Mutation_p.P495H|NRXN2_ENST00000409571.1_Missense_Mutation_p.P519H|NRXN2_ENST00000265459.6_Missense_Mutation_p.P526H			Q9P2S2	NRX2A_HUMAN	neurexin 2	526	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						CAGCCCATTGGGCTCGGTGGT	0.657																																							uc001oar.2		NA																	0				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						c.(1576-1578)CCC>CAC		neurexin 2 isoform alpha-1 precursor							39.0	44.0	43.0					11																	64434943		2201	4297	6498	SO:0001583	missense	9379				cell adhesion	integral to membrane		g.chr11:64434943G>T		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.1577C>A	11.37:g.64434943G>T	ENSP00000366774:p.Pro526His					NRXN2_uc001oas.2_Missense_Mutation_p.P495H|NRXN2_uc001oaq.2_Missense_Mutation_p.P193H	p.P526H	NM_015080	NP_055895	P58401	NRX2B_HUMAN			10	2016	-			Error:Variant_position_missing_in_P58401_after_alignment					A7E2C1|Q9Y2D6	Missense_Mutation	SNP	ENST00000377551.1	37	c.1577C>A	CCDS8077.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.664859	0.88251	.	.	ENSG00000110076	ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571;ENST00000442300	T;T;T;T;T	0.81163	-1.32;-1.32;-1.32;-1.32;-1.46	4.63	4.63	0.57726	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.42964	U	0.000632	D	0.91908	0.7438	M	0.93720	3.45	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.93858	0.7151	10	0.87932	D	0	.	15.0038	0.71495	0.0:0.0:1.0:0.0	.	495;526;272	Q9P2S2-2;Q9P2S2;E7EV67	.;NRX2A_HUMAN;.	H	526;495;526;495;519;282	ENSP00000366774:P526H;ENSP00000366782:P495H;ENSP00000265459:P526H;ENSP00000386416:P519H;ENSP00000388971:P282H	ENSP00000265459:P526H	P	-	2	0	NRXN2	64191519	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.648000	0.98483	2.392000	0.81423	0.462000	0.41574	CCC		0.657	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080		22	56	1	0	6.33239e-15	0.010504	1.05446e-14	22	56				
GRM5	2915	broad.mit.edu	37	11	88300451	88300451	+	Silent	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr11:88300451G>T	ENST00000305447.4	-	7	2549	c.2400C>A	c.(2398-2400)atC>atA	p.I800I	GRM5_ENST00000455756.2_Silent_p.I800I|GRM5_ENST00000305432.5_Silent_p.I800I|GRM5_ENST00000393297.1_Silent_p.I800I|GRM5_ENST00000418177.2_Silent_p.I800I	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	800					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	AACACATGGTGATGATTTTGT	0.488																																							uc001pcq.2		NA																	0				central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9						c.(2398-2400)ATC>ATA		glutamate receptor, metabotropic 5 isoform a	Acamprosate(DB00659)						149.0	128.0	135.0					11																	88300451		2201	4299	6500	SO:0001819	synonymous_variant	2915				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr11:88300451G>T	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.2400C>A	11.37:g.88300451G>T						GRM5_uc009yvm.2_Silent_p.I800I	p.I800I	NM_001143831	NP_001137303	P41594	GRM5_HUMAN			7	2600	-		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)	800			Extracellular (Potential).		Q6J164	Silent	SNP	ENST00000305447.4	37	c.2400C>A	CCDS44694.1																																																																																				0.488	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842		25	52	1	0	1.64293e-13	0.00333	2.66441e-13	25	52				
GUCY1A2	2977	broad.mit.edu	37	11	106849374	106849374	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr11:106849374C>T	ENST00000526355.2	-	3	926	c.458G>A	c.(457-459)gGa>gAa	p.G153E	GUCY1A2_ENST00000347596.2_Missense_Mutation_p.G153E|GUCY1A2_ENST00000282249.2_Missense_Mutation_p.G153E	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	153					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	CTGAAGAATTCCTGAGACATC	0.363																																							uc001pjg.1		NA																	0				large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8						c.(457-459)GGA>GAA		guanylate cyclase 1, soluble, alpha 2							126.0	121.0	122.0					11																	106849374		2201	4298	6499	SO:0001583	missense	2977				intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding	g.chr11:106849374C>T	X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.458G>A	11.37:g.106849374C>T	ENSP00000431245:p.Gly153Glu					GUCY1A2_uc010rvo.1_Missense_Mutation_p.G153E|GUCY1A2_uc009yxn.1_Missense_Mutation_p.G153E	p.G153E	NM_000855	NP_000846	P33402	GCYA2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	3	848	-		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)	153					A1L4C4|B7ZLT5	Missense_Mutation	SNP	ENST00000526355.2	37	c.458G>A	CCDS8335.1	.	.	.	.	.	.	.	.	.	.	C	8.315	0.823081	0.16678	.	.	ENSG00000152402	ENST00000526355;ENST00000282249;ENST00000347596	T;T;T	0.41065	1.01;1.01;1.01	5.73	5.73	0.89815	Heme-NO binding (1);NO signalling/Golgi transport  ligand-binding domain (1);	0.000000	0.40554	U	0.001075	T	0.51126	0.1656	L	0.34521	1.04	0.53005	D	0.999964	D;B;D	0.89917	1.0;0.011;1.0	D;B;D	0.97110	1.0;0.005;1.0	T	0.24154	-1.0168	10	0.06099	T	0.92	.	18.8659	0.92292	0.0:1.0:0.0:0.0	.	153;153;153	B7ZLT5;P33402-2;P33402	.;.;GCYA2_HUMAN	E	153	ENSP00000431245:G153E;ENSP00000282249:G153E;ENSP00000344874:G153E	ENSP00000282249:G153E	G	-	2	0	GUCY1A2	106354584	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.983000	0.56916	2.882000	0.98803	0.655000	0.94253	GGA		0.363	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389003.2			7	21	0	0	0	0.001984	0	7	21				
GUCY1A2	2977	broad.mit.edu	37	11	106849452	106849452	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr11:106849452T>A	ENST00000526355.2	-	3	848	c.380A>T	c.(379-381)gAa>gTa	p.E127V	GUCY1A2_ENST00000347596.2_Missense_Mutation_p.E127V|GUCY1A2_ENST00000282249.2_Missense_Mutation_p.E127V	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	127					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	GAAATTCTTTTCTGCATCCCT	0.378																																							uc001pjg.1		NA																	0				large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8						c.(379-381)GAA>GTA		guanylate cyclase 1, soluble, alpha 2							109.0	105.0	106.0					11																	106849452		2201	4298	6499	SO:0001583	missense	2977				intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding	g.chr11:106849452T>A	X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.380A>T	11.37:g.106849452T>A	ENSP00000431245:p.Glu127Val					GUCY1A2_uc010rvo.1_Missense_Mutation_p.E127V|GUCY1A2_uc009yxn.1_Missense_Mutation_p.E127V	p.E127V	NM_000855	NP_000846	P33402	GCYA2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	3	770	-		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)	127					A1L4C4|B7ZLT5	Missense_Mutation	SNP	ENST00000526355.2	37	c.380A>T	CCDS8335.1	.	.	.	.	.	.	.	.	.	.	T	16.14	3.038705	0.55003	.	.	ENSG00000152402	ENST00000526355;ENST00000282249;ENST00000347596	D;D;D	0.87729	-1.96;-2.29;-1.97	5.73	5.73	0.89815	.	0.000000	0.42053	U	0.000770	D	0.88614	0.6484	N	0.22421	0.69	0.49483	D	0.999792	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.998	D	0.88279	0.2935	10	0.37606	T	0.19	.	15.1688	0.72854	0.0:0.0:0.0:1.0	.	127;127;127	B7ZLT5;P33402-2;P33402	.;.;GCYA2_HUMAN	V	127	ENSP00000431245:E127V;ENSP00000282249:E127V;ENSP00000344874:E127V	ENSP00000282249:E127V	E	-	2	0	GUCY1A2	106354662	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.714000	0.68422	2.324000	0.78689	0.533000	0.62120	GAA		0.378	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389003.2			5	14	0	0	0	0.001168	0	5	14				
RBM7	10179	broad.mit.edu	37	11	114270704	114270704	+	5'Flank	SNP	A	A	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr11:114270704A>G	ENST00000540163.1	+	0	0				C11orf71_ENST00000325636.4_Intron|RP11-212D19.4_ENST00000544347.1_5'Flank|RBM7_ENST00000541475.1_5'Flank|RBM7_ENST00000545678.1_5'Flank|RBM7_ENST00000375490.5_5'Flank|RBM7_ENST00000544582.1_5'Flank			Q9Y580	RBM7_HUMAN	RNA binding motif protein 7						meiotic nuclear division (GO:0007126)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17		all_cancers(61;5.06e-12)|all_epithelial(67;5.3e-06)|all_hematologic(158;7.68e-05)|Acute lymphoblastic leukemia(157;0.000966)|Melanoma(852;0.00153)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.0818)|Prostate(24;0.104)		BRCA - Breast invasive adenocarcinoma(274;2.56e-06)|Epithelial(105;4.17e-05)|all cancers(92;0.000348)		TCGAGCTGCGATAACACCTCC	0.478																																							uc001pou.3		NA																	0					0						c.(349-351)ATC>ACC		hypothetical protein LOC54494							46.0	46.0	46.0					11																	114270704		1961	4143	6104	SO:0001631	upstream_gene_variant	54494							g.chr11:114270704A>G	AF156098	CCDS8370.1, CCDS66233.1, CCDS73395.1	11q23.1-q23.2	2013-02-12			ENSG00000076053	ENSG00000076053		"""RNA binding motif (RRM) containing"""	9904	protein-coding gene	gene with protein product		612413				12477932	Standard	NM_001286045		Approved		uc001pov.3	Q9Y580			11.37:g.114270704A>G	Exception_encountered					C11orf71_uc001pot.1_Intron|RBM7_uc001pov.2_5'Flank|RBM7_uc001pow.2_5'Flank|RBM7_uc001pox.2_5'Flank	p.I117T	NM_019021	NP_061894	Q6IPW1	CK071_HUMAN		BRCA - Breast invasive adenocarcinoma(274;2.6e-06)|Epithelial(105;4.31e-05)|all cancers(92;0.00036)	1	552	-		all_cancers(61;1.15e-11)|all_epithelial(67;5.3e-06)|all_hematologic(158;0.000303)|Acute lymphoblastic leukemia(157;0.000966)|Melanoma(852;0.00153)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.0818)|Prostate(24;0.104)	117					B2R6K8|Q9NUT4	Missense_Mutation	SNP	ENST00000540163.1	37	c.350T>C	CCDS8370.1																																																																																				0.478	RBM7-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399010.1	NM_016090		8	43	0	0	0	0.00308	0	8	43				
UBASH3B	84959	broad.mit.edu	37	11	122653759	122653759	+	Splice_Site	SNP	A	A	T	rs202047453		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr11:122653759A>T	ENST00000284273.5	+	5	976		c.e5-1			NM_032873.4	NP_116262.2	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing B						negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein kinase activity (GO:0006469)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|prostate(1)|skin(2)|stomach(2)	26		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		TCCTTTTTCCAGAAGTGCATG	0.453																																							uc001pyi.3		NA																	0				central_nervous_system(1)	1						c.e5-2		ubiquitin associated and SH3 domain containing,							229.0	242.0	237.0					11																	122653759		2202	4299	6501	SO:0001630	splice_region_variant	84959					cytoplasm|nucleus	protein tyrosine phosphatase activity	g.chr11:122653759A>T	AB075839	CCDS31694.1	11q24.1	2010-04-28	2010-04-28		ENSG00000154127	ENSG00000154127			29884	protein-coding gene	gene with protein product	"""SH3 domain-containing 70 kDa protein, suppressor of T-cell receptor signaling 1, nm23-phosphorylated unknown substrate"""	609201				11853319, 12370296	Standard	NM_032873		Approved	KIAA1959, STS-1	uc001pyi.4	Q8TF42	OTTHUMG00000166025	ENST00000284273.5:c.602-1A>T	11.37:g.122653759A>T							p.E201_splice	NM_032873	NP_116262	Q8TF42	UBS3B_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)	5	962	+		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)						Q53GT5|Q53GT8|Q8NBV7|Q96IG9|Q96NZ2	Splice_Site	SNP	ENST00000284273.5	37	c.602_splice	CCDS31694.1	.	.	.	.	.	.	.	.	.	.	A	14.47	2.545449	0.45280	.	.	ENSG00000154127	ENST00000284273	.	.	.	4.99	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7237	0.69326	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UBASH3B	122158969	1.000000	0.71417	0.945000	0.38365	0.385000	0.30292	9.313000	0.96297	1.890000	0.54733	0.528000	0.53228	.		0.453	UBASH3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387499.1	NM_032873	Intron	47	234	0	0	0	0.00361	0	47	234				
CACNA1C	775	broad.mit.edu	37	12	2614017	2614017	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr12:2614017G>A	ENST00000347598.4	+	8	1123	c.1123G>A	c.(1123-1125)Gcc>Acc	p.A375T	CACNA1C_ENST00000344100.3_Missense_Mutation_p.A375T|CACNA1C_ENST00000399637.1_Missense_Mutation_p.A375T|CACNA1C_ENST00000335762.5_Missense_Mutation_p.A375T|CACNA1C_ENST00000399655.1_Missense_Mutation_p.A375T|CACNA1C_ENST00000399629.1_Missense_Mutation_p.A375T|CACNA1C_ENST00000399591.1_Missense_Mutation_p.A375T|CACNA1C_ENST00000399603.1_Intron|CACNA1C_ENST00000399606.1_Missense_Mutation_p.A375T|CACNA1C_ENST00000399621.1_Missense_Mutation_p.A375T|CACNA1C_ENST00000399641.1_Intron|CACNA1C_ENST00000406454.3_Intron|CACNA1C_ENST00000399601.1_Missense_Mutation_p.A375T|CACNA1C_ENST00000491104.1_Intron|CACNA1C_ENST00000399595.1_Missense_Mutation_p.A375T|CACNA1C_ENST00000399644.1_Missense_Mutation_p.A375T|CACNA1C_ENST00000399597.1_Missense_Mutation_p.A375T|CACNA1C_ENST00000480911.1_Missense_Mutation_p.A375T|CACNA1C_ENST00000402845.3_Missense_Mutation_p.A375T|CACNA1C_ENST00000399638.1_Missense_Mutation_p.A375T|CACNA1C_ENST00000399634.1_Intron|CACNA1C_ENST00000327702.7_Missense_Mutation_p.A375T|CACNA1C_ENST00000399617.1_Intron|CACNA1C_ENST00000399649.1_Missense_Mutation_p.A375T	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	375					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GGTCAATGATGCCGTAGGAAG	0.522																																							uc009zdu.1		NA																	0				ovary(10)|central_nervous_system(1)	11						c.(1123-1125)GCC>ACC		calcium channel, voltage-dependent, L type,	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)						100.0	100.0	100.0					12																	2614017		1980	4172	6152	SO:0001583	missense	775				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity	g.chr12:2614017G>A	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.1123G>A	12.37:g.2614017G>A	ENSP00000266376:p.Ala375Thr					CACNA1C_uc009zdv.1_Missense_Mutation_p.A372T|CACNA1C_uc001qkb.2_Missense_Mutation_p.A375T|CACNA1C_uc001qkc.2_Missense_Mutation_p.A375T|CACNA1C_uc001qke.2_Missense_Mutation_p.A375T|CACNA1C_uc001qkf.2_Missense_Mutation_p.A375T|CACNA1C_uc001qjz.2_Missense_Mutation_p.A375T|CACNA1C_uc001qkd.2_Missense_Mutation_p.A375T|CACNA1C_uc001qkg.2_Missense_Mutation_p.A375T|CACNA1C_uc009zdw.1_Missense_Mutation_p.A375T|CACNA1C_uc001qkh.2_Missense_Mutation_p.A375T|CACNA1C_uc001qkl.2_Missense_Mutation_p.A375T|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Missense_Mutation_p.A375T|CACNA1C_uc001qkp.2_Missense_Mutation_p.A375T|CACNA1C_uc001qkr.2_Missense_Mutation_p.A375T|CACNA1C_uc001qku.2_Missense_Mutation_p.A375T|CACNA1C_uc001qkq.2_Missense_Mutation_p.A375T|CACNA1C_uc001qks.2_Missense_Mutation_p.A375T|CACNA1C_uc001qkt.2_Missense_Mutation_p.A375T|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron|CACNA1C_uc009zdy.1_Intron|CACNA1C_uc001qkv.1_5'UTR	p.A375T	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	8	1436	+			375			I.|Extracellular (Potential).		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	c.1123G>A	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.929693	0.92389	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399595	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98437	-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93;-4.93	5.17	5.17	0.71159	Ion transport (1);	.	.	.	.	D	0.99029	0.9668	M	0.84948	2.725	0.80722	D	1	D;D;D;D;D;D;D;P;D;D;D;D;D;D;D;D;D;D;D	0.76494	0.999;0.998;0.965;0.999;0.999;0.998;0.999;0.842;0.982;0.999;0.998;0.998;0.999;0.968;0.998;0.999;0.999;0.998;0.998	D;D;D;D;D;D;D;P;P;D;D;P;D;P;D;D;D;D;D	0.87578	0.996;0.995;0.919;0.996;0.998;0.995;0.998;0.868;0.858;0.998;0.998;0.868;0.998;0.779;0.991;0.998;0.998;0.991;0.995	D	0.99716	1.1008	9	0.72032	D	0.01	.	18.8623	0.92278	0.0:0.0:1.0:0.0	.	375;372;375;375;375;375;375;375;375;375;375;375;375;375;375;375;375;375;375	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-11;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	T	375	ENSP00000336982:A375T;ENSP00000382563:A375T;ENSP00000437936:A375T;ENSP00000382552:A375T;ENSP00000382547:A375T;ENSP00000382506:A375T;ENSP00000382530:A375T;ENSP00000382546:A375T;ENSP00000382500:A375T;ENSP00000266376:A375T;ENSP00000382515:A375T;ENSP00000382510:A375T;ENSP00000341092:A375T;ENSP00000382537:A375T;ENSP00000329877:A375T;ENSP00000382557:A375T;ENSP00000385724:A375T;ENSP00000382504:A375T	ENSP00000329877:A375T	A	+	1	0	CACNA1C	2484278	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.684000	0.91462	0.650000	0.86243	GCC		0.522	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719		3	18	0	0	0	0.004672	0	3	18				
KCNA6	3742	broad.mit.edu	37	12	4919702	4919702	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr12:4919702G>T	ENST00000280684.3	+	1	1361	c.495G>T	c.(493-495)gaG>gaT	p.E165D	KCNA6_ENST00000433855.1_Missense_Mutation_p.E165D|RP11-234B24.4_ENST00000542988.1_lincRNA			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	165					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	TGCTCTTTGAGTACCCAGAGA	0.637										HNSCC(72;0.22)																													uc001qng.2		NA																	0				skin(2)|ovary(1)	3						c.(493-495)GAG>GAT		potassium voltage-gated channel, shaker-related							36.0	38.0	37.0					12																	4919702		2203	4300	6503	SO:0001583	missense	3742					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr12:4919702G>T	X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.495G>T	12.37:g.4919702G>T	ENSP00000280684:p.Glu165Asp	HNSCC(72;0.22)					p.E165D	NM_002235	NP_002226	P17658	KCNA6_HUMAN			1	1361	+			165						Missense_Mutation	SNP	ENST00000280684.3	37	c.495G>T	CCDS8534.1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.528592	0.64860	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	T;T	0.68181	-0.31;-0.31	4.87	2.88	0.33553	.	0.111103	0.64402	D	0.000012	T	0.69806	0.3152	L	0.39898	1.24	0.45205	D	0.99821	D	0.61080	0.989	D	0.66716	0.946	T	0.70051	-0.4978	10	0.62326	D	0.03	.	8.0519	0.30583	0.2727:0.0:0.7273:0.0	.	165	P17658	KCNA6_HUMAN	D	165	ENSP00000408321:E165D;ENSP00000280684:E165D	ENSP00000280684:E165D	E	+	3	2	KCNA6	4789963	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.700000	0.61803	1.265000	0.44215	0.563000	0.77884	GAG		0.637	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398909.1	NM_002235		14	35	1	0	1.49906e-05	0.00245	1.80954e-05	14	35				
ARHGDIB	397	broad.mit.edu	37	12	15095548	15095548	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr12:15095548A>G	ENST00000228945.4	-	6	658	c.514T>C	c.(514-516)Tac>Cac	p.Y172H	ARHGDIB_ENST00000541546.1_Missense_Mutation_p.Y172H|ARHGDIB_ENST00000541644.1_Missense_Mutation_p.Y172H|ARHGDIB_ENST00000539131.1_5'UTR	NM_001175.4	NP_001166.3	P52566	GDIR2_HUMAN	Rho GDP dissociation inhibitor (GDI) beta	172					actin cytoskeleton organization (GO:0030036)|cellular component movement (GO:0006928)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of cell adhesion (GO:0007162)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)|Rho GDP-dissociation inhibitor activity (GO:0005094)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	15						TTGTTGTGGTACGTGCCTCGC	0.537																																							uc001rcq.1		NA																	0					0						c.(514-516)TAC>CAC		Rho GDP dissociation inhibitor (GDI) beta							250.0	184.0	207.0					12																	15095548		2203	4300	6503	SO:0001583	missense	397				actin cytoskeleton organization|cellular component movement|immune response|multicellular organismal development|negative regulation of cell adhesion|regulation of small GTPase mediated signal transduction|Rho protein signal transduction	cytoplasmic membrane-bounded vesicle|cytoskeleton|cytosol	GTPase activator activity|Rho GDP-dissociation inhibitor activity	g.chr12:15095548A>G	L07916	CCDS8671.1	12p12.3	2014-01-30				ENSG00000111348		"""Endogenous ligands"""	679	protein-coding gene	gene with protein product		602843		RAP1GN1, GDIA2, GDID4		8434008, 8356058	Standard	NM_001175		Approved	Ly-GDI, RhoGDI2	uc001rcq.1	P52566		ENST00000228945.4:c.514T>C	12.37:g.15095548A>G	ENSP00000228945:p.Tyr172His					ARHGDIB_uc001rcp.1_RNA	p.Y172H	NM_001175	NP_001166	P52566	GDIR2_HUMAN			6	618	-			172					B5BU79	Missense_Mutation	SNP	ENST00000228945.4	37	c.514T>C	CCDS8671.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.0|23.0	4.359036|4.359036	0.82353|0.82353	.|.	.|.	ENSG00000111348|ENSG00000111348	ENST00000536592|ENST00000228945;ENST00000541644;ENST00000541546	.|.	.|.	.|.	4.41|4.41	4.41|4.41	0.53225|0.53225	.|Immunoglobulin E-set (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.86686|0.86686	0.5992|0.5992	H|H	0.96861|0.96861	3.895|3.895	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.90272|0.90272	0.4308|0.4308	5|9	.|0.87932	.|D	.|0	-15.845|-15.845	11.9958|11.9958	0.53201|0.53201	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|172	.|P52566	.|GDIR2_HUMAN	A|H	165|172	.|.	.|ENSP00000228945:Y172H	V|Y	-|-	2|1	0|0	ARHGDIB|ARHGDIB	14986815|14986815	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.956000|0.956000	0.61745|0.61745	8.671000|8.671000	0.91174|0.91174	1.991000|1.991000	0.58162|0.58162	0.529000|0.529000	0.55759|0.55759	GTA|TAC		0.537	ARHGDIB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400871.1	NM_001175		15	98	0	0	0	0.00499	0	15	98				
RERGL	79785	broad.mit.edu	37	12	18237467	18237467	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr12:18237467T>A	ENST00000229002.2	-	5	525	c.319A>T	c.(319-321)Act>Tct	p.T107S	RERGL_ENST00000538724.1_Missense_Mutation_p.T106S|RERGL_ENST00000536890.1_3'UTR|RERGL_ENST00000541632.1_5'UTR	NM_024730.2	NP_079006.1	Q9H628	RERGL_HUMAN	RERG/RAS-like	107	Small GTPase-like.				GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			endometrium(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	17						CAATGACTAGTTTGTGGCTCC	0.373																																							uc001rdq.2		NA																	0					0						c.(319-321)ACT>TCT		RERG/RAS-like							137.0	138.0	138.0					12																	18237467		2203	4300	6503	SO:0001583	missense	79785				signal transduction	membrane	GTP binding|GTPase activity	g.chr12:18237467T>A	AK026308	CCDS8679.1, CCDS66332.1	12p12.3	2014-08-12			ENSG00000111404	ENSG00000111404			26213	protein-coding gene	gene with protein product						24127187	Standard	NM_001286201		Approved	FLJ22655	uc001rdq.3	Q9H628	OTTHUMG00000168820	ENST00000229002.2:c.319A>T	12.37:g.18237467T>A	ENSP00000229002:p.Thr107Ser					RERGL_uc001rdr.2_Missense_Mutation_p.T106S	p.T107S	NM_024730	NP_079006	Q9H628	RERGL_HUMAN			5	513	-			107			Small GTPase-like.			Missense_Mutation	SNP	ENST00000229002.2	37	c.319A>T	CCDS8679.1	.	.	.	.	.	.	.	.	.	.	T	0.113	-1.135258	0.01742	.	.	ENSG00000111404	ENST00000229002;ENST00000538724	T;T	0.75821	-0.97;-0.97	4.91	1.35	0.21983	.	0.714107	0.14593	N	0.310133	T	0.51805	0.1696	N	0.17312	0.475	0.09310	N	1	B;B	0.21821	0.0;0.061	B;B	0.22152	0.001;0.038	T	0.32640	-0.9899	10	0.08179	T	0.78	.	7.8855	0.29648	0.0:0.2348:0.0:0.7652	.	106;107	F5H686;Q9H628	.;RERGL_HUMAN	S	107;106	ENSP00000229002:T107S;ENSP00000437814:T106S	ENSP00000229002:T107S	T	-	1	0	RERGL	18128734	0.000000	0.05858	0.704000	0.30370	0.400000	0.30750	0.422000	0.21296	0.426000	0.26116	0.383000	0.25322	ACT		0.373	RERGL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401198.1	NM_024730		25	39	0	0	0	0.004656	0	25	39				
OVOS2	144203	broad.mit.edu	37	12	31300813	31300813	+	IGR	SNP	A	A	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr12:31300813A>T								RP11-551L14.1 (30408 upstream) : FAM60A (132704 downstream)																							CCAGGAACCCACTGACTGAGA	0.448																																							uc010sjy.1		NA																	0					NA						c.e11+1		RecName: Full=Ovostatin homolog 1; Flags: Precursor;							51.0	53.0	52.0					12																	31300813		1895	4094	5989	SO:0001628	intergenic_variant	0							g.chr12:31300813A>T																													12.37:g.31300813A>T							p.H482_splice							11	1445	-									Splice_Site	SNP		37	c.1445_splice																																																																																				0	0.448									31	55	0	0	0	0.008361	0	31	55				
PRICKLE1	144165	broad.mit.edu	37	12	42853627	42853627	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr12:42853627T>C	ENST00000455697.1	-	8	2765	c.2480A>G	c.(2479-2481)aAt>aGt	p.N827S	RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000548696.1_Missense_Mutation_p.N827S|PRICKLE1_ENST00000445766.2_Missense_Mutation_p.N827S|PRICKLE1_ENST00000345127.3_Missense_Mutation_p.N827S|PRICKLE1_ENST00000552240.1_Missense_Mutation_p.N827S	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	827					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		AATAATACAATTTTTGCCCTT	0.398																																							uc010skv.1		NA																	0				ovary(3)|skin(1)	4						c.(2479-2481)AAT>AGT		prickle homolog 1							187.0	179.0	182.0					12																	42853627		2203	4300	6503	SO:0001583	missense	144165				negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cardiac muscle cell myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein import into nucleus	cytosol|nuclear membrane	zinc ion binding	g.chr12:42853627T>C	AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.2480A>G	12.37:g.42853627T>C	ENSP00000401060:p.Asn827Ser					PRICKLE1_uc001rnl.2_Missense_Mutation_p.N827S|PRICKLE1_uc010skw.1_Missense_Mutation_p.N827S|PRICKLE1_uc001rnm.2_Missense_Mutation_p.N827S|PRICKLE1_uc001rnk.1_5'Flank	p.N827S	NM_001144881	NP_001138353	Q96MT3	PRIC1_HUMAN		GBM - Glioblastoma multiforme(48;0.2)	8	2767	-	all_cancers(12;4.25e-05)|Breast(8;0.176)		827					Q14C83|Q71QF8|Q96N00	Missense_Mutation	SNP	ENST00000455697.1	37	c.2480A>G	CCDS8742.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.992188	0.74703	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	D;D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75;-1.75	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.82692	0.5092	N	0.08118	0	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.87058	0.2151	10	0.87932	D	0	-30.9	16.0265	0.80548	0.0:0.0:0.0:1.0	.	827	Q96MT3	PRIC1_HUMAN	S	827	ENSP00000401060:N827S;ENSP00000398947:N827S;ENSP00000448359:N827S;ENSP00000345064:N827S;ENSP00000449819:N827S	ENSP00000345064:N827S	N	-	2	0	PRICKLE1	41139894	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.546000	0.82137	2.239000	0.73571	0.533000	0.62120	AAT		0.398	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1			42	62	0	0	0	0.002852	0	42	62				
NELL2	4753	broad.mit.edu	37	12	44915846	44915846	+	Silent	SNP	A	A	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr12:44915846A>G	ENST00000429094.2	-	18	2616	c.2112T>C	c.(2110-2112)aaT>aaC	p.N704N	NELL2_ENST00000551601.1_Silent_p.N656N|NELL2_ENST00000437801.2_Silent_p.N754N|NELL2_ENST00000452445.2_Silent_p.N704N|NELL2_ENST00000549027.1_Silent_p.N703N|NELL2_ENST00000395487.2_Silent_p.N703N|NELL2_ENST00000333837.4_Silent_p.N727N	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	704	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		AAGTTTCCCCATTTTGATGGA	0.453																																							uc001rog.2		NA																	0				skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						c.(2110-2112)AAT>AAC		NEL-like protein 2 isoform b precursor							130.0	118.0	122.0					12																	44915846		2203	4300	6503	SO:0001819	synonymous_variant	4753				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity	g.chr12:44915846A>G	D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.2112T>C	12.37:g.44915846A>G						NELL2_uc001rof.3_Silent_p.N703N|NELL2_uc001roh.2_Silent_p.N704N|NELL2_uc009zkd.2_Silent_p.N656N|NELL2_uc010skz.1_Silent_p.N754N|NELL2_uc010sla.1_Silent_p.N727N	p.N704N	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN		GBM - Glioblastoma multiforme(48;0.092)	18	2707	-	Lung SC(27;0.192)	Lung NSC(34;0.144)	704			VWFC 4.		B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Silent	SNP	ENST00000429094.2	37	c.2112T>C	CCDS8746.1																																																																																				0.453	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	NM_006159		4	34	0	0	0	0.009096	0	4	34				
SCN8A	6334	broad.mit.edu	37	12	52162673	52162673	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr12:52162673C>T	ENST00000354534.6	+	17	3104	c.2926C>T	c.(2926-2928)Ctc>Ttc	p.L976F	SCN8A_ENST00000545061.1_Missense_Mutation_p.L976F	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	976					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	TCTGGCCTTGCTCCTGAGCTC	0.493																																							uc001ryw.2		NA																	0				ovary(7)	7						c.(2926-2928)CTC>TTC		sodium channel, voltage gated, type VIII, alpha	Lamotrigine(DB00555)						81.0	80.0	80.0					12																	52162673		2038	4213	6251	SO:0001583	missense	6334				axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity	g.chr12:52162673C>T	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.2926C>T	12.37:g.52162673C>T	ENSP00000346534:p.Leu976Phe					SCN8A_uc010snl.1_Missense_Mutation_p.L841F	p.L976F	NM_014191	NP_055006	Q9UQD0	SCN8A_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.181)	17	3104	+			976			Helical; Name=S6 of repeat II; (Potential).|II.		B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	ENST00000354534.6	37	c.2926C>T	CCDS44891.1	.	.	.	.	.	.	.	.	.	.	C	18.05	3.537015	0.65085	.	.	ENSG00000196876	ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961	D;D;D	0.97870	-4.58;-4.58;-4.58	4.66	3.77	0.43336	.	0.000000	0.85682	D	0.000000	D	0.99152	0.9707	H	0.98388	4.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98619	1.0666	10	0.87932	D	0	.	11.0356	0.47799	0.0:0.8472:0.0:0.1528	.	976;976	F8VWM7;Q9UQD0	.;SCN8A_HUMAN	F	976;976;976;889	ENSP00000346534:L976F;ENSP00000440360:L976F;ENSP00000347255:L976F	ENSP00000346534:L976F	L	+	1	0	SCN8A	50448940	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.610000	0.36869	1.577000	0.49804	-0.251000	0.11542	CTC		0.493	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191		6	36	0	0	0	0.001168	0	6	36				
CTDSP2	10106	broad.mit.edu	37	12	58217755	58217755	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr12:58217755T>A	ENST00000398073.2	-	7	925	c.622A>T	c.(622-624)Agg>Tgg	p.R208W	CTDSP2_ENST00000547701.1_Missense_Mutation_p.R56W|MIR26A2_ENST00000385054.1_RNA|CTDSP2_ENST00000548823.1_Intron	NM_005730.3	NP_005721.3	O14595	CTDS2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2	208	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein dephosphorylation (GO:0006470)	nucleoplasm (GO:0005654)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(1)|prostate(2)	7	all_neural(12;0.00559)|Glioma(12;0.0143)|Melanoma(17;0.122)					CTCAGGTCCCTCCCCAGGCGG	0.607																																							uc001sqm.2		NA																	0				central_nervous_system(1)	1						c.(622-624)AGG>TGG		nuclear LIM interactor-interacting factor 2							39.0	43.0	42.0					12																	58217755		2036	4176	6212	SO:0001583	missense	10106				protein dephosphorylation	nucleus|soluble fraction	CTD phosphatase activity|metal ion binding	g.chr12:58217755T>A	AF000152	CCDS41801.1	12q14.1	2012-06-14			ENSG00000175215	ENSG00000175215		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	17077	protein-coding gene	gene with protein product	"""conserved gene amplified in osteosarcoma"", ""nuclear LIM interactor-interacting factor 2"", ""NLI-interacting factor 2"", ""small CTD phosphatase 2"""	608711				9315096, 12721286	Standard	XM_005268556		Approved	OS4, SCP2, PSR2	uc001sqm.3	O14595	OTTHUMG00000170483	ENST00000398073.2:c.622A>T	12.37:g.58217755T>A	ENSP00000381148:p.Arg208Trp					CTDSP2_uc010ssg.1_Missense_Mutation_p.R82W|CTDSP2_uc009zqf.2_Missense_Mutation_p.R56W|CTDSP2_uc009zqg.2_Intron	p.R208W	NM_005730	NP_005721	O14595	CTDS2_HUMAN			7	1151	-	all_neural(12;0.00559)|Glioma(12;0.0143)|Melanoma(17;0.122)		208			FCP1 homology.		A8K5H4|Q53ZR2|Q6NZY3|Q9UEX1	Missense_Mutation	SNP	ENST00000398073.2	37	c.622A>T	CCDS41801.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.2|22.2	4.259014|4.259014	0.80246|0.80246	.|.	.|.	ENSG00000175215|ENSG00000175215	ENST00000550144|ENST00000398073;ENST00000549039;ENST00000547701	.|T;T;T	.|0.23552	.|1.9;1.9;1.9	5.56|5.56	4.4|4.4	0.53042|0.53042	.|NLI interacting factor (3);Dullard phosphatase domain, eukaryotic (1);HAD-like domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.63988|0.63988	0.2558|0.2558	H|H	0.97465|0.97465	4.01|4.01	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	T|T	0.74556|0.74556	-0.3626|-0.3626	5|10	.|0.87932	.|D	.|0	-24.0745|-24.0745	11.1866|11.1866	0.48660|0.48660	0.0:0.0:0.2918:0.7082|0.0:0.0:0.2918:0.7082	.|.	.|82;208	.|B4DH48;O14595	.|.;CTDS2_HUMAN	V|W	177|208;62;56	.|ENSP00000381148:R208W;ENSP00000448386:R62W;ENSP00000446705:R56W	.|ENSP00000381148:R208W	E|R	-|-	2|1	0|2	CTDSP2|CTDSP2	56504022|56504022	1.000000|1.000000	0.71417|0.71417	0.965000|0.965000	0.40720|0.40720	0.657000|0.657000	0.38888|0.38888	3.090000|3.090000	0.50191|0.50191	1.095000|1.095000	0.41419|0.41419	0.533000|0.533000	0.62120|0.62120	GAG|AGG		0.607	CTDSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409353.1	NM_005730		5	37	0	0	0	0.000602	0	5	37				
DPY19L2	283417	broad.mit.edu	37	12	63974554	63974554	+	Silent	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr12:63974554C>A	ENST00000324472.4	-	19	1971	c.1788G>T	c.(1786-1788)gtG>gtT	p.V596V	DPY19L2_ENST00000413230.2_Silent_p.V43V	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	596					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		GTATTGACATCACTGTTAAAA	0.353																																							uc001srp.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1786-1788)GTG>GTT		dpy-19-like 2							89.0	83.0	85.0					12																	63974554		2203	4300	6503	SO:0001819	synonymous_variant	283417				multicellular organismal development|spermatid development	integral to membrane		g.chr12:63974554C>A		CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.1788G>T	12.37:g.63974554C>A						DPY19L2_uc010sso.1_Silent_p.V43V	p.V596V	NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)	19	1969	-			596					A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Silent	SNP	ENST00000324472.4	37	c.1788G>T	CCDS31851.1																																																																																				0.353	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400689.2	NM_173812		11	44	1	0	3.03607e-14	0.001368	4.94522e-14	11	44				
MDM2	4193	broad.mit.edu	37	12	69233396	69233396	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr12:69233396G>C	ENST00000350057.5	+	9	1168	c.1168G>C	c.(1168-1170)Gaa>Caa	p.E390Q	RP11-611O2.5_ENST00000553141.1_RNA|MDM2_ENST00000517852.1_Missense_Mutation_p.E54Q|MDM2_ENST00000393412.3_Missense_Mutation_p.E142Q|MDM2_ENST00000428863.2_Missense_Mutation_p.E194Q|MDM2_ENST00000540827.1_Missense_Mutation_p.E220Q|MDM2_ENST00000478070.1_3'UTR|MDM2_ENST00000462284.1_Missense_Mutation_p.E421Q|MDM2_ENST00000258149.5_Missense_Mutation_p.E360Q|MDM2_ENST00000356290.4_Missense_Mutation_p.E245Q|MDM2_ENST00000393410.1_Missense_Mutation_p.E167Q|MDM2_ENST00000258148.7_Missense_Mutation_p.E366Q|MDM2_ENST00000299252.4_Missense_Mutation_p.E245Q|MDM2_ENST00000393413.3_Missense_Mutation_p.E142Q|MDM2_ENST00000348801.2_Missense_Mutation_p.E189Q|MDM2_ENST00000360430.2_Missense_Mutation_p.E220Q|MDM2_ENST00000544561.1_Intron|MDM2_ENST00000545204.1_3'UTR			Q00987	MDM2_HUMAN	MDM2 proto-oncogene, E3 ubiquitin protein ligase	415	Necessary for interaction with USP2.				cellular response to acid chemical (GO:0071229)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to estrogen stimulus (GO:0071391)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to UV-C (GO:0071494)|cellular response to vitamin B1 (GO:0071301)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of protein localization (GO:0045184)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein processing (GO:0010955)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-lysine modification (GO:0018205)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein export from nucleus (GO:0046827)|protein complex assembly (GO:0006461)|protein destabilization (GO:0031648)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of protein catabolic process (GO:0042176)|response to antibiotic (GO:0046677)|response to carbohydrate (GO:0009743)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ether (GO:0045472)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to morphine (GO:0043278)|synaptic transmission (GO:0007268)|traversing start control point of mitotic cell cycle (GO:0007089)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(8)|prostate(1)|urinary_tract(1)	19	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			GAAAGAGTTTGAAAGGGAAGA	0.388			A		"""sarcoma, glioma, colorectal, other"""																																		uc001sui.2		NA		Dom	yes		12	12q15	4193	A	Mdm2 p53 binding protein homolog			"""M, O, E, L"""			sarcoma|glioma|colorectal|other		0				lung(2)|central_nervous_system(1)	3						c.(1261-1263)GAA>CAA		mouse double minute 2 homolog isoform MDM2							117.0	109.0	112.0					12																	69233396		1861	4115	5976	SO:0001583	missense	4193				cellular response to hypoxia|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|establishment of protein localization|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mitotic cell cycle|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein complex assembly|protein destabilization|protein localization to nucleus|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to antibiotic|synaptic transmission	cytosol|endocytic vesicle membrane|insoluble fraction|nucleolus|nucleoplasm|plasma membrane|protein complex	enzyme binding|identical protein binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr12:69233396G>C		CCDS8986.2, CCDS61189.1	12q13-q14	2014-06-26	2014-06-26		ENSG00000135679	ENSG00000135679			6973	protein-coding gene	gene with protein product		164785	"""mouse double minute 2, human homolog of; p53-binding protein"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse)"", ""Mdm2 p53 binding protein homolog (mouse)"""			1614537, 16905769	Standard	NM_002392		Approved	HDM2, MGC5370	uc001sui.4	Q00987	OTTHUMG00000142827	ENST00000350057.5:c.1168G>C	12.37:g.69233396G>C	ENSP00000266624:p.Glu390Gln					MDM2_uc009zri.2_Missense_Mutation_p.E376Q|MDM2_uc009zqx.2_Missense_Mutation_p.E366Q|MDM2_uc009zqw.2_Intron|MDM2_uc001suk.2_Intron|MDM2_uc001sun.3_Missense_Mutation_p.E240Q|MDM2_uc009zqz.2_Missense_Mutation_p.E368Q|MDM2_uc009zra.2_Missense_Mutation_p.E219Q|MDM2_uc001sum.1_Missense_Mutation_p.E49Q|MDM2_uc009zrd.2_Missense_Mutation_p.E105Q|MDM2_uc009zrc.2_Missense_Mutation_p.E105Q|MDM2_uc009zre.2_Missense_Mutation_p.E162Q|MDM2_uc009zrf.2_Missense_Mutation_p.E105Q|MDM2_uc001suo.2_Missense_Mutation_p.E215Q|MDM2_uc009zrg.2_Missense_Mutation_p.E137Q|MDM2_uc009zrh.2_Missense_Mutation_p.E189Q	p.E421Q	NM_002392	NP_002383	Q00987	MDM2_HUMAN	all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)		11	1548	+	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		415			Necessary for interaction with USP2.		A6NL51|A8K2S6|Q13226|Q13297|Q13298|Q13299|Q13300|Q13301|Q53XW0|Q71TW9|Q8WYJ1|Q8WYJ2|Q9UGI3|Q9UMT8	Missense_Mutation	SNP	ENST00000350057.5	37	c.1261G>C		.	.	.	.	.	.	.	.	.	.	G	5.137	0.210971	0.09757	.	.	ENSG00000135679	ENST00000462284;ENST00000544648;ENST00000258149;ENST00000356290;ENST00000540827;ENST00000428863;ENST00000393412;ENST00000311420;ENST00000258148;ENST00000393413;ENST00000350057;ENST00000393410;ENST00000299252;ENST00000360430;ENST00000517852;ENST00000348801	T;T;T;T;T;T;T;T;T;T;T;T;T	0.46451	1.44;2.9;2.9;2.9;2.9;2.9;0.87;2.9;1.45;2.9;2.9;2.9;2.9	5.07	3.24	0.37175	.	0.926408	0.09324	N	0.817811	T	0.55000	0.1893	L	0.50333	1.59	0.09310	N	1	D;D;D;D;D;D;D;D;P;P	0.71674	0.997;0.988;0.986;0.998;0.986;0.978;0.996;0.962;0.791;0.949	D;P;P;P;P;P;D;P;B;P	0.63597	0.911;0.775;0.756;0.897;0.825;0.666;0.916;0.788;0.273;0.544	T	0.38329	-0.9666	9	.	.	.	-18.619	9.8636	0.41129	0.1597:0.0:0.8403:0.0	.	370;194;142;167;245;415;366;220;54;421	Q00987-9;Q00987-3;Q00987-4;Q9H4C5;Q00987-5;Q00987;G3XA89;Q00987-2;Q9H4C3;Q00987-11	.;.;.;.;.;MDM2_HUMAN;.;.;.;.	Q	421;370;360;245;220;194;142;376;366;142;390;167;245;220;54;189	ENSP00000417281:E421Q;ENSP00000258149:E360Q;ENSP00000348637:E245Q;ENSP00000440932:E220Q;ENSP00000410694:E194Q;ENSP00000377064:E142Q;ENSP00000258148:E366Q;ENSP00000377065:E142Q;ENSP00000266624:E390Q;ENSP00000377062:E167Q;ENSP00000299252:E245Q;ENSP00000353611:E220Q;ENSP00000335096:E189Q	.	E	+	1	0	MDM2	67519663	1.000000	0.71417	0.028000	0.17463	0.084000	0.17831	4.668000	0.61568	0.659000	0.30945	-0.140000	0.14226	GAA		0.388	MDM2-033	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000402665.1	NM_006880		15	28	0	0	0	0.00245	0	15	28				
BEST3	144453	broad.mit.edu	37	12	70072571	70072571	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr12:70072571G>T	ENST00000330891.5	-	5	810	c.584C>A	c.(583-585)gCc>gAc	p.A195D	BEST3_ENST00000476098.1_Missense_Mutation_p.A33D|BEST3_ENST00000553096.1_Missense_Mutation_p.A89D|BEST3_ENST00000331471.4_Missense_Mutation_p.A195D|BEST3_ENST00000488961.1_Missense_Mutation_p.A33D	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	195					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			TTCATTCCGGGCTTTAGTTGC	0.358																																							uc001svg.2		NA																	0					0						c.(583-585)GCC>GAC		vitelliform macular dystrophy 2-like 3 isoform							121.0	113.0	115.0					12																	70072571		1877	4109	5986	SO:0001583	missense	144453					chloride channel complex|plasma membrane	chloride channel activity	g.chr12:70072571G>T	AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.584C>A	12.37:g.70072571G>T	ENSP00000332413:p.Ala195Asp					BEST3_uc001svd.1_Missense_Mutation_p.A195D|BEST3_uc001sve.1_RNA|BEST3_uc001svf.2_Missense_Mutation_p.A33D|BEST3_uc010stm.1_Missense_Mutation_p.A89D|BEST3_uc001svh.2_Missense_Mutation_p.A33D	p.A195D	NM_032735	NP_116124	Q8N1M1	BEST3_HUMAN	Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)		5	811	-	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		195			Helical; (Potential).		B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Missense_Mutation	SNP	ENST00000330891.5	37	c.584C>A	CCDS8992.2	.	.	.	.	.	.	.	.	.	.	G	31	5.091197	0.94149	.	.	ENSG00000127325	ENST00000331471;ENST00000488961;ENST00000330891;ENST00000553096;ENST00000476098;ENST00000552295;ENST00000548658	D;D;D;D;D;D;D	0.98947	-5.26;-5.26;-5.26;-5.26;-5.26;-5.26;-5.26	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.99504	0.9823	H	0.97103	3.94	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.91635	0.995;0.998;0.999;0.988	D	0.98194	1.0464	10	0.87932	D	0	-25.6068	19.6101	0.95602	0.0:0.0:1.0:0.0	.	33;195;33;195	E9PNM2;Q8N1M1;B5MDI8;Q8N1M1-1	.;BEST3_HUMAN;.;.	D	195;33;195;89;33;89;117	ENSP00000329064:A195D;ENSP00000433213:A33D;ENSP00000332413:A195D;ENSP00000449548:A89D;ENSP00000434713:A33D;ENSP00000447689:A89D;ENSP00000446575:A117D	ENSP00000332413:A195D	A	-	2	0	BEST3	68358838	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.640000	0.89533	0.650000	0.86243	GCC		0.358	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313908.2	NM_152439		4	33	1	0	0.00909568	0.009096	0.00961102	4	33				
PLXNC1	10154	broad.mit.edu	37	12	94649046	94649046	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr12:94649046T>C	ENST00000258526.4	+	17	3310	c.3061T>C	c.(3061-3063)Ttt>Ctt	p.F1021L	PLXNC1_ENST00000547057.1_Missense_Mutation_p.F68L	NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	1021					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CTACAAACATTTTGCTCTGAG	0.403																																							uc001tdc.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(3061-3063)TTT>CTT		plexin C1 precursor							192.0	177.0	182.0					12																	94649046		2203	4300	6503	SO:0001583	missense	10154				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding	g.chr12:94649046T>C	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.3061T>C	12.37:g.94649046T>C	ENSP00000258526:p.Phe1021Leu					PLXNC1_uc010sut.1_Missense_Mutation_p.F68L	p.F1021L	NM_005761	NP_005752	O60486	PLXC1_HUMAN			17	3310	+			1021			Cytoplasmic (Potential).		Q59H25	Missense_Mutation	SNP	ENST00000258526.4	37	c.3061T>C	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.938621	0.92526	.	.	ENSG00000136040	ENST00000258526;ENST00000550080;ENST00000547057	T;T;T	0.15487	2.42;2.42;2.42	6.17	6.17	0.99709	Plexin, cytoplasmic RasGAP domain (1);	0.000000	0.85682	D	0.000000	T	0.41696	0.1170	M	0.64404	1.975	0.80722	D	1	D;D	0.76494	0.979;0.999	D;D	0.83275	0.982;0.996	T	0.16808	-1.0390	10	0.72032	D	0.01	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	68;1021	B4DHQ7;O60486	.;PLXC1_HUMAN	L	1021;68;68	ENSP00000258526:F1021L;ENSP00000447625:F68L;ENSP00000446720:F68L	ENSP00000258526:F1021L	F	+	1	0	PLXNC1	93173177	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.371000	0.80710	0.533000	0.62120	TTT		0.403	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2			5	24	0	0	0	0.000602	0	5	24				
TMEM132B	114795	broad.mit.edu	37	12	125834873	125834873	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr12:125834873G>A	ENST00000299308.3	+	2	936	c.928G>A	c.(928-930)Gac>Aac	p.D310N		NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	310						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		CTCTGTGGCAGACCAGTTCAC	0.483																																							uc001uhe.1		NA																	0				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19						c.(928-930)GAC>AAC		transmembrane protein 132B							142.0	134.0	137.0					12																	125834873		1933	4117	6050	SO:0001583	missense	114795					integral to membrane		g.chr12:125834873G>A	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.928G>A	12.37:g.125834873G>A	ENSP00000299308:p.Asp310Asn						p.D310N	NM_052907	NP_443139	Q14DG7	T132B_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)	2	936	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		310			Extracellular (Potential).		A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	37	c.928G>A	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.482816	0.63962	.	.	ENSG00000139364	ENST00000299308	T	0.14391	2.51	5.52	3.43	0.39272	.	.	.	.	.	T	0.11367	0.0277	L	0.48362	1.52	0.80722	D	1	B	0.13145	0.007	B	0.12156	0.007	T	0.09596	-1.0667	9	0.33940	T	0.23	.	6.1455	0.20283	0.08:0.1347:0.6465:0.1387	.	310	Q14DG7	T132B_HUMAN	N	310	ENSP00000299308:D310N	ENSP00000299308:D310N	D	+	1	0	TMEM132B	124400826	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.322000	0.59215	2.590000	0.87494	0.655000	0.94253	GAC		0.483	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907		17	143	0	0	0	0.004007	0	17	143				
P2RX2	22953	broad.mit.edu	37	12	133196156	133196156	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr12:133196156C>A	ENST00000389110.3	+	2	342	c.305C>A	c.(304-306)cCc>cAc	p.P102H	P2RX2_ENST00000350048.5_Missense_Mutation_p.P102H|P2RX2_ENST00000449132.2_Missense_Mutation_p.P102H|P2RX2_ENST00000348800.5_Missense_Mutation_p.P102H|P2RX2_ENST00000351222.4_Intron|P2RX2_ENST00000343948.4_Missense_Mutation_p.P102H|P2RX2_ENST00000352418.4_Silent_p.P79P	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	102					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		GTGAAGCCCCCCGAGGTgcgg	0.711																																							uc001ukj.1		NA																	0					0						c.(304-306)CCC>CAC		purinergic receptor P2X2 isoform A							35.0	35.0	35.0					12																	133196156		2202	4300	6502	SO:0001583	missense	22953				positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|protein homooligomerization	integral to membrane	ATP binding|extracellular ATP-gated cation channel activity|identical protein binding|purinergic nucleotide receptor activity	g.chr12:133196156C>A	AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.305C>A	12.37:g.133196156C>A	ENSP00000373762:p.Pro102His					P2RX2_uc001uki.1_Missense_Mutation_p.P102H|P2RX2_uc001ukk.1_Missense_Mutation_p.P102H|P2RX2_uc001ukl.1_Missense_Mutation_p.P102H|P2RX2_uc001ukm.1_Silent_p.P79P|P2RX2_uc001ukn.1_Intron|P2RX2_uc009zyt.1_Missense_Mutation_p.P102H|P2RX2_uc001uko.1_Missense_Mutation_p.P102H	p.P102H	NM_170682	NP_733782	Q9UBL9	P2RX2_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)	2	305	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)	102			Extracellular (Potential).		A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Missense_Mutation	SNP	ENST00000389110.3	37	c.305C>A	CCDS31931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.26|17.26	3.343916|3.343916	0.61073|0.61073	.|.	.|.	ENSG00000187848|ENSG00000187848	ENST00000389110;ENST00000449132;ENST00000343948;ENST00000350048;ENST00000348800|ENST00000542301;ENST00000536121;ENST00000535910	T;T;T;T;T|T;T;T	0.04406|0.04194	3.63;3.63;3.63;3.63;3.63|3.68;3.68;3.68	4.44|4.44	3.53|3.53	0.40419|0.40419	.|.	0.060953|0.060953	0.64402|0.64402	D|D	0.000002|0.000002	T|T	0.12008|0.12008	0.0292|0.0292	.|.	.|.	.|.	0.45097|0.45097	D|D	0.998114|0.998114	D;D;B;D;D;D|.	0.89917|.	1.0;0.999;0.241;1.0;1.0;1.0|.	D;D;B;D;D;D|.	0.97110|.	1.0;0.971;0.178;1.0;1.0;0.999|.	T|T	0.01743|0.01743	-1.1283|-1.1283	9|7	0.87932|0.48119	D|T	0|0.1	-20.9912|-20.9912	12.3883|12.3883	0.55345|0.55345	0.0:0.9131:0.0:0.0869|0.0:0.9131:0.0:0.0869	.|.	102;102;102;102;102;102|.	Q32MC3;Q9UBL9-7;Q9UBL9-3;Q9UBL9-4;Q9UBL9;Q9UBL9-2|.	.;.;.;.;P2RX2_HUMAN;.|.	H|T	102|113;88;58	ENSP00000373762:P102H;ENSP00000405531:P102H;ENSP00000343339:P102H;ENSP00000343904:P102H;ENSP00000345095:P102H|ENSP00000444477:P113T;ENSP00000444853:P88T;ENSP00000437646:P58T	ENSP00000343339:P102H|ENSP00000437646:P58T	P|P	+|+	2|1	0|0	P2RX2|P2RX2	131706229|131706229	0.766000|0.766000	0.28496|0.28496	0.947000|0.947000	0.38551|0.38551	0.256000|0.256000	0.26092|0.26092	4.213000|4.213000	0.58520|0.58520	2.007000|2.007000	0.58848|0.58848	0.505000|0.505000	0.49811|0.49811	CCC|CCG		0.711	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397542.1			9	48	1	0	0.00448238	0.004482	0.00480439	9	48				
NALCN	259232	broad.mit.edu	37	13	101726011	101726011	+	Silent	SNP	C	C	A	rs139869457		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr13:101726011C>A	ENST00000251127.6	-	37	4203	c.4122G>T	c.(4120-4122)tcG>tcT	p.S1374S		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1374					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CTTTTCCAGCCGAAGAAAAAT	0.353																																							uc001vox.1		NA																	0				ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(4120-4122)TCG>TCT		voltage gated channel like 1							67.0	64.0	65.0					13																	101726011		2203	4300	6503	SO:0001819	synonymous_variant	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101726011C>A	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4122G>T	13.37:g.101726011C>A							p.S1374S	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN			37	4311	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		1374			Extracellular (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Silent	SNP	ENST00000251127.6	37	c.4122G>T	CCDS9498.1																																																																																				0.353	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		6	28	1	0	0.00198382	0.001984	0.00215106	6	28				
CUL4A	8451	broad.mit.edu	37	13	113897418	113897418	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr13:113897418A>G	ENST00000375440.4	+	11	1256	c.1172A>G	c.(1171-1173)aAg>aGg	p.K391R	CUL4A_ENST00000375441.3_Missense_Mutation_p.K291R|CUL4A_ENST00000326335.4_Missense_Mutation_p.K291R|CUL4A_ENST00000451881.1_Missense_Mutation_p.K291R	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	391					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			AACCTGATGAAGGAGTCCTTT	0.443																																							uc010tjy.1		NA																	0				central_nervous_system(2)|skin(1)	3						c.(1171-1173)AAG>AGG		cullin 4A isoform 1							144.0	121.0	129.0					13																	113897418		2203	4300	6503	SO:0001583	missense	8451				cell cycle arrest|DNA repair|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	ubiquitin protein ligase binding	g.chr13:113897418A>G	U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.1172A>G	13.37:g.113897418A>G	ENSP00000364589:p.Lys391Arg					CUL4A_uc010tjx.1_Missense_Mutation_p.K291R|CUL4A_uc010agu.2_Missense_Mutation_p.K252R|CUL4A_uc010tjz.1_Missense_Mutation_p.K70R	p.K391R	NM_001008895	NP_001008895	Q13619	CUL4A_HUMAN	all cancers(43;0.112)		12	1183	+	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	391					A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Missense_Mutation	SNP	ENST00000375440.4	37	c.1172A>G	CCDS41908.1	.	.	.	.	.	.	.	.	.	.	A	16.53	3.149401	0.57151	.	.	ENSG00000139842	ENST00000375441;ENST00000451881;ENST00000326335;ENST00000375440	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	4.97	4.97	0.65823	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.68311	0.2987	L	0.28054	0.825	0.58432	D	0.999999	B;B	0.20887	0.049;0.049	B;B	0.26202	0.067;0.067	T	0.64676	-0.6351	10	0.36615	T	0.2	-41.1875	14.9611	0.71158	1.0:0.0:0.0:0.0	.	391;391	Q13619;A8MSH7	CUL4A_HUMAN;.	R	291;291;291;391	ENSP00000364590:K291R;ENSP00000389118:K291R;ENSP00000322132:K291R;ENSP00000364589:K391R	ENSP00000322132:K291R	K	+	2	0	CUL4A	112945419	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.141000	0.94612	1.982000	0.57802	0.533000	0.62120	AAG		0.443	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045888.3	NM_003589		23	43	0	0	0	0.003954	0	23	43				
POTEG	404785	broad.mit.edu	37	14	19553564	19553564	+	Missense_Mutation	SNP	G	G	C	rs369726800		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr14:19553564G>C	ENST00000409832.3	+	1	200	c.148G>C	c.(148-150)Gac>Cac	p.D50H		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	50										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						TGGAGACCACGACGATTCTGC	0.607																																							uc001vuz.1		NA																	0				ovary(1)	1						c.(148-150)GAC>CAC		POTE ankyrin domain family, member G							86.0	119.0	108.0					14																	19553564		2192	4283	6475	SO:0001583	missense	404785							g.chr14:19553564G>C		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.148G>C	14.37:g.19553564G>C	ENSP00000386971:p.Asp50His					POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA	p.D50H	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN			1	200	+			50					A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	c.148G>C	CCDS32018.1	.	.	.	.	.	.	.	.	.	.	g	8.478	0.859207	0.17178	.	.	ENSG00000222036	ENST00000409832	T	0.41400	1.0	.	.	.	.	.	.	.	.	T	0.50205	0.1602	L	0.43152	1.355	0.09310	N	1	D	0.89917	1.0	D	0.74348	0.983	T	0.35574	-0.9783	7	0.72032	D	0.01	.	.	.	.	.	50	Q6S5H5	POTEG_HUMAN	H	50	ENSP00000386971:D50H	ENSP00000386971:D50H	D	+	1	0	POTEG	18623564	0.000000	0.05858	0.013000	0.15412	0.013000	0.08279	-0.414000	0.07114	0.162000	0.19483	0.165000	0.16767	GAC		0.607	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	NM_001005356		26	392	0	0	0	0.002836	0	26	392				
LRFN5	145581	broad.mit.edu	37	14	42356189	42356189	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr14:42356189G>A	ENST00000298119.4	+	3	1550	c.361G>A	c.(361-363)Ggt>Agt	p.G121S	LRFN5_ENST00000554120.1_Missense_Mutation_p.G121S|LRFN5_ENST00000554171.1_Missense_Mutation_p.G121S	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	121						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TATGTTCAGTGGTCTTTCCAA	0.378										HNSCC(30;0.082)																													uc001wvm.2		NA																	0				ovary(5)|pancreas(2)|central_nervous_system(1)	8						c.(361-363)GGT>AGT		leucine rich repeat and fibronectin type III							79.0	77.0	77.0					14																	42356189		2203	4300	6503	SO:0001583	missense	145581					integral to membrane		g.chr14:42356189G>A	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.361G>A	14.37:g.42356189G>A	ENSP00000298119:p.Gly121Ser	HNSCC(30;0.082)				LRFN5_uc010ana.2_Missense_Mutation_p.G121S	p.G121S	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)	3	1559	+			121			Extracellular (Potential).|LRR 3.		B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	c.361G>A	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.126108	0.77549	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	D;D;D	0.91351	-2.83;-2.83;-2.83	5.56	5.56	0.83823	.	0.000000	0.56097	D	0.000023	D	0.92639	0.7661	L	0.31926	0.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92976	0.6402	10	0.54805	T	0.06	.	17.0193	0.86429	0.0:0.0:1.0:0.0	.	121;121	G3V364;Q96NI6	.;LRFN5_HUMAN	S	121	ENSP00000298119:G121S;ENSP00000451897:G121S;ENSP00000451067:G121S	ENSP00000298119:G121S	G	+	1	0	LRFN5	41425939	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.595000	0.87683	0.650000	0.86243	GGT		0.378	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447		14	73	0	0	0	0.001855	0	14	73				
DAAM1	23002	broad.mit.edu	37	14	59789744	59789744	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr14:59789744C>G	ENST00000395125.1	+	5	598	c.575C>G	c.(574-576)tCt>tGt	p.S192C	DAAM1_ENST00000351081.1_Missense_Mutation_p.S192C|DAAM1_ENST00000360909.3_Missense_Mutation_p.S192C	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	192	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		ATGAACAACTCTCAAGGCCGG	0.448																																							uc001xdz.1		NA																	0				ovary(1)	1						c.(574-576)TCT>TGT		dishevelled-associated activator of							91.0	85.0	87.0					14																	59789744		2203	4300	6503	SO:0001583	missense	23002				actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding	g.chr14:59789744C>G	AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.575C>G	14.37:g.59789744C>G	ENSP00000378557:p.Ser192Cys					DAAM1_uc001xea.1_Missense_Mutation_p.S192C|DAAM1_uc001xeb.1_Missense_Mutation_p.S192C	p.S192C	NM_014992	NP_055807	Q9Y4D1	DAAM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.165)	6	700	+			192			GBD/FH3.		Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	ENST00000395125.1	37	c.575C>G	CCDS9737.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.275930	0.80580	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000358498;ENST00000395125	D;D;D	0.90197	-2.63;-2.63;-2.63	6.16	6.16	0.99307	GTPase-binding/formin homology 3 (1);Armadillo-like helical (1);Armadillo-type fold (1);Diaphanous GTPase-binding (1);	0.000000	0.85682	D	0.000000	D	0.95859	0.8652	M	0.80847	2.515	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.995;0.997	D	0.95182	0.8300	10	0.66056	D	0.02	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	192;192	Q9Y4D1-2;Q9Y4D1	.;DAAM1_HUMAN	C	192	ENSP00000354162:S192C;ENSP00000247170:S192C;ENSP00000378557:S192C	ENSP00000247170:S192C	S	+	2	0	DAAM1	58859497	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	TCT		0.448	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992		14	56	0	0	0	0.001855	0	14	56				
RTN1	6252	broad.mit.edu	37	14	60212835	60212835	+	Silent	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr14:60212835G>T	ENST00000267484.5	-	2	941	c.606C>A	c.(604-606)ccC>ccA	p.P202P		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	202					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		TCACCTCCTCGGGTCTGGTTA	0.453																																							uc001xen.1		NA																	0				ovary(2)|central_nervous_system(2)	4						c.(604-606)CCC>CCA		reticulon 1 isoform A							246.0	240.0	242.0					14																	60212835		2203	4300	6503	SO:0001819	synonymous_variant	6252				neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity	g.chr14:60212835G>T	L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.606C>A	14.37:g.60212835G>T							p.P202P	NM_021136	NP_066959	Q16799	RTN1_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0968)	2	815	-			202					Q16800|Q16801|Q5BKZ4|Q9BQ59	Silent	SNP	ENST00000267484.5	37	c.606C>A	CCDS9740.1																																																																																				0.453	RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2			20	170	1	0	9.7654e-05	0.007413	0.000113121	20	170				
STON2	85439	broad.mit.edu	37	14	81743256	81743256	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr14:81743256T>A	ENST00000267540.2	-	4	2599	c.2399A>T	c.(2398-2400)gAc>gTc	p.D800V	STON2_ENST00000556280.1_5'Flank|STON2_ENST00000555447.1_Missense_Mutation_p.D800V	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	800	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		TGAGTTTTTGTCCGGCAGTCG	0.463																																							uc010tvu.1		NA																	0				skin(3)|pancreas(2)	5						c.(2398-2400)GAC>GTC		stonin 2							116.0	114.0	115.0					14																	81743256		2203	4300	6503	SO:0001583	missense	85439				endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding	g.chr14:81743256T>A	AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.2399A>T	14.37:g.81743256T>A	ENSP00000267540:p.Asp800Val					STON2_uc001xvk.1_Missense_Mutation_p.D800V|STON2_uc010tvt.1_Missense_Mutation_p.D597V	p.D800V	NM_033104	NP_149095	Q8WXE9	STON2_HUMAN		BRCA - Breast invasive adenocarcinoma(234;0.0348)	4	2600	-			800			MHD.		G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	ENST00000267540.2	37	c.2399A>T	CCDS9875.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.34|15.34	2.806052|2.806052	0.50421|0.50421	.|.	.|.	ENSG00000140022|ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540|ENST00000553821	T;T|.	0.20598|.	2.06;2.06|.	6.07|6.07	6.07|6.07	0.98685|0.98685	Clathrin adaptor, mu subunit, C-terminal (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70272|0.70272	0.3205|0.3205	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.999|.	T|T	0.67530|0.67530	-0.5647|-0.5647	10|5	0.87932|.	D|.	0|.	-31.9581|-31.9581	16.6288|16.6288	0.85011|0.85011	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	800;800|.	Q8WXE9;G3V2T7|.	STON2_HUMAN;.|.	V|S	800;812;800|8	ENSP00000450857:D800V;ENSP00000267540:D800V|.	ENSP00000267540:D800V|.	D|T	-|-	2|1	0|0	STON2|STON2	80813009|80813009	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.817000|0.817000	0.46193|0.46193	6.412000|6.412000	0.73303|0.73303	2.326000|2.326000	0.78906|0.78906	0.533000|0.533000	0.62120|0.62120	GAC|ACA		0.463	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1	NM_033104		47	85	0	0	0	0.00361	0	47	85				
TTC7B	145567	broad.mit.edu	37	14	91007859	91007859	+	Silent	SNP	C	C	A	rs142524402		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr14:91007859C>A	ENST00000328459.6	-	20	2506	c.2385G>T	c.(2383-2385)tcG>tcT	p.S795S	TTC7B_ENST00000554654.1_5'UTR|TTC7B_ENST00000357056.2_Silent_p.S812S	NM_001010854.1	NP_001010854.1	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	795										NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	36		Melanoma(154;0.222)				CGTGGGCTGTCGAGTTCACCT	0.637																																							uc001xyp.2		NA																	0				ovary(2)	2						c.(2383-2385)TCG>TCT		tetratricopeptide repeat domain 7B		C		4,4402	8.1+/-20.4	0,4,2199	54.0	44.0	47.0		2385	-11.4	0.0	14	dbSNP_134	47	0,8600		0,0,4300	no	coding-synonymous	TTC7B	NM_001010854.1		0,4,6499	AA,AC,CC		0.0,0.0908,0.0308		795/844	91007859	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	145567						binding	g.chr14:91007859C>A	BC035865	CCDS32140.1	14q32.12	2013-01-11	2004-06-02	2004-06-04		ENSG00000165914		"""Tetratricopeptide (TTC) repeat domain containing"""	19858	protein-coding gene	gene with protein product			"""tetratricopeptide repeat domain 7 like 1"""	TTC7L1			Standard	XM_005267367		Approved		uc001xyp.3	Q86TV6		ENST00000328459.6:c.2385G>T	14.37:g.91007859C>A						TTC7B_uc001xyo.2_Silent_p.S239S|TTC7B_uc010ats.2_RNA	p.S795S	NM_001010854	NP_001010854	Q86TV6	TTC7B_HUMAN			20	2507	-		Melanoma(154;0.222)	795			TPR 10.		Q86U24|Q86VT3	Silent	SNP	ENST00000328459.6	37	c.2385G>T	CCDS32140.1	.	.	.	.	.	.	.	.	.	.	C	10.02	1.235372	0.22626	9.08E-4	0.0	ENSG00000165914	ENST00000555894;ENST00000557292	.	.	.	5.72	-11.4	0.00090	.	.	.	.	.	T	0.58293	0.2112	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73388	-0.3998	4	.	.	.	-5.3761	15.1967	0.73096	0.12:0.0843:0.6901:0.1056	.	.	.	.	Y	137;223	.	.	D	-	1	0	TTC7B	90077612	0.000000	0.05858	0.018000	0.16275	0.976000	0.68499	-2.426000	0.01027	-2.814000	0.00346	0.462000	0.41574	GAC		0.637	TTC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411364.2			13	22	1	0	9.31168e-06	0.001855	1.15391e-05	13	22				
