#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_ACHILLES_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
PLCH2	9651	broad.mit.edu	37	1	2429996	2429996	+	Silent	SNP	C	C	A	rs370514223		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:2429996C>A	ENST00000419816.2	+	17	2533	c.2259C>A	c.(2257-2259)ccC>ccA	p.P753P	PLCH2_ENST00000288766.5_Intron|PLCH2_ENST00000449969.1_Silent_p.P726P|PLCH2_ENST00000378488.3_Silent_p.P717P|PLCH2_ENST00000378486.3_Silent_p.P753P			O75038	PLCH2_HUMAN	phospholipase C, eta 2	753	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		ACCCCCTGCCCGGGCAGCTCA	0.687																																							uc001aji.1		NA																	0				central_nervous_system(3)|ovary(1)|skin(1)	5						c.(2257-2259)CCC>CCA		phospholipase C, eta 2							15.0	18.0	17.0					1																	2429996		1907	4107	6014	SO:0001819	synonymous_variant	9651				intracellular signal transduction|lipid catabolic process	cytoplasm|plasma membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr1:2429996C>A	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.2259C>A	1.37:g.2429996C>A						PLCH2_uc010nyz.1_Silent_p.P541P|PLCH2_uc009vle.1_Silent_p.P505P|PLCH2_uc001ajj.1_Silent_p.P541P|PLCH2_uc001ajk.1_Silent_p.P541P|PLCH2_uc001ajl.1_5'Flank	p.P753P	NM_014638	NP_055453	O75038	PLCH2_HUMAN		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)	17	2533	+	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)	753			C2.		A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Silent	SNP	ENST00000419816.2	37	c.2259C>A		.	.	.	.	.	.	.	.	.	.	C	10.99	1.508561	0.27036	.	.	ENSG00000149527	ENST00000419816	.	.	.	4.84	-9.68	0.00528	.	0.054667	0.85682	D	0.000000	T	0.49133	0.1539	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60576	-0.7236	6	0.87932	D	0	.	3.6713	0.08275	0.1498:0.1064:0.1592:0.5846	.	.	.	.	Q	48	.	ENSP00000389803:P48Q	P	+	2	0	PLCH2	2419856	0.000000	0.05858	0.831000	0.32960	0.982000	0.71751	-6.217000	0.00075	-1.688000	0.01435	-0.258000	0.10820	CCG		0.687	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638		5	13	1	0	1.23904e-05	0.000602	1.47252e-05	5	13				
KLHDC7A	127707	broad.mit.edu	37	1	18809454	18809454	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:18809454G>T	ENST00000400664.1	+	1	2031	c.1979G>T	c.(1978-1980)gGc>gTc	p.G660V		NM_152375.2	NP_689588.2	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	660						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TGGTGGGCCGGCCCCACCGGG	0.677																																							uc001bax.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)	3						c.(1978-1980)GGC>GTC		kelch domain containing 7A							24.0	27.0	26.0					1																	18809454		2202	4298	6500	SO:0001583	missense	127707					integral to membrane		g.chr1:18809454G>T	AK096072	CCDS185.2	1p36.13	2008-02-05			ENSG00000179023	ENSG00000179023			26791	protein-coding gene	gene with protein product							Standard	NM_152375		Approved	FLJ38753	uc001bax.3	Q5VTJ3	OTTHUMG00000002431	ENST00000400664.1:c.1979G>T	1.37:g.18809454G>T	ENSP00000383505:p.Gly660Val					KLHDC7A_uc009vpg.2_Missense_Mutation_p.G442V	p.G660V	NM_152375	NP_689588	Q5VTJ3	KLD7A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	1	2031	+		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)	660			Kelch 5.		Q8N8W6	Missense_Mutation	SNP	ENST00000400664.1	37	c.1979G>T	CCDS185.2	.	.	.	.	.	.	.	.	.	.	G	10.59	1.394191	0.25205	.	.	ENSG00000179023	ENST00000400664;ENST00000540290	T	0.15256	2.44	4.68	2.76	0.32466	Kelch-type beta propeller (1);	0.459886	0.22576	N	0.058279	T	0.11452	0.0279	L	0.36672	1.1	0.47407	D	0.99941	B;B	0.33135	0.399;0.399	B;B	0.32533	0.147;0.147	T	0.12785	-1.0534	10	0.15066	T	0.55	.	8.324	0.32145	0.0886:0.1593:0.7521:0.0	.	597;660	A7E2V3;Q5VTJ3	.;KLD7A_HUMAN	V	660;597	ENSP00000383505:G660V	ENSP00000383505:G660V	G	+	2	0	KLHDC7A	18682041	0.994000	0.37717	0.999000	0.59377	0.863000	0.49368	5.678000	0.68153	0.924000	0.37069	0.561000	0.74099	GGC		0.677	KLHDC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006923.3	NM_152375		8	46	1	0	1.06961e-07	0.00308	1.44047e-07	8	46				
EPHA10	284656	broad.mit.edu	37	1	38227387	38227387	+	Silent	SNP	G	G	T	rs143929786		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:38227387G>T	ENST00000373048.4	-	3	539	c.540C>A	c.(538-540)atC>atA	p.I180I	EPHA10_ENST00000427468.2_Silent_p.I180I|EPHA10_ENST00000319637.6_Silent_p.I180I	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	180	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TGAGCGGTCCGATCTCGCGCA	0.662																																							uc009vvi.2		NA																	0				breast(4)|stomach(3)|lung(1)	8						c.(538-540)ATC>ATA		EPH receptor A10 isofom 3							35.0	43.0	40.0					1																	38227387		2196	4298	6494	SO:0001819	synonymous_variant	284656					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity	g.chr1:38227387G>T	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.540C>A	1.37:g.38227387G>T						EPHA10_uc001cbw.3_Silent_p.I180I	p.I180I	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN			3	626	-	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)	180			Extracellular (Potential).		A4FU89|J3KPB5|Q6NW42	Silent	SNP	ENST00000373048.4	37	c.540C>A	CCDS41305.1																																																																																				0.662	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641		14	70	1	0	3.27435e-08	0.00245	4.48551e-08	14	70				
ERI3	79033	broad.mit.edu	37	1	44750540	44750540	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:44750540C>T	ENST00000372257.2	-	7	979	c.798G>A	c.(796-798)gcG>gcA	p.A266A	ERI3_ENST00000537474.1_Silent_p.A89A|ERI3_ENST00000372259.5_Silent_p.A151A|ERI3_ENST00000495828.1_5'UTR	NM_024066.1	NP_076971.1	O43414	ERI3_HUMAN	ERI1 exoribonuclease family member 3	266	Exonuclease.						exonuclease activity (GO:0004527)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TGAAGTAATCCGCCACTGGCA	0.522																																							uc001clt.2		NA																	0				ovary(2)|large_intestine(1)	3						c.(796-798)GCG>GCA		prion protein interacting protein							77.0	76.0	76.0					1																	44750540		2203	4300	6503	SO:0001819	synonymous_variant	79033					intracellular	exonuclease activity|metal ion binding|nucleic acid binding	g.chr1:44750540C>T	AF007157	CCDS30696.1	1p34.1	2009-10-07	2009-10-07	2008-12-16	ENSG00000117419	ENSG00000117419		"""Enhanced RNAi three prime mRNA exonucleases"""	17276	protein-coding gene	gene with protein product	"""enhanced RNAi three prime mRNA exonuclease homolog 3 (C.elegans)"", ""exoribonuclease 3"""	609917	"""prion protein interacting protein"""	PRNPIP			Standard	XM_005271184		Approved	FLJ22943, PINT1	uc001clt.3	O43414	OTTHUMG00000007637	ENST00000372257.2:c.798G>A	1.37:g.44750540C>T						ERI3_uc010okv.1_Silent_p.A89A|ERI3_uc009vxg.2_Silent_p.A266A|ERI3_uc010okw.1_Silent_p.A188A|ERI3_uc001clu.2_Silent_p.A188A	p.A266A	NM_024066	NP_076971	O43414	ERI3_HUMAN			7	1039	-			266			Exonuclease.		B1AK98|Q5T2T7|Q5T2T9|Q5TG35|Q9BQA0|Q9UEB4	Silent	SNP	ENST00000372257.2	37	c.798G>A	CCDS30696.1																																																																																				0.522	ERI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020243.1	NM_024066		10	52	0	0	0	0.006214	0	10	52				
FAM159A	348378	broad.mit.edu	37	1	53122519	53122519	+	Missense_Mutation	SNP	T	T	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:53122519T>G	ENST00000517870.1	+	3	530	c.380T>G	c.(379-381)gTg>gGg	p.V127G	FAM159A_ENST00000401050.3_Intron	NM_001042693.1	NP_001036158.1	Q6UWV7	F159A_HUMAN	family with sequence similarity 159, member A	127						integral component of membrane (GO:0016021)				endometrium(3)|lung(6)|upper_aerodigestive_tract(1)	10						GCGGCAGAAGTGCCAAAAGTG	0.567																																							uc001cuf.2		NA																	0					0						c.(379-381)GTG>GGG		hypothetical protein LOC348378							72.0	78.0	76.0					1																	53122519		2015	4191	6206	SO:0001583	missense	348378					integral to membrane		g.chr1:53122519T>G		CCDS41336.1	1p32.3	2008-08-08			ENSG00000182183	ENSG00000182183			28757	protein-coding gene	gene with protein product						12477932	Standard	NM_001042693		Approved	MGC52498	uc001cuf.3	Q6UWV7	OTTHUMG00000008330	ENST00000517870.1:c.380T>G	1.37:g.53122519T>G	ENSP00000429726:p.Val127Gly					FAM159A_uc001cug.1_Intron|FAM159A_uc001cuh.2_Intron	p.V127G	NM_001042693	NP_001036158	Q6UWV7	F159A_HUMAN			3	480	+			127					Q6ZRG4	Missense_Mutation	SNP	ENST00000517870.1	37	c.380T>G	CCDS41336.1	.	.	.	.	.	.	.	.	.	.	T	10.12	1.261906	0.23051	.	.	ENSG00000182183	ENST00000517870	.	.	.	3.3	0.982	0.19762	.	.	.	.	.	T	0.19366	0.0465	L	0.29908	0.895	0.09310	N	0.999999	P	0.46512	0.879	B	0.40101	0.319	T	0.11591	-1.0581	8	0.59425	D	0.04	.	4.8712	0.13633	0.0:0.2671:0.0:0.7329	.	127	Q6UWV7	F159A_HUMAN	G	127	.	ENSP00000429726:V127G	V	+	2	0	FAM159A	52895107	0.970000	0.33590	0.007000	0.13788	0.002000	0.02628	0.853000	0.27777	0.199000	0.20427	-0.371000	0.07208	GTG		0.567	FAM159A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022934.2	NM_001042693		24	109	0	0	0	0.014323	0	24	109				
ACOT11	26027	broad.mit.edu	37	1	55060276	55060276	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:55060276G>A	ENST00000371316.3	+	6	601	c.519G>A	c.(517-519)gaG>gaA	p.E173E	ACOT11_ENST00000343744.2_Silent_p.E173E|ACOT11_ENST00000481208.1_3'UTR	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11	173					fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						AGAAGATGGAGCACAGTGTGG	0.622																																					Ovarian(148;1440 1861 22015 32453 51933)	Ovarian(148;1440 1861 22015 32453 51933)	uc001cxm.1		NA																	0				central_nervous_system(1)	1						c.(517-519)GAG>GAA		thioesterase, adipose associated isoform BFIT1							47.0	45.0	46.0					1																	55060276		2203	4300	6503	SO:0001819	synonymous_variant	26027				fatty acid metabolic process|intracellular signal transduction|response to cold		acyl-CoA thioesterase activity|carboxylesterase activity	g.chr1:55060276G>A	AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.519G>A	1.37:g.55060276G>A						ACOT11_uc001cxj.1_Silent_p.E51E|ACOT11_uc001cxk.2_Silent_p.E139E|ACOT11_uc001cxl.1_Silent_p.E173E	p.E173E	NM_015547	NP_056362	Q8WXI4	ACO11_HUMAN			6	601	+			173					B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	Silent	SNP	ENST00000371316.3	37	c.519G>A	CCDS592.1																																																																																				0.622	ACOT11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027356.1	NM_015547		7	34	0	0	0	0.00308	0	7	34				
SRSF11	9295	broad.mit.edu	37	1	70715696	70715696	+	Missense_Mutation	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:70715696A>G	ENST00000370950.3	+	11	1166	c.1084A>G	c.(1084-1086)Aaa>Gaa	p.K362E	SRSF11_ENST00000484162.1_3'UTR|SRSF11_ENST00000370949.1_Missense_Mutation_p.K302E|SRSF11_ENST00000370951.1_Missense_Mutation_p.K362E|SRSF11_ENST00000405432.1_Missense_Mutation_p.K362E			Q05519	SRS11_HUMAN	serine/arginine-rich splicing factor 11	362					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(3)|ovary(2)|skin(1)	6						TCGGTCTCCTAAAAGAAAATT	0.368																																							uc001des.2		NA																	0					0						c.(1084-1086)AAA>GAA		splicing factor, arginine/serine-rich 11							82.0	88.0	86.0					1																	70715696		2203	4300	6503	SO:0001583	missense	9295				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding	g.chr1:70715696A>G	M74002	CCDS647.1, CCDS53332.1	1p31.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000116754	ENSG00000116754		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10782	protein-coding gene	gene with protein product	"""SR splicing factor 11"""	602010	"""splicing factor, arginine/serine-rich 11"""	SFRS11		1896467, 20516191	Standard	NM_004768		Approved	p54, NET2	uc001des.3	Q05519	OTTHUMG00000009342	ENST00000370950.3:c.1084A>G	1.37:g.70715696A>G	ENSP00000359988:p.Lys362Glu					SFRS11_uc001det.2_Missense_Mutation_p.K362E|SFRS11_uc001deu.2_Missense_Mutation_p.K369E|SFRS11_uc001dev.2_Missense_Mutation_p.K172E|SFRS11_uc001dew.2_Missense_Mutation_p.K302E	p.K362E	NM_004768	NP_004759	Q05519	SRS11_HUMAN			11	1208	+			362					Q5T758|Q8IWE6	Missense_Mutation	SNP	ENST00000370950.3	37	c.1084A>G	CCDS647.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.022332	0.75275	.	.	ENSG00000116754	ENST00000370951;ENST00000370950;ENST00000405432;ENST00000395136;ENST00000370949	D;D;D;T;T	0.83992	-1.72;-1.79;-1.79;-0.28;-0.48	5.45	5.45	0.79879	.	0.046409	0.85682	D	0.000000	D	0.84593	0.5506	M	0.74881	2.28	0.80722	D	1	D;P;P;P	0.58268	0.982;0.787;0.787;0.787	P;B;B;B	0.52554	0.702;0.351;0.351;0.351	D	0.86458	0.1777	10	0.56958	D	0.05	.	15.4776	0.75497	1.0:0.0:0.0:0.0	.	302;369;362;362	Q5T757;Q6PJB9;Q8IWE6;Q05519	.;.;.;SRS11_HUMAN	E	362;362;362;369;302	ENSP00000359989:K362E;ENSP00000359988:K362E;ENSP00000384357:K362E;ENSP00000378568:K369E;ENSP00000359987:K302E	ENSP00000359987:K302E	K	+	1	0	SRSF11	70488284	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.765000	0.85310	2.204000	0.70986	0.533000	0.62120	AAA		0.368	SRSF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025889.1	NM_004768		11	52	0	0	0	0.010729	0	11	52				