ARHGAP11A	9824	broad.mit.edu	37	15	32928865	32928865	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr15:32928865G>T	ENST00000361627.3	+	12	2613	c.1891G>T	c.(1891-1893)Gaa>Taa	p.E631*	ARHGAP11A_ENST00000543522.1_Nonsense_Mutation_p.E442*|ARHGAP11A_ENST00000565905.1_Nonsense_Mutation_p.E442*	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	631					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		AAAATTAACTGAACCATCTTA	0.343																																					Colon(45;757 1134 30003 36652)	Colon(45;757 1134 30003 36652)	uc001zgy.1		NA																	0				skin(3)|breast(2)|urinary_tract(1)	6						c.(1891-1893)GAA>TAA		Rho GTPase activating protein 11A isoform 1							47.0	49.0	48.0					15																	32928865		2201	4300	6501	SO:0001587	stop_gained	9824				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr15:32928865G>T	D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.1891G>T	15.37:g.32928865G>T	ENSP00000355090:p.Glu631*					ARHGAP11A_uc010ubw.1_Nonsense_Mutation_p.E442*|ARHGAP11A_uc010ubx.1_Nonsense_Mutation_p.E442*	p.E631*	NM_014783	NP_055598	Q6P4F7	RHGBA_HUMAN		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	12	2613	+		all_lung(180;1.3e-11)	631					B4DZN9|Q6PI96|Q9Y3S6	Nonsense_Mutation	SNP	ENST00000361627.3	37	c.1891G>T	CCDS10028.1	.	.	.	.	.	.	.	.	.	.	.	39	7.769755	0.98480	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	.	.	.	4.68	3.76	0.43208	.	0.000000	0.53938	D	0.000047	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	10.1497	0.42784	0.1624:0.0:0.8376:0.0	.	.	.	.	X	631;442	.	ENSP00000355090:E631X	E	+	1	0	ARHGAP11A	30716157	0.998000	0.40836	0.041000	0.18516	0.005000	0.04900	3.500000	0.53318	1.174000	0.42811	0.557000	0.71058	GAA		0.343	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251417.1	NM_014783		15	23	1	0	1.05317e-09	0.00245	1.488e-09	15	23				
ACTC1	70	broad.mit.edu	37	15	35084623	35084623	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr15:35084623G>T	ENST00000290378.4	-	4	1257	c.602C>A	c.(601-603)tCc>tAc	p.S201Y	RP11-814P5.1_ENST00000558707.1_RNA|RP11-814P5.1_ENST00000503496.1_RNA|ACTC1_ENST00000557860.1_5'UTR	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	201					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		GGTGACAAAGGAGTAGCCACG	0.537																																							uc001ziu.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(601-603)TCC>TAC		cardiac muscle alpha actin 1 proprotein							111.0	98.0	102.0					15																	35084623		2201	4298	6499	SO:0001583	missense	70				apoptosis|cardiac muscle tissue morphogenesis|cardiac myofibril assembly|muscle filament sliding|skeletal muscle thin filament assembly	actomyosin, actin part|cytosol|I band	ATP binding|ATPase activity|myosin binding	g.chr15:35084623G>T	BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.602C>A	15.37:g.35084623G>T	ENSP00000290378:p.Ser201Tyr					uc001zit.1_Intron	p.S201Y	NM_005159	NP_005150	P68032	ACTC_HUMAN		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)	4	845	-		all_lung(180;2.3e-08)	201					P04270	Missense_Mutation	SNP	ENST00000290378.4	37	c.602C>A	CCDS10041.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.044478	0.75732	.	.	ENSG00000159251	ENST00000290378;ENST00000544062	D	0.95690	-3.78	5.08	5.08	0.68730	.	0.000000	0.53938	U	0.000058	D	0.97901	0.9310	M	0.83223	2.63	0.80722	D	1	P	0.47545	0.897	D	0.72075	0.976	D	0.98331	1.0533	10	0.87932	D	0	.	19.0331	0.92965	0.0:0.0:1.0:0.0	.	201	P68032	ACTC_HUMAN	Y	201;166	ENSP00000290378:S201Y	ENSP00000290378:S201Y	S	-	2	0	ACTC1	32871915	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.263000	0.95617	2.802000	0.96397	0.655000	0.94253	TCC		0.537	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251876.3	NM_005159		14	58	1	0	1.49906e-05	0.00245	1.80954e-05	14	58				
HERC1	8925	broad.mit.edu	37	15	63991040	63991040	+	Missense_Mutation	SNP	A	A	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr15:63991040A>C	ENST00000443617.2	-	26	4879	c.4792T>G	c.(4792-4794)Ttt>Gtt	p.F1598V	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	1598					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CCACTCACAAAGCTTACAACA	0.443																																							uc002amp.2		NA																	0				ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						c.(4792-4794)TTT>GTT		hect domain and RCC1-like domain 1							79.0	76.0	77.0					15																	63991040		1864	4098	5962	SO:0001583	missense	8925				protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity	g.chr15:63991040A>C	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.4792T>G	15.37:g.63991040A>C	ENSP00000390158:p.Phe1598Val					HERC1_uc010uil.1_Missense_Mutation_p.F582V	p.F1598V	NM_003922	NP_003913	Q15751	HERC1_HUMAN			26	4940	-			1598					Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	c.4792T>G	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	A	18.45	3.626813	0.66901	.	.	ENSG00000103657	ENST00000443617;ENST00000425434	T	0.42900	0.96	5.45	5.45	0.79879	.	0.070418	0.56097	U	0.000028	T	0.34250	0.0891	L	0.29908	0.895	0.58432	D	0.999999	P;B	0.40731	0.728;0.281	B;B	0.37888	0.26;0.081	T	0.28681	-1.0036	10	0.87932	D	0	.	15.5161	0.75826	1.0:0.0:0.0:0.0	.	582;1598	B4DKS2;Q15751	.;HERC1_HUMAN	V	1598;582	ENSP00000390158:F1598V	ENSP00000389613:F582V	F	-	1	0	HERC1	61778093	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	8.799000	0.91895	2.062000	0.61559	0.482000	0.46254	TTT		0.443	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922		14	30	0	0	0	0.001855	0	14	30				
ACSBG1	23205	broad.mit.edu	37	15	78474319	78474319	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr15:78474319C>A	ENST00000258873.4	-	8	1268	c.1063G>T	c.(1063-1065)Gcc>Tcc	p.A355S	ACSBG1_ENST00000541759.1_Missense_Mutation_p.A113S|ACSBG1_ENST00000560817.1_Missense_Mutation_p.A113S	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	355					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						ACCTTCAGGGCGTCGGGTTCG	0.612																																							uc002bdh.2		NA																	0				ovary(1)	1						c.(1063-1065)GCC>TCC		lipidosin							92.0	72.0	79.0					15																	78474319		2196	4293	6489	SO:0001583	missense	23205				long-chain fatty acid metabolic process|myelination|very long-chain fatty acid metabolic process	cytoplasmic membrane-bounded vesicle|endoplasmic reticulum|microsome	ATP binding|long-chain fatty acid-CoA ligase activity|very long-chain fatty acid-CoA ligase activity	g.chr15:78474319C>A	AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.1063G>T	15.37:g.78474319C>A	ENSP00000258873:p.Ala355Ser					ACSBG1_uc010umw.1_Missense_Mutation_p.A351S|ACSBG1_uc010umx.1_Missense_Mutation_p.A113S|ACSBG1_uc010umy.1_Missense_Mutation_p.A248S	p.A355S	NM_015162	NP_055977	Q96GR2	ACBG1_HUMAN			8	1119	-			355					B2RB61|O75126|Q76N27|Q9HC26	Missense_Mutation	SNP	ENST00000258873.4	37	c.1063G>T	CCDS10298.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.339075	0.81911	.	.	ENSG00000103740	ENST00000258873;ENST00000541759	T;T	0.10860	2.83;2.83	5.14	5.14	0.70334	AMP-dependent synthetase/ligase (1);	0.062472	0.64402	D	0.000007	T	0.29749	0.0743	M	0.85630	2.765	0.58432	D	0.999994	P;P	0.39131	0.627;0.661	P;P	0.48030	0.46;0.564	T	0.03619	-1.1019	10	0.51188	T	0.08	-29.3765	18.0423	0.89322	0.0:1.0:0.0:0.0	.	351;355	B7Z2Y6;Q96GR2	.;ACBG1_HUMAN	S	355;113	ENSP00000258873:A355S;ENSP00000439955:A113S	ENSP00000258873:A355S	A	-	1	0	ACSBG1	76261374	1.000000	0.71417	0.947000	0.38551	0.911000	0.54048	7.694000	0.84235	2.571000	0.86741	0.650000	0.86243	GCC		0.612	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289802.2	NM_015162		8	38	1	0	0.00448238	0.004482	0.00480439	8	38				
SLC28A1	9154	broad.mit.edu	37	15	85488008	85488008	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr15:85488008G>A	ENST00000286749.3	+	17	1874	c.1784G>A	c.(1783-1785)gGg>gAg	p.G595E	SLC28A1_ENST00000394573.1_Missense_Mutation_p.G595E|SLC28A1_ENST00000537216.1_Intron|SLC28A1_ENST00000537624.1_Missense_Mutation_p.G595E|SLC28A1_ENST00000538177.1_Missense_Mutation_p.G429E			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	595					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)	p.G595V(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	ATGCCCAGGGGGGCTGAAGTT	0.602																																							uc002blg.2		NA																	1	Substitution - Missense(1)		lung(1)	skin(2)|ovary(1)	3						c.(1783-1785)GGG>GAG		solute carrier family 28, member 1 isoform 1							91.0	90.0	90.0					15																	85488008		2203	4299	6502	SO:0001583	missense	9154				nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding	g.chr15:85488008G>A	U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.1784G>A	15.37:g.85488008G>A	ENSP00000286749:p.Gly595Glu					SLC28A1_uc010bnb.2_Missense_Mutation_p.G595E|SLC28A1_uc010upe.1_Missense_Mutation_p.G429E|SLC28A1_uc010upf.1_Missense_Mutation_p.G595E|SLC28A1_uc010upg.1_Intron	p.G595E	NM_004213	NP_004204	O00337	S28A1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		18	1986	+			595					A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Missense_Mutation	SNP	ENST00000286749.3	37	c.1784G>A	CCDS10334.1	.	.	.	.	.	.	.	.	.	.	G	10.38	1.334244	0.24253	.	.	ENSG00000156222	ENST00000538177;ENST00000537624;ENST00000286749;ENST00000394573	T;T;T;T	0.02552	4.25;4.75;4.74;4.74	4.72	-3.14	0.05250	.	0.546001	0.16722	N	0.202229	T	0.02494	0.0076	M	0.70595	2.14	0.54753	D	0.999985	B;B;B	0.14012	0.009;0.001;0.006	B;B;B	0.21151	0.02;0.002;0.033	T	0.47045	-0.9147	10	0.07644	T	0.81	-15.4721	0.6126	0.00764	0.3775:0.124:0.2473:0.2513	.	595;429;595	F5H560;B7Z3L6;O00337	.;.;S28A1_HUMAN	E	429;595;595;595	ENSP00000443752:G429E;ENSP00000444700:G595E;ENSP00000286749:G595E;ENSP00000378074:G595E	ENSP00000286749:G595E	G	+	2	0	SLC28A1	83289012	0.001000	0.12720	0.118000	0.21660	0.047000	0.14425	-0.346000	0.07760	-0.410000	0.07542	-0.310000	0.09108	GGG		0.602	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308998.2			18	71	0	0	0	0.00278	0	18	71				
LRRK1	79705	broad.mit.edu	37	15	101550913	101550913	+	Silent	SNP	A	A	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr15:101550913A>G	ENST00000388948.3	+	9	1511	c.1152A>G	c.(1150-1152)gaA>gaG	p.E384E	LRRK1_ENST00000284395.5_Silent_p.E381E	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AGCTACAGGAACTTGATATAT	0.378																																							uc002bwr.2		NA																	0				ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12						c.(1150-1152)GAA>GAG		leucine-rich repeat kinase 1							105.0	105.0	105.0					15																	101550913		1831	4072	5903	SO:0001819	synonymous_variant	79705				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	g.chr15:101550913A>G	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.1152A>G	15.37:g.101550913A>G						LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA	p.E384E	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)		9	1471	+	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		384			LRR 5.			Silent	SNP	ENST00000388948.3	37	c.1152A>G	CCDS42086.1																																																																																				0.378	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652		4	41	0	0	0	0.009096	0	4	41				
PKD1	5310	broad.mit.edu	37	16	2164249	2164249	+	Silent	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr16:2164249C>A	ENST00000262304.4	-	11	2983	c.2775G>T	c.(2773-2775)cgG>cgT	p.R925R	RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Silent_p.R925R	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	925	PKD 3. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CCGCCGTCACCCGCAGGCTGA	0.682																																							uc002cos.1		NA																	0				central_nervous_system(2)|skin(1)	3						c.(2773-2775)CGG>CGT		polycystin 1 isoform 1 precursor							15.0	14.0	14.0					16																	2164249		2172	4254	6426	SO:0001819	synonymous_variant	5310				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding	g.chr16:2164249C>A	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.2775G>T	16.37:g.2164249C>A						PKD1_uc002cot.1_Silent_p.R925R	p.R925R	NM_001009944	NP_001009944	P98161	PKD1_HUMAN			11	2984	-			925			Extracellular (Potential).|PKD 3.		Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	c.2775G>T	CCDS32369.1																																																																																				0.682	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1			5	45	1	0	1.23904e-05	0.000602	1.51528e-05	5	45				
ABCA3	21	broad.mit.edu	37	16	2328346	2328346	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr16:2328346C>A	ENST00000301732.5	-	30	5361	c.4661G>T	c.(4660-4662)tGg>tTg	p.W1554L	ABCA3_ENST00000382381.3_Missense_Mutation_p.W1496L	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	1554	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CACGGTGTCCCAAAGCAGGCG	0.642																																							uc002cpy.1		NA																	0				breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16	GRCh37	CM074654	ABCA3	M		c.(4660-4662)TGG>TTG		ATP-binding cassette, sub-family A member 3							54.0	56.0	56.0					16																	2328346		2198	4300	6498	SO:0001583	missense	21				response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:2328346C>A	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.4661G>T	16.37:g.2328346C>A	ENSP00000301732:p.Trp1554Leu					ABCA3_uc010bsk.1_Missense_Mutation_p.W1496L	p.W1554L	NM_001089	NP_001080	Q99758	ABCA3_HUMAN			30	5373	-		Ovarian(90;0.17)	1554			ABC transporter 2.		B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	ENST00000301732.5	37	c.4661G>T	CCDS10466.1	.	.	.	.	.	.	.	.	.	.	C	19.67	3.870997	0.72065	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.97455	-4.39	5.41	5.41	0.78517	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.060757	0.64402	D	0.000001	D	0.97826	0.9286	L	0.49350	1.555	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	D	0.98753	1.0721	10	0.87932	D	0	.	18.1356	0.89618	0.0:1.0:0.0:0.0	.	1558;1554	Q4LE27;Q99758	.;ABCA3_HUMAN	L	1554;1558	ENSP00000301732:W1554L	ENSP00000301732:W1554L	W	-	2	0	ABCA3	2268347	1.000000	0.71417	1.000000	0.80357	0.009000	0.06853	7.640000	0.83355	2.691000	0.91804	0.561000	0.74099	TGG		0.642	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089		28	95	1	0	3.65163e-15	0.00632	6.13539e-15	28	95				
AMDHD2	51005	broad.mit.edu	37	16	2578487	2578487	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr16:2578487G>T	ENST00000293971.6	+	8	991	c.897G>T	c.(895-897)ttG>ttT	p.L299F	AMDHD2_ENST00000413459.3_Missense_Mutation_p.L299F|AMDHD2_ENST00000565570.1_Intron|AMDHD2_ENST00000302956.4_Missense_Mutation_p.L299F|CEMP1_ENST00000382350.1_Intron	NM_015944.3	NP_057028.2	Q9Y303	NAGA_HUMAN	amidohydrolase domain containing 2	299					carbohydrate metabolic process (GO:0005975)|N-acetylglucosamine metabolic process (GO:0006044)|N-acetylneuraminate catabolic process (GO:0019262)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-phosphate deacetylase activity (GO:0008448)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(3)|skin(2)|urinary_tract(2)	19						TCCCTGCCTTGGGCCTGGGCA	0.667																																							uc002cqq.2		NA																	0				skin(2)|large_intestine(1)|breast(1)	4						c.(895-897)TTG>TTT		amidohydrolase domain containing 2 isoform 1							37.0	34.0	35.0					16																	2578487		2197	4299	6496	SO:0001583	missense	51005				N-acetylglucosamine metabolic process		N-acetylglucosamine-6-phosphate deacetylase activity	g.chr16:2578487G>T	AF132948	CCDS10471.1, CCDS53984.1	16p13.3	2008-02-05			ENSG00000162066	ENSG00000162066			24262	protein-coding gene	gene with protein product						10810093	Standard	NM_001145815		Approved	CGI-14	uc010uwc.2	Q9Y303	OTTHUMG00000128866	ENST00000293971.6:c.897G>T	16.37:g.2578487G>T	ENSP00000293971:p.Leu299Phe					AMDHD2_uc002cqp.2_Missense_Mutation_p.L299F|AMDHD2_uc010uwc.1_Missense_Mutation_p.L299F|AMDHD2_uc010uwd.1_Missense_Mutation_p.L63F	p.L299F	NM_015944	NP_057028	Q9Y303	NAGA_HUMAN			8	994	+			299					B4DL77|Q8WV54	Missense_Mutation	SNP	ENST00000293971.6	37	c.897G>T		.	.	.	.	.	.	.	.	.	.	G	19.07	3.755349	0.69648	.	.	ENSG00000162066	ENST00000413459;ENST00000302956;ENST00000293971	D;D;T	0.99933	-8.25;-8.25;0.98	5.51	4.51	0.55191	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.044855	0.85682	D	0.000000	D	0.99799	0.9914	M	0.75884	2.315	0.80722	D	1	P;B;B	0.46277	0.875;0.051;0.154	P;B;B	0.45794	0.493;0.158;0.098	D	0.99985	1.3118	10	0.09843	T	0.71	-26.5285	14.4242	0.67204	0.0:0.0:0.8521:0.1479	.	299;299;299	Q9Y303-3;Q9Y303;Q9Y303-2	.;NAGA_HUMAN;.	F	299	ENSP00000391596:L299F;ENSP00000307481:L299F;ENSP00000293971:L299F	ENSP00000293971:L299F	L	+	3	2	AMDHD2	2518488	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.942000	0.56614	2.582000	0.87167	0.655000	0.94253	TTG		0.667	AMDHD2-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000435652.1	NM_015944		6	43	1	0	0.00116845	0.001168	0.00127809	6	43				
MYH11	4629	broad.mit.edu	37	16	15808797	15808797	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr16:15808797G>C	ENST00000300036.5	-	40	5864	c.5755C>G	c.(5755-5757)Cgc>Ggc	p.R1919G	NDE1_ENST00000396355.1_Intron|MYH11_ENST00000396324.3_Missense_Mutation_p.R1926G|MYH11_ENST00000576790.2_Missense_Mutation_p.R1919G|MYH11_ENST00000452625.2_Missense_Mutation_p.R1926G|NDE1_ENST00000342673.5_Intron|NDE1_ENST00000396354.1_Intron	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1919					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						TTCACCTCGCGGCCCATGGCC	0.672			T	CBFB	AML																																		uc002ddy.2		NA		Dom	yes		16	16p13.13-p13.12	4629	T	"""myosin, heavy polypeptide 11, smooth muscle"""			L	CBFB		AML		0				ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						c.(5755-5757)CGC>GGC		smooth muscle myosin heavy chain 11 isoform							118.0	116.0	117.0					16																	15808797		2197	4300	6497	SO:0001583	missense	4629				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr16:15808797G>C	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.5755C>G	16.37:g.15808797G>C	ENSP00000300036:p.Arg1919Gly					MYH11_uc002ddv.2_Missense_Mutation_p.R1926G|MYH11_uc002ddw.2_Missense_Mutation_p.R1919G|MYH11_uc002ddx.2_Missense_Mutation_p.R1926G|MYH11_uc010bvg.2_Missense_Mutation_p.R1751G|NDE1_uc010uzy.1_Intron|NDE1_uc002dds.2_Intron|MYH11_uc010bvh.2_Missense_Mutation_p.R625G	p.R1919G	NM_002474	NP_002465	P35749	MYH11_HUMAN			40	5862	-			1919			Potential.		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	c.5755C>G	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.757028	0.69648	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27	4.76	4.76	0.60689	Myosin tail (1);	0.000000	0.85682	D	0.000000	D	0.84696	0.5529	L	0.59967	1.855	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.997;0.999	D	0.85882	0.1423	10	0.72032	D	0.01	.	11.9407	0.52899	0.0:0.0:0.8263:0.1736	.	1926;1919;1926;1919;1926	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	G	1919;1919;1926;1926;1926	ENSP00000300036:R1919G;ENSP00000345136:R1919G;ENSP00000379616:R1926G;ENSP00000407821:R1926G	ENSP00000300036:R1919G	R	-	1	0	MYH11	15716298	1.000000	0.71417	0.998000	0.56505	0.963000	0.63663	3.704000	0.54815	2.177000	0.69029	0.455000	0.32223	CGC		0.672	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113		101	101	0	0	0	0.00361	0	101	101				
ITPRIPL2	162073	broad.mit.edu	37	16	19126972	19126972	+	Nonsense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr16:19126972C>T	ENST00000381440.3	+	1	1719	c.1189C>T	c.(1189-1191)Cag>Tag	p.Q397*	CTD-2349B8.1_ENST00000564808.2_Intron	NM_001034841.3	NP_001030013.1	Q3MIP1	IPIL2_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 2	397						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						GGCCGCCACCCAGTGGGGACG	0.657																																							uc002dfu.3		NA																	0				skin(2)	2						c.(1189-1191)CAG>TAG		inositol 1,4,5-triphosphate receptor interacting							67.0	79.0	75.0					16																	19126972		2196	4297	6493	SO:0001587	stop_gained	162073					integral to membrane		g.chr16:19126972C>T		CCDS32395.1	16p12.3	2011-04-28	2011-04-28		ENSG00000205730	ENSG00000205730			27257	protein-coding gene	gene with protein product			"""inositol 1,4,5-triphosphate receptor interacting protein-like 2"""				Standard	NM_001034841		Approved	FLJ22994, MGC126798, MGC126800, LOC162073	uc002dfu.4	Q3MIP1		ENST00000381440.3:c.1189C>T	16.37:g.19126972C>T	ENSP00000370849:p.Gln397*					ITPRIPL2_uc002dft.2_Nonsense_Mutation_p.Q93*	p.Q397*	NM_001034841	NP_001030013	Q3MIP1	IPIL2_HUMAN			1	1719	+			397			Cytoplasmic (Potential).			Nonsense_Mutation	SNP	ENST00000381440.3	37	c.1189C>T	CCDS32395.1	.	.	.	.	.	.	.	.	.	.	C	43	9.928876	0.99298	.	.	ENSG00000205730	ENST00000381440	.	.	.	5.27	5.27	0.74061	.	0.325999	0.20721	U	0.086905	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-8.1991	18.8869	0.92381	0.0:1.0:0.0:0.0	.	.	.	.	X	397	.	ENSP00000370849:Q397X	Q	+	1	0	ITPRIPL2	19034473	0.995000	0.38212	0.996000	0.52242	0.977000	0.68977	3.225000	0.51246	2.449000	0.82847	0.655000	0.94253	CAG		0.657	ITPRIPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435827.3	NM_001034841		56	208	0	0	0	0.00361	0	56	208				
ABCC12	94160	broad.mit.edu	37	16	48142350	48142350	+	Splice_Site	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr16:48142350C>T	ENST00000311303.3	-	17	2717		c.e17+1		ABCC12_ENST00000416054.1_Splice_Site|ABCC12_ENST00000448542.1_Splice_Site	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12							integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				TTATACTGAACCTCCAGAAGC	0.388																																							uc002efc.1		NA																	0				ovary(2)|skin(1)	3						c.e17+1		ATP-binding cassette protein C12							80.0	77.0	78.0					16																	48142350		2201	4300	6501	SO:0001630	splice_region_variant	94160					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:48142350C>T	AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.2371+1G>A	16.37:g.48142350C>T						ABCC12_uc002eey.1_Splice_Site|ABCC12_uc002eez.1_Splice_Site|ABCC12_uc002efa.1_Splice_Site|ABCC12_uc002efb.1_Splice_Site|ABCC12_uc002efd.1_Splice_Site	p.G791_splice	NM_033226	NP_150229	Q96J65	MRP9_HUMAN			17	2717	-		all_cancers(37;0.0474)|all_lung(18;0.047)						Q49AL2|Q8TAF0|Q8TEY2	Splice_Site	SNP	ENST00000311303.3	37	c.2371_splice	CCDS10730.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.104254	0.76983	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.812	0.88619	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ABCC12	46699851	1.000000	0.71417	0.997000	0.53966	0.878000	0.50629	4.283000	0.58977	2.506000	0.84524	0.563000	0.77884	.		0.388	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226	Intron	13	35	0	0	0	0.001368	0	13	35				
WSCD1	23302	broad.mit.edu	37	17	6012984	6012984	+	Missense_Mutation	SNP	C	C	G	rs146993898		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr17:6012984C>G	ENST00000574946.1	+	6	1297	c.907C>G	c.(907-909)Cgg>Ggg	p.R303G	WSCD1_ENST00000539421.1_Missense_Mutation_p.R303G|WSCD1_ENST00000574232.1_Missense_Mutation_p.R303G|WSCD1_ENST00000317744.5_Missense_Mutation_p.R303G|WSCD1_ENST00000573634.1_Missense_Mutation_p.R187G			Q658N2	WSCD1_HUMAN	WSC domain containing 1	303	WSC 2. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						CCCTACCCCCCGGTTCAACCT	0.562																																							uc010cli.2		NA																	0					0						c.(907-909)CGG>GGG		WSC domain containing 1							194.0	179.0	184.0					17																	6012984		2203	4300	6503	SO:0001583	missense	23302					integral to membrane	sulfotransferase activity	g.chr17:6012984C>G		CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.907C>G	17.37:g.6012984C>G	ENSP00000460825:p.Arg303Gly					WSCD1_uc002gcn.2_Missense_Mutation_p.R303G|WSCD1_uc002gco.2_Missense_Mutation_p.R303G|WSCD1_uc010clj.2_5'UTR	p.R303G	NM_015253	NP_056068	Q658N2	WSCD1_HUMAN			6	1286	+			303			WSC 2.		A8K0N8|D3DTM3|O60276|Q96G45	Missense_Mutation	SNP	ENST00000574946.1	37	c.907C>G	CCDS32538.1	.	.	.	.	.	.	.	.	.	.	C	11.07	1.531057	0.27387	.	.	ENSG00000179314	ENST00000317744;ENST00000539421	T;T	0.54866	0.55;0.55	5.64	3.39	0.38822	Carbohydrate-binding WSC (2);Carbohydrate-binding WSC, subgroup (1);	0.454260	0.24688	N	0.036419	T	0.37999	0.1024	L	0.27053	0.805	0.21256	N	0.999746	B	0.21606	0.058	B	0.26202	0.067	T	0.20174	-1.0283	10	0.21014	T	0.42	-30.6289	11.5364	0.50639	0.1456:0.7273:0.1271:0.0	.	303	Q658N2	WSCD1_HUMAN	G	303	ENSP00000323087:R303G;ENSP00000446032:R303G	ENSP00000323087:R303G	R	+	1	2	WSCD1	5953708	0.982000	0.34865	1.000000	0.80357	0.917000	0.54804	4.385000	0.59613	1.311000	0.45024	0.557000	0.71058	CGG		0.562	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438965.4	NM_015253		37	191	0	0	0	0.004878	0	37	191				
DNAH2	146754	broad.mit.edu	37	17	7721353	7721353	+	Silent	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr17:7721353C>T	ENST00000572933.1	+	68	11786	c.10326C>T	c.(10324-10326)aaC>aaT	p.N3442N	DNAH2_ENST00000389173.2_Silent_p.N3442N			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3442	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TACTTCAGAACGTGCAGGAAT	0.522																																							uc002giu.1		NA																	0				ovary(6)|skin(6)|central_nervous_system(1)	13						c.(10324-10326)AAC>AAT		dynein heavy chain domain 3							134.0	119.0	124.0					17																	7721353		2203	4300	6503	SO:0001819	synonymous_variant	146754				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:7721353C>T	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.10326C>T	17.37:g.7721353C>T						DNAH2_uc010cnm.1_Silent_p.N380N	p.N3442N	NM_020877	NP_065928	Q9P225	DYH2_HUMAN			67	10340	+		all_cancers(10;4.66e-07)|Prostate(122;0.081)	3442			AAA 5 (By similarity).		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	37	c.10326C>T	CCDS32551.1																																																																																				0.522	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877		15	113	0	0	0	0.003163	0	15	113				
CCL7	6354	broad.mit.edu	37	17	32598209	32598209	+	Missense_Mutation	SNP	A	A	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr17:32598209A>C	ENST00000378569.2	+	2	191	c.121A>C	c.(121-123)Aag>Cag	p.K41Q	CCL7_ENST00000394627.1_Silent_p.I58I|CCL7_ENST00000394630.3_Intron|CCL7_ENST00000200307.4_Missense_Mutation_p.K51Q	NM_006273.2	NP_006264.2	P80098	CCL7_HUMAN	chemokine (C-C motif) ligand 7	41					cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|cellular response to ethanol (GO:0071361)|chemotaxis (GO:0006935)|cytoskeleton organization (GO:0007010)|eosinophil chemotaxis (GO:0048245)|immune response (GO:0006955)|inflammatory response (GO:0006954)|monocyte chemotaxis (GO:0002548)|positive regulation of cell migration (GO:0030335)|positive regulation of natural killer cell chemotaxis (GO:2000503)|regulation of cell shape (GO:0008360)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR1 chemokine receptor binding (GO:0031726)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)			autonomic_ganglia(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	Breast(3;0.00224)	Breast(31;0.151)|Ovarian(249;0.17)		BRCA - Breast invasive adenocarcinoma(366;0.155)		ATTTATCAATAAGAAAATCCC	0.473																																							uc002hhz.2		NA																	0				ovary(1)	1						c.(121-123)AAG>CAG		chemokine (C-C motif) ligand 7 precursor							88.0	89.0	89.0					17																	32598209		2203	4300	6503	SO:0001583	missense	6354				cell-cell signaling|cellular calcium ion homeostasis|chemotaxis|immune response|inflammatory response|signal transduction	extracellular space	chemokine activity|heparin binding	g.chr17:32598209A>C	AF043338	CCDS11278.1	17q11.2-q12	2013-02-25	2002-08-22	2002-08-23	ENSG00000108688	ENSG00000108688		"""Chemokine ligands"", ""Endogenous ligands"""	10634	protein-coding gene	gene with protein product	"""monocyte chemoattractant protein 3"", ""monocyte chemotactic protein 3"""	158106	"""small inducible cytokine A7 (monocyte chemotactic protein 3)"""	SCYA6, SCYA7		8461011	Standard	NM_006273		Approved	MCP-3, NC28, FIC, MARC, MCP3	uc002hhz.4	P80098	OTTHUMG00000132889	ENST00000378569.2:c.121A>C	17.37:g.32598209A>C	ENSP00000367832:p.Lys41Gln					CCL7_uc010ctf.2_Intron	p.K41Q	NM_006273	NP_006264	P80098	CCL7_HUMAN		BRCA - Breast invasive adenocarcinoma(366;0.155)	2	191	+	Breast(3;0.00224)	Breast(31;0.151)|Ovarian(249;0.17)	41					Q569J6	Missense_Mutation	SNP	ENST00000378569.2	37	c.121A>C	CCDS11278.1	.	.	.	.	.	.	.	.	.	.	A	13.05	2.120947	0.37436	.	.	ENSG00000108688	ENST00000378569;ENST00000200307	.	.	.	4.28	0.415	0.16411	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.955865	0.08621	N	0.918473	T	0.41880	0.1178	.	.	.	0.09310	N	1	P	0.42456	0.78	P	0.46917	0.531	T	0.35895	-0.9770	8	0.39692	T	0.17	.	9.7601	0.40526	0.4604:0.5396:0.0:0.0	.	41	P80098	CCL7_HUMAN	Q	51;41	.	ENSP00000200307:K41Q	K	+	1	0	CCL7	29622322	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.043000	0.13971	-0.049000	0.13379	0.533000	0.62120	AAG		0.473	CCL7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256386.2	NM_006273		32	50	0	0	0	0.008361	0	32	50				
THRA	7067	broad.mit.edu	37	17	38240933	38240933	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr17:38240933G>T	ENST00000264637.4	+	6	1021	c.441G>T	c.(439-441)aaG>aaT	p.K147N	THRA_ENST00000394121.4_Missense_Mutation_p.K147N|THRA_ENST00000546243.1_Missense_Mutation_p.K147N|THRA_ENST00000450525.2_Missense_Mutation_p.K147N|THRA_ENST00000584985.1_Missense_Mutation_p.K147N	NM_003250.5	NP_003241.2	P10827	THA_HUMAN	thyroid hormone receptor, alpha	147					cartilage condensation (GO:0001502)|cytoplasmic sequestering of transcription factor (GO:0042994)|erythrocyte differentiation (GO:0030218)|female courtship behavior (GO:0008050)|gene expression (GO:0010467)|hormone-mediated signaling pathway (GO:0009755)|learning or memory (GO:0007611)|negative regulation of DNA-templated transcription, initiation (GO:2000143)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of female receptivity (GO:0045925)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|regulation of lipid catabolic process (GO:0050994)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cold (GO:0009409)|thyroid gland development (GO:0030878)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Type I pneumocyte differentiation (GO:0060509)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|steroid receptor RNA activator RNA binding (GO:0002153)|TBP-class protein binding (GO:0017025)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)	11	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GGCGGCGGAAGGAGGAGATGA	0.587																																							uc002htw.2		NA																	0					0						c.(439-441)AAG>AAT		thyroid hormone receptor, alpha isoform 2	Levothyroxine(DB00451)|Liothyronine(DB00279)						131.0	119.0	123.0					17																	38240933		2203	4300	6503	SO:0001583	missense	7067				negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|negative regulation of transcription initiation, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription from RNA polymerase II promoter	cytosol|nucleoplasm	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|TBP-class protein binding|thyroid hormone binding|thyroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding	g.chr17:38240933G>T	J03239	CCDS11360.1, CCDS42316.1, CCDS58546.1	17q21.1	2013-01-16	2011-05-19		ENSG00000126351	ENSG00000126351		"""Nuclear hormone receptors"""	11796	protein-coding gene	gene with protein product		190120	"""thyroid hormone receptor, alpha (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog)"", ""thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)"""	THRA1, THRA2, ERBA1		6323162, 6589608	Standard	NM_003250		Approved	EAR-7.1/EAR-7.2, THRA3, AR7, ERBA, NR1A1	uc002htw.3	P10827	OTTHUMG00000133332	ENST00000264637.4:c.441G>T	17.37:g.38240933G>T	ENSP00000264637:p.Lys147Asn					THRA_uc010cwp.1_Missense_Mutation_p.K147N|THRA_uc002htv.2_Missense_Mutation_p.K147N|THRA_uc002htx.2_Missense_Mutation_p.K147N	p.K147N	NM_003250	NP_003241	P10827	THA_HUMAN			6	924	+	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)	147					A8K3B5|P21205|Q8N6A1|Q96H73	Missense_Mutation	SNP	ENST00000264637.4	37	c.441G>T	CCDS11360.1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.320426	0.60634	.	.	ENSG00000126351	ENST00000394121;ENST00000264637;ENST00000450525;ENST00000546243	D;D;D;D	0.94046	-3.18;-3.18;-3.34;-3.34	4.67	2.68	0.31781	Nuclear hormone receptor, ligand-binding (1);	0.103362	0.64402	D	0.000004	D	0.95404	0.8508	M	0.75447	2.3	0.43667	D	0.996095	P;P;D	0.57899	0.864;0.786;0.981	P;B;D	0.69824	0.669;0.368;0.966	D	0.94253	0.7495	10	0.72032	D	0.01	.	9.0594	0.36425	0.2367:0.0:0.7633:0.0	.	147;147;147	P10827-3;P10827;Q6FH41	.;THA_HUMAN;.	N	147	ENSP00000377679:K147N;ENSP00000264637:K147N;ENSP00000395641:K147N;ENSP00000443972:K147N	ENSP00000264637:K147N	K	+	3	2	THRA	35494459	1.000000	0.71417	0.996000	0.52242	0.972000	0.66771	3.803000	0.55560	0.581000	0.29539	0.436000	0.28706	AAG		0.587	THRA-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257160.2			79	95	1	0	4.81439e-37	0.00361	8.84615e-37	79	95				
KRT28	162605	broad.mit.edu	37	17	38948771	38948771	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr17:38948771G>A	ENST00000306658.7	-	8	1368	c.1303C>T	c.(1303-1305)Cgt>Tgt	p.R435C		NM_181535.3	NP_853513.2			keratin 28											NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30		Breast(137;0.000301)				ACTTTACCACGTTGATCTAGC	0.358																																					Melanoma(19;789 869 15380 26882 39836)	Melanoma(19;789 869 15380 26882 39836)	uc002hvh.1		NA																	0				ovary(1)	1						c.(1303-1305)CGT>TGT		keratin 25D							128.0	118.0	122.0					17																	38948771		2202	4300	6502	SO:0001583	missense	162605					cytoplasm|intermediate filament	structural molecule activity	g.chr17:38948771G>A	AK129827	CCDS11376.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000173908	ENSG00000173908		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30842	protein-coding gene	gene with protein product			"""keratin 25D"""	KRT25D		16831889	Standard	NM_181535		Approved		uc002hvh.1	Q7Z3Y7	OTTHUMG00000133365	ENST00000306658.7:c.1303C>T	17.37:g.38948771G>A	ENSP00000305263:p.Arg435Cys						p.R435C	NM_181535	NP_853513	Q7Z3Y7	K1C28_HUMAN			8	1369	-		Breast(137;0.000301)	435			Tail.			Missense_Mutation	SNP	ENST00000306658.7	37	c.1303C>T	CCDS11376.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.673849	0.47781	.	.	ENSG00000173908	ENST00000306658	D	0.82619	-1.63	6.1	5.11	0.69529	.	0.101607	0.44483	D	0.000442	T	0.79215	0.4408	L	0.50333	1.59	0.47153	D	0.999332	B	0.18863	0.031	B	0.13407	0.009	T	0.76121	-0.3075	10	0.62326	D	0.03	.	13.2868	0.60247	0.0:0.1587:0.8413:0.0	.	435	Q7Z3Y7	K1C28_HUMAN	C	435	ENSP00000305263:R435C	ENSP00000305263:R435C	R	-	1	0	KRT28	36202297	0.780000	0.28664	1.000000	0.80357	0.899000	0.52679	1.171000	0.31896	1.553000	0.49476	0.650000	0.86243	CGT		0.358	KRT28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257201.2	NM_181535		6	15	0	0	0	0.001168	0	6	15				
KRTAP4-11	653240	broad.mit.edu	37	17	39274415	39274415	+	Silent	SNP	C	C	T	rs425487		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr17:39274415C>T	ENST00000391413.2	-	1	191	c.153G>A	c.(151-153)agG>agA	p.R51R		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	51	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14). {ECO:0000269|PubMed:15955084}.			keratin filament (GO:0045095)		p.R51R(6)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCACTGGGGCCTGCAGCAGC	0.667																																							uc002hvz.2		NA																	6	Substitution - coding silent(6)		endometrium(3)|kidney(2)|lung(1)		0						c.(151-153)AGG>AGA		keratin associated protein 4-11							9.0	15.0	13.0					17																	39274415		682	1579	2261	SO:0001819	synonymous_variant	653240					keratin filament		g.chr17:39274415C>T	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.153G>A	17.37:g.39274415C>T							p.R51R	NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	STAD - Stomach adenocarcinoma(17;0.000371)		1	192	-		Breast(137;0.000496)	51		Missing (in allele KAP4.14).	6.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		A0AUY2	Silent	SNP	ENST00000391413.2	37	c.153G>A	CCDS45675.1																																																																																				0.667	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1			4	86	0	0	0	0.009096	0	4	86				
WNT9B	7484	broad.mit.edu	37	17	44952705	44952705	+	Silent	SNP	C	C	T	rs142428656	byFrequency	TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr17:44952705C>T	ENST00000290015.2	+	3	626	c.573C>T	c.(571-573)gaC>gaT	p.D191D	WNT9B_ENST00000393461.2_Silent_p.D191D	NM_003396.1	NP_003387.1	O14905	WNT9B_HUMAN	wingless-type MMTV integration site family, member 9B	191					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to starvation (GO:0009267)|collecting duct development (GO:0072044)|cornea development in camera-type eye (GO:0061303)|embryonic cranial skeleton morphogenesis (GO:0048701)|establishment of planar polarity involved in nephron morphogenesis (GO:0072046)|in utero embryonic development (GO:0001701)|kidney rudiment formation (GO:0072003)|male genitalia development (GO:0030539)|mesenchymal stem cell maintenance involved in nephron morphogenesis (GO:0072038)|mesonephric duct formation (GO:0072181)|metanephric tubule formation (GO:0072174)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|positive regulation of catalytic activity (GO:0043085)|regulation of asymmetric cell division (GO:0009786)|regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003339)|regulation of protein phosphorylation (GO:0001932)|regulation of tube size (GO:0035150)|response to retinoic acid (GO:0032526)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			large_intestine(2)|lung(8)	10			BRCA - Breast invasive adenocarcinoma(9;0.0257)			CACGGGCAGACGCCCACAATA	0.607													C|||	2	0.000399361	0.0015	0.0	5008	,	,		19169	0.0		0.0	False		,,,				2504	0.0						uc002ikw.1		NA																	0				lung(2)	2						c.(571-573)GAC>GAT		wingless-type MMTV integration site family,		C		11,4393	16.8+/-37.8	0,11,2191	48.0	41.0	43.0		573	-9.8	0.1	17	dbSNP_134	43	0,8598		0,0,4299	no	coding-synonymous	WNT9B	NM_003396.1		0,11,6490	TT,TC,CC		0.0,0.2498,0.0846		191/358	44952705	11,12991	2202	4299	6501	SO:0001819	synonymous_variant	7484				anterior/posterior pattern formation|axis specification|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|collecting duct development|cornea development in camera-type eye|endoderm development|establishment of planar polarity involved in nephron morphogenesis|kidney rudiment formation|male genitalia development|mesonephric duct formation|metanephric tubule development|neuron differentiation|palate development|regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|uterus morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway|Wnt receptor signaling pathway, planar cell polarity pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|G-protein-coupled receptor binding	g.chr17:44952705C>T	AF028703	CCDS11506.1	17q21	2008-01-07	2003-03-11	2003-03-14		ENSG00000158955		"""Wingless-type MMTV integration sites"""	12779	protein-coding gene	gene with protein product		602864	"""wingless-type MMTV integration site family, member 15"""	WNT15		9441749, 11713592	Standard	NM_003396		Approved	WNT14B	uc002ikw.1	O14905		ENST00000290015.2:c.573C>T	17.37:g.44952705C>T						WNT9B_uc002ikx.1_Silent_p.D191D	p.D191D	NM_003396	NP_003387	O14905	WNT9B_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.0257)		3	610	+			191					Q6UXT4|Q96Q09	Silent	SNP	ENST00000290015.2	37	c.573C>T	CCDS11506.1																																																																																				0.607	WNT9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440433.1	NM_003396		5	23	0	0	0	0.000602	0	5	23				
BZRAP1	9256	broad.mit.edu	37	17	56395678	56395678	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr17:56395678G>A	ENST00000343736.4	-	14	1998	c.1835C>T	c.(1834-1836)tCc>tTc	p.S612F	BZRAP1_ENST00000355701.3_Missense_Mutation_p.S612F|BZRAP1_ENST00000268893.6_Missense_Mutation_p.S552F			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	612						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GTTGTGGATGGACTCGGAGTG	0.607																																							uc002ivx.3		NA																	0				upper_aerodigestive_tract(2)|skin(1)	3						c.(1834-1836)TCC>TTC		peripheral benzodiazepine receptor-associated							164.0	146.0	152.0					17																	56395678		2203	4300	6503	SO:0001583	missense	9256					mitochondrion	benzodiazepine receptor binding	g.chr17:56395678G>A	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.1835C>T	17.37:g.56395678G>A	ENSP00000345824:p.Ser612Phe					BZRAP1_uc010dcs.2_Missense_Mutation_p.S552F|BZRAP1_uc010wnt.1_Missense_Mutation_p.S612F	p.S612F	NM_004758	NP_004749	O95153	RIMB1_HUMAN			14	2706	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		612					O75111|Q8N5W3	Missense_Mutation	SNP	ENST00000343736.4	37	c.1835C>T	CCDS11605.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632825	0.87660	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	D;D;D	0.88046	-2.33;-2.33;-2.33	5.46	5.46	0.80206	.	0.339906	0.30252	N	0.010045	D	0.91277	0.7250	L	0.59436	1.845	0.43187	D	0.995012	D;D;P	0.58970	0.977;0.984;0.918	P;P;P	0.59056	0.831;0.851;0.723	D	0.91887	0.5520	10	0.72032	D	0.01	.	18.2851	0.90112	0.0:0.0:1.0:0.0	.	612;552;612	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	F	612;612;552	ENSP00000347929:S612F;ENSP00000345824:S612F;ENSP00000268893:S552F	ENSP00000268893:S552F	S	-	2	0	BZRAP1	53750677	1.000000	0.71417	0.842000	0.33263	0.966000	0.64601	6.481000	0.73608	2.559000	0.86315	0.491000	0.48974	TCC		0.607	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	NM_004758		10	55	0	0	0	0.008291	0	10	55				
DNAH17	8632	broad.mit.edu	37	17	76547656	76547656	+	Silent	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr17:76547656C>T	ENST00000585328.1	-	16	2476	c.2352G>A	c.(2350-2352)aaG>aaA	p.K784K	DNAH17_ENST00000389840.5_Silent_p.K784K	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	784	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TTTGTTTTGCCTTTTGCATCC	0.463																																							uc002jvv.1		NA																	0				ovary(6)|breast(2)|skin(1)	9						c.(1456-1458)AAG>AAA		RecName: Full=Dynein heavy chain 17, axonemal; AltName: Full=Axonemal beta dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain-like protein 1; AltName: Full=Axonemal dynein heavy chain-like protein 1; AltName: Full=Dynein light chain 2, axonemal;							174.0	144.0	154.0					17																	76547656		2203	4300	6503	SO:0001819	synonymous_variant	8632							g.chr17:76547656C>T	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.2352G>A	17.37:g.76547656C>T							p.K486K					BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)		12	1564	-								O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Silent	SNP	ENST00000585328.1	37	c.1458G>A																																																																																					0.463	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628		21	65	0	0	0	0.002299	0	21	65				
DNAH17	8632	broad.mit.edu	37	17	76547658	76547658	+	Nonsense_Mutation	SNP	T	T	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr17:76547658T>A	ENST00000585328.1	-	16	2474	c.2350A>T	c.(2350-2352)Aag>Tag	p.K784*	DNAH17_ENST00000389840.5_Nonsense_Mutation_p.K784*	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	784	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TGTTTTGCCTTTTGCATCCTG	0.468																																							uc002jvv.1		NA																	0				ovary(6)|breast(2)|skin(1)	9						c.(1456-1458)AAG>TAG		RecName: Full=Dynein heavy chain 17, axonemal; AltName: Full=Axonemal beta dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain-like protein 1; AltName: Full=Axonemal dynein heavy chain-like protein 1; AltName: Full=Dynein light chain 2, axonemal;							175.0	146.0	155.0					17																	76547658		2203	4300	6503	SO:0001587	stop_gained	8632							g.chr17:76547658T>A	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.2350A>T	17.37:g.76547658T>A	ENSP00000465516:p.Lys784*						p.K486*					BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)		12	1562	-								O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Nonsense_Mutation	SNP	ENST00000585328.1	37	c.1456A>T		.	.	.	.	.	.	.	.	.	.	T	38	7.156483	0.98099	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	.	.	.	4.78	4.78	0.61160	.	1.135340	0.06768	N	0.782973	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.8436	0.57817	0.0:0.0:0.0:1.0	.	.	.	.	X	784	.	ENSP00000300671:K784X	K	-	1	0	DNAH17	74059253	0.614000	0.27017	0.027000	0.17364	0.127000	0.20565	3.454000	0.52986	1.905000	0.55150	0.379000	0.24179	AAG		0.468	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628		22	66	0	0	0	0.00278	0	22	66				
RNF213	57674	broad.mit.edu	37	17	78320969	78320969	+	Missense_Mutation	SNP	G	G	A	rs76918558		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr17:78320969G>A	ENST00000582970.1	+	29	8977	c.8834G>A	c.(8833-8835)cGc>cAc	p.R2945H	RNF213_ENST00000508628.2_Missense_Mutation_p.R2994H|RNF213_ENST00000336301.6_Missense_Mutation_p.R1018H	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	2945					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GTGTGTAAGCGCCAGGACAAG	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		20774	0.001		0.0	False		,,,				2504	0.0						uc002jyh.1		NA																	0				ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21						c.(3052-3054)CGC>CAC		ring finger protein 213							48.0	38.0	42.0					17																	78320969		2203	4300	6503	SO:0001583	missense	57674							g.chr17:78320969G>A	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.8834G>A	17.37:g.78320969G>A	ENSP00000464087:p.Arg2945His						p.R1018H	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)		4	3276	+	all_neural(118;0.0538)		Error:Variant_position_missing_in_Q9HCF4_after_alignment					C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	c.3053G>A	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	G	4.920	0.171040	0.09391	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T;T	0.59083	0.29;1.91	5.82	-11.6	0.00059	.	2.299150	0.01130	N	0.005963	T	0.24812	0.0602	N	0.08118	0	0.09310	N	1	B	0.27882	0.192	B	0.11329	0.006	T	0.19257	-1.0311	10	0.40728	T	0.16	.	0.8571	0.01185	0.3302:0.2684:0.2067:0.1948	.	1018	Q63HN8	RN213_HUMAN	H	2945;2994;1018	ENSP00000425956:R2945H;ENSP00000338218:R1018H	ENSP00000338218:R1018H	R	+	2	0	RNF213	75935564	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-1.973000	0.01500	-2.041000	0.00915	-1.119000	0.02030	CGC		0.532	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914		5	20	0	0	0	0.000602	0	5	20				
TMEM105	284186	broad.mit.edu	37	17	79287590	79287590	+	Missense_Mutation	SNP	T	T	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr17:79287590T>G	ENST00000332900.1	-	3	800	c.251A>C	c.(250-252)cAt>cCt	p.H84P		NM_178520.3	NP_848615.1	Q8N8V8	TM105_HUMAN	transmembrane protein 105	84						integral component of membrane (GO:0016021)				NS(1)|large_intestine(3)|lung(1)|ovary(2)	7	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.0892)			AGGCCCTTCATGTCTTCGCCT	0.652																																							uc002kad.1		NA																	0				ovary(1)	1						c.(250-252)CAT>CCT		transmembrane protein 105							57.0	67.0	63.0					17																	79287590		2203	4300	6503	SO:0001583	missense	284186					integral to membrane		g.chr17:79287590T>G	AK096111	CCDS11781.1	17q25.3	2008-04-21	2008-04-21	2008-04-21		ENSG00000185332			26794	protein-coding gene	gene with protein product							Standard	NM_178520		Approved	FLJ38792	uc002kad.2	Q8N8V8		ENST00000332900.1:c.251A>C	17.37:g.79287590T>G	ENSP00000329795:p.His84Pro						p.H84P	NM_178520	NP_848615	Q8N8V8	TM105_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.0892)		3	801	-	all_neural(118;0.0804)|Melanoma(429;0.242)		84						Missense_Mutation	SNP	ENST00000332900.1	37	c.251A>C	CCDS11781.1	.	.	.	.	.	.	.	.	.	.	T	5.870	0.344595	0.11126	.	.	ENSG00000185332	ENST00000332900	T	0.53423	0.62	1.9	-3.79	0.04320	.	.	.	.	.	T	0.21962	0.0529	N	0.08118	0	0.09310	N	1	B	0.18310	0.027	B	0.10450	0.005	T	0.10823	-1.0613	9	0.87932	D	0	.	3.4798	0.07598	0.3432:0.401:0.0:0.2558	.	84	Q8N8V8	TM105_HUMAN	P	84	ENSP00000329795:H84P	ENSP00000329795:H84P	H	-	2	0	TMEM105	76902185	0.010000	0.17322	0.000000	0.03702	0.290000	0.27261	-0.914000	0.04038	-1.961000	0.01016	-0.856000	0.03024	CAT		0.652	TMEM105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439607.1	NM_178520		18	114	0	0	0	0.006122	0	18	114				
CEP192	55125	broad.mit.edu	37	18	13087146	13087146	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr18:13087146G>T	ENST00000325971.8	+	29	5552	c.3959G>T	c.(3958-3960)cGc>cTc	p.R1320L	CEP192_ENST00000430049.2_Missense_Mutation_p.R1441L|CEP192_ENST00000506447.1_Missense_Mutation_p.R1916L|CEP192_ENST00000540847.2_3'UTR			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	1320					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TTTTCTGTCCGCAACACTGGC	0.363																																							uc010xac.1		NA																	0				ovary(4)|pancreas(1)	5						c.(5746-5748)CGC>CTC		centrosomal protein 192kDa							83.0	85.0	84.0					18																	13087146		2203	4300	6503	SO:0001583	missense	55125							g.chr18:13087146G>T	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.3959G>T	18.37:g.13087146G>T	ENSP00000317156:p.Arg1320Leu					CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.R1441L|CEP192_uc002kru.2_RNA|CEP192_uc002krv.2_Missense_Mutation_p.R338L|CEP192_uc002krw.2_Missense_Mutation_p.R65L|CEP192_uc002krx.2_5'UTR|CEP192_uc002kry.2_5'Flank	p.R1916L	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN			31	5827	+			1916					A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	37	c.5747G>T		.	.	.	.	.	.	.	.	.	.	G	27.6	4.843568	0.91197	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.38240	1.15;1.15;1.15	5.5	4.6	0.57074	.	0.057177	0.64402	D	0.000003	T	0.53400	0.1794	M	0.66939	2.045	0.58432	D	0.999995	D;D;D	0.69078	0.997;0.98;0.989	D;P;P	0.63703	0.917;0.827;0.823	T	0.56360	-0.7992	10	0.72032	D	0.01	-8.7279	10.7639	0.46281	0.1575:0.0:0.8425:0.0	.	1441;1916;518	C9JT09;E9PF99;Q9HCK3	.;.;.	L	1916;1320;1320;1441	ENSP00000427550:R1916L;ENSP00000317156:R1320L;ENSP00000389190:R1441L	ENSP00000317156:R1320L	R	+	2	0	CEP192	13077146	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	6.174000	0.71943	1.256000	0.44068	0.650000	0.86243	CGC		0.363	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142		15	52	1	0	1.02788e-11	0.00499	1.5843e-11	15	52				
C18orf8	29919	broad.mit.edu	37	18	21109655	21109655	+	Silent	SNP	C	C	T	rs373654910		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr18:21109655C>T	ENST00000269221.3	+	16	1583	c.1473C>T	c.(1471-1473)aaC>aaT	p.N491N	C18orf8_ENST00000590868.1_Silent_p.N443N|C18orf8_ENST00000591367.1_3'UTR	NM_013326.3	NP_037458.3	Q96DM3	MIC1_HUMAN	chromosome 18 open reading frame 8	491	Mic1.					lysosomal membrane (GO:0005765)				endometrium(9)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	21	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					GTTCTCTTAACCAGTTTCAGA	0.388																																							uc010xax.1		NA																	0				ovary(1)	1						c.(1471-1473)AAC>AAT		colon cancer-associated protein Mic1		C		0,4406		0,0,2203	148.0	146.0	147.0		1473	5.5	1.0	18		147	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	C18orf8	NM_013326.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		491/658	21109655	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	29919							g.chr18:21109655C>T	AK057192	CCDS32803.1, CCDS74199.1	18q11.2	2013-12-13			ENSG00000141452	ENSG00000141452			24326	protein-coding gene	gene with protein product	"""colon cancer associated protein Mic1"", ""macrophage inhibitory cytokine 1"""					12477932	Standard	NM_013326		Approved	MIC1, MIC-1, HsT2591	uc021uie.2	Q96DM3		ENST00000269221.3:c.1473C>T	18.37:g.21109655C>T						C18orf8_uc002kul.2_RNA|C18orf8_uc010xay.1_Silent_p.N115N|NPC1_uc010dlu.1_RNA	p.N491N	NM_013326	NP_037458	Q96DM3	MIC1_HUMAN			17	1594	+	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)		491			Mic1.		Q9BU17|Q9Y5M0	Silent	SNP	ENST00000269221.3	37	c.1473C>T	CCDS32803.1																																																																																				0.388	C18orf8-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445386.1	NM_013326		15	101	0	0	0	0.003163	0	15	101				
ASXL3	80816	broad.mit.edu	37	18	31325198	31325198	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr18:31325198G>T	ENST00000269197.5	+	12	5386	c.5386G>T	c.(5386-5388)Gtt>Ttt	p.V1796F		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1796					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AGAGAGAAACGTTGAAATTCC	0.498																																							uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(5386-5388)GTT>TTT		additional sex combs like 3							79.0	78.0	78.0					18																	31325198		1895	4124	6019	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31325198G>T	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.5386G>T	18.37:g.31325198G>T	ENSP00000269197:p.Val1796Phe					ASXL3_uc002kxq.2_Missense_Mutation_p.V1503F	p.V1796F	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN			12	5441	+			1796					Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.5386G>T	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	G	10.72	1.429110	0.25726	.	.	ENSG00000141431	ENST00000269197	T	0.16597	2.33	5.7	-6.18	0.02085	.	.	.	.	.	T	0.10035	0.0246	N	0.19112	0.55	0.09310	N	1	P	0.39216	0.664	B	0.32022	0.139	T	0.09335	-1.0679	9	0.66056	D	0.02	.	16.7039	0.85366	0.7227:0.0:0.2773:0.0	.	1796	Q9C0F0	ASXL3_HUMAN	F	1796	ENSP00000269197:V1796F	ENSP00000269197:V1796F	V	+	1	0	ASXL3	29579196	0.000000	0.05858	0.000000	0.03702	0.480000	0.33159	-1.252000	0.02880	-1.150000	0.02840	-0.137000	0.14449	GTT		0.498	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			62	100	1	0	1.88225e-35	0.00361	3.44157e-35	62	100				
CD226	10666	broad.mit.edu	37	18	67613982	67613982	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr18:67613982C>A	ENST00000280200.4	-	3	638	c.370G>T	c.(370-372)Gtg>Ttg	p.V124L	CD226_ENST00000577287.1_5'UTR|CD226_ENST00000582621.1_Missense_Mutation_p.V124L|CD226_ENST00000581982.1_Intron	NM_006566.2	NP_006557.2	Q15762	CD226_HUMAN	CD226 molecule	124	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)|cytokine production (GO:0001816)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	24		Esophageal squamous(42;0.129)				GACTGAACCACCTGTATCACC	0.383																																					NSCLC(184;838 2130 8673 21498 50749)	NSCLC(184;838 2130 8673 21498 50749)	uc010dqo.2		NA																	0					0						c.(370-372)GTG>TTG		CD226 molecule precursor							93.0	86.0	88.0					18																	67613982		2203	4300	6503	SO:0001583	missense	10666				cell adhesion|cell recognition|positive regulation of Fc receptor mediated stimulatory signaling pathway|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	cell surface|integral to plasma membrane|membrane raft	cell adhesion molecule binding|integrin binding|protein kinase binding|receptor activity	g.chr18:67613982C>A	U56102	CCDS11997.1	18q22.3	2013-01-11	2006-03-28		ENSG00000150637	ENSG00000150637		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	16961	protein-coding gene	gene with protein product		605397	"""CD226 antigen"""			8673704	Standard	NM_006566		Approved	DNAM-1, DNAM1, PTA1, TLiSA1	uc002lkm.4	Q15762	OTTHUMG00000132809	ENST00000280200.4:c.370G>T	18.37:g.67613982C>A	ENSP00000280200:p.Val124Leu					CD226_uc002lkm.3_Missense_Mutation_p.V124L	p.V124L	NM_006566	NP_006557	Q15762	CD226_HUMAN			2	817	-		Esophageal squamous(42;0.129)	124			Ig-like C2-type 1.|Extracellular (Potential).		B2R818	Missense_Mutation	SNP	ENST00000280200.4	37	c.370G>T	CCDS11997.1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.071153	0.55646	.	.	ENSG00000150637	ENST00000280200	T	0.58506	0.33	5.51	5.51	0.81932	Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.122835	0.53938	D	0.000044	T	0.74756	0.3758	M	0.82517	2.595	0.36059	D	0.841315	D	0.69078	0.997	P	0.62649	0.905	T	0.78633	-0.2128	10	0.32370	T	0.25	.	15.277	0.73750	0.0:1.0:0.0:0.0	.	124	Q15762	CD226_HUMAN	L	124	ENSP00000280200:V124L	ENSP00000280200:V124L	V	-	1	0	CD226	65764962	0.989000	0.36119	0.954000	0.39281	0.016000	0.09150	3.791000	0.55469	2.756000	0.94617	0.655000	0.94253	GTG		0.383	CD226-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256226.3	NM_006566		9	38	1	0	0.000673444	0.008291	0.00075208	9	38				
SHC2	25759	broad.mit.edu	37	19	422268	422268	+	Missense_Mutation	SNP	T	T	C	rs369081529		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:422268T>C	ENST00000264554.6	-	11	1497	c.1498A>G	c.(1498-1500)Atg>Gtg	p.M500V		NM_012435.2	NP_036567.2	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing) transforming protein 2	500	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of MAPK activity (GO:0000187)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)	cytosol (GO:0005829)				endometrium(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTCGAAGCATCCTCTCTGCC	0.701																																							uc002loq.3		NA																	0					0						c.(1498-1500)ATG>GTG		SHC (Src homology 2 domain containing)			VAL/MET	0,4366		0,0,2183	18.0	22.0	20.0		1498	2.6	0.9	19		20	2,8552		0,2,4275	no	missense	SHC2	NM_012435.2	21	0,2,6458	CC,CT,TT		0.0234,0.0,0.0155	benign	500/583	422268	2,12918	2183	4277	6460	SO:0001583	missense	25759				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol		g.chr19:422268T>C	AB001451	CCDS45891.1	19p13.3	2013-02-14				ENSG00000129946		"""SH2 domain containing"""	29869	protein-coding gene	gene with protein product	"""neuronal Shc adaptor homolog"""	605217				7527937, 9507002	Standard	NM_012435		Approved	SLI, SCK, SHCB	uc002loq.4	P98077		ENST00000264554.6:c.1498A>G	19.37:g.422268T>C	ENSP00000264554:p.Met500Val					SHC2_uc002lop.3_Missense_Mutation_p.M241V	p.M500V	NM_012435	NP_036567	P98077	SHC2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	11	1498	-		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)	500			SH2.		O60230|Q9NPL5|Q9UCX4	Missense_Mutation	SNP	ENST00000264554.6	37	c.1498A>G	CCDS45891.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.141125	0.37825	0.0	2.34E-4	ENSG00000129946	ENST00000264554	T	0.62498	0.02	4.75	2.58	0.30949	SH2 motif (5);	0.225707	0.37809	N	0.001940	T	0.45776	0.1359	L	0.28740	0.885	0.30179	N	0.800626	B	0.09022	0.002	B	0.20384	0.029	T	0.46541	-0.9184	10	0.87932	D	0	-23.1409	5.4557	0.16590	0.1722:0.0:0.6626:0.1653	.	500	P98077	SHC2_HUMAN	V	500	ENSP00000264554:M500V	ENSP00000264554:M500V	M	-	1	0	SHC2	373268	1.000000	0.71417	0.855000	0.33649	0.764000	0.43329	3.632000	0.54287	0.678000	0.31325	-0.172000	0.13284	ATG		0.701	SHC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451840.3			4	20	0	0	0	0.009096	0	4	20				
EEF2	1938	broad.mit.edu	37	19	3979429	3979429	+	Silent	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:3979429G>A	ENST00000309311.6	-	11	1699	c.1611C>T	c.(1609-1611)atC>atT	p.I537I		NM_001961.3	NP_001952.1	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2	537					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|positive regulation of gene expression (GO:0010628)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation activator activity (GO:0008494)|translation elongation factor activity (GO:0003746)			endometrium(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTCCTCGATGATGCACTGAA	0.637																																					Colon(165;1804 1908 4071 6587 18799)	Colon(165;1804 1908 4071 6587 18799)	uc002lze.2		NA																	0					0						c.(1609-1611)ATC>ATT		eukaryotic translation elongation factor 2							63.0	68.0	66.0					19																	3979429		2203	4300	6503	SO:0001819	synonymous_variant	1938					cytosol|ribonucleoprotein complex	GTP binding|GTPase activity|protein binding|translation elongation factor activity	g.chr19:3979429G>A	Z11692	CCDS12117.1	19p13.3	2012-09-20			ENSG00000167658	ENSG00000167658			3214	protein-coding gene	gene with protein product	"""polypeptidyl-tRNA translocase"""	130610		EF2		2610926, 6427766	Standard	NM_001961		Approved	EEF-2	uc002lze.3	P13639		ENST00000309311.6:c.1611C>T	19.37:g.3979429G>A							p.I537I	NM_001961	NP_001952	P13639	EF2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)	11	1694	-		Hepatocellular(1079;0.137)	537					B2RMP5|D6W618|Q58J86	Silent	SNP	ENST00000309311.6	37	c.1611C>T	CCDS12117.1																																																																																				0.637	EEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457615.2	NM_001961		33	78	0	0	0	0.003271	0	33	78				
CATSPERD	257062	broad.mit.edu	37	19	5776215	5776216	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:5776215_5776216GG>TT	ENST00000381624.3	+	21	2046_2047	c.1985_1986GG>TT	c.(1984-1986)aGG>aTT	p.R662I	CATSPERD_ENST00000309164.7_3'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	662					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											GCCCCTTTGAGGTGGCCAGACG	0.564																																							uc002mda.2		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(1984-1986)AGG>ATT		transmembrane protein 146 precursor																																				SO:0001583	missense	257062					integral to membrane		g.chr19:5776215_5776216GG>TT	BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	Exception_encountered	19.37:g.5776215_5776216delinsTT	ENSP00000371037:p.Arg662Ile						p.R662I	NM_152784	NP_689997	Q86XM0	TM146_HUMAN			21	2046_2047	+			662			Extracellular (Potential).		Q6ZRP1	Missense_Mutation	DNP	ENST00000381624.3	37	c.1985_1986GG>TT	CCDS12149.2																																																																																				0.564	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2	NM_152784		20	58	0	0	0	0.004672	0	20	58				
EMR1	2015	broad.mit.edu	37	19	6919615	6919615	+	Missense_Mutation	SNP	C	C	T	rs144318055	byFrequency	TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:6919615C>T	ENST00000312053.4	+	13	1514	c.1477C>T	c.(1477-1479)Cgc>Tgc	p.R493C	EMR1_ENST00000381404.4_Missense_Mutation_p.R441C|EMR1_ENST00000250572.8_Missense_Mutation_p.R493C|EMR1_ENST00000450315.3_Missense_Mutation_p.R316C|EMR1_ENST00000381407.5_Missense_Mutation_p.R352C	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	493	Ser/Thr-rich.				cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					TTTAAATGAGCGCTTCTTCAA	0.473													C|||	2	0.000399361	0.0	0.0	5008	,	,		14252	0.0		0.0	False		,,,				2504	0.002						uc002mfw.2		NA																	0				ovary(3)|lung(1)|skin(1)	5						c.(1477-1479)CGC>TGC		egf-like module containing, mucin-like, hormone		C	CYS/ARG	0,4406		0,0,2203	139.0	127.0	131.0		1477	-2.7	0.0	19	dbSNP_134	131	1,8599	1.2+/-3.3	0,1,4299	no	missense	EMR1	NM_001974.3	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	493/887	6919615	1,13005	2203	4300	6503	SO:0001583	missense	2015				cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr19:6919615C>T	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.1477C>T	19.37:g.6919615C>T	ENSP00000311545:p.Arg493Cys					EMR1_uc010dvc.2_Missense_Mutation_p.R493C|EMR1_uc010dvb.2_Missense_Mutation_p.R441C|EMR1_uc010xji.1_Missense_Mutation_p.R352C|EMR1_uc010xjj.1_Missense_Mutation_p.R316C	p.R493C	NM_001974	NP_001965	Q14246	EMR1_HUMAN			13	1515	+	all_hematologic(4;0.166)		493			Ser/Thr-rich.|Extracellular (Potential).		A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	ENST00000312053.4	37	c.1477C>T	CCDS12175.1	.	.	.	.	.	.	.	.	.	.	C	11.39	1.624733	0.28889	0.0	1.16E-4	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572;ENST00000381407;ENST00000450315	T;T;T;T;T	0.78924	-1.17;-1.2;-1.22;-0.02;0.31	3.99	-2.67	0.06059	.	.	.	.	.	T	0.76364	0.3977	L	0.59436	1.845	0.09310	N	1	D;D;D;D;D	0.71674	0.998;0.993;0.994;0.991;0.978	P;P;P;B;B	0.50049	0.623;0.528;0.629;0.328;0.425	T	0.69884	-0.5024	9	0.66056	D	0.02	.	10.0385	0.42144	0.1809:0.7113:0.1078:0.0	.	316;352;493;441;493	E7EPX9;B7Z486;Q14246-2;E9PD45;Q14246	.;.;.;.;EMR1_HUMAN	C	493;493;441;493;352;316	ENSP00000311545:R493C;ENSP00000370811:R441C;ENSP00000250572:R493C;ENSP00000370814:R352C;ENSP00000405974:R316C	ENSP00000250572:R493C	R	+	1	0	EMR1	6870615	0.046000	0.20272	0.005000	0.12908	0.001000	0.01503	0.541000	0.23207	-0.287000	0.09064	0.491000	0.48974	CGC		0.473	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458485.1			25	85	0	0	0	0.005443	0	25	85				
MUC16	94025	broad.mit.edu	37	19	9047883	9047883	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:9047883C>A	ENST00000397910.4	-	5	33951	c.33748G>T	c.(33748-33750)Gtt>Ttt	p.V11250F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11252	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AAAGTTGGAACAACAGAACTT	0.483																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(33748-33750)GTT>TTT		mucin 16							70.0	63.0	65.0					19																	9047883		1927	4135	6062	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9047883C>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.33748G>T	19.37:g.9047883C>A	ENSP00000381008:p.Val11250Phe						p.V11250F	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			5	33952	-			11252			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.33748G>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	7.169	0.587346	0.13812	.	.	ENSG00000181143	ENST00000397910	T	0.02837	4.14	3.42	-1.87	0.07737	.	.	.	.	.	T	0.03011	0.0089	L	0.50333	1.59	.	.	.	P	0.49635	0.926	B	0.41202	0.35	T	0.36625	-0.9740	8	0.87932	D	0	.	3.9196	0.09237	0.0:0.4694:0.1776:0.353	.	11250	B5ME49	.	F	11250	ENSP00000381008:V11250F	ENSP00000381008:V11250F	V	-	1	0	MUC16	8908883	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.009000	0.01455	-0.228000	0.09869	-0.155000	0.13514	GTT		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		6	31	1	0	0.00116845	0.001168	0.00127809	6	31				