CLCA4	22802	broad.mit.edu	37	1	87043639	87043639	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:87043639C>A	ENST00000370563.3	+	12	2048	c.2006C>A	c.(2005-2007)aCa>aAa	p.T669K	RP4-651E10.4_ENST00000456587.1_RNA	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	669					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		ACAGCATATACAGAAAATGGC	0.403																																							uc009wcs.2		NA																	0				ovary(2)	2						c.(2005-2007)ACA>AAA		chloride channel accessory 4							51.0	49.0	49.0					1																	87043639		1836	4092	5928	SO:0001583	missense	22802					apical plasma membrane|extracellular region|integral to plasma membrane	chloride channel activity	g.chr1:87043639C>A	AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.2006C>A	1.37:g.87043639C>A	ENSP00000359594:p.Thr669Lys					CLCA4_uc009wct.2_Missense_Mutation_p.T432K|CLCA4_uc009wcu.2_Missense_Mutation_p.T489K	p.T669K	NM_012128	NP_036260	Q14CN2	CLCA4_HUMAN		all cancers(265;0.0202)|Epithelial(280;0.0404)	12	2050	+		Lung NSC(277;0.238)	669					A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Missense_Mutation	SNP	ENST00000370563.3	37	c.2006C>A	CCDS41355.1	.	.	.	.	.	.	.	.	.	.	C	1.188	-0.636079	0.03557	.	.	ENSG00000016602	ENST00000370563	T	0.02944	4.1	5.25	0.731	0.18277	.	1.046830	0.07483	N	0.904329	T	0.00496	0.0016	N	0.10972	0.075	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.39251	-0.9623	10	0.05833	T	0.94	-6.229	11.0984	0.48160	0.6628:0.2315:0.1057:0.0	.	221;669	Q9NXP1;Q14CN2	.;CLCA4_HUMAN	K	669	ENSP00000359594:T669K	ENSP00000359594:T669K	T	+	2	0	CLCA4	86816227	0.000000	0.05858	0.057000	0.19452	0.890000	0.51754	-0.891000	0.04135	0.359000	0.24239	0.655000	0.94253	ACA		0.403	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128		8	34	1	0	5.18039e-06	0.00308	6.34598e-06	8	34				
TGFBR3	7049	broad.mit.edu	37	1	92161256	92161256	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:92161256C>A	ENST00000525962.1	-	15	2471	c.2410G>T	c.(2410-2412)Gcc>Tcc	p.A804S	TGFBR3_ENST00000370399.2_Missense_Mutation_p.A803S|TGFBR3_ENST00000212355.4_Missense_Mutation_p.A804S			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	804					blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		TACCACAAGGCCCCCGTCAGG	0.483																																							uc001doh.2		NA																	0				ovary(3)	3						c.(2410-2412)GCC>TCC		transforming growth factor, beta receptor III							142.0	121.0	128.0					1																	92161256		2203	4300	6503	SO:0001583	missense	7049				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding	g.chr1:92161256C>A	L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.2410G>T	1.37:g.92161256C>A	ENSP00000436127:p.Ala804Ser					TGFBR3_uc009wde.2_Missense_Mutation_p.A499S|TGFBR3_uc010osy.1_Missense_Mutation_p.A762S|TGFBR3_uc001doi.2_Missense_Mutation_p.A803S|TGFBR3_uc001doj.2_Missense_Mutation_p.A803S	p.A804S	NM_003243	NP_003234	Q03167	TGBR3_HUMAN		all cancers(265;0.0108)|Epithelial(280;0.0825)	16	2876	-		all_lung(203;0.00719)|Lung NSC(277;0.0268)	804			Helical; (Potential).		A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Missense_Mutation	SNP	ENST00000525962.1	37	c.2410G>T	CCDS30770.1	.	.	.	.	.	.	.	.	.	.	C	34	5.405359	0.96051	.	.	ENSG00000069702	ENST00000212355;ENST00000370399;ENST00000525962;ENST00000465892	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.63803	0.2542	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.975;0.996;0.998	T	0.65878	-0.6061	10	0.66056	D	0.02	-21.6088	19.397	0.94611	0.0:1.0:0.0:0.0	.	804;803;804	A8K5N0;Q03167-2;Q03167	.;.;TGBR3_HUMAN	S	804;803;804;803	ENSP00000212355:A804S;ENSP00000359426:A803S;ENSP00000436127:A804S;ENSP00000432638:A803S	ENSP00000212355:A804S	A	-	1	0	TGFBR3	91933844	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.129000	0.77225	2.585000	0.87301	0.563000	0.77884	GCC		0.483	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382308.1	NM_003243		8	104	1	0	1.12685e-05	0.004482	1.3442e-05	8	104				
EVI5	7813	broad.mit.edu	37	1	93170268	93170268	+	Silent	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:93170268A>G	ENST00000370331.1	-	3	324	c.315T>C	c.(313-315)tcT>tcC	p.S105S	EVI5_ENST00000543509.1_Silent_p.S105S|EVI5_ENST00000540033.1_Silent_p.S105S	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	105	Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.|Ser-rich.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		ACCCATTTACAGATCTTAAAG	0.368																																							uc001dox.2		NA																	0				ovary(1)|breast(1)	2						c.(313-315)TCT>TCC		ecotropic viral integration site 5							104.0	105.0	105.0					1																	93170268		2203	4300	6503	SO:0001819	synonymous_variant	7813				cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity	g.chr1:93170268A>G	AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.315T>C	1.37:g.93170268A>G						EVI5_uc010otf.1_Silent_p.S105S	p.S105S	NM_005665	NP_005656	O60447	EVI5_HUMAN		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)	3	325	-		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)	105			Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.|Ser-rich.		A6NKX8|B9A6J0|Q9H1Y9	Silent	SNP	ENST00000370331.1	37	c.315T>C	CCDS30774.1																																																																																				0.368	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030047.1	NM_005665		3	67	0	0	0	0.004672	0	3	67				
COL11A1	1301	broad.mit.edu	37	1	103427822	103427822	+	Splice_Site	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:103427822C>A	ENST00000370096.3	-	40	3337		c.e40-1		COL11A1_ENST00000512756.1_Splice_Site|COL11A1_ENST00000358392.2_Splice_Site|COL11A1_ENST00000353414.4_Splice_Site	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1						cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CTGGATCACCCTAAAGAATAT	0.388																																							uc001dul.2		NA																	0				ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.e40-1		alpha 1 type XI collagen isoform A							70.0	72.0	71.0					1																	103427822		2203	4300	6503	SO:0001630	splice_region_variant	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103427822C>A	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3025-1G>T	1.37:g.103427822C>A						COL11A1_uc001duk.2_Splice_Site_p.G205_splice|COL11A1_uc001dum.2_Splice_Site_p.G1021_splice|COL11A1_uc001dun.2_Splice_Site_p.G970_splice|COL11A1_uc009weh.2_Splice_Site_p.G893_splice	p.G1009_splice	NM_001854	NP_001845	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	40	3343	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)						B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Splice_Site	SNP	ENST00000370096.3	37	c.3025_splice	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	18.70	3.679433	0.68042	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	.	.	.	5.37	4.46	0.54185	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.91	0.63860	0.0:0.9265:0.0:0.0735	.	.	.	.	.	-1	.	.	.	-	.	.	COL11A1	103200410	1.000000	0.71417	0.996000	0.52242	0.962000	0.63368	7.425000	0.80255	1.259000	0.44117	0.557000	0.71058	.		0.388	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	Intron	14	65	1	0	7.93312e-07	0.00245	1.01678e-06	14	65				