MUC16	94025	broad.mit.edu	37	19	9059529	9059529	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:9059529C>A	ENST00000397910.4	-	3	28120	c.27917G>T	c.(27916-27918)aGc>aTc	p.S9306I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9308	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AAGGACAGTGCTTTTTTCTGT	0.507																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(27916-27918)AGC>ATC		mucin 16							157.0	153.0	154.0					19																	9059529		1991	4177	6168	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9059529C>A	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.27917G>T	19.37:g.9059529C>A	ENSP00000381008:p.Ser9306Ile						p.S9306I	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			3	28121	-			9308			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.27917G>T	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	2.672	-0.277256	0.05679	.	.	ENSG00000181143	ENST00000397910	T	0.02682	4.2	2.23	-4.46	0.03536	.	.	.	.	.	T	0.01387	0.0045	N	0.08118	0	.	.	.	B	0.06786	0.001	B	0.11329	0.006	T	0.47598	-0.9105	8	0.87932	D	0	.	0.292	0.00260	0.2138:0.2291:0.2804:0.2767	.	9306	B5ME49	.	I	9306	ENSP00000381008:S9306I	ENSP00000381008:S9306I	S	-	2	0	MUC16	8920529	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.851000	0.00350	-1.622000	0.01560	-0.372000	0.07161	AGC		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		10	139	1	0	2.80697e-09	0.000978	3.92135e-09	10	139				
MUC16	94025	broad.mit.edu	37	19	9086780	9086780	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:9086780C>T	ENST00000397910.4	-	1	5238	c.5035G>A	c.(5035-5037)Ggg>Agg	p.G1679R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1679	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCCATTGTCCCAGCCATAGAG	0.498																																							uc002mkp.2		NA																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(5035-5037)GGG>AGG		mucin 16							106.0	101.0	103.0					19																	9086780		1966	4180	6146	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9086780C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5035G>A	19.37:g.9086780C>T	ENSP00000381008:p.Gly1679Arg						p.G1679R	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			1	5239	-			1679			Ser-rich.|Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.5035G>A	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	2.420	-0.333308	0.05278	.	.	ENSG00000181143	ENST00000397910	T	0.03607	3.87	1.33	-1.02	0.10135	.	.	.	.	.	T	0.01940	0.0061	N	0.08118	0	.	.	.	P	0.51537	0.946	B	0.41619	0.361	T	0.44847	-0.9301	8	0.87932	D	0	.	3.9406	0.09325	0.0:0.5297:0.0:0.4703	.	1679	B5ME49	.	R	1679	ENSP00000381008:G1679R	ENSP00000381008:G1679R	G	-	1	0	MUC16	8947780	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	0.132000	0.15891	-0.277000	0.09193	0.313000	0.20887	GGG		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		4	117	0	0	0	0.009096	0	4	117				
ZNF560	147741	broad.mit.edu	37	19	9578633	9578633	+	Silent	SNP	A	A	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:9578633A>T	ENST00000301480.4	-	10	1203	c.990T>A	c.(988-990)acT>acA	p.T330T		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	330					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						TTGTGGAGTGAGTAAATGCTT	0.388																																							uc002mlp.1		NA																	0				skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						c.(988-990)ACT>ACA		zinc finger protein 560							186.0	157.0	167.0					19																	9578633		2203	4300	6503	SO:0001819	synonymous_variant	147741				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:9578633A>T	AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.990T>A	19.37:g.9578633A>T						ZNF560_uc010dwr.1_Silent_p.T224T	p.T330T	NM_152476	NP_689689	Q96MR9	ZN560_HUMAN			10	1200	-			330					Q495S9|Q495T1	Silent	SNP	ENST00000301480.4	37	c.990T>A	CCDS12214.1																																																																																				0.388	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476		16	49	0	0	0	0.004007	0	16	49				
COL5A3	50509	broad.mit.edu	37	19	10114363	10114363	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:10114363G>A	ENST00000264828.3	-	6	812	c.727C>T	c.(727-729)Cgt>Tgt	p.R243C		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	243	Nonhelical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CGCCGAGGACGAGGGGTTTCT	0.582																																							uc002mmq.1		NA																	0				ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10						c.(727-729)CGT>TGT		collagen, type V, alpha 3 preproprotein							119.0	92.0	101.0					19																	10114363		2203	4300	6503	SO:0001583	missense	50509				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent	g.chr19:10114363G>A	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.727C>T	19.37:g.10114363G>A	ENSP00000264828:p.Arg243Cys						p.R243C	NM_015719	NP_056534	P25940	CO5A3_HUMAN	Epithelial(33;7.11e-05)		6	813	-			243			Nonhelical region.		Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	c.727C>T	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663156	0.47572	.	.	ENSG00000080573	ENST00000264828	D	0.89681	-2.55	4.08	-1.07	0.09968	.	1.387490	0.05950	U	0.638691	T	0.76579	0.4007	N	0.14661	0.345	0.09310	N	1	P	0.34892	0.474	B	0.25884	0.064	T	0.65882	-0.6060	10	0.56958	D	0.05	.	7.4214	0.27073	0.1012:0.5057:0.3931:0.0	.	243	P25940	CO5A3_HUMAN	C	243	ENSP00000264828:R243C	ENSP00000264828:R243C	R	-	1	0	COL5A3	9975363	0.000000	0.05858	0.005000	0.12908	0.755000	0.42902	-0.665000	0.05286	-0.144000	0.11314	0.456000	0.33151	CGT		0.582	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719		14	60	0	0	0	0.003163	0	14	60				
ZNF799	90576	broad.mit.edu	37	19	12501395	12501395	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:12501395T>A	ENST00000430385.3	-	4	2017	c.1817A>T	c.(1816-1818)cAt>cTt	p.H606L	CTD-3105H18.14_ENST00000435033.1_Intron|ZNF799_ENST00000419318.1_Missense_Mutation_p.H574L	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	606					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						AGTCTTTTTATGTCTATGCAA	0.408																																							uc010dyt.2		NA																	0				breast(3)|ovary(2)|skin(1)	6						c.(1816-1818)CAT>CTT		zinc finger protein 799							84.0	90.0	88.0					19																	12501395		2203	4298	6501	SO:0001583	missense	90576				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12501395T>A	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1817A>T	19.37:g.12501395T>A	ENSP00000411084:p.His606Leu					ZNF799_uc002mts.3_Intron	p.H606L	NM_001080821	NP_001074290	Q96GE5	ZN799_HUMAN			4	1967	-			606			C2H2-type 17.			Missense_Mutation	SNP	ENST00000430385.3	37	c.1817A>T	CCDS45989.1	.	.	.	.	.	.	.	.	.	.	T	12.77	2.038868	0.35989	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	T;T	0.60672	0.17;0.17	1.27	1.27	0.21489	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.81465	0.4828	H	0.97465	4.01	0.09310	N	1	D	0.71674	0.998	D	0.76575	0.988	T	0.67757	-0.5588	9	0.87932	D	0	.	7.9991	0.30286	0.0:0.0:0.0:1.0	.	606	Q96GE5	ZN799_HUMAN	L	574;606	ENSP00000415278:H574L;ENSP00000411084:H606L	ENSP00000415278:H574L	H	-	2	0	ZNF799	12362395	0.000000	0.05858	0.006000	0.13384	0.010000	0.07245	-0.233000	0.09041	0.842000	0.35045	0.347000	0.21830	CAT		0.408	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2	NM_001080821		17	82	0	0	0	0.001882	0	17	82				
ZNF714	148206	broad.mit.edu	37	19	21300752	21300752	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:21300752G>C	ENST00000596143.1	+	5	1607	c.1282G>C	c.(1282-1284)Gaa>Caa	p.E428Q	ZNF714_ENST00000601416.1_3'UTR|ZNF714_ENST00000291770.7_3'UTR|ZNF714_ENST00000596053.1_Intron	NM_182515.3	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	428					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|urinary_tract(2)	18						CAAATGTGAAGAATGTGGCAA	0.368																																							uc002npo.3		NA																	0					0						c.(1285-1287)GAA>CAA		zinc finger protein 714							40.0	43.0	42.0					19																	21300752		2174	4291	6465	SO:0001583	missense	148206				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:21300752G>C	AK056006	CCDS54239.1	19p12	2013-01-08				ENSG00000160352		"""Zinc fingers, C2H2-type"""	27124	protein-coding gene	gene with protein product						12477932	Standard	NM_182515		Approved		uc002npo.4	Q96N38		ENST00000596143.1:c.1282G>C	19.37:g.21300752G>C	ENSP00000472368:p.Glu428Gln					ZNF714_uc002npl.2_Missense_Mutation_p.E274Q|ZNF714_uc010ecp.1_Missense_Mutation_p.E380Q|ZNF714_uc002npn.2_RNA	p.E429Q	NM_182515	NP_872321	Q96N38	ZN714_HUMAN			6	1645	+			429			C2H2-type 12.		Q49AI1|Q86W65|Q8ND40	Missense_Mutation	SNP	ENST00000596143.1	37	c.1285G>C	CCDS54239.1	.	.	.	.	.	.	.	.	.	.	.	9.421	1.083154	0.20309	.	.	ENSG00000160352	ENST00000343332;ENST00000291770	.	.	.	1.05	1.05	0.20165	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24353	0.0590	N	0.01771	-0.73	0.09310	N	1	D;D;D	0.89917	0.958;0.996;1.0	P;P;D	0.85130	0.568;0.835;0.997	T	0.14337	-1.0476	8	0.54805	T	0.06	.	6.462	0.21962	0.0:0.5488:0.4512:0.0	.	429;428;429	Q96N38-2;A6NEM4;Q96N38	.;.;ZN714_HUMAN	Q	428	.	ENSP00000291770:E428Q	E	+	1	0	ZNF714	21092592	0.000000	0.05858	0.022000	0.16811	0.021000	0.10359	0.001000	0.13038	0.459000	0.27016	0.462000	0.41574	GAA		0.368	ZNF714-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463930.1	NM_182515		12	22	0	0	0	0.001368	0	12	22				
LSM14A	26065	broad.mit.edu	37	19	34712605	34712605	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:34712605G>C	ENST00000433627.5	+	9	1405	c.1330G>C	c.(1330-1332)Ggt>Cgt	p.G444R	LSM14A_ENST00000544216.3_Missense_Mutation_p.G444R|LSM14A_ENST00000540746.2_Missense_Mutation_p.G403R	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	444					cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					ATTCAGAGGAGGTCGTGGGGG	0.507																																							uc002nvb.3		NA																	0				skin(1)	1						c.(1330-1332)GGT>CGT		LSM14 homolog A isoform a							70.0	57.0	61.0					19																	34712605		2203	4300	6503	SO:0001583	missense	26065				cytoplasmic mRNA processing body assembly|multicellular organismal development|regulation of translation	cytoplasmic mRNA processing body|intracellular membrane-bounded organelle|stress granule		g.chr19:34712605G>C	AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.1330G>C	19.37:g.34712605G>C	ENSP00000413964:p.Gly444Arg					LSM14A_uc002nva.3_Missense_Mutation_p.G444R|LSM14A_uc010xru.1_Missense_Mutation_p.G403R|LSM14A_uc002nvc.3_Missense_Mutation_p.G250R	p.G444R	NM_001114093	NP_001107565	Q8ND56	LS14A_HUMAN			9	1526	+	Esophageal squamous(110;0.162)		444					B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Missense_Mutation	SNP	ENST00000433627.5	37	c.1330G>C	CCDS46040.1	.	.	.	.	.	.	.	.	.	.	g	25.4	4.632967	0.87660	.	.	ENSG00000257103	ENST00000544216;ENST00000433627;ENST00000540746	T;T;T	0.28069	1.63;1.63;1.63	6.06	5.03	0.67393	.	0.147267	0.64402	D	0.000011	T	0.39279	0.1072	L	0.60455	1.87	0.58432	D	0.999996	P;P;P	0.41366	0.535;0.747;0.665	B;B;P	0.46917	0.228;0.303;0.531	T	0.31613	-0.9937	10	0.87932	D	0	-6.9092	12.2793	0.54755	0.1352:0.0:0.8648:0.0	.	403;444;444	B4DTG6;Q8ND56;Q8ND56-2	.;LS14A_HUMAN;.	R	444;444;403	ENSP00000446271:G444R;ENSP00000413964:G444R;ENSP00000446451:G403R	ENSP00000314768:G444R	G	+	1	0	LSM14A	39404445	1.000000	0.71417	0.996000	0.52242	0.966000	0.64601	3.604000	0.54081	1.584000	0.49913	0.655000	0.94253	GGT		0.507	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451576.3	NM_015578		9	27	0	0	0	0.008291	0	9	27				
HKR1	284459	broad.mit.edu	37	19	37854341	37854341	+	Silent	SNP	A	A	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:37854341A>G	ENST00000324411.4	+	6	1913	c.1644A>G	c.(1642-1644)tcA>tcG	p.S548S	HKR1_ENST00000392153.3_Silent_p.S529S|HKR1_ENST00000591471.1_Silent_p.S275S|HKR1_ENST00000589392.1_Silent_p.S530S|HKR1_ENST00000544914.1_Silent_p.S275S|HKR1_ENST00000541583.2_Silent_p.S487S|HKR1_ENST00000591134.1_Intron	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	548					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGACACATTCAGGGGAAAAGC	0.507																																							uc002ogb.2		NA																	0				ovary(2)	2						c.(1642-1644)TCA>TCG		GLI-Kruppel family member HKR1							54.0	49.0	50.0					19																	37854341		2203	4300	6503	SO:0001819	synonymous_variant	284459				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:37854341A>G	M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1644A>G	19.37:g.37854341A>G						HKR1_uc002ofx.2_Silent_p.S264S|HKR1_uc002ofy.2_Silent_p.S264S|HKR1_uc002oga.2_Silent_p.S530S|HKR1_uc010xto.1_Silent_p.S530S|HKR1_uc002ogc.2_Silent_p.S529S|HKR1_uc010xtp.1_Silent_p.S487S|HKR1_uc002ogd.2_Silent_p.S487S	p.S548S	NM_181786	NP_861451	P10072	HKR1_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)		6	1913	+			548					A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Silent	SNP	ENST00000324411.4	37	c.1644A>G	CCDS12502.1																																																																																				0.507	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1	NM_181786		3	57	0	0	0	0.004672	0	3	57				
MAP3K10	4294	broad.mit.edu	37	19	40711891	40711891	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:40711891G>T	ENST00000253055.3	+	5	1550	c.1262G>T	c.(1261-1263)cGg>cTg	p.R421L	AC118344.1_ENST00000408124.1_RNA	NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	421	Leucine-zipper 2.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						CAGCTGCGGCGGCGGGAGCAG	0.687																																							uc002ona.2		NA																	0				ovary(2)|lung(2)|skin(1)|pancreas(1)	6						c.(1261-1263)CGG>CTG		mitogen-activated protein kinase kinase kinase							18.0	19.0	19.0					19																	40711891		2198	4293	6491	SO:0001583	missense	4294				activation of JUN kinase activity|induction of apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of JNK cascade|protein autophosphorylation|smoothened signaling pathway	cytoplasm	ATP binding|bHLH transcription factor binding|JUN kinase kinase kinase activity|protein homodimerization activity|transcription corepressor activity	g.chr19:40711891G>T	X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.1262G>T	19.37:g.40711891G>T	ENSP00000253055:p.Arg421Leu					MAP3K10_uc002onb.2_Intron	p.R421L	NM_002446	NP_002437	Q02779	M3K10_HUMAN			5	1550	+			421			Leucine-zipper 2.		Q12761|Q14871	Missense_Mutation	SNP	ENST00000253055.3	37	c.1262G>T	CCDS12549.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.347334	0.82022	.	.	ENSG00000130758	ENST00000253055	T	0.77358	-1.09	4.43	4.43	0.53597	.	0.115441	0.56097	D	0.000040	T	0.78836	0.4346	M	0.74467	2.265	0.58432	D	0.999994	P	0.35328	0.495	B	0.37304	0.246	T	0.82339	-0.0506	10	0.72032	D	0.01	.	14.8813	0.70534	0.0:0.0:1.0:0.0	.	421	Q02779	M3K10_HUMAN	L	421	ENSP00000253055:R421L	ENSP00000253055:R421L	R	+	2	0	MAP3K10	45403731	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.768000	0.62293	2.143000	0.66587	0.491000	0.48974	CGG		0.687	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462552.1	NM_002446		3	20	1	0	6.4e-05	0.004672	7.48504e-05	3	20				
AXL	558	broad.mit.edu	37	19	41727831	41727831	+	Silent	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:41727831C>T	ENST00000301178.4	+	4	646	c.456C>T	c.(454-456)gcC>gcT	p.A152A	CTD-2195B23.3_ENST00000598541.1_RNA|AXL_ENST00000594880.1_3'UTR|AXL_ENST00000359092.3_Silent_p.A152A	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	152	Ig-like C2-type 2.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						CTGTGGCCGCCAACACCCCCT	0.662																																							uc010ehj.2		NA																	0				lung(4)|stomach(3)|ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	13						c.(454-456)GCC>GCT		AXL receptor tyrosine kinase isoform 1							27.0	26.0	26.0					19																	41727831		2203	4300	6503	SO:0001819	synonymous_variant	558					integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	g.chr19:41727831C>T	M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.456C>T	19.37:g.41727831C>T						CYP2F1_uc010xvw.1_Intron|AXL_uc010ehi.1_Silent_p.A152A|AXL_uc010ehk.2_Silent_p.A152A	p.A152A	NM_021913	NP_068713	P30530	UFO_HUMAN			4	646	+			152			Ig-like C2-type 2.|Extracellular (Potential).		Q8N5L2|Q9UD27	Silent	SNP	ENST00000301178.4	37	c.456C>T	CCDS12575.1																																																																																				0.662	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463323.2			4	27	0	0	0	0.000602	0	4	27				
ACPT	93650	broad.mit.edu	37	19	51297178	51297178	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:51297178C>G	ENST00000270593.1	+	8	812	c.812C>G	c.(811-813)tCc>tGc	p.S271C	ACPT_ENST00000270594.3_Missense_Mutation_p.S178C|CTD-2568A17.8_ENST00000594114.1_RNA	NM_033068.2	NP_149059.1	Q9BZG2	PPAT_HUMAN	acid phosphatase, testicular	271						integral component of membrane (GO:0016021)	acid phosphatase activity (GO:0003993)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(3)	11		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		GCAAACTTCTCCCGGGTCCAG	0.587																																							uc002pta.1		NA																	0					0						c.(811-813)TCC>TGC		testicular acid phosphatase precursor							116.0	114.0	115.0					19																	51297178		2203	4300	6503	SO:0001583	missense	93650					integral to membrane	acid phosphatase activity	g.chr19:51297178C>G	AF321918	CCDS12802.1	19q13.33	2012-10-02			ENSG00000142513	ENSG00000142513			14376	protein-coding gene	gene with protein product		606362				11414767	Standard	NM_033068		Approved		uc002pta.1	Q9BZG2		ENST00000270593.1:c.812C>G	19.37:g.51297178C>G	ENSP00000270593:p.Ser271Cys						p.S271C	NM_033068	NP_149059	Q9BZG2	PPAT_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)	8	812	+		all_neural(266;0.057)	271			Extracellular (Potential).		C0H3P7|Q9BZG3|Q9BZG4	Missense_Mutation	SNP	ENST00000270593.1	37	c.812C>G	CCDS12802.1	.	.	.	.	.	.	.	.	.	.	c	21.0	4.079081	0.76528	.	.	ENSG00000142513	ENST00000270593;ENST00000270594	T;T	0.30981	1.51;1.51	4.48	4.48	0.54585	.	0.000000	0.64402	D	0.000001	T	0.55289	0.1911	M	0.75615	2.305	0.45464	D	0.998435	D	0.89917	1.0	D	0.81914	0.995	T	0.61028	-0.7145	10	0.72032	D	0.01	-11.4503	15.0193	0.71617	0.0:1.0:0.0:0.0	.	271	Q9BZG2	PPAT_HUMAN	C	271;178	ENSP00000270593:S271C;ENSP00000270594:S178C	ENSP00000270593:S271C	S	+	2	0	ACPT	55988990	0.997000	0.39634	0.980000	0.43619	0.992000	0.81027	3.800000	0.55537	2.218000	0.71995	0.561000	0.74099	TCC		0.587	ACPT-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464434.1	NM_033068		26	111	0	0	0	0.00632	0	26	111				
SIGLEC10	89790	broad.mit.edu	37	19	51914473	51914473	+	Silent	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:51914473G>T	ENST00000339313.5	-	11	2090	c.1974C>A	c.(1972-1974)tcC>tcA	p.S658S	SIGLEC10_ENST00000356298.5_Silent_p.S658S|SIGLEC10_ENST00000442846.3_Silent_p.S415S|SIGLEC10_ENST00000436984.2_Silent_p.S515S|SIGLEC10_ENST00000432469.2_Silent_p.S480S|SIGLEC10_ENST00000439889.2_Silent_p.S600S|SIGLEC10_ENST00000353836.5_Silent_p.S563S|SIGLEC10_ENST00000525998.1_Silent_p.S473S|SIGLEC10_ENST00000441969.3_Silent_p.S505S			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	658					cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		GGCTCTCCTGGGATTCTGGGG	0.567																																							uc002pwo.2		NA																	0				skin(1)	1						c.(1972-1974)TCC>TCA		sialic acid binding Ig-like lectin 10 precursor							192.0	188.0	190.0					19																	51914473		2203	4300	6503	SO:0001819	synonymous_variant	89790				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding	g.chr19:51914473G>T	AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.1974C>A	19.37:g.51914473G>T						SIGLEC10_uc002pwp.2_Silent_p.S600S|SIGLEC10_uc002pwq.2_Silent_p.S505S|SIGLEC10_uc002pwr.2_Silent_p.S563S|SIGLEC10_uc010ycy.1_Silent_p.S473S|SIGLEC10_uc010ycz.1_Silent_p.S515S|SIGLEC10_uc010eow.2_Silent_p.S375S	p.S658S	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)	11	2590	-		all_neural(266;0.0199)	658			Cytoplasmic (Potential).		A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Silent	SNP	ENST00000339313.5	37	c.1974C>A	CCDS12832.1																																																																																				0.567	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384620.2	NM_033130		46	119	1	0	1.32667e-27	0.00361	2.41389e-27	46	119				
ZNF350	59348	broad.mit.edu	37	19	52472344	52472344	+	Nonsense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:52472344C>T	ENST00000243644.4	-	3	283	c.56G>A	c.(55-57)tGg>tAg	p.W19*	HCCAT3_ENST00000595010.1_RNA|HCCAT3_ENST00000600253.1_RNA|ZNF350_ENST00000600703.1_5'UTR	NM_021632.3	NP_067645.3	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	19	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		CCACTCCTCCCAAGTGAAGTC	0.493																																							uc002pyd.2		NA																	0				breast(1)	1						c.(55-57)TGG>TAG		zinc finger protein 350							149.0	134.0	139.0					19																	52472344		2203	4300	6503	SO:0001587	stop_gained	59348				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix|transcriptional repressor complex	DNA binding|protein binding|zinc ion binding	g.chr19:52472344C>T	AF295096	CCDS12845.1	19q13.41	2013-05-23			ENSG00000256683	ENSG00000256683		"""Zinc fingers, C2H2-type"", ""-"""	16656	protein-coding gene	gene with protein product		605422				11090615, 11161714	Standard	NM_021632		Approved	ZBRK1, ZFQR	uc002pyd.3	Q9GZX5	OTTHUMG00000182538	ENST00000243644.4:c.56G>A	19.37:g.52472344C>T	ENSP00000243644:p.Trp19*					uc002pyb.2_Intron|uc002pyc.2_Intron	p.W19*	NM_021632	NP_067645	Q9GZX5	ZN350_HUMAN		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)	3	284	-		all_neural(266;0.0505)	19			KRAB.		Q96G73|Q9HAQ4	Nonsense_Mutation	SNP	ENST00000243644.4	37	c.56G>A	CCDS12845.1	.	.	.	.	.	.	.	.	.	.	C	18.97	3.735361	0.69189	.	.	ENSG00000256683	ENST00000243644	.	.	.	3.43	1.02	0.19986	.	0.846162	0.09676	N	0.770504	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	5.9799	0.19401	0.3744:0.4424:0.1833:0.0	.	.	.	.	X	19	.	ENSP00000243644:W19X	W	-	2	0	ZNF350	57164156	0.001000	0.12720	0.836000	0.33094	0.472000	0.32918	-0.530000	0.06179	0.622000	0.30249	0.585000	0.79938	TGG		0.493	ZNF350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462278.1	NM_021632		33	95	0	0	0	0.002445	0	33	95				
ZNF578	147660	broad.mit.edu	37	19	53013918	53013918	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:53013918G>T	ENST00000421239.2	+	6	528	c.284G>T	c.(283-285)aGt>aTt	p.S95I	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	95	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		AGACATGAAAGTTATCACACT	0.393																																							uc002pzp.3		NA																	0					0						c.(283-285)AGT>ATT		zinc finger protein 578							115.0	120.0	118.0					19																	53013918		2203	4300	6503	SO:0001583	missense	147660				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53013918G>T	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.284G>T	19.37:g.53013918G>T	ENSP00000459216:p.Ser95Ile						p.S95I	NM_001099694	NP_001093164	Q96N58	ZN578_HUMAN		GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)	6	528	+			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					B4DR51|I3L1Y6	Missense_Mutation	SNP	ENST00000421239.2	37	c.284G>T	CCDS54310.1	.	.	.	.	.	.	.	.	.	.	-	12.32	1.901272	0.33535	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.48	1.48	0.22813	.	.	.	.	.	T	0.34861	0.0912	L	0.50333	1.59	0.09310	N	1	D	0.54207	0.965	P	0.48089	0.566	T	0.13575	-1.0504	7	.	.	.	.	5.7581	0.18184	0.0:0.3429:0.6571:0.0	.	95	G3V4F6	.	I	95	.	.	S	+	2	0	ZNF578	57705730	0.000000	0.05858	0.013000	0.15412	0.222000	0.24845	-0.103000	0.10940	0.835000	0.34877	0.297000	0.19635	AGT		0.393	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472		30	111	1	0	9.80776e-20	0.00632	1.70948e-19	30	111				
NLRP9	338321	broad.mit.edu	37	19	56249718	56249718	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:56249718T>A	ENST00000332836.2	-	1	50	c.23A>T	c.(22-24)gAt>gTt	p.D8V	RN7SKP109_ENST00000410592.1_RNA	NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	8	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.D8G(1)		NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CAAGCCAAAATCCGAAAAAAA	0.398																																							uc002qly.2		NA																	1	Substitution - Missense(1)		endometrium(1)	skin(4)|ovary(2)|breast(1)	7						c.(22-24)GAT>GTT		NLR family, pyrin domain containing 9							72.0	79.0	77.0					19																	56249718		2201	4300	6501	SO:0001583	missense	338321					cytoplasm	ATP binding	g.chr19:56249718T>A	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.23A>T	19.37:g.56249718T>A	ENSP00000331857:p.Asp8Val						p.D8V	NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN		GBM - Glioblastoma multiforme(193;0.123)	1	51	-		Colorectal(82;0.000133)|Ovarian(87;0.133)	8			DAPIN.		B2RN12|Q86W27	Missense_Mutation	SNP	ENST00000332836.2	37	c.23A>T	CCDS12934.1	.	.	.	.	.	.	.	.	.	.	T	11.30	1.596839	0.28445	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.50548	0.74	3.3	3.3	0.37823	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.66005	0.2746	M	0.79123	2.44	0.19300	N	0.999974	D	0.89917	1.0	D	0.85130	0.997	T	0.53143	-0.8480	9	0.87932	D	0	.	8.3819	0.32477	0.0:0.0:0.0:1.0	.	8	Q7RTR0	NALP9_HUMAN	V	8	ENSP00000331857:D8V	ENSP00000331857:D8V	D	-	2	0	NLRP9	60941530	0.330000	0.24705	0.016000	0.15963	0.278000	0.26855	2.273000	0.43381	1.774000	0.52232	0.529000	0.55759	GAT		0.398	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820		22	86	0	0	0	0.010504	0	22	86				
PEG3	5178	broad.mit.edu	37	19	57326402	57326402	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:57326402G>C	ENST00000326441.9	-	10	3771	c.3408C>G	c.(3406-3408)gaC>gaG	p.D1136E	ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.D1136E|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.D1010E|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.D1012E|ZIM2_ENST00000391708.3_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1136					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		ACTCCCGACTGTCAACCAGGC	0.483																																							uc002qnu.2		NA																	0				ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12						c.(3406-3408)GAC>GAG		paternally expressed 3 isoform 1							169.0	151.0	157.0					19																	57326402		2203	4300	6503	SO:0001583	missense	5178				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:57326402G>C	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.3408C>G	19.37:g.57326402G>C	ENSP00000326581:p.Asp1136Glu					ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.D1107E|PEG3_uc002qnv.2_Missense_Mutation_p.D1136E|PEG3_uc002qnw.2_Missense_Mutation_p.D1012E|PEG3_uc002qnx.2_Missense_Mutation_p.D1010E|PEG3_uc010etr.2_Missense_Mutation_p.D1136E	p.D1136E	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN		GBM - Glioblastoma multiforme(193;0.0269)	7	3759	-		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)	1136					A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	c.3408C>G	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	G	5.225	0.226963	0.09916	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02369	4.32;4.32	4.33	-3.9	0.04181	.	0.382752	0.22567	N	0.058397	T	0.03434	0.0099	L	0.29908	0.895	.	.	.	B;D;D	0.89917	0.067;1.0;1.0	B;D;D	0.83275	0.012;0.994;0.996	T	0.34650	-0.9820	9	0.06494	T	0.89	-18.8261	1.9743	0.03412	0.4953:0.133:0.2231:0.1485	.	1012;1136;1071	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	E	1136	ENSP00000326581:D1136E;ENSP00000403051:D1136E	ENSP00000326581:D1136E	D	-	3	2	ZIM2	62018214	0.000000	0.05858	0.001000	0.08648	0.975000	0.68041	0.011000	0.13264	-0.563000	0.06078	-0.345000	0.07892	GAC		0.483	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2			51	118	0	0	0	0.00361	0	51	118				
ZNF304	57343	broad.mit.edu	37	19	57867973	57867973	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:57867973G>C	ENST00000282286.5	+	3	909	c.736G>C	c.(736-738)Gct>Cct	p.A246P	ZNF304_ENST00000391705.3_Missense_Mutation_p.A246P|ZNF304_ENST00000443917.2_Missense_Mutation_p.A293P|ZNF304_ENST00000598744.1_Missense_Mutation_p.A204P			Q9HCX3	ZN304_HUMAN	zinc finger protein 304	246					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A246P(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)	26		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		GATGACTCATGCTGAGGTGAG	0.443																																							uc010ygw.1		NA																	1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(736-738)GCT>CCT		zinc finger protein 304							88.0	84.0	86.0					19																	57867973		2203	4300	6503	SO:0001583	missense	57343				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:57867973G>C	AJ276316	CCDS12950.1, CCDS74462.1	19q13.4	2013-01-08				ENSG00000131845		"""Zinc fingers, C2H2-type"", ""-"""	13505	protein-coding gene	gene with protein product		613840					Standard	XM_005259090		Approved		uc010ygw.2	Q9HCX3		ENST00000282286.5:c.736G>C	19.37:g.57867973G>C	ENSP00000282286:p.Ala246Pro					ZNF304_uc010etw.2_Missense_Mutation_p.A293P|ZNF304_uc010etx.2_Missense_Mutation_p.A204P	p.A246P	NM_020657	NP_065708	Q9HCX3	ZN304_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)	3	1124	+		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)	246						Missense_Mutation	SNP	ENST00000282286.5	37	c.736G>C	CCDS12950.1	.	.	.	.	.	.	.	.	.	.	g	5.668	0.307902	0.10733	.	.	ENSG00000131845	ENST00000282286;ENST00000391705;ENST00000443917	T;T;T	0.15487	2.42;2.42;2.42	3.82	-7.63	0.01290	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08313	0.0207	L	0.28115	0.83	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.29427	-1.0012	9	0.66056	D	0.02	.	1.185	0.01853	0.2238:0.1801:0.3306:0.2655	.	246;293	Q9HCX3;E7EQD3	ZN304_HUMAN;.	P	246;246;293	ENSP00000282286:A246P;ENSP00000375586:A246P;ENSP00000401642:A293P	ENSP00000282286:A246P	A	+	1	0	ZNF304	62559785	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.665000	0.05286	-3.849000	0.00099	-2.972000	0.00081	GCT		0.443	ZNF304-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465785.1			14	46	0	0	0	0.00245	0	14	46				
ZSCAN1	284312	broad.mit.edu	37	19	58565031	58565031	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:58565031C>T	ENST00000282326.1	+	6	1086	c.839C>T	c.(838-840)tCg>tTg	p.S280L		NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	280					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GCAGGCATCTCGGTAGTGCCG	0.627																																							uc002qrc.1		NA																	0				ovary(2)	2						c.(838-840)TCG>TTG		zinc finger and SCAN domain containing 1							66.0	66.0	66.0					19																	58565031		2203	4300	6503	SO:0001583	missense	284312				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58565031C>T	AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.839C>T	19.37:g.58565031C>T	ENSP00000282326:p.Ser280Leu						p.S280L	NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)	6	1086	+		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	280					Q3B798|Q6WLH8|Q86WS8	Missense_Mutation	SNP	ENST00000282326.1	37	c.839C>T	CCDS12969.1	.	.	.	.	.	.	.	.	.	.	C	9.478	1.097387	0.20552	.	.	ENSG00000152467	ENST00000282326	T	0.04706	3.57	1.14	1.14	0.20703	.	.	.	.	.	T	0.01976	0.0062	N	0.08118	0	0.45150	D	0.998167	B	0.28552	0.215	B	0.15052	0.012	T	0.53229	-0.8468	9	0.17369	T	0.5	.	5.6568	0.17647	0.0:1.0:0.0:0.0	.	280	Q8NBB4	ZSCA1_HUMAN	L	280	ENSP00000282326:S280L	ENSP00000282326:S280L	S	+	2	0	ZSCAN1	63256843	0.004000	0.15560	0.001000	0.08648	0.001000	0.01503	0.619000	0.24388	0.930000	0.37217	0.491000	0.48974	TCG		0.627	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466427.1	NM_182572		9	45	0	0	0	0.006214	0	9	45				
OTOF	9381	broad.mit.edu	37	2	26691279	26691279	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr2:26691279C>A	ENST00000272371.2	-	33	4213	c.4087G>T	c.(4087-4089)Gag>Tag	p.E1363*	OTOF_ENST00000339598.3_Nonsense_Mutation_p.E596*|OTOF_ENST00000402415.3_Nonsense_Mutation_p.E673*|OTOF_ENST00000403946.3_Nonsense_Mutation_p.E1363*|OTOF_ENST00000338581.6_Nonsense_Mutation_p.E596*	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1363					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCTCACCCTCGGTATTGTCC	0.562																																					GBM(102;732 1451 20652 24062 31372)	GBM(102;732 1451 20652 24062 31372)	uc002rhk.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7						c.(4087-4089)GAG>TAG		otoferlin isoform a							215.0	171.0	186.0					2																	26691279		2203	4300	6503	SO:0001587	stop_gained	9381				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding	g.chr2:26691279C>A	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.4087G>T	2.37:g.26691279C>A	ENSP00000272371:p.Glu1363*					OTOF_uc010yla.1_Nonsense_Mutation_p.E93*|OTOF_uc002rhh.2_Nonsense_Mutation_p.E596*|OTOF_uc002rhi.2_Nonsense_Mutation_p.E673*|OTOF_uc002rhj.2_Nonsense_Mutation_p.E596*	p.E1363*	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN			33	4214	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1363			Cytoplasmic (Potential).		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Nonsense_Mutation	SNP	ENST00000272371.2	37	c.4087G>T	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	C	41	8.859639	0.98980	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	.	.	.	5.62	5.62	0.85841	.	0.572737	0.19693	N	0.108211	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	18.2396	0.89963	0.0:1.0:0.0:0.0	.	.	.	.	X	596;596;673;1363;1363	.	ENSP00000272371:E1363X	E	-	1	0	OTOF	26544783	0.999000	0.42202	0.730000	0.30809	0.082000	0.17680	5.250000	0.65432	2.644000	0.89710	0.561000	0.74099	GAG		0.562	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3			7	58	1	0	1.06961e-07	0.00308	1.40977e-07	7	58				
GALNT14	79623	broad.mit.edu	37	2	31147628	31147628	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr2:31147628C>A	ENST00000349752.5	-	12	1852	c.1213G>T	c.(1213-1215)Gag>Tag	p.E405*	GALNT14_ENST00000324589.5_Nonsense_Mutation_p.E410*|GALNT14_ENST00000406653.1_Nonsense_Mutation_p.E385*|GALNT14_ENST00000356174.3_Nonsense_Mutation_p.E372*|GALNT14_ENST00000420311.2_Nonsense_Mutation_p.E370*|GALNT14_ENST00000486564.1_Intron	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	405					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					TAGATATTCTCCAGGTACCAC	0.532																																							uc002rnr.2		NA																	0				upper_aerodigestive_tract(2)|skin(1)	3						c.(1213-1215)GAG>TAG		N-acetylgalactosaminyltransferase 14							94.0	82.0	86.0					2																	31147628		2203	4300	6503	SO:0001587	stop_gained	79623					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	g.chr2:31147628C>A	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.1213G>T	2.37:g.31147628C>A	ENSP00000288988:p.Glu405*					GALNT14_uc002rnq.2_Nonsense_Mutation_p.E385*|GALNT14_uc002rns.2_Nonsense_Mutation_p.E410*|GALNT14_uc010ymr.1_Nonsense_Mutation_p.E370*|GALNT14_uc010ezo.1_Nonsense_Mutation_p.E372*	p.E405*	NM_024572	NP_078848	Q96FL9	GLT14_HUMAN			12	1832	-	Acute lymphoblastic leukemia(172;0.155)		405			Lumenal (Potential).		B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Nonsense_Mutation	SNP	ENST00000349752.5	37	c.1213G>T	CCDS1773.2	.	.	.	.	.	.	.	.	.	.	c	38	6.893554	0.97916	.	.	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	.	.	.	4.62	3.74	0.42951	.	0.108202	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	11.9959	0.53204	0.0:0.9146:0.0:0.0854	.	.	.	.	X	405;410;385;372;370;372	.	ENSP00000314500:E410X	E	-	1	0	GALNT14	31001132	1.000000	0.71417	0.998000	0.56505	0.846000	0.48090	4.549000	0.60726	0.935000	0.37341	0.306000	0.20318	GAG		0.532	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572		8	30	1	0	0.000442599	0.006214	0.00049876	8	30				
WDPCP	51057	broad.mit.edu	37	2	63849930	63849930	+	IGR	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr2:63849930C>A								MDH1 (15599 upstream) : RPS4XP5 (19658 downstream)																							CCCAGGAACTCCGGAGCACGC	0.617																																							uc002sck.1		NA																	0					0						c.(34-36)CGG>CGT		SubName: Full=Px19-like protein, isoform CRA_c; SubName: Full=cDNA, FLJ92457, Homo sapiens px19-like protein (PX19), mRNA;																																				SO:0001628	intergenic_variant	388955							g.chr2:63849930C>A																													2.37:g.63849930C>A							p.R12R	NR_003131						1	230	-									Silent	SNP		37	c.36G>T																																																																																				0	0.617									6	28	1	0	0.00307968	0.00308	0.00332962	6	28				
APLF	200558	broad.mit.edu	37	2	68804988	68804988	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr2:68804988G>T	ENST00000303795.4	+	10	1541	c.1370G>T	c.(1369-1371)gGg>gTg	p.G457V	APLF_ENST00000471727.1_3'UTR	NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	457					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of DNA ligation (GO:0051106)|regulation of isotype switching (GO:0045191)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|endodeoxyribonuclease activity (GO:0004520)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25						GATAATGTTGGGCAACCCAAT	0.413																																							uc002sep.2		NA																	0				ovary(2)	2						c.(1369-1371)GGG>GTG		aprataxin and PNKP like factor							173.0	169.0	170.0					2																	68804988		2203	4300	6503	SO:0001583	missense	200558				double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding	g.chr2:68804988G>T	BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621			28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13		18474613, 18077224, 17353262	Standard	NM_173545		Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	ENST00000303795.4:c.1370G>T	2.37:g.68804988G>T	ENSP00000307004:p.Gly457Val					APLF_uc002seq.1_RNA|APLF_uc002ser.1_Missense_Mutation_p.G188V	p.G457V	NM_173545	NP_775816	Q8IW19	APLF_HUMAN			10	1543	+			457					A8K476|Q53P47|Q53PB9|Q53QU0	Missense_Mutation	SNP	ENST00000303795.4	37	c.1370G>T	CCDS1888.1	.	.	.	.	.	.	.	.	.	.	G	18.56	3.649669	0.67358	.	.	ENSG00000169621	ENST00000303795	T	0.25749	1.78	4.46	3.58	0.41010	.	0.000000	0.85682	D	0.000000	T	0.45776	0.1359	M	0.71581	2.175	0.58432	D	0.999994	D	0.67145	0.996	D	0.65140	0.932	T	0.45041	-0.9288	10	0.72032	D	0.01	.	11.5117	0.50496	0.0905:0.0:0.9095:0.0	.	457	Q8IW19	APLF_HUMAN	V	457	ENSP00000307004:G457V	ENSP00000307004:G457V	G	+	2	0	APLF	68658492	0.900000	0.30661	0.282000	0.24776	0.540000	0.34992	1.204000	0.32296	0.873000	0.35799	-0.143000	0.13931	GGG		0.413	APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251759.1	NM_173545		10	47	1	0	0.00621372	0.006214	0.00664102	10	47				
CYP26B1	56603	broad.mit.edu	37	2	72360249	72360249	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr2:72360249C>T	ENST00000001146.2	-	5	1252	c.1049G>A	c.(1048-1050)gGg>gAg	p.G350E	CYP26B1_ENST00000412253.1_Missense_Mutation_p.G159E|CYP26B1_ENST00000546307.1_Missense_Mutation_p.G275E	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	350					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						GTAGCGCAGCCCACTGAGCGT	0.642																																							uc002sih.1		NA																	0				skin(2)	2						c.(1048-1050)GGG>GAG		cytochrome P450, family 26, subfamily b,							56.0	48.0	50.0					2																	72360249		2203	4300	6503	SO:0001583	missense	56603				cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding	g.chr2:72360249C>T		CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.1049G>A	2.37:g.72360249C>T	ENSP00000001146:p.Gly350Glu					CYP26B1_uc010yra.1_Missense_Mutation_p.G333E|CYP26B1_uc010yrb.1_Missense_Mutation_p.G275E	p.G350E	NM_019885	NP_063938	Q9NR63	CP26B_HUMAN			5	1049	-			350					B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Missense_Mutation	SNP	ENST00000001146.2	37	c.1049G>A	CCDS1919.1	.	.	.	.	.	.	.	.	.	.	C	11.21	1.572178	0.28092	.	.	ENSG00000003137	ENST00000001146;ENST00000412253;ENST00000546307	T;T;T	0.66995	-0.24;-0.24;-0.24	5.64	4.76	0.60689	.	0.459987	0.28182	N	0.016285	T	0.37598	0.1009	N	0.02213	-0.635	0.09310	N	0.999997	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.17979	0.02;0.02;0.012	T	0.20273	-1.0280	10	0.17832	T	0.49	-20.1321	9.2402	0.37491	0.0:0.7767:0.1459:0.0774	.	275;333;350	B7Z2K6;B7Z2P4;Q9NR63	.;.;CP26B_HUMAN	E	350;159;275	ENSP00000001146:G350E;ENSP00000401465:G159E;ENSP00000443304:G275E	ENSP00000001146:G350E	G	-	2	0	CYP26B1	72213757	0.983000	0.35010	0.256000	0.24389	0.329000	0.28539	3.236000	0.51336	1.539000	0.49286	0.650000	0.86243	GGG		0.642	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251969.1	NM_019885		12	46	0	0	0	0.000978	0	12	46				
LRRTM4	80059	broad.mit.edu	37	2	77745966	77745966	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr2:77745966C>A	ENST00000409093.1	-	3	1365	c.1029G>T	c.(1027-1029)aaG>aaT	p.K343N	LRRTM4_ENST00000409282.1_Missense_Mutation_p.K344N|LRRTM4_ENST00000409088.3_Missense_Mutation_p.K343N|LRRTM4_ENST00000409884.1_Missense_Mutation_p.K343N|LRRTM4_ENST00000409911.1_Missense_Mutation_p.K344N			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	343	LRRCT.				alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		CCTGGATGTGCTTAGGTCCCG	0.418																																							uc002snr.2		NA																	0				pancreas(3)|ovary(1)	4						c.(1027-1029)AAG>AAT		leucine rich repeat transmembrane neuronal 4							73.0	68.0	69.0					2																	77745966		1899	4109	6008	SO:0001583	missense	80059					integral to membrane		g.chr2:77745966C>A	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1029G>T	2.37:g.77745966C>A	ENSP00000386357:p.Lys343Asn					LRRTM4_uc002snq.2_Missense_Mutation_p.K343N|LRRTM4_uc002sns.2_Missense_Mutation_p.K343N|LRRTM4_uc002snt.2_Missense_Mutation_p.K344N	p.K343N	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN		Colorectal(11;0.059)	3	1444	-			343			LRRCT.|Extracellular (Potential).		Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	c.1029G>T	CCDS46346.1	.	.	.	.	.	.	.	.	.	.	C	13.41	2.227582	0.39399	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.53640	0.61;0.63;0.63;0.73;0.75	5.73	3.94	0.45596	.	0.000000	0.85682	D	0.000000	T	0.61299	0.2336	M	0.66939	2.045	0.58432	D	0.999992	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.79108	0.981;0.992;0.981	T	0.58595	-0.7609	10	0.41790	T	0.15	.	7.5397	0.27731	0.0:0.6806:0.0:0.3194	.	344;343;343	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	N	344;343;343;343;344	ENSP00000387228:K344N;ENSP00000387297:K343N;ENSP00000386357:K343N;ENSP00000386236:K343N;ENSP00000386286:K344N	ENSP00000386236:K343N	K	-	3	2	LRRTM4	77599474	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.801000	0.38843	0.765000	0.33221	0.655000	0.94253	AAG		0.418	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993		6	13	1	0	0.00116845	0.001168	0.00127809	6	13				
SEMA4C	54910	broad.mit.edu	37	2	97526877	97526878	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr2:97526877_97526878CC>AA	ENST00000305476.5	-	15	2119_2120	c.1987_1988GG>TT	c.(1987-1989)GGg>TTg	p.G663L		NM_017789.4	NP_060259.4	Q9C0C4	SEM4C_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C	663					cell migration in hindbrain (GO:0021535)|cerebellum development (GO:0021549)|muscle cell differentiation (GO:0042692)|neural tube closure (GO:0001843)|positive regulation of stress-activated MAPK cascade (GO:0032874)|semaphorin-plexin signaling pathway (GO:0071526)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle membrane (GO:0030672)	receptor activity (GO:0004872)			NS(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	17						CCACACCAGCCCCAGGTTTTCC	0.698																																							uc002sxh.3		NA																	0				skin(2)	2						c.(1987-1989)GGG>TTG		semaphorin 4C precursor																																				SO:0001583	missense	54910				muscle cell differentiation|nervous system development|positive regulation of stress-activated MAPK cascade	cell junction|integral to membrane|postsynaptic density|postsynaptic membrane|synaptic vesicle membrane	receptor activity	g.chr2:97526877_97526878CC>AA	AB051526	CCDS2029.1	2q11.2	2013-01-11			ENSG00000168758	ENSG00000168758		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10731	protein-coding gene	gene with protein product	"""M-Sema F"""	604462		SEMAI		7656991	Standard	NM_017789		Approved	Semacl1, Semaf	uc002sxh.4	Q9C0C4	OTTHUMG00000130535	ENST00000305476.5:c.1987_1988delinsAA	2.37:g.97526877_97526878delinsAA	ENSP00000306844:p.Gly663Leu					SEMA4C_uc002sxf.3_Missense_Mutation_p.G163L|SEMA4C_uc002sxe.2_Missense_Mutation_p.G204L|SEMA4C_uc002sxg.3_Missense_Mutation_p.G716L	p.G663L	NM_017789	NP_060259	Q9C0C4	SEM4C_HUMAN			15	2147_2148	-			663			Extracellular (Potential).		Q32MJ3|Q7Z5X0	Missense_Mutation	DNP	ENST00000305476.5	37	c.1987_1988GG>TT	CCDS2029.1																																																																																				0.698	SEMA4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252957.1	NM_017789		12	28	0	0	0	0.004672	0	12	28				
CFAP221	200373	broad.mit.edu	37	2	120383254	120383254	+	Silent	SNP	G	G	T	rs371319201		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr2:120383254G>T	ENST00000413369.3	+	15	1593	c.1506G>T	c.(1504-1506)tcG>tcT	p.S502S	PCDP1_ENST00000602047.1_Silent_p.S216S|PCDP1_ENST00000597189.1_3'UTR	NM_001271049.1	NP_001257978												p.S216S(1)				Colorectal(110;0.196)					CAAAACAATCGATAGCACAAG	0.428																																							uc002tmb.2		NA																	1	Substitution - coding silent(1)		large_intestine(1)		0						c.(646-648)TCG>TCT		primary ciliary dyskinesia protein 1							118.0	99.0	106.0					2																	120383254		2203	4300	6503	SO:0001819	synonymous_variant	200373					cilium	calmodulin binding	g.chr2:120383254G>T																												ENST00000413369.3:c.1506G>T	2.37:g.120383254G>T						PCDP1_uc010yyq.1_Silent_p.S346S	p.S216S	NM_001029996	NP_001025167	Q4G0U5	PCDP1_HUMAN			16	1740	+	Colorectal(110;0.196)		502						Silent	SNP	ENST00000413369.3	37	c.648G>T	CCDS33282.2	.	.	.	.	.	.	.	.	.	.	G	1.730	-0.494311	0.04322	.	.	ENSG00000163075	ENST00000443972;ENST00000413057	.	.	.	4.17	-8.34	0.00988	.	.	.	.	.	T	0.22975	0.0555	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.06972	-1.0797	4	.	.	.	1.104	5.0918	0.14711	0.1175:0.2647:0.4634:0.1544	.	.	.	.	L	61;50	.	.	R	+	2	0	AC069154.2	120099724	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.822000	0.00357	-4.381000	0.00053	-1.114000	0.02060	CGA		0.428	PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464236.1			5	17	1	0	1.23904e-05	0.000602	1.51528e-05	5	17				
AMMECR1L	83607	broad.mit.edu	37	2	128631402	128631402	+	Splice_Site	SNP	T	T	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr2:128631402T>C	ENST00000272647.5	-	3	667	c.407A>G	c.(406-408)tAt>tGt	p.Y136C	AMMECR1L_ENST00000393001.1_Splice_Site_p.Y136C	NM_001199140.1	NP_001186069.1	Q6DCA0	AMERL_HUMAN	AMMECR1-like	136	AMMECR1. {ECO:0000255|PROSITE- ProRule:PRU00467}.									central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	9	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)		ATTTACTCACTAGGGGTCATT	0.498																																							uc002tpl.2		NA																	0				central_nervous_system(1)	1						c.(406-408)TAT>TGT		AMME chromosomal region gene 1-like							176.0	181.0	179.0					2																	128631402		2203	4300	6503	SO:0001630	splice_region_variant	83607							g.chr2:128631402T>C		CCDS2152.1	2q21	2012-11-15	2012-11-15		ENSG00000144233	ENSG00000144233			28658	protein-coding gene	gene with protein product			"""AMME chromosomal region gene 1-like"""				Standard	NM_001199140		Approved	MGC4268	uc002tpl.3	Q6DCA0	OTTHUMG00000131535	ENST00000272647.5:c.407+1A>G	2.37:g.128631402T>C						AMMECR1L_uc002tpm.2_Missense_Mutation_p.Y136C	p.Y136C	NM_031445	NP_113633	Q6DCA0	AMERL_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.07)	3	658	-	Colorectal(110;0.1)		136			AMMECR1.		B4E276	Missense_Mutation	SNP	ENST00000272647.5	37	c.407A>G	CCDS2152.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.341310	0.81911	.	.	ENSG00000144233	ENST00000272647;ENST00000393001	.	.	.	5.37	5.37	0.77165	AMMECR1 domain (2);	0.000000	0.64402	D	0.000002	T	0.57577	0.2063	L	0.52573	1.65	0.80722	D	1	B	0.31640	0.333	B	0.32533	0.147	T	0.55554	-0.8123	8	.	.	.	-20.1996	15.3775	0.74621	0.0:0.0:0.0:1.0	.	136	Q6DCA0	AMERL_HUMAN	C	136	.	.	Y	-	2	0	AMMECR1L	128347872	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.649000	0.83500	2.048000	0.60808	0.533000	0.62120	TAT		0.498	AMMECR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254392.1	NM_031445	Missense_Mutation	57	124	0	0	0	0.00361	0	57	124				
NEB	4703	broad.mit.edu	37	2	152536299	152536299	+	Missense_Mutation	SNP	T	T	C	rs187343008	byFrequency	TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr2:152536299T>C	ENST00000172853.10	-	32	3338	c.3191A>G	c.(3190-3192)tAt>tGt	p.Y1064C	NEB_ENST00000397345.3_Missense_Mutation_p.Y1064C|NEB_ENST00000603639.1_Missense_Mutation_p.Y1064C|NEB_ENST00000604864.1_Missense_Mutation_p.Y1064C|NEB_ENST00000427231.2_Missense_Mutation_p.Y1064C|NEB_ENST00000409198.1_Missense_Mutation_p.Y1064C			P20929	NEBU_HUMAN	nebulin	1064					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCTCAGGTCATATCCCTTCTT	0.448													T|||	9	0.00179712	0.0	0.0	5008	,	,		14896	0.0		0.0089	False		,,,				2504	0.0						uc010fnx.2		NA																	0				ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20						c.(3190-3192)TAT>TGT		nebulin isoform 3		T	CYS/TYR,CYS/TYR,CYS/TYR	5,3909		0,5,1952	111.0	110.0	110.0		3191,3191,3191	5.7	1.0	2		110	83,8227		1,81,4073	yes	missense,missense,missense	NEB	NM_001164507.1,NM_001164508.1,NM_004543.4	194,194,194	1,86,6025	CC,CT,TT		0.9988,0.1277,0.7199	probably-damaging,probably-damaging,probably-damaging	1064/8526,1064/8526,1064/6670	152536299	88,12136	1957	4155	6112	SO:0001583	missense	4703				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	g.chr2:152536299T>C	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.3191A>G	2.37:g.152536299T>C	ENSP00000172853:p.Tyr1064Cys						p.Y1064C	NM_004543	NP_004534	P20929	NEBU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.219)	32	3382	-			1064			Nebulin 26.		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37	c.3191A>G		8	0.003663003663003663	0	0.0	0	0.0	0	0.0	8	0.010554089709762533	T	19.35	3.811668	0.70797	0.001277	0.009988	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.12569	2.69;2.75;2.75;2.67	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.30198	0.0757	M	0.79926	2.475	0.80722	D	1	D	0.69078	0.997	D	0.64687	0.928	T	0.12016	-1.0564	10	0.54805	T	0.06	.	15.0328	0.71720	0.0:0.0:0.0:1.0	.	1064	P20929	NEBU_HUMAN	C	1064	ENSP00000386259:Y1064C;ENSP00000380505:Y1064C;ENSP00000416578:Y1064C;ENSP00000172853:Y1064C	ENSP00000172853:Y1064C	Y	-	2	0	NEB	152244545	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.060000	0.71141	2.197000	0.70478	0.528000	0.53228	TAT		0.448	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		3	75	0	0	0	0.004672	0	3	75				
ACVR1C	130399	broad.mit.edu	37	2	158390505	158390505	+	Silent	SNP	T	T	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr2:158390505T>A	ENST00000243349.8	-	9	1767	c.1407A>T	c.(1405-1407)ggA>ggT	p.G469G	ACVR1C_ENST00000335450.7_Silent_p.G389G|ACVR1C_ENST00000348328.5_Silent_p.G312G|ACVR1C_ENST00000409680.3_Silent_p.G419G	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						GGCGGGCCGCTCCGTTGGCAT	0.383																																							uc002tzk.3		NA																	0				lung(3)|ovary(2)|skin(2)	7						c.(1405-1407)GGA>GGT		activin A receptor, type IC isoform 1							91.0	100.0	97.0					2																	158390505		2203	4300	6503	SO:0001819	synonymous_variant	130399				apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity	g.chr2:158390505T>A	BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.1407A>T	2.37:g.158390505T>A						ACVR1C_uc002tzl.3_Silent_p.G389G|ACVR1C_uc010fof.2_Silent_p.G312G|ACVR1C_uc010foe.2_Silent_p.G419G	p.G469G	NM_145259	NP_660302	Q8NER5	ACV1C_HUMAN			9	1650	-			469			Protein kinase.|Cytoplasmic (Potential).			Silent	SNP	ENST00000243349.8	37	c.1407A>T	CCDS2205.1																																																																																				0.383	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254924.2	NM_145259		17	47	0	0	0	0.010504	0	17	47				
ATF2	1386	broad.mit.edu	37	2	175983089	175983089	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr2:175983089G>A	ENST00000264110.2	-	6	506	c.208C>T	c.(208-210)Cca>Tca	p.P70S	ATF2_ENST00000409635.1_Missense_Mutation_p.P12S|ATF2_ENST00000409437.1_Missense_Mutation_p.P52S|ATF2_ENST00000409833.1_Missense_Mutation_p.P70S|ATF2_ENST00000426833.3_Missense_Mutation_p.P52S|ATF2_ENST00000392543.2_Intron|ATF2_ENST00000538946.1_Missense_Mutation_p.P52S|ATF2_ENST00000392544.1_Missense_Mutation_p.P70S|ATF2_ENST00000409499.1_Intron|ATF2_ENST00000487334.2_Missense_Mutation_p.P52S|ATF2_ENST00000345739.5_Missense_Mutation_p.P12S	NM_001256090.1|NM_001256091.1|NM_001880.3	NP_001243019.1|NP_001243020.1|NP_001871.2	P15336	ATF2_HUMAN	activating transcription factor 2	70					adipose tissue development (GO:0060612)|cellular response to DNA damage stimulus (GO:0006974)|chromatin organization (GO:0006325)|fat cell differentiation (GO:0045444)|histone acetylation (GO:0016573)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|outflow tract morphogenesis (GO:0003151)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta2 production (GO:0032915)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	cAMP response element binding (GO:0035497)|cAMP response element binding protein binding (GO:0008140)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.125)		Pseudoephedrine(DB00852)	GTTGGTGTTGGGGTCTGATCT	0.333																																					Pancreas(17;87 705 4534 15538 30988)	Pancreas(17;87 705 4534 15538 30988)	uc002ujl.2		NA																	0				lung(1)|breast(1)|pancreas(1)	3						c.(208-210)CCA>TCA		activating transcription factor 2							98.0	95.0	96.0					2																	175983089		2202	4299	6501	SO:0001583	missense	1386				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nucleoplasm	protein dimerization activity|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding	g.chr2:175983089G>A	X15875	CCDS2262.1, CCDS58737.1, CCDS58738.1, CCDS58739.1	2q32	2013-01-10			ENSG00000115966	ENSG00000115966		"""basic leucine zipper proteins"""	784	protein-coding gene	gene with protein product		123811	"""cAMP responsive element binding protein 2"""	CREB2		1833307, 1838349	Standard	NM_001880		Approved	TREB7, CRE-BP1, HB16	uc002ujl.4	P15336	OTTHUMG00000132424	ENST00000264110.2:c.208C>T	2.37:g.175983089G>A	ENSP00000264110:p.Pro70Ser					ATF2_uc010fqv.2_Missense_Mutation_p.P21S|ATF2_uc002ujv.2_5'UTR|ATF2_uc002ujm.2_Missense_Mutation_p.P12S|ATF2_uc002ujn.2_RNA|ATF2_uc002ujo.2_Intron|ATF2_uc002ujp.2_RNA|ATF2_uc002ujq.2_Missense_Mutation_p.P70S|ATF2_uc002ujr.2_RNA|ATF2_uc010fqu.2_Missense_Mutation_p.P52S|ATF2_uc002ujs.2_Missense_Mutation_p.P12S|ATF2_uc002ujt.2_RNA|ATF2_uc002uju.2_RNA|ATF2_uc002ujw.1_Missense_Mutation_p.P12S|ATF2_uc002ujx.1_RNA|ATF2_uc002ujy.1_Missense_Mutation_p.P70S	p.P70S	NM_001880	NP_001871	P15336	ATF2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.125)		6	470	-			70					A1L3Z2|A4D7U4|A4D7U5|A4D7V1|D3DPE9|G8JLM5|Q13000|Q3B7B7|Q4ZFU9|Q53RY2|Q8TAR1|Q96JT8	Missense_Mutation	SNP	ENST00000264110.2	37	c.208C>T	CCDS2262.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.789895	0.90367	.	.	ENSG00000115966	ENST00000264110;ENST00000345739;ENST00000542046;ENST00000409437;ENST00000409635;ENST00000392544;ENST00000426833;ENST00000538946;ENST00000487334;ENST00000437522;ENST00000409833	T;D;T;D;T;T;T;T;T	0.95171	1.5;-3.63;1.5;-3.63;1.5;1.5;1.5;1.5;1.5	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.97508	0.9184	M	0.82323	2.585	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.992;1.0;1.0;1.0	D	0.97854	1.0276	10	0.87932	D	0	-14.7081	19.6783	0.95946	0.0:0.0:1.0:0.0	.	52;47;12;70	A4D7U4;B3KY57;Q3B7B7;P15336	.;.;.;ATF2_HUMAN	S	70;12;47;52;12;70;52;52;52;12;70	ENSP00000264110:P70S;ENSP00000340576:P12S;ENSP00000386326:P52S;ENSP00000387093:P12S;ENSP00000376327:P70S;ENSP00000407911:P52S;ENSP00000437952:P52S;ENSP00000443513:P52S;ENSP00000386526:P70S	ENSP00000264110:P70S	P	-	1	0	ATF2	175691335	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.724000	0.93272	0.585000	0.79938	CCA		0.333	ATF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255562.1	NM_001880		6	19	0	0	0	0.001168	0	6	19				
TTN	7273	broad.mit.edu	37	2	179638339	179638339	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr2:179638339C>A	ENST00000591111.1	-	32	7668	c.7444G>T	c.(7444-7446)Gat>Tat	p.D2482Y	TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D2436Y|TTN_ENST00000342992.6_Missense_Mutation_p.D2482Y|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.D2436Y|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.D2482Y|TTN_ENST00000589042.1_Missense_Mutation_p.D2482Y|TTN_ENST00000342175.6_Missense_Mutation_p.D2436Y			Q8WZ42	TITIN_HUMAN	titin	12803	Ig-like 14.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTTGTTCATCATTTAAGTAC	0.423																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(7444-7446)GAT>TAT		titin isoform N2-A							126.0	115.0	119.0					2																	179638339		2203	4300	6503	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179638339C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.7444G>T	2.37:g.179638339C>A	ENSP00000465570:p.Asp2482Tyr					TTN_uc010zfh.1_Missense_Mutation_p.D2436Y|TTN_uc010zfi.1_Missense_Mutation_p.D2436Y|TTN_uc010zfj.1_Missense_Mutation_p.D2436Y|TTN_uc002unb.2_Missense_Mutation_p.D2482Y	p.D2482Y	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		32	7668	-			2482					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.7444G>T		.	.	.	.	.	.	.	.	.	.	C	12.40	1.926999	0.34002	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	5.82	5.82	0.92795	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.68933	0.3055	M	0.89353	3.025	0.36860	D	0.888371	D;D;D;D;D	0.89917	0.997;0.997;0.997;0.997;1.0	D;D;D;D;D	0.76575	0.964;0.964;0.964;0.964;0.988	T	0.78155	-0.2314	9	0.87932	D	0	.	13.3254	0.60457	0.0:0.9282:0.0:0.0718	.	2436;2436;2436;2482;2482	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	Y	2482;2436;2436;2436;2436;2482	ENSP00000343764:D2482Y;ENSP00000434586:D2436Y;ENSP00000340554:D2436Y;ENSP00000352154:D2436Y;ENSP00000354117:D2482Y	ENSP00000340554:D2436Y	D	-	1	0	TTN	179346584	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	6.091000	0.71406	2.765000	0.95021	0.650000	0.86243	GAT		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		3	50	1	0	0.000602214	0.000602	0.000674552	3	50				
SATB2	23314	broad.mit.edu	37	2	200137283	200137283	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr2:200137283C>A	ENST00000417098.1	-	11	2669	c.1853G>T	c.(1852-1854)cGc>cTc	p.R618L	SATB2_ENST00000443023.1_Missense_Mutation_p.R559L|SATB2_ENST00000260926.5_Missense_Mutation_p.R618L|SATB2_ENST00000457245.1_Missense_Mutation_p.R618L|SATB2_ENST00000428695.1_Missense_Mutation_p.R500L	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	618					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GATCTTTGTGCGAGACCGGGG	0.562																																					Colon(30;262 767 11040 24421 36230)	Colon(30;262 767 11040 24421 36230)	uc002uuy.1		NA																	0				ovary(1)	1						c.(1852-1854)CGC>CTC		SATB homeobox 2							70.0	75.0	73.0					2																	200137283		2203	4300	6503	SO:0001583	missense	23314					cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity	g.chr2:200137283C>A	AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.1853G>T	2.37:g.200137283C>A	ENSP00000401112:p.Arg618Leu					SATB2_uc010fsq.1_Missense_Mutation_p.R500L|SATB2_uc002uuz.1_Missense_Mutation_p.R618L|SATB2_uc002uva.1_Missense_Mutation_p.R618L	p.R618L	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN			11	2670	-			618			Homeobox.		A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	ENST00000417098.1	37	c.1853G>T	CCDS2327.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919910	0.73098	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000428695;ENST00000457245	D;D;D;D;D	0.99158	-5.5;-5.5;-5.5;-5.5;-5.5	5.47	5.47	0.80525	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98520	0.9506	N	0.19112	0.55	0.58432	D	0.999994	D;B	0.64830	0.994;0.002	D;B	0.74023	0.982;0.004	D	0.99934	1.1347	10	0.72032	D	0.01	-14.3378	19.7423	0.96237	0.0:1.0:0.0:0.0	.	500;618	Q3ZB87;Q9UPW6	.;SATB2_HUMAN	L	618;559;618;500;618	ENSP00000401112:R618L;ENSP00000388764:R559L;ENSP00000260926:R618L;ENSP00000388581:R500L;ENSP00000405420:R618L	ENSP00000260926:R618L	R	-	2	0	SATB2	199845528	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.541000	0.67212	2.737000	0.93849	0.644000	0.83932	CGC		0.562	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256140.1	NM_015265		27	87	1	0	4.22769e-11	0.00632	6.35859e-11	27	87				
KIF1A	547	broad.mit.edu	37	2	241683359	241683359	+	Splice_Site	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr2:241683359C>A	ENST00000320389.7	-	31	3439	c.3281G>T	c.(3280-3282)aGc>aTc	p.S1094I	KIF1A_ENST00000498729.2_Splice_Site_p.S1195I	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	1094					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GGGCGCTAACCTGAGCACGTC	0.592																																							uc002vzy.2		NA																	0				lung(1)	1						c.(3280-3282)AGC>ATC		axonal transport of synaptic vesicles							84.0	93.0	90.0					2																	241683359		1957	4132	6089	SO:0001630	splice_region_variant	547				anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity	g.chr2:241683359C>A	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.3281+1G>T	2.37:g.241683359C>A						KIF1A_uc010fzk.2_Missense_Mutation_p.S1195I|KIF1A_uc002vzz.1_Missense_Mutation_p.S1195I	p.S1094I	NM_004321	NP_004312	Q12756	KIF1A_HUMAN		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)	31	3427	-		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	1094					B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	c.3281G>T	CCDS46561.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.83|12.83	2.054718|2.054718	0.36277|0.36277	.|.	.|.	ENSG00000130294|ENSG00000130294	ENST00000431776|ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283	.|T;T;T	.|0.75821	.|-0.97;-0.97;-0.97	4.91|4.91	4.03|4.03	0.46877|0.46877	.|.	.|0.000000	.|0.85682	.|U	.|0.000000	T|T	0.80144|0.80144	0.4569|0.4569	L|L	0.45581|0.45581	1.43|1.43	0.54753|0.54753	D|D	0.99998|0.99998	.|P;D;D	.|0.76494	.|0.729;0.999;0.991	.|B;D;P	.|0.68943	.|0.32;0.961;0.818	T|T	0.78502|0.78502	-0.2179|-0.2179	5|9	.|.	.|.	.|.	.|.	13.0725|13.0725	0.59070|0.59070	0.0:0.9218:0.0:0.0782|0.0:0.9218:0.0:0.0782	.|.	.|1195;1195;1094	.|F5H045;Q12756-2;Q12756	.|.;.;KIF1A_HUMAN	S|I	18|1094;1195;1195;1195	.|ENSP00000322791:S1094I;ENSP00000438388:S1195I;ENSP00000384231:S1195I	.|.	A|S	-|-	1|2	0|0	KIF1A|KIF1A	241332032|241332032	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.017000|0.017000	0.09413|0.09413	7.618000|7.618000	0.83043|0.83043	1.067000|1.067000	0.40740|0.40740	-0.218000|-0.218000	0.12543|0.12543	GCC|AGC		0.592	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	Missense_Mutation	30	88	1	0	1.13719e-10	0.008361	1.66997e-10	30	88				
BFSP1	631	broad.mit.edu	37	20	17474970	17474970	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr20:17474970G>T	ENST00000377873.3	-	8	1786	c.1747C>A	c.(1747-1749)Cca>Aca	p.P583T	BFSP1_ENST00000377868.2_Missense_Mutation_p.P458T|BFSP1_ENST00000544874.1_Missense_Mutation_p.P444T|BFSP1_ENST00000536626.1_Missense_Mutation_p.P444T	NM_001195.3	NP_001186.1	Q12934	BFSP1_HUMAN	beaded filament structural protein 1, filensin	583	Tail.				cell maturation (GO:0048469)|lens fiber cell development (GO:0070307)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)|stomach(1)	18						GGTATAGATGGTTCCTCTGCA	0.597																																							uc002wpo.2		NA																	0				central_nervous_system(1)	1						c.(1747-1749)CCA>ACA		filensin isoform 1							119.0	119.0	119.0					20																	17474970		2203	4300	6503	SO:0001583	missense	631					cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens	g.chr20:17474970G>T	Y16717	CCDS13126.1, CCDS54448.1, CCDS63229.1	20p12.1	2014-06-05			ENSG00000125864	ENSG00000125864		"""Intermediate filaments type VI, eye lens intermediate filaments"""	1040	protein-coding gene	gene with protein product		603307				9787085	Standard	NM_001161705		Approved	CP94, CP115, LIFL-H, filensin	uc002wpo.3	Q12934	OTTHUMG00000031940	ENST00000377873.3:c.1747C>A	20.37:g.17474970G>T	ENSP00000367104:p.Pro583Thr					BFSP1_uc002wpp.2_Missense_Mutation_p.P458T|BFSP1_uc010zrn.1_Missense_Mutation_p.P444T|BFSP1_uc010zro.1_Missense_Mutation_p.P444T	p.P583T	NM_001195	NP_001186	Q12934	BFSP1_HUMAN			8	1786	-			583			Tail.		F5H0G1|O43595|O76034|O95676|Q8IVZ6|Q9HBX4	Missense_Mutation	SNP	ENST00000377873.3	37	c.1747C>A	CCDS13126.1	.	.	.	.	.	.	.	.	.	.	G	18.60	3.658000	0.67586	.	.	ENSG00000125864	ENST00000377873;ENST00000377868;ENST00000536626;ENST00000544874	T;T;T;T	0.61158	0.13;0.13;0.13;0.13	5.04	4.09	0.47781	.	0.350056	0.29972	N	0.010737	T	0.65760	0.2722	L	0.55990	1.75	0.26564	N	0.973676	D;D	0.65815	0.964;0.995	P;P	0.58721	0.602;0.844	T	0.60214	-0.7307	10	0.56958	D	0.05	-5.5597	12.0271	0.53377	0.0849:0.0:0.9151:0.0	.	458;583	Q12934-2;Q12934	.;BFSP1_HUMAN	T	583;458;444;444	ENSP00000367104:P583T;ENSP00000367099:P458T;ENSP00000442522:P444T;ENSP00000439870:P444T	ENSP00000367099:P458T	P	-	1	0	BFSP1	17422970	0.811000	0.29063	0.039000	0.18376	0.168000	0.22595	1.976000	0.40579	1.112000	0.41740	0.655000	0.94253	CCA		0.597	BFSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078119.6	NM_001195		6	173	1	0	0.00198382	0.001984	0.00215106	6	173				