COL11A1	1301	broad.mit.edu	37	1	103544311	103544311	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:103544311C>A	ENST00000370096.3	-	3	703	c.391G>T	c.(391-393)Gtt>Ttt	p.V131F	COL11A1_ENST00000512756.1_Missense_Mutation_p.V131F|COL11A1_ENST00000358392.2_Missense_Mutation_p.V131F|COL11A1_ENST00000353414.4_Missense_Mutation_p.V131F	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	131	Laminin G-like.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GATCTCCCAACCTCAACACCA	0.383																																							uc001dul.2		NA																	0				ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12						c.(391-393)GTT>TTT		alpha 1 type XI collagen isoform A							80.0	83.0	82.0					1																	103544311		2203	4300	6503	SO:0001583	missense	1301				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging	g.chr1:103544311C>A	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.391G>T	1.37:g.103544311C>A	ENSP00000359114:p.Val131Phe					COL11A1_uc001dum.2_Missense_Mutation_p.V131F|COL11A1_uc001dun.2_Missense_Mutation_p.V131F|COL11A1_uc009weh.2_Missense_Mutation_p.V131F	p.V131F	NM_001854	NP_001845	P12107	COBA1_HUMAN		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)	3	709	-		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)	131			TSP N-terminal.		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	c.391G>T	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	18.29	3.591093	0.66219	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239;ENST00000447608	T;T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12;-1.12	5.53	5.53	0.82687	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	T	0.80243	0.4587	M	0.69185	2.1	0.80722	D	1	P;D;D;D	0.56746	0.942;0.959;0.977;0.967	P;P;P;P	0.57720	0.771;0.734;0.734;0.826	T	0.81693	-0.0817	10	0.54805	T	0.06	.	12.757	0.57341	0.0:0.9251:0.0:0.0749	.	131;131;131;131	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	F	131;131;131;131;131;58	ENSP00000359114:V131F;ENSP00000351163:V131F;ENSP00000302551:V131F;ENSP00000426533:V131F;ENSP00000408640:V131F;ENSP00000410177:V58F	ENSP00000302551:V131F	V	-	1	0	COL11A1	103316899	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.317000	0.51968	2.607000	0.88179	0.655000	0.94253	GTT		0.383	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630		8	41	1	0	5.18039e-06	0.00308	6.34598e-06	8	41				
RBM15	64783	broad.mit.edu	37	1	110883214	110883214	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:110883214G>T	ENST00000369784.3	+	1	2087	c.1187G>T	c.(1186-1188)cGc>cTc	p.R396L	RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000602849.1_Missense_Mutation_p.R396L|RBM15_ENST00000487146.2_Missense_Mutation_p.R396L	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	396	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		GCGTTTGATCGCTTTGGAGTC	0.478			T	MKL1	acute megakaryocytic leukemia																																		uc001dzl.1		NA		Dom	yes		1	1p13	64783	T	RNA binding motif protein 15			L	MKL1		acute megakaryocytic leukemia		0				ovary(3)	3						c.(1186-1188)CGC>CTC		RNA binding motif protein 15							57.0	59.0	58.0					1																	110883214		2203	4300	6503	SO:0001583	missense	64783				interspecies interaction between organisms	nucleus	nucleotide binding|protein binding|RNA binding	g.chr1:110883214G>T	AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.1187G>T	1.37:g.110883214G>T	ENSP00000358799:p.Arg396Leu					RBM15_uc001dzm.1_Missense_Mutation_p.R396L|uc001dzj.2_5'Flank	p.R396L	NM_022768	NP_073605	Q96T37	RBM15_HUMAN		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)	1	1270	+		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)	396			RRM 2.		A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Missense_Mutation	SNP	ENST00000369784.3	37	c.1187G>T	CCDS822.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.180947	0.78677	.	.	ENSG00000162775	ENST00000369784	T	0.16196	2.36	4.69	4.69	0.59074	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.44483	D	0.000450	T	0.34948	0.0915	M	0.72353	2.195	0.80722	D	1	P;D	0.89917	0.65;1.0	P;D	0.85130	0.552;0.997	T	0.18116	-1.0347	10	0.72032	D	0.01	-6.4088	17.7957	0.88570	0.0:0.0:1.0:0.0	.	396;396	Q96T37-3;Q96T37	.;RBM15_HUMAN	L	396	ENSP00000358799:R396L	ENSP00000358799:R396L	R	+	2	0	RBM15	110684737	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.242000	0.72376	2.446000	0.82766	0.655000	0.94253	CGC		0.478	RBM15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000031114.2	NM_022768		13	54	1	0	9.05144e-12	0.001855	1.40972e-11	13	54				
HIPK1	204851	broad.mit.edu	37	1	114515660	114515660	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:114515660G>T	ENST00000369558.1	+	16	3391	c.3159G>T	c.(3157-3159)tcG>tcT	p.S1053S	HIPK1_ENST00000406344.1_Silent_p.S659S|HIPK1_ENST00000369555.2_Silent_p.S1008S|HIPK1_ENST00000369554.2_Silent_p.S1008S|HIPK1_ENST00000340480.4_Silent_p.S679S|HIPK1_ENST00000369553.1_Silent_p.S659S|HIPK1_ENST00000369561.4_Silent_p.S1019S|HIPK1_ENST00000426820.2_Silent_p.S1053S			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	1053	Interaction with TP53.				anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGCAGTCATCGGCGGCTCCAA	0.587																																							uc001eem.2		NA																	0				ovary(4)	4						c.(3157-3159)TCG>TCT		homeodomain-interacting protein kinase 1 isoform							115.0	126.0	122.0					1																	114515660		2203	4300	6503	SO:0001819	synonymous_variant	204851				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	g.chr1:114515660G>T	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.3159G>T	1.37:g.114515660G>T						HIPK1_uc001een.2_Silent_p.S1053S|HIPK1_uc001eeo.2_Silent_p.S679S|HIPK1_uc001eep.2_Silent_p.S659S|HIPK1_uc001eeq.2_Silent_p.S345S	p.S1053S	NM_198268	NP_938009	Q86Z02	HIPK1_HUMAN		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)	16	3320	+	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)	1053			Interaction with TP53.		A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Silent	SNP	ENST00000369558.1	37	c.3159G>T	CCDS867.1	.	.	.	.	.	.	.	.	.	.	G	2.879	-0.232279	0.05983	.	.	ENSG00000163349	ENST00000361587	.	.	.	5.09	-10.1	0.00402	.	.	.	.	.	T	0.14614	0.0353	.	.	.	0.51482	D	0.999929	.	.	.	.	.	.	T	0.41233	-0.9520	4	.	.	.	.	0.7429	0.00977	0.3299:0.1246:0.1914:0.3541	.	.	.	.	C	334	.	.	G	+	1	0	HIPK1	114317183	0.004000	0.15560	0.348000	0.25681	0.919000	0.55068	-0.210000	0.09345	-2.086000	0.00863	-0.905000	0.02835	GGC		0.587	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268		43	219	1	0	3.61848e-18	0.007835	6.48686e-18	43	219				