TTI1	9675	broad.mit.edu	37	20	36641088	36641088	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr20:36641088G>T	ENST00000373448.2	-	3	1369	c.1131C>A	c.(1129-1131)agC>agA	p.S377R	TTI1_ENST00000373447.3_Missense_Mutation_p.S377R|TTI1_ENST00000487362.1_Intron|TTI1_ENST00000449821.1_Missense_Mutation_p.S377R	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	377					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)				breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						GGGAATGCAGGCTTTCTGACA	0.453																																							uc002xhl.2		NA																	0					0						c.(1129-1131)AGC>AGA		hypothetical protein LOC9675							153.0	155.0	155.0					20																	36641088		2203	4300	6503	SO:0001583	missense	9675						binding	g.chr20:36641088G>T	BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.1131C>A	20.37:g.36641088G>T	ENSP00000362547:p.Ser377Arg					KIAA0406_uc002xhm.2_Missense_Mutation_p.S377R	p.S377R	NM_014657	NP_055472	O43156	TTI1_HUMAN			3	1340	-		Myeloproliferative disorder(115;0.00874)	377					D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Missense_Mutation	SNP	ENST00000373448.2	37	c.1131C>A	CCDS13300.1	.	.	.	.	.	.	.	.	.	.	G	12.07	1.827616	0.32329	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	T;T;T	0.14144	2.53;2.53;2.53	5.5	4.49	0.54785	Armadillo-like helical (1);Armadillo-type fold (1);	0.040549	0.85682	D	0.000000	T	0.09335	0.0230	N	0.22421	0.69	0.35981	D	0.836024	B	0.26258	0.145	B	0.24541	0.054	T	0.21348	-1.0248	10	0.15066	T	0.55	-26.8744	13.809	0.63250	0.0834:0.0:0.9166:0.0	.	377	O43156	TTI1_HUMAN	R	377	ENSP00000362547:S377R;ENSP00000362546:S377R;ENSP00000407270:S377R	ENSP00000362546:S377R	S	-	3	2	TTI1	36074502	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	0.762000	0.26503	2.861000	0.98227	0.655000	0.94253	AGC		0.453	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657		59	134	1	0	4.48484e-38	0.00361	8.32261e-38	59	134				
PPP1R16B	26051	broad.mit.edu	37	20	37546959	37546959	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr20:37546959G>C	ENST00000299824.1	+	11	1543	c.1354G>C	c.(1354-1356)Gac>Cac	p.D452H	PPP1R16B_ENST00000373331.2_Missense_Mutation_p.D410H	NM_015568.2	NP_056383.1	Q96T49	PP16B_HUMAN	protein phosphatase 1, regulatory subunit 16B	452					regulation of filopodium assembly (GO:0051489)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(23)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	49		Myeloproliferative disorder(115;0.00878)				TGAGGTGCCTGACTACAGCAT	0.622																																							uc002xje.2		NA																	0				upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3						c.(1354-1356)GAC>CAC		protein phosphatase 1 regulatory inhibitor							140.0	130.0	133.0					20																	37546959		2203	4300	6503	SO:0001583	missense	26051				regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding	g.chr20:37546959G>C	AB020630	CCDS13309.1, CCDS54462.1	20q11.23	2013-01-10	2011-10-04		ENSG00000101445	ENSG00000101445		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	15850	protein-coding gene	gene with protein product	"""TGF-beta-inhibited membrane-associated protein"", ""ankyrin repeat domain protein 4"""	613275	"""protein phosphatase 1, regulatory (inhibitor) subunit 16B"""			10048485, 12055102	Standard	NM_001172735		Approved	KIAA0823, TIMAP, ANKRD4	uc002xje.3	Q96T49	OTTHUMG00000032465	ENST00000299824.1:c.1354G>C	20.37:g.37546959G>C	ENSP00000299824:p.Asp452His					PPP1R16B_uc010ggc.2_Missense_Mutation_p.D410H	p.D452H	NM_015568	NP_056383	Q96T49	PP16B_HUMAN			11	1543	+		Myeloproliferative disorder(115;0.00878)	452					A2RRR6|E9PFS8|O94912|Q5W9G4|Q9NQG4	Missense_Mutation	SNP	ENST00000299824.1	37	c.1354G>C	CCDS13309.1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.287798	0.59976	.	.	ENSG00000101445	ENST00000299824;ENST00000373331	T;T	0.74947	-0.62;-0.89	5.3	5.3	0.74995	.	0.350233	0.30639	N	0.009186	T	0.79009	0.4374	L	0.40543	1.245	0.32374	N	0.555405	D;P	0.69078	0.997;0.935	P;P	0.59221	0.854;0.679	T	0.82297	-0.0527	10	0.49607	T	0.09	.	17.1291	0.86722	0.0:0.0:1.0:0.0	.	410;452	E9PFS8;Q96T49	.;PP16B_HUMAN	H	452;410	ENSP00000299824:D452H;ENSP00000362428:D410H	ENSP00000299824:D452H	D	+	1	0	PPP1R16B	36980373	1.000000	0.71417	0.989000	0.46669	0.983000	0.72400	4.967000	0.63722	2.474000	0.83562	0.655000	0.94253	GAC		0.622	PPP1R16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079220.2	NM_015568		52	151	0	0	0	0.00361	0	52	151				
PTPRT	11122	broad.mit.edu	37	20	40828028	40828028	+	Splice_Site	SNP	C	C	A	rs142326423		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr20:40828028C>A	ENST00000373187.1	-	16	2342	c.2343G>T	c.(2341-2343)ttG>ttT	p.L781F	PTPRT_ENST00000373198.4_Splice_Site_p.L800F|PTPRT_ENST00000373201.1_Splice_Site_p.R771S|PTPRT_ENST00000356100.2_Splice_Site_p.R790S|PTPRT_ENST00000373184.1_Splice_Site_p.R771S|PTPRT_ENST00000373193.3_Missense_Mutation_p.R784S|PTPRT_ENST00000373190.1_Splice_Site_p.L781F			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	781					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.R803R(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TGGCCAGCTTCCTTTGGGACA	0.562																																							uc002xkg.2		NA																	1	Substitution - coding silent(1)	p.R803R(1)	skin(1)	skin(8)|ovary(7)|lung(5)	20						c.(2341-2343)TTG>TTT		protein tyrosine phosphatase, receptor type, T							96.0	101.0	100.0					20																	40828028		1977	4146	6123	SO:0001630	splice_region_variant	11122				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity	g.chr20:40828028C>A	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.2343-1G>T	20.37:g.40828028C>A						PTPRT_uc010ggj.2_Missense_Mutation_p.L800F|PTPRT_uc010ggi.2_5'UTR	p.L781F	NM_007050	NP_008981	O14522	PTPRT_HUMAN			16	2527	-		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)	781			Cytoplasmic (Potential).		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	c.2343G>T	CCDS42874.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.02|16.02	3.004223|3.004223	0.54254|0.54254	.|.	.|.	ENSG00000196090|ENSG00000196090	ENST00000373190;ENST00000373187|ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T|T;T;T;T;T	0.35048|0.38560	1.34;1.33|1.31;1.13;1.31;1.15;1.14	5.93|5.93	5.93|5.93	0.95920|0.95920	.|.	.|0.212194	.|0.38897	.|N	.|0.001536	T|T	0.43033|0.43033	0.1229|0.1229	L|L	0.34521|0.34521	1.04|1.04	0.48762|0.48762	D|D	0.999709|0.999709	D;P|.	0.53462|.	0.96;0.932|.	D;P|.	0.66351|.	0.943;0.879|.	T|T	0.13335|0.13335	-1.0513|-1.0513	9|8	0.46703|0.33940	T|T	0.11|0.23	.|.	13.5351|13.5351	0.61643|0.61643	0.0:0.9291:0.0:0.0709|0.0:0.9291:0.0:0.0709	.|.	800;781|.	O14522-1;O14522|.	.;PTPRT_HUMAN|.	F|S	781|784;790;803;771;771	ENSP00000362286:L781F;ENSP00000362283:L781F|ENSP00000362289:R784S;ENSP00000348408:R790S;ENSP00000362294:R803S;ENSP00000362280:R771S;ENSP00000362297:R771S	ENSP00000362283:L781F|ENSP00000348408:R790S	L|R	-|-	3|3	2|2	PTPRT|PTPRT	40261442|40261442	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.418000|4.418000	0.59828|0.59828	2.814000|2.814000	0.96858|0.96858	0.591000|0.591000	0.81541|0.81541	TTG|AGG		0.562	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		Missense_Mutation	65	128	1	0	9.04393e-38	0.00361	1.66999e-37	65	128				
TP53RK	112858	broad.mit.edu	37	20	45315870	45315870	+	Splice_Site	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr20:45315870C>T	ENST00000372102.3	-	2	314	c.289G>A	c.(289-291)Gaa>Aaa	p.E97K	RP1-28H20.3_ENST00000606362.1_lincRNA			Q96S44	PRPK_HUMAN	TP53 regulating kinase	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				lipopolysaccharide biosynthetic process (GO:0009103)|protein phosphorylation (GO:0006468)|tRNA processing (GO:0008033)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|hydrolase activity (GO:0016787)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|large_intestine(1)|lung(4)|skin(1)	7		Myeloproliferative disorder(115;0.0122)				GGCAGATATTCCTGAAATCAA	0.343																																							uc002xsk.2		NA																	0					0						c.(283-285)GGA>GAA		p53-related protein kinase							135.0	157.0	150.0					20																	45315870		2191	4298	6489	SO:0001630	splice_region_variant	112858				lipopolysaccharide biosynthetic process	membrane|nucleus	ATP binding|p53 binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr20:45315870C>T		CCDS13401.1	20q13.2	2014-05-14	2004-05-10	2004-05-12	ENSG00000172315	ENSG00000172315			16197	protein-coding gene	gene with protein product		608679	"""chromosome 20 open reading frame 64"""	C20orf64		11546806, 12914926	Standard	NM_033550		Approved	dJ101A2.2, prpk, Nori-2p, BUD32	uc002xsk.3	Q96S44	OTTHUMG00000085887	ENST00000372102.3:c.289-1G>A	20.37:g.45315870C>T						SLC13A3_uc002xsg.1_5'Flank|SLC13A3_uc010gho.1_5'Flank|TP53RK_uc002xsj.2_Missense_Mutation_p.E97K	p.G95E	NM_033550	NP_291028	Q96S44	PRPK_HUMAN			2	507	-		Myeloproliferative disorder(115;0.0122)	95			Nuclear localization signal (Potential).|Protein kinase.		B3KU44|Q3T977|Q5JZ01|Q6NZ60|Q96FM7|Q9NQE6	Missense_Mutation	SNP	ENST00000372102.3	37	c.284G>A		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.57|15.57	2.872338|2.872338	0.51695|0.51695	.|.	.|.	ENSG00000172315|ENSG00000172315	ENST00000372102|ENST00000372114	T|T	0.07800|0.35236	3.16|1.32	5.38|5.38	5.38|5.38	0.77491|0.77491	.|Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.69744|0.69744	0.3145|0.3145	M|M	0.90977|0.90977	3.165|3.165	0.41650|0.41650	D|D	0.989129|0.989129	B|D	0.30973|0.89917	0.302|1.0	B|D	0.27500|0.87578	0.08|0.998	T|T	0.75847|0.75847	-0.3173|-0.3173	9|10	0.09843|0.59425	T|D	0.71|0.04	.|.	19.3333|19.3333	0.94303|0.94303	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	97|95	Q5JZ02|Q96S44	.|PRPK_HUMAN	K|E	97|95	ENSP00000361174:E97K|ENSP00000361186:G95E	ENSP00000361174:E97K|ENSP00000361186:G95E	E|G	-|-	1|2	0|0	TP53RK|TP53RK	44749277|44749277	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.390000|0.390000	0.30446|0.30446	7.559000|7.559000	0.82265|0.82265	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	GAA|GGA		0.343	TP53RK-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000193688.1	NM_033550	Missense_Mutation	61	180	0	0	0	0.00361	0	61	180				
HRH3	11255	broad.mit.edu	37	20	60791826	60791826	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr20:60791826A>T	ENST00000340177.5	-	3	858	c.574T>A	c.(574-576)Ttc>Atc	p.F192I	HRH3_ENST00000317393.6_Missense_Mutation_p.F192I	NM_007232.2	NP_009163.2	Q9Y5N1	HRH3_HUMAN	histamine receptor H3	192					brain development (GO:0007420)|drinking behavior (GO:0042756)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of gamma-aminobutyric acid secretion (GO:0014053)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of serotonin secretion (GO:0014063)|neurotransmitter secretion (GO:0007269)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of norepinephrine secretion (GO:0014061)|response to organic cyclic compound (GO:0014070)	integral component of plasma membrane (GO:0005887)|myelin sheath (GO:0043209)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|histamine receptor activity (GO:0004969)			breast(1)|endometrium(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	9	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;7.08e-07)		Betahistine(DB06698)|Histamine Phosphate(DB00667)|Mirtazapine(DB00370)	TTGTAGAAGAACTCGGCATAG	0.577																																							uc002ycf.2		NA																	0					0						c.(574-576)TTC>ATC		histamine receptor H3	Histamine Phosphate(DB00667)						85.0	71.0	75.0					20																	60791826		2203	4300	6503	SO:0001583	missense	11255				G-protein signaling, coupled to cyclic nucleotide second messenger|neurotransmitter secretion	integral to plasma membrane	histamine receptor activity	g.chr20:60791826A>T	AF140538	CCDS13493.1	20q13.33	2013-09-19			ENSG00000101180	ENSG00000101180		"""GPCR / Class A : Histamine receptors"""	5184	protein-coding gene	gene with protein product		604525				10347254	Standard	NM_007232		Approved	GPCR97	uc002ycf.2	Q9Y5N1	OTTHUMG00000032899	ENST00000340177.5:c.574T>A	20.37:g.60791826A>T	ENSP00000342560:p.Phe192Ile					HRH3_uc002ycg.2_Missense_Mutation_p.F192I|HRH3_uc002ych.2_Missense_Mutation_p.F192I|HRH3_uc002yci.2_Missense_Mutation_p.F192I	p.F192I	NM_007232	NP_009163	Q9Y5N1	HRH3_HUMAN	BRCA - Breast invasive adenocarcinoma(19;7.08e-07)		3	871	-	Breast(26;7.76e-09)		192			Extracellular (Potential).		Q4QRI7|Q9GZX2|Q9H4K8	Missense_Mutation	SNP	ENST00000340177.5	37	c.574T>A	CCDS13493.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.231293	0.79688	.	.	ENSG00000101180	ENST00000340177;ENST00000317393;ENST00000370797	T;T	0.73047	-0.71;-0.71	4.4	4.4	0.53042	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.81009	0.4734	M	0.67397	2.05	0.80722	D	1	P;D;D;D	0.76494	0.666;0.999;0.998;0.994	B;D;D;D	0.77557	0.336;0.99;0.983;0.966	T	0.79797	-0.1652	10	0.32370	T	0.25	-34.3834	13.9014	0.63806	1.0:0.0:0.0:0.0	.	192;192;192;192	Q9Y5N1-2;E7EWA7;Q8WXZ9;Q9Y5N1	.;.;.;HRH3_HUMAN	I	192	ENSP00000342560:F192I;ENSP00000321482:F192I	ENSP00000321482:F192I	F	-	1	0	HRH3	60225221	1.000000	0.71417	1.000000	0.80357	0.562000	0.35680	8.998000	0.93550	1.739000	0.51704	0.172000	0.16884	TTC		0.577	HRH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079994.1	NM_007232		12	37	0	0	0	0.000978	0	12	37				
COL20A1	57642	broad.mit.edu	37	20	61956826	61956826	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr20:61956826C>A	ENST00000358894.6	+	28	3428	c.3328C>A	c.(3328-3330)Cat>Aat	p.H1110N	COL20A1_ENST00000326996.6_Missense_Mutation_p.H1142N|COL20A1_ENST00000435874.1_Missense_Mutation_p.H1117N|COL20A1_ENST00000422202.1_Missense_Mutation_p.H1117N	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	1110	Collagen-like 1.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					GAAGGGAGACCATGGGCTTCC	0.672																																							uc011aau.1		NA																	0				central_nervous_system(1)	1						c.(3328-3330)CAT>AAT		collagen, type XX, alpha 1							50.0	58.0	55.0					20																	61956826		1882	4115	5997	SO:0001583	missense	57642				cell adhesion	collagen|extracellular space	structural molecule activity	g.chr20:61956826C>A	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.3328C>A	20.37:g.61956826C>A	ENSP00000351767:p.His1110Asn					COL20A1_uc011aav.1_Missense_Mutation_p.H931N	p.H1110N	NM_020882	NP_065933	Q9P218	COKA1_HUMAN			28	3428	+	all_cancers(38;1.39e-10)		1110			Collagen-like 1.		Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Missense_Mutation	SNP	ENST00000358894.6	37	c.3328C>A	CCDS46628.1	.	.	.	.	.	.	.	.	.	.	C	1.305	-0.603746	0.03717	.	.	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202;ENST00000415763;ENST00000455906	D;D;D;D;D;D	0.94046	-3.34;-3.34;-3.34;-3.34;-1.76;-1.76	3.66	1.28	0.21552	.	0.918684	0.09203	U	0.834382	T	0.82102	0.4964	N	0.05467	-0.045	0.09310	N	1	B;B	0.14438	0.008;0.01	B;B	0.12837	0.004;0.008	T	0.70313	-0.4906	10	0.17369	T	0.5	.	5.1791	0.15150	0.2079:0.4551:0.337:0.0	.	1117;1110	Q9P218-2;Q9P218	.;COKA1_HUMAN	N	1110;1142;1117;1117;245;100	ENSP00000351767:H1110N;ENSP00000323077:H1142N;ENSP00000408690:H1117N;ENSP00000414753:H1117N;ENSP00000410799:H245N;ENSP00000406345:H100N	ENSP00000323077:H1142N	H	+	1	0	COL20A1	61427271	0.000000	0.05858	0.946000	0.38457	0.299000	0.27559	-0.093000	0.11111	1.608000	0.50180	0.467000	0.42956	CAT		0.672	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882		16	37	1	0	5.03518e-11	0.007413	7.51249e-11	16	37				
POTED	317754	broad.mit.edu	37	21	15013714	15013714	+	Missense_Mutation	SNP	G	G	T	rs202212566	byFrequency	TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr21:15013714G>T	ENST00000299443.5	+	11	1634	c.1582G>T	c.(1582-1584)Gtg>Ttg	p.V528L		NM_174981.3|NM_207355.2	NP_778146.2|NP_997238.2	Q86YR6	POTED_HUMAN	POTE ankyrin domain family, member D	528						plasma membrane (GO:0005886)				central_nervous_system(1)|large_intestine(10)|liver(2)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	33						TGAAAACAGCGTGTTGCAGGA	0.353																																							uc002yjb.1		NA																	0				ovary(3)|skin(3)	6						c.(1582-1584)GTG>TTG		pote protein							32.0	41.0	39.0					21																	15013714		882	3109	3991	SO:0001583	missense	317754					plasma membrane		g.chr21:15013714G>T	AY172978	CCDS13562.1	21q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000166351	ENSG00000166351		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	23822	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 1"""	607549	"""ankyrin repeat domain 21"", ""ANKRD26-like family B, member 3"""	ANKRD21, A26B3		12475935, 15276201, 16364570	Standard	NM_174981		Approved	POTE, POTE-21, POTE21, CT104.1	uc002yjb.1	Q86YR6	OTTHUMG00000074197	ENST00000299443.5:c.1582G>T	21.37:g.15013714G>T	ENSP00000299443:p.Val528Leu						p.V528L	NM_174981	NP_778146	Q86YR6	POTED_HUMAN			11	1634	+			528			Potential.		C9JCF7	Missense_Mutation	SNP	ENST00000299443.5	37	c.1582G>T	CCDS13562.1	.	.	.	.	.	.	.	.	.	.	g	2.982	-0.210102	0.06140	.	.	ENSG00000166351	ENST00000299443	T	0.12672	2.66	2.1	0.869	0.19096	.	.	.	.	.	T	0.04452	0.0122	N	0.02247	-0.625	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46428	-0.9192	9	0.12430	T	0.62	.	6.9617	0.24601	0.8448:0.0:0.1552:0.0	.	528	Q86YR6	POTED_HUMAN	L	528	ENSP00000299443:V528L	ENSP00000299443:V528L	V	+	1	0	POTED	13935585	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.773000	0.26661	-0.311000	0.08754	-2.570000	0.00171	GTG		0.353	POTED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157660.1	NM_174981		17	11	1	0	5.3912e-06	0.006122	6.74805e-06	17	11				
KRTAP20-2	337976	broad.mit.edu	37	21	32007602	32007602	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr21:32007602A>G	ENST00000330798.2	+	1	48	c.20A>G	c.(19-21)tAc>tGc	p.Y7C		NM_181616.1	NP_853647.1	Q3LI61	KR202_HUMAN	keratin associated protein 20-2	7			Y -> H (in dbSNP:rs8132705).			intermediate filament (GO:0005882)				central_nervous_system(1)|endometrium(3)|kidney(1)|lung(2)|ovary(1)	8						TACAGCAACTACTATGGTGGT	0.522																																							uc011adg.1		NA																	0				central_nervous_system(1)	1						c.(19-21)TAC>TGC		keratin associated protein 20-2							175.0	144.0	155.0					21																	32007602		2203	4300	6503	SO:0001583	missense	337976					intermediate filament		g.chr21:32007602A>G	AP001708	CCDS13604.1	21q22.1	2006-03-13			ENSG00000184032	ENSG00000184032		"""Keratin associated proteins"""	18944	protein-coding gene	gene with protein product						12359730	Standard	NM_181616		Approved	KAP20.2	uc011adg.2	Q3LI61	OTTHUMG00000057786	ENST00000330798.2:c.20A>G	21.37:g.32007602A>G	ENSP00000330746:p.Tyr7Cys						p.Y7C	NM_181616	NP_853647	Q3LI61	KR202_HUMAN			1	20	+			7						Missense_Mutation	SNP	ENST00000330798.2	37	c.20A>G	CCDS13604.1	.	.	.	.	.	.	.	.	.	.	A	6.914	0.538267	0.13188	.	.	ENSG00000184032	ENST00000330798	T	0.12361	2.69	4.85	-0.889	0.10580	.	0.672146	0.12112	N	0.498431	T	0.08403	0.0209	.	.	.	0.09310	N	1	B	0.24721	0.11	B	0.23419	0.046	T	0.35076	-0.9803	9	0.87932	D	0	.	1.2036	0.01890	0.5516:0.1484:0.1561:0.1439	.	7	Q3LI61	KR202_HUMAN	C	7	ENSP00000330746:Y7C	ENSP00000330746:Y7C	Y	+	2	0	KRTAP20-2	30929473	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	0.458000	0.21892	-0.198000	0.10333	0.533000	0.62120	TAC		0.522	KRTAP20-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128238.3			39	64	0	0	0	0.005524	0	39	64				
TIAM1	7074	broad.mit.edu	37	21	32537381	32537381	+	Splice_Site	SNP	C	C	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr21:32537381C>G	ENST00000286827.3	-	17	3360	c.2889G>C	c.(2887-2889)ggG>ggC	p.G963G	TIAM1_ENST00000541036.1_Splice_Site_p.G903G	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	963					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						AAAGGCTGTGCCCTGTCAGAT	0.537																																							uc002yow.1		NA																	0				lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						c.(2887-2889)GGG>GGC		T-cell lymphoma invasion and metastasis 1							57.0	54.0	55.0					21																	32537381		2203	4300	6503	SO:0001630	splice_region_variant	7074				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity	g.chr21:32537381C>G		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.2888-1G>C	21.37:g.32537381C>G						TIAM1_uc011adk.1_Silent_p.G963G|TIAM1_uc011adl.1_Silent_p.G903G	p.G963G	NM_003253	NP_003244	Q13009	TIAM1_HUMAN			17	3361	-			963					B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	ENST00000286827.3	37	c.2889G>C	CCDS13609.1																																																																																				0.537	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	Silent	12	33	0	0	0	0.001368	0	12	33				
FTCD	10841	broad.mit.edu	37	21	47571592	47571593	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr21:47571592_47571593CC>AA	ENST00000291670.5	-	5	558_559	c.515_516GG>TT	c.(514-516)gGG>gTT	p.G172V	FTCD_ENST00000355384.2_Missense_Mutation_p.G172V|FTCD_ENST00000397748.1_Missense_Mutation_p.G172V|FTCD_ENST00000397746.3_Missense_Mutation_p.G172V|FTCD_ENST00000498355.2_5'UTR|FTCD-AS1_ENST00000446649.1_RNA|FTCD_ENST00000397743.1_Missense_Mutation_p.G172V|FTCD_ENST00000359679.2_Missense_Mutation_p.G172V	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase	172	Formiminotransferase N-subdomain. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	TGGCCGTGGCCCCCCAACTGGG	0.639																																							uc002zif.2		NA																	0				pancreas(1)|skin(1)	2						c.(514-516)GGG>GTT		formiminotransferase cyclodeaminase	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Tetrahydrofolic acid(DB00116)																																			SO:0001583	missense	10841				folic acid-containing compound metabolic process|histidine catabolic process	centriole|cytosol|Golgi apparatus	folic acid binding|formimidoyltetrahydrofolate cyclodeaminase activity|glutamate formimidoyltransferase activity	g.chr21:47571592_47571593CC>AA	U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.515_516delinsAA	21.37:g.47571592_47571593delinsAA	ENSP00000291670:p.Gly172Val					FTCD_uc002zig.2_Missense_Mutation_p.G172V|FTCD_uc002zih.2_Missense_Mutation_p.G172V|FTCD_uc010gqf.2_Missense_Mutation_p.G172V|FTCD_uc010gqg.1_Missense_Mutation_p.G41V	p.G172V	NM_006657	NP_006648	O95954	FTCD_HUMAN		Colorectal(79;0.235)	5	559_560	-	Breast(49;0.214)		172			Formiminotransferase N-subdomain (By similarity).		B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	Missense_Mutation	DNP	ENST00000291670.5	37	c.515_516GG>TT	CCDS13731.1																																																																																				0.639	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206962.1	NM_006657		11	62	0	0	0	0.004672	0	11	62				
CABIN1	23523	broad.mit.edu	37	22	24483437	24483438	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr22:24483437_24483438GG>CT	ENST00000398319.2	+	23	3681_3682	c.3296_3297GG>CT	c.(3295-3297)cGG>cCT	p.R1099P	CABIN1_ENST00000263119.5_Missense_Mutation_p.R1099P|CABIN1_ENST00000405822.2_Missense_Mutation_p.R1049P	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1099					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GCTCTGGCCCGGGCCAGCCGCA	0.54																																							uc002zzi.1		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						c.(3295-3297)CGG>CCT		calcineurin binding protein 1																																				SO:0001583	missense	23523				cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity	g.chr22:24483437_24483438GG>CT	AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	Exception_encountered	22.37:g.24483437_24483438delinsCT	ENSP00000381364:p.Arg1099Pro					CABIN1_uc002zzj.1_Missense_Mutation_p.R1049P|CABIN1_uc002zzl.1_Missense_Mutation_p.R1099P	p.R1099P	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN			23	3423_3424	+			1099					G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	DNP	ENST00000398319.2	37	c.3296_3297GG>CT	CCDS13823.1																																																																																				0.540	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295		8	40	0	0	0	0.004672	0	8	40				
SF3A1	10291	broad.mit.edu	37	22	30737734	30737734	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr22:30737734C>A	ENST00000215793.8	-	7	1172	c.1018G>T	c.(1018-1020)Gag>Tag	p.E340*	SF3A1_ENST00000439242.1_Nonsense_Mutation_p.E275*	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	340					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						GGAGGCTCCTCCGCCTTCTCC	0.547																																							uc003ahl.2		NA																	0				ovary(3)|large_intestine(1)|pancreas(1)	5						c.(1018-1020)GAG>TAG		splicing factor 3a, subunit 1, 120kDa isoform 1							266.0	221.0	236.0					22																	30737734		2203	4300	6503	SO:0001587	stop_gained	10291				nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|U2-type spliceosomal complex	protein binding|RNA binding	g.chr22:30737734C>A	X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.1018G>T	22.37:g.30737734C>A	ENSP00000215793:p.Glu340*						p.E340*	NM_005877	NP_005868	Q15459	SF3A1_HUMAN			7	1150	-			340					E9PAW1	Nonsense_Mutation	SNP	ENST00000215793.8	37	c.1018G>T	CCDS13875.1	.	.	.	.	.	.	.	.	.	.	C	37	6.393007	0.97529	.	.	ENSG00000099995	ENST00000439242;ENST00000215793;ENST00000536049;ENST00000444440	.	.	.	5.97	5.97	0.96955	.	0.189484	0.56097	D	0.000031	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-23.5602	16.6497	0.85186	0.0:0.8704:0.1296:0.0	.	.	.	.	X	275;340;237;36	.	ENSP00000215793:E340X	E	-	1	0	SF3A1	29067734	0.962000	0.33011	0.956000	0.39512	0.688000	0.40055	2.606000	0.46291	2.837000	0.97791	0.655000	0.94253	GAG		0.547	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320916.2	NM_005877		42	131	1	0	7.05377e-20	0.00361	1.24106e-19	42	131				
CACNA1I	8911	broad.mit.edu	37	22	40030681	40030681	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr22:40030681G>T	ENST00000402142.3	+	5	692	c.692G>T	c.(691-693)tGg>tTg	p.W231L	CACNA1I_ENST00000404898.1_Missense_Mutation_p.W231L|CACNA1I_ENST00000336649.4_Missense_Mutation_p.W231L|CACNA1I_ENST00000407673.1_Missense_Mutation_p.W231L|CACNA1I_ENST00000401624.1_Missense_Mutation_p.W231L|CACNA1I_ENST00000400164.3_Missense_Mutation_p.W231L	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	231					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	GTGCAGCTCTGGGCGGGCCTG	0.567																																							uc003ayc.2		NA																	0				breast(1)|central_nervous_system(1)	2						c.(691-693)TGG>TTG		calcium channel, voltage-dependent, T type,	Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)						130.0	133.0	132.0					22																	40030681		2082	4225	6307	SO:0001583	missense	8911				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding	g.chr22:40030681G>T	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.692G>T	22.37:g.40030681G>T	ENSP00000385019:p.Trp231Leu					CACNA1I_uc003ayd.2_Missense_Mutation_p.W231L|CACNA1I_uc003aye.2_Missense_Mutation_p.W146L|CACNA1I_uc003ayf.2_Missense_Mutation_p.W146L	p.W231L	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN			5	692	+	Melanoma(58;0.0749)		231			I.|Helical; Name=S5 of repeat I; (Potential).		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	ENST00000402142.3	37	c.692G>T	CCDS46710.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.909300	0.92107	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.98264	-4.83;-4.83;-4.83;-4.83;-4.83;-4.83	5.52	5.52	0.82312	Ion transport (1);	0.600408	0.19138	N	0.121766	D	0.98692	0.9561	L	0.60455	1.87	0.80722	D	1	D;D;D;D	0.89917	0.994;0.995;0.994;1.0	D;D;D;D	0.87578	0.93;0.922;0.93;0.998	D	0.99911	1.1202	10	0.72032	D	0.01	.	19.4255	0.94740	0.0:0.0:1.0:0.0	.	231;231;231;231	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	L	231	ENSP00000385019:W231L;ENSP00000384093:W231L;ENSP00000383887:W231L;ENSP00000385680:W231L;ENSP00000337829:W231L;ENSP00000383028:W231L	ENSP00000337829:W231L	W	+	2	0	CACNA1I	38360627	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	9.476000	0.97823	2.588000	0.87417	0.655000	0.94253	TGG		0.567	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406		41	89	1	0	8.16277e-20	0.006999	1.42944e-19	41	89				
CHL1	10752	broad.mit.edu	37	3	431095	431095	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr3:431095C>A	ENST00000256509.2	+	20	3050	c.2408C>A	c.(2407-2409)gCt>gAt	p.A803D	CHL1_ENST00000397491.2_Missense_Mutation_p.A787D	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		AAGGTCCAGGCTATCAATCAA	0.502																																							uc003bou.2		NA																	0				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12						c.(2359-2361)GCT>GAT		cell adhesion molecule with homology to L1CAM							122.0	105.0	111.0					3																	431095		2203	4300	6503	SO:0001583	missense	10752				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix		g.chr3:431095C>A	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.2408C>A	3.37:g.431095C>A	ENSP00000256509:p.Ala803Asp					CHL1_uc003bot.2_Missense_Mutation_p.A803D|CHL1_uc003bow.1_Missense_Mutation_p.A787D|CHL1_uc011asi.1_Missense_Mutation_p.A803D	p.A787D	NM_006614	NP_006605	O00533	CHL1_HUMAN		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)	19	2631	+		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)	787			Fibronectin type-III 2.|Extracellular (Potential).		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	37	c.2360C>A	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.914585	0.92178	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.77098	-1.07;-1.07	5.4	5.4	0.78164	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.90068	0.6898	M	0.87038	2.855	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.994	D	0.91519	0.5233	10	0.87932	D	0	.	19.1737	0.93594	0.0:1.0:0.0:0.0	.	787;787;803	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	D	803;787	ENSP00000256509:A803D;ENSP00000380628:A787D	ENSP00000256509:A803D	A	+	2	0	CHL1	406095	1.000000	0.71417	0.979000	0.43373	0.813000	0.45954	7.208000	0.77907	2.524000	0.85096	0.591000	0.81541	GCT		0.502	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614		7	43	1	0	0.000274275	0.004482	0.000312858	7	43				
ITPR1	3708	broad.mit.edu	37	3	4712497	4712497	+	Silent	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr3:4712497G>A	ENST00000443694.2	+	17	2046	c.2046G>A	c.(2044-2046)gtG>gtA	p.V682V	ITPR1_ENST00000357086.4_Silent_p.V697V|ITPR1_ENST00000456211.2_Silent_p.V682V|ITPR1_ENST00000423119.2_Silent_p.V697V|ITPR1_ENST00000302640.8_Silent_p.V682V|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Silent_p.V697V			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	697					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	AGGAAGAGGTGTGGCTGTTTT	0.493																																							uc003bqa.2		NA																	0				lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21						c.(2089-2091)GTG>GTA		inositol 1,4,5-triphosphate receptor, type 1							64.0	62.0	63.0					3																	4712497		1977	4166	6143	SO:0001819	synonymous_variant	3708				activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding	g.chr3:4712497G>A	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.2046G>A	3.37:g.4712497G>A						ITPR1_uc010hca.1_Silent_p.V682V|ITPR1_uc011asu.1_Intron|ITPR1_uc010hcb.1_Silent_p.V682V	p.V697V	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN		Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	20	2439	+			697			Cytoplasmic (Potential).		E7EPX7|E9PDE9|Q14660|Q99897	Silent	SNP	ENST00000443694.2	37	c.2091G>A	CCDS54551.1																																																																																				0.493	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222		3	18	0	0	0	0.004672	0	3	18				
GRM7	2917	broad.mit.edu	37	3	7620820	7620820	+	Missense_Mutation	SNP	G	G	A	rs200432501		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr3:7620820G>A	ENST00000357716.4	+	8	2501	c.2227G>A	c.(2227-2229)Gcc>Acc	p.A743T	GRM7_ENST00000389336.4_Missense_Mutation_p.A743T|GRM7_ENST00000402647.2_Missense_Mutation_p.A743T|GRM7_ENST00000403881.1_Missense_Mutation_p.A743T|GRM7_ENST00000458641.2_3'UTR|GRM7_ENST00000486284.1_Missense_Mutation_p.A743T	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	743					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						CCCTGAGCAAGCCAGAGGGGT	0.423													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19633	0.0		0.0	False		,,,				2504	0.0						uc003bqm.2		NA																	0				ovary(4)|lung(3)	7						c.(2227-2229)GCC>ACC		glutamate receptor, metabotropic 7 isoform a	L-Glutamic Acid(DB00142)						126.0	112.0	117.0					3																	7620820		2203	4300	6503	SO:0001583	missense	2917				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding	g.chr3:7620820G>A	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.2227G>A	3.37:g.7620820G>A	ENSP00000350348:p.Ala743Thr					GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.A743T|GRM7_uc003bql.2_Missense_Mutation_p.A743T|GRM7_uc003bqn.1_Missense_Mutation_p.A326T|GRM7_uc010hch.1_Missense_Mutation_p.A254T	p.A743T	NM_000844	NP_000835	Q14831	GRM7_HUMAN			8	2501	+			743			Extracellular (Potential).		Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	c.2227G>A	CCDS43042.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	11.07	1.531278	0.27387	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	D;D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35;-2.35	6.17	5.29	0.74685	GPCR, family 3, C-terminal (2);	0.100909	0.64402	D	0.000002	D	0.90738	0.7093	L	0.31845	0.965	0.58432	D	0.999994	B;P;D;D;B	0.76494	0.071;0.827;0.999;0.997;0.309	B;P;D;D;B	0.85130	0.115;0.602;0.997;0.992;0.083	D	0.88490	0.3075	10	0.20046	T	0.44	.	16.3639	0.83307	0.0:0.1321:0.8679:0.0	.	743;743;498;743;743	B7ZKK0;Q14831-5;Q59G95;Q14831;Q14831-2	.;.;.;GRM7_HUMAN;.	T	743	ENSP00000350348:A743T;ENSP00000417536:A743T;ENSP00000373987:A743T;ENSP00000385664:A743T;ENSP00000384585:A743T	ENSP00000350348:A743T	A	+	1	0	GRM7	7595820	1.000000	0.71417	1.000000	0.80357	0.220000	0.24768	9.869000	0.99810	1.608000	0.50180	-0.176000	0.13171	GCC		0.423	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844		7	62	0	0	0	0.00308	0	7	62				
RAF1	5894	broad.mit.edu	37	3	12645699	12645699	+	Missense_Mutation	SNP	G	G	A	rs80338796		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr3:12645699G>A	ENST00000251849.4	-	7	1209	c.770C>T	c.(769-771)tCg>tTg	p.S257L	RAF1_ENST00000534997.1_Missense_Mutation_p.S42L|RAF1_ENST00000442415.2_Missense_Mutation_p.S257L|RAF1_ENST00000542177.1_Missense_Mutation_p.S176L	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	257			S -> L (in NS5 and LEOPARD2; shows in vitro greater kinase activity and enhanced ERK activation than wild-type). {ECO:0000269|PubMed:17603482, ECO:0000269|PubMed:17603483}.		activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S257L(3)|p.S257W(1)	ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	TGTGGATGTCGACCTCTGCCT	0.527			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																														uc003bxf.3		NA		Dom	yes		3	3p25	5894	T	v-raf-1 murine leukemia viral oncogene homolog 1			M	SRGAP3		pilocytic astrocytoma	ESRP1/RAF1(4)|SRGAP3/RAF1(4)	4	Substitution - Missense(4)		large_intestine(3)|lung(1)	central_nervous_system(4)|prostate(4)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)|liver(1)|ovary(1)	14	GRCh37	CM073301	RAF1	M	rs80338796	c.(769-771)TCG>TTG		v-raf-1 murine leukemia viral oncogene homolog	Sorafenib(DB00398)						157.0	138.0	145.0					3																	12645699		2203	4300	6503	SO:0001583	missense	5894	Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	activation of MAPKK activity|apoptosis|axon guidance|cell proliferation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of peptidyl-serine phosphorylation|Ras protein signal transduction|synaptic transmission	cytosol|mitochondrial outer membrane|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|receptor signaling protein activity	g.chr3:12645699G>A	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.770C>T	3.37:g.12645699G>A	ENSP00000251849:p.Ser257Leu					RAF1_uc011aut.1_Missense_Mutation_p.S42L|RAF1_uc011auu.1_Missense_Mutation_p.S175L	p.S257L	NM_002880	NP_002871	P04049	RAF1_HUMAN			7	1185	-			257		S -> L (in NS5 and LEOPARD2; shows in vitro greater kinase activity and enhanced ERK activation than wild-type).			B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	ENST00000251849.4	37	c.770C>T	CCDS2612.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.523633	0.85600	.	.	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427;ENST00000534997;ENST00000542177	T;T;T;T;T	0.77358	-1.07;-1.09;-1.01;-0.96;-1.05	5.73	5.73	0.89815	.	0.108329	0.64402	D	0.000003	T	0.81173	0.4767	M	0.81802	2.56	0.80722	A	1	P;P;B	0.48230	0.907;0.746;0.337	B;B;B	0.40741	0.339;0.226;0.117	D	0.85183	0.1005	9	0.87932	D	0	.	20.2602	0.98440	0.0:0.0:1.0:0.0	.	176;42;257	B4E0X2;B4E1N6;P04049	.;.;RAF1_HUMAN	L	257;257;136;42;176	ENSP00000251849:S257L;ENSP00000401888:S257L;ENSP00000398591:S136L;ENSP00000441186:S42L;ENSP00000443567:S176L	ENSP00000251849:S257L	S	-	2	0	RAF1	12620699	1.000000	0.71417	0.974000	0.42286	0.322000	0.28314	9.807000	0.99171	2.861000	0.98227	0.655000	0.94253	TCG		0.527	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252015.2	NM_002880		28	62	0	0	0	0.00632	0	28	62				
LAMB2	3913	broad.mit.edu	37	3	49166129	49166129	+	Missense_Mutation	SNP	T	T	C	rs367670275		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr3:49166129T>C	ENST00000418109.1	-	15	2019	c.1855A>G	c.(1855-1857)Atg>Gtg	p.M619V	LAMB2_ENST00000464891.1_5'Flank|LAMB2_ENST00000305544.4_Missense_Mutation_p.M619V	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	619	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TCATAGTCCATAGCCTTCGGC	0.597																																							uc003cwe.2		NA																	0				ovary(3)	3						c.(1855-1857)ATG>GTG		laminin, beta 2 precursor		T	VAL/MET	1,4405	2.1+/-5.4	0,1,2202	80.0	83.0	82.0		1855	5.0	1.0	3		82	0,8600		0,0,4300	no	missense	LAMB2	NM_002292.3	21	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	probably-damaging	619/1799	49166129	1,13005	2203	4300	6503	SO:0001583	missense	3913				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity	g.chr3:49166129T>C		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.1855A>G	3.37:g.49166129T>C	ENSP00000388325:p.Met619Val					LAMB2_uc003cwf.1_Missense_Mutation_p.M619V	p.M619V	NM_002292	NP_002283	P55268	LAMB2_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	14	2154	-			619			Laminin IV type B.		Q16321	Missense_Mutation	SNP	ENST00000418109.1	37	c.1855A>G	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.180822	0.78677	2.27E-4	0.0	ENSG00000172037	ENST00000418109;ENST00000305544	T;T	0.35605	1.3;1.3	5.04	5.04	0.67666	Laminin IV (1);	0.085006	0.85682	D	0.000000	T	0.59783	0.2219	M	0.82517	2.595	0.80722	D	1	D	0.58268	0.982	D	0.67548	0.952	T	0.60505	-0.7250	10	0.23302	T	0.38	.	14.4557	0.67416	0.0:0.0:0.0:1.0	.	619	P55268	LAMB2_HUMAN	V	619	ENSP00000388325:M619V;ENSP00000307156:M619V	ENSP00000307156:M619V	M	-	1	0	LAMB2	49141133	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.656000	0.83736	1.904000	0.55121	0.459000	0.35465	ATG		0.597	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292		33	45	0	0	0	0.009535	0	33	45				
GBE1	2632	broad.mit.edu	37	3	81698058	81698058	+	Missense_Mutation	SNP	C	C	A	rs201166587		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr3:81698058C>A	ENST00000429644.2	-	5	1283	c.640G>T	c.(640-642)Gct>Tct	p.A214S	GBE1_ENST00000489715.1_Missense_Mutation_p.A173S	NM_000158.3	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1	214					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	1,4-alpha-glucan branching enzyme activity (GO:0003844)|cation binding (GO:0043169)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|endometrium(5)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		TTATAAGAAGCTACTTTTCCT	0.318									Glycogen Storage Disease, type IV																														uc003dqg.2		NA																	0				ovary(3)	3						c.(640-642)GCT>TCT		glucan (1,4-alpha-), branching enzyme 1		C	SER/ALA	0,3606		0,0,1803	48.0	47.0	47.0		640	6.1	1.0	3		47	1,8123		0,1,4061	no	missense	GBE1	NM_000158.3	99	0,1,5864	AA,AC,CC		0.0123,0.0,0.0085	benign	214/703	81698058	1,11729	1803	4062	5865	SO:0001583	missense	2632	Glycogen_Storage_Disease_type_IV	Familial Cancer Database	Andersen Disease, Brancher deficiency	glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds	g.chr3:81698058C>A		CCDS54612.1	3p12.2	2013-09-20	2008-08-01		ENSG00000114480	ENSG00000114480	2.4.1.18		4180	protein-coding gene	gene with protein product	"""glycogen branching enzyme"", ""Andersen disease"", ""glycogen storage disease type IV"""	607839				8463281	Standard	NM_000158		Approved		uc021xav.1	Q04446	OTTHUMG00000158978	ENST00000429644.2:c.640G>T	3.37:g.81698058C>A	ENSP00000410833:p.Ala214Ser					GBE1_uc011bgm.1_Missense_Mutation_p.A173S	p.A214S	NM_000158	NP_000149	Q04446	GLGB_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)	6	923	-		Lung NSC(201;0.0117)	214					B3KWV3|Q96EN0	Missense_Mutation	SNP	ENST00000429644.2	37	c.640G>T	CCDS54612.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.903220	0.52333	0.0	1.23E-4	ENSG00000114480	ENST00000429644;ENST00000264326;ENST00000489715	D;D	0.86164	-2.08;-2.08	6.06	6.06	0.98353	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.83514	0.5271	L	0.46947	1.48	0.58432	D	0.999992	B;P	0.45986	0.101;0.87	B;B	0.39419	0.024;0.299	T	0.80344	-0.1422	10	0.12103	T	0.63	-24.4757	20.6208	0.99490	0.0:1.0:0.0:0.0	.	173;214	E9PGM4;Q04446	.;GLGB_HUMAN	S	214;265;173	ENSP00000410833:A214S;ENSP00000419638:A173S	ENSP00000264326:A265S	A	-	1	0	GBE1	81780748	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.882000	0.98803	0.655000	0.94253	GCT		0.318	GBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352760.2			6	9	1	0	3.59834e-05	0.001168	4.2474e-05	6	9				
EPHA3	2042	broad.mit.edu	37	3	89448476	89448476	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr3:89448476A>T	ENST00000336596.2	+	7	1665	c.1440A>T	c.(1438-1440)caA>caT	p.Q480H	EPHA3_ENST00000452448.2_Missense_Mutation_p.Q480H|EPHA3_ENST00000494014.1_Missense_Mutation_p.Q480H	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	480	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.Q480Q(2)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		AGCAGGAACAAGAAACAAGTT	0.368										TSP Lung(6;0.00050)																													uc003dqy.2		NA																	2	Substitution - coding silent(2)		lung(2)	lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33						c.(1438-1440)CAA>CAT		ephrin receptor EphA3 isoform a precursor							70.0	72.0	72.0					3																	89448476		2203	4300	6503	SO:0001583	missense	2042					extracellular region|integral to plasma membrane	ATP binding	g.chr3:89448476A>T	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1440A>T	3.37:g.89448476A>T	ENSP00000337451:p.Gln480His	TSP Lung(6;0.00050)				EPHA3_uc003dqx.1_Missense_Mutation_p.Q480H|EPHA3_uc010hon.1_RNA	p.Q480H	NM_005233	NP_005224	P29320	EPHA3_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)	7	1665	+	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)	480			Extracellular (Potential).|Fibronectin type-III 2.		Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	c.1440A>T	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	A	17.92	3.506329	0.64410	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.58506	0.33;0.33;0.33	5.35	5.35	0.76521	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.68604	0.3019	L	0.55834	1.745	0.58432	D	0.999999	D;D	0.71674	0.998;0.979	D;P	0.83275	0.996;0.799	T	0.68458	-0.5403	9	.	.	.	.	9.8073	0.40801	0.9229:0.0:0.0771:0.0	.	480;480	P29320;P29320-2	EPHA3_HUMAN;.	H	480	ENSP00000337451:Q480H;ENSP00000399926:Q480H;ENSP00000419190:Q480H	.	Q	+	3	2	EPHA3	89531166	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.259000	0.65485	2.026000	0.59711	0.460000	0.39030	CAA		0.368	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233		15	38	0	0	0	0.00499	0	15	38				
EPHA6	285220	broad.mit.edu	37	3	97356759	97356759	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr3:97356759C>T	ENST00000514100.1	+	11	1035	c.793C>T	c.(793-795)Ctc>Ttc	p.L265F	EPHA6_ENST00000502694.1_Missense_Mutation_p.L265F|EPHA6_ENST00000442602.2_3'UTR|EPHA6_ENST00000389672.5_Missense_Mutation_p.L873F	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	779						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						GGTCGGAATGCTCCGAGGCAT	0.428																																							uc010how.1		NA																	0				stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						c.(2617-2619)CTC>TTC		EPH receptor A6 isoform a							187.0	184.0	185.0					3																	97356759		1984	4177	6161	SO:0001583	missense	285220					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr3:97356759C>T	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.793C>T	3.37:g.97356759C>T	ENSP00000421711:p.Leu265Phe					EPHA6_uc011bgp.1_3'UTR|EPHA6_uc003drs.3_Missense_Mutation_p.L265F|EPHA6_uc003drr.3_Missense_Mutation_p.L265F|EPHA6_uc003drt.2_Missense_Mutation_p.L265F|EPHA6_uc010hox.1_RNA	p.L873F	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN			14	2660	+			778			Protein kinase.|Cytoplasmic (Potential).		D6RAL5	Missense_Mutation	SNP	ENST00000514100.1	37	c.2617C>T		.	.	.	.	.	.	.	.	.	.	C	26.2	4.719172	0.89205	.	.	ENSG00000080224	ENST00000389672;ENST00000514100;ENST00000502694	T;T;T	0.62941	-0.01;0.93;0.93	5.8	5.8	0.92144	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.74688	0.3749	L	0.39566	1.225	0.80722	D	1	D;D;D	0.89917	0.986;1.0;0.999	P;D;D	0.85130	0.866;0.997;0.978	T	0.75728	-0.3216	9	0.87932	D	0	.	20.0567	0.97653	0.0:1.0:0.0:0.0	.	778;265;265	Q9UF33;Q9UF33-2;D6RAL5	EPHA6_HUMAN;.;.	F	873;265;265	ENSP00000374323:L873F;ENSP00000421711:L265F;ENSP00000423950:L265F	ENSP00000374323:L873F	L	+	1	0	EPHA6	98839449	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.845000	0.62853	2.752000	0.94435	0.650000	0.86243	CTC		0.428	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000359997.1	NM_001080448		43	79	0	0	0	0.002522	0	43	79				
CPA3	1359	broad.mit.edu	37	3	148586701	148586701	+	Splice_Site	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr3:148586701G>T	ENST00000296046.3	+	3	196		c.e3-1		RP11-680B3.2_ENST00000488190.1_RNA	NM_001870.2	NP_001861.2	P15088	CBPA3_HUMAN	carboxypeptidase A3 (mast cell)						angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TATCTCTGCAGCTTGACTTCT	0.438																																							uc003ewm.2		NA																	0				breast(1)|skin(1)	2						c.e3-1		carboxypeptidase A3 precursor							142.0	122.0	129.0					3																	148586701		2203	4300	6503	SO:0001630	splice_region_variant	1359				proteolysis	stored secretory granule|transport vesicle	metallocarboxypeptidase activity|zinc ion binding	g.chr3:148586701G>T		CCDS3138.1	3q24	2012-02-10			ENSG00000163751	ENSG00000163751	3.4.17.1		2298	protein-coding gene	gene with protein product	"""mast cell carboxypeptidase A"", ""tissue carboxypeptidase A"""	114851					Standard	NM_001870		Approved		uc003ewm.3	P15088	OTTHUMG00000159526	ENST00000296046.3:c.145-1G>T	3.37:g.148586701G>T							p.L49_splice	NM_001870	NP_001861	P15088	CBPA3_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)		3	197	+								Q96E94	Splice_Site	SNP	ENST00000296046.3	37	c.145_splice	CCDS3138.1	.	.	.	.	.	.	.	.	.	.	G	18.58	3.655251	0.67472	.	.	ENSG00000163751	ENST00000296046	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2064	0.54355	0.0823:0.0:0.9177:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CPA3	150069391	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.122000	0.57910	2.542000	0.85734	0.655000	0.94253	.		0.438	CPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355974.1	NM_001870	Intron	19	45	1	0	1.67942e-08	0.006122	2.30302e-08	19	45				
CPA3	1359	broad.mit.edu	37	3	148614332	148614332	+	Silent	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr3:148614332C>T	ENST00000296046.3	+	11	1144	c.1092C>T	c.(1090-1092)gaC>gaT	p.D364D	RP11-680B3.2_ENST00000488190.1_RNA	NM_001870.2	NP_001861.2	P15088	CBPA3_HUMAN	carboxypeptidase A3 (mast cell)	364					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			CTTCTTTAGACTGGGCTTATG	0.388																																							uc003ewm.2		NA																	0				breast(1)|skin(1)	2						c.(1090-1092)GAC>GAT		carboxypeptidase A3 precursor							74.0	76.0	75.0					3																	148614332		2203	4299	6502	SO:0001819	synonymous_variant	1359				proteolysis	stored secretory granule|transport vesicle	metallocarboxypeptidase activity|zinc ion binding	g.chr3:148614332C>T		CCDS3138.1	3q24	2012-02-10			ENSG00000163751	ENSG00000163751	3.4.17.1		2298	protein-coding gene	gene with protein product	"""mast cell carboxypeptidase A"", ""tissue carboxypeptidase A"""	114851					Standard	NM_001870		Approved		uc003ewm.3	P15088	OTTHUMG00000159526	ENST00000296046.3:c.1092C>T	3.37:g.148614332C>T							p.D364D	NM_001870	NP_001861	P15088	CBPA3_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)		11	1144	+			364					Q96E94	Silent	SNP	ENST00000296046.3	37	c.1092C>T	CCDS3138.1																																																																																				0.388	CPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355974.1	NM_001870		6	57	0	0	0	0.00308	0	6	57				
ABCC5	10057	broad.mit.edu	37	3	183700641	183700641	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr3:183700641C>A	ENST00000334444.6	-	6	986	c.746G>T	c.(745-747)cGc>cTc	p.R249L	ABCC5_ENST00000492216.1_5'UTR|ABCC5_ENST00000265586.6_Missense_Mutation_p.R249L	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	249	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	CCCCCGCAAGCGGACACCGGT	0.507																																							uc003fmg.2		NA																	0				ovary(2)|large_intestine(1)|central_nervous_system(1)	4						c.(745-747)CGC>CTC		ATP-binding cassette, sub-family C, member 5							95.0	95.0	95.0					3																	183700641		1959	4137	6096	SO:0001583	missense	10057					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity	g.chr3:183700641C>A	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.746G>T	3.37:g.183700641C>A	ENSP00000333926:p.Arg249Leu					ABCC5_uc011bqt.1_5'UTR|ABCC5_uc010hxl.2_Missense_Mutation_p.R249L	p.R249L	NM_005688	NP_005679	O15440	MRP5_HUMAN	Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		6	911	-	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		249			ABC transmembrane type-1 1.		B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	ENST00000334444.6	37	c.746G>T	CCDS43176.1	.	.	.	.	.	.	.	.	.	.	C	34	5.334305	0.95758	.	.	ENSG00000114770	ENST00000334444;ENST00000382495;ENST00000265586	D;D	0.91068	-2.78;-2.78	5.52	5.52	0.82312	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.95987	0.8693	M	0.85859	2.78	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.979	D	0.96183	0.9132	10	0.72032	D	0.01	-18.5869	19.4562	0.94892	0.0:1.0:0.0:0.0	.	249;249	Q86UX3;O15440	.;MRP5_HUMAN	L	249;185;249	ENSP00000333926:R249L;ENSP00000265586:R249L	ENSP00000265586:R249L	R	-	2	0	ABCC5	185183335	1.000000	0.71417	0.993000	0.49108	0.995000	0.86356	7.460000	0.80816	2.585000	0.87301	0.655000	0.94253	CGC		0.507	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688		20	56	1	0	1.28384e-07	0.001882	1.67438e-07	20	56				
SST	6750	broad.mit.edu	37	3	187386920	187386921	+	Missense_Mutation	DNP	GC	GC	TG			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr3:187386920_187386921GC>TG	ENST00000287641.3	-	2	390_391	c.283_284GC>CA	c.(283-285)GCt>CAt	p.A95H		NM_001048.3	NP_001039.1	P61278	SMS_HUMAN	somatostatin	95					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hyperosmotic response (GO:0006972)|negative regulation of cell proliferation (GO:0008285)|regulation of cell migration (GO:0030334)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to heat (GO:0009408)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)	hormone activity (GO:0005179)			kidney(1)|large_intestine(1)|lung(6)|pancreas(1)	9	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.00444)	Cysteamine(DB00847)	GGGTGCCATAGCCGGGTTTGAG	0.495																																							uc003frn.2		NA																	0				pancreas(1)	1						c.(283-285)GCT>CAT		somatostatin preproprotein	Bromocriptine(DB01200)|Cysteamine(DB00847)																																			SO:0001583	missense	6750				digestion|G-protein coupled receptor protein signaling pathway|induction of apoptosis by hormones|negative regulation of cell proliferation|response to nutrient|synaptic transmission	extracellular space	hormone activity	g.chr3:187386920_187386921GC>TG		CCDS3288.1	3q28	2013-02-28			ENSG00000157005	ENSG00000157005		"""Endogenous ligands"""	11329	protein-coding gene	gene with protein product	"""somatostatin-14"", ""somatostatin-28"", ""prepro-somatostatin"""	182450				6126875, 6142531	Standard	NM_001048		Approved	SMST	uc003frn.3	P61278	OTTHUMG00000156462	ENST00000287641.3:c.283_284delinsTG	3.37:g.187386920_187386921delinsTG	ENSP00000287641:p.Ala95His						p.A95H	NM_001048	NP_001039	P61278	SMS_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.00444)	2	405_406	-	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		95					B2R5G3|P01166	Missense_Mutation	DNP	ENST00000287641.3	37	c.283_284GC>CA	CCDS3288.1																																																																																				0.495	SST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344278.1	NM_001048		28	200	0	0	0	0.004672	0	28	200				
LMLN	89782	broad.mit.edu	37	3	197687280	197687280	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr3:197687280C>T	ENST00000330198.4	+	1	210	c.188C>T	c.(187-189)cCc>cTc	p.P63L	LMLN_ENST00000482695.1_Intron|LMLN_ENST00000332636.5_Intron|LMLN_ENST00000420910.2_Missense_Mutation_p.P63L|IQCG_ENST00000480302.1_5'Flank|IQCG_ENST00000265239.6_5'Flank	NM_033029.3	NP_149018.2	Q96KR4	LMLN_HUMAN	leishmanolysin-like (metallopeptidase M8 family)	63					cell adhesion (GO:0007155)|mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		AGTTCCCCTCCCTGCCGGCAC	0.657																																							uc011buo.1		NA																	0				skin(1)	1						c.(187-189)CCC>CTC		leishmanolysin-like isoform 2							43.0	47.0	46.0					3																	197687280		2203	4300	6503	SO:0001583	missense	89782				cell adhesion|cell division|mitosis|proteolysis	cytoplasm|membrane	metalloendopeptidase activity|zinc ion binding	g.chr3:197687280C>T	AJ312398	CCDS3332.1, CCDS46988.1	3q29	2008-02-04			ENSG00000185621	ENSG00000185621	3.4.24.36		15991	protein-coding gene	gene with protein product		609380					Standard	NM_033029		Approved	Gp63, Msp	uc010iar.3	Q96KR4	OTTHUMG00000155375	ENST00000330198.4:c.188C>T	3.37:g.197687280C>T	ENSP00000328829:p.Pro63Leu					IQCG_uc003fyp.2_5'Flank|LMLN_uc003fyt.2_Intron|LMLN_uc010iar.2_Missense_Mutation_p.P63L|LMLN_uc010ias.2_Intron|LMLN_uc003fyu.2_5'UTR	p.P63L	NM_033029	NP_149018	Q96KR4	LMLN_HUMAN	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)	1	210	+	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	63					B3LDG9|B3LDH0|C9J796|F8WB28|Q96KR5	Missense_Mutation	SNP	ENST00000330198.4	37	c.188C>T	CCDS3332.1	.	.	.	.	.	.	.	.	.	.	C	16.13	3.035931	0.54896	.	.	ENSG00000185621	ENST00000330198;ENST00000420910	T;T	0.40225	1.04;1.04	4.22	2.27	0.28462	.	0.415293	0.20715	N	0.087014	T	0.25754	0.0627	L	0.38175	1.15	0.22292	N	0.999228	P;P	0.42296	0.669;0.775	B;B	0.35655	0.123;0.207	T	0.18935	-1.0321	10	0.62326	D	0.03	-2.6759	4.5031	0.11874	0.2199:0.666:0.0:0.1141	.	63;63	Q96KR4;F8WB28	LMLN_HUMAN;.	L	63	ENSP00000328829:P63L;ENSP00000410926:P63L	ENSP00000328829:P63L	P	+	2	0	LMLN	199171677	0.520000	0.26250	0.687000	0.30102	0.996000	0.88848	0.959000	0.29240	1.140000	0.42260	0.456000	0.33151	CCC		0.657	LMLN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339701.1	NM_033029		36	51	0	0	0	0.004878	0	36	51				
EVC2	132884	broad.mit.edu	37	4	5664968	5664968	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:5664968C>A	ENST00000344408.5	-	9	1064	c.1011G>T	c.(1009-1011)tgG>tgT	p.W337C	EVC2_ENST00000310917.2_Missense_Mutation_p.W257C|EVC2_ENST00000344938.1_Missense_Mutation_p.W337C	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	337					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						TCTCATACTGCCAAACCTTCA	0.498																																							uc003gij.2		NA																	0				large_intestine(3)|ovary(2)	5						c.(1009-1011)TGG>TGT		limbin							118.0	118.0	118.0					4																	5664968		2203	4300	6503	SO:0001583	missense	132884					integral to membrane		g.chr4:5664968C>A	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1011G>T	4.37:g.5664968C>A	ENSP00000342144:p.Trp337Cys					EVC2_uc011bwb.1_5'UTR|EVC2_uc003gik.2_Missense_Mutation_p.W257C	p.W337C	NM_147127	NP_667338	Q86UK5	LBN_HUMAN			9	1065	-			337					Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	37	c.1011G>T	CCDS3382.2	.	.	.	.	.	.	.	.	.	.	C	13.65	2.300734	0.40694	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.76578	-1.03;-1.03;-1.03	5.27	4.19	0.49359	.	1.174360	0.05913	N	0.631976	T	0.71953	0.3401	N	0.22421	0.69	0.09310	N	0.99999	P	0.48694	0.914	P	0.48334	0.574	T	0.62334	-0.6876	10	0.66056	D	0.02	-1.1217	6.7088	0.23266	0.0:0.8446:0.0:0.1554	.	337	Q86UK5	LBN_HUMAN	C	337;257;337	ENSP00000339954:W337C;ENSP00000311683:W257C;ENSP00000342144:W337C	ENSP00000311683:W257C	W	-	3	0	EVC2	5715869	0.046000	0.20272	0.024000	0.17045	0.030000	0.12068	0.067000	0.14510	2.602000	0.87976	0.655000	0.94253	TGG		0.498	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127		26	65	1	0	4.59853e-10	0.005443	6.59712e-10	26	65				
CRMP1	1400	broad.mit.edu	37	4	5837717	5837717	+	Silent	SNP	G	G	T	rs540841995	byFrequency	TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:5837717G>T	ENST00000397890.2	-	11	1420	c.1206C>A	c.(1204-1206)gcC>gcA	p.A402A	CRMP1_ENST00000512574.1_Silent_p.A400A|CRMP1_ENST00000324989.7_Silent_p.A516A|CRMP1_ENST00000511535.1_5'UTR	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	402					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CCGAGCCCACGGCAATCCGCC	0.527																																							uc003gip.2		NA																	0				ovary(2)	2						c.(1204-1206)GCC>GCA		collapsin response mediator protein 1 isoform 2							148.0	134.0	139.0					4																	5837717		2203	4300	6503	SO:0001819	synonymous_variant	1400				axon guidance|pyrimidine base catabolic process	cytosol|microtubule organizing center|spindle	dihydropyrimidinase activity|protein binding	g.chr4:5837717G>T	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.1206C>A	4.37:g.5837717G>T						CRMP1_uc003gin.1_Silent_p.A314A|CRMP1_uc003giq.2_Silent_p.A402A|CRMP1_uc003gir.2_Silent_p.A397A|CRMP1_uc003gis.2_Silent_p.A516A	p.A402A	NM_001313	NP_001304	Q14194	DPYL1_HUMAN		Colorectal(103;0.0721)	12	1307	-			402					A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	ENST00000397890.2	37	c.1206C>A	CCDS43207.1																																																																																				0.527	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358871.1	NM_001313		30	90	1	0	8.16721e-17	0.002096	1.39104e-16	30	90				
TLR1	7096	broad.mit.edu	37	4	38800341	38800341	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:38800341G>T	ENST00000502213.2	-	3	341	c.112C>A	c.(112-114)Cac>Aac	p.H38N	TLR1_ENST00000308979.2_Missense_Mutation_p.H38N			Q15399	TLR1_HUMAN	toll-like receptor 1	38					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						TTAGGAACGTGGATGAGACCG	0.323																																					GBM(5;216 373 40795 46382)	GBM(5;216 373 40795 46382)	uc003gtl.2		NA																	0				lung(2)|skin(2)|prostate(1)	5						c.(112-114)CAC>AAC		toll-like receptor 1 precursor							71.0	77.0	75.0					4																	38800341		2199	4297	6496	SO:0001583	missense	7096				cellular response to triacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|inflammatory response|innate immune response|macrophage activation|positive regulation of interleukin-6 biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	integral to plasma membrane|phagocytic vesicle membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	protein heterodimerization activity|transmembrane receptor activity	g.chr4:38800341G>T	U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.112C>A	4.37:g.38800341G>T	ENSP00000421259:p.His38Asn						p.H38N	NM_003263	NP_003254	Q15399	TLR1_HUMAN			4	386	-			38			Extracellular (Potential).		D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Missense_Mutation	SNP	ENST00000502213.2	37	c.112C>A	CCDS33973.1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.239169	0.22711	.	.	ENSG00000174125	ENST00000308979;ENST00000502213;ENST00000505940;ENST00000515861;ENST00000506146	T;T;T;D;T	0.83250	2.28;2.28;4.34;-1.7;0.25	4.93	-1.35	0.09114	.	0.657623	0.14027	N	0.346399	T	0.74726	0.3754	M	0.71036	2.16	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.60444	-0.7262	10	0.35671	T	0.21	.	1.1437	0.01771	0.1913:0.1786:0.1962:0.4339	.	38	Q15399	TLR1_HUMAN	N	38	ENSP00000354932:H38N;ENSP00000421259:H38N;ENSP00000421856:H38N;ENSP00000423017:H38N;ENSP00000423725:H38N	ENSP00000354932:H38N	H	-	1	0	TLR1	38476736	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.491000	0.22419	-0.429000	0.07329	-0.181000	0.13052	CAC		0.323	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360510.3			20	52	1	0	5.03518e-11	0.007413	7.51249e-11	20	52				
PDGFRA	5156	broad.mit.edu	37	4	55139896	55139897	+	Splice_Site	DNP	CA	CA	AG			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:55139896_55139897CA>AG	ENST00000257290.5	+	10	1888_1889	c.1557_1558CA>AG	c.(1555-1560)ccCAcc>ccAGcc	p.T520A	FIP1L1_ENST00000507166.1_Intron	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	520					adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	TGGTGGCTCCCAGTGAGTTCCT	0.55			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											Pancreas(151;208 1913 7310 23853 37092)	Pancreas(151;208 1913 7310 23853 37092)	uc003han.3		NA		Dom	yes		4	4q11-q13	5156	Mis|O|T	"""platelet-derived growth factor, alpha-receptor"""			"""L, M, O"""	FIP1L1		GIST|idiopathic hypereosinophilic syndrome		0				soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674						c.(1555-1560)CCCACC>CCAGCC		platelet-derived growth factor receptor alpha	Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)																																			SO:0001630	splice_region_variant	5156	Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity	g.chr4:55139896_55139897CA>AG	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	Exception_encountered	4.37:g.55139896_55139897delinsAG		TSP Lung(21;0.16)				PDGFRA_uc003haa.2_Intron|PDGFRA_uc010igq.1_Missense_Mutation_p.T414A|PDGFRA_uc003ham.2_RNA	p.T520A	NM_006206	NP_006197	P16234	PGFRA_HUMAN	GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		10	1888_1889	+	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		520			Extracellular (Potential).		B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	DNP	ENST00000257290.5	37	c.1557_1558CA>AG	CCDS3495.1																																																																																				0.550	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206	Missense_Mutation	15	47	0	0	0	0.004672	0	15	47				
AFP	174	broad.mit.edu	37	4	74308081	74308081	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:74308081G>A	ENST00000395792.2	+	5	651	c.551G>A	c.(550-552)cGc>cAc	p.R184H	AFP_ENST00000226359.2_Missense_Mutation_p.R184H	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein	184	Albumin 1. {ECO:0000255|PROSITE- ProRule:PRU00769}.				ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGGGCTGCTCGCTATGACAAA	0.373									Alpha-Fetoprotein, Hereditary Persistence of																														uc003hgz.1		NA																	0				ovary(1)	1						c.(550-552)CGC>CAC		alpha-fetoprotein precursor							95.0	90.0	92.0					4																	74308081		2203	4300	6503	SO:0001583	missense	174	Alpha-Fetoprotein_Hereditary_Persistence_of	Familial Cancer Database	HPAFP	transport		metal ion binding	g.chr4:74308081G>A	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.551G>A	4.37:g.74308081G>A	ENSP00000379138:p.Arg184His					AFP_uc003hha.1_Missense_Mutation_p.R184H|AFP_uc011cbg.1_5'UTR	p.R184H	NM_001134	NP_001125	P02771	FETA_HUMAN	Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		5	598	+	Breast(15;0.00102)		184			Albumin 1.		B2RBU3	Missense_Mutation	SNP	ENST00000395792.2	37	c.551G>A	CCDS3556.1	.	.	.	.	.	.	.	.	.	.	G	3.571	-0.087549	0.07097	.	.	ENSG00000081051	ENST00000395792;ENST00000226359	T;T	0.72615	-0.67;-0.67	5.33	-2.4	0.06583	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.815398	0.11338	N	0.574347	T	0.42562	0.1208	N	0.05012	-0.13	0.09310	N	1	B;B	0.18968	0.032;0.004	B;B	0.19946	0.027;0.008	T	0.22941	-1.0202	10	0.30078	T	0.28	.	5.6286	0.17497	0.4979:0.0:0.3701:0.132	.	26;184	B4DMX4;P02771	.;FETA_HUMAN	H	184	ENSP00000379138:R184H;ENSP00000226359:R184H	ENSP00000226359:R184H	R	+	2	0	AFP	74526945	0.000000	0.05858	0.015000	0.15790	0.714000	0.41099	0.513000	0.22770	-0.369000	0.08028	0.586000	0.80456	CGC		0.373	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252284.3			13	25	0	0	0	0.001368	0	13	25				
BMP3	651	broad.mit.edu	37	4	81974526	81974526	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:81974526A>G	ENST00000282701.2	+	3	1575	c.1255A>G	c.(1255-1257)Atc>Gtc	p.I419V		NM_001201.2	NP_001192.2	P12645	BMP3_HUMAN	bone morphogenetic protein 3	419					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|growth (GO:0040007)|ossification (GO:0001503)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	BMP receptor binding (GO:0070700)|receptor binding (GO:0005102)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	29						TCATGCTACCATCCAGAGTAT	0.433																																							uc003hmg.3		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(1255-1257)ATC>GTC		bone morphogenetic protein 3 preproprotein							141.0	142.0	142.0					4																	81974526		2203	4300	6503	SO:0001583	missense	651				cartilage development|cell differentiation|cell-cell signaling|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity	g.chr4:81974526A>G	M22491	CCDS3588.1	4q21	2013-02-06	2008-05-22		ENSG00000152785	ENSG00000152785		"""Bone morphogenetic proteins"""	1070	protein-coding gene	gene with protein product	"""osteogenin"""	112263	"""bone morphogenetic protein 3 (osteogenic)"""				Standard	NM_001201		Approved		uc003hmg.4	P12645	OTTHUMG00000130292	ENST00000282701.2:c.1255A>G	4.37:g.81974526A>G	ENSP00000282701:p.Ile419Val						p.I419V	NM_001201	NP_001192	P12645	BMP3_HUMAN			3	1575	+			419					Q4VAS5	Missense_Mutation	SNP	ENST00000282701.2	37	c.1255A>G	CCDS3588.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.704438	0.88924	.	.	ENSG00000152785	ENST00000282701;ENST00000395581	T	0.61980	0.06	5.97	5.97	0.96955	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.62792	0.2457	N	0.16066	0.365	0.80722	D	1	D	0.64830	0.994	D	0.79108	0.992	T	0.58538	-0.7619	10	0.10377	T	0.69	.	16.1223	0.81369	1.0:0.0:0.0:0.0	.	419	P12645	BMP3_HUMAN	V	419;17	ENSP00000282701:I419V	ENSP00000282701:I419V	I	+	1	0	BMP3	82193550	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.930000	0.92872	2.288000	0.76882	0.533000	0.62120	ATC		0.433	BMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252634.1			33	91	0	0	0	0.003271	0	33	91				
HELQ	113510	broad.mit.edu	37	4	84338004	84338004	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:84338004C>A	ENST00000295488.3	-	17	3240	c.3078G>T	c.(3076-3078)caG>caT	p.Q1026H	HELQ_ENST00000510985.1_Missense_Mutation_p.Q959H	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	1026					double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						CACTGTATAACTGTTTTGCTC	0.353								Other identified genes with known or suspected DNA repair function																															uc003hom.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(3076-3078)CAG>CAT	Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function	DNA helicase HEL308							126.0	118.0	121.0					4																	84338004		2203	4300	6503	SO:0001583	missense	113510						ATP binding|ATP-dependent helicase activity|nucleic acid binding	g.chr4:84338004C>A	AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.3078G>T	4.37:g.84338004C>A	ENSP00000295488:p.Gln1026His					HELQ_uc010ikb.2_Missense_Mutation_p.Q959H|HELQ_uc003hol.3_RNA|HELQ_uc010ikc.2_RNA	p.Q1026H	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN			17	3257	-			1026					Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Missense_Mutation	SNP	ENST00000295488.3	37	c.3078G>T	CCDS3603.1	.	.	.	.	.	.	.	.	.	.	C	16.17	3.048020	0.55110	.	.	ENSG00000163312	ENST00000295488;ENST00000510985	T;T	0.64991	0.18;-0.13	5.86	3.01	0.34805	.	0.000000	0.85682	D	0.000000	T	0.77329	0.4114	M	0.88704	2.975	0.54753	D	0.999987	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.993	T	0.73824	-0.3861	10	0.20519	T	0.43	-7.3363	7.884	0.29640	0.0:0.6492:0.0:0.3508	.	959;1026	E3W980;Q8TDG4	.;HELQ_HUMAN	H	1026;959	ENSP00000295488:Q1026H;ENSP00000424539:Q959H	ENSP00000295488:Q1026H	Q	-	3	2	HELQ	84557028	0.647000	0.27304	0.999000	0.59377	0.748000	0.42578	-0.144000	0.10280	0.292000	0.22492	-0.216000	0.12614	CAG		0.353	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252810.1	NM_133636		15	40	1	0	2.61681e-11	0.00245	3.98397e-11	15	40				
WDFY3	23001	broad.mit.edu	37	4	85724565	85724565	+	Missense_Mutation	SNP	C	C	A	rs368147903		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:85724565C>A	ENST00000295888.4	-	16	2892	c.2485G>T	c.(2485-2487)Gac>Tac	p.D829Y	WDFY3_ENST00000322366.6_Missense_Mutation_p.D829Y|WDFY3-AS1_ENST00000510449.1_RNA|WDFY3_ENST00000512267.1_5'UTR	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	829					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		AGTTTCAGGTCGGCAACATTT	0.423																																							uc003hpd.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(2485-2487)GAC>TAC		WD repeat and FYVE domain containing 3 isoform							93.0	90.0	91.0					4																	85724565		2203	4300	6503	SO:0001583	missense	23001					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding	g.chr4:85724565C>A	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.2485G>T	4.37:g.85724565C>A	ENSP00000295888:p.Asp829Tyr						p.D829Y	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000808)	16	2893	-		Hepatocellular(203;0.114)	829					Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	c.2485G>T	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	C	18.46	3.628212	0.66901	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.65549	-0.16;-0.15	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.71333	0.3327	L	0.51422	1.61	0.80722	D	1	D	0.65815	0.995	P	0.54706	0.759	T	0.72714	-0.4210	10	0.66056	D	0.02	.	19.9403	0.97159	0.0:1.0:0.0:0.0	.	829	Q8IZQ1	WDFY3_HUMAN	Y	829	ENSP00000318466:D829Y;ENSP00000295888:D829Y	ENSP00000295888:D829Y	D	-	1	0	WDFY3	85943589	1.000000	0.71417	0.995000	0.50966	0.232000	0.25224	7.194000	0.77789	2.712000	0.92718	0.650000	0.86243	GAC		0.423	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991		8	33	1	0	0.000157383	0.00308	0.000180628	8	33				
MEPE	56955	broad.mit.edu	37	4	88766569	88766569	+	Silent	SNP	T	T	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:88766569T>C	ENST00000424957.3	+	4	622	c.549T>C	c.(547-549)agT>agC	p.S183S	MEPE_ENST00000540395.1_Silent_p.S70S|MEPE_ENST00000508016.1_3'UTR|MEPE_ENST00000497649.2_Silent_p.S159S|MEPE_ENST00000395102.4_Silent_p.S214S|MEPE_ENST00000560249.1_Silent_p.S70S|MEPE_ENST00000361056.3_Silent_p.S183S	NM_001184694.1	NP_001171623.1	Q9NQ76	MEPE_HUMAN	matrix extracellular phosphoglycoprotein	183					biomineral tissue development (GO:0031214)|negative regulation of bone mineralization (GO:0030502)|regulation of bone remodeling (GO:0046850)|skeletal system development (GO:0001501)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		TCCCAGCAAGTATGAATTATG	0.413																																							uc003hqy.2		NA																	0				ovary(1)|lung(1)|skin(1)	3						c.(547-549)AGT>AGC		matrix, extracellular phosphoglycoprotein with							75.0	81.0	79.0					4																	88766569		2203	4300	6503	SO:0001819	synonymous_variant	56955				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding	g.chr4:88766569T>C	AJ276396	CCDS3625.1, CCDS54776.1	4q21.1	2008-08-29	2008-08-29		ENSG00000152595	ENSG00000152595			13361	protein-coding gene	gene with protein product		605912	"""matrix, extracellular phosphoglycoprotein with ASARM motif (bone)"""			10945470	Standard	NM_020203		Approved		uc003hqy.3	Q9NQ76	OTTHUMG00000130592	ENST00000424957.3:c.549T>C	4.37:g.88766569T>C						MEPE_uc010ikn.2_Silent_p.S70S	p.S183S	NM_020203	NP_064588	Q9NQ76	MEPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000432)	4	588	+		Hepatocellular(203;0.114)	183					A1A4X9|A8MTA3|D2CFR4|F5H5C5	Silent	SNP	ENST00000424957.3	37	c.549T>C	CCDS3625.1																																																																																				0.413	MEPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253038.1			22	59	0	0	0	0.010504	0	22	59				
NDST3	9348	broad.mit.edu	37	4	119163305	119163305	+	Splice_Site	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:119163305G>T	ENST00000296499.5	+	12	2802		c.e12+1			NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3						heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						AAGCTTTAACGTAAGTTTATA	0.343																																							uc003ibx.2		NA																	0				large_intestine(1)	1						c.e12+1		N-deacetylase/N-sulfotransferase (heparan							76.0	80.0	79.0					4																	119163305		2203	4298	6501	SO:0001630	splice_region_variant	9348					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity	g.chr4:119163305G>T	AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.2399+1G>T	4.37:g.119163305G>T							p.T800_splice	NM_004784	NP_004775	O95803	NDST3_HUMAN			12	2802	+								B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Splice_Site	SNP	ENST00000296499.5	37	c.2399_splice	CCDS3708.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.899208	0.91962	.	.	ENSG00000164100	ENST00000296499	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9054	0.97006	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NDST3	119382753	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.592000	0.82676	2.698000	0.92095	0.655000	0.94253	.		0.343	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256517.4	NM_004784	Intron	13	47	1	0	4.3838e-07	0.001855	5.63847e-07	13	47				
FAT4	79633	broad.mit.edu	37	4	126241834	126241834	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:126241834G>C	ENST00000394329.3	+	1	4281	c.4268G>C	c.(4267-4269)gGa>gCa	p.G1423A		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1423	Cadherin 14. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TTTCCTCCTGGAGATATTTTC	0.423																																							uc003ifj.3		NA																	0				ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						c.(4267-4269)GGA>GCA		FAT tumor suppressor homolog 4 precursor							137.0	128.0	131.0					4																	126241834		1869	4105	5974	SO:0001583	missense	79633				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:126241834G>C	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.4268G>C	4.37:g.126241834G>C	ENSP00000377862:p.Gly1423Ala						p.G1423A	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN			1	4268	+			1423			Cadherin 14.|Extracellular (Potential).		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	c.4268G>C	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	13.92	2.380174	0.42207	.	.	ENSG00000196159	ENST00000394329	T	0.01665	4.7	4.87	4.87	0.63330	Cadherin (1);Cadherin-like (1);	0.000000	0.34484	U	0.003932	T	0.03651	0.0104	N	0.12637	0.245	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65459	-0.6163	10	0.07644	T	0.81	.	18.1883	0.89799	0.0:0.0:1.0:0.0	.	1423	Q6V0I7	FAT4_HUMAN	A	1423	ENSP00000377862:G1423A	ENSP00000377862:G1423A	G	+	2	0	FAT4	126461284	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.454000	0.97621	2.535000	0.85469	0.655000	0.94253	GGA		0.423	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582		6	90	0	0	0	0.004482	0	6	90				
RNF150	57484	broad.mit.edu	37	4	141832458	141832458	+	Silent	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:141832458C>A	ENST00000515673.2	-	6	1071	c.1038G>T	c.(1036-1038)ctG>ctT	p.L346L	RNF150_ENST00000379512.2_Silent_p.L205L|RNF150_ENST00000306799.3_Silent_p.L304L|RNF150_ENST00000507500.1_Silent_p.L346L|RNF150_ENST00000420921.2_Silent_p.L205L			Q9ULK6	RN150_HUMAN	ring finger protein 150	346						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|large_intestine(10)|lung(7)|ovary(1)	19	all_hematologic(180;0.162)					GTGGACCTCCCAGAGAGCCCT	0.547																																							uc003iio.1		NA																	0				ovary(1)	1						c.(1036-1038)CTG>CTT		ring finger protein 150 precursor							95.0	88.0	91.0					4																	141832458		2203	4300	6503	SO:0001819	synonymous_variant	57484					integral to membrane	zinc ion binding	g.chr4:141832458C>A	AB033040	CCDS34065.1	4q31.1	2013-01-09			ENSG00000170153	ENSG00000170153		"""RING-type (C3HC4) zinc fingers"""	23138	protein-coding gene	gene with protein product						10574462	Standard	XM_005263150		Approved	KIAA1214	uc003iio.1	Q9ULK6	OTTHUMG00000161380	ENST00000515673.2:c.1038G>T	4.37:g.141832458C>A						RNF150_uc010iok.1_Silent_p.L304L|RNF150_uc003iip.1_Silent_p.L346L	p.L346L	NM_020724	NP_065775	Q9ULK6	RN150_HUMAN			6	1692	-	all_hematologic(180;0.162)		346			Cytoplasmic (Potential).		Q3T1D0|Q6ZNW6	Silent	SNP	ENST00000515673.2	37	c.1038G>T	CCDS34065.1																																																																																				0.547	RNF150-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364739.2	XM_291090		19	63	1	0	3.51602e-12	0.008871	5.48734e-12	19	63				
LRBA	987	broad.mit.edu	37	4	151682995	151682995	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:151682995C>A	ENST00000357115.3	-	35	5828	c.5585G>T	c.(5584-5586)tGg>tTg	p.W1862L	LRBA_ENST00000507224.1_Missense_Mutation_p.W1862L|LRBA_ENST00000535741.1_Missense_Mutation_p.W1862L|LRBA_ENST00000510413.1_Missense_Mutation_p.W1862L	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1862						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AGAATTTTGCCACTCCTATAA	0.264																																							uc010ipj.2		NA																	0				ovary(3)|breast(3)|skin(1)	7						c.(5584-5586)TGG>TTG		LPS-responsive vesicle trafficking, beach and							46.0	55.0	52.0					4																	151682995		2200	4274	6474	SO:0001583	missense	987					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding	g.chr4:151682995C>A	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.5585G>T	4.37:g.151682995C>A	ENSP00000349629:p.Trp1862Leu					LRBA_uc003ilt.3_Missense_Mutation_p.W521L|LRBA_uc003ilu.3_Missense_Mutation_p.W1862L	p.W1862L	NM_006726	NP_006717	P50851	LRBA_HUMAN			35	6059	-	all_hematologic(180;0.151)		1862					Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	c.5585G>T	CCDS3773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.6|24.6	4.547505|4.547505	0.86022|0.86022	.|.	.|.	ENSG00000198589|ENSG00000198589	ENST00000509835|ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	.|D;T;D;D	.|0.86627	.|-1.58;-1.44;-1.54;-2.15	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.94212|0.94212	0.8142|0.8142	M|M	0.85542|0.85542	2.76|2.76	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.999;1.0	.|D;D	.|0.87578	.|0.994;0.998	D|D	0.94804|0.94804	0.7973|0.7973	5|10	.|0.62326	.|D	.|0.03	.|.	18.5067|18.5067	0.90900|0.90900	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1862;1862	.|P50851;P50851-2	.|LRBA_HUMAN;.	C|L	515|1862	.|ENSP00000446299:W1862L;ENSP00000421552:W1862L;ENSP00000349629:W1862L;ENSP00000422180:W1862L	.|ENSP00000349629:W1862L	G|W	-|-	1|2	0|0	LRBA|LRBA	151902445|151902445	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	7.128000|7.128000	0.77217|0.77217	2.352000|2.352000	0.79861|0.79861	0.655000|0.655000	0.94253|0.94253	GGC|TGG		0.264	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1			14	58	1	0	1.3612e-06	0.003163	1.72697e-06	14	58				
NAF1	92345	broad.mit.edu	37	4	164061434	164061434	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:164061434C>T	ENST00000274054.2	-	5	1012	c.819G>A	c.(817-819)atG>atA	p.M273I	NAF1_ENST00000509434.1_Start_Codon_SNP_p.M1I|NAF1_ENST00000422287.2_Missense_Mutation_p.M273I	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	273					pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				GAGCAAAATACATAGTCTCCT	0.323																																							uc003iqj.2		NA																	0				ovary(2)	2						c.(817-819)ATG>ATA		nuclear assembly factor 1 homolog isoform a							89.0	96.0	94.0					4																	164061434		2203	4296	6499	SO:0001583	missense	92345				rRNA processing|snRNA pseudouridine synthesis	cytoplasm|nucleus|small nucleolar ribonucleoprotein complex	protein binding|snoRNA binding	g.chr4:164061434C>T		CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.819G>A	4.37:g.164061434C>T	ENSP00000274054:p.Met273Ile					NAF1_uc010iqw.1_Missense_Mutation_p.M273I	p.M273I	NM_138386	NP_612395	Q96HR8	NAF1_HUMAN			5	1013	-	all_hematologic(180;0.166)	Prostate(90;0.109)	273					D3DP28|E9PAZ2	Missense_Mutation	SNP	ENST00000274054.2	37	c.819G>A	CCDS3803.1	.	.	.	.	.	.	.	.	.	.	C	15.24	2.773385	0.49786	.	.	ENSG00000145414	ENST00000509434;ENST00000422287;ENST00000274054	T;T	0.27890	1.64;1.71	5.68	5.68	0.88126	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.048235	0.85682	D	0.000000	T	0.23926	0.0579	N	0.10664	0.02	0.53005	D	0.999969	B;B	0.26258	0.145;0.125	B;B	0.36186	0.219;0.112	T	0.12630	-1.0540	10	0.30854	T	0.27	-17.7047	18.7805	0.91930	0.0:1.0:0.0:0.0	.	273;273	E9PAZ2;Q96HR8	.;NAF1_HUMAN	I	1;273;273	ENSP00000408963:M273I;ENSP00000274054:M273I	ENSP00000274054:M273I	M	-	3	0	NAF1	164280884	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.591000	0.53986	2.693000	0.91896	0.655000	0.94253	ATG		0.323	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364684.2	NM_138386		14	39	0	0	0	0.00245	0	14	39				
ZFP42	132625	broad.mit.edu	37	4	188924130	188924130	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:188924130G>T	ENST00000326866.4	+	4	577	c.169G>T	c.(169-171)Gag>Tag	p.E57*	ZFP42_ENST00000509524.1_Nonsense_Mutation_p.E57*	NM_174900.3	NP_777560.2	Q96MM3	ZFP42_HUMAN	ZFP42 zinc finger protein	57					female gonad development (GO:0008585)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|meiotic nuclear division (GO:0007126)|regulation of genetic imprinting (GO:2000653)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		TGTGTGCTATGAGCCTGGCCC	0.542																																							uc003izg.1		NA																	0				ovary(1)|skin(1)	2						c.(169-171)GAG>TAG		zinc finger protein 42							113.0	99.0	104.0					4																	188924130		2203	4300	6503	SO:0001587	stop_gained	132625				female gonad development|male gonad development|meiosis	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr4:188924130G>T	AK056719	CCDS3849.1	4q35.2	2014-09-04	2012-11-27		ENSG00000179059	ENSG00000179059		"""Zinc fingers, C2H2-type"""	30949	protein-coding gene	gene with protein product		614572	"""zinc finger protein 42 homolog (mouse)"", ""zinc finger protein 42"""			12110702	Standard	NM_174900		Approved	REX1, ZNF754	uc003izh.1	Q96MM3	OTTHUMG00000160235	ENST00000326866.4:c.169G>T	4.37:g.188924130G>T	ENSP00000317686:p.Glu57*					ZFP42_uc003izh.1_Nonsense_Mutation_p.E57*|ZFP42_uc003izi.1_Nonsense_Mutation_p.E57*	p.E57*	NM_174900	NP_777560	Q96MM3	ZFP42_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)	3	414	+		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)	57					D3DP65|Q8WXE2	Nonsense_Mutation	SNP	ENST00000326866.4	37	c.169G>T	CCDS3849.1	.	.	.	.	.	.	.	.	.	.	G	36	5.613055	0.96637	.	.	ENSG00000179059	ENST00000326866;ENST00000509524	.	.	.	4.63	3.77	0.43336	.	1.215000	0.06489	N	0.734271	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.8086	0.18454	0.0952:0.0:0.7117:0.193	.	.	.	.	X	57	.	ENSP00000317686:E57X	E	+	1	0	ZFP42	189161124	0.405000	0.25336	0.012000	0.15200	0.002000	0.02628	1.602000	0.36783	1.510000	0.48803	0.655000	0.94253	GAG		0.542	ZFP42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359794.1	NM_174900		18	65	1	0	3.41278e-10	0.00499	4.95318e-10	18	65				
TRIML2	205860	broad.mit.edu	37	4	189026054	189026054	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:189026054C>A	ENST00000512729.1	-	2	446	c.72G>T	c.(70-72)agG>agT	p.R24S	TRIML2_ENST00000326754.3_Missense_Mutation_p.R24S|TRIML2_ENST00000536972.1_Missense_Mutation_p.R74S|TRIML2_ENST00000502707.1_5'Flank	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	24					protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)			central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		CAAGTTTCTCCCTCGATGTGT	0.393																																							uc003izl.2		NA																	0				central_nervous_system(2)	2						c.(70-72)AGG>AGT		tripartite motif family-like 2							204.0	190.0	195.0					4																	189026054		2203	4300	6503	SO:0001583	missense	205860						ligase activity	g.chr4:189026054C>A	AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.72G>T	4.37:g.189026054C>A	ENSP00000422581:p.Arg24Ser					TRIML2_uc011cle.1_Missense_Mutation_p.R74S|TRIML2_uc011clf.1_Missense_Mutation_p.R74S	p.R24S	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)	2	108	-		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)	24			Potential.		B7Z6J6	Missense_Mutation	SNP	ENST00000512729.1	37	c.72G>T	CCDS3850.1	.	.	.	.	.	.	.	.	.	.	C	6.022	0.372469	0.11409	.	.	ENSG00000179046	ENST00000512729;ENST00000326754;ENST00000536972	T;T;T	0.58210	0.52;0.35;3.64	4.63	1.99	0.26369	.	0.815592	0.10610	N	0.654585	T	0.46425	0.1392	M	0.64170	1.965	0.09310	N	1	P;B;P	0.40144	0.704;0.421;0.675	B;B;B	0.36922	0.236;0.08;0.08	T	0.32929	-0.9888	10	0.46703	T	0.11	.	6.6899	0.23165	0.0:0.7106:0.0:0.2894	.	74;24;24	B7Z6J6;B7ZLC3;Q8N7C3	.;.;TRIMM_HUMAN	S	24;24;74	ENSP00000422581:R24S;ENSP00000317498:R24S;ENSP00000441236:R74S	ENSP00000317498:R24S	R	-	3	2	TRIML2	189263048	0.038000	0.19896	0.007000	0.13788	0.145000	0.21501	0.681000	0.25320	0.449000	0.26747	-0.157000	0.13467	AGG		0.393	TRIML2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359733.1	NM_173553		20	73	1	0	2.4624e-09	0.008871	3.45291e-09	20	73				
TRIML1	339976	broad.mit.edu	37	4	189060824	189060824	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr4:189060824G>T	ENST00000332517.3	+	1	252	c.112G>T	c.(112-114)Gtg>Ttg	p.V38L	RP11-366H4.3_ENST00000501322.2_RNA	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	38					multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		CTTTTGTCTGGTGTGTCTCCT	0.527																																					Melanoma(31;213 1036 16579 23968 32372)	Melanoma(31;213 1036 16579 23968 32372)	uc003izm.1		NA																	0				ovary(1)|pancreas(1)|breast(1)|skin(1)	4						c.(112-114)GTG>TTG		tripartite motif family-like 1							182.0	181.0	181.0					4																	189060824		2203	4300	6503	SO:0001583	missense	339976				multicellular organismal development		ligase activity|zinc ion binding	g.chr4:189060824G>T	AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.112G>T	4.37:g.189060824G>T	ENSP00000327738:p.Val38Leu						p.V38L	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)	1	227	+		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)	38			RING-type.		Q96BE5	Missense_Mutation	SNP	ENST00000332517.3	37	c.112G>T	CCDS3851.1	.	.	.	.	.	.	.	.	.	.	G	6.496	0.459647	0.12342	.	.	ENSG00000184108	ENST00000332517	T	0.07688	3.17	5.59	-7.67	0.01272	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	1.158830	0.06420	N	0.722165	T	0.03178	0.0093	N	0.04655	-0.195	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.47995	-0.9073	10	0.26408	T	0.33	-3.9806	8.5913	0.33688	0.2464:0.1924:0.5612:0.0	.	38	Q8N9V2	TRIML_HUMAN	L	38	ENSP00000327738:V38L	ENSP00000327738:V38L	V	+	1	0	TRIML1	189297818	0.000000	0.05858	0.073000	0.20177	0.479000	0.33129	0.187000	0.16998	-0.749000	0.04747	-0.290000	0.09829	GTG		0.527	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359813.1	NM_178556		57	163	1	0	3.21867e-24	0.00361	5.82799e-24	57	163				
ADCY2	108	broad.mit.edu	37	5	7773143	7773143	+	Silent	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:7773143G>T	ENST00000338316.4	+	18	2402	c.2313G>T	c.(2311-2313)gtG>gtT	p.V771V	ADCY2_ENST00000537121.1_Silent_p.V591V	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	771					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						TGGCCTTGGTGGGCTACAACA	0.517																																							uc003jdz.1		NA																	0				ovary(5)|pancreas(1)|skin(1)	7						c.(2311-2313)GTG>GTT		adenylate cyclase 2							225.0	193.0	204.0					5																	7773143		2203	4300	6503	SO:0001819	synonymous_variant	108				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding	g.chr5:7773143G>T	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.2313G>T	5.37:g.7773143G>T						ADCY2_uc011cmo.1_Silent_p.V591V	p.V771V	NM_020546	NP_065433	Q08462	ADCY2_HUMAN			18	2380	+			771			Helical; (Potential).		B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	c.2313G>T	CCDS3872.2																																																																																				0.517	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546		42	83	1	0	1.04594e-18	0.00623	1.79786e-18	42	83				
TAS2R1	50834	broad.mit.edu	37	5	9629708	9629708	+	Missense_Mutation	SNP	T	T	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:9629708T>A	ENST00000382492.2	-	1	755	c.437A>T	c.(436-438)aAa>aTa	p.K146I	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	146					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						CCCTGCATATTTGCTATGGAA	0.393																																							uc003jem.1		NA																	0				ovary(3)	3						c.(436-438)AAA>ATA		taste receptor T2R1							63.0	69.0	67.0					5																	9629708		2203	4300	6503	SO:0001583	missense	50834				chemosensory behavior|sensory perception of taste	integral to membrane	taste receptor activity	g.chr5:9629708T>A	AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.437A>T	5.37:g.9629708T>A	ENSP00000371932:p.Lys146Ile						p.K146I	NM_019599	NP_062545	Q9NYW7	TA2R1_HUMAN			1	756	-			146			Extracellular (Potential).		Q646G8	Missense_Mutation	SNP	ENST00000382492.2	37	c.437A>T	CCDS3876.1	.	.	.	.	.	.	.	.	.	.	T	16.64	3.178723	0.57692	.	.	ENSG00000169777	ENST00000382492	T	0.00711	5.8	5.43	-0.192	0.13248	.	8.316520	0.00166	N	0.000003	T	0.01421	0.0046	N	0.25789	0.76	0.09310	N	1	D	0.61080	0.989	P	0.59115	0.852	T	0.41378	-0.9512	9	.	.	.	.	1.4062	0.02281	0.4077:0.0897:0.1376:0.365	.	146	Q9NYW7	TA2R1_HUMAN	I	146	ENSP00000371932:K146I	.	K	-	2	0	TAS2R1	9682708	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.634000	0.24614	0.132000	0.18615	0.533000	0.62120	AAA		0.393	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206988.2			16	34	0	0	0	0.003163	0	16	34				
ITGA2	3673	broad.mit.edu	37	5	52356839	52356839	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:52356839G>T	ENST00000296585.5	+	12	1564	c.1421G>T	c.(1420-1422)gGc>gTc	p.G474V		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	474					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				AATGAGAATGGCAATATCACG	0.473																																							uc003joy.2		NA																	0				lung(1)	1						c.(1420-1422)GGC>GTC		integrin alpha 2 precursor							112.0	104.0	107.0					5																	52356839		2203	4299	6502	SO:0001583	missense	3673				axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity	g.chr5:52356839G>T		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.1421G>T	5.37:g.52356839G>T	ENSP00000296585:p.Gly474Val					ITGA2_uc011cqa.1_RNA|ITGA2_uc011cqb.1_RNA|ITGA2_uc011cqc.1_Missense_Mutation_p.G398V|ITGA2_uc011cqd.1_RNA|ITGA2_uc011cqe.1_RNA	p.G474V	NM_002203	NP_002194	P17301	ITA2_HUMAN			12	1564	+		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)	474			Extracellular (Potential).|FG-GAP 4.		Q14595	Missense_Mutation	SNP	ENST00000296585.5	37	c.1421G>T	CCDS3957.1	.	.	.	.	.	.	.	.	.	.	G	16.17	3.046717	0.55110	.	.	ENSG00000164171	ENST00000296585	T	0.11063	2.81	5.65	5.65	0.86999	.	0.146509	0.64402	D	0.000007	T	0.36386	0.0965	M	0.82433	2.59	0.80722	D	1	P;D	0.65815	0.715;0.995	B;P	0.61397	0.439;0.888	T	0.05131	-1.0904	10	0.51188	T	0.08	.	20.0845	0.97795	0.0:0.0:1.0:0.0	.	474;474	E7ESP4;P17301	.;ITA2_HUMAN	V	474	ENSP00000296585:G474V	ENSP00000296585:G474V	G	+	2	0	ITGA2	52392596	1.000000	0.71417	0.996000	0.52242	0.278000	0.26855	4.879000	0.63100	2.821000	0.97095	0.650000	0.86243	GGC		0.473	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203		27	57	1	0	1.06801e-11	0.009535	1.63938e-11	27	57				
ADAMTS6	11174	broad.mit.edu	37	5	64766967	64766967	+	Nonsense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:64766967C>A	ENST00000536360.1	-	3	913	c.100G>T	c.(100-102)Gaa>Taa	p.E34*				Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6	34						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		GTCAGGAATTCCTCTTTGTAA	0.343																																							uc003jtp.2		NA																	0					0						c.(100-102)GAA>TAA		ADAM metallopeptidase with thrombospondin type 1							45.0	45.0	45.0					5																	64766967		2196	4298	6494	SO:0001587	stop_gained	11174				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:64766967C>A	AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000536360.1:c.100G>T	5.37:g.64766967C>A	ENSP00000440995:p.Glu34*					ADAMTS6_uc003jto.2_RNA|ADAMTS6_uc003jtq.2_RNA|ADAMTS6_uc003jtr.1_5'UTR	p.E34*	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN		Lung(70;0.00942)	3	914	-		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)	34					Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Nonsense_Mutation	SNP	ENST00000536360.1	37	c.100G>T		.	.	.	.	.	.	.	.	.	.	C	44	11.244340	0.99536	.	.	ENSG00000049192	ENST00000381055;ENST00000261306;ENST00000464680;ENST00000536360	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	19.4536	0.94878	0.0:1.0:0.0:0.0	.	.	.	.	X	34	.	ENSP00000261306:E34X	E	-	1	0	ADAMTS6	64802723	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.105000	0.77031	2.668000	0.90789	0.478000	0.44815	GAA		0.343	ADAMTS6-201	KNOWN	basic	protein_coding	protein_coding		NM_197941		6	14	1	0	8.12818e-05	0.001984	9.4449e-05	6	14				
SV2C	22987	broad.mit.edu	37	5	75621336	75621336	+	Silent	SNP	G	G	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:75621336G>C	ENST00000502798.2	+	13	2590	c.2148G>C	c.(2146-2148)ctG>ctC	p.L716L	SV2C_ENST00000322285.7_Intron	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	716					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		TCGTTGGGCTGTGCCTGCCTG	0.517																																							uc003kei.1		NA																	0				skin(1)	1						c.(2146-2148)CTG>CTC		synaptic vesicle glycoprotein 2C							107.0	108.0	108.0					5																	75621336		2047	4202	6249	SO:0001819	synonymous_variant	22987				neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr5:75621336G>C	AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.2148G>C	5.37:g.75621336G>C							p.L716L	NM_014979	NP_055794	Q496J9	SV2C_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)	13	2282	+		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)	716			Helical; (Potential).		Q496K1|Q9UPU8	Silent	SNP	ENST00000502798.2	37	c.2148G>C	CCDS43331.1																																																																																				0.517	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368700.4			21	55	0	0	0	0.010504	0	21	55				
VCAN	1462	broad.mit.edu	37	5	82875806	82875806	+	Silent	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:82875806C>T	ENST00000265077.3	+	14	10453	c.9888C>T	c.(9886-9888)tgC>tgT	p.C3296C	VCAN_ENST00000343200.5_Silent_p.C2309C|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000512590.2_Silent_p.C1494C|VCAN_ENST00000342785.4_Silent_p.C1542C|VCAN_ENST00000502527.2_Silent_p.C555C	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	3296	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.C3296C(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TAGTCGCTTGCGGCCAGCCCC	0.373																																							uc003kii.3		NA																	1	Substitution - coding silent(1)		large_intestine(1)	ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16						c.(9886-9888)TGC>TGT		versican isoform 1 precursor																																				SO:0001819	synonymous_variant	1462				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding	g.chr5:82875806C>T	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.9888C>T	5.37:g.82875806C>T						VCAN_uc003kij.3_Silent_p.C2309C|VCAN_uc010jau.2_Silent_p.C1542C|VCAN_uc003kik.3_Silent_p.C555C|VCAN_uc003kil.3_Silent_p.C1960C	p.C3296C	NM_004385	NP_004376	P13611	CSPG2_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	14	10244	+		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)	3296			Sushi.		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	37	c.9888C>T	CCDS4060.1																																																																																				0.373	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385		13	54	0	0	0	0.001368	0	13	54				
SNX24	28966	broad.mit.edu	37	5	122281823	122281823	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:122281823A>T	ENST00000261369.4	+	3	403	c.218A>T	c.(217-219)cAg>cTg	p.Q73L	SNX24_ENST00000395451.4_Missense_Mutation_p.Q106L|SNX24_ENST00000513881.1_Missense_Mutation_p.Q73L|SNX24_ENST00000511211.1_3'UTR|SNX24_ENST00000506996.1_Missense_Mutation_p.Q73L	NM_014035.2	NP_054754.1	Q9Y343	SNX24_HUMAN	sorting nexin 24	73	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			lung(5)	5		Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000654)|Epithelial(69;0.0016)|all cancers(49;0.0139)		GTCTTGGAACAGCGACGACAA	0.338																																							uc011cwo.1		NA																	0					0						c.(217-219)CAG>CTG		SBBI31 protein							53.0	56.0	55.0					5																	122281823		2203	4300	6503	SO:0001583	missense	28966				cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding	g.chr5:122281823A>T	AF139461	CCDS4132.1	5q23.2	2008-03-11	2007-08-15		ENSG00000064652	ENSG00000064652		"""Sorting nexins"""	21533	protein-coding gene	gene with protein product						12461558	Standard	NM_014035		Approved	SBBI31	uc011cwo.2	Q9Y343	OTTHUMG00000128913	ENST00000261369.4:c.218A>T	5.37:g.122281823A>T	ENSP00000261369:p.Gln73Leu					SNX24_uc003ktf.2_Missense_Mutation_p.Q73L|SNX24_uc010jcy.2_Missense_Mutation_p.Q73L	p.Q73L	NM_014035	NP_054754	Q9Y343	SNX24_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000654)|Epithelial(69;0.0016)|all cancers(49;0.0139)	3	387	+		Prostate(80;0.0387)	73			PX.		Q6UY33	Missense_Mutation	SNP	ENST00000261369.4	37	c.218A>T	CCDS4132.1	.	.	.	.	.	.	.	.	.	.	A	27.0	4.790286	0.90367	.	.	ENSG00000064652	ENST00000261369;ENST00000513881;ENST00000395451;ENST00000506996	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.86	5.86	0.93980	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.66147	0.2760	M	0.77406	2.37	0.80722	D	1	P;D	0.61697	0.93;0.99	D;D	0.71184	0.915;0.972	T	0.69472	-0.5136	10	0.66056	D	0.02	-0.061	16.5602	0.84551	1.0:0.0:0.0:0.0	.	73;73	Q9Y343;Q9Y343-2	SNX24_HUMAN;.	L	73;73;106;73	ENSP00000261369:Q73L;ENSP00000424149:Q73L;ENSP00000378837:Q106L;ENSP00000422535:Q73L	ENSP00000261369:Q73L	Q	+	2	0	SNX24	122309722	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.842000	0.92136	2.367000	0.80283	0.528000	0.53228	CAG		0.338	SNX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250885.2	NM_014035		12	27	0	0	0	0.00245	0	12	27				
MEGF10	84466	broad.mit.edu	37	5	126792966	126792966	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:126792966G>T	ENST00000274473.6	+	26	3646	c.3379G>T	c.(3379-3381)Gac>Tac	p.D1127Y	MEGF10_ENST00000503335.2_Missense_Mutation_p.D1127Y	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	1127	Necessary for formation of large intracellular vacuoles.|Ser-rich.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		TAAGCAAGAGGACAGTGGTGG	0.527																																							uc003kuh.3		NA																	0				ovary(4)	4						c.(3379-3381)GAC>TAC		multiple EGF-like-domains 10 precursor							101.0	85.0	90.0					5																	126792966		2203	4300	6503	SO:0001583	missense	84466				cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup		g.chr5:126792966G>T	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.3379G>T	5.37:g.126792966G>T	ENSP00000274473:p.Asp1127Tyr					MEGF10_uc003kui.3_Missense_Mutation_p.D1127Y	p.D1127Y	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)	26	3741	+		Prostate(80;0.165)	1127			Cytoplasmic (Potential).|Necessary for formation of large intracellular vacuoles.|Ser-rich.		Q68DE5|Q8WUL3	Missense_Mutation	SNP	ENST00000274473.6	37	c.3379G>T	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	G	12.07	1.828259	0.32329	.	.	ENSG00000145794	ENST00000503335;ENST00000274473	D;D	0.81499	-1.5;-1.5	6.01	5.13	0.70059	.	0.384954	0.24003	N	0.042445	T	0.77870	0.4195	N	0.08118	0	0.27159	N	0.961218	D	0.89917	1.0	D	0.71184	0.972	T	0.71712	-0.4510	10	0.72032	D	0.01	-7.4343	10.4773	0.44672	0.0688:0.1348:0.7964:0.0	.	1127	Q96KG7	MEG10_HUMAN	Y	1127	ENSP00000423354:D1127Y;ENSP00000274473:D1127Y	ENSP00000274473:D1127Y	D	+	1	0	MEGF10	126820865	1.000000	0.71417	0.977000	0.42913	0.048000	0.14542	2.423000	0.44705	1.518000	0.48934	0.650000	0.86243	GAC		0.527	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446		23	57	1	0	5.26018e-13	0.001882	8.49371e-13	23	57				
PCDHA1	56147	broad.mit.edu	37	5	140167866	140167866	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:140167866C>T	ENST00000504120.2	+	1	1991	c.1991C>T	c.(1990-1992)aCt>aTt	p.T664I	PCDHA1_ENST00000378133.3_Missense_Mutation_p.T664I|PCDHA1_ENST00000394633.3_Intron	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	664	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCACGGCCACTGTGCTTGTA	0.657																																							uc003lhb.2		NA																	0				skin(1)	1						c.(1990-1992)ACT>ATT		protocadherin alpha 1 isoform 1 precursor							44.0	49.0	48.0					5																	140167866		2201	4299	6500	SO:0001583	missense	56147				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140167866C>T	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1991C>T	5.37:g.140167866C>T	ENSP00000420840:p.Thr664Ile					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Missense_Mutation_p.T664I	p.T664I	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1991	+			664			Cadherin 6.|Extracellular (Potential).		O75288|Q9NRT7	Missense_Mutation	SNP	ENST00000504120.2	37	c.1991C>T	CCDS54913.1	.	.	.	.	.	.	.	.	.	.	c	12.92	2.083876	0.36758	.	.	ENSG00000204970	ENST00000504120;ENST00000378133	T;T	0.55234	0.53;0.53	3.89	3.89	0.44902	Cadherin (4);Cadherin-like (1);	0.000000	0.38959	U	0.001504	T	0.74809	0.3765	M	0.84585	2.705	0.26043	N	0.981584	D;D	0.76494	0.999;0.996	D;D	0.76071	0.987;0.958	T	0.70687	-0.4803	10	0.87932	D	0	.	16.2422	0.82418	0.0:1.0:0.0:0.0	.	664;664	Q9Y5I3;Q9Y5I3-3	PCDA1_HUMAN;.	I	664	ENSP00000420840:T664I;ENSP00000367373:T664I	ENSP00000367373:T664I	T	+	2	0	PCDHA1	140148050	0.027000	0.19231	0.458000	0.27068	0.002000	0.02628	3.028000	0.49705	1.876000	0.54355	0.650000	0.86243	ACT		0.657	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900		28	83	0	0	0	0.004656	0	28	83				
PCDHA6	56142	broad.mit.edu	37	5	140210056	140210056	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:140210056G>C	ENST00000529310.1	+	1	2494	c.2380G>C	c.(2380-2382)Gat>Cat	p.D794H	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	794					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTAAATGAAGATCATGATGC	0.358																																							uc003lho.2		NA																	0				haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						c.(2380-2382)GAT>CAT		protocadherin alpha 6 isoform 1 precursor							59.0	63.0	61.0					5																	140210056		2203	4300	6503	SO:0001583	missense	56142				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140210056G>C	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.2380G>C	5.37:g.140210056G>C	ENSP00000433378:p.Asp794His					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc011dab.1_Missense_Mutation_p.D794H	p.D794H	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2407	+			794			Cytoplasmic (Potential).		O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	c.2380G>C	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.059597	0.36373	.	.	ENSG00000081842	ENST00000529310	T	0.13420	2.59	4.08	2.26	0.28386	.	0.565765	0.12740	U	0.443097	T	0.10423	0.0255	L	0.29908	0.895	0.40828	D	0.983564	B;B	0.12013	0.005;0.003	B;B	0.15052	0.012;0.005	T	0.09707	-1.0662	10	0.42905	T	0.14	.	8.8082	0.34952	0.0855:0.1517:0.7628:0.0	.	794;794	Q9UN73-3;Q9UN73	.;PCDA6_HUMAN	H	794	ENSP00000433378:D794H	ENSP00000433378:D794H	D	+	1	0	PCDHA6	140190240	0.246000	0.23909	0.007000	0.13788	0.781000	0.44180	2.373000	0.44266	0.459000	0.27016	0.305000	0.20034	GAT		0.358	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909		26	49	0	0	0	0.003954	0	26	49				
PCDHA10	56139	broad.mit.edu	37	5	140237240	140237240	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:140237240C>A	ENST00000307360.5	+	1	1607	c.1607C>A	c.(1606-1608)gCg>gAg	p.A536E	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	536	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A536V(1)|p.?(1)		NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGTGAGCGCGCGCGATGGG	0.677																																							uc003lhx.2		NA																	2	Substitution - Missense(1)|Unknown(1)		lung(2)	ovary(2)|skin(2)|breast(1)	5						c.(1606-1608)GCG>GAG		protocadherin alpha 10 isoform 1 precursor							53.0	59.0	57.0					5																	140237240		2196	4265	6461	SO:0001583	missense	56139				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140237240C>A	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1607C>A	5.37:g.140237240C>A	ENSP00000304234:p.Ala536Glu					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc011dad.1_Missense_Mutation_p.A536E	p.A536E	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1607	+			536			Cadherin 5.|Extracellular (Potential).		A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	ENST00000307360.5	37	c.1607C>A	CCDS54921.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.761443	0.49468	.	.	ENSG00000250120	ENST00000307360	T	0.75938	-0.98	3.63	3.63	0.41609	Cadherin (5);Cadherin-like (1);	.	.	.	.	D	0.92163	0.7515	H	0.99391	4.545	0.39129	D	0.961813	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96341	0.9251	9	0.87932	D	0	.	15.8439	0.78871	0.0:1.0:0.0:0.0	.	536;536	Q9Y5I2-3;Q9Y5I2	.;PCDAA_HUMAN	E	536	ENSP00000304234:A536E	ENSP00000304234:A536E	A	+	2	0	PCDHA10	140217424	1.000000	0.71417	1.000000	0.80357	0.355000	0.29361	5.385000	0.66231	2.007000	0.58848	0.561000	0.74099	GCG		0.677	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901		30	24	1	0	2.12542e-12	0.00632	3.34506e-12	30	24				
PCDHGB2	56103	broad.mit.edu	37	5	140741739	140741739	+	Silent	SNP	G	G	T	rs576630104		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:140741739G>T	ENST00000522605.1	+	1	2037	c.2037G>T	c.(2035-2037)cgG>cgT	p.R679R	PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	679					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGACCGCCGGGAGCCCTCTG	0.597													.|||	1	0.000199681	0.0008	0.0	5008	,	,		18428	0.0		0.0	False		,,,				2504	0.0						uc003ljs.1		NA																	0					0						c.(2035-2037)CGG>CGT		protocadherin gamma subfamily B, 2 isoform 1							61.0	65.0	63.0					5																	140741739		2021	4177	6198	SO:0001819	synonymous_variant	56103				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140741739G>T	AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.2037G>T	5.37:g.140741739G>T						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Silent_p.R679R|PCDHGA5_uc011das.1_5'Flank	p.R679R	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2037	+			679			Extracellular (Potential).		Q3MIJ3|Q9UN65	Silent	SNP	ENST00000522605.1	37	c.2037G>T	CCDS54924.1																																																																																				0.597	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923		29	64	1	0	5.77227e-19	0.008361	9.96786e-19	29	64				
PCDHGA9	56107	broad.mit.edu	37	5	140784598	140784598	+	Silent	SNP	C	C	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:140784598C>G	ENST00000573521.1	+	1	2079	c.2079C>G	c.(2077-2079)ctC>ctG	p.L693L	PCDHGB4_ENST00000519479.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	693					homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCTCTACCTCGTTGTGGCTG	0.597																																							uc003lkh.1		NA																	0					0						c.(2077-2079)CTC>CTG		protocadherin gamma subfamily A, 9 isoform 1							109.0	121.0	117.0					5																	140784598		2146	4267	6413	SO:0001819	synonymous_variant	56107				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140784598C>G	AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.2079C>G	5.37:g.140784598C>G						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc011dax.1_Silent_p.L693L	p.L693L	NM_018921	NP_061744	Q9Y5G4	PCDG9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2079	+			693			Helical; (Potential).		A2RU65|Q9Y5C9	Silent	SNP	ENST00000573521.1	37	c.2079C>G	CCDS58981.1																																																																																				0.597	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437105.1	NM_018921		30	107	0	0	0	0.008361	0	30	107				
PCDHGB7	56099	broad.mit.edu	37	5	140798052	140798052	+	Missense_Mutation	SNP	A	A	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:140798052A>T	ENST00000398594.2	+	1	626	c.626A>T	c.(625-627)cAc>cTc	p.H209L	PCDHGB4_ENST00000519479.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA8_ENST00000398604.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	209	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCGCTCACCACTTGGTACTG	0.498																																							uc003lkn.1		NA																	0				ovary(2)	2						c.(625-627)CAC>CTC		protocadherin gamma subfamily B, 7 isoform 1							70.0	71.0	71.0					5																	140798052		1941	4146	6087	SO:0001583	missense	56099				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140798052A>T	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.626A>T	5.37:g.140798052A>T	ENSP00000381594:p.His209Leu					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkm.2_Missense_Mutation_p.H209L|PCDHGA11_uc003lko.1_5'Flank|PCDHGA11_uc003lkp.1_5'Flank|PCDHGA11_uc003lkq.1_5'Flank	p.H209L	NM_018927	NP_061750	Q9Y5F8	PCDGJ_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	771	+			209			Extracellular (Potential).|Cadherin 2.		Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	37	c.626A>T	CCDS47293.1	.	.	.	.	.	.	.	.	.	.	a	9.171	1.021120	0.19433	.	.	ENSG00000254122	ENST00000398594	T	0.52526	0.66	5.84	4.65	0.58169	Cadherin (4);Cadherin-like (1);	1.741500	0.04524	U	0.385228	T	0.51193	0.1660	L	0.60845	1.875	0.09310	N	1	B;B	0.12013	0.005;0.004	B;B	0.12837	0.008;0.008	T	0.45833	-0.9234	10	0.48119	T	0.1	.	12.8107	0.57637	0.8633:0.1367:0.0:0.0	.	209;209	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	L	209	ENSP00000381594:H209L	ENSP00000381594:H209L	H	+	2	0	PCDHGB7	140778236	0.000000	0.05858	0.030000	0.17652	0.683000	0.39861	-0.188000	0.09642	1.010000	0.39314	0.533000	0.62120	CAC		0.498	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927		17	69	0	0	0	0.004007	0	17	69				
SH3RF2	153769	broad.mit.edu	37	5	145435760	145435760	+	Silent	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:145435760G>T	ENST00000511217.1	+	7	1591	c.1539G>T	c.(1537-1539)cgG>cgT	p.R513R	SH3RF2_ENST00000359120.4_Silent_p.R513R|SH3RF2_ENST00000511705.1_3'UTR			Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	513					negative regulation of phosphatase activity (GO:0010923)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGAAAGGGCGGAGCAGCATGA	0.547																																							uc003lnt.2		NA																	0				ovary(1)|skin(1)	2						c.(1537-1539)CGG>CGT		SH3 domain containing ring finger 2							64.0	64.0	64.0					5																	145435760		2203	4300	6503	SO:0001819	synonymous_variant	153769						ligase activity|protein phosphatase 1 binding|zinc ion binding	g.chr5:145435760G>T	AL833297	CCDS4280.1	5q32	2013-01-09	2011-11-04	2011-11-04	ENSG00000156463	ENSG00000156463		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26299	protein-coding gene	gene with protein product	"""heart protein phosphatase 1-binding protein"", ""POSH-eliminating RING protein"""	613377	"""protein phosphatase 1, regulatory subunit 39"""	PPP1R39		22128169	Standard	NM_152550		Approved	FLJ23654, RNF158, Hepp1, POSHER	uc003lnt.3	Q8TEC5	OTTHUMG00000129685	ENST00000511217.1:c.1539G>T	5.37:g.145435760G>T						SH3RF2_uc011dbl.1_Silent_p.R513R|SH3RF2_uc011dbm.1_5'UTR|SH3RF2_uc003lnu.2_5'UTR|SH3RF2_uc011dbn.1_5'UTR	p.R513R	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		8	1777	+			513					A8K961|Q08AM9|Q6GMR9|Q8N5S8|Q96LP8	Silent	SNP	ENST00000511217.1	37	c.1539G>T	CCDS4280.1																																																																																				0.547	SH3RF2-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372804.1	NM_152550		28	47	1	0	1.17739e-12	0.005443	1.88484e-12	28	47				
KCNMB1	3779	broad.mit.edu	37	5	169805858	169805858	+	Silent	SNP	G	G	A	rs374179746		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:169805858G>A	ENST00000274629.4	-	4	868	c.426C>T	c.(424-426)aaC>aaT	p.N142N	KCNIP1_ENST00000518527.1_Intron|KCNIP1_ENST00000377360.4_Intron	NM_004137.3	NP_004128.1	Q16558	KCMB1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 1	142					blood coagulation (GO:0007596)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to calcium ion (GO:0051592)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			endometrium(1)|large_intestine(1)|lung(7)|ovary(2)	11	Renal(175;0.000159)|Lung NSC(126;0.0165)|all_lung(126;0.026)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.175)	Miconazole(DB01110)|Procaine(DB00721)	CGCTGGTTTCGTTCCCCCGAG	0.617																																							uc003maq.1		NA																	0				ovary(2)	2						c.(424-426)AAC>AAT		potassium large conductance calcium-activated		G	,	0,4406		0,0,2203	90.0	86.0	87.0		,426	-7.3	0.0	5		87	1,8599	1.2+/-3.3	0,1,4299	no	intron,coding-synonymous	KCNMB1,KCNIP1	NM_001034838.1,NM_004137.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	,142/192	169805858	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3779				platelet activation|synaptic transmission		calcium-activated potassium channel activity|potassium channel regulator activity	g.chr5:169805858G>A	AF035046	CCDS4373.1	5q34	2012-02-23			ENSG00000145936	ENSG00000145936		"""Potassium channels"""	6285	protein-coding gene	gene with protein product	"""BK channel beta subunit"""	603951				8799178, 9888999	Standard	NM_004137		Approved	hslo-beta	uc003maq.2	Q16558	OTTHUMG00000130439	ENST00000274629.4:c.426C>T	5.37:g.169805858G>A						KCNIP1_uc003map.2_Intron	p.N142N	NM_004137	NP_004128	Q16558	KCMB1_HUMAN	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.175)	4	826	-	Renal(175;0.000159)|Lung NSC(126;0.0165)|all_lung(126;0.026)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	142			Extracellular (Potential).		O00707|O00708|P78475|Q53YR0|Q8TAX3|Q93005	Silent	SNP	ENST00000274629.4	37	c.426C>T	CCDS4373.1																																																																																				0.617	KCNMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252830.3			8	38	0	0	0	0.00308	0	8	38				
RNF182	221687	broad.mit.edu	37	6	13977460	13977461	+	Missense_Mutation	DNP	TG	TG	GT			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:13977460_13977461TG>GT	ENST00000488300.1	+	3	633_634	c.110_111TG>GT	c.(109-111)cTG>cGT	p.L37R	RNF182_ENST00000544682.1_Missense_Mutation_p.L37R|RNF182_ENST00000537388.1_Missense_Mutation_p.L37R|RNF182_ENST00000537663.1_Missense_Mutation_p.L37R	NM_152737.3	NP_689950.1	Q8N6D2	RN182_HUMAN	ring finger protein 182	37					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|large_intestine(7)|liver(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(50;0.00405)|Ovarian(93;0.0964)	all_hematologic(90;0.135)	Epithelial(50;0.195)			CCCAAAGTGCTGGAGTGTTGTC	0.475																																							uc003nbe.2		NA																	0				large_intestine(2)|ovary(1)	3						c.(109-111)CTG>CGT		ring finger protein 182																																				SO:0001583	missense	221687					cytoplasm|integral to membrane|intracellular membrane-bounded organelle	protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr6:13977460_13977461TG>GT	AK090576	CCDS4531.1	6p23	2013-01-09			ENSG00000180537	ENSG00000180537		"""RING-type (C3HC4) zinc fingers"""	28522	protein-coding gene	gene with protein product						12477932	Standard	NM_152737		Approved	MGC33993	uc003nbg.3	Q8N6D2	OTTHUMG00000014280	Exception_encountered	6.37:g.13977460_13977461delinsGT	ENSP00000420465:p.Leu37Arg					RNF182_uc003nbf.2_Missense_Mutation_p.L37R|RNF182_uc003nbg.2_Missense_Mutation_p.L37R	p.L37R	NM_152737	NP_689950	Q8N6D2	RN182_HUMAN	Epithelial(50;0.195)		3	528_529	+	Breast(50;0.00405)|Ovarian(93;0.0964)	all_hematologic(90;0.135)	37			RING-type.		B2RDG2|Q8NBG3	Missense_Mutation	DNP	ENST00000488300.1	37	c.110_111TG>GT	CCDS4531.1																																																																																				0.475	RNF182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039911.2	NM_152737		40	99	0	0	0	0.004672	0	40	99				
OR10C1	442194	broad.mit.edu	37	6	29408489	29408489	+	Missense_Mutation	SNP	C	C	T	rs147036236	byFrequency	TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:29408489C>T	ENST00000444197.2	+	1	1407	c.697C>T	c.(697-699)Cgc>Tgc	p.R233C	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						TGTTGCGGGCCGCCGCAAGGC	0.592																																							uc011dlp.1		NA																	0					0						c.(697-699)CGC>TGC		olfactory receptor, family 10, subfamily C,							227.0	253.0	244.0					6																	29408489		1511	2709	4220	SO:0001583	missense	442194				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29408489C>T		CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.697C>T	6.37:g.29408489C>T	ENSP00000419119:p.Arg233Cys					OR11A1_uc010jrh.1_Intron	p.R233C	NM_013941	NP_039229	Q96KK4	O10C1_HUMAN			1	697	+			233			Cytoplasmic (Potential).		Q5SUN7|Q96R18	Missense_Mutation	SNP	ENST00000444197.2	37	c.697C>T	CCDS34364.1	.	.	.	.	.	.	.	.	.	.	C	11.30	1.599375	0.28534	.	.	ENSG00000206474	ENST00000444197	T	0.00337	8.05	3.49	3.49	0.39957	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39475	N	0.001352	T	0.00496	0.0016	M	0.92923	3.36	0.29225	N	0.8737	D	0.89917	1.0	D	0.79784	0.993	T	0.14200	-1.0481	10	0.72032	D	0.01	.	9.6185	0.39708	0.354:0.646:0.0:0.0	.	233	Q96KK4	O10C1_HUMAN	C	233	ENSP00000419119:R233C	ENSP00000419119:R233C	R	+	1	0	OR10C1	29516468	0.000000	0.05858	0.365000	0.25901	0.078000	0.17371	-0.875000	0.04205	1.795000	0.52594	0.603000	0.83216	CGC		0.592	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076415.2			40	214	0	0	0	0.006999	0	40	214				
OR2H1	26716	broad.mit.edu	37	6	29430484	29430484	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:29430484G>T	ENST00000377136.1	+	4	1403	c.938G>T	c.(937-939)tGg>tTg	p.W313L	OR2H1_ENST00000442615.1_Missense_Mutation_p.W313L|OR2H1_ENST00000377133.1_Missense_Mutation_p.W313L|OR2H1_ENST00000377132.1_Missense_Mutation_p.W313L|OR2H1_ENST00000396792.2_Missense_Mutation_p.W313L|OR2H1_ENST00000473369.1_3'UTR			Q9GZK4	OR2H1_HUMAN	olfactory receptor, family 2, subfamily H, member 1	313						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(5)|lung(12)	17						AGGGAAAGCTGGAGAGCTGCT	0.433																																							uc003nmi.2		NA																	0					0						c.(937-939)TGG>TTG		olfactory receptor, family 2, subfamily H,							37.0	41.0	40.0					6																	29430484		1509	2709	4218	SO:0001583	missense	26716				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr6:29430484G>T	AF044491	CCDS4660.1	6p22.1	2014-02-19	2002-02-28		ENSG00000204688	ENSG00000204688		"""GPCR / Class A : Olfactory receptors"""	8252	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily H, member 8"""	OR2H6, OR2H8			Standard	NM_030883		Approved	OR6-2	uc003nmi.3	Q9GZK4	OTTHUMG00000031050	ENST00000377136.1:c.938G>T	6.37:g.29430484G>T	ENSP00000366340:p.Trp313Leu					OR2H1_uc003nmj.1_Missense_Mutation_p.W313L|OR2H1_uc010jri.1_Missense_Mutation_p.W235L	p.W313L	NM_030883	NP_112145	Q9GZK4	OR2H1_HUMAN			3	1381	+			313			Cytoplasmic (Potential).		B0S7T4|O43629|O43661|O43662|Q5SUN6|Q9GZK9	Missense_Mutation	SNP	ENST00000377136.1	37	c.938G>T	CCDS4660.1	.	.	.	.	.	.	.	.	.	.	G	5.042	0.193500	0.09599	.	.	ENSG00000204688	ENST00000377136;ENST00000377133;ENST00000442615;ENST00000377132;ENST00000396792	T;T;T;T;T	0.08546	3.08;3.08;3.08;3.08;3.08	2.98	2.1	0.27182	.	.	.	.	.	T	0.03178	0.0093	N	0.08118	0	0.09310	N	1	D	0.57571	0.98	P	0.59424	0.857	T	0.39663	-0.9603	9	0.40728	T	0.16	.	5.9619	0.19305	0.1449:0.0:0.8551:0.0	.	313	Q9GZK4	OR2H1_HUMAN	L	313	ENSP00000366340:W313L;ENSP00000366337:W313L;ENSP00000393254:W313L;ENSP00000366336:W313L;ENSP00000380010:W313L	ENSP00000366336:W313L	W	+	2	0	OR2H1	29538463	0.005000	0.15991	0.003000	0.11579	0.051000	0.14879	0.000000	0.12993	0.832000	0.34804	0.596000	0.82720	TGG		0.433	OR2H1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194014.3			14	41	1	0	4.36969e-10	0.001855	6.29303e-10	14	41				
DNAH8	1769	broad.mit.edu	37	6	38818077	38818077	+	Silent	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:38818077G>A	ENST00000359357.3	+	36	4853	c.4599G>A	c.(4597-4599)caG>caA	p.Q1533Q	DNAH8_ENST00000441566.1_Silent_p.Q1533Q|DNAH8_ENST00000449981.2_Silent_p.Q1750Q			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1533					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AAATAATGCAGCGAGCTCATG	0.363																																							uc003ooe.1		NA																	0				skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						c.(4597-4599)CAG>CAA		dynein, axonemal, heavy polypeptide 8							124.0	120.0	122.0					6																	38818077		2203	4300	6503	SO:0001819	synonymous_variant	1769							g.chr6:38818077G>A	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.4599G>A	6.37:g.38818077G>A							p.Q1533Q	NM_001371	NP_001362					36	5199	+								O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37	c.4599G>A																																																																																					0.363	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		18	40	0	0	0	0.007413	0	18	40				
DNAH8	1769	broad.mit.edu	37	6	38891790	38891790	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:38891790G>T	ENST00000359357.3	+	71	10417	c.10163G>T	c.(10162-10164)tGc>tTc	p.C3388F	RP1-207H1.3_ENST00000418399.1_RNA|DNAH8_ENST00000441566.1_Missense_Mutation_p.C3352F|DNAH8_ENST00000449981.2_Missense_Mutation_p.C3605F|RP1-207H1.3_ENST00000416948.1_RNA			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3388					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.C3388F(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						ATTCTGCTGTGCACGGGATTC	0.428																																							uc003ooe.1		NA																	2	Substitution - Missense(2)		lung(2)	skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						c.(10162-10164)TGC>TTC		dynein, axonemal, heavy polypeptide 8							237.0	218.0	225.0					6																	38891790		2203	4300	6503	SO:0001583	missense	1769							g.chr6:38891790G>T	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.10163G>T	6.37:g.38891790G>T	ENSP00000352312:p.Cys3388Phe					uc003oof.1_Intron	p.C3388F	NM_001371	NP_001362					71	10763	+								O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37	c.10163G>T		.	.	.	.	.	.	.	.	.	.	G	15.99	2.994934	0.54041	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.73681	-0.77;-0.77;-0.77	6.06	5.14	0.70334	Dynein heavy chain, coiled coil stalk (1);	0.364353	0.31279	N	0.007935	T	0.67795	0.2931	L	0.56769	1.78	0.42305	D	0.99219	P	0.36222	0.544	B	0.41619	0.361	T	0.70995	-0.4720	10	0.51188	T	0.08	.	15.334	0.74238	0.0:0.2542:0.7458:0.0	.	3388	Q96JB1	DYH8_HUMAN	F	3593;3593;3388;3352	ENSP00000333363:C3593F;ENSP00000352312:C3388F;ENSP00000402294:C3352F	ENSP00000333363:C3593F	C	+	2	0	DNAH8	38999768	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.798000	0.38814	2.882000	0.98803	0.655000	0.94253	TGC		0.428	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927		18	53	1	0	9.16793e-09	0.00499	1.27124e-08	18	53				
ZNF318	24149	broad.mit.edu	37	6	43323347	43323347	+	Silent	SNP	T	T	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:43323347T>A	ENST00000361428.2	-	4	1802	c.1725A>T	c.(1723-1725)ccA>ccT	p.P575P	ZNF318_ENST00000318149.3_Silent_p.P575P	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	575					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			GCTTTACAGCTGGAGCTGAAG	0.468																																							uc003oux.2		NA																	0				ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7						c.(1723-1725)CCA>CCT		zinc finger protein 318							102.0	107.0	106.0					6																	43323347		2203	4300	6503	SO:0001819	synonymous_variant	24149				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding	g.chr6:43323347T>A	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.1725A>T	6.37:g.43323347T>A						ZNF318_uc003ouw.2_RNA	p.P575P	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)		4	1803	-			575					O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Silent	SNP	ENST00000361428.2	37	c.1725A>T	CCDS4895.2																																																																																				0.468	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345		38	124	0	0	0	0.004289	0	38	124				
GSTA4	2941	broad.mit.edu	37	6	52850269	52850269	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:52850269C>A	ENST00000370959.1	-	4	369	c.252G>T	c.(250-252)aaG>aaT	p.K84N	GSTA4_ENST00000370960.1_Intron|GSTA4_ENST00000486559.1_5'UTR|GSTA4_ENST00000541324.1_Intron			O15217	GSTA4_HUMAN	glutathione S-transferase alpha 4	84					glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)			endometrium(1)|lung(3)|skin(2)|urinary_tract(1)	7	Lung NSC(77;0.103)				Glutathione(DB00143)	CCTTGAGGTTCTTGCCAAAGA	0.488																																							uc003pbc.2		NA																	0					0						c.(250-252)AAG>AAT		glutathione S-transferase alpha 4	Glutathione(DB00143)						187.0	149.0	162.0					6																	52850269		2203	4300	6503	SO:0001583	missense	2941				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity|protein homodimerization activity	g.chr6:52850269C>A	AF020918	CCDS4948.1	6p12.2	2012-06-21	2008-11-26		ENSG00000170899	ENSG00000170899	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4629	protein-coding gene	gene with protein product		605450	"""glutathione S-transferase A4"""			9480897	Standard	NM_001512		Approved		uc003pbf.3	O15217	OTTHUMG00000014868	ENST00000370959.1:c.252G>T	6.37:g.52850269C>A	ENSP00000359998:p.Lys84Asn					GSTA4_uc003pbd.2_Intron|GSTA4_uc003pbe.2_Intron|GSTA4_uc003pbf.2_Missense_Mutation_p.K84N	p.K84N	NM_001512	NP_001503	O15217	GSTA4_HUMAN			3	316	-	Lung NSC(77;0.103)		84					B2RD15|Q5T7Q8|Q6P4G1|Q9BX18|Q9H414	Missense_Mutation	SNP	ENST00000370959.1	37	c.252G>T	CCDS4948.1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.510182	0.44660	.	.	ENSG00000170899	ENST00000370963;ENST00000370959	T;T	0.35048	1.33;1.33	5.13	0.348	0.16026	Glutathione S-transferase, C-terminal-like (1);Thioredoxin-like fold (1);	0.248733	0.46145	N	0.000302	T	0.15609	0.0376	M	0.72353	2.195	0.80722	D	1	B	0.17038	0.02	B	0.19946	0.027	T	0.07654	-1.0761	10	0.62326	D	0.03	-15.3197	1.964	0.03392	0.1353:0.4913:0.1607:0.2127	.	84	O15217	GSTA4_HUMAN	N	84	ENSP00000360002:K84N;ENSP00000359998:K84N	ENSP00000359998:K84N	K	-	3	2	GSTA4	52958228	0.175000	0.23083	0.912000	0.35992	0.983000	0.72400	-0.328000	0.07945	0.105000	0.17753	0.563000	0.77884	AAG		0.488	GSTA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040946.1	NM_001512		17	43	1	0	2.94398e-08	0.007413	3.99311e-08	17	43				
BAI3	577	broad.mit.edu	37	6	69666045	69666045	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:69666045C>T	ENST00000370598.1	+	7	2146	c.1325C>T	c.(1324-1326)gCa>gTa	p.A442V		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	442	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A442E(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GGGCCATGGGCAGAAAGCAGA	0.527																																							uc003pev.3		NA																	1	Substitution - Missense(1)	p.A442E(1)	lung(1)	lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50						c.(1324-1326)GCA>GTA		brain-specific angiogenesis inhibitor 3							67.0	61.0	63.0					6																	69666045		2203	4300	6503	SO:0001583	missense	577				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:69666045C>T	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1325C>T	6.37:g.69666045C>T	ENSP00000359630:p.Ala442Val					BAI3_uc010kak.2_Missense_Mutation_p.A442V	p.A442V	NM_001704	NP_001695	O60242	BAI3_HUMAN			7	1773	+		all_lung(197;0.212)	442			TSP type-1 3.|Extracellular (Potential).		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	c.1325C>T	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.844259	0.51164	.	.	ENSG00000135298	ENST00000370598	T	0.53857	0.6	5.71	5.71	0.89125	.	0.121928	0.56097	D	0.000037	T	0.22936	0.0554	N	0.05078	-0.115	0.80722	D	1	P	0.43231	0.801	P	0.46419	0.516	T	0.11518	-1.0584	10	0.10902	T	0.67	.	15.3429	0.74311	0.0:0.8609:0.1391:0.0	.	442	O60242	BAI3_HUMAN	V	442	ENSP00000359630:A442V	ENSP00000359630:A442V	A	+	2	0	BAI3	69722766	1.000000	0.71417	0.999000	0.59377	0.942000	0.58702	5.827000	0.69300	2.701000	0.92244	0.591000	0.81541	GCA		0.527	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1			3	25	0	0	0	0.004672	0	3	25				