GJA5	2702	broad.mit.edu	37	1	147231030	147231030	+	Missense_Mutation	SNP	C	C	T	rs367924086		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:147231030C>T	ENST00000271348.2	-	2	478	c.317G>A	c.(316-318)cGc>cAc	p.R106H	RP11-433J22.2_ENST00000428911.1_RNA|GJA5_ENST00000369237.1_Missense_Mutation_p.R106H	NM_005266.5	NP_005257.2	P36382	CXA5_HUMAN	gap junction protein, alpha 5, 40kDa	106					angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|atrial cardiac muscle cell action potential (GO:0086014)|atrial septum development (GO:0003283)|AV node cell to bundle of His cell communication by electrical coupling (GO:0086053)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|gap junction assembly (GO:0016264)|mitral valve development (GO:0003174)|outflow tract morphogenesis (GO:0003151)|pulmonary valve formation (GO:0003193)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|transmembrane transport (GO:0055085)|ventricular septum development (GO:0003281)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)	gap junction channel activity involved in AV node cell-bundle of His cell electrical coupling (GO:0086077)|gap junction channel activity involved in cardiac conduction electrical coupling (GO:0086075)|gap junction hemi-channel activity (GO:0055077)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	20	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			CCGTAGCTTGCGCTTCTCCTG	0.617																																							uc001eps.1		NA																	0				ovary(1)	1						c.(316-318)CGC>CAC		connexin 40							94.0	87.0	89.0					1																	147231030		2203	4300	6503	SO:0001583	missense	2702				angiogenesis|cell-cell junction assembly|muscle contraction	integral to membrane		g.chr1:147231030C>T		CCDS929.1	1q21.1	2008-02-05	2007-01-16		ENSG00000143140	ENSG00000265107		"""Ion channels / Gap junction proteins (connexins)"""	4279	protein-coding gene	gene with protein product	"""connexin 40"""	121013	"""gap junction protein, alpha 5, 40kD (connexin 40)"", ""gap junction protein, alpha 5, 40kDa (connexin 40)"""				Standard	NM_005266		Approved	CX40	uc001eps.1	P36382	OTTHUMG00000014020	ENST00000271348.2:c.317G>A	1.37:g.147231030C>T	ENSP00000271348:p.Arg106His					GJA5_uc001ept.1_Missense_Mutation_p.R106H	p.R106H	NM_181703	NP_859054	P36382	CXA5_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.202)		2	458	-	all_hematologic(923;0.0276)		106			Cytoplasmic (Potential).		Q5T3B6|Q5U0N6	Missense_Mutation	SNP	ENST00000271348.2	37	c.317G>A	CCDS929.1	.	.	.	.	.	.	.	.	.	.	C	9.656	1.142836	0.21205	.	.	ENSG00000143140	ENST00000271348;ENST00000369237;ENST00000430508	D;D;D	0.99089	-5.41;-5.41;-5.41	5.68	3.81	0.43845	Connexin, N-terminal (1);	0.327142	0.22572	N	0.058337	D	0.96642	0.8904	N	0.25201	0.72	0.43724	D	0.9962	D	0.62365	0.991	P	0.55055	0.767	D	0.95729	0.8773	10	0.51188	T	0.08	.	8.9637	0.35863	0.0:0.7734:0.0:0.2266	.	106	P36382	CXA5_HUMAN	H	106	ENSP00000271348:R106H;ENSP00000358240:R106H;ENSP00000407645:R106H	ENSP00000271348:R106H	R	-	2	0	GJA5	145697654	0.996000	0.38824	0.240000	0.24138	0.146000	0.21551	1.677000	0.37576	0.743000	0.32719	0.563000	0.77884	CGC		0.617	GJA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039422.2	NM_181703		25	155	0	0	0	0.00278	0	25	155				
PRUNE	58497	broad.mit.edu	37	1	151006393	151006393	+	Nonsense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:151006393A>T	ENST00000271620.3	+	8	1201	c.1045A>T	c.(1045-1047)Aag>Tag	p.K349*	PRUNE_ENST00000368934.1_Nonsense_Mutation_p.K114*|BNIPL_ENST00000295294.7_5'Flank|BNIPL_ENST00000368931.3_5'Flank|PRUNE_ENST00000271619.8_Nonsense_Mutation_p.K137*|PRUNE_ENST00000368937.1_Nonsense_Mutation_p.K114*|PRUNE_ENST00000368936.1_Nonsense_Mutation_p.K167*|PRUNE_ENST00000368935.1_Nonsense_Mutation_p.K64*	NM_021222.1	NP_067045.1	Q86TP1	PRUNE_HUMAN	prune exopolyphosphatase	349						cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGTCTCTCGAAAGAAACTTCT	0.557																																							uc001ewh.1		NA																	0				ovary(1)	1						c.(1045-1047)AAG>TAG		prune							128.0	122.0	124.0					1																	151006393		2203	4300	6503	SO:0001587	stop_gained	58497					cytoplasm|focal adhesion|nucleus	inorganic diphosphatase activity|manganese ion binding|protein binding	g.chr1:151006393A>T	U67085	CCDS977.1	1q21.2	2013-04-29	2013-04-29		ENSG00000143363	ENSG00000143363	3.6.1.11		13420	protein-coding gene	gene with protein product			"""prune homolog (Drosophila)"""			10602478, 11687967, 18700747	Standard	NM_021222		Approved	DRES-17, HTCD37	uc001ewh.1	Q86TP1	OTTHUMG00000035062	ENST00000271620.3:c.1045A>T	1.37:g.151006393A>T	ENSP00000271620:p.Lys349*					PRUNE_uc001ewi.1_Nonsense_Mutation_p.K167*|PRUNE_uc010pco.1_Nonsense_Mutation_p.K117*|PRUNE_uc001ewj.1_Nonsense_Mutation_p.K64*|PRUNE_uc001ewk.1_Nonsense_Mutation_p.K114*|BNIPL_uc009wmi.2_5'Flank|BNIPL_uc001ewl.2_5'Flank	p.K349*	NM_021222	NP_067045	Q86TP1	PRUNE_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)		8	1181	+	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		349					B2RCH8|B4DFL7|Q5SZF9|Q659E5|Q6P4E0|Q8N654|Q96JU5|Q9C071|Q9C072|Q9UIV0	Nonsense_Mutation	SNP	ENST00000271620.3	37	c.1045A>T	CCDS977.1	.	.	.	.	.	.	.	.	.	.	A	36	5.599820	0.96614	.	.	ENSG00000143363	ENST00000271620;ENST00000302413;ENST00000271619;ENST00000368937;ENST00000431193;ENST00000368936;ENST00000368935;ENST00000368934	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-20.9474	13.6027	0.62029	1.0:0.0:0.0:0.0	.	.	.	.	X	349;282;137;114;114;167;64;114	.	.	K	+	1	0	PRUNE	149273017	1.000000	0.71417	0.969000	0.41365	0.975000	0.68041	7.339000	0.79282	2.371000	0.80710	0.533000	0.62120	AAG		0.557	PRUNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084885.1	NM_021222		71	175	0	0	0	0.01441	0	71	175				
HRNR	388697	broad.mit.edu	37	1	152191370	152191370	+	Missense_Mutation	SNP	C	C	A	rs146160152	byFrequency	TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:152191370C>A	ENST00000368801.2	-	3	2810	c.2735G>T	c.(2734-2736)gGc>gTc	p.G912V	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	912					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCGACCGGAGCCAGACCCATG	0.642																																							uc001ezt.1		NA																	0				skin(2)|ovary(1)	3						c.(2734-2736)GGC>GTC		hornerin							123.0	136.0	131.0					1																	152191370		2203	4300	6503	SO:0001583	missense	388697				keratinization		calcium ion binding|protein binding	g.chr1:152191370C>A	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.2735G>T	1.37:g.152191370C>A	ENSP00000357791:p.Gly912Val						p.G912V	NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	2811	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		912			10.		Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	c.2735G>T	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	C	5.808	0.333318	0.11013	.	.	ENSG00000197915	ENST00000368801	T	0.01705	4.68	3.68	1.65	0.23941	.	.	.	.	.	T	0.00906	0.0030	L	0.50333	1.59	0.09310	N	0.999992	D	0.56968	0.978	P	0.50860	0.652	T	0.41840	-0.9486	9	0.11485	T	0.65	.	4.5109	0.11910	0.2181:0.6588:0.0:0.1232	.	912	Q86YZ3	HORN_HUMAN	V	912	ENSP00000357791:G912V	ENSP00000357791:G912V	G	-	2	0	HRNR	150457994	0.001000	0.12720	0.015000	0.15790	0.009000	0.06853	0.698000	0.25571	0.720000	0.32209	0.505000	0.49811	GGC		0.642	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		43	330	1	0	7.63091e-17	0.007835	1.34279e-16	43	330				