COL12A1	1303	broad.mit.edu	37	6	75841753	75841753	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:75841753G>A	ENST00000322507.8	-	35	6149	c.5840C>T	c.(5839-5841)cCt>cTt	p.P1947L	COL12A1_ENST00000345356.6_Missense_Mutation_p.P783L|COL12A1_ENST00000416123.2_Missense_Mutation_p.P1947L|COL12A1_ENST00000483888.2_Missense_Mutation_p.P1947L	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1947	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						GAGGCTGTTAGGTGTAGGATT	0.453																																							uc003phs.2		NA																	0				ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						c.(5839-5841)CCT>CTT		collagen, type XII, alpha 1 long isoform							161.0	161.0	161.0					6																	75841753		2016	4162	6178	SO:0001583	missense	1303				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength	g.chr6:75841753G>A	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.5840C>T	6.37:g.75841753G>A	ENSP00000325146:p.Pro1947Leu					COL12A1_uc003pht.2_Missense_Mutation_p.P783L	p.P1947L	NM_004370	NP_004361	Q99715	COCA1_HUMAN			35	6006	-			1947			Fibronectin type-III 15.		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	c.5840C>T	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.208123	0.79240	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	T;T;T;T	0.58506	0.33;0.33;0.33;0.33	6.17	6.17	0.99709	Fibronectin, type III (4);	0.082396	0.52532	D	0.000073	T	0.57946	0.2088	M	0.77616	2.38	0.80722	D	1	P;P	0.40000	0.649;0.698	B;B	0.40702	0.228;0.338	T	0.62272	-0.6889	10	0.52906	T	0.07	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	783;1947	Q99715-2;Q99715	.;COCA1_HUMAN	L	1947;1947;783;1947;1947	ENSP00000325146:P1947L;ENSP00000305147:P783L;ENSP00000412864:P1947L;ENSP00000421216:P1947L	ENSP00000325146:P1947L	P	-	2	0	COL12A1	75898473	1.000000	0.71417	0.957000	0.39632	0.878000	0.50629	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	CCT		0.453	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370		17	56	0	0	0	0.006122	0	17	56				
CGA	1081	broad.mit.edu	37	6	87797884	87797884	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:87797884A>G	ENST00000369582.2	-	2	135	c.35T>C	c.(34-36)cTg>cCg	p.L12P		NM_000735.3	NP_000726.1	P01215	GLHA_HUMAN	glycoprotein hormones, alpha polypeptide	12					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|cellular response to hormone stimulus (GO:0032870)|developmental growth (GO:0048589)|follicle-stimulating hormone secretion (GO:0046884)|gonad development (GO:0008406)|luteinizing hormone secretion (GO:0032275)|negative regulation of organ growth (GO:0046621)|peptide hormone processing (GO:0016486)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)	15		all_cancers(76;5.98e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000102)		BRCA - Breast invasive adenocarcinoma(108;0.0484)		CAATGTGACCAGAAAGATAGC	0.398																																							uc003plj.1		NA																	0				ovary(1)	1						c.(34-36)CTG>CCG		glycoprotein hormones, alpha polypeptide							125.0	103.0	111.0					6																	87797884		2203	4300	6503	SO:0001583	missense	1081				hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity	g.chr6:87797884A>G	V00518	CCDS5007.1, CCDS75492.1	6q14-q21	2013-02-26			ENSG00000135346	ENSG00000135346		"""Endogenous ligands"""	1885	protein-coding gene	gene with protein product	"""follicle-stimulating hormone alpha subunit"", ""chorionic gonadotropin, alpha polypeptide"", ""luteinizing hormone alpha chain"", ""lutropin alpha chain"", ""thyroid-stimulating hormone alpha chain"", ""glycoprotein hormones alpha chain"""	118850				6286817	Standard	NM_000735		Approved	HCG, GPHa, GPHA1, FSHA, LHA, TSHA	uc021zci.1	P01215	OTTHUMG00000015161	ENST00000369582.2:c.35T>C	6.37:g.87797884A>G	ENSP00000358595:p.Leu12Pro						p.L12P	NM_000735	NP_000726	P01215	GLHA_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0484)	2	136	-		all_cancers(76;5.98e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000102)	12						Missense_Mutation	SNP	ENST00000369582.2	37	c.35T>C	CCDS5007.1	.	.	.	.	.	.	.	.	.	.	A	13.65	2.301614	0.40694	.	.	ENSG00000135346	ENST00000369582	.	.	.	5.63	5.63	0.86233	.	0.135952	0.49305	D	0.000142	T	0.81029	0.4738	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.85099	0.0956	9	0.87932	D	0	-2.8988	15.828	0.78730	1.0:0.0:0.0:0.0	.	12	P01215	GLHA_HUMAN	P	12	.	ENSP00000358595:L12P	L	-	2	0	CGA	87854603	1.000000	0.71417	0.996000	0.52242	0.004000	0.04260	5.902000	0.69869	2.139000	0.66308	0.477000	0.44152	CTG		0.398	CGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041425.1	NM_000735		4	10	0	0	0	0.000602	0	4	10				
GJA10	84694	broad.mit.edu	37	6	90605016	90605017	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:90605016_90605017CC>AA	ENST00000369352.1	+	1	829_830	c.829_830CC>AA	c.(829-831)CCt>AAt	p.P277N	Y_RNA_ENST00000517082.1_RNA	NM_032602.1	NP_115991.1	P57773	CXA9_HUMAN	gap junction protein, alpha 10, 62kDa	0					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|skin(3)|urinary_tract(1)	37		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)		CTCTTCATTGCCTGAAAGAATC	0.436																																							uc011eaa.1		NA																	0					0						c.(829-831)CCT>AAT		gap junction protein, alpha 10																																				SO:0001583	missense	84694				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity	g.chr6:90605016_90605017CC>AA	AF296766	CCDS5025.1	6q15-q16	2008-02-05			ENSG00000135355	ENSG00000135355		"""Ion channels / Gap junction proteins (connexins)"""	16995	protein-coding gene	gene with protein product	"""connexin 62"""	611924					Standard	NM_032602		Approved	CX62	uc011eaa.2	Q969M2	OTTHUMG00000015210	Exception_encountered	6.37:g.90605016_90605017delinsAA	ENSP00000358358:p.Pro277Asn						p.P277N	NM_032602	NP_115991	Q969M2	CXA10_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0915)	1	829_830	+		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)	277			Cytoplasmic (Potential).		B2R722|B3KVQ2|Q5TA63|Q96KG0	Missense_Mutation	DNP	ENST00000369352.1	37	c.829_830CC>AA	CCDS5025.1																																																																																				0.436	GJA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041505.1	NM_032602		17	33	0	0	0	0.004672	0	17	33				
EPHA7	2045	broad.mit.edu	37	6	93967918	93967918	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:93967918C>A	ENST00000369303.4	-	11	2193	c.2009G>T	c.(2008-2010)gGt>gTt	p.G670V		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	670	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TTCTGTGTAACCAACTTTCAG	0.438																																							uc003poe.2		NA																	0				lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28						c.(2008-2010)GGT>GTT		ephrin receptor EphA7 precursor							138.0	140.0	139.0					6																	93967918		2203	4300	6503	SO:0001583	missense	2045					integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr6:93967918C>A	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2009G>T	6.37:g.93967918C>A	ENSP00000358309:p.Gly670Val					EPHA7_uc003pof.2_Missense_Mutation_p.G665V|EPHA7_uc011eac.1_Missense_Mutation_p.G666V	p.G670V	NM_004440	NP_004431	Q15375	EPHA7_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0847)	11	2250	-		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)	670			Cytoplasmic (Potential).|Protein kinase.		A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	c.2009G>T	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	C	31	5.093692	0.94149	.	.	ENSG00000135333	ENST00000369303	D	0.82984	-1.67	6.08	6.08	0.98989	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88555	0.6468	L	0.49640	1.575	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.993;0.996;0.998	D	0.88180	0.2870	10	0.87932	D	0	.	20.6721	0.99693	0.0:1.0:0.0:0.0	.	666;665;670	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	V	670	ENSP00000358309:G670V	ENSP00000358309:G670V	G	-	2	0	EPHA7	94024639	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.894000	0.99253	0.591000	0.81541	GGT		0.438	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1			36	78	1	0	1.414e-09	0.003755	1.99027e-09	36	78				
SOBP	55084	broad.mit.edu	37	6	107955481	107955481	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:107955481C>A	ENST00000317357.5	+	6	2092	c.1433C>A	c.(1432-1434)cCg>cAg	p.P478Q		NM_018013.3	NP_060483.3			sine oculis binding protein homolog (Drosophila)											endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	26		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		CTGCTGCCCCCGCCGCCTCCG	0.706																																							uc003prx.2		NA																	0				ovary(1)	1						c.(1432-1434)CCG>CAG		sine oculis binding protein homolog							3.0	4.0	4.0					6																	107955481		1598	3709	5307	SO:0001583	missense	55084						metal ion binding	g.chr6:107955481C>A	AK001021	CCDS43488.1	6q21	2007-03-15			ENSG00000112320	ENSG00000112320			29256	protein-coding gene	gene with protein product		613667					Standard	NM_018013		Approved	FLJ10159	uc003prx.3	A7XYQ1	OTTHUMG00000015312	ENST00000317357.5:c.1433C>A	6.37:g.107955481C>A	ENSP00000318900:p.Pro478Gln						p.P478Q	NM_018013	NP_060483	A7XYQ1	SOBP_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)	6	1937	+		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)	478			Pro-rich.			Missense_Mutation	SNP	ENST00000317357.5	37	c.1433C>A	CCDS43488.1	.	.	.	.	.	.	.	.	.	.	c	18.05	3.535937	0.64972	.	.	ENSG00000112320	ENST00000317357;ENST00000230065	T	0.34667	1.35	4.75	4.75	0.60458	.	0.192582	0.34700	N	0.003744	T	0.45478	0.1344	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.27905	-1.0060	10	0.32370	T	0.25	-5.0604	17.7607	0.88463	0.0:1.0:0.0:0.0	.	478	A7XYQ1	SOBP_HUMAN	Q	478;75	ENSP00000318900:P478Q	ENSP00000230065:P75Q	P	+	2	0	SOBP	108062174	1.000000	0.71417	0.996000	0.52242	0.919000	0.55068	7.259000	0.78381	2.164000	0.68074	0.556000	0.70494	CCG		0.706	SOBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041693.2	NM_018013		5	12	1	0	0.000602214	0.000602	0.000674552	5	12				
HS3ST5	222537	broad.mit.edu	37	6	114379192	114379192	+	Silent	SNP	G	G	C	rs200605320		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:114379192G>C	ENST00000312719.5	-	5	1458	c.270C>G	c.(268-270)ctC>ctG	p.L90L	RP3-399L15.3_ENST00000519270.1_RNA|RP3-399L15.3_ENST00000519104.1_RNA|HS3ST5_ENST00000411826.1_Silent_p.L90L|RP3-399L15.3_ENST00000523087.1_RNA			Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 5	90					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|negative regulation of coagulation (GO:0050819)|protein sulfation (GO:0006477)|regulation of viral entry into host cell (GO:0046596)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(4)|endometrium(2)|kidney(1)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	41		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		TGGCCTTGGGGAGCTGCTGGA	0.572																																							uc003pwg.3		NA																	0				ovary(1)|pancreas(1)	2						c.(268-270)CTC>CTG		heparan sulfate (glucosamine)							68.0	65.0	66.0					6																	114379192		2203	4300	6503	SO:0001819	synonymous_variant	222537				heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding	g.chr6:114379192G>C	AF503292	CCDS34517.1	6q21	2011-11-16			ENSG00000249853	ENSG00000249853		"""Sulfotransferases, membrane-bound"""	19419	protein-coding gene	gene with protein product		609407				12138164	Standard	NM_153612		Approved	3-OST-5	uc003pwg.4	Q8IZT8	OTTHUMG00000015412	ENST00000312719.5:c.270C>G	6.37:g.114379192G>C						uc003pwf.2_Intron|HS3ST5_uc003pwh.3_Silent_p.L90L	p.L90L	NM_153612	NP_705840	Q8IZT8	HS3S5_HUMAN		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)	2	302	-		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)	90			Lumenal (Potential).		A8K1J2|Q52LI2|Q8N285	Silent	SNP	ENST00000312719.5	37	c.270C>G	CCDS34517.1																																																																																				0.572	HS3ST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041911.2	NM_153612		17	59	0	0	0	0.004007	0	17	59				
TBC1D32	221322	broad.mit.edu	37	6	121629179	121629179	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:121629179C>A	ENST00000398212.2	-	5	682	c.633G>T	c.(631-633)tgG>tgT	p.W211C	TBC1D32_ENST00000275159.6_Missense_Mutation_p.W211C	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	211					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										AGAGAGTAGTCCAATTTTCAC	0.338																																							uc003pyo.1		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(631-633)TGG>TGT		hypothetical protein LOC221322							103.0	98.0	100.0					6																	121629179		1856	4101	5957	SO:0001583	missense	221322				multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity	g.chr6:121629179C>A	AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.633G>T	6.37:g.121629179C>A	ENSP00000381270:p.Trp211Cys					C6orf170_uc003pyq.1_RNA	p.W211C	NM_152730	NP_689943	Q96NH3	BROMI_HUMAN		GBM - Glioblastoma multiforme(226;0.00521)	5	701	-			211					Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Missense_Mutation	SNP	ENST00000398212.2	37	c.633G>T	CCDS43501.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.788877	0.70337	.	.	ENSG00000146350	ENST00000275159;ENST00000398212;ENST00000422369	T;T;T	0.28255	1.62;1.62;1.62	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.50582	0.1624	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.57033	-0.7880	10	0.87932	D	0	-6.9791	18.3947	0.90494	0.0:1.0:0.0:0.0	.	211	Q96NH3	BROMI_HUMAN	C	211	ENSP00000275159:W211C;ENSP00000381270:W211C;ENSP00000397993:W211C	ENSP00000275159:W211C	W	-	3	0	C6orf170	121670878	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.704000	0.74639	2.387000	0.81309	0.484000	0.47621	TGG		0.338	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380937.2	NM_152730		8	31	1	0	1.12685e-05	0.004482	1.38718e-05	8	31				
SAMD3	154075	broad.mit.edu	37	6	130466509	130466509	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:130466509G>T	ENST00000368134.2	-	13	1862	c.1254C>A	c.(1252-1254)agC>agA	p.S418R	RP11-73O6.3_ENST00000415964.1_RNA|SAMD3_ENST00000439090.2_Missense_Mutation_p.S418R|SAMD3_ENST00000457563.2_Missense_Mutation_p.S442R|SAMD3_ENST00000437477.2_Missense_Mutation_p.S418R|RP11-73O6.3_ENST00000609978.1_RNA	NM_001258275.1	NP_001245204.1	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3	418										breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(15)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	29				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		TGACAAAAAGGCTGGGATCAT	0.338																																							uc003qbv.2		NA																	0				ovary(1)	1						c.(1252-1254)AGC>AGA		sterile alpha motif domain containing 3 isoform							94.0	83.0	86.0					6																	130466509		2203	4300	6503	SO:0001583	missense	154075							g.chr6:130466509G>T	AK091351	CCDS34539.1, CCDS64525.1	6q23.1	2013-01-10			ENSG00000164483	ENSG00000164483		"""Sterile alpha motif (SAM) domain containing"""	21574	protein-coding gene	gene with protein product							Standard	NM_001017373		Approved	bA73O6.2, FLJ34032	uc031spp.1	Q8N6K7	OTTHUMG00000015556	ENST00000368134.2:c.1254C>A	6.37:g.130466509G>T	ENSP00000357116:p.Ser418Arg					SAMD3_uc003qbx.2_Missense_Mutation_p.S418R|SAMD3_uc003qbw.2_Missense_Mutation_p.S418R	p.S418R	NM_001017373	NP_001017373	Q8N6K7	SAMD3_HUMAN		GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)	12	1580	-			418					B4DY20|E1P576|J3KQK4|Q4VXD8|Q8NAY1|Q8NB96	Missense_Mutation	SNP	ENST00000368134.2	37	c.1254C>A	CCDS34539.1	.	.	.	.	.	.	.	.	.	.	G	12.88	2.070218	0.36566	.	.	ENSG00000164483	ENST00000368134;ENST00000457563;ENST00000439090;ENST00000437477	T;T;T;T	0.47528	0.85;0.84;0.85;0.85	4.97	-4.37	0.03633	.	0.088386	0.49305	D	0.000155	T	0.31888	0.0811	M	0.64997	1.995	0.80722	D	1	P	0.48162	0.906	P	0.49752	0.621	T	0.40961	-0.9535	10	0.51188	T	0.08	.	8.5458	0.33421	0.6124:0.0:0.281:0.1067	.	418	Q8N6K7	SAMD3_HUMAN	R	418;442;418;418	ENSP00000357116:S418R;ENSP00000402092:S442R;ENSP00000403565:S418R;ENSP00000391163:S418R	ENSP00000357116:S418R	S	-	3	2	SAMD3	130508202	0.997000	0.39634	0.774000	0.31636	0.303000	0.27691	0.459000	0.21908	-0.893000	0.03930	-2.049000	0.00408	AGC		0.338	SAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042197.3	NM_152552		6	18	1	0	1.06961e-07	0.00308	1.40977e-07	6	18				
OLIG3	167826	broad.mit.edu	37	6	137815150	137815151	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:137815150_137815151CC>TT	ENST00000367734.2	-	1	380_381	c.157_158GG>AA	c.(157-159)GGg>AAg	p.G53K		NM_175747.2	NP_786923.1	Q7RTU3	OLIG3_HUMAN	oligodendrocyte transcription factor 3	53					spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron migration (GO:0097476)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II transcription corepressor activity (GO:0001106)			endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	11	Breast(32;0.165)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00161)|OV - Ovarian serous cystadenocarcinoma(155;0.00447)		GAGGCTTTCCCCGGGCATCTTC	0.619																																							uc003qhp.1		NA																	0					0						c.(157-159)GGG>AAG		oligodendrocyte transcription factor 3																																				SO:0001583	missense	167826				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr6:137815150_137815151CC>TT	AK096362	CCDS5186.1	6q23.3	2013-05-21			ENSG00000177468	ENSG00000177468		"""Basic helix-loop-helix proteins"""	18003	protein-coding gene	gene with protein product		609323					Standard	NM_175747		Approved	Bhlhb7, bHLHe20	uc003qhp.1	Q7RTU3	OTTHUMG00000015657	ENST00000367734.2:c.157_158delinsTT	6.37:g.137815150_137815151delinsTT	ENSP00000356708:p.Gly53Lys						p.G53K	NM_175747	NP_786923	Q7RTU3	OLIG3_HUMAN		GBM - Glioblastoma multiforme(68;0.00161)|OV - Ovarian serous cystadenocarcinoma(155;0.00447)	1	381_382	-	Breast(32;0.165)|Colorectal(23;0.24)		53					Q8N8Q0	Missense_Mutation	DNP	ENST00000367734.2	37	c.157_158GG>AA	CCDS5186.1																																																																																				0.619	OLIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042405.1	NM_175747		19	115	0	0	0	0.004672	0	19	115				
GRM1	2911	broad.mit.edu	37	6	146755768	146755768	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:146755768G>A	ENST00000282753.1	+	8	3656	c.3421G>A	c.(3421-3423)Gat>Aat	p.D1141N	GRM1_ENST00000492807.2_3'UTR|GRM1_ENST00000355289.4_3'UTR|GRM1_ENST00000392299.2_3'UTR|GRM1_ENST00000507907.1_3'UTR|GRM1_ENST00000361719.2_Missense_Mutation_p.D1141N			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	1141					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		GACCCCGGATGATTCGCCTGC	0.662																																							uc010khw.1		NA																	0				lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19						c.(3421-3423)GAT>AAT		glutamate receptor, metabotropic 1 isoform alpha	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)						44.0	48.0	47.0					6																	146755768		2202	4300	6502	SO:0001583	missense	2911				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity	g.chr6:146755768G>A	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.3421G>A	6.37:g.146755768G>A	ENSP00000282753:p.Asp1141Asn					GRM1_uc010khv.1_3'UTR|GRM1_uc003qll.2_3'UTR|GRM1_uc011edz.1_3'UTR|GRM1_uc011eea.1_3'UTR	p.D1141N	NM_000838	NP_000829	Q13255	GRM1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	9	3891	+		Ovarian(120;0.0387)	1141			Cytoplasmic (Potential).		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	c.3421G>A	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.900336	0.72754	.	.	ENSG00000152822	ENST00000361719;ENST00000282753	D;D	0.88586	-2.4;-2.4	5.97	5.97	0.96955	.	0.296081	0.39985	N	0.001211	T	0.80204	0.4580	L	0.29908	0.895	0.80722	D	1	B	0.21606	0.058	B	0.20767	0.031	T	0.74337	-0.3698	10	0.45353	T	0.12	.	20.428	0.99075	0.0:0.0:1.0:0.0	.	1141	Q13255	GRM1_HUMAN	N	1141	ENSP00000354896:D1141N;ENSP00000282753:D1141N	ENSP00000282753:D1141N	D	+	1	0	GRM1	146797461	1.000000	0.71417	0.938000	0.37757	0.959000	0.62525	6.352000	0.73027	2.837000	0.97791	0.655000	0.94253	GAT		0.662	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838		6	66	0	0	0	0.001168	0	6	66				
TAGAP	117289	broad.mit.edu	37	6	159457971	159457971	+	Missense_Mutation	SNP	C	C	A	rs200734731		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:159457971C>A	ENST00000367066.3	-	10	1415	c.1084G>T	c.(1084-1086)Gtg>Ttg	p.V362L	RP1-111C20.4_ENST00000607391.1_RNA|RP1-111C20.4_ENST00000607796.1_RNA|TAGAP_ENST00000326965.6_Missense_Mutation_p.V184L|RP1-111C20.4_ENST00000606466.1_RNA|RP1-111C20.4_ENST00000606470.1_RNA	NM_001278733.1|NM_054114.3	NP_001265662.1|NP_473455.2	Q8N103	TAGAP_HUMAN	T-cell activation RhoGTPase activating protein	362					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|autonomic_ganglia(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(2)|skin(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		AGCCTGGCCACGGTGCTCACA	0.647																																							uc003qrz.2		NA																	0				ovary(1)	1						c.(1084-1086)GTG>TTG		T-cell activation Rho GTPase-activating protein							40.0	43.0	42.0					6																	159457971		2203	4300	6503	SO:0001583	missense	117289				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|guanyl-nucleotide exchange factor activity	g.chr6:159457971C>A	AF385429	CCDS5261.1, CCDS5262.1, CCDS5263.1	6q25.3	2011-09-07	2008-03-25		ENSG00000164691	ENSG00000164691		"""Rho GTPase activating proteins"""	15669	protein-coding gene	gene with protein product		609667	"""T-cell activation GTPase activating protein"""			16375659, 18311140, 18356936	Standard	NM_152133		Approved	FLJ32631, IDDM21, ARHGAP47	uc003qrz.3	Q8N103	OTTHUMG00000015923	ENST00000367066.3:c.1084G>T	6.37:g.159457971C>A	ENSP00000356033:p.Val362Leu					TAGAP_uc011eft.1_Missense_Mutation_p.V299L|TAGAP_uc003qsa.2_Missense_Mutation_p.V184L	p.V362L	NM_054114	NP_473455	Q8N103	TAGAP_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)	10	1416	-		Breast(66;0.000776)|Ovarian(120;0.0303)	362					Q2NKM8|Q8NI40|Q96KZ2|Q96QA2	Missense_Mutation	SNP	ENST00000367066.3	37	c.1084G>T	CCDS5261.1	.	.	.	.	.	.	.	.	.	.	C	10.35	1.326540	0.24080	.	.	ENSG00000164691	ENST00000367066;ENST00000326965;ENST00000539071	T;T	0.17370	2.28;2.54	6.05	-1.53	0.08611	.	1.187990	0.05952	N	0.639036	T	0.02848	0.0085	L	0.43152	1.355	0.09310	N	1	B	0.13594	0.008	B	0.09377	0.004	T	0.37430	-0.9706	10	0.07813	T	0.8	-5.8737	2.6535	0.05005	0.098:0.235:0.3466:0.3204	.	362	Q8N103	TAGAP_HUMAN	L	362;184;27	ENSP00000356033:V362L;ENSP00000322650:V184L	ENSP00000322650:V184L	V	-	1	0	TAGAP	159377959	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.284000	0.08422	-0.051000	0.13334	-0.143000	0.13931	GTG		0.647	TAGAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042890.1	NM_054114		12	61	1	0	0.000978159	0.000978	0.00108911	12	61				
PDE10A	10846	broad.mit.edu	37	6	165801872	165801872	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr6:165801872T>C	ENST00000366882.1	-	18	1851	c.1697A>G	c.(1696-1698)cAg>cGg	p.Q566R	PDE10A_ENST00000539869.2_Missense_Mutation_p.Q576R|PDE10A_ENST00000354448.4_Missense_Mutation_p.Q566R			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	566					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	GTCGAACTTCTGCAGGTAGCT	0.527																																					Esophageal Squamous(22;308 615 5753 12038 40624)	Esophageal Squamous(22;308 615 5753 12038 40624)	uc003qun.2		NA																	0				ovary(3)|skin(2)	5						c.(1696-1698)CAG>CGG		phosphodiesterase 10A isoform 2	Dipyridamole(DB00975)						142.0	119.0	127.0					6																	165801872		2203	4300	6503	SO:0001583	missense	10846				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding	g.chr6:165801872T>C	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1697A>G	6.37:g.165801872T>C	ENSP00000355847:p.Gln566Arg					PDE10A_uc011egj.1_RNA|PDE10A_uc011egk.1_Missense_Mutation_p.Q496R|PDE10A_uc003quo.2_Missense_Mutation_p.Q576R	p.Q566R	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	18	1938	-		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)	566					Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37	c.1697A>G		.	.	.	.	.	.	.	.	.	.	T	13.87	2.365629	0.41902	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.80994	-1.44;-1.44	5.89	5.89	0.94794	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.85779	0.5776	M	0.72894	2.215	0.80722	D	1	D;B	0.56035	0.974;0.166	D;B	0.70487	0.969;0.179	D	0.84272	0.0489	10	0.31617	T	0.26	.	16.3109	0.82869	0.0:0.0:0.0:1.0	.	576;566	Q9ULW9;Q9Y233	.;PDE10_HUMAN	R	566;594;576;566;565	ENSP00000355847:Q566R;ENSP00000346435:Q566R	ENSP00000341187:Q576R	Q	-	2	0	PDE10A	165721862	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	7.409000	0.80053	2.257000	0.74773	0.460000	0.39030	CAG		0.527	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1			18	62	0	0	0	0.006122	0	18	62				
SDK1	221935	broad.mit.edu	37	7	4247746	4247746	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr7:4247746G>T	ENST00000404826.2	+	37	5369	c.5230G>T	c.(5230-5232)Gca>Tca	p.A1744S	SDK1_ENST00000389531.3_Missense_Mutation_p.A1724S	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1744	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CTACTGGGAGGCAGACAGCCA	0.562																																							uc003smx.2		NA																	0				large_intestine(3)|ovary(2)|skin(1)	6						c.(5230-5232)GCA>TCA		sidekick 1 precursor							74.0	76.0	75.0					7																	4247746		2203	4300	6503	SO:0001583	missense	221935				cell adhesion	integral to membrane		g.chr7:4247746G>T	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.5230G>T	7.37:g.4247746G>T	ENSP00000385899:p.Ala1744Ser					SDK1_uc010kso.2_Missense_Mutation_p.A1000S|SDK1_uc003smy.2_Missense_Mutation_p.A231S	p.A1744S	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)	37	5369	+		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)	1744			Fibronectin type-III 11.		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	c.5230G>T	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	7.042	0.562662	0.13498	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.56941	0.43;0.43	4.77	3.88	0.44766	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.493916	0.18747	N	0.132284	T	0.30541	0.0768	N	0.12961	0.28	0.22317	N	0.999205	B;B;B	0.19445	0.03;0.02;0.036	B;B;B	0.18871	0.02;0.023;0.018	T	0.13818	-1.0495	10	0.22109	T	0.4	.	6.479	0.22053	0.1514:0.0:0.7001:0.1485	.	1724;231;1744	F8W6X9;F2Z3E9;Q7Z5N4	.;.;SDK1_HUMAN	S	1744;1724	ENSP00000385899:A1744S;ENSP00000374182:A1724S	ENSP00000374182:A1724S	A	+	1	0	SDK1	4214272	0.816000	0.29132	0.986000	0.45419	0.972000	0.66771	1.244000	0.32778	1.110000	0.41699	0.655000	0.94253	GCA		0.562	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744		17	59	1	0	1.56452e-12	0.007413	2.48327e-12	17	59				
DGKB	1607	broad.mit.edu	37	7	14647118	14647118	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr7:14647118G>T	ENST00000403951.2	-	17	1796	c.1377C>A	c.(1375-1377)ttC>ttA	p.F459L	DGKB_ENST00000402815.1_Missense_Mutation_p.F458L|DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000399322.3_Missense_Mutation_p.F459L|DGKB_ENST00000407950.1_Missense_Mutation_p.F451L|DGKB_ENST00000258767.5_Missense_Mutation_p.F459L|DGKB_ENST00000444700.2_Missense_Mutation_p.F440L|DGKB_ENST00000406247.3_Missense_Mutation_p.F459L			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	459	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						ATAGATACTGGAATTTTCTGT	0.284																																							uc003ssz.2		NA																	0				lung(5)|ovary(4)|breast(2)|skin(1)	12						c.(1375-1377)TTC>TTA		diacylglycerol kinase, beta isoform 1	Phosphatidylserine(DB00144)						43.0	41.0	42.0					7																	14647118		1779	4045	5824	SO:0001583	missense	1607				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding	g.chr7:14647118G>T	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.1377C>A	7.37:g.14647118G>T	ENSP00000385780:p.Phe459Leu					DGKB_uc011jxt.1_Missense_Mutation_p.F440L|DGKB_uc003sta.2_Missense_Mutation_p.F459L|DGKB_uc011jxu.1_Missense_Mutation_p.F458L	p.F459L	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN			16	1564	-			459			DAGKc.		A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	ENST00000403951.2	37	c.1377C>A	CCDS47547.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.931566	0.73442	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21;2.21;2.21	5.6	3.42	0.39159	Diacylglycerol kinase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.20780	0.0500	L	0.31157	0.91	0.51233	D	0.999915	D;D;D;D	0.64830	0.988;0.994;0.994;0.959	P;D;D;P	0.63877	0.893;0.919;0.919;0.734	T	0.03761	-1.1006	10	0.37606	T	0.19	.	4.4639	0.11680	0.4289:0.0:0.5711:0.0	.	458;440;459;459	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	L	459;459;459;458;451;440;459	ENSP00000385780:F459L;ENSP00000382260:F459L;ENSP00000258767:F459L;ENSP00000384909:F458L;ENSP00000385031:F451L;ENSP00000388451:F440L;ENSP00000386066:F459L	ENSP00000258767:F459L	F	-	3	2	DGKB	14613643	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.646000	0.37249	1.501000	0.48654	0.561000	0.74099	TTC		0.284	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080		7	18	1	0	0.000157383	0.00308	0.000180628	7	18				
ELMO1	9844	broad.mit.edu	37	7	36895295	36895295	+	Missense_Mutation	SNP	G	G	A	rs182459066		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr7:36895295G>A	ENST00000310758.4	-	22	2692	c.2045C>T	c.(2044-2046)aCg>aTg	p.T682M	ELMO1_ENST00000396045.3_Missense_Mutation_p.T202M|ELMO1_ENST00000396040.2_Missense_Mutation_p.T202M|ELMO1_ENST00000442504.1_Missense_Mutation_p.T682M|ELMO1_ENST00000448602.1_Missense_Mutation_p.T682M|ELMO1_ENST00000341056.3_Missense_Mutation_p.T384M	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	682					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GTCATTCCGCGTCAGGTCGCT	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		19463	0.001		0.0	False		,,,				2504	0.0						uc003tfk.1		NA																	0				ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						c.(2044-2046)ACG>ATG		engulfment and cell motility 1 isoform 1							177.0	149.0	159.0					7																	36895295		2203	4300	6503	SO:0001583	missense	9844				actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding	g.chr7:36895295G>A	AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.2045C>T	7.37:g.36895295G>A	ENSP00000312185:p.Thr682Met					ELMO1_uc003tfi.1_Missense_Mutation_p.T202M|ELMO1_uc003tfj.1_Missense_Mutation_p.T202M|ELMO1_uc011kbb.1_RNA|ELMO1_uc011kbc.1_Missense_Mutation_p.T586M|ELMO1_uc010kxg.1_Missense_Mutation_p.T682M	p.T682M	NM_014800	NP_055615	Q92556	ELMO1_HUMAN			22	2352	-			682					A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	ENST00000310758.4	37	c.2045C>T	CCDS5449.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	16.84	3.235130	0.58886	.	.	ENSG00000155849	ENST00000341056;ENST00000396045;ENST00000310758;ENST00000361912;ENST00000396040;ENST00000442504;ENST00000448602	T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8;0.8	4.88	4.0	0.46444	.	0.060622	0.64402	N	0.000004	T	0.58566	0.2131	L	0.52126	1.63	0.80722	D	1	D	0.76494	0.999	P	0.61328	0.887	T	0.61917	-0.6964	10	0.59425	D	0.04	.	13.6099	0.62071	0.075:0.0:0.925:0.0	.	682	Q92556	ELMO1_HUMAN	M	384;202;682;586;202;682;682	ENSP00000342142:T384M;ENSP00000379360:T202M;ENSP00000312185:T682M;ENSP00000379355:T202M;ENSP00000406952:T682M;ENSP00000394458:T682M	ENSP00000312185:T682M	T	-	2	0	ELMO1	36861820	1.000000	0.71417	0.870000	0.34147	0.965000	0.64279	9.657000	0.98554	1.420000	0.47138	0.650000	0.86243	ACG		0.572	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442		34	91	0	0	0	0.002445	0	34	91				
INHBA	3624	broad.mit.edu	37	7	41729603	41729603	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr7:41729603C>A	ENST00000242208.4	-	3	1172	c.926G>T	c.(925-927)cGg>cTg	p.R309L	INHBA_ENST00000464515.1_5'UTR|AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000442711.1_Missense_Mutation_p.R309L	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	309					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CAAGCCCCGCCGACGCCGGCG	0.562										TSP Lung(11;0.080)																													uc003thq.2		NA																	0				lung(5)|ovary(1)	6						c.(925-927)CGG>CTG		inhibin beta A precursor							106.0	110.0	109.0					7																	41729603		2203	4300	6503	SO:0001583	missense	3624				cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity	g.chr7:41729603C>A		CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.926G>T	7.37:g.41729603C>A	ENSP00000242208:p.Arg309Leu	TSP Lung(11;0.080)				INHBA_uc003thr.2_Missense_Mutation_p.R309L	p.R309L	NM_002192	NP_002183	P08476	INHBA_HUMAN			2	1161	-			309					Q14599	Missense_Mutation	SNP	ENST00000242208.4	37	c.926G>T	CCDS5464.1	.	.	.	.	.	.	.	.	.	.	.	18.33	3.600987	0.66332	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	T;T	0.80033	-1.33;-1.33	5.82	5.82	0.92795	Transforming growth factor-beta, C-terminal (1);	0.245815	0.40640	N	0.001042	T	0.74627	0.3741	L	0.38692	1.165	0.52099	D	0.999945	P	0.39940	0.696	B	0.40038	0.317	T	0.77456	-0.2581	10	0.72032	D	0.01	-19.894	13.3152	0.60403	0.0:0.9279:0.0:0.0721	.	309	P08476	INHBA_HUMAN	L	309	ENSP00000242208:R309L;ENSP00000397197:R309L	ENSP00000242208:R309L	R	-	2	0	INHBA	41696128	1.000000	0.71417	0.991000	0.47740	0.992000	0.81027	3.844000	0.55873	2.762000	0.94881	0.484000	0.47621	CGG		0.562	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1			31	104	1	0	1.39806e-14	0.008361	2.30741e-14	31	104				
TFEC	22797	broad.mit.edu	37	7	115624467	115624467	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr7:115624467G>T	ENST00000265440.7	-	2	209	c.29C>A	c.(28-30)cCa>cAa	p.P10Q	TFEC_ENST00000484212.1_Missense_Mutation_p.P100Q|TFEC_ENST00000393485.1_Missense_Mutation_p.P10Q|TFEC_ENST00000320239.7_Missense_Mutation_p.P10Q	NM_012252.3	NP_036384.1	O14948	TFEC_HUMAN	transcription factor EC	10	Necessary for transcriptional transactivation.				cellular response to heat (GO:0034605)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|kidney(1)|large_intestine(5)|lung(13)|prostate(2)|skin(1)|urinary_tract(2)	25			STAD - Stomach adenocarcinoma(10;0.00878)			TTTAAGAGTTGGATTGATGAT	0.498																																							uc003vhj.1		NA																	0				large_intestine(1)	1						c.(28-30)CCA>CAA		transcription factor EC isoform a							183.0	161.0	169.0					7																	115624467		2203	4300	6503	SO:0001583	missense	22797					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity	g.chr7:115624467G>T	D43945	CCDS5762.1, CCDS34738.1, CCDS59076.1	7q31.2	2013-05-21			ENSG00000105967	ENSG00000105967		"""Basic helix-loop-helix proteins"""	11754	protein-coding gene	gene with protein product		604732				9256061	Standard	NM_012252		Approved	TCFEC, TFECL, bHLHe34	uc003vhj.2	O14948	OTTHUMG00000023518	ENST00000265440.7:c.29C>A	7.37:g.115624467G>T	ENSP00000265440:p.Pro10Gln					TFEC_uc003vhk.1_Missense_Mutation_p.P10Q|TFEC_uc003vhl.3_Missense_Mutation_p.P10Q|TFEC_uc011kmw.1_Missense_Mutation_p.P100Q	p.P10Q	NM_012252	NP_036384	O14948	TFEC_HUMAN	STAD - Stomach adenocarcinoma(10;0.00878)		2	213	-			10			Necessary for transcriptional transactivation.		B2R8X5|Q5H9U8|Q709A4|Q8N6J9	Missense_Mutation	SNP	ENST00000265440.7	37	c.29C>A	CCDS5762.1	.	.	.	.	.	.	.	.	.	.	G	0.120	-1.126818	0.01770	.	.	ENSG00000105967	ENST00000265440;ENST00000320239;ENST00000393485;ENST00000484212	T;T;T;T	0.12672	2.66;2.77;3.03;2.7	5.09	3.94	0.45596	.	0.127814	0.53938	N	0.000056	T	0.03520	0.0101	N	0.01048	-1.04	0.43657	D	0.99607	B;B;B;B	0.16166	0.016;0.001;0.0;0.0	B;B;B;B	0.06405	0.002;0.001;0.0;0.0	T	0.33701	-0.9858	10	0.02654	T	1	-3.7642	9.9439	0.41598	0.0:0.0:0.1811:0.8189	.	100;10;10;10	B7Z757;O14948-3;O14948-2;O14948	.;.;.;TFEC_HUMAN	Q	10;10;10;100	ENSP00000265440:P10Q;ENSP00000318676:P10Q;ENSP00000377125:P10Q;ENSP00000417432:P100Q	ENSP00000265440:P10Q	P	-	2	0	TFEC	115411703	0.999000	0.42202	0.026000	0.17262	0.079000	0.17450	3.330000	0.52068	0.879000	0.35944	-0.262000	0.10625	CCA		0.498	TFEC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000059839.4	NM_012252		32	80	1	0	1.39806e-14	0.008361	2.30741e-14	32	80				
CAV1	857	broad.mit.edu	37	7	116199023	116199023	+	Silent	SNP	A	A	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr7:116199023A>G	ENST00000341049.2	+	3	497	c.219A>G	c.(217-219)gcA>gcG	p.A73A	CAV1_ENST00000405348.1_Silent_p.A42A|CAV1_ENST00000393468.1_Silent_p.A42A|CAV1_ENST00000393470.1_Silent_p.A62A|CAV1_ENST00000393467.1_Silent_p.A42A	NM_001753.4	NP_001744.2	Q03135	CAV1_HUMAN	caveolin 1, caveolae protein, 22kDa	73					angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion transport (GO:0006816)|caveola assembly (GO:0070836)|caveolin-mediated endocytosis (GO:0072584)|cellular calcium ion homeostasis (GO:0006874)|cellular response to hyperoxia (GO:0071455)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol transport (GO:0030301)|cytosolic calcium ion homeostasis (GO:0051480)|inactivation of MAPK activity (GO:0000188)|lactation (GO:0007595)|leukocyte migration (GO:0050900)|lipid storage (GO:0019915)|maintenance of protein location in cell (GO:0032507)|mammary gland development (GO:0030879)|mammary gland involution (GO:0060056)|MAPK cascade (GO:0000165)|membrane depolarization (GO:0051899)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of pinocytosis (GO:0048550)|negative regulation of protein binding (GO:0032091)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|nitric oxide homeostasis (GO:0033484)|nitric oxide metabolic process (GO:0046209)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of vasoconstriction (GO:0045907)|protein homooligomerization (GO:0051260)|protein localization (GO:0008104)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)|regulation of blood coagulation (GO:0030193)|regulation of fatty acid metabolic process (GO:0019217)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidase activity (GO:0052547)|regulation of smooth muscle contraction (GO:0006940)|regulation of the force of heart contraction by chemical signal (GO:0003057)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to ischemia (GO:0002931)|response to progesterone (GO:0032570)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|vasculogenesis (GO:0001570)|vasoconstriction (GO:0042310)|vesicle organization (GO:0016050)|viral process (GO:0016032)	acrosomal membrane (GO:0002080)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell cortex (GO:0005938)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lipid particle (GO:0005811)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cholesterol binding (GO:0015485)|enzyme binding (GO:0019899)|nitric-oxide synthase binding (GO:0050998)|patched binding (GO:0005113)|peptidase activator activity (GO:0016504)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)			ATGTGATTGCAGAACCAGAAG	0.428																																							uc003vif.1		NA																	0					0						c.(217-219)GCA>GCG		caveolin 1							88.0	72.0	77.0					7																	116199023		2203	4300	6503	SO:0001819	synonymous_variant	857				blood coagulation|calcium ion transport|caveola assembly|cellular response to starvation|cholesterol homeostasis|cytosolic calcium ion homeostasis|inactivation of MAPK activity|interspecies interaction between organisms|leukocyte migration|lipid storage|maintenance of protein location in cell|mammary gland involution|membrane depolarization|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of endothelial cell proliferation|negative regulation of epithelial cell differentiation|negative regulation of nitric oxide biosynthetic process|negative regulation of peptidyl-serine phosphorylation|negative regulation of protein binding|negative regulation of transcription from RNA polymerase II promoter|nitric oxide homeostasis|nitric oxide metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of metalloenzyme activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of vasoconstriction|protein homooligomerization|receptor internalization|regulation of blood coagulation|regulation of fatty acid metabolic process|regulation of nitric-oxide synthase activity|regulation of smooth muscle contraction|response to calcium ion|response to estrogen stimulus|response to hypoxia|response to progesterone stimulus|skeletal muscle tissue development|T cell costimulation|triglyceride metabolic process|vasculogenesis|vesicle organization	apical plasma membrane|basolateral plasma membrane|caveola|caveola|cytosol|endoplasmic reticulum|endosome|Golgi membrane|lipid particle|perinuclear region of cytoplasm	cholesterol binding|nitric-oxide synthase binding|peptidase activator activity|protein binding|protein complex scaffold|receptor binding	g.chr7:116199023A>G	AF125348	CCDS5767.1, CCDS55156.1	7q31	2006-02-09	2002-08-29		ENSG00000105974	ENSG00000105974			1527	protein-coding gene	gene with protein product		601047	"""caveolin 1, caveolae protein, 22kD"""	CAV		10087206	Standard	NM_001753		Approved		uc003vif.2	Q03135	OTTHUMG00000023413	ENST00000341049.2:c.219A>G	7.37:g.116199023A>G						CAV1_uc010lkd.1_Silent_p.A42A|CAV1_uc010lke.1_Silent_p.A42A|CAV1_uc003vig.1_RNA|CAV1_uc003vih.2_Silent_p.A42A|CAV1_uc010lkf.1_Silent_p.A42A	p.A73A	NM_001753	NP_001744	Q03135	CAV1_HUMAN	STAD - Stomach adenocarcinoma(10;0.00878)		3	497	+	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		73			Cytoplasmic (Potential).		Q9UGP1|Q9UNG1|Q9UQH6	Silent	SNP	ENST00000341049.2	37	c.219A>G	CCDS5767.1																																																																																				0.428	CAV1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000059734.4	NM_001753		8	19	0	0	0	0.00308	0	8	19				
GRM8	2918	broad.mit.edu	37	7	126883250	126883250	+	Nonsense_Mutation	SNP	G	G	T	rs548779443		TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr7:126883250G>T	ENST00000339582.2	-	2	817	c.9C>A	c.(7-9)tgC>tgA	p.C3*	GRM8_ENST00000358373.3_Nonsense_Mutation_p.C3*|GRM8_ENST00000444921.2_Nonsense_Mutation_p.C3*|GRM8_ENST00000405249.1_Nonsense_Mutation_p.C3*			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	3					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				GCTTTCCCTCGCATACCATTT	0.498										HNSCC(24;0.065)	OREG0003802	type=REGULATORY REGION|Gene=GRM8|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																											uc003vlr.2		NA																	0				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23						c.(7-9)TGC>TGA		glutamate receptor, metabotropic 8 isoform a	L-Glutamic Acid(DB00142)						62.0	58.0	60.0					7																	126883250		2203	4300	6503	SO:0001587	stop_gained	2918				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane		g.chr7:126883250G>T		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.9C>A	7.37:g.126883250G>T	ENSP00000344173:p.Cys3*	HNSCC(24;0.065)	OREG0003802	type=REGULATORY REGION|Gene=GRM8|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	1553	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Nonsense_Mutation_p.C3*|GRM8_uc010lkz.1_RNA	p.C3*	NM_000845	NP_000836	O00222	GRM8_HUMAN			1	320	-		Prostate(267;0.186)	3					A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Nonsense_Mutation	SNP	ENST00000339582.2	37	c.9C>A	CCDS5794.1	.	.	.	.	.	.	.	.	.	.	G	39	7.513167	0.98329	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249;ENST00000457830;ENST00000412160	.	.	.	6.17	4.37	0.52481	.	0.175824	0.50627	D	0.000104	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.7499	0.57302	0.1334:0.0:0.8666:0.0	.	.	.	.	X	3	.	ENSP00000344173:C3X	C	-	3	2	GRM8	126670486	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	2.715000	0.47210	0.925000	0.37094	0.655000	0.94253	TGC		0.498	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4			16	43	1	0	1.5739e-10	0.004007	2.30221e-10	16	43				
MGAM	8972	broad.mit.edu	37	7	141726932	141726932	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr7:141726932G>T	ENST00000549489.2	+	9	1095	c.1000G>T	c.(1000-1002)Gcg>Tcg	p.A334S	MGAM_ENST00000475668.2_Missense_Mutation_p.A334S	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	334	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCTTCAGCCTGCGCCAGCCAT	0.383																																							uc003vwy.2		NA																	0				ovary(2)	2						c.(1000-1002)GCG>TCG		maltase-glucoamylase	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)						128.0	119.0	122.0					7																	141726932		1875	4117	5992	SO:0001583	missense	8972				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity	g.chr7:141726932G>T	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.1000G>T	7.37:g.141726932G>T	ENSP00000447378:p.Ala334Ser						p.A334S	NM_004668	NP_004659	O43451	MGA_HUMAN			9	1054	+	Melanoma(164;0.0272)		334			Lumenal (Potential).|Maltase.		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	c.1000G>T	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	G	4.132	0.022840	0.08006	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.84873	-1.91	5.36	-5.23	0.02798	Glycoside hydrolase-type carbohydrate-binding (1);	0.665161	0.13845	N	0.358745	T	0.76392	0.3981	L	0.39020	1.185	0.09310	N	1	B	0.18013	0.025	B	0.28638	0.092	T	0.58707	-0.7589	10	0.25106	T	0.35	.	14.1875	0.65614	0.6502:0.0:0.3498:0.0	.	334	O43451	MGA_HUMAN	S	334;334;211	ENSP00000447378:A334S	ENSP00000316431:A211S	A	+	1	0	MGAM	141373401	0.003000	0.15002	0.001000	0.08648	0.131000	0.20780	0.021000	0.13489	-1.105000	0.03011	-0.812000	0.03155	GCG		0.383	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3			24	87	1	0	7.33532e-06	0.003954	9.15075e-06	24	87				
ZNF746	155061	broad.mit.edu	37	7	149174137	149174137	+	Splice_Site	SNP	A	A	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr7:149174137A>C	ENST00000340622.3	-	6	994	c.714T>G	c.(712-714)ggT>ggG	p.G238G	ZNF746_ENST00000458143.2_Splice_Site_p.G238G			Q6NUN9	ZN746_HUMAN	zinc finger protein 746	238					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			TGGAATGGACACCTGCGGTAA	0.622																																							uc003wfw.2		NA																	0				ovary(2)|breast(1)	3						c.(712-714)GGT>GGG		zinc finger protein 746 isoform 2							105.0	79.0	88.0					7																	149174137		2203	4300	6503	SO:0001630	splice_region_variant	155061				negative regulation of transcription, DNA-dependent|neuron death|regulation of cell death|transcription, DNA-dependent	cytoplasm|nucleus	transcription regulatory region DNA binding|ubiquitin protein ligase binding|zinc ion binding	g.chr7:149174137A>C	AK055975	CCDS5897.1, CCDS55180.1	7q36.1	2013-01-08			ENSG00000181220	ENSG00000181220		"""Zinc fingers, C2H2-type"", ""-"""	21948	protein-coding gene	gene with protein product		613914					Standard	NM_152557		Approved	FLJ31413	uc010lpi.2	Q6NUN9	OTTHUMG00000158972	ENST00000340622.3:c.713-1T>G	7.37:g.149174137A>C						ZNF746_uc010lpi.2_Silent_p.G238G	p.G238G	NM_152557	NP_689770	Q6NUN9	ZN746_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00358)		6	985	-	Melanoma(164;0.165)		238					A8K6Z9|Q6ZRF9	Silent	SNP	ENST00000340622.3	37	c.714T>G	CCDS5897.1																																																																																				0.622	ZNF746-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352730.1	NM_152557	Silent	9	32	0	0	0	0.006214	0	9	32				
ADAMDEC1	27299	broad.mit.edu	37	8	24242041	24242041	+	Silent	SNP	A	A	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr8:24242041A>T	ENST00000256412.4	+	1	244	c.24A>T	c.(22-24)ctA>ctT	p.L8L	RP11-624C23.1_ENST00000518988.1_RNA|ADAMDEC1_ENST00000538205.1_5'UTR|RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000523700.1_RNA|ADAMDEC1_ENST00000522298.1_5'UTR	NM_014479.3	NP_055294.1	O15204	ADEC1_HUMAN	ADAM-like, decysin 1	8					immune response (GO:0006955)|negative regulation of cell adhesion (GO:0007162)	extracellular region (GO:0005576)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|large_intestine(4)|skin(2)|stomach(1)	9		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		TCTCCCAGCTACCTGCAGTGG	0.453																																					Ovarian(147;687 1849 3699 25981 31337)	Ovarian(147;687 1849 3699 25981 31337)	uc003xdz.2		NA																	0				skin(2)	2						c.(22-24)CTA>CTT		ADAM-like, decysin 1 isoform 1							131.0	97.0	109.0					8																	24242041		2203	4300	6503	SO:0001819	synonymous_variant	27299				integrin-mediated signaling pathway|negative regulation of cell adhesion|proteolysis	extracellular region|integral to membrane	integrin binding|metalloendopeptidase activity|zinc ion binding	g.chr8:24242041A>T	Y13323	CCDS6044.1, CCDS55212.1	8p12	2008-08-07			ENSG00000134028	ENSG00000134028			16299	protein-coding gene	gene with protein product		606393				9271581, 12037602	Standard	NM_001145271		Approved	M12.219	uc003xdz.2	O15204	OTTHUMG00000097858	ENST00000256412.4:c.24A>T	8.37:g.24242041A>T						ADAMDEC1_uc010lub.2_5'UTR|ADAMDEC1_uc011lab.1_5'UTR	p.L8L	NM_014479	NP_055294	O15204	ADEC1_HUMAN		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)	1	244	+		Prostate(55;0.0181)	8					B7ZAK5	Silent	SNP	ENST00000256412.4	37	c.24A>T	CCDS6044.1																																																																																				0.453	ADAMDEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215149.2	NM_014479		5	10	0	0	0	0.000602	0	5	10				
ADAM7	8756	broad.mit.edu	37	8	24299997	24299997	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr8:24299997C>A	ENST00000175238.6	+	2	147	c.64C>A	c.(64-66)Ctt>Att	p.L22I	RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|ADAM7_ENST00000441335.2_Missense_Mutation_p.L22I|ADAM7_ENST00000380789.1_Missense_Mutation_p.L22I	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	22						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		AAAGTTCATCCTTGGAGTAGA	0.408																																							uc003xeb.2		NA																	0				skin(3)|ovary(1)|kidney(1)	5						c.(64-66)CTT>ATT		a disintegrin and metalloproteinase domain 7							206.0	204.0	205.0					8																	24299997		2203	4300	6503	SO:0001583	missense	8756				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding	g.chr8:24299997C>A	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.64C>A	8.37:g.24299997C>A	ENSP00000175238:p.Leu22Ile					ADAM7_uc003xea.1_Missense_Mutation_p.L22I	p.L22I	NM_003817	NP_003808	Q9H2U9	ADAM7_HUMAN		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)	2	177	+		Prostate(55;0.0181)	22			Extracellular (Potential).		A8K8X7|O75959|Q6PEJ6	Missense_Mutation	SNP	ENST00000175238.6	37	c.64C>A	CCDS6045.1	.	.	.	.	.	.	.	.	.	.	C	3.875	-0.027199	0.07589	.	.	ENSG00000069206	ENST00000441335;ENST00000175238;ENST00000380789	T;T;T	0.28895	2.33;1.59;1.6	4.23	1.35	0.21983	.	0.748306	0.11515	N	0.556346	T	0.17365	0.0417	L	0.29908	0.895	0.09310	N	0.999999	B;B	0.20550	0.0;0.046	B;B	0.17098	0.002;0.017	T	0.27806	-1.0063	10	0.22109	T	0.4	.	2.636	0.04958	0.1849:0.5155:0.1946:0.1051	.	22;22	Q9H2U9;Q6PEJ6	ADAM7_HUMAN;.	I	22	ENSP00000393073:L22I;ENSP00000175238:L22I;ENSP00000370166:L22I	ENSP00000175238:L22I	L	+	1	0	ADAM7	24355942	0.002000	0.14202	0.141000	0.22245	0.449000	0.32228	0.330000	0.19715	0.292000	0.22492	0.557000	0.71058	CTT		0.408	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817		14	140	1	0	2.62699e-14	0.003163	4.29766e-14	14	140				
CDCA2	157313	broad.mit.edu	37	8	25325745	25325745	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr8:25325745G>T	ENST00000330560.3	+	6	1028	c.551G>T	c.(550-552)gGt>gTt	p.G184V	CDCA2_ENST00000380665.3_Missense_Mutation_p.G169V	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	184					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		AGAAAGGAAGGTCTCAGCGCT	0.363																																							uc003xep.1		NA																	0					0						c.(550-552)GGT>GTT		cell division cycle associated 2							44.0	44.0	44.0					8																	25325745		2203	4300	6503	SO:0001583	missense	157313				cell division|mitosis	cytoplasm|nucleus		g.chr8:25325745G>T	BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.551G>T	8.37:g.25325745G>T	ENSP00000328228:p.Gly184Val					PPP2R2A_uc003xek.2_Intron|CDCA2_uc011lae.1_Missense_Mutation_p.G184V|CDCA2_uc003xeq.1_Missense_Mutation_p.G169V|CDCA2_uc003xer.1_5'UTR	p.G184V	NM_152562	NP_689775	Q69YH5	CDCA2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)	6	1030	+		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)	184					Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Missense_Mutation	SNP	ENST00000330560.3	37	c.551G>T	CCDS6049.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.989732	0.35131	.	.	ENSG00000184661	ENST00000330560;ENST00000380665	T;T	0.32753	1.44;1.44	5.06	-2.64	0.06114	.	0.777423	0.12081	N	0.501343	T	0.22003	0.0530	L	0.47716	1.5	0.09310	N	0.999993	B;B;B	0.19583	0.037;0.037;0.037	B;B;B	0.17433	0.018;0.018;0.018	T	0.24941	-1.0146	10	0.56958	D	0.05	0.3039	5.5061	0.16854	0.5524:0.0:0.301:0.1465	.	184;169;184	B7Z5Q5;E9PEI0;Q69YH5	.;.;CDCA2_HUMAN	V	184;169	ENSP00000328228:G184V;ENSP00000370040:G169V	ENSP00000328228:G184V	G	+	2	0	CDCA2	25381662	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.317000	0.08060	-0.390000	0.07774	-1.057000	0.02308	GGT		0.363	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216891.3	NM_152562		6	21	1	0	3.59834e-05	0.001168	4.2474e-05	6	21				
PXDNL	137902	broad.mit.edu	37	8	52320868	52320868	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr8:52320868C>A	ENST00000356297.4	-	17	3416	c.3316G>T	c.(3316-3318)Ggc>Tgc	p.G1106C	PXDNL_ENST00000543296.1_Missense_Mutation_p.G1106C	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1106					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GCAGCCACGCCAAACAGCCCC	0.572																																							uc003xqu.3		NA																	0				ovary(1)|pancreas(1)	2						c.(3316-3318)GGC>TGC		peroxidasin homolog-like precursor							53.0	58.0	56.0					8																	52320868		1894	4107	6001	SO:0001583	missense	137902				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity	g.chr8:52320868C>A		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.3316G>T	8.37:g.52320868C>A	ENSP00000348645:p.Gly1106Cys					PXDNL_uc003xqt.3_RNA	p.G1106C	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN			17	3417	-		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)	1106					B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	c.3316G>T	CCDS47855.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.67|10.67	1.416337|1.416337	0.25552|0.25552	.|.	.|.	ENSG00000147485|ENSG00000147485	ENST00000356297;ENST00000543296|ENST00000522933	T;T|.	0.69685|.	-0.42;-0.42|.	3.25|3.25	2.36|2.36	0.29203|0.29203	.|.	0.379871|.	0.22141|.	N|.	0.064044|.	T|T	0.76941|0.76941	0.4058|0.4058	M|M	0.91612|0.91612	3.225|3.225	0.37497|0.37497	D|D	0.916612|0.916612	D|.	0.89917|.	1.0|.	D|.	0.79108|.	0.992|.	T|T	0.78635|0.78635	-0.2127|-0.2127	10|5	0.72032|.	D|.	0.01|.	.|.	8.1014|8.1014	0.30859|0.30859	0.0:0.8712:0.0:0.1288|0.0:0.8712:0.0:0.1288	.|.	1106|.	A1KZ92|.	PXDNL_HUMAN|.	C|F	1106|224	ENSP00000348645:G1106C;ENSP00000444865:G1106C|.	ENSP00000348645:G1106C|.	G|L	-|-	1|3	0|2	PXDNL|PXDNL	52483421|52483421	1.000000|1.000000	0.71417|0.71417	0.005000|0.005000	0.12908|0.12908	0.014000|0.014000	0.08584|0.08584	3.156000|3.156000	0.50708|0.50708	0.342000|0.342000	0.23796|0.23796	-0.140000|-0.140000	0.14226|0.14226	GGC|TTG		0.572	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651		8	86	1	0	0.00829132	0.008291	0.00883618	8	86				
NSMAF	8439	broad.mit.edu	37	8	59508123	59508123	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr8:59508123T>C	ENST00000038176.3	-	22	2100	c.1888A>G	c.(1888-1890)Aaa>Gaa	p.K630E	NSMAF_ENST00000427130.2_Missense_Mutation_p.K661E	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor	630					ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				TCTTACTCTTTGTGGATTTTA	0.428																																							uc003xtt.2		NA																	0				ovary(1)	1						c.(1888-1890)AAA>GAA		neutral sphingomyelinase (N-SMase) activation							171.0	162.0	165.0					8																	59508123		2203	4300	6503	SO:0001583	missense	8439				ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity	g.chr8:59508123T>C	X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.1888A>G	8.37:g.59508123T>C	ENSP00000038176:p.Lys630Glu					NSMAF_uc011lee.1_Missense_Mutation_p.K661E	p.K630E	NM_003580	NP_003571	Q92636	FAN_HUMAN			22	2102	-		all_lung(136;0.174)|Lung NSC(129;0.2)	630			WD 1.		B4DFB0|E9PCH0|Q8IW26	Missense_Mutation	SNP	ENST00000038176.3	37	c.1888A>G	CCDS6173.1	.	.	.	.	.	.	.	.	.	.	T	29.7	5.031756	0.93575	.	.	ENSG00000035681	ENST00000038176;ENST00000427130	T;T	0.29397	1.57;1.57	5.89	5.89	0.94794	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.044574	0.85682	D	0.000000	T	0.44180	0.1281	M	0.77820	2.39	0.48696	D	0.999694	P;P	0.45827	0.867;0.764	B;P	0.45913	0.433;0.497	T	0.42716	-0.9435	9	.	.	.	.	16.3083	0.82859	0.0:0.0:0.0:1.0	.	661;630	Q92636-2;Q92636	.;FAN_HUMAN	E	630;661	ENSP00000038176:K630E;ENSP00000411012:K661E	.	K	-	1	0	NSMAF	59670677	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.546000	0.82137	2.250000	0.74265	0.455000	0.32223	AAA		0.428	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378384.1	NM_003580		8	24	0	0	0	0.008291	0	8	24				
ZFAND1	79752	broad.mit.edu	37	8	82626216	82626216	+	Silent	SNP	T	T	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr8:82626216T>A	ENST00000220669.5	-	6	435	c.417A>T	c.(415-417)acA>acT	p.T139T	ZFAND1_ENST00000522520.1_Silent_p.T32T|ZFAND1_ENST00000519523.1_Silent_p.T139T|ZFAND1_ENST00000521287.1_Silent_p.T32T|ZFAND1_ENST00000517588.1_Silent_p.T32T|ZFAND1_ENST00000521895.1_Silent_p.T32T|ZFAND1_ENST00000523096.1_Silent_p.T139T	NM_024699.2	NP_078975.2	Q8TCF1	ZFAN1_HUMAN	zinc finger, AN1-type domain 1	139							zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						CCTTTGCAGCTGTTTCACTAT	0.348																																							uc003ycj.1		NA																	0				ovary(1)	1						c.(415-417)ACA>ACT		zinc finger, AN1-type domain 1							197.0	168.0	178.0					8																	82626216		2203	4300	6503	SO:0001819	synonymous_variant	79752						zinc ion binding	g.chr8:82626216T>A		CCDS6232.1, CCDS55250.1, CCDS55251.1	8q21.13	2006-07-07						"""Zinc fingers, AN1-type domain containing"""	25858	protein-coding gene	gene with protein product						12477932	Standard	NM_024699		Approved	FLJ14007	uc003ycj.2	Q8TCF1		ENST00000220669.5:c.417A>T	8.37:g.82626216T>A						ZFAND1_uc010lzx.1_Silent_p.T139T|ZFAND1_uc003yck.1_Silent_p.T32T	p.T139T	NM_024699	NP_078975	Q8TCF1	ZFAN1_HUMAN			6	431	-			139					E5RIG0|E5RJ99|Q658R7|Q6IA32|Q6PGQ6|Q9H810	Silent	SNP	ENST00000220669.5	37	c.417A>T	CCDS6232.1																																																																																				0.348	ZFAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379739.1	NM_024699		6	34	0	0	0	0.001168	0	6	34				
NCALD	83988	broad.mit.edu	37	8	102731625	102731625	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr8:102731625C>T	ENST00000311028.3	-	5	611	c.233G>A	c.(232-234)gGg>gAg	p.G78E	NCALD_ENST00000519508.2_Missense_Mutation_p.G78E|NCALD_ENST00000522951.1_Missense_Mutation_p.G78E|NCALD_ENST00000220931.6_Missense_Mutation_p.G78E|NCALD_ENST00000521599.1_Missense_Mutation_p.G78E|NCALD_ENST00000395923.1_Missense_Mutation_p.G78E	NM_001040624.1|NM_001040626.1	NP_001035714.1|NP_001035716.1	P61601	NCALD_HUMAN	neurocalcin delta	78	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium-mediated signaling (GO:0019722)|regulation of systemic arterial blood pressure (GO:0003073)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	clathrin coat of trans-Golgi network vesicle (GO:0030130)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)	8	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)			GTCTATTGTCCCATCTCCATT	0.453																																							uc003yke.2		NA																	0					0						c.(232-234)GGG>GAG		neurocalcin delta							152.0	151.0	151.0					8																	102731625		2203	4300	6503	SO:0001583	missense	83988				synaptic transmission|vesicle-mediated transport	clathrin coat of trans-Golgi network vesicle|cytosol	actin binding|calcium ion binding|clathrin binding|tubulin binding	g.chr8:102731625C>T	AF052142	CCDS6292.1	8q22.3	2014-08-12			ENSG00000104490	ENSG00000104490		"""EF-hand domain containing"""	7655	protein-coding gene	gene with protein product		606722				11267673	Standard	XM_006716672		Approved		uc003ykk.3	P61601	OTTHUMG00000164876	ENST00000311028.3:c.233G>A	8.37:g.102731625C>T	ENSP00000310587:p.Gly78Glu					NCALD_uc003ykf.2_Missense_Mutation_p.G78E|NCALD_uc003ykg.2_Missense_Mutation_p.G78E|NCALD_uc003ykh.2_Missense_Mutation_p.G78E|NCALD_uc003yki.2_Missense_Mutation_p.G78E|NCALD_uc003ykj.2_Missense_Mutation_p.G78E|NCALD_uc003ykk.2_Missense_Mutation_p.G78E|NCALD_uc003ykl.2_Missense_Mutation_p.G78E	p.G78E	NM_032041	NP_114430	P61601	NCALD_HUMAN	all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)		2	602	-	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		78			EF-hand 2.|1 (Potential).		P29554|Q8IYC3|Q9H0W2	Missense_Mutation	SNP	ENST00000311028.3	37	c.233G>A	CCDS6292.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.907003	0.92107	.	.	ENSG00000104490	ENST00000395923;ENST00000311028;ENST00000220931;ENST00000521599;ENST00000519508;ENST00000522951;ENST00000522448;ENST00000520690;ENST00000518727;ENST00000520425;ENST00000518166;ENST00000522252;ENST00000517822;ENST00000524209;ENST00000517531;ENST00000521964;ENST00000519098;ENST00000523923	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96992	-2.63;-2.63;-2.63;-2.63;-2.63;-2.63;-2.63;-2.63;-2.63;-2.63;-2.63;-2.63;-2.63;-2.63;-2.63;-4.2;-4.2;-4.2	5.23	5.23	0.72850	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.98899	0.9627	H	0.97635	4.045	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.99548	1.0965	10	0.87932	D	0	.	18.7908	0.91973	0.0:1.0:0.0:0.0	.	78	P61601	NCALD_HUMAN	E	78	ENSP00000379256:G78E;ENSP00000310587:G78E;ENSP00000220931:G78E;ENSP00000428105:G78E;ENSP00000430476:G78E;ENSP00000428781:G78E;ENSP00000429466:G78E;ENSP00000429255:G78E;ENSP00000430731:G78E;ENSP00000430925:G78E;ENSP00000429522:G78E;ENSP00000428598:G78E;ENSP00000428312:G78E;ENSP00000429493:G78E;ENSP00000429245:G78E;ENSP00000430064:G78E;ENSP00000430534:G78E;ENSP00000428193:G78E	ENSP00000220931:G78E	G	-	2	0	NCALD	102800801	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.731000	0.84895	2.416000	0.81992	0.557000	0.71058	GGG		0.453	NCALD-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380732.2			19	136	0	0	0	0.006122	0	19	136				
COL14A1	7373	broad.mit.edu	37	8	121344948	121344948	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr8:121344948G>A	ENST00000297848.3	+	42	5029	c.4759G>A	c.(4759-4761)Gga>Aga	p.G1587R	COL14A1_ENST00000247781.3_Missense_Mutation_p.G1492R|COL14A1_ENST00000309791.4_Missense_Mutation_p.G1587R	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			AGGAAGCATGGGACCGCAAGG	0.502																																							uc003yox.2		NA																	0				ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12						c.(4759-4761)GGA>AGA		collagen, type XIV, alpha 1 precursor							115.0	102.0	107.0					8																	121344948		2203	4300	6503	SO:0001583	missense	7373				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging	g.chr8:121344948G>A		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.4759G>A	8.37:g.121344948G>A	ENSP00000297848:p.Gly1587Arg					COL14A1_uc003yoz.2_Missense_Mutation_p.G552R	p.G1587R	NM_021110	NP_066933	Q05707	COEA1_HUMAN	OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)		42	5024	+	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		1587			Triple-helical region 1 (COL2).			Missense_Mutation	SNP	ENST00000297848.3	37	c.4759G>A	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	G	16.64	3.180786	0.57800	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	D;D;D	0.99353	-5.77;-5.77;-5.77	5.52	5.52	0.82312	.	0.048608	0.85682	D	0.000000	D	0.99625	0.9863	H	0.96861	3.895	0.80722	D	1	D	0.69078	0.997	D	0.74348	0.983	D	0.97787	1.0236	10	0.72032	D	0.01	.	16.3283	0.82996	0.0:0.0:1.0:0.0	.	1587	Q05707	COEA1_HUMAN	R	1587;1587;1492	ENSP00000311809:G1587R;ENSP00000297848:G1587R;ENSP00000247781:G1492R	ENSP00000247781:G1492R	G	+	1	0	COL14A1	121414129	1.000000	0.71417	0.910000	0.35882	0.122000	0.20287	5.902000	0.69869	2.594000	0.87642	0.561000	0.74099	GGA		0.502	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110		8	15	0	0	0	0.008291	0	8	15				