HRNR	388697	broad.mit.edu	37	1	152193475	152193475	+	Silent	SNP	A	A	G	rs372474699		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:152193475A>G	ENST00000368801.2	-	3	705	c.630T>C	c.(628-630)tcT>tcC	p.S210S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	210					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCCGGAGCCAGAGCCGTGTT	0.572																																							uc001ezt.1		NA																	0				skin(2)|ovary(1)	3						c.(628-630)TCT>TCC		hornerin							115.0	125.0	122.0					1																	152193475		2203	4300	6503	SO:0001819	synonymous_variant	388697				keratinization		calcium ion binding|protein binding	g.chr1:152193475A>G	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.630T>C	1.37:g.152193475A>G							p.S210S	NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	706	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		210			2.		Q5DT20|Q5U1F4	Silent	SNP	ENST00000368801.2	37	c.630T>C	CCDS30859.1																																																																																				0.572	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868		34	225	0	0	0	0.010818	0	34	225				
LCE1F	353137	broad.mit.edu	37	1	152749092	152749092	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:152749092G>T	ENST00000334371.2	+	1	245	c.245G>T	c.(244-246)cGg>cTg	p.R82L		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	82	Poly-Arg.				keratinization (GO:0031424)					kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CACCACAGACGGCGTAGGTCC	0.701																																							uc010pdv.1		NA																	0					0						c.(244-246)CGG>CTG		late cornified envelope 1F							22.0	26.0	25.0					1																	152749092		2202	4297	6499	SO:0001583	missense	353137				keratinization			g.chr1:152749092G>T		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.245G>T	1.37:g.152749092G>T	ENSP00000334187:p.Arg82Leu						p.R82L	NM_178354	NP_848131	Q5T754	LCE1F_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		1	245	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		82			Poly-Arg.			Missense_Mutation	SNP	ENST00000334371.2	37	c.245G>T	CCDS1023.1	.	.	.	.	.	.	.	.	.	.	G	6.837	0.523592	0.13066	.	.	ENSG00000240386	ENST00000334371	T	0.03553	3.89	4.3	-8.05	0.01106	.	.	.	.	.	T	0.00998	0.0033	L	0.40543	1.245	0.19945	N	0.999947	B	0.26195	0.144	B	0.22880	0.042	T	0.46652	-0.9176	9	0.87932	D	0	.	8.0187	0.30395	0.4199:0.4368:0.1433:0.0	.	82	Q5T754	LCE1F_HUMAN	L	82	ENSP00000334187:R82L	ENSP00000334187:R82L	R	+	2	0	LCE1F	151015716	0.000000	0.05858	0.569000	0.28460	0.410000	0.31052	-0.797000	0.04570	-1.572000	0.01661	-1.012000	0.02466	CGG		0.701	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354		8	78	1	0	0.000157383	0.00308	0.00017807	8	78				
FCRL1	115350	broad.mit.edu	37	1	157769856	157769856	+	Silent	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:157769856A>G	ENST00000368176.3	-	7	1090	c.1023T>C	c.(1021-1023)gaT>gaC	p.D341D	FCRL1_ENST00000358292.3_Silent_p.D302D|FCRL1_ENST00000491942.1_Silent_p.D341D|FCRL1_ENST00000489998.1_5'UTR	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	341						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			ACCTGAGTGGATCCCTGGCTG	0.388																																					GBM(54;482 1003 11223 30131 35730)	GBM(54;482 1003 11223 30131 35730)	uc001frg.2		NA																	0				skin(4)|ovary(3)	7						c.(1021-1023)GAT>GAC		Fc receptor-like 1 isoform 1 precursor							99.0	89.0	93.0					1																	157769856		2203	4300	6503	SO:0001819	synonymous_variant	115350					integral to membrane|plasma membrane	receptor activity	g.chr1:157769856A>G	BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.1023T>C	1.37:g.157769856A>G						FCRL1_uc001frf.2_RNA|FCRL1_uc001frh.2_Silent_p.D341D|FCRL1_uc001fri.2_Silent_p.D302D|FCRL1_uc001frj.2_RNA	p.D341D	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		7	1136	-	all_hematologic(112;0.0378)		341			Cytoplasmic (Potential).		B2RE05|Q8N759|Q8NDI0|Q96PJ6	Silent	SNP	ENST00000368176.3	37	c.1023T>C	CCDS1170.1																																																																																				0.388	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051401.1	NM_052938		9	37	0	0	0	0.008291	0	9	37				
OR10K2	391107	broad.mit.edu	37	1	158389873	158389873	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:158389873G>T	ENST00000314902.2	-	1	783	c.784C>A	c.(784-786)Cct>Act	p.P262T		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	262						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					TTGGACTGAGGCCTTAAGTAG	0.413																																							uc010pii.1		NA																	0				pancreas(1)	1						c.(784-786)CCT>ACT		olfactory receptor, family 10, subfamily K,							117.0	114.0	115.0					1																	158389873		2203	4300	6503	SO:0001583	missense	391107				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158389873G>T	AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.784C>A	1.37:g.158389873G>T	ENSP00000324251:p.Pro262Thr						p.P262T	NM_001004476	NP_001004476	Q6IF99	O10K2_HUMAN			1	784	-	all_hematologic(112;0.0378)		262			Extracellular (Potential).			Missense_Mutation	SNP	ENST00000314902.2	37	c.784C>A	CCDS30896.1	.	.	.	.	.	.	.	.	.	.	g	7.916	0.737446	0.15574	.	.	ENSG00000180708	ENST00000314902	T	0.00274	8.35	4.23	4.23	0.50019	GPCR, rhodopsin-like superfamily (1);	0.331817	0.21871	N	0.067893	T	0.00356	0.0011	M	0.93420	3.415	0.09310	N	1	P	0.45283	0.855	P	0.51582	0.674	T	0.12708	-1.0537	10	0.72032	D	0.01	.	15.8908	0.79296	0.0:0.0:1.0:0.0	.	262	Q6IF99	O10K2_HUMAN	T	262	ENSP00000324251:P262T	ENSP00000324251:P262T	P	-	1	0	OR10K2	156656497	0.921000	0.31238	0.021000	0.16686	0.050000	0.14768	3.116000	0.50399	2.332000	0.79248	0.591000	0.81541	CCT		0.413	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051854.1	NM_001004476		17	92	1	0	3.99206e-14	0.007413	6.60504e-14	17	92				
OR10R2	343406	broad.mit.edu	37	1	158449763	158449763	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:158449763C>A	ENST00000368152.1	+	1	96	c.96C>A	c.(94-96)ttC>ttA	p.F32L	RP11-144L1.4_ENST00000426251.1_RNA|RP11-144L1.4_ENST00000419738.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					TCACCGAATTCCTGTTGCTGG	0.413																																							uc010pik.1		NA																	0				pancreas(2)|skin(1)	3						c.(94-96)TTC>TTA		olfactory receptor, family 10, subfamily R,							169.0	165.0	167.0					1																	158449763		2203	4300	6503	SO:0001583	missense	343406				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:158449763C>A	AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.96C>A	1.37:g.158449763C>A	ENSP00000357134:p.Phe32Leu					uc001fso.1_RNA	p.F32L	NM_001004472	NP_001004472	Q8NGX6	O10R2_HUMAN			1	96	+	all_hematologic(112;0.0378)		32			Extracellular (Potential).		Q5VWM8|Q6IFS1|Q96R61	Missense_Mutation	SNP	ENST00000368152.1	37	c.96C>A	CCDS30898.1	.	.	.	.	.	.	.	.	.	.	c	13.14	2.147401	0.37923	.	.	ENSG00000198965	ENST00000368152	T	0.04454	3.62	4.18	2.31	0.28768	.	.	.	.	.	T	0.11196	0.0273	M	0.86502	2.82	0.22468	N	0.999076	D	0.89917	1.0	D	0.91635	0.999	T	0.06935	-1.0799	9	0.72032	D	0.01	.	7.576	0.27937	0.0:0.7115:0.0:0.2885	.	32	Q8NGX6	O10R2_HUMAN	L	32	ENSP00000357134:F32L	ENSP00000357134:F32L	F	+	3	2	OR10R2	156716387	0.000000	0.05858	0.682000	0.30024	0.396000	0.30629	-0.410000	0.07151	0.399000	0.25367	-0.225000	0.12378	TTC		0.413	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051847.2	NM_001004472		37	145	1	0	4.62619e-21	0.004289	8.49246e-21	37	145				
SPTA1	6708	broad.mit.edu	37	1	158627314	158627314	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:158627314G>T	ENST00000368147.4	-	19	2938	c.2758C>A	c.(2758-2760)Cct>Act	p.P920T		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	920					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCTACAATAGGTTCCTTCTCT	0.458																																							uc001fst.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(2758-2760)CCT>ACT		spectrin, alpha, erythrocytic 1							149.0	151.0	151.0					1																	158627314		1980	4166	6146	SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158627314G>T	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2758C>A	1.37:g.158627314G>T	ENSP00000357129:p.Pro920Thr						p.P920T	NM_003126	NP_003117	P02549	SPTA1_HUMAN			19	2957	-	all_hematologic(112;0.0378)		920			Spectrin 10.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	c.2758C>A	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.351515	0.82132	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.48201	0.82;0.82	4.68	4.68	0.58851	.	0.000000	0.31989	N	0.006747	T	0.60971	0.2310	M	0.83118	2.625	0.58432	D	0.999998	D	0.62365	0.991	D	0.74674	0.984	T	0.59161	-0.7506	10	0.16420	T	0.52	.	16.6727	0.85271	0.0:0.0:1.0:0.0	.	920	P02549	SPTA1_HUMAN	T	920	ENSP00000357130:P920T;ENSP00000357129:P920T	ENSP00000357129:P920T	P	-	1	0	SPTA1	156893938	1.000000	0.71417	0.969000	0.41365	0.985000	0.73830	8.424000	0.90267	2.569000	0.86673	0.655000	0.94253	CCT		0.458	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		27	153	1	0	4.72057e-08	0.003954	6.42522e-08	27	153				
SPTA1	6708	broad.mit.edu	37	1	158645987	158645988	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:158645987_158645988CC>AA	ENST00000368147.4	-	8	1235_1236	c.1055_1056GG>TT	c.(1054-1056)tGG>tTT	p.W352F		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	352					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GAATATGCTCCCAGCTGGAGAC	0.485																																							uc001fst.1		NA																	0				ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8						c.(1054-1056)TGG>TTT		spectrin, alpha, erythrocytic 1																																				SO:0001583	missense	6708				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton	g.chr1:158645987_158645988CC>AA	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1055_1056delinsAA	1.37:g.158645987_158645988delinsAA	ENSP00000357129:p.Trp352Phe						p.W352F	NM_003126	NP_003117	P02549	SPTA1_HUMAN			8	1254_1255	-	all_hematologic(112;0.0378)		352			Spectrin 4.		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	DNP	ENST00000368147.4	37	c.1055_1056GG>TT	CCDS41423.1																																																																																				0.485	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126		39	100	0	0	0	0.004672	0	39	100				
FCRLA	84824	broad.mit.edu	37	1	161683163	161683163	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:161683163C>T	ENST00000236938.6	+	5	1366	c.1124C>T	c.(1123-1125)gCt>gTt	p.A375V	FCRLA_ENST00000294796.4_Missense_Mutation_p.A224V|FCRLA_ENST00000546024.1_Missense_Mutation_p.A286V|FCRLA_ENST00000367953.3_Missense_Mutation_p.A364V|FCRLA_ENST00000350710.3_Missense_Mutation_p.A140V|FCRLA_ENST00000349527.4_Missense_Mutation_p.A263V|FCRLA_ENST00000540926.1_Missense_Mutation_p.A364V|FCRLA_ENST00000367957.2_Missense_Mutation_p.A235V|FCRLA_ENST00000309691.6_Missense_Mutation_p.A269V|FCRLA_ENST00000540521.1_Missense_Mutation_p.A241V|FCRLA_ENST00000367959.2_Missense_Mutation_p.A381V|FCRLA_ENST00000367949.2_Missense_Mutation_p.A191V|FCRLA_ENST00000470841.1_3'UTR|FCRLA_ENST00000367950.1_Missense_Mutation_p.A151V	NM_032738.3	NP_116127.3	Q7L513	FCRLA_HUMAN	Fc receptor-like A	358					cell differentiation (GO:0030154)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|kidney(12)|large_intestine(4)|lung(13)|prostate(1)|skin(2)|stomach(1)	34	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00301)			AAGGCTACTGCTGAATAGAAG	0.453																																							uc001gbe.2		NA																	0					0						c.(1141-1143)GCT>GTT		Fc receptor-like and mucin-like 1							58.0	54.0	55.0					1																	161683163		2203	4300	6503	SO:0001583	missense	84824				cell differentiation	cytoplasm|extracellular region		g.chr1:161683163C>T	AF531423	CCDS30926.1, CCDS53415.1, CCDS53416.1, CCDS53417.1, CCDS53418.1, CCDS53419.1, CCDS53420.1	1q23.3	2014-01-28	2006-09-26	2006-09-26	ENSG00000132185	ENSG00000132185		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18504	protein-coding gene	gene with protein product		606891	"""Fc receptor-like and mucin-like 1"""	FCRLM1		11754007	Standard	NM_001184866		Approved	MGC4595, FCRLc2, FCRLb, FCRLc1, FCRLd, FCRLe, FCRL, FCRLa, FREB, FCRLX	uc001gbe.3	Q7L513	OTTHUMG00000034537	ENST00000236938.6:c.1124C>T	1.37:g.161683163C>T	ENSP00000236938:p.Ala375Val					FCRLA_uc001gbd.2_Missense_Mutation_p.A375V|FCRLA_uc001gbf.2_Missense_Mutation_p.A286V|FCRLA_uc001gbg.2_Missense_Mutation_p.A235V|FCRLA_uc009wuo.2_Missense_Mutation_p.A241V|FCRLA_uc009wup.2_Missense_Mutation_p.A191V|FCRLA_uc009wuq.2_Missense_Mutation_p.A140V	p.A381V	NM_032738	NP_116127	Q7L513	FCRLA_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00301)		6	1384	+	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		358					A0N0M1|A6NC03|A6NL20|F5H720|F8W743|G3V1J2|Q5VXA1|Q5VXA2|Q5VXA3|Q5VXA4|Q5VXB0|Q5VXB1|Q8NEW4|Q8WXH3|Q96PC6|Q96PJ0|Q96PJ1|Q96PJ2|Q96PJ4|Q9BR57	Missense_Mutation	SNP	ENST00000236938.6	37	c.1142C>T	CCDS30926.1	.	.	.	.	.	.	.	.	.	.	C	15.63	2.890595	0.52014	.	.	ENSG00000132185	ENST00000236938;ENST00000367959;ENST00000546024;ENST00000540521;ENST00000367949;ENST00000350710;ENST00000540926;ENST00000367957;ENST00000349527;ENST00000309691;ENST00000294796;ENST00000367953;ENST00000367950	T;T;T;T;T;T;T;T;T;T;T;T;T	0.56776	5.31;5.29;4.31;4.04;0.45;0.44;5.36;3.87;3.48;4.38;4.12;5.36;0.52	4.37	-0.0948	0.13643	.	0.950145	0.08755	N	0.898599	T	0.34019	0.0883	N	0.22421	0.69	0.09310	N	1	B;D;D;D;D;B;D	0.76494	0.035;0.998;0.999;0.999;0.996;0.002;0.996	B;D;D;D;D;B;D	0.83275	0.025;0.987;0.996;0.991;0.99;0.003;0.944	T	0.11251	-1.0595	10	0.36615	T	0.2	.	3.1041	0.06336	0.2508:0.4438:0.0:0.3054	.	140;191;241;235;286;381;375	F8W743;A6NL20;F5H720;Q5VXB1;G3V1J2;A6NC03;Q7L513-9	.;.;.;.;.;.;.	V	375;381;286;241;191;140;364;235;263;269;224;364;151	ENSP00000236938:A375V;ENSP00000356936:A381V;ENSP00000439838:A286V;ENSP00000442870:A241V;ENSP00000356926:A191V;ENSP00000344808:A140V;ENSP00000446380:A364V;ENSP00000356934:A235V;ENSP00000294798:A263V;ENSP00000309596:A269V;ENSP00000294796:A224V;ENSP00000356930:A364V;ENSP00000356927:A151V	ENSP00000236938:A375V	A	+	2	0	FCRLA	159949787	0.004000	0.15560	0.000000	0.03702	0.092000	0.18411	0.209000	0.17435	-0.010000	0.14271	0.655000	0.94253	GCT		0.453	FCRLA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083574.1	NM_032738		8	74	0	0	0	0.004482	0	8	74				