FER1L6	654463	broad.mit.edu	37	8	125033810	125033810	+	Silent	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr8:125033810C>A	ENST00000522917.1	+	17	2240	c.2034C>A	c.(2032-2034)gcC>gcA	p.A678A	FER1L6_ENST00000399018.1_Silent_p.A678A|FER1L6-AS1_ENST00000518567.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	678						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GCAAGGAGGCCAAGGGGATCA	0.443																																							uc003yqw.2		NA																	0				ovary(5)|skin(5)|central_nervous_system(1)	11						c.(2032-2034)GCC>GCA		fer-1-like 6							139.0	139.0	139.0					8																	125033810		2003	4180	6183	SO:0001819	synonymous_variant	654463					integral to membrane		g.chr8:125033810C>A	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2034C>A	8.37:g.125033810C>A						uc003yqx.1_Intron	p.A678A	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	STAD - Stomach adenocarcinoma(47;0.00186)		17	2240	+	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		678			Cytoplasmic (Potential).			Silent	SNP	ENST00000522917.1	37	c.2034C>A	CCDS43767.1																																																																																				0.443	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112		15	95	1	0	6.72482e-11	0.003163	9.95381e-11	15	95				
ZNF251	90987	broad.mit.edu	37	8	145947374	145947374	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr8:145947374C>A	ENST00000292562.7	-	5	1946	c.1671G>T	c.(1669-1671)tgG>tgT	p.W557C	ZNF251_ENST00000524394.1_Intron	NM_138367.1	NP_612376.1	Q9BRH9	ZN251_HUMAN	zinc finger protein 251	557					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|kidney(1)|large_intestine(5)|lung(9)|stomach(1)	17	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)		TGTGAACTGTCCAGCGCAGAA	0.493																																							uc003zdv.3		NA																	0					0						c.(1669-1671)TGG>TGT		zinc finger protein 251							86.0	88.0	87.0					8																	145947374		2024	4215	6239	SO:0001583	missense	90987				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:145947374C>A	AK000435	CCDS47944.1	8q24.3	2013-01-08			ENSG00000198169	ENSG00000198169		"""Zinc fingers, C2H2-type"", ""-"""	13045	protein-coding gene	gene with protein product							Standard	NM_138367		Approved		uc003zdv.4	Q9BRH9	OTTHUMG00000165189	ENST00000292562.7:c.1671G>T	8.37:g.145947374C>A	ENSP00000292562:p.Trp557Cys						p.W557C	NM_138367	NP_612376	Q9BRH9	ZN251_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)	5	1927	-	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		557					Q2M219	Missense_Mutation	SNP	ENST00000292562.7	37	c.1671G>T	CCDS47944.1	.	.	.	.	.	.	.	.	.	.	C	13.98	2.400032	0.42613	.	.	ENSG00000198169	ENST00000292562	T	0.07327	3.2	1.93	0.978	0.19740	.	.	.	.	.	T	0.04407	0.0121	N	0.11756	0.17	0.48511	D	0.999667	P	0.43352	0.804	B	0.36959	0.237	T	0.49011	-0.8983	9	0.72032	D	0.01	-0.8367	8.829	0.35072	0.2268:0.7732:0.0:0.0	.	557	Q9BRH9	ZN251_HUMAN	C	557	ENSP00000292562:W557C	ENSP00000292562:W557C	W	-	3	0	ZNF251	145918183	0.001000	0.12720	0.002000	0.10522	0.019000	0.09904	1.585000	0.36600	0.347000	0.23924	0.563000	0.77884	TGG		0.493	ZNF251-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382541.1	NM_138367		33	43	1	0	2.80507e-11	0.002445	4.236e-11	33	43				
PTPRD	5789	broad.mit.edu	37	9	8521338	8521338	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr9:8521338G>T	ENST00000381196.4	-	17	1443	c.900C>A	c.(898-900)taC>taA	p.Y300*	PTPRD_ENST00000540109.1_Nonsense_Mutation_p.Y300*|PTPRD_ENST00000360074.4_Nonsense_Mutation_p.Y287*|PTPRD_ENST00000355233.5_Nonsense_Mutation_p.Y300*|PTPRD_ENST00000358503.5_Nonsense_Mutation_p.Y287*|PTPRD_ENST00000537002.1_Nonsense_Mutation_p.Y297*|PTPRD_ENST00000397606.3_Nonsense_Mutation_p.Y290*|PTPRD_ENST00000356435.5_Nonsense_Mutation_p.Y300*|PTPRD_ENST00000397611.3_Nonsense_Mutation_p.Y297*|PTPRD_ENST00000486161.1_Nonsense_Mutation_p.Y300*|PTPRD_ENST00000397617.3_Nonsense_Mutation_p.Y290*	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	300	Ig-like C2-type 3.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CAACACAGGTGTAATTTGCTG	0.423										TSP Lung(15;0.13)																													uc003zkk.2		NA																	0				lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(898-900)TAC>TAA		protein tyrosine phosphatase, receptor type, D							170.0	149.0	156.0					9																	8521338		2203	4300	6503	SO:0001587	stop_gained	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8521338G>T	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.900C>A	9.37:g.8521338G>T	ENSP00000370593:p.Tyr300*	TSP Lung(15;0.13)				PTPRD_uc003zkp.2_Nonsense_Mutation_p.Y300*|PTPRD_uc003zkq.2_Nonsense_Mutation_p.Y300*|PTPRD_uc003zkr.2_Nonsense_Mutation_p.Y294*|PTPRD_uc003zks.2_Nonsense_Mutation_p.Y290*|PTPRD_uc003zkl.2_Nonsense_Mutation_p.Y300*|PTPRD_uc003zkm.2_Nonsense_Mutation_p.Y287*|PTPRD_uc003zkn.2_Nonsense_Mutation_p.Y300*|PTPRD_uc003zko.2_Nonsense_Mutation_p.Y297*	p.Y300*	NM_002839	NP_002830	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	19	1611	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	300			Extracellular (Potential).|Ig-like C2-type 3.		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Nonsense_Mutation	SNP	ENST00000381196.4	37	c.900C>A	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	G	35	5.464059	0.96257	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	.	.	.	5.91	-4.52	0.03472	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7024	0.77552	0.7823:0.0:0.2177:0.0	.	.	.	.	X	300;300;287;287;300;290;297;297;300;300;300;290	.	.	Y	-	3	2	PTPRD	8511338	0.940000	0.31905	0.947000	0.38551	0.990000	0.78478	0.096000	0.15147	-0.676000	0.05238	-0.345000	0.07892	TAC		0.423	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			10	50	1	0	3.07112e-06	0.000978	3.85699e-06	10	50				
SH3GL2	6456	broad.mit.edu	37	9	17791273	17791274	+	Nonsense_Mutation	DNP	GG	GG	AT			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr9:17791273_17791274GG>AT	ENST00000380607.4	+	7	789_790	c.669_670GG>AT	c.(667-672)ctGGag>ctATag	p.E224*	SH3GL2_ENST00000537391.1_Nonsense_Mutation_p.E177*	NM_003026.2	NP_003017.1	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2	224	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of receptor internalization (GO:0002090)|signal transduction (GO:0007165)|synaptic vesicle endocytosis (GO:0048488)	clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		AAGCTCAGCTGGAGTACCACAA	0.46																																							uc003zna.2		NA																	0				skin(1)	1						c.(667-672)CTGGAG>CTATAG		SH3-domain GRB2-like 2																																				SO:0001587	stop_gained	6456				axon guidance|central nervous system development|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	cytosol|Golgi membrane|plasma membrane	identical protein binding|lipid binding	g.chr9:17791273_17791274GG>AT	X99657	CCDS6483.1	9p22	2008-02-05			ENSG00000107295	ENSG00000107295			10831	protein-coding gene	gene with protein product		604465				9169142	Standard	XM_005251549		Approved	SH3P4, SH3D2A, CNSA2, EEN-B1	uc003zna.3	Q99962	OTTHUMG00000019601	Exception_encountered	9.37:g.17791273_17791274delinsAT	ENSP00000369981:p.Glu224*					SH3GL2_uc011lmy.1_Nonsense_Mutation_p.E177*	p.E224*	NM_003026	NP_003017	Q99962	SH3G2_HUMAN		GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)	7	957_958	+			224			BAR.|Potential.		B2R618|Q9NQK5	Nonsense_Mutation	DNP	ENST00000380607.4	37	c.669_670GG>AT	CCDS6483.1																																																																																				0.460	SH3GL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051796.1	NM_003026		18	87	0	0	0	0.004672	0	18	87				
FRMPD1	22844	broad.mit.edu	37	9	37692734	37692734	+	Silent	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr9:37692734G>A	ENST00000539465.1	+	2	689	c.96G>A	c.(94-96)tcG>tcA	p.S32S	FRMPD1_ENST00000377765.3_Silent_p.S32S|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	32						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		GGGACAGCTCGGCCCGGTAAG	0.547																																							uc004aag.1		NA																	0				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9						c.(94-96)TCG>TCA		FERM and PDZ domain containing 1							68.0	66.0	67.0					9																	37692734		2203	4300	6503	SO:0001819	synonymous_variant	22844					cytoskeleton|cytosol|plasma membrane		g.chr9:37692734G>A	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.96G>A	9.37:g.37692734G>A						FRMPD1_uc004aah.1_Silent_p.S32S	p.S32S	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN		GBM - Glioblastoma multiforme(29;0.00655)	2	140	+			32					B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Silent	SNP	ENST00000539465.1	37	c.96G>A	CCDS6612.1																																																																																				0.547	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907		4	73	0	0	0	0.009096	0	4	73				
FRMPD1	22844	broad.mit.edu	37	9	37740199	37740199	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr9:37740199G>T	ENST00000539465.1	+	15	2267	c.1674G>T	c.(1672-1674)caG>caT	p.Q558H	FRMPD1_ENST00000541302.1_Missense_Mutation_p.Q427H|FRMPD1_ENST00000536622.1_Missense_Mutation_p.Q380H|FRMPD1_ENST00000377765.3_Missense_Mutation_p.Q558H|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	558						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		AGGAGGAGCAGCCTCCTGGGA	0.632																																							uc004aag.1		NA																	0				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9						c.(1672-1674)CAG>CAT		FERM and PDZ domain containing 1							36.0	42.0	40.0					9																	37740199		2203	4300	6503	SO:0001583	missense	22844					cytoskeleton|cytosol|plasma membrane		g.chr9:37740199G>T	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.1674G>T	9.37:g.37740199G>T	ENSP00000444411:p.Gln558His					FRMPD1_uc004aah.1_Missense_Mutation_p.Q558H|FRMPD1_uc011lqm.1_Missense_Mutation_p.Q380H|FRMPD1_uc011lqn.1_Missense_Mutation_p.Q427H	p.Q558H	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN		GBM - Glioblastoma multiforme(29;0.00655)	15	1718	+			558					B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	c.1674G>T	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	G	6.666	0.491430	0.12702	.	.	ENSG00000070601	ENST00000377765;ENST00000539465;ENST00000536622;ENST00000541302	T;T;T;T	0.18502	3.2;3.2;2.21;2.21	5.95	-0.408	0.12381	.	1.609800	0.03075	N	0.157643	T	0.14527	0.0351	L	0.51422	1.61	0.09310	N	1	B;P	0.35600	0.34;0.511	B;B	0.31751	0.064;0.135	T	0.15292	-1.0442	10	0.44086	T	0.13	0.0641	1.6357	0.02741	0.2061:0.1182:0.4325:0.2433	.	427;558	B4DZC8;Q5SYB0	.;FRPD1_HUMAN	H	558;558;380;427	ENSP00000366995:Q558H;ENSP00000444411:Q558H;ENSP00000437762:Q380H;ENSP00000444804:Q427H	ENSP00000366995:Q558H	Q	+	3	2	FRMPD1	37730199	0.001000	0.12720	0.001000	0.08648	0.028000	0.11728	0.885000	0.28227	-0.343000	0.08351	-0.181000	0.13052	CAG		0.632	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907		30	50	1	0	1.68575e-08	0.007291	2.30325e-08	30	50				
C9orf156	51531	broad.mit.edu	37	9	100678466	100678466	+	Silent	SNP	T	T	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr9:100678466T>A	ENST00000375119.3	-	2	307	c.231A>T	c.(229-231)ctA>ctT	p.L77L	Y_RNA_ENST00000364960.1_RNA|C9orf156_ENST00000478126.1_Intron	NM_016481.3	NP_057565.3	Q9BU70	NAP1_HUMAN	chromosome 9 open reading frame 156	77	TsaA-like. {ECO:0000255|PROSITE- ProRule:PRU01003}.				viral process (GO:0016032)		hydrolase activity (GO:0016787)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)	13		Acute lymphoblastic leukemia(62;0.158)				AAAACTGTTCTAGGCCCATCA	0.408																																							uc004axv.1		NA																	0					0						c.(229-231)CTA>CTT		Nef associated protein 1							81.0	76.0	78.0					9																	100678466		2203	4300	6503	SO:0001819	synonymous_variant	51531				interspecies interaction between organisms		hydrolase activity	g.chr9:100678466T>A	AK023069	CCDS6730.1	9q31.1	2011-03-02			ENSG00000136932	ENSG00000136932			30967	protein-coding gene	gene with protein product	"""Nef (lentivirus myristoylated factor) associated protein 1"""						Standard	NM_016481		Approved	HSPC219, NAP1	uc004axv.1	Q9BU70	OTTHUMG00000021007	ENST00000375119.3:c.231A>T	9.37:g.100678466T>A						C9orf156_uc004axw.1_5'UTR|C9orf156_uc004axx.1_5'UTR|C9orf156_uc010msq.1_5'UTR	p.L77L	NM_016481	NP_057565	Q9BU70	NAP1_HUMAN			2	308	-		Acute lymphoblastic leukemia(62;0.158)	77					Q5T113|Q86SK0|Q9NXJ7|Q9P0Q7	Silent	SNP	ENST00000375119.3	37	c.231A>T	CCDS6730.1																																																																																				0.408	C9orf156-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055401.1	NM_016481		7	31	0	0	0	0.004482	0	7	31				
OR13F1	138805	broad.mit.edu	37	9	107267317	107267317	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr9:107267317G>T	ENST00000334726.2	+	1	863	c.774G>T	c.(772-774)atG>atT	p.M258I		NM_001004485.1	NP_001004485.1	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F, member 1	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						CTCTCTCCATGCACCTGAAGC	0.478																																							uc011lvm.1		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(772-774)ATG>ATT		olfactory receptor, family 13, subfamily F,							110.0	105.0	107.0					9																	107267317		2203	4300	6503	SO:0001583	missense	138805				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:107267317G>T		CCDS35087.1	9q31.1	2013-09-24			ENSG00000186881	ENSG00000186881		"""GPCR / Class A : Olfactory receptors"""	14723	protein-coding gene	gene with protein product							Standard	NM_001004485		Approved		uc011lvm.2	Q8NGS4	OTTHUMG00000020404	ENST00000334726.2:c.774G>T	9.37:g.107267317G>T	ENSP00000334452:p.Met258Ile						p.M258I	NM_001004485	NP_001004485	Q8NGS4	O13F1_HUMAN			1	774	+			258			Helical; Name=6; (Potential).		Q6IF50	Missense_Mutation	SNP	ENST00000334726.2	37	c.774G>T	CCDS35087.1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953847	0.34471	.	.	ENSG00000186881	ENST00000334726	T	0.00145	8.67	4.3	0.376	0.16193	GPCR, rhodopsin-like superfamily (1);	0.208574	0.34484	N	0.003927	T	0.00109	0.0003	L	0.31207	0.915	0.23036	N	0.998399	B	0.23128	0.08	B	0.21360	0.034	T	0.32134	-0.9918	10	0.54805	T	0.06	.	5.6386	0.17550	0.2588:0.1444:0.5968:0.0	.	258	Q8NGS4	O13F1_HUMAN	I	258	ENSP00000334452:M258I	ENSP00000334452:M258I	M	+	3	0	OR13F1	106307138	0.000000	0.05858	0.632000	0.29296	0.952000	0.60782	-0.350000	0.07721	0.070000	0.16634	0.655000	0.94253	ATG		0.478	OR13F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053475.1			25	62	1	0	2.98393e-07	0.00278	3.85123e-07	25	62				
SLC44A1	23446	broad.mit.edu	37	9	108097868	108097868	+	Silent	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr9:108097868C>T	ENST00000374720.3	+	4	541	c.294C>T	c.(292-294)tgC>tgT	p.C98C	SLC44A1_ENST00000607692.1_3'UTR|SLC44A1_ENST00000374724.1_Silent_p.C98C|SLC44A1_ENST00000374723.1_Silent_p.C98C	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1	98					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	TGGATCCATGCAACCTGGACT	0.403																																							uc004bcn.2		NA																	0				breast(3)|ovary(1)	4						c.(292-294)TGC>TGT		CDW92 antigen	Choline(DB00122)						167.0	153.0	158.0					9																	108097868		2203	4300	6503	SO:0001819	synonymous_variant	23446					integral to membrane|mitochondrial outer membrane|plasma membrane	choline transmembrane transporter activity	g.chr9:108097868C>T	AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.294C>T	9.37:g.108097868C>T						SLC44A1_uc010mtk.1_Silent_p.C98C	p.C98C	NM_080546	NP_536856	Q8WWI5	CTL1_HUMAN			4	515	+			98			Mitochondrial intermembrane (Potential).		A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Silent	SNP	ENST00000374720.3	37	c.294C>T	CCDS6763.1																																																																																				0.403	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053500.1	NM_080546		21	53	0	0	0	0.008871	0	21	53				
NR5A1	2516	broad.mit.edu	37	9	127262971	127262971	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr9:127262971C>T	ENST00000373588.4	-	4	464	c.268G>A	c.(268-270)Ggt>Agt	p.G90S		NM_004959.4	NP_004950.2	Q13285	STF1_HUMAN	nuclear receptor subfamily 5, group A, member 1	90					adrenal gland development (GO:0030325)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|hormone metabolic process (GO:0042445)|intracellular receptor signaling pathway (GO:0030522)|luteinization (GO:0001553)|maintenance of protein location in nucleus (GO:0051457)|male gonad development (GO:0008584)|multicellular organismal aging (GO:0010259)|negative regulation of female gonad development (GO:2000195)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|primary sex determination (GO:0007538)|regulation of steroid biosynthetic process (GO:0050810)|tissue development (GO:0009888)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(1)|upper_aerodigestive_tract(1)	2						TTCCGGCCACCCCTCATACGG	0.612																																							uc004boo.1		NA																	0					0						c.(268-270)GGT>AGT		nuclear receptor subfamily 5, group A, member 1							47.0	53.0	51.0					9																	127262971		2110	4052	6162	SO:0001583	missense	2516				cell-cell signaling|male gonad development|positive regulation of transcription from RNA polymerase II promoter|primary sex determination|regulation of steroid biosynthetic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|phospholipid binding|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding	g.chr9:127262971C>T	D88155	CCDS6856.1	9q33	2013-01-16			ENSG00000136931	ENSG00000136931		"""Nuclear hormone receptors"""	7983	protein-coding gene	gene with protein product		184757		FTZF1		7789992	Standard	NM_004959		Approved	FTZ1, SF-1, ELP, AD4BP	uc004boo.1	Q13285	OTTHUMG00000020655	ENST00000373588.4:c.268G>A	9.37:g.127262971C>T	ENSP00000362690:p.Gly90Ser						p.G90S	NM_004959	NP_004950	Q13285	STF1_HUMAN			4	455	-			90					O15196|Q5T6F5	Missense_Mutation	SNP	ENST00000373588.4	37	c.268G>A	CCDS6856.1	.	.	.	.	.	.	.	.	.	.	C	33	5.288643	0.95517	.	.	ENSG00000136931	ENST00000373588;ENST00000455734	D;D	0.98747	-5.11;-3.96	4.92	4.92	0.64577	Zinc finger, NHR/GATA-type (1);Nuclear hormone receptor, ligand-binding (1);	0.000000	0.85682	D	0.000000	D	0.99077	0.9683	M	0.80982	2.52	0.80722	D	1	P	0.50528	0.936	D	0.69824	0.966	D	0.99727	1.1011	10	0.72032	D	0.01	.	17.1079	0.86668	0.0:1.0:0.0:0.0	.	90	Q13285	STF1_HUMAN	S	90	ENSP00000362690:G90S;ENSP00000393245:G90S	ENSP00000362690:G90S	G	-	1	0	NR5A1	126302792	1.000000	0.71417	0.994000	0.49952	0.984000	0.73092	7.792000	0.85828	2.277000	0.76020	0.561000	0.74099	GGT		0.612	NR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054029.1	NM_004959		18	49	0	0	0	0.008871	0	18	49				
NUP188	23511	broad.mit.edu	37	9	131730940	131730940	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr9:131730940G>T	ENST00000372577.2	+	9	762	c.741G>T	c.(739-741)agG>agT	p.R247S		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	247					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						TTGGTAGTAGGCAGACCAATA	0.393																																							uc004bws.1		NA																	0				ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						c.(739-741)AGG>AGT		nucleoporin 188kDa							197.0	178.0	185.0					9																	131730940		2203	4300	6503	SO:0001583	missense	23511				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr9:131730940G>T	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.741G>T	9.37:g.131730940G>T	ENSP00000361658:p.Arg247Ser						p.R247S	NM_015354	NP_056169	Q5SRE5	NU188_HUMAN			9	763	+			247					Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	c.741G>T	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	G	17.68	3.449353	0.63178	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.32753	1.44	5.52	3.7	0.42460	.	0.000000	0.85682	D	0.000000	T	0.40119	0.1104	L	0.34521	1.04	0.52501	D	0.999953	D	0.69078	0.997	D	0.75020	0.985	T	0.14282	-1.0478	10	0.52906	T	0.07	0.0345	9.3408	0.38079	0.244:0.0:0.756:0.0	.	247	Q5SRE5	NU188_HUMAN	S	136;247	ENSP00000361658:R247S	ENSP00000349125:R136S	R	+	3	2	NUP188	130770761	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.330000	0.33781	0.824000	0.34613	-0.259000	0.10710	AGG		0.393	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2			7	53	1	0	1.12685e-05	0.004482	1.38718e-05	7	53				
GPR107	57720	broad.mit.edu	37	9	132863393	132863393	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr9:132863393G>A	ENST00000372406.1	+	12	1529	c.1022G>A	c.(1021-1023)gGg>gAg	p.G341E	GPR107_ENST00000347136.6_Missense_Mutation_p.G341E|GPR107_ENST00000372410.3_Missense_Mutation_p.G341E	NM_001136557.1	NP_001130029.1	Q5VW38	GP107_HUMAN	G protein-coupled receptor 107	341						integral component of membrane (GO:0016021)				endometrium(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	11		Ovarian(14;0.000531)				AGTTTGAAAGGGGCGCTACTC	0.428																																							uc004bze.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(1021-1023)GGG>GAG		G protein-coupled receptor 107 isoform 1							167.0	159.0	162.0					9																	132863393		2203	4300	6503	SO:0001583	missense	57720					integral to membrane		g.chr9:132863393G>A	AF376725	CCDS35162.1, CCDS48041.1, CCDS48042.1	9q34.2	2014-01-30			ENSG00000148358	ENSG00000148358		"""GPCR / Unclassified : 7TM orphan receptors"""	17830	protein-coding gene	gene with protein product							Standard	NM_020960		Approved	KIAA1624, RP11-88G17, FLJ20998, LUSTR1	uc004bzd.2	Q5VW38	OTTHUMG00000020804	ENST00000372406.1:c.1022G>A	9.37:g.132863393G>A	ENSP00000361483:p.Gly341Glu					GPR107_uc004bzb.2_Missense_Mutation_p.G152E|GPR107_uc004bzc.3_RNA|GPR107_uc011mbx.1_Missense_Mutation_p.G341E|GPR107_uc004bzd.2_Missense_Mutation_p.G341E	p.G341E	NM_001136557	NP_001130029	Q5VW38	GP107_HUMAN			12	1249	+		Ovarian(14;0.000531)	341			Helical; Name=3; (Potential).		A6NJ53|Q2TB81|Q5JPA3|Q5VW39|Q96T26|Q9H658|Q9HCE8	Missense_Mutation	SNP	ENST00000372406.1	37	c.1022G>A	CCDS48041.1	.	.	.	.	.	.	.	.	.	.	G	36	5.907456	0.97093	.	.	ENSG00000148358	ENST00000372406;ENST00000347136;ENST00000372410;ENST00000455412	T;T;T	0.27557	1.66;1.74;1.7	6.08	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	M	0.89715	3.055	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.70680	-0.4805	10	0.62326	D	0.03	-18.5338	13.8968	0.63778	0.0731:0.0:0.9269:0.0	.	341;341;341	G5E994;Q5VW38;Q5VW38-2	.;GP107_HUMAN;.	E	341	ENSP00000361483:G341E;ENSP00000336988:G341E;ENSP00000361487:G341E	ENSP00000336988:G341E	G	+	2	0	GPR107	131903214	1.000000	0.71417	0.578000	0.28575	0.916000	0.54674	7.280000	0.78610	1.579000	0.49836	0.591000	0.81541	GGG		0.428	GPR107-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054643.2			30	67	0	0	0	0.007291	0	30	67				
RAPGEF1	2889	broad.mit.edu	37	9	134471745	134471745	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr9:134471745C>A	ENST00000372189.3	-	14	2194	c.2071G>T	c.(2071-2073)Gac>Tac	p.D691Y	RAPGEF1_ENST00000372190.3_Missense_Mutation_p.D709Y|RAPGEF1_ENST00000372195.1_Missense_Mutation_p.D708Y	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	691	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		CCGCGGACGTCCGGCCCGTCA	0.527																																							uc004cbc.2		NA																	0				lung(3)|ovary(2)|breast(1)|skin(1)	7						c.(2071-2073)GAC>TAC		guanine nucleotide-releasing factor 2 isoform a							77.0	86.0	83.0					9																	134471745		2139	4247	6386	SO:0001583	missense	2889				activation of MAPKK activity|nerve growth factor receptor signaling pathway|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome	guanyl-nucleotide exchange factor activity|SH3 domain binding	g.chr9:134471745C>A	BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.2071G>T	9.37:g.134471745C>A	ENSP00000361263:p.Asp691Tyr					RAPGEF1_uc004cbb.2_Missense_Mutation_p.D709Y|RAPGEF1_uc010mzm.2_RNA|RAPGEF1_uc010mzn.2_Missense_Mutation_p.D866Y|RAPGEF1_uc004cbd.2_Missense_Mutation_p.D696Y	p.D691Y	NM_005312	NP_005303	Q13905	RPGF1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)	14	2201	-		Myeloproliferative disorder(178;0.204)	691			N-terminal Ras-GEF.		Q5JUE4|Q8IV73	Missense_Mutation	SNP	ENST00000372189.3	37	c.2071G>T	CCDS48047.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.99|18.99	3.739166|3.739166	0.69304|0.69304	.|.	.|.	ENSG00000107263|ENSG00000107263	ENST00000266110;ENST00000372195;ENST00000429421;ENST00000372189;ENST00000372190;ENST00000411834;ENST00000337036;ENST00000398415;ENST00000357686|ENST00000414781	T;T;T|.	0.28895|.	1.59;1.59;1.59|.	5.57|5.57	5.57|5.57	0.84162|0.84162	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (2);|.	0.224065|.	0.45867|.	D|.	0.000328|.	T|T	0.76644|0.76644	0.4016|0.4016	M|M	0.74258|0.74258	2.255|2.255	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.998;0.998|.	T|T	0.75808|0.75808	-0.3187|-0.3187	10|5	0.72032|.	D|.	0.01|.	.|.	18.5364|18.5364	0.91011|0.91011	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	708;691;709|.	Q68DL3;Q13905;Q13905-3|.	.;RPGF1_HUMAN;.|.	Y|V	691;708;637;691;709;671;669;136;708|118	ENSP00000361269:D708Y;ENSP00000361263:D691Y;ENSP00000361264:D709Y|.	ENSP00000266110:D691Y|.	D|G	-|-	1|2	0|0	RAPGEF1|RAPGEF1	133461566|133461566	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.388000|0.388000	0.30384|0.30384	7.434000|7.434000	0.80377|0.80377	2.615000|2.615000	0.88500|0.88500	0.561000|0.561000	0.74099|0.74099	GAC|GGA		0.527	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054759.2	NM_005312		11	30	1	0	9.31168e-06	0.001855	1.15391e-05	11	30				
NOTCH1	4851	broad.mit.edu	37	9	139409742	139409742	+	Splice_Site	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr9:139409742C>A	ENST00000277541.6	-	12	2089	c.2014G>T	c.(2014-2016)Ggg>Tgg	p.G672W		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	672	EGF-like 17; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GGCCGCTCACCTGTGTAGCCC	0.637			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																													uc004chz.2		NA		Dom	yes		9	9q34.3	4851	T|Mis|O	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""			L	TRB@		T-ALL		0				haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856						c.(2014-2016)GGG>TGG		notch1 preproprotein							53.0	59.0	57.0					9																	139409742		2148	4245	6393	SO:0001630	splice_region_variant	4851				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	g.chr9:139409742C>A	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.2014+1G>T	9.37:g.139409742C>A		HNSCC(8;0.001)				NOTCH1_uc004cia.1_5'Flank	p.G672W	NM_017617	NP_060087	P46531	NOTC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)	12	2014	-	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)	672			Extracellular (Potential).|EGF-like 17; calcium-binding (Potential).		Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	c.2014G>T	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.898351	0.52227	.	.	ENSG00000148400	ENST00000277541	D	0.98249	-4.82	4.79	4.79	0.61399	EGF (1);EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.056664	0.64402	U	0.000001	D	0.99533	0.9833	H	0.99825	4.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97465	1.0037	9	.	.	.	.	16.8345	0.85953	0.0:1.0:0.0:0.0	.	672	P46531	NOTC1_HUMAN	W	672	ENSP00000277541:G672W	.	G	-	1	0	NOTCH1	138529563	1.000000	0.71417	0.999000	0.59377	0.073000	0.16967	7.653000	0.83643	2.193000	0.70182	0.467000	0.42956	GGG		0.637	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	Missense_Mutation	20	35	1	0	8.04996e-18	0.001882	1.37736e-17	20	35				
PRKX	5613	broad.mit.edu	37	X	3533931	3533931	+	Silent	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:3533931G>A	ENST00000262848.5	-	7	1230	c.876C>T	c.(874-876)aaC>aaT	p.N292N	PRKX_ENST00000425240.1_5'UTR	NM_005044.4	NP_005035.1	P51817	PRKX_HUMAN	protein kinase, X-linked	292	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial tube morphogenesis (GO:0060562)|kidney morphogenesis (GO:0060993)|myeloid cell differentiation (GO:0030099)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of epithelial cell differentiation involved in kidney development (GO:2000696)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|skin(2)	12		all_lung(23;0.000396)|Lung NSC(23;0.00123)				CATTCGCCCCGTTCTTCAAAA	0.433																																							uc010nde.2		NA																	0				skin(2)|lung(1)	3						c.(874-876)AAC>AAT		protein kinase, X-linked							108.0	73.0	85.0					X																	3533931		2202	4300	6502	SO:0001819	synonymous_variant	5613						ATP binding|cAMP-dependent protein kinase activity	g.chrX:3533931G>A		CCDS14125.1	Xp22.3	2008-08-01			ENSG00000183943	ENSG00000183943	2.7.11.1		9441	protein-coding gene	gene with protein product		300083				7633447	Standard	NM_005044		Approved	PKX1	uc010nde.3	P51817	OTTHUMG00000021087	ENST00000262848.5:c.876C>T	X.37:g.3533931G>A							p.N292N	NM_005044	NP_005035	P51817	PRKX_HUMAN			7	1243	-		all_lung(23;0.000396)|Lung NSC(23;0.00123)	292			Protein kinase.			Silent	SNP	ENST00000262848.5	37	c.876C>T	CCDS14125.1																																																																																				0.433	PRKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055659.1	NM_005044		6	18	0	0	0	0.001984	0	6	18				
ASB9	140462	broad.mit.edu	37	X	15287938	15287938	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:15287938G>T	ENST00000380488.4	-	1	332	c.59C>A	c.(58-60)cCt>cAt	p.P20H	ASB9_ENST00000546332.1_Missense_Mutation_p.P20H|ASB9_ENST00000380485.3_Missense_Mutation_p.P20H|ASB9_ENST00000380483.3_Missense_Mutation_p.P20H|ASB9_ENST00000473862.1_5'UTR	NM_001031739.2	NP_001026909.1	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box containing 9	20					intracellular signal transduction (GO:0035556)|positive regulation of protein catabolic process (GO:0045732)|protein ubiquitination (GO:0016567)	mitochondrion (GO:0005739)				breast(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(10)	15	Hepatocellular(33;0.183)					CCTGATGCCAGGAAAGTCCCT	0.577																																							uc004cwl.2		NA																	0					0						c.(58-60)CCT>CAT		ankyrin repeat and SOCS box-containing 9 isoform							113.0	88.0	97.0					X																	15287938		2203	4300	6503	SO:0001583	missense	140462				intracellular signal transduction			g.chrX:15287938G>T	AK000643	CCDS14163.1, CCDS35208.1, CCDS55372.1	Xp22.2	2013-01-10	2011-01-25		ENSG00000102048	ENSG00000102048		"""Ankyrin repeat domain containing"""	17184	protein-coding gene	gene with protein product		300890	"""ankyrin repeat and SOCS box-containing 9"""			12076535	Standard	NM_001031739		Approved	DKFZP564L0862, MGC4954, FLJ20636	uc004cwl.3	Q96DX5	OTTHUMG00000021172	ENST00000380488.4:c.59C>A	X.37:g.15287938G>T	ENSP00000369855:p.Pro20His					ASB9_uc004cwk.2_Missense_Mutation_p.P20H|ASB9_uc004cwm.2_Missense_Mutation_p.P20H|ASB9_uc010ner.2_Missense_Mutation_p.P20H|ASB9_uc004cwn.2_Missense_Mutation_p.P20H	p.P20H	NM_001031739	NP_001026909	Q96DX5	ASB9_HUMAN			1	306	-	Hepatocellular(33;0.183)		20					A8K8A5|Q9BVF5|Q9NWS5|Q9Y4T3	Missense_Mutation	SNP	ENST00000380488.4	37	c.59C>A	CCDS35208.1	.	.	.	.	.	.	.	.	.	.	G	14.80	2.642672	0.47153	.	.	ENSG00000102048	ENST00000380483;ENST00000380485;ENST00000380488;ENST00000546332	T;T;T;T	0.65178	1.03;-0.14;-0.09;-0.14	5.65	4.79	0.61399	.	0.711379	0.13200	N	0.406029	T	0.63283	0.2498	L	0.36672	1.1	0.09310	N	1	D;P;P;D	0.69078	0.997;0.912;0.81;0.976	P;B;B;B	0.52710	0.707;0.234;0.234;0.412	T	0.54944	-0.8217	10	0.62326	D	0.03	-4.1772	11.574	0.50850	0.0:0.1749:0.8251:0.0	.	20;20;20;20	Q7Z4A2;Q9BVF5;Q96DX5;Q96DX5-2	.;.;ASB9_HUMAN;.	H	20	ENSP00000369850:P20H;ENSP00000369852:P20H;ENSP00000369855:P20H;ENSP00000438943:P20H	ENSP00000369850:P20H	P	-	2	0	ASB9	15197859	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	0.526000	0.22971	1.135000	0.42183	0.513000	0.50165	CCT		0.577	ASB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055844.1			18	69	1	0	1.28384e-07	0.001882	1.67438e-07	18	69				
PHEX	5251	broad.mit.edu	37	X	22132685	22132685	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:22132685A>G	ENST00000379374.4	+	11	1848	c.1283A>G	c.(1282-1284)cAg>cGg	p.Q428R	PHEX_ENST00000537599.1_Missense_Mutation_p.Q428R|PHEX_ENST00000418858.3_Missense_Mutation_p.Q131R|PHEX_ENST00000535894.1_Missense_Mutation_p.Q331R	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	428					bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						GTGTACTTCCAGGAAGATAAG	0.408																																							uc004dah.2		NA																	0				ovary(2)|lung(1)	3						c.(1282-1284)CAG>CGG		phosphate-regulating neutral endopeptidase							129.0	111.0	117.0					X																	22132685		2203	4300	6503	SO:0001583	missense	5251				biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding	g.chrX:22132685A>G	U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.1283A>G	X.37:g.22132685A>G	ENSP00000368682:p.Gln428Arg					PHEX_uc011mjr.1_Missense_Mutation_p.Q428R|PHEX_uc011mjs.1_Missense_Mutation_p.Q331R	p.Q428R	NM_000444	NP_000435	P78562	PHEX_HUMAN			11	1486	+			428			Extracellular (Potential).		O00678|Q13646|Q2M325|Q93032|Q99827	Missense_Mutation	SNP	ENST00000379374.4	37	c.1283A>G	CCDS14204.1	.	.	.	.	.	.	.	.	.	.	A	9.466	1.094301	0.20471	.	.	ENSG00000102174	ENST00000379374;ENST00000537599;ENST00000535894;ENST00000418858	D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52	5.36	4.19	0.49359	Peptidase M13 (1);Metallopeptidase, catalytic domain (1);	0.166295	0.53938	N	0.000046	T	0.75221	0.3820	M	0.61703	1.905	0.45318	D	0.998317	B;B	0.15141	0.01;0.012	B;B	0.18561	0.013;0.022	T	0.65829	-0.6073	10	0.18710	T	0.47	.	10.385	0.44134	0.9218:0.0:0.0782:0.0	.	428;428	F5GXU4;P78562	.;PHEX_HUMAN	R	428;428;331;131	ENSP00000368682:Q428R;ENSP00000440362:Q428R;ENSP00000439418:Q331R;ENSP00000443531:Q131R	ENSP00000368682:Q428R	Q	+	2	0	PHEX	22042606	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.225000	0.72271	0.692000	0.31613	0.417000	0.27973	CAG		0.408	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056035.1	NM_000444		8	41	0	0	0	0.00308	0	8	41				
PCYT1B	9468	broad.mit.edu	37	X	24608231	24608231	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:24608231C>G	ENST00000379144.2	-	4	525	c.395G>C	c.(394-396)aGa>aCa	p.R132T	PCYT1B_ENST00000379145.1_Missense_Mutation_p.R114T|PCYT1B_ENST00000356768.4_Missense_Mutation_p.R132T	NM_004845.4	NP_004836.2	Q9Y5K3	PCY1B_HUMAN	phosphate cytidylyltransferase 1, choline, beta	132					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|ovarian follicle development (GO:0001541)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	choline-phosphate cytidylyltransferase activity (GO:0004105)			breast(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	17					Choline(DB00122)	AGCTTCGTATCTCTCGGCTTC	0.458																																							uc004dbi.2		NA																	0					0						c.(394-396)AGA>ACA		choline phosphate cytidylyltransferase 1 beta	Choline(DB00122)						153.0	118.0	130.0					X																	24608231		2203	4300	6503	SO:0001583	missense	9468					endoplasmic reticulum	choline-phosphate cytidylyltransferase activity	g.chrX:24608231C>G	AF052510	CCDS14213.1, CCDS55391.1, CCDS55392.1	Xp22	2008-02-05	2005-09-05		ENSG00000102230	ENSG00000102230	2.7.7.15		8755	protein-coding gene	gene with protein product		604926	"""phosphate cytidylyltransferase 1, choline, beta isoform"""			9593753	Standard	NM_004845		Approved	CCT-beta, CTB	uc004dbi.3	Q9Y5K3	OTTHUMG00000021270	ENST00000379144.2:c.395G>C	X.37:g.24608231C>G	ENSP00000368439:p.Arg132Thr					PCYT1B_uc004dbk.3_Missense_Mutation_p.R132T|PCYT1B_uc004dbj.2_Missense_Mutation_p.R114T	p.R132T	NM_004845	NP_004836	Q9Y5K3	PCY1B_HUMAN			4	628	-			132			Catalytic (Potential).		A8IX00|B2RCX8|B4DK10|E9PD84|O60621|Q86XC9	Missense_Mutation	SNP	ENST00000379144.2	37	c.395G>C	CCDS14213.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.766229	0.90020	.	.	ENSG00000102230	ENST00000379145;ENST00000379144;ENST00000356768	D;D;D	0.99706	-6.47;-6.47;-6.47	5.44	5.44	0.79542	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);Cytidyltransferase-related (1);	0.000000	0.85682	D	0.000000	D	0.99896	0.9950	H	0.99911	4.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95927	0.8935	10	0.87932	D	0	-16.9045	18.3331	0.90277	0.0:1.0:0.0:0.0	.	132;114;132	Q9Y5K3-2;E9PD84;Q9Y5K3	.;.;PCY1B_HUMAN	T	114;132;132	ENSP00000368440:R114T;ENSP00000368439:R132T;ENSP00000349211:R132T	ENSP00000349211:R132T	R	-	2	0	PCYT1B	24518152	1.000000	0.71417	0.991000	0.47740	0.922000	0.55478	7.320000	0.79064	2.524000	0.85096	0.600000	0.82982	AGA		0.458	PCYT1B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056103.1	NM_004845		12	37	0	0	0	0.000978	0	12	37				
GK	2710	broad.mit.edu	37	X	30738765	30738765	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:30738765G>A	ENST00000378943.3	+	16	1425	c.1246G>A	c.(1246-1248)Gga>Aga	p.G416R	GK_ENST00000378946.3_Missense_Mutation_p.G422R|GK_ENST00000378945.3_Missense_Mutation_p.G416R|GK-AS1_ENST00000464659.1_RNA|RP11-242C19.2_ENST00000497961.1_RNA|GK_ENST00000427190.1_Missense_Mutation_p.G217R	NM_001128127.2	NP_001121599.1	P32189	GLPK_HUMAN	glycerol kinase	422					cellular lipid metabolic process (GO:0044255)|glucose homeostasis (GO:0042593)|glycerol catabolic process (GO:0019563)|glycerol metabolic process (GO:0006071)|glycerol-3-phosphate biosynthetic process (GO:0046167)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|glycerol kinase activity (GO:0004370)			central_nervous_system(1)|large_intestine(3)	4						TCGAGACTGTGGAATTCCACT	0.368																																							uc004dch.3		NA																	0				central_nervous_system(1)	1						c.(1264-1266)GGA>AGA		glycerol kinase isoform a							106.0	97.0	100.0					X																	30738765		2202	4300	6502	SO:0001583	missense	2710				glycerol-3-phosphate metabolic process|triglyceride biosynthetic process	cytosol|mitochondrial outer membrane	ATP binding|glycerol kinase activity	g.chrX:30738765G>A	X78711	CCDS14225.1, CCDS35224.1, CCDS48090.1, CCDS75963.1	Xp21.3	2014-09-17			ENSG00000198814	ENSG00000198814	2.7.1.30	"""Glycerol kinases"""	4289	protein-coding gene	gene with protein product		300474				7987308	Standard	NM_203391		Approved	GK1, GKD	uc022buj.1	P32189	OTTHUMG00000021328	ENST00000378943.3:c.1246G>A	X.37:g.30738765G>A	ENSP00000368226:p.Gly416Arg					GK_uc010ngj.2_Missense_Mutation_p.G416R|GK_uc004dci.3_Missense_Mutation_p.G416R|GK_uc011mjz.1_Missense_Mutation_p.G217R|GK_uc011mka.1_Missense_Mutation_p.G259R|GK_uc010ngk.2_Missense_Mutation_p.G211R	p.G422R	NM_203391	NP_976325	P32189	GLPK_HUMAN			17	1443	+			422					A6NJP5|B2R833|Q6IQ27|Q8IVR5|Q9UMP0|Q9UMP1	Missense_Mutation	SNP	ENST00000378943.3	37	c.1264G>A	CCDS48090.1	.	.	.	.	.	.	.	.	.	.	G	18.63	3.665299	0.67700	.	.	ENSG00000198814	ENST00000378946;ENST00000378943;ENST00000534212;ENST00000378945;ENST00000427190;ENST00000451432;ENST00000378938	D;D;D;D;D	0.93488	-3.23;-3.23;-3.23;-3.23;-3.23	5.59	5.59	0.84812	Carbohydrate kinase, FGGY, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94384	0.8194	M	0.68593	2.085	0.80722	D	1	B;B;B;B;B	0.27971	0.196;0.121;0.041;0.041;0.121	B;B;B;B;B	0.39876	0.312;0.139;0.138;0.138;0.216	D	0.93256	0.6639	10	0.72032	D	0.01	.	18.8394	0.92176	0.0:0.0:1.0:0.0	.	259;422;416;416;422	E7EQC0;P32189;P32189-2;P32189-1;A6NJP5	.;GLPK_HUMAN;.;.;.	R	422;416;422;416;217;259;11	ENSP00000368229:G422R;ENSP00000368226:G416R;ENSP00000368228:G416R;ENSP00000401720:G217R;ENSP00000368221:G11R	ENSP00000368221:G11R	G	+	1	0	GK	30648686	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.914000	0.87478	2.483000	0.83821	0.600000	0.82982	GGA		0.368	GK-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056170.1	NM_000167		15	62	0	0	0	0.004007	0	15	62				
DMD	1756	broad.mit.edu	37	X	32380912	32380912	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:32380912G>T	ENST00000357033.4	-	37	5524	c.5318C>A	c.(5317-5319)aCt>aAt	p.T1773N	DMD_ENST00000378677.2_Missense_Mutation_p.T1769N	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1773	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TACCTTTCCAGTCTTAATTCT	0.483																																							uc004dda.1		NA																	0				ovary(3)|pancreas(2)|large_intestine(1)	6						c.(5317-5319)ACT>AAT		dystrophin Dp427m isoform							176.0	138.0	151.0					X																	32380912		2202	4300	6502	SO:0001583	missense	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:32380912G>T	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5318C>A	X.37:g.32380912G>T	ENSP00000354923:p.Thr1773Asn					DMD_uc004dcw.2_Missense_Mutation_p.T429N|DMD_uc004dcx.2_Missense_Mutation_p.T432N|DMD_uc004dcz.2_Missense_Mutation_p.T1650N|DMD_uc004dcy.1_Missense_Mutation_p.T1769N|DMD_uc004ddb.1_Missense_Mutation_p.T1765N|DMD_uc010ngo.1_Intron	p.T1773N	NM_004006	NP_003997	P11532	DMD_HUMAN			37	5562	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	1773			Spectrin 12.|Interaction with SYNM (By similarity).		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	c.5318C>A	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.349793	0.41599	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.50813	0.73;0.73	5.36	5.36	0.76844	.	0.228496	0.21510	U	0.073397	T	0.37945	0.1022	L	0.40543	1.245	0.80722	D	1	B;P;B;B;B	0.38677	0.358;0.642;0.411;0.411;0.411	B;B;B;B;B	0.35114	0.124;0.193;0.196;0.142;0.142	T	0.19128	-1.0315	10	0.31617	T	0.26	.	12.7728	0.57432	0.0:0.3235:0.6765:0.0	.	1765;1773;1769;432;429	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	N	1765;432;429;1769;1773;1773;1650	ENSP00000367948:T1769N;ENSP00000354923:T1773N	ENSP00000354923:T1773N	T	-	2	0	DMD	32290833	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.116000	0.50399	2.218000	0.71995	0.544000	0.68410	ACT		0.483	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		33	93	1	0	2.68265e-12	0.002836	4.20432e-12	33	93				
DMD	1756	broad.mit.edu	37	X	32481653	32481653	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:32481653C>A	ENST00000357033.4	-	25	3541	c.3335G>T	c.(3334-3336)gGg>gTg	p.G1112V	DMD_ENST00000378677.2_Missense_Mutation_p.G1108V	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1112					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TATCTTCTGCCCACCTTCATT	0.388																																							uc004dda.1		NA																	0				ovary(3)|pancreas(2)|large_intestine(1)	6						c.(3334-3336)GGG>GTG		dystrophin Dp427m isoform							178.0	122.0	141.0					X																	32481653		2202	4299	6501	SO:0001583	missense	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:32481653C>A	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3335G>T	X.37:g.32481653C>A	ENSP00000354923:p.Gly1112Val					DMD_uc004dcz.2_Missense_Mutation_p.G989V|DMD_uc004dcy.1_Missense_Mutation_p.G1108V|DMD_uc004ddb.1_Missense_Mutation_p.G1104V|DMD_uc010ngo.1_Intron	p.G1112V	NM_004006	NP_003997	P11532	DMD_HUMAN			25	3579	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	1112			Spectrin 7.		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	c.3335G>T	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	17.83	3.486575	0.63962	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.39787	1.06;1.06	5.43	4.57	0.56435	.	0.000000	0.37669	U	0.001994	T	0.62258	0.2413	M	0.73598	2.24	0.80722	D	1	D;P;D	0.89917	0.999;0.752;1.0	D;P;D	0.70716	0.95;0.518;0.97	T	0.60994	-0.7152	10	0.26408	T	0.33	.	15.2254	0.73348	0.0:0.8546:0.1454:0.0	.	1104;1112;1108	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	V	1104;1108;1112;1112;989	ENSP00000367948:G1108V;ENSP00000354923:G1112V	ENSP00000354923:G1112V	G	-	2	0	DMD	32391574	1.000000	0.71417	0.942000	0.38095	0.955000	0.61496	4.850000	0.62889	1.059000	0.40554	0.436000	0.28706	GGG		0.388	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		4	7	1	0	0.00909568	0.009096	0.00961102	4	7				
CXorf22	170063	broad.mit.edu	37	X	35970075	35970075	+	Silent	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:35970075C>A	ENST00000297866.5	+	6	1107	c.1041C>A	c.(1039-1041)acC>acA	p.T347T		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	347										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						TTTGTTTCACCCCAAAGTAAG	0.259																																							uc004ddj.2		NA																	0				large_intestine(1)|lung(1)|ovary(1)	3						c.(1039-1041)ACC>ACA		hypothetical protein LOC170063							51.0	49.0	50.0					X																	35970075		2192	4248	6440	SO:0001819	synonymous_variant	170063							g.chrX:35970075C>A	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1041C>A	X.37:g.35970075C>A						CXorf22_uc010ngv.2_RNA	p.T347T	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN			6	1100	+			347					Q5JRM8|Q8N6X8	Silent	SNP	ENST00000297866.5	37	c.1041C>A	CCDS14237.2																																																																																				0.259	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632		9	54	1	0	1.33987e-11	0.008291	2.04824e-11	9	54				
BCOR	54880	broad.mit.edu	37	X	39921532	39921532	+	Nonsense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:39921532G>A	ENST00000378444.4	-	10	4516	c.4288C>T	c.(4288-4290)Cag>Tag	p.Q1430*	BCOR_ENST00000378463.1_Nonsense_Mutation_p.Q273*|BCOR_ENST00000342274.4_Nonsense_Mutation_p.Q1396*|BCOR_ENST00000397354.3_Nonsense_Mutation_p.Q1396*|BCOR_ENST00000378455.4_Nonsense_Mutation_p.Q1378*	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1430					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						TGTGTGGACTGGGAGGCTGGT	0.582			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																																uc004den.3		NA		Rec	yes		X	Xp11.4	54880		BCL6 corepressor	yes							0				ovary(2)|kidney(1)|central_nervous_system(1)	4						c.(4288-4290)CAG>TAG		BCL-6 interacting corepressor isoform c							111.0	77.0	88.0					X																	39921532		2202	4300	6502	SO:0001587	stop_gained	54880				heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding	g.chrX:39921532G>A	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.4288C>T	X.37:g.39921532G>A	ENSP00000367705:p.Gln1430*					BCOR_uc004dep.3_Nonsense_Mutation_p.Q1396*|BCOR_uc004deo.3_Nonsense_Mutation_p.Q1378*|BCOR_uc010nhb.2_Nonsense_Mutation_p.Q138*|BCOR_uc004dem.3_Nonsense_Mutation_p.Q1396*	p.Q1430*	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN			10	4580	-			1430					D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Nonsense_Mutation	SNP	ENST00000378444.4	37	c.4288C>T	CCDS48093.1	.	.	.	.	.	.	.	.	.	.	G	43	10.474429	0.99412	.	.	ENSG00000183337	ENST00000413905;ENST00000378463;ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000442018	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-21.846	12.1875	0.54247	0.0797:0.0:0.9203:0.0	.	.	.	.	X	300;273;1378;1396;1430;1396;103	.	ENSP00000345923:Q1396X	Q	-	1	0	BCOR	39806476	1.000000	0.71417	0.428000	0.26697	0.469000	0.32828	4.634000	0.61325	2.375000	0.81037	0.594000	0.82650	CAG		0.582	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745		6	19	0	0	0	0.001984	0	6	19				
SLC9A7	84679	broad.mit.edu	37	X	46522080	46522080	+	Splice_Site	SNP	T	T	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:46522080T>G	ENST00000328306.4	-	6	819		c.e6-2			NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7						ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						GCACAGTCACTGAAAAGTGAG	0.418																																					Pancreas(118;454 1696 1930 13865 39976)	Pancreas(118;454 1696 1930 13865 39976)	uc004dgu.1		NA																	0				ovary(2)	2						c.e6-1		solute carrier family 9, member 7							74.0	59.0	64.0					X																	46522080		2203	4300	6503	SO:0001630	splice_region_variant	84679				regulation of pH	Golgi membrane|integral to membrane|recycling endosome membrane|trans-Golgi network	potassium:hydrogen antiporter activity|protein homodimerization activity|sodium:hydrogen antiporter activity	g.chrX:46522080T>G	AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.794-2A>C	X.37:g.46522080T>G						SLC9A7_uc004dgv.1_Splice_Site_p.V265_splice	p.V265_splice	NM_032591	NP_115980	Q96T83	SL9A7_HUMAN			6	802	-								O75827|Q5JXP9	Splice_Site	SNP	ENST00000328306.4	37	c.794_splice	CCDS14269.1	.	.	.	.	.	.	.	.	.	.	T	18.82	3.704746	0.68615	.	.	ENSG00000065923	ENST00000328306	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1858	0.65605	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC9A7	46407024	1.000000	0.71417	0.978000	0.43139	0.777000	0.43975	7.549000	0.82163	1.797000	0.52628	0.486000	0.48141	.		0.418	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056370.1	NM_032591	Intron	9	20	0	0	0	0.006214	0	9	20				
SLC9A7	84679	broad.mit.edu	37	X	46618218	46618218	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:46618218G>C	ENST00000328306.4	-	1	272	c.247C>G	c.(247-249)Ctc>Gtc	p.L83V		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	83					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						AGGATGGTGAGCGTGAGCAGC	0.627																																					Pancreas(118;454 1696 1930 13865 39976)	Pancreas(118;454 1696 1930 13865 39976)	uc004dgu.1		NA																	0				ovary(2)	2						c.(247-249)CTC>GTC		solute carrier family 9, member 7							60.0	41.0	47.0					X																	46618218		2203	4300	6503	SO:0001583	missense	84679				regulation of pH	Golgi membrane|integral to membrane|recycling endosome membrane|trans-Golgi network	potassium:hydrogen antiporter activity|protein homodimerization activity|sodium:hydrogen antiporter activity	g.chrX:46618218G>C	AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.247C>G	X.37:g.46618218G>C	ENSP00000330320:p.Leu83Val					SLC9A7_uc004dgv.1_Missense_Mutation_p.L83V	p.L83V	NM_032591	NP_115980	Q96T83	SL9A7_HUMAN			1	255	-			83			Helical; (Potential).		O75827|Q5JXP9	Missense_Mutation	SNP	ENST00000328306.4	37	c.247C>G	CCDS14269.1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.376395	0.61735	.	.	ENSG00000065923	ENST00000328306	T	0.15834	2.39	4.63	4.63	0.57726	Cation/H+ exchanger (1);	1.175070	0.05847	N	0.620458	T	0.24275	0.0588	L	0.41710	1.295	0.53688	D	0.999975	B	0.30361	0.277	B	0.35607	0.206	T	0.06058	-1.0848	10	0.56958	D	0.05	.	16.671	0.85267	0.0:0.0:1.0:0.0	.	83	Q96T83	SL9A7_HUMAN	V	83	ENSP00000330320:L83V	ENSP00000330320:L83V	L	-	1	0	SLC9A7	46503162	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.591000	0.53986	2.306000	0.77630	0.457000	0.33378	CTC		0.627	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056370.1	NM_032591		11	40	0	0	0	0.000978	0	11	40				
CDK16	5127	broad.mit.edu	37	X	47083104	47083104	+	Missense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:47083104C>T	ENST00000357227.4	+	2	572	c.148C>T	c.(148-150)Cgt>Tgt	p.R50C	CDK16_ENST00000276052.6_Missense_Mutation_p.R124C|CDK16_ENST00000518022.1_Missense_Mutation_p.R50C|CDK16_ENST00000457458.2_Missense_Mutation_p.R56C	NM_006201.4	NP_006192.1	Q00536	CDK16_HUMAN	cyclin-dependent kinase 16	50					exocytosis (GO:0006887)|growth hormone secretion (GO:0030252)|neuron projection development (GO:0031175)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|spermatogenesis (GO:0007283)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|large_intestine(4)|lung(3)	11						GGCCCCCACACGTGCTGCTCC	0.637																																							uc004dho.2		NA																	0				lung(1)	1						c.(148-150)CGT>TGT		PCTAIRE protein kinase 1 isoform 1							93.0	63.0	73.0					X																	47083104		2203	4299	6502	SO:0001583	missense	5127						ATP binding|cyclin-dependent protein kinase activity|protein binding	g.chrX:47083104C>T		CCDS14276.1, CCDS48101.1, CCDS55408.1	Xp11	2011-11-08	2009-12-16	2009-12-16	ENSG00000102225	ENSG00000102225		"""Cyclin-dependent kinases"""	8749	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase"""	311550	"""PCTAIRE protein kinase 1"""	PCTK1		1437147, 19884882	Standard	NM_033018		Approved	PCTAIRE, PCTAIRE1, PCTGAIRE, FLJ16665	uc011mll.2	Q00536	OTTHUMG00000021438	ENST00000357227.4:c.148C>T	X.37:g.47083104C>T	ENSP00000349762:p.Arg50Cys					CDK16_uc011mli.1_Missense_Mutation_p.R56C|CDK16_uc011mlj.1_Missense_Mutation_p.R50C|CDK16_uc011mlk.1_Missense_Mutation_p.R50C|CDK16_uc011mll.1_Missense_Mutation_p.R124C	p.R50C	NM_006201	NP_006192	Q00536	CDK16_HUMAN			2	544	+			50					A8K280|B7Z7C8|J3KN74|J3KQP7	Missense_Mutation	SNP	ENST00000357227.4	37	c.148C>T	CCDS14276.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.70|10.70	1.423508|1.423508	0.25639|0.25639	.|.	.|.	ENSG00000102225|ENSG00000102225	ENST00000457458;ENST00000522883;ENST00000357227;ENST00000519758;ENST00000520893;ENST00000540877;ENST00000517426;ENST00000518391;ENST00000518022;ENST00000276052|ENST00000523034	T;T;T;T;T;T|T	0.73258|0.34667	-0.52;-0.52;-0.73;0.88;-0.52;-0.53|1.35	4.46|4.46	3.58|3.58	0.41010|0.41010	.|.	0.463335|.	0.22141|.	N|.	0.064045|.	T|T	0.32071|0.32071	0.0817|0.0817	L|L	0.38175|0.38175	1.15|1.15	0.09310|0.09310	N|N	1|1	P;B;B;P|.	0.44521|.	0.837;0.05;0.001;0.628|.	B;B;B;B|.	0.40329|.	0.326;0.01;0.0;0.179|.	T|T	0.18335|0.18335	-1.0340|-1.0340	10|7	0.72032|0.41790	D|T	0.01|0.15	-0.3189|-0.3189	7.3216|7.3216	0.26531|0.26531	0.1909:0.6269:0.1822:0.0|0.1909:0.6269:0.1822:0.0	.|.	124;50;148;50|.	B7Z7C8;B7Z461;B7Z8T0;Q00536|.	.;.;.;CDK16_HUMAN|.	C|M	56;50;50;50;50;148;50;50;50;124|23	ENSP00000405798:R56C;ENSP00000349762:R50C;ENSP00000429985:R50C;ENSP00000429044:R50C;ENSP00000429751:R50C;ENSP00000276052:R124C|ENSP00000430486:T23M	ENSP00000276052:R124C|ENSP00000430486:T23M	R|T	+|+	1|2	0|0	CDK16|CDK16	46968048|46968048	0.288000|0.288000	0.24324|0.24324	0.052000|0.052000	0.19188|0.19188	0.702000|0.702000	0.40608|0.40608	0.895000|0.895000	0.28363|0.28363	0.961000|0.961000	0.38030|0.38030	0.431000|0.431000	0.28591|0.28591	CGT|ACG		0.637	CDK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056406.2	NM_006201		3	23	0	0	0	0.004672	0	3	23				
TBC1D25	4943	broad.mit.edu	37	X	48418713	48418713	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:48418713C>A	ENST00000376771.4	+	6	1758	c.1417C>A	c.(1417-1419)Cct>Act	p.P473T	TBC1D25_ENST00000537536.1_Missense_Mutation_p.P219T|snoU13_ENST00000459609.1_RNA	NM_002536.2	NP_002527.1	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	473					autophagy (GO:0006914)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of autophagic vacuole maturation (GO:1901096)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						CATGCTGAGGCCTGCTGGTGG	0.632																																							uc004dka.1		NA																	0				ovary(1)	1						c.(1417-1419)CCT>ACT		TBC1 domain family, member 25							40.0	38.0	39.0					X																	48418713		2202	4300	6502	SO:0001583	missense	4943					intracellular	Rab GTPase activator activity	g.chrX:48418713C>A	L08240	CCDS35242.1	Xp11.23	2014-01-28	2007-01-12	2007-01-12	ENSG00000068354	ENSG00000068354			8092	protein-coding gene	gene with protein product		311240	"""ornithine aminotransferase-like 1"""	OATL1		21383079	Standard	NM_002536		Approved		uc004dka.1	Q3MII6	OTTHUMG00000024123	ENST00000376771.4:c.1417C>A	X.37:g.48418713C>A	ENSP00000365962:p.Pro473Thr					TBC1D25_uc011mly.1_Missense_Mutation_p.P415T|TBC1D25_uc004dkb.1_Missense_Mutation_p.P219T|TBC1D25_uc011mlz.1_Missense_Mutation_p.P219T|TBC1D25_uc011mma.1_Missense_Mutation_p.P219T|TBC1D25_uc004dkc.1_Missense_Mutation_p.P219T|TBC1D25_uc011mmb.1_Missense_Mutation_p.P477T|TBC1D25_uc011mmc.1_Missense_Mutation_p.P219T|TBC1D25_uc011mmd.1_Missense_Mutation_p.P219T	p.P473T	NM_002536	NP_002527	Q3MII6	TBC25_HUMAN			6	1528	+			473					Q08AN9|Q3MII4|Q8TAR9	Missense_Mutation	SNP	ENST00000376771.4	37	c.1417C>A	CCDS35242.1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.068999	0.55539	.	.	ENSG00000068354	ENST00000376771;ENST00000537536	T;T	0.20881	2.04;2.04	5.44	5.44	0.79542	Rab-GAP/TBC domain (1);	1.247630	0.05560	N	0.568924	T	0.18841	0.0452	L	0.46157	1.445	0.45205	D	0.998212	P;P;P	0.43094	0.799;0.578;0.799	B;B;B	0.33799	0.17;0.17;0.17	T	0.19031	-1.0318	10	0.14656	T	0.56	-12.5725	10.7941	0.46451	0.1888:0.8111:0.0:0.0	.	477;415;473	B4DF03;B4DGU3;Q3MII6	.;.;TBC25_HUMAN	T	473;219	ENSP00000365962:P473T;ENSP00000444091:P219T	ENSP00000365962:P473T	P	+	1	0	TBC1D25	48303657	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.654000	0.61469	2.275000	0.75901	0.436000	0.28706	CCT		0.632	TBC1D25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060764.2	NM_002536		17	45	1	0	1.99824e-07	0.00499	2.59701e-07	17	45				
GLOD5	392465	broad.mit.edu	37	X	48629391	48629391	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:48629391G>A	ENST00000303227.6	+	3	291	c.250G>A	c.(250-252)Gag>Aag	p.E84K	GLOD5_ENST00000470676.1_3'UTR	NM_001080489.2	NP_001073958.2	A6NK44	GLOD5_HUMAN	glyoxalase domain containing 5	84										endometrium(1)|lung(2)	3						TAACCTCCACGAGGTGGGAAA	0.498																																							uc011mmh.1		NA																	0					0						c.(250-252)GAG>AAG		glyoxalase domain containing 5							49.0	44.0	45.0					X																	48629391		1846	4092	5938	SO:0001583	missense	392465							g.chrX:48629391G>A		CCDS55410.1	Xp11.23	2008-02-05			ENSG00000171433	ENSG00000171433			33358	protein-coding gene	gene with protein product							Standard	NM_001080489		Approved		uc011mmh.2	A6NK44	OTTHUMG00000024125	ENST00000303227.6:c.250G>A	X.37:g.48629391G>A	ENSP00000302552:p.Glu84Lys						p.E84K	NM_001080489	NP_001073958					3	291	+									Missense_Mutation	SNP	ENST00000303227.6	37	c.250G>A	CCDS55410.1	.	.	.	.	.	.	.	.	.	.	g	17.23	3.337079	0.60963	.	.	ENSG00000171433	ENST00000303227	.	.	.	4.74	4.74	0.60224	.	0.050996	0.85682	D	0.000000	T	0.45716	0.1356	L	0.50333	1.59	0.44603	D	0.997575	P	0.45396	0.857	B	0.40038	0.317	T	0.39143	-0.9628	9	0.18710	T	0.47	.	14.4452	0.67345	0.0:0.0:1.0:0.0	.	72	A6NK44	GLOD5_HUMAN	K	84	.	ENSP00000302552:E84K	E	+	1	0	GLOD5	48514335	1.000000	0.71417	0.981000	0.43875	0.979000	0.70002	5.524000	0.67105	2.077000	0.62373	0.380000	0.24917	GAG		0.498	GLOD5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080489		5	23	0	0	0	0.001168	0	5	23				
CACNA1F	778	broad.mit.edu	37	X	49065126	49065126	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:49065126G>T	ENST00000376265.2	-	43	5066	c.5005C>A	c.(5005-5007)Ccc>Acc	p.P1669T	CACNA1F_ENST00000376251.1_Missense_Mutation_p.P1604T|CACNA1F_ENST00000323022.5_Missense_Mutation_p.P1658T	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1669					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CGAGCTGAGGGCTGGGAGACC	0.567																																							uc004dnb.2		NA																	0				breast(3)|ovary(1)|kidney(1)|skin(1)	6						c.(5005-5007)CCC>ACC		calcium channel, voltage-dependent, L type,	Verapamil(DB00661)						56.0	52.0	53.0					X																	49065126		2203	4300	6503	SO:0001583	missense	778				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity	g.chrX:49065126G>T	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.5005C>A	X.37:g.49065126G>T	ENSP00000365441:p.Pro1669Thr					CACNA1F_uc010nip.2_Missense_Mutation_p.P1658T	p.P1669T	NM_005183	NP_005174	O60840	CAC1F_HUMAN			43	5067	-			1669			Cytoplasmic (Potential).		A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	ENST00000376265.2	37	c.5005C>A	CCDS35253.1	.	.	.	.	.	.	.	.	.	.	g	1.970	-0.436758	0.04636	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.96168	-3.93;-3.86;-3.86	5.01	2.25	0.28309	.	4.310420	0.00508	N	0.000176	D	0.92254	0.7543	L	0.43152	1.355	0.26501	N	0.974773	B;B	0.18741	0.011;0.03	B;B	0.18263	0.014;0.021	T	0.78437	-0.2204	10	0.22109	T	0.4	.	4.461	0.11666	0.1985:0.0:0.6238:0.1777	.	1658;1669	F5CIQ9;O60840	.;CAC1F_HUMAN	T	1604;1658;1669	ENSP00000365427:P1604T;ENSP00000321618:P1658T;ENSP00000365441:P1669T	ENSP00000321618:P1658T	P	-	1	0	CACNA1F	48952070	0.999000	0.42202	0.961000	0.40146	0.005000	0.04900	0.147000	0.16202	0.209000	0.20645	-0.930000	0.02707	CCC		0.567	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183		20	57	1	0	9.95505e-16	0.002299	1.6802e-15	20	57				
DGKK	139189	broad.mit.edu	37	X	50111949	50111949	+	RNA	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:50111949G>T	ENST00000376025.2	-	0	3864							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					CTACAGTTGAGATCTCGATGG	0.388																																							uc010njr.1		NA																	0				ovary(1)|kidney(1)	2						c.(3805-3807)TCT>TAT		diacylglycerol kinase kappa							174.0	143.0	153.0					X																	50111949		1893	4120	6013			139189				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chrX:50111949G>T	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50111949G>T							p.S1269Y	NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN			29	3866	-	Ovarian(276;0.236)		1269			PDZ-binding.		B2RP91	Missense_Mutation	SNP	ENST00000376025.2	37	c.3806C>A																																																																																					0.388	DGKK-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000368187.1	NM_001013742		13	31	1	0	3.41278e-10	0.00499	4.95318e-10	13	31				
CYSLTR1	10800	broad.mit.edu	37	X	77529058	77529058	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:77529058C>A	ENST00000373304.3	-	3	478	c.186G>T	c.(184-186)atG>atT	p.M62I		NM_001282187.1|NM_001282188.1|NM_006639.3	NP_001269116.1|NP_001269117.1|NP_006630.1	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	62					defense response (GO:0006952)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory gaseous exchange (GO:0007585)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene receptor activity (GO:0004974)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14					Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	CTAAATTAATCATGTATACTT	0.413																																							uc004edb.2		NA																	0				ovary(1)	1						c.(184-186)ATG>ATT		cysteinyl leukotriene receptor 1	Amlexanox(DB01025)|Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)						91.0	74.0	80.0					X																	77529058		2203	4300	6503	SO:0001583	missense	10800				elevation of cytosolic calcium ion concentration|respiratory gaseous exchange	integral to plasma membrane|membrane fraction	leukotriene receptor activity	g.chrX:77529058C>A	AF119711	CCDS14439.1	Xq13-q21	2012-08-10			ENSG00000173198	ENSG00000173198		"""GPCR / Class A : Leukotriene receptors"""	17451	protein-coding gene	gene with protein product		300201				10391245, 10462554	Standard	NM_006639		Approved	CysLT1, CysLT(1), CYSLT1R	uc004edb.3	Q9Y271	OTTHUMG00000021889	ENST00000373304.3:c.186G>T	X.37:g.77529058C>A	ENSP00000362401:p.Met62Ile					CYSLTR1_uc010nma.2_Missense_Mutation_p.M62I|CYSLTR1_uc010nmb.2_Missense_Mutation_p.M62I	p.M62I	NM_006639	NP_006630	Q9Y271	CLTR1_HUMAN			3	586	-			62			Helical; Name=2; (Potential).		B2R954|D3DTE4|Q5JS94|Q8IV19	Missense_Mutation	SNP	ENST00000373304.3	37	c.186G>T	CCDS14439.1	.	.	.	.	.	.	.	.	.	.	c	17.41	3.382669	0.61845	.	.	ENSG00000173198	ENST00000373304	T	0.34667	1.35	4.53	4.53	0.55603	GPCR, rhodopsin-like superfamily (1);	0.082436	0.85682	D	0.000000	T	0.37376	0.1001	L	0.35341	1.055	0.41301	D	0.987041	D	0.53619	0.961	P	0.49752	0.621	T	0.33085	-0.9882	10	0.72032	D	0.01	.	13.8027	0.63212	0.0:1.0:0.0:0.0	.	62	Q9Y271	CLTR1_HUMAN	I	62	ENSP00000362401:M62I	ENSP00000362401:M62I	M	-	3	0	CYSLTR1	77415714	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.795000	0.69074	1.823000	0.53134	0.452000	0.29995	ATG		0.413	CYSLTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057315.1			9	38	1	0	0.00448238	0.004482	0.00480439	9	38				
P2RY10	27334	broad.mit.edu	37	X	78216382	78216382	+	Missense_Mutation	SNP	G	G	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:78216382G>A	ENST00000171757.2	+	4	645	c.365G>A	c.(364-366)tGt>tAt	p.C122Y	P2RY10_ENST00000544091.1_Missense_Mutation_p.C122Y|P2RY10_ENST00000475374.1_3'UTR	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						GCCAGCATTTGTTTCCTGACG	0.507																																							uc004ede.2		NA																	0				ovary(2)|lung(2)|breast(1)	5						c.(364-366)TGT>TAT		G-protein coupled purinergic receptor P2Y10							127.0	115.0	119.0					X																	78216382		2203	4300	6503	SO:0001583	missense	27334					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chrX:78216382G>A	AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.365G>A	X.37:g.78216382G>A	ENSP00000171757:p.Cys122Tyr					P2RY10_uc004edf.2_Missense_Mutation_p.C122Y	p.C122Y	NM_014499	NP_055314	O00398	P2Y10_HUMAN			4	734	+			122			Helical; Name=3; (Potential).		D3DTE5|Q4VBN7|Q86V16	Missense_Mutation	SNP	ENST00000171757.2	37	c.365G>A	CCDS14442.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.842332	0.00068	.	.	ENSG00000078589	ENST00000544091;ENST00000171757	T;T	0.35973	1.28;1.28	4.74	1.79	0.24919	GPCR, rhodopsin-like superfamily (1);	0.439106	0.22876	N	0.054574	T	0.19765	0.0475	N	0.14661	0.345	0.19300	N	0.999972	B	0.02656	0.0	B	0.09377	0.004	T	0.20075	-1.0286	10	0.18276	T	0.48	.	11.913	0.52749	0.0:0.0:0.3986:0.6014	.	122	O00398	P2Y10_HUMAN	Y	122	ENSP00000443138:C122Y;ENSP00000171757:C122Y	ENSP00000171757:C122Y	C	+	2	0	P2RY10	78103038	0.001000	0.12720	0.370000	0.25965	0.189000	0.23516	0.308000	0.19314	0.053000	0.16036	0.422000	0.28245	TGT		0.507	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057323.1			49	122	0	0	0	0.00361	0	49	122				
KLHL4	56062	broad.mit.edu	37	X	86877411	86877411	+	Missense_Mutation	SNP	A	A	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:86877411A>C	ENST00000373119.4	+	5	1270	c.1125A>C	c.(1123-1125)ttA>ttC	p.L375F	KLHL4_ENST00000373114.4_Missense_Mutation_p.L375F	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	375						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						GACTGCCATTACTCCCACCAC	0.393																																							uc004efb.2		NA																	0				ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						c.(1123-1125)TTA>TTC		kelch-like 4 isoform 1							132.0	111.0	118.0					X																	86877411		2203	4300	6503	SO:0001583	missense	56062					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding	g.chrX:86877411A>C	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1125A>C	X.37:g.86877411A>C	ENSP00000362211:p.Leu375Phe					KLHL4_uc004efa.2_Missense_Mutation_p.L375F	p.L375F	NM_019117	NP_061990	Q9C0H6	KLHL4_HUMAN			5	1307	+			375					B2RTW2|Q9Y3J5	Missense_Mutation	SNP	ENST00000373119.4	37	c.1125A>C	CCDS14457.1	.	.	.	.	.	.	.	.	.	.	A	16.55	3.155705	0.57259	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.74421	-0.84;-0.84	5.24	4.04	0.47022	BTB/Kelch-associated (2);	0.079472	0.50627	N	0.000114	D	0.82449	0.5039	M	0.72894	2.215	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.80910	-0.1171	10	0.66056	D	0.02	.	6.8174	0.23839	0.766:0.1505:0.0835:0.0	.	375;375	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	F	375	ENSP00000362211:L375F;ENSP00000362206:L375F	ENSP00000362206:L375F	L	+	3	2	KLHL4	86764067	0.987000	0.35691	0.996000	0.52242	0.968000	0.65278	0.254000	0.18314	0.609000	0.30018	0.356000	0.21956	TTA		0.393	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1			31	76	0	0	0	0.002096	0	31	76				
PCDH11X	27328	broad.mit.edu	37	X	91873430	91873430	+	Nonsense_Mutation	SNP	C	C	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:91873430C>T	ENST00000373094.1	+	7	4380	c.3535C>T	c.(3535-3537)Cag>Tag	p.Q1179*	PCDH11X_ENST00000361655.2_Nonsense_Mutation_p.Q1161*|PCDH11X_ENST00000373097.1_Nonsense_Mutation_p.Q1169*|PCDH11X_ENST00000298274.8_Nonsense_Mutation_p.Q1142*|PCDH11X_ENST00000504220.2_3'UTR|PCDH11X_ENST00000406881.1_Nonsense_Mutation_p.Q1171*|PCDH11X_ENST00000373088.1_Nonsense_Mutation_p.Q1142*	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1179					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						ACCACTGTCACAGGCCTCTAC	0.587																																					NSCLC(38;925 1092 2571 38200 45895)	NSCLC(38;925 1092 2571 38200 45895)	uc004efk.1		NA																	0				large_intestine(2)	2						c.(3535-3537)CAG>TAG		protocadherin 11 X-linked isoform c							178.0	142.0	154.0					X																	91873430		2203	4300	6503	SO:0001587	stop_gained	27328				homophilic cell adhesion	integral to plasma membrane	calcium ion binding	g.chrX:91873430C>T	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3535C>T	X.37:g.91873430C>T	ENSP00000362186:p.Gln1179*					PCDH11X_uc004efl.1_Nonsense_Mutation_p.Q1169*|PCDH11X_uc004efo.1_Nonsense_Mutation_p.Q1142*|PCDH11X_uc010nmv.1_3'UTR|PCDH11X_uc004efm.1_Nonsense_Mutation_p.Q1171*|PCDH11X_uc004efn.1_Nonsense_Mutation_p.Q1161*	p.Q1179*	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN			7	4380	+			1179			Cytoplasmic (Potential).		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Nonsense_Mutation	SNP	ENST00000373094.1	37	c.3535C>T	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890136	0.91889	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000373088;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	.	.	.	3.75	0.685	0.18009	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	1.3548	0.02180	0.3747:0.3198:0.1819:0.1237	.	.	.	.	X	1179;1169;1142;1161;1171;1179;1142	.	ENSP00000298274:Q1142X	Q	+	1	0	PCDH11X	91760086	0.000000	0.05858	0.005000	0.12908	0.113000	0.19764	0.009000	0.13219	0.581000	0.29539	0.370000	0.22315	CAG		0.587	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969		37	128	0	0	0	0.004289	0	37	128				
CXorf57	55086	broad.mit.edu	37	X	105855611	105855611	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:105855611G>C	ENST00000372548.4	+	1	410	c.301G>C	c.(301-303)Gat>Cat	p.D101H	CXorf57_ENST00000372544.2_Missense_Mutation_p.D101H	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	101							poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						GACGATCTCAGATGGGGTGTA	0.498																																							uc004emi.3		NA																	0				ovary(1)|lung(1)|breast(1)	3						c.(301-303)GAT>CAT		hypothetical protein LOC55086							109.0	102.0	104.0					X																	105855611		2203	4300	6503	SO:0001583	missense	55086							g.chrX:105855611G>C	AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.301G>C	X.37:g.105855611G>C	ENSP00000361628:p.Asp101His					CXorf57_uc004emj.3_Missense_Mutation_p.D101H|CXorf57_uc004emh.2_Missense_Mutation_p.D101H	p.D101H	NM_018015	NP_060485	Q6NSI4	CX057_HUMAN			1	452	+			101					H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Missense_Mutation	SNP	ENST00000372548.4	37	c.301G>C	CCDS14519.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.970780	0.74246	.	.	ENSG00000147231	ENST00000372544;ENST00000372548	D;D	0.96300	-3.97;-3.97	4.0	4.0	0.46444	Nucleic acid-binding, OB-fold-like (1);	0.000000	0.85682	D	0.000000	D	0.97492	0.9179	M	0.70275	2.135	0.47037	D	0.999293	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.97924	1.0316	10	0.87932	D	0	-15.0125	12.874	0.57980	0.0:0.0:1.0:0.0	.	101;101;101	A8K6R5;Q6NSI4;Q6NSI4-2	.;CX057_HUMAN;.	H	101	ENSP00000361623:D101H;ENSP00000361628:D101H	ENSP00000361623:D101H	D	+	1	0	CXorf57	105742267	1.000000	0.71417	0.901000	0.35422	0.991000	0.79684	7.721000	0.84768	1.983000	0.57843	0.600000	0.82982	GAT		0.498	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057800.2	NM_018015		49	116	0	0	0	0.00361	0	49	116				
PRPS1	5631	broad.mit.edu	37	X	106885667	106885667	+	Silent	SNP	C	C	T	rs61752962	byFrequency	TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:106885667C>T	ENST00000372435.4	+	4	599	c.477C>T	c.(475-477)atC>atT	p.I159I	PRPS1_ENST00000543248.1_Silent_p.I159I|PRPS1_ENST00000372428.4_Silent_p.I92I|PRPS1_ENST00000372418.1_Silent_p.I59I	NM_002764.3	NP_002755.1	P60891	PRPS1_HUMAN	phosphoribosyl pyrophosphate synthetase 1	159					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|hypoxanthine biosynthetic process (GO:0046101)|nervous system development (GO:0007399)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|pyrimidine nucleotide biosynthetic process (GO:0006221)|ribonucleoside monophosphate biosynthetic process (GO:0009156)|small molecule metabolic process (GO:0044281)|urate biosynthetic process (GO:0034418)	cytosol (GO:0005829)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			breast(3)|endometrium(2)|kidney(3)|large_intestine(3)|lung(11)|upper_aerodigestive_tract(1)	23						GGGAGAATATCTCTGAGTGGA	0.428													C|||	19	0.00503311	0.0	0.0014	3775	,	,		15256	0.0		0.007	False		,,,				2504	0.0112						uc004ene.3		NA																	0				breast(3)|large_intestine(1)	4						c.(475-477)ATC>ATT		phosphoribosyl pyrophosphate synthetase 1		C	,	7,3828		0,6,1,1626,570	152.0	128.0	136.0		,477	1.6	1.0	X	dbSNP_129	136	56,6672		0,43,13,2385,1859	no	intron,coding-synonymous	PRPS1	NM_001204402.1,NM_002764.3	,	0,49,14,4011,2429	TT,TC,T,CC,C		0.8323,0.1825,0.5964	,	,159/319	106885667	63,10500	2203	4300	6503	SO:0001819	synonymous_variant	5631				5-phosphoribose 1-diphosphate biosynthetic process|hypoxanthine biosynthetic process|nervous system development|nucleoside metabolic process|purine nucleotide biosynthetic process|pyrimidine nucleotide biosynthetic process|ribonucleoside monophosphate biosynthetic process|urate biosynthetic process	cytosol	ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity	g.chrX:106885667C>T	X15331	CCDS14529.1, CCDS76007.1	Xq22.3	2014-09-17			ENSG00000147224	ENSG00000147224	2.7.6.1		9462	protein-coding gene	gene with protein product	"""PRS I"", ""ribose-phosphate diphosphokinase 1"""	311850	"""deafness, X-linked 2, perceptive, congenital"""	DFN2		1962753, 20021999	Standard	NM_002764		Approved	CMTX5, DFNX1	uc004ene.4	P60891	OTTHUMG00000022167	ENST00000372435.4:c.477C>T	X.37:g.106885667C>T						PRPS1_uc010npg.2_Silent_p.I126I|PRPS1_uc011msj.1_Intron	p.I159I	NM_002764	NP_002755	P60891	PRPS1_HUMAN			4	682	+			159					B1ALA8|B2R6T7|B4DNL6|D3DUX6|P09329	Silent	SNP	ENST00000372435.4	37	c.477C>T	CCDS14529.1																																																																																				0.428	PRPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057840.1			3	58	0	0	0	0.004672	0	3	58				
IRS4	8471	broad.mit.edu	37	X	107979005	107979005	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:107979005C>A	ENST00000372129.2	-	1	646	c.570G>T	c.(568-570)tgG>tgT	p.W190C	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.3_ENST00000436013.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	190	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GCAGCAAGTACCAGCTTTCCT	0.662																																							uc004eoc.2		NA																	0				ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(568-570)TGG>TGT		insulin receptor substrate 4							52.0	42.0	45.0					X																	107979005		2203	4299	6502	SO:0001583	missense	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107979005C>A	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.570G>T	X.37:g.107979005C>A	ENSP00000361202:p.Trp190Cys						p.W190C	NM_003604	NP_003595	O14654	IRS4_HUMAN			1	603	-			190			PH.			Missense_Mutation	SNP	ENST00000372129.2	37	c.570G>T	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.482016	0.44147	.	.	ENSG00000133124	ENST00000372129	D	0.98249	-4.82	4.27	3.41	0.39046	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.64402	D	0.000001	D	0.98934	0.9638	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99437	1.0937	10	0.87932	D	0	-6.8754	11.5749	0.50856	0.0:0.9106:0.0:0.0894	.	190	O14654	IRS4_HUMAN	C	190	ENSP00000361202:W190C	ENSP00000361202:W190C	W	-	3	0	IRS4	107865661	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.843000	0.69424	0.828000	0.34709	0.600000	0.82982	TGG		0.662	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604		14	42	1	0	1.05317e-09	0.00245	1.488e-09	14	42				
DOCK11	139818	broad.mit.edu	37	X	117676698	117676698	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:117676698A>G	ENST00000276202.7	+	2	176	c.113A>G	c.(112-114)aAa>aGa	p.K38R	DOCK11_ENST00000276204.6_Missense_Mutation_p.K38R	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	38					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						GAAAAGGCCAAAGTTGTTGAG	0.368																																							uc004eqp.2		NA																	0				ovary(3)	3						c.(112-114)AAA>AGA		dedicator of cytokinesis 11							95.0	93.0	94.0					X																	117676698		2203	4300	6503	SO:0001583	missense	139818				blood coagulation	cytosol	GTP binding	g.chrX:117676698A>G	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.113A>G	X.37:g.117676698A>G	ENSP00000276202:p.Lys38Arg						p.K38R	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN			2	176	+			38					A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	c.113A>G	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	A	11.93	1.786992	0.31593	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.18657	2.2;2.2	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.19485	0.0468	L	0.55743	1.74	0.40133	D	0.976749	B	0.17852	0.024	B	0.20577	0.03	T	0.08249	-1.0731	10	0.24483	T	0.36	3.1447	8.1644	0.31217	0.9079:0.0:0.0921:0.0	.	38	Q5JSL3	DOC11_HUMAN	R	38	ENSP00000276204:K38R;ENSP00000276202:K38R	ENSP00000276202:K38R	K	+	2	0	DOCK11	117560726	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	6.438000	0.73426	1.793000	0.52555	0.483000	0.47432	AAA		0.368	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658		40	84	0	0	0	0.00623	0	40	84				
CT47B1	643311	broad.mit.edu	37	X	120008948	120008948	+	Missense_Mutation	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:120008948C>A	ENST00000371311.3	-	1	831	c.577G>T	c.(577-579)Gct>Tct	p.A193S		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	193										breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						ACCGACGCAGCCTCCTGGATC	0.706																																							uc011muc.1		NA																	0					0						c.(577-579)GCT>TCT		cancer/testis antigen family 147, member B1							29.0	28.0	28.0					X																	120008948		692	1589	2281	SO:0001583	missense	643311							g.chrX:120008948C>A		CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.577G>T	X.37:g.120008948C>A	ENSP00000360360:p.Ala193Ser						p.A193S	NM_001145718	NP_001139190	P0C2W7	CT47B_HUMAN			1	832	-			193					A6NM97	Missense_Mutation	SNP	ENST00000371311.3	37	c.577G>T	CCDS48161.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.528085	0.27299	.	.	ENSG00000236446	ENST00000371311	.	.	.	1.09	-2.09	0.07232	.	.	.	.	.	T	0.22360	0.0539	N	0.08118	0	0.09310	N	1	D	0.55605	0.972	P	0.59948	0.866	T	0.09885	-1.0654	8	0.35671	T	0.21	.	2.7289	0.05221	0.3065:0.3885:0.3049:0.0	.	193	P0C2W7	CT47B_HUMAN	S	193	.	ENSP00000360360:A193S	A	-	1	0	CT47B1	119892976	0.000000	0.05858	0.000000	0.03702	0.108000	0.19459	-1.138000	0.03216	-0.672000	0.05266	0.110000	0.15639	GCT		0.706	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058121.1	NM_001145718		47	104	1	0	5.20006e-24	0.002852	9.32511e-24	47	104				
CT47B1	643311	broad.mit.edu	37	X	120009178	120009178	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:120009178G>T	ENST00000371311.3	-	1	601	c.347C>A	c.(346-348)cCg>cAg	p.P116Q		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	116										breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						GCCCGCCGCCGGGTACCGACG	0.637																																							uc011muc.1		NA																	0					0						c.(346-348)CCG>CAG		cancer/testis antigen family 147, member B1							53.0	67.0	63.0					X																	120009178		692	1590	2282	SO:0001583	missense	643311							g.chrX:120009178G>T		CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.347C>A	X.37:g.120009178G>T	ENSP00000360360:p.Pro116Gln						p.P116Q	NM_001145718	NP_001139190	P0C2W7	CT47B_HUMAN			1	602	-			116					A6NM97	Missense_Mutation	SNP	ENST00000371311.3	37	c.347C>A	CCDS48161.1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.712794	0.30413	.	.	ENSG00000236446	ENST00000371311	.	.	.	1.62	-1.24	0.09435	.	0.909002	0.08962	N	0.868554	T	0.40791	0.1131	L	0.34521	1.04	0.09310	N	1	D	0.76494	0.999	D	0.85130	0.997	T	0.28267	-1.0049	9	0.87932	D	0	.	1.729	0.02928	0.3046:0.0:0.3927:0.3027	.	116	P0C2W7	CT47B_HUMAN	Q	116	.	ENSP00000360360:P116Q	P	-	2	0	CT47B1	119893206	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	0.387000	0.20718	-0.412000	0.07519	0.171000	0.16805	CCG		0.637	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058121.1	NM_001145718		27	41	1	0	3.6726e-16	0.003954	6.22673e-16	27	41				
UTP14A	10813	broad.mit.edu	37	X	129059173	129059173	+	Splice_Site	SNP	T	T	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:129059173T>A	ENST00000394422.3	+	12	1777		c.e12+2		UTP14A_ENST00000371051.5_Splice_Site|RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000371042.3_Splice_Site|UTP14A_ENST00000425117.2_Splice_Site	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)						rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						GAGGAGCTGGTGAGCAGAGCC	0.483																																							uc004euz.2		NA																	0				ovary(2)	2						c.e12+2		UTP14, U3 small nucleolar ribonucleoprotein,							86.0	81.0	82.0					X																	129059173		2203	4300	6503	SO:0001630	splice_region_variant	10813				rRNA processing	nucleolus|small-subunit processome	protein binding	g.chrX:129059173T>A	AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.1749+2T>A	X.37:g.129059173T>A						UTP14A_uc011mup.1_Splice_Site_p.L531_splice|UTP14A_uc011muq.1_Splice_Site_p.L529_splice	p.L583_splice	NM_006649	NP_006640	Q9BVJ6	UT14A_HUMAN			12	1777	+								A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Splice_Site	SNP	ENST00000394422.3	37	c.1749_splice	CCDS14615.1	.	.	.	.	.	.	.	.	.	.	T	15.36	2.809773	0.50421	.	.	ENSG00000156697	ENST00000425117;ENST00000394422;ENST00000371051;ENST00000371042	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6318	0.56661	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	UTP14A	128886854	1.000000	0.71417	1.000000	0.80357	0.443000	0.32047	3.169000	0.50809	1.971000	0.57363	0.486000	0.48141	.		0.483	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058221.1	NM_006649	Intron	34	101	0	0	0	0.002445	0	34	101				
IGSF1	3547	broad.mit.edu	37	X	130416558	130416558	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:130416558G>T	ENST00000361420.3	-	7	1185	c.1106C>A	c.(1105-1107)aCc>aAc	p.T369N	IGSF1_ENST00000370910.1_Missense_Mutation_p.T360N|IGSF1_ENST00000370904.1_Missense_Mutation_p.T360N|IGSF1_ENST00000370903.3_Missense_Mutation_p.T369N			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	369	Ig-like C2-type 4.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						ATCGATGCTGGTGGCATCCAA	0.463																																							uc004ewd.2		NA																	0				ovary(3)|lung(1)|central_nervous_system(1)	5						c.(1105-1107)ACC>AAC		immunoglobulin superfamily, member 1 isoform 1							204.0	166.0	179.0					X																	130416558		2203	4300	6503	SO:0001583	missense	3547				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding	g.chrX:130416558G>T	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.1106C>A	X.37:g.130416558G>T	ENSP00000355010:p.Thr369Asn					IGSF1_uc004ewe.3_Missense_Mutation_p.T358N|IGSF1_uc004ewf.2_Missense_Mutation_p.T349N	p.T369N	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN			7	1344	-			369			Ig-like C2-type 4.|Extracellular (Potential).		B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	ENST00000361420.3	37	c.1106C>A	CCDS14629.1	.	.	.	.	.	.	.	.	.	.	G	0.882	-0.728381	0.03135	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.00801	5.68;5.68;5.68;5.68	4.78	2.98	0.34508	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.985643	0.08273	N	0.971119	T	0.01976	0.0062	M	0.77103	2.36	0.09310	N	1	B;B	0.26845	0.161;0.085	B;B	0.31614	0.116;0.133	T	0.45512	-0.9256	10	0.41790	T	0.15	.	5.2967	0.15756	0.1066:0.0:0.6936:0.1998	.	360;369	Q8N6C5-2;Q8N6C5	.;IGSF1_HUMAN	N	360;369;360;369	ENSP00000359947:T360N;ENSP00000355010:T369N;ENSP00000359941:T360N;ENSP00000359940:T369N	ENSP00000355010:T369N	T	-	2	0	IGSF1	130244239	0.553000	0.26513	0.226000	0.23910	0.129000	0.20672	1.208000	0.32345	0.540000	0.28808	0.594000	0.82650	ACC		0.463	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1			39	51	1	0	7.04047e-22	0.005524	1.25052e-21	39	51				
CT45A5	441521	broad.mit.edu	37	X	134947917	134947917	+	Nonsense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:134947917G>T	ENST00000463085.2	-	3	497	c.408C>A	c.(406-408)tgC>tgA	p.C136*	CT45A4_ENST00000420087.2_Intron|CT45A5_ENST00000491480.1_Nonsense_Mutation_p.C136*|CT45A5_ENST00000370724.3_Nonsense_Mutation_p.C136*			Q6NSH3	CT455_HUMAN	cancer/testis antigen family 45, member A5	136										endometrium(1)|large_intestine(2)|lung(6)	9						TTCGTCCAAGGCATCGGATTT	0.398																																							uc004eze.2		NA																	0					0						c.(406-408)TGC>TGA		cancer/testis antigen family 45, member A5							193.0	162.0	173.0					X																	134947917		2186	4264	6450	SO:0001587	stop_gained	441521							g.chrX:134947917G>T	AY743713	CCDS35406.1	Xq26.3	2009-03-12				ENSG00000269586			33270	protein-coding gene	gene with protein product	"""cancer/testis antigen CT45-5"""	300796				15905330	Standard	XM_006724759		Approved	CT45-5, CT45.5	uc022ces.1	Q6NSH3		ENST00000463085.2:c.408C>A	X.37:g.134947917G>T	ENSP00000424778:p.Cys136*					CT45A5_uc011mvu.1_Nonsense_Mutation_p.C136*	p.C136*	NM_001007551	NP_001007552	Q6NSH3	CT455_HUMAN			3	653	-			136					A8K842|B7ZMC5	Nonsense_Mutation	SNP	ENST00000463085.2	37	c.408C>A	CCDS35406.1	.	.	.	.	.	.	.	.	.	.	G	9.466	1.094435	0.20471	.	.	ENSG00000242284	ENST00000370724;ENST00000491480	.	.	.	2.4	-4.8	0.03190	.	0.502966	0.21508	U	0.073419	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	4.7147	0.12889	0.0:0.4451:0.308:0.247	.	.	.	.	X	136	.	ENSP00000359759:C136X	C	-	3	2	CT45A5	134775583	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.811000	0.04500	-2.067000	0.00885	-0.819000	0.03115	TGC		0.398	CT45A5-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472589.1	NM_001007551		42	93	1	0	1.59361e-14	0.006999	2.61857e-14	42	93				
SLC9A6	10479	broad.mit.edu	37	X	135067901	135067901	+	Silent	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:135067901G>T	ENST00000370698.3	+	1	275	c.240G>T	c.(238-240)ctG>ctT	p.L80L	SLC9A6_ENST00000370701.1_Silent_p.L28L|SLC9A6_ENST00000370695.4_Silent_p.L80L	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	80					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					TCATCCTGCTGCTCACCCTCA	0.597																																							uc004ezj.2		NA																	0				ovary(1)	1						c.(238-240)CTG>CTT		solute carrier family 9 (sodium/hydrogen							143.0	130.0	135.0					X																	135067901		2203	4300	6503	SO:0001819	synonymous_variant	10479				regulation of pH	early endosome membrane|endoplasmic reticulum membrane|integral to membrane|microsome|plasma membrane|recycling endosome membrane	sodium:hydrogen antiporter activity	g.chrX:135067901G>T	AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.240G>T	X.37:g.135067901G>T						SLC9A6_uc004ezk.2_Silent_p.L80L|SLC9A6_uc011mvx.1_Silent_p.L28L	p.L80L	NM_006359	NP_006350	Q92581	SL9A6_HUMAN			1	316	+	Acute lymphoblastic leukemia(192;0.000127)		80			Helical; (Potential).		A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Silent	SNP	ENST00000370698.3	37	c.240G>T	CCDS14654.1																																																																																				0.597	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058450.1	NM_006359		38	167	1	0	2.05212e-20	0.005524	3.62768e-20	38	167				
MAGEC3	139081	broad.mit.edu	37	X	140984900	140984900	+	Silent	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:140984900C>A	ENST00000298296.1	+	7	1356	c.1356C>A	c.(1354-1356)ccC>ccA	p.P452P	MAGEC3_ENST00000536088.1_Silent_p.P154P|MAGEC3_ENST00000483584.1_3'UTR|MAGEC3_ENST00000544766.1_Silent_p.P154P|MAGEC3_ENST00000409007.1_Silent_p.P154P|MAGEC3_ENST00000443323.2_Silent_p.P74P	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	452										NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					AATCCTTGCCCAGGTATGCCC	0.502																																							uc011mwp.1		NA																	0				skin(2)|central_nervous_system(1)	3						c.(1354-1356)CCC>CCA		melanoma antigen family C, 3 isoform 1							70.0	64.0	66.0					X																	140984900		2203	4300	6503	SO:0001819	synonymous_variant	139081							g.chrX:140984900C>A	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1356C>A	X.37:g.140984900C>A						MAGEC3_uc004fbs.2_Silent_p.P154P|MAGEC3_uc010nsj.2_Silent_p.P154P	p.P452P	NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN			7	1356	+	Acute lymphoblastic leukemia(192;6.56e-05)		452					Q3SYA7|Q5JZ43|Q9BZ80	Silent	SNP	ENST00000298296.1	37	c.1356C>A	CCDS14676.1																																																																																				0.502	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702		28	43	1	0	1.04121e-07	0.005443	1.38211e-07	28	43				
SLITRK2	84631	broad.mit.edu	37	X	144904758	144904758	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:144904758G>T	ENST00000370490.1	+	1	5070	c.815G>T	c.(814-816)aGt>aTt	p.S272I	SLITRK2_ENST00000447897.2_Missense_Mutation_p.S272I|SLITRK2_ENST00000434188.2_Missense_Mutation_p.S272I|SLITRK2_ENST00000428560.2_Missense_Mutation_p.S272I|SLITRK2_ENST00000413937.2_Missense_Mutation_p.S272I			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	272					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					AGTGATTCCAGTCAGAGGGGC	0.572																																							uc004fcd.2		NA																	0				ovary(5)|central_nervous_system(1)|pancreas(1)	7						c.(814-816)AGT>ATT		SLIT and NTRK-like family, member 2 precursor							84.0	79.0	81.0					X																	144904758		2202	4300	6502	SO:0001583	missense	84631					integral to membrane		g.chrX:144904758G>T	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.815G>T	X.37:g.144904758G>T	ENSP00000359521:p.Ser272Ile					SLITRK2_uc010nsp.2_Missense_Mutation_p.S272I|SLITRK2_uc010nso.2_Missense_Mutation_p.S272I|SLITRK2_uc011mwq.1_Missense_Mutation_p.S272I|SLITRK2_uc011mwr.1_Missense_Mutation_p.S272I|SLITRK2_uc011mws.1_Missense_Mutation_p.S272I|SLITRK2_uc004fcg.2_Missense_Mutation_p.S272I|SLITRK2_uc011mwt.1_Missense_Mutation_p.S272I	p.S272I	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN			5	1805	+	Acute lymphoblastic leukemia(192;6.56e-05)		272			Extracellular (Potential).		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	c.815G>T	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	G	5.278	0.236774	0.10023	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85	5.53	-0.353	0.12594	.	0.651605	0.14701	N	0.303565	T	0.33731	0.0873	L	0.42245	1.32	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.19386	-1.0307	10	0.40728	T	0.16	-0.5737	5.897	0.18945	0.2476:0.409:0.3434:0.0	.	272	Q9H156	SLIK2_HUMAN	I	272	ENSP00000334374:S272I;ENSP00000411681:S272I;ENSP00000359521:S272I;ENSP00000397015:S272I;ENSP00000407347:S272I;ENSP00000412010:S272I	ENSP00000334374:S272I	S	+	2	0	SLITRK2	144712450	0.000000	0.05858	0.002000	0.10522	0.771000	0.43674	0.751000	0.26348	-0.115000	0.11915	-0.192000	0.12808	AGT		0.572	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539		50	104	1	0	6.31075e-24	0.00361	1.12627e-23	50	104				
CXorf40B	541578	broad.mit.edu	37	X	149101926	149101926	+	Missense_Mutation	SNP	A	A	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:149101926A>G	ENST00000370406.3	-	4	995	c.167T>C	c.(166-168)cTg>cCg	p.L56P	CXorf40B_ENST00000355203.2_Missense_Mutation_p.L56P|CXorf40B_ENST00000462691.1_Missense_Mutation_p.L56P|CXorf40B_ENST00000370404.1_Missense_Mutation_p.L56P			Q96DE9	CX04B_HUMAN	chromosome X open reading frame 40B	56										endometrium(1)|lung(4)	5	Acute lymphoblastic leukemia(192;6.56e-05)					CTCCACCAGCAGCTCCCGACA	0.587																																							uc004fdy.2		NA																	0					0						c.(166-168)CTG>CCG		hypothetical protein LOC541578							140.0	132.0	135.0					X																	149101926		2200	4300	6500	SO:0001583	missense	541578							g.chrX:149101926A>G	BC009523	CCDS35426.1	Xq28	2012-11-28			ENSG00000197021	ENSG00000197021			17402	protein-coding gene	gene with protein product							Standard	XM_005274698		Approved		uc004fdy.3	Q96DE9	OTTHUMG00000034327	ENST00000370406.3:c.167T>C	X.37:g.149101926A>G	ENSP00000359434:p.Leu56Pro					CXorf40B_uc011mxs.1_RNA	p.L56P	NM_001013845	NP_001013867	Q96DE9	CX04B_HUMAN			4	683	-	Acute lymphoblastic leukemia(192;6.56e-05)		56						Missense_Mutation	SNP	ENST00000370406.3	37	c.167T>C	CCDS35426.1	.	.	.	.	.	.	.	.	.	.	a	17.24	3.339272	0.60963	.	.	ENSG00000197021	ENST00000462691;ENST00000370406;ENST00000355203;ENST00000370404	D;D;D;D	0.93659	-3.26;-3.26;-3.26;-3.26	3.24	1.96	0.26148	PUA-like domain (1);	0.231569	0.35349	N	0.003267	D	0.93122	0.7810	L	0.57536	1.79	0.22424	N	0.999116	D	0.54964	0.969	P	0.55508	0.777	D	0.86629	0.1884	10	0.87932	D	0	-10.9585	7.2991	0.26409	0.8003:0.0:0.0:0.1997	.	56	Q96DE9	CX04B_HUMAN	P	56	ENSP00000417546:L56P;ENSP00000359434:L56P;ENSP00000347339:L56P;ENSP00000359432:L56P	ENSP00000347339:L56P	L	-	2	0	CXorf40B	148852584	1.000000	0.71417	0.010000	0.14722	0.396000	0.30629	5.140000	0.64807	0.060000	0.16281	0.371000	0.22339	CTG		0.587	CXorf40B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082896.2	NP_001013867		35	153	0	0	0	0.002836	0	35	153				
MTMR1	8776	broad.mit.edu	37	X	149901131	149901131	+	Missense_Mutation	SNP	G	G	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:149901131G>C	ENST00000370390.3	+	9	1142	c.985G>C	c.(985-987)Gat>Cat	p.D329H	MTMR1_ENST00000542156.1_Missense_Mutation_p.D329H|MTMR1_ENST00000541925.1_Missense_Mutation_p.D235H|MTMR1_ENST00000538506.1_Missense_Mutation_p.D216H|MTMR1_ENST00000544228.1_Missense_Mutation_p.D329H|MTMR1_ENST00000451863.2_Missense_Mutation_p.D329H|MTMR1_ENST00000445323.2_Missense_Mutation_p.D337H	NM_003828.2	NP_003819.1	Q13613	MTMR1_HUMAN	myotubularin related protein 1	329	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					AACAATAATGGATGCTAACGC	0.438																																							uc004fei.2		NA																	0				ovary(1)	1						c.(985-987)GAT>CAT		myotubularin-related protein 1							126.0	101.0	109.0					X																	149901131		2203	4300	6503	SO:0001583	missense	8776					plasma membrane	protein tyrosine phosphatase activity	g.chrX:149901131G>C	U58032	CCDS14695.1	Xq28	2011-06-09			ENSG00000063601	ENSG00000063601		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7449	protein-coding gene	gene with protein product		300171				9828128	Standard	XM_005274765		Approved		uc004fei.3	Q13613	OTTHUMG00000024159	ENST00000370390.3:c.985G>C	X.37:g.149901131G>C	ENSP00000359417:p.Asp329His					MTMR1_uc011mya.1_Missense_Mutation_p.D235H|MTMR1_uc004feg.1_Missense_Mutation_p.D329H|MTMR1_uc004feh.1_Missense_Mutation_p.D337H|MTMR1_uc004fej.2_RNA|MTMR1_uc010ntf.2_RNA	p.D329H	NM_003828	NP_003819	Q13613	MTMR1_HUMAN			9	1120	+	Acute lymphoblastic leukemia(192;6.56e-05)		329			Myotubularin phosphatase.		A0A024RC07|Q9UBX6|Q9UEM0|Q9UQD5	Missense_Mutation	SNP	ENST00000370390.3	37	c.985G>C	CCDS14695.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.344797	0.82022	.	.	ENSG00000063601	ENST00000541925;ENST00000542156;ENST00000370390;ENST00000445323;ENST00000544228;ENST00000451863;ENST00000538506	D;D;D;D;D;D;D	0.90504	-2.68;-2.68;-2.68;-2.68;-2.68;-2.68;-2.68	5.93	5.93	0.95920	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.000000	0.85682	D	0.000000	D	0.95037	0.8393	M	0.72624	2.21	0.80722	D	1	D;B;D	0.76494	0.998;0.307;0.999	D;B;D	0.71656	0.974;0.171;0.961	D	0.94995	0.8138	10	0.66056	D	0.02	.	19.2892	0.94092	0.0:0.0:1.0:0.0	.	329;337;329	Q13613;F8WA39;Q8NEC6	MTMR1_HUMAN;.;.	H	235;329;329;337;329;329;216	ENSP00000441879:D235H;ENSP00000445281:D329H;ENSP00000359417:D329H;ENSP00000414178:D337H;ENSP00000440534:D329H;ENSP00000387446:D329H;ENSP00000443444:D216H	ENSP00000359417:D329H	D	+	1	0	MTMR1	149651789	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	8.062000	0.89475	2.508000	0.84585	0.523000	0.50628	GAT		0.438	MTMR1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060863.2	NM_003828, NM_176789		15	36	0	0	0	0.00245	0	15	36				
PASD1	139135	broad.mit.edu	37	X	150840152	150840152	+	Silent	SNP	C	C	A			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:150840152C>A	ENST00000370357.4	+	13	1583	c.1338C>A	c.(1336-1338)ctC>ctA	p.L446L		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	446						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					AGCGGCCTCTCCCACATCCCA	0.498																																							uc004fev.3		NA																	0				ovary(3)	3						c.(1336-1338)CTC>CTA		PAS domain containing 1							143.0	118.0	126.0					X																	150840152		2203	4300	6503	SO:0001819	synonymous_variant	139135					nucleus	signal transducer activity	g.chrX:150840152C>A	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1338C>A	X.37:g.150840152C>A							p.L446L	NM_173493	NP_775764	Q8IV76	PASD1_HUMAN			13	1670	+	Acute lymphoblastic leukemia(192;6.56e-05)		446					Q3MNE0|Q69HD7|Q8N7X9	Silent	SNP	ENST00000370357.4	37	c.1338C>A	CCDS35431.1																																																																																				0.498	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493		35	99	1	0	1.62565e-12	0.002445	2.56935e-12	35	99				
CETN2	1069	broad.mit.edu	37	X	151998262	151998262	+	Silent	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:151998262G>T	ENST00000370277.3	-	2	112	c.46C>A	c.(46-48)Cga>Aga	p.R16R	NSDHL_ENST00000440023.1_5'Flank|NSDHL_ENST00000370274.3_5'Flank|CETN2_ENST00000493482.1_5'Flank	NM_004344.1	NP_004335.1	P41208	CETN2_HUMAN	centrin, EF-hand protein, 2	16	Required for self-assembly.				centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)|regulation of cytokinesis (GO:0032465)|spermatogenesis (GO:0007283)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|intracellular (GO:0005622)|photoreceptor connecting cilium (GO:0032391)|XPC complex (GO:0071942)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|calcium ion binding (GO:0005509)|nucleic acid binding (GO:0003676)			breast(1)|lung(4)|prostate(1)|skin(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)					ATTCTTTTTCGCTGAGAACTT	0.408								Direct reversal of damage;Nucleotide excision repair (NER)																															uc004fgq.2		NA																	0					0						c.(46-48)CGA>AGA	Direct_reversal_of_damage|NER	caltractin							164.0	142.0	149.0					X																	151998262		2203	4300	6503	SO:0001819	synonymous_variant	1069				cell division|centriole replication|G2/M transition of mitotic cell cycle|mitosis|nucleotide-excision repair|regulation of cytokinesis	centriole|cytosol|XPC complex	ATP binding|ATP-dependent helicase activity|calcium ion binding|nucleic acid binding	g.chrX:151998262G>T	X72964	CCDS14716.1	Xq28	2013-01-10			ENSG00000147400	ENSG00000147400		"""EF-hand domain containing"""	1867	protein-coding gene	gene with protein product		300006		CALT		7713520, 8597638	Standard	NM_004344		Approved	CEN2	uc004fgq.3	P41208	OTTHUMG00000024246	ENST00000370277.3:c.46C>A	X.37:g.151998262G>T						CETN2_uc004fgr.2_5'UTR|NSDHL_uc004fgt.1_5'Flank|NSDHL_uc004fgs.1_5'Flank	p.R16R	NM_004344	NP_004335	P41208	CETN2_HUMAN			2	93	-	Acute lymphoblastic leukemia(192;6.56e-05)		16			Required for self-assembly.		B2R4T4|Q53XW1	Silent	SNP	ENST00000370277.3	37	c.46C>A	CCDS14716.1																																																																																				0.408	CETN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061197.1	NM_004344		24	67	1	0	5.35356e-11	0.00278	7.95569e-11	24	67				
NSDHL	50814	broad.mit.edu	37	X	152018931	152018931	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:152018931G>T	ENST00000370274.3	+	3	425	c.231G>T	c.(229-231)caG>caT	p.Q77H	NSDHL_ENST00000440023.1_Missense_Mutation_p.Q77H	NM_015922.2	NP_057006.1	Q15738	NSDHL_HUMAN	NAD(P) dependent steroid dehydrogenase-like	77					cholesterol biosynthetic process (GO:0006695)|hair follicle development (GO:0001942)|labyrinthine layer blood vessel development (GO:0060716)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|sterol-4-alpha-carboxylate 3-dehydrogenase (decarboxylating) activity (GO:0047012)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(5)	15	Acute lymphoblastic leukemia(192;6.56e-05)					ATAATCCCCAGGTGCGGTTCT	0.537																																							uc004fgt.1		NA																	0					0						c.(229-231)CAG>CAT		NAD(P) dependent steroid dehydrogenase-like	NADH(DB00157)						213.0	199.0	203.0					X																	152018931		2203	4300	6503	SO:0001583	missense	50814				cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|C-3 sterol dehydrogenase (C-4 sterol decarboxylase) activity|sterol-4-alpha-carboxylate 3-dehydrogenase (decarboxylating) activity	g.chrX:152018931G>T	X96621	CCDS14717.1	Xq28	2011-09-14			ENSG00000147383	ENSG00000147383	1.1.1.170	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	13398	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 31E, member 1"""	300275				10710235, 12837764, 19027726	Standard	NM_015922		Approved	XAP104, H105e3, SDR31E1	uc004fgs.1	Q15738	OTTHUMG00000024185	ENST00000370274.3:c.231G>T	X.37:g.152018931G>T	ENSP00000359297:p.Gln77His					NSDHL_uc004fgs.1_Missense_Mutation_p.Q77H	p.Q77H	NM_001129765	NP_001123237	Q15738	NSDHL_HUMAN			4	492	+	Acute lymphoblastic leukemia(192;6.56e-05)		77					D3DWT6|O00344	Missense_Mutation	SNP	ENST00000370274.3	37	c.231G>T	CCDS14717.1	.	.	.	.	.	.	.	.	.	.	g	6.028	0.373603	0.11409	.	.	ENSG00000147383	ENST00000370274;ENST00000440023;ENST00000432467	D;D;D	0.88277	-2.36;-2.36;-2.36	5.51	-1.98	0.07480	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.632380	0.16205	N	0.224779	T	0.77438	0.4130	L	0.35793	1.09	0.09310	N	0.999999	B	0.06786	0.001	B	0.09377	0.004	T	0.62685	-0.6802	10	0.49607	T	0.09	-1.8245	0.685	0.00882	0.187:0.2334:0.2208:0.3588	.	77	Q15738	NSDHL_HUMAN	H	77	ENSP00000359297:Q77H;ENSP00000391854:Q77H;ENSP00000396266:Q77H	ENSP00000359297:Q77H	Q	+	3	2	NSDHL	151769587	0.000000	0.05858	0.008000	0.14137	0.189000	0.23516	-1.296000	0.02762	-0.552000	0.06167	-0.282000	0.10007	CAG		0.537	NSDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060927.1	NM_015922		56	179	1	0	4.64219e-42	0.00361	8.70119e-42	56	179				
L1CAM	3897	broad.mit.edu	37	X	153136566	153136566	+	Missense_Mutation	SNP	G	G	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:153136566G>T	ENST00000370060.1	-	6	658	c.469C>A	c.(469-471)Cct>Act	p.P157T	L1CAM_ENST00000361699.4_Missense_Mutation_p.P157T|L1CAM_ENST00000538883.1_Missense_Mutation_p.P159T|L1CAM_ENST00000543994.1_Missense_Mutation_p.P159T|L1CAM_ENST00000370057.3_Missense_Mutation_p.P157T|L1CAM_ENST00000361981.3_Missense_Mutation_p.P152T|L1CAM_ENST00000370055.1_Missense_Mutation_p.P152T	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	157	Ig-like C2-type 2.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGGTTGCAAGGCAGAACCACT	0.637																																							uc004fjb.2		NA																	0				ovary(8)|central_nervous_system(1)	9						c.(469-471)CCT>ACT		L1 cell adhesion molecule isoform 1 precursor							51.0	44.0	46.0					X																	153136566		2203	4300	6503	SO:0001583	missense	3897				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane		g.chrX:153136566G>T	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.469C>A	X.37:g.153136566G>T	ENSP00000359077:p.Pro157Thr					L1CAM_uc004fjc.2_Missense_Mutation_p.P157T|L1CAM_uc010nuo.2_Missense_Mutation_p.P152T|L1CAM_uc004fjd.1_5'Flank|L1CAM_uc004fje.1_Missense_Mutation_p.P152T	p.P157T	NM_000425	NP_000416	P32004	L1CAM_HUMAN			5	577	-	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		157			Extracellular (Potential).|Ig-like C2-type 2.		A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	c.469C>A	CCDS14733.1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.455604	0.43634	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000540065;ENST00000370055;ENST00000361699	T;T;T;T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91	5.12	5.12	0.69794	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000007	T	0.75474	0.3854	L	0.61036	1.89	0.41863	D	0.990232	P;B;P	0.43314	0.765;0.257;0.803	B;B;P	0.47299	0.408;0.202;0.543	T	0.72004	-0.4421	10	0.11182	T	0.66	.	16.2934	0.82760	0.0:0.0:1.0:0.0	.	152;157;157	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	T	157;159;157;159;152;27;152;157	ENSP00000359077:P157T;ENSP00000438430:P159T;ENSP00000359074:P157T;ENSP00000439645:P159T;ENSP00000354712:P152T;ENSP00000359072:P152T;ENSP00000355380:P157T	ENSP00000355380:P157T	P	-	1	0	L1CAM	152789760	0.998000	0.40836	0.416000	0.26546	0.211000	0.24417	2.946000	0.49050	2.366000	0.80165	0.436000	0.28706	CCT		0.637	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003		13	50	1	0	4.36969e-10	0.001855	6.29303e-10	13	50				
FLNA	2316	broad.mit.edu	37	X	153590841	153590841	+	Missense_Mutation	SNP	T	T	C			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:153590841T>C	ENST00000369850.3	-	17	2746	c.2510A>G	c.(2509-2511)aAg>aGg	p.K837R	FLNA_ENST00000360319.4_Missense_Mutation_p.K837R|FLNA_ENST00000422373.1_Missense_Mutation_p.K837R|FLNA_ENST00000344736.4_Missense_Mutation_p.K837R	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	837					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGGCGTGTACTTGACCGTGAA	0.592																																							uc004fkk.2		NA																	0				breast(6)	6						c.(2509-2511)AAG>AGG		filamin A, alpha isoform 2							91.0	102.0	99.0					X																	153590841		2067	4175	6242	SO:0001583	missense	2316				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding	g.chrX:153590841T>C	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.2510A>G	X.37:g.153590841T>C	ENSP00000358866:p.Lys837Arg					FLNA_uc010nuu.1_Missense_Mutation_p.K837R	p.K837R	NM_001110556	NP_001104026	P21333	FLNA_HUMAN			17	2759	-	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		837			Filamin 6.		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	c.2510A>G	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	T	16.82	3.227291	0.58668	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83	4.91	4.91	0.64330	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.86155	0.5865	L	0.31664	0.95	0.80722	D	1	B;P	0.42248	0.064;0.774	B;P	0.56916	0.149;0.809	D	0.86476	0.1788	10	0.48119	T	0.1	.	13.906	0.63836	0.0:0.0:0.0:1.0	.	837;837	P21333-2;P21333	.;FLNA_HUMAN	R	837;810;837;837;837	ENSP00000353467:K837R;ENSP00000416926:K837R;ENSP00000358866:K837R;ENSP00000358863:K837R	ENSP00000358863:K837R	K	-	2	0	FLNA	153244035	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.259000	0.72494	1.728000	0.51552	0.430000	0.28490	AAG		0.592	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3			35	122	0	0	0	0.003271	0	35	122				
VAMP7	6845	broad.mit.edu	37	X	155171606	155171607	+	Nonsense_Mutation	DNP	GA	GA	TT			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	GA	GA	-	-	GA	GA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:155171606_155171607GA>TT	ENST00000286448.6	+	8	819_820	c.654_655GA>TT	c.(652-657)gtGAag>gtTTag	p.K219*	VAMP7_ENST00000460621.1_Nonsense_Mutation_p.K178*|VAMP7_ENST00000262640.6_Missense_Mutation_p.E196L	NM_001145149.2|NM_005638.5	NP_001138621.1|NP_005629.1	P51809	VAMP7_HUMAN	vesicle-associated membrane protein 7	219					calcium ion-dependent exocytosis (GO:0017156)|endosome to lysosome transport (GO:0008333)|eosinophil degranulation (GO:0043308)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi to plasma membrane protein transport (GO:0043001)|membrane organization (GO:0061024)|neutrophil degranulation (GO:0043312)|phagocytosis, engulfment (GO:0006911)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of protein targeting to vacuolar membrane (GO:1900483)|SNARE complex assembly (GO:0035493)|triglyceride transport (GO:0034197)|vesicle fusion (GO:0006906)|vesicle fusion with Golgi apparatus (GO:0048280)|vesicle-mediated transport (GO:0016192)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|synapse (GO:0045202)				large_intestine(1)|lung(8)	9	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CAAGCTGTGTGAAGAAATAGGA	0.396																																							uc004fnr.2		NA																	0					0						c.(652-657)GTGAAG>GTTTAG		vesicle-associated membrane protein 7 isoform 1																																				SO:0001587	stop_gained	6845				calcium ion-dependent exocytosis|endosome to lysosome transport|eosinophil degranulation|ER to Golgi vesicle-mediated transport|neutrophil degranulation|phagocytosis, engulfment|post-Golgi vesicle-mediated transport|protein transport|vesicle fusion	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|phagocytic vesicle membrane|plasma membrane|SNARE complex|transport vesicle membrane	protein binding	g.chrX:155171606_155171607GA>TT	AJ295938	CCDS14770.4, CCDS48199.1, CCDS55548.1	Xq28 and Yq12	2013-02-13	2007-12-05	2007-12-05	ENSG00000124333	ENSG00000124333		"""Pseudoautosomal regions / PAR2"", ""Vesicle-associated membrane proteins"""	11486	protein-coding gene	gene with protein product		300053	"""synaptobrevin-like 1"""	SYBL1		8640232, 11440841	Standard	NM_001145149		Approved	VAMP-7, TI-VAMP	uc004fns.3	P51809	OTTHUMG00000022679	Exception_encountered	X.37:g.155171606_155171607delinsTT	ENSP00000286448:p.Lys219*					VAMP7_uc004fnt.2_Nonsense_Mutation_p.K178*|VAMP7_uc011naa.1_Nonsense_Mutation_p.K180*|VAMP7_uc011nab.1_Nonsense_Mutation_p.K118*|VAMP7_uc004fns.2_Missense_Mutation_p.E196L|VAMP7_uc011nac.1_Nonsense_Mutation_p.K152*	p.K219*	NM_005638	NP_005629	P51809	VAMP7_HUMAN			8	828_829	+	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		219			Vesicular (Potential).		Q53GY7|Q7Z409|Q9H4A7	Nonsense_Mutation	DNP	ENST00000286448.6	37	c.654_655GA>TT	CCDS14770.4																																																																																				0.396	VAMP7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058843.1	NM_005638		4	33	0	0	0	0.004672	0	4	33				
IL9R	3581	broad.mit.edu	37	X	155233457	155233457	+	Missense_Mutation	SNP	C	C	G			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:155233457C>G	ENST00000244174.5	+	4	549	c.370C>G	c.(370-372)Cac>Gac	p.H124D	IL9R_ENST00000540897.1_Silent_p.T158T|IL9R_ENST00000369423.2_Silent_p.T168T|IL9R_ENST00000424344.3_Missense_Mutation_p.H103D	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	124					cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)			NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CACTTTCCACCACTGCATGTC	0.622																																							uc004fnv.1		NA																	0					0						c.(370-372)CAC>GAC		interleukin 9 receptor precursor							123.0	112.0	116.0					X																	155233457		2203	4296	6499	SO:0001583	missense	3581				cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity	g.chrX:155233457C>G	M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.370C>G	X.37:g.155233457C>G	ENSP00000244174:p.His124Asp					IL9R_uc010nvn.2_Missense_Mutation_p.H103D|IL9R_uc004fnu.1_Silent_p.T168T	p.H124D	NM_002186	NP_002177	Q01113	IL9R_HUMAN			4	549	+	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)		124			Extracellular (Potential).		B9ZVT0|Q14634|Q8WWU1|Q96TF0	Missense_Mutation	SNP	ENST00000244174.5	37	c.370C>G	CCDS14771.4	.	.	.	.	.	.	.	.	.	.	.	7.463	0.645069	0.14451	.	.	ENSG00000124334	ENST00000244174;ENST00000424344;ENST00000455739	T;T	0.28255	1.62;1.62	1.29	-0.846	0.10734	.	1.805090	0.02464	N	0.086837	T	0.12305	0.0299	.	.	.	0.09310	N	1	B;B	0.28178	0.202;0.015	B;B	0.23018	0.043;0.009	T	0.11767	-1.0574	9	0.06757	T	0.87	-21.8528	4.1477	0.10224	0.0:0.5292:0.0:0.4708	.	103;124	F5H3Z0;Q01113	.;IL9R_HUMAN	D	124;103;103	ENSP00000244174:H124D;ENSP00000388918:H103D	ENSP00000244174:H124D	H	+	1	0	IL9R	154886651	0.023000	0.18921	0.068000	0.19968	0.539000	0.34962	-0.197000	0.09518	-0.405000	0.07599	0.287000	0.19450	CAC		0.622	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058981.1	NM_002186		12	44	0	0	0	0.000978	0	12	44				
GPATCH4	54865	broad.mit.edu	37	1	156565503	156565504	+	Frame_Shift_Ins	INS	-	-	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:156565503_156565504insT	ENST00000438976.2	-	8	659_660	c.629_630insA	c.(628-630)aagfs	p.K210fs	GPATCH4_ENST00000368232.4_Frame_Shift_Ins_p.K205fs|GPATCH4_ENST00000497287.1_5'UTR			Q5T3I0	GPTC4_HUMAN	G patch domain containing 4	205							poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(3)|stomach(1)	17	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TTTTCTTTTTCTTTTTTTTGGG	0.535																																							uc001fpm.2		NA																	0				ovary(1)	1						c.(628-630)AAGfs		G patch domain containing 4 isoform 1																																				SO:0001589	frameshift_variant	54865					intracellular	nucleic acid binding	g.chr1:156565503_156565504insT	BC056904	CCDS1146.1, CCDS44245.1	1q22	2013-01-28		2006-12-13	ENSG00000160818	ENSG00000160818		"""G patch domain containing"""	25982	protein-coding gene	gene with protein product				GPATC4		12477932	Standard	NM_015590		Approved	FLJ20249, DKFZP434F1735	uc001fpl.3	Q5T3I0	OTTHUMG00000033203	ENST00000438976.2:c.630dupA	1.37:g.156565511_156565511dupT	ENSP00000396441:p.Lys210fs					APOA1BP_uc010php.1_Intron|GPATCH4_uc001fpl.2_Frame_Shift_Ins_p.K205fs	p.K210fs	NM_015590	NP_056405	Q5T3I0	GPTC4_HUMAN			8	668_669	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		205			Potential.		Q5T3I1|Q6ZUE7|Q8IWG8|Q9NXH4	Frame_Shift_Ins	INS	ENST00000438976.2	37	c.629_630insA	CCDS44245.1																																																																																				0.535	GPATCH4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386947.1	NM_017725		7	133	NA	NA	NA	NA	NA	7	133	---	---	---	---
RGS21	431704	broad.mit.edu	37	1	192335245	192335245	+	Frame_Shift_Del	DEL	T	T	-			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr1:192335245delT	ENST00000417209.2	+	5	624	c.450delT	c.(448-450)cctfs	p.P150fs		NM_001039152.3	NP_001034241.1	Q2M5E4	RGS21_HUMAN	regulator of G-protein signaling 21	150					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			NS(1)|endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	15						AATGGCTCCCTTTTTTGTGAG	0.338																																							uc001gsh.2		NA																	0				ovary(1)|skin(1)	2						c.(448-450)CCTfs		regulator of G-protein signaling 21							38.0	37.0	37.0					1																	192335245		1794	4063	5857	SO:0001589	frameshift_variant	431704				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity	g.chr1:192335245delT	AY643711	CCDS41448.1	1q31.2	2013-09-24	2007-08-14		ENSG00000253148	ENSG00000253148		"""Regulators of G-protein signaling"""	26839	protein-coding gene	gene with protein product		612407	"""regulator of G-protein signalling 21"""			15066150	Standard	NM_001039152		Approved		uc001gsh.3	Q2M5E4	OTTHUMG00000035594	ENST00000417209.2:c.450delT	1.37:g.192335245delT	ENSP00000428343:p.Pro150fs						p.P150fs	NM_001039152	NP_001034241	Q2M5E4	RGS21_HUMAN			5	624	+			150						Frame_Shift_Del	DEL	ENST00000417209.2	37	c.450delT	CCDS41448.1																																																																																				0.338	RGS21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086387.2			9	20	NA	NA	NA	NA	NA	9	20	---	---	---	---
Unknown	0	broad.mit.edu	37	10	135491055	135491055	+	IGR	DEL	C	C	-			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr10:135491055delC								AL845259.1 (17876 upstream) : None (None downstream)																							CGCAGGCAGGCGGCCTGTGCA	0.731																																							uc010qvi.1		NA																	0					0						c.(664-666)GGCfs		double homeobox, 4-like							34.0	45.0	41.0					10																	135491055		1222	2280	3502	SO:0001628	intergenic_variant	653544					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:135491055delC																													10.37:g.135491055delC							p.G222fs	NM_001127389	NP_001120861	F5GZ66	F5GZ66_HUMAN			1	777	+			222						Frame_Shift_Del	DEL		37	c.666delC																																																																																				0	0.731									21	684	NA	NA	NA	NA	NA	21	684	---	---	---	---
OVCH1	341350	broad.mit.edu	37	12	29630297	29630297	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr12:29630297delG	ENST00000318184.5	-	11	1222	c.1223delC	c.(1222-1224)actfs	p.T408fs	OVCH1-AS1_ENST00000549411.1_Intron|OVCH1-AS1_ENST00000551108.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	408	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					CTGTACAGCAGTAACGGTAAG	0.458																																							uc001rix.1		NA																	0				ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10						c.(1222-1224)ACTfs		ovochymase 1 precursor							156.0	150.0	152.0					12																	29630297		1950	4149	6099	SO:0001589	frameshift_variant	341350				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity	g.chr12:29630297delG	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.1223delC	12.37:g.29630297delG	ENSP00000326708:p.Thr408fs						p.T408fs	NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN			11	1223	-	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)		408			CUB 1.			Frame_Shift_Del	DEL	ENST00000318184.5	37	c.1223delC																																																																																					0.458	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378		18	105	NA	NA	NA	NA	NA	18	105	---	---	---	---
NOL4	8715	broad.mit.edu	37	18	31803106	31803106	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr18:31803106delG	ENST00000261592.5	-	1	409	c.112delC	c.(112-114)cagfs	p.Q38fs	NOL4_ENST00000538587.1_5'Flank|NOL4_ENST00000589544.1_Frame_Shift_Del_p.Q38fs|RP11-379L18.1_ENST00000587528.1_RNA|NOL4_ENST00000590846.1_5'Flank|NOL4_ENST00000269185.4_5'UTR|NOL4_ENST00000535475.1_5'Flank	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	38						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						TTGAGGAGCTGGACGATCCGT	0.577																																							uc010dmi.2		NA																	0				ovary(3)	3						c.(112-114)CAGfs		nucleolar protein 4							109.0	115.0	113.0					18																	31803106		2066	4185	6251	SO:0001589	frameshift_variant	8715					nucleolus	RNA binding	g.chr18:31803106delG	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.112delC	18.37:g.31803106delG	ENSP00000261592:p.Gln38fs					NOL4_uc002kxr.3_5'Flank|NOL4_uc010xbt.1_5'Flank|NOL4_uc010dmh.2_5'Flank|NOL4_uc010xbu.1_Frame_Shift_Del_p.Q38fs|NOL4_uc002kxt.3_Frame_Shift_Del_p.Q38fs	p.Q38fs	NM_003787	NP_003778	O94818	NOL4_HUMAN			1	341	-			38					B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Frame_Shift_Del	DEL	ENST00000261592.5	37	c.112delC	CCDS11907.2																																																																																				0.577	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787		26	105	NA	NA	NA	NA	NA	26	105	---	---	---	---
NCR1	9437	broad.mit.edu	37	19	55420680	55420680	+	Frame_Shift_Del	DEL	C	C	-			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr19:55420680delC	ENST00000291890.4	+	4	470	c.432delC	c.(430-432)tgcfs	p.C144fs	NCR1_ENST00000338835.5_Frame_Shift_Del_p.C144fs|NCR1_ENST00000594765.1_Frame_Shift_Del_p.C144fs|NCR1_ENST00000598576.1_Frame_Shift_Del_p.C132fs|NCR1_ENST00000350790.5_Frame_Shift_Del_p.C49fs|NCR1_ENST00000447255.1_Frame_Shift_Del_p.C144fs|NCR1_ENST00000357397.5_Frame_Shift_Del_p.C37fs	NM_004829.5	NP_004820.2	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	144	Ig-like 2.				cellular defense response (GO:0006968)|intracellular signal transduction (GO:0035556)|natural killer cell activation (GO:0030101)|regulation of natural killer cell mediated cytotoxicity (GO:0042269)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|SWI/SNF complex (GO:0016514)	receptor signaling protein activity (GO:0005057)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(193;0.0449)		CCTTCTACTGCCGTCTAGACA	0.562																																							uc002qib.2		NA																	0				large_intestine(1)|ovary(1)	2						c.(430-432)TGCfs		natural cytotoxicity triggering receptor 1							110.0	86.0	94.0					19																	55420680		2203	4300	6503	SO:0001589	frameshift_variant	9437				cellular defense response|natural killer cell activation|regulation of natural killer cell mediated cytotoxicity	integral to plasma membrane|SWI/SNF complex	receptor activity|receptor signaling protein activity	g.chr19:55420680delC	AJ001383	CCDS12911.1, CCDS46181.1, CCDS46182.1, CCDS56103.1	19q13.42	2013-09-20	2002-11-13	2002-11-15	ENSG00000189430	ENSG00000189430		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6731	protein-coding gene	gene with protein product		604530	"""lymphocyte antigen 94 (mouse) homolog (activating NK-receptor; NK-p46)"""	LY94		9730896	Standard	NM_001145457		Approved	NK-p46, NKP46, CD335	uc002qib.2	O76036	OTTHUMG00000183212	ENST00000291890.4:c.432delC	19.37:g.55420680delC	ENSP00000291890:p.Cys144fs					NCR1_uc002qic.2_Frame_Shift_Del_p.C144fs|NCR1_uc002qie.2_Frame_Shift_Del_p.C144fs|NCR1_uc002qid.2_Frame_Shift_Del_p.C49fs|NCR1_uc002qif.2_Frame_Shift_Del_p.C49fs|NCR1_uc010esj.2_Frame_Shift_Del_p.C37fs	p.C144fs	NM_004829	NP_004820	O76036	NCTR1_HUMAN		GBM - Glioblastoma multiforme(193;0.0449)	4	470	+			144			Extracellular (Potential).|Ig-like 2.		B0V3L2|B0V3L3|B0V3L4|B0V3L5|B8JL03|O76016|O76017|O76018	Frame_Shift_Del	DEL	ENST00000291890.4	37	c.432delC	CCDS12911.1																																																																																				0.562	NCR1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465680.1			9	47	NA	NA	NA	NA	NA	9	47	---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	41648136	41648137	+	Frame_Shift_Ins	INS	-	-	T			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr21:41648136_41648137insT	ENST00000400454.1	-	11	2720_2721	c.2243_2244insA	c.(2242-2244)aatfs	p.N748fs		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	748	Ig-like C2-type 8.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GCAACGACCCATTGCTGAGAAC	0.525																																					Melanoma(134;970 1778 1785 21664 32388)	Melanoma(134;970 1778 1785 21664 32388)	uc002yyq.1		NA																	0				ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11						c.(2242-2244)AATfs		Down syndrome cell adhesion molecule isoform																																				SO:0001589	frameshift_variant	1826				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding	g.chr21:41648136_41648137insT	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.2244dupA	21.37:g.41648138_41648138dupT	ENSP00000383303:p.Asn748fs					DSCAM_uc002yyr.1_RNA	p.N748fs	NM_001389	NP_001380	O60469	DSCAM_HUMAN			11	2695_2696	-		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)	748			Extracellular (Potential).|Ig-like C2-type 8.		O60468	Frame_Shift_Ins	INS	ENST00000400454.1	37	c.2243_2244insA	CCDS42929.1																																																																																				0.525	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389		20	49	NA	NA	NA	NA	NA	20	49	---	---	---	---
APOBEC3D	140564	broad.mit.edu	37	22	39421324	39421324	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr22:39421324delG	ENST00000216099.8	+	3	867	c.460delG	c.(460-462)gggfs	p.G154fs	APOBEC3D_ENST00000381568.4_Frame_Shift_Del_p.G154fs|APOBEC3D_ENST00000427494.2_Intron	NM_152426.3	NP_689639.2	Q96AK3	ABC3D_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D	154					defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines (GO:0016814)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)	11	Melanoma(58;0.04)					GCATAAGGCAGGGGCCCGTGT	0.597																																							uc011aoe.1		NA																	0					0						c.(460-462)GGGfs		apolipoprotein B mRNA editing enzyme, catalytic							47.0	51.0	50.0					22																	39421324		2203	4300	6503	SO:0001589	frameshift_variant	140564				negative regulation of transposition		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|zinc ion binding	g.chr22:39421324delG	BF832090	CCDS46709.1	22q13.1	2012-10-19	2008-05-01		ENSG00000243811	ENSG00000243811		"""Apolipoprotein B mRNA editing enzymes"""	17354	protein-coding gene	gene with protein product		609900	"""apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D (putative)"", ""apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3E pseudogene"""	APOBEC3E		11863358	Standard	NM_152426		Approved	ARP6, APOBEC3DE	uc003awt.4	Q96AK3	OTTHUMG00000151084	ENST00000216099.8:c.460delG	22.37:g.39421324delG	ENSP00000216099:p.Gly154fs					APOBEC3D_uc011aod.1_Frame_Shift_Del_p.G154fs|APOBEC3D_uc011aof.1_Intron|APOBEC3D_uc003awu.3_Intron|APOBEC3D_uc003awt.3_Frame_Shift_Del_p.G154fs|APOBEC3D_uc010gxu.2_Intron	p.G154fs	NM_152426	NP_689639	Q96AK3	ABC3D_HUMAN			3	514	+	Melanoma(58;0.04)		154					Q5JZ91|Q7Z2N2|Q7Z2N5|Q7Z2N6	Frame_Shift_Del	DEL	ENST00000216099.8	37	c.460delG	CCDS46709.1																																																																																				0.597	APOBEC3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321232.2	NM_152426		11	53	NA	NA	NA	NA	NA	11	53	---	---	---	---
IL4	3565	broad.mit.edu	37	5	132015566	132015566	+	Frame_Shift_Del	DEL	G	G	-			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chr5:132015566delG	ENST00000231449.2	+	3	409	c.344delG	c.(343-345)tggfs	p.W115fs	IL4_ENST00000350025.2_Frame_Shift_Del_p.W99fs	NM_000589.3	NP_000580.1	P05112	IL4_HUMAN	interleukin 4	115					B cell costimulation (GO:0031296)|B cell differentiation (GO:0030183)|cellular defense response (GO:0006968)|cellular response to mercury ion (GO:0071288)|chemotaxis (GO:0006935)|cholesterol metabolic process (GO:0008203)|connective tissue growth factor biosynthetic process (GO:0045189)|defense response to protozoan (GO:0042832)|dendritic cell differentiation (GO:0097028)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|female pregnancy (GO:0007565)|immune response (GO:0006955)|innate immune response in mucosa (GO:0002227)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chronic inflammatory response (GO:0002677)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of macrophage activation (GO:0043031)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of T-helper 17 cell differentiation (GO:2000320)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of immune response (GO:0050776)|regulation of isotype switching (GO:0045191)|regulation of phosphorylation (GO:0042325)|regulation of proton transport (GO:0010155)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|T-helper 1 cell lineage commitment (GO:0002296)|T-helper 2 cell cytokine production (GO:0035745)|T-helper 2 cell differentiation (GO:0045064)|type 2 immune response (GO:0042092)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|interleukin-4 receptor binding (GO:0005136)			NS(1)|large_intestine(3)|lung(3)|prostate(1)	8		all_cancers(142;2.81e-05)|all_lung(232;1.47e-05)|Lung NSC(810;2.31e-05)|all_neural(839;0.0459)|Ovarian(839;0.0481)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	GBM - Glioblastoma multiforme(465;0.00245)		AGGAACCTCTGGGGCCTGGCG	0.602																																							uc003kxk.1		NA																	0					0						c.(343-345)TGGfs		interleukin 4 isoform 1 precursor							25.0	25.0	25.0					5																	132015566		2203	4300	6503	SO:0001589	frameshift_variant	3565				B cell differentiation|cellular defense response|chemotaxis|cholesterol metabolic process|connective tissue growth factor biosynthetic process|negative regulation of apoptosis|negative regulation of osteoclast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of interleukin-13 production|positive regulation of isotype switching to IgE isotypes|positive regulation of isotype switching to IgG isotypes|positive regulation of MHC class II biosynthetic process|positive regulation of T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|T-helper 2 cell cytokine production	extracellular space	cytokine activity|growth factor activity|interleukin-4 receptor binding	g.chr5:132015566delG	M23442	CCDS4158.1, CCDS4159.1	5q23-q31	2011-07-14			ENSG00000113520	ENSG00000113520		"""Interleukins and interleukin receptors"""	6014	protein-coding gene	gene with protein product	"""B_cell stimulatory factor 1"", ""lymphocyte stimulatory factor 1"", ""B cell growth factor 1"""	147780				3016727	Standard	NM_000589		Approved	BSF1, IL-4, BCGF1, BCGF-1, MGC79402	uc003kxk.2	P05112	OTTHUMG00000059724	ENST00000231449.2:c.344delG	5.37:g.132015566delG	ENSP00000231449:p.Trp115fs					IL4_uc003kxl.1_Frame_Shift_Del_p.W99fs	p.W115fs	NM_000589	NP_000580	P05112	IL4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	GBM - Glioblastoma multiforme(465;0.00245)	3	714	+		all_cancers(142;2.81e-05)|all_lung(232;1.47e-05)|Lung NSC(810;2.31e-05)|all_neural(839;0.0459)|Ovarian(839;0.0481)|Breast(839;0.198)	115					Q14630|Q6NZ77	Frame_Shift_Del	DEL	ENST00000231449.2	37	c.344delG	CCDS4158.1																																																																																				0.602	IL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132786.1	NM_000589		8	45	NA	NA	NA	NA	NA	8	45	---	---	---	---
CDX4	1046	broad.mit.edu	37	X	72667267	72667267	+	Frame_Shift_Del	DEL	C	C	-			TCGA-97-7546-01A-11D-2036-08	TCGA-97-7546-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	0e867b98-7689-4cde-ac39-95561719484b	8ac57855-42a3-4a1c-bf03-c7733fe5cfe5	g.chrX:72667267delC	ENST00000373514.2	+	1	178	c.178delC	c.(178-180)cccfs	p.P60fs		NM_005193.1	NP_005184.1	O14627	CDX4_HUMAN	caudal type homeobox 4	60					anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|skin(1)	18	Renal(35;0.156)					TCCTCATATGCCCAGCATGGA	0.617																																							uc011mqk.1		NA																	0					0						c.(178-180)CCCfs		caudal type homeobox 4							52.0	44.0	47.0					X																	72667267		2203	4300	6503	SO:0001589	frameshift_variant	1046					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:72667267delC	AF029879	CCDS14424.1	Xq13.2	2012-03-09	2007-07-09		ENSG00000131264	ENSG00000131264		"""Homeoboxes / ANTP class : HOXL subclass"""	1808	protein-coding gene	gene with protein product		300025	"""caudal type homeo box transcription factor 4"""			7655457	Standard	NM_005193		Approved		uc011mqk.2	O14627	OTTHUMG00000021831	ENST00000373514.2:c.178delC	X.37:g.72667267delC	ENSP00000362613:p.Pro60fs						p.P60fs	NM_005193	NP_005184	O14627	CDX4_HUMAN			1	178	+	Renal(35;0.156)		60					A1A513|Q5JS20	Frame_Shift_Del	DEL	ENST00000373514.2	37	c.178delC	CCDS14424.1																																																																																				0.617	CDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057229.2	NM_005193		18	36	NA	NA	NA	NA	NA	18	36	---	---	---	---