DUSP12	11266	broad.mit.edu	37	1	161722885	161722885	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:161722885C>G	ENST00000367943.4	+	5	727	c.695C>G	c.(694-696)tCt>tGt	p.S232C		NM_007240.1	NP_009171.1	Q9UNI6	DUS12_HUMAN	dual specificity phosphatase 12	232					cellular protein modification process (GO:0006464)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of glucokinase activity (GO:0033133)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|lung(1)	5	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			TTTCGAAGTTCTAGTATTCTG	0.423																																							uc001gbo.2		NA																	0				breast(1)	1						c.(694-696)TCT>TGT		dual specificity phosphatase 12							171.0	158.0	162.0					1																	161722885		2203	4300	6503	SO:0001583	missense	11266				positive regulation of glucokinase activity	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity|zinc ion binding	g.chr1:161722885C>G	AF119226	CCDS1234.1	1q21-q22	2011-06-09			ENSG00000081721	ENSG00000081721		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3067	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""YVH1 protein-tyrosine phosphatase (S. cerevisiae) ortholog"""	604835				10446167	Standard	XM_005244862		Approved	YVH1, DUSP1	uc001gbo.3	Q9UNI6	OTTHUMG00000034540	ENST00000367943.4:c.695C>G	1.37:g.161722885C>G	ENSP00000356920:p.Ser232Cys					DUSP12_uc001gbp.2_Missense_Mutation_p.S102C	p.S232C	NM_007240	NP_009171	Q9UNI6	DUS12_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00634)		5	706	+	all_hematologic(112;0.0359)		232					Q5VXA8	Missense_Mutation	SNP	ENST00000367943.4	37	c.695C>G	CCDS1234.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.503405	0.85176	.	.	ENSG00000081721	ENST00000367943	T	0.04317	3.65	5.72	5.72	0.89469	Zinc finger, C2H2 (1);	0.176716	0.51477	D	0.000090	T	0.16300	0.0392	M	0.80332	2.49	0.47949	D	0.999550	D	0.89917	1.0	D	0.70227	0.968	T	0.00350	-1.1797	9	0.56958	D	0.05	.	17.365	0.87360	0.0:1.0:0.0:0.0	.	232	Q9UNI6	DUS12_HUMAN	C	232	ENSP00000356920:S232C	ENSP00000356920:S232C	S	+	2	0	DUSP12	159989509	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.585000	0.74062	2.689000	0.91719	0.591000	0.81541	TCT		0.423	DUSP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083588.1	NM_007240		43	110	0	0	0	0.009718	0	43	110				
UCK2	7371	broad.mit.edu	37	1	165859550	165859550	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:165859550C>T	ENST00000367879.4	+	2	512	c.209C>T	c.(208-210)tCg>tTg	p.S70L	UCK2_ENST00000372212.4_Missense_Mutation_p.S70L	NM_012474.4	NP_036606.2	Q9BZX2	UCK2_HUMAN	uridine-cytidine kinase 2	70					cellular response to oxygen levels (GO:0071453)|CTP salvage (GO:0044211)|feeding behavior (GO:0007631)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|response to axon injury (GO:0048678)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					GTCCTTACCTCGGAGCAGAAG	0.562																																							uc001gdp.2		NA																	0				ovary(1)	1						c.(208-210)TCG>TTG		uridine-cytidine kinase 2							96.0	83.0	88.0					1																	165859550		2203	4300	6503	SO:0001583	missense	7371				pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|phosphotransferase activity, alcohol group as acceptor|uridine kinase activity	g.chr1:165859550C>T	AF236637	CCDS1252.1	1p32	2012-10-02	2004-07-13	2004-07-14	ENSG00000143179	ENSG00000143179	2.7.1.48		12562	protein-coding gene	gene with protein product		609329	"""uridine monophosphate kinase"""	UMPK			Standard	NM_012474		Approved		uc001gdp.3	Q9BZX2	OTTHUMG00000040117	ENST00000367879.4:c.209C>T	1.37:g.165859550C>T	ENSP00000356853:p.Ser70Leu					UCK2_uc010plb.1_5'UTR	p.S70L	NM_012474	NP_036606	Q9BZX2	UCK2_HUMAN			2	390	+	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)		70					Q5VV91|Q7KZV3|Q92528|Q96KG5|Q9BU42	Missense_Mutation	SNP	ENST00000367879.4	37	c.209C>T	CCDS1252.1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.312876	0.23908	.	.	ENSG00000143179	ENST00000367879;ENST00000372212	.	.	.	5.76	3.69	0.42338	Phosphoribulokinase/uridine kinase (1);	0.391218	0.29660	N	0.011537	T	0.11153	0.0272	N	0.05259	-0.085	0.39583	D	0.969462	B	0.13145	0.007	B	0.08055	0.003	T	0.06075	-1.0847	8	0.52906	T	0.07	-0.012	7.8914	0.29680	0.0:0.7651:0.0:0.2348	.	70	Q9BZX2	UCK2_HUMAN	L	70	.	ENSP00000356853:S70L	S	+	2	0	UCK2	164126174	0.242000	0.23868	0.010000	0.14722	0.104000	0.19210	3.866000	0.56040	1.429000	0.47314	0.655000	0.94253	TCG		0.562	UCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096753.1	NM_012474		13	71	0	0	0	0.013537	0	13	71				
POU2F1	5451	broad.mit.edu	37	1	167381288	167381288	+	Missense_Mutation	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:167381288T>C	ENST00000541643.3	+	15	1741	c.1579T>C	c.(1579-1581)Tcc>Ccc	p.S527P	POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000367866.2_Missense_Mutation_p.S550P|POU2F1_ENST00000429375.2_Missense_Mutation_p.S487P|POU2F1_ENST00000420254.3_Missense_Mutation_p.S527P|POU2F1_ENST00000367862.5_Missense_Mutation_p.S539P			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	527					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						TCTGAGTCCCTCCCCTTCTGC	0.592																																							uc001gec.2		NA																	0				central_nervous_system(2)|skin(2)|breast(1)	5						c.(1579-1581)TCC>CCC		POU class 2 homeobox 1							91.0	78.0	82.0					1																	167381288		2203	4300	6503	SO:0001583	missense	5451				negative regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr1:167381288T>C	BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.1579T>C	1.37:g.167381288T>C	ENSP00000441285:p.Ser527Pro					POU2F1_uc001ged.2_Missense_Mutation_p.S525P|POU2F1_uc001gee.2_Missense_Mutation_p.S527P|POU2F1_uc010plh.1_Missense_Mutation_p.S464P|POU2F1_uc001gef.2_Missense_Mutation_p.S539P|POU2F1_uc001geg.2_Missense_Mutation_p.S425P|POU2F1_uc009wvg.1_RNA	p.S527P	NM_002697	NP_002688	P14859	PO2F1_HUMAN			15	1741	+			527					B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Missense_Mutation	SNP	ENST00000541643.3	37	c.1579T>C		.	.	.	.	.	.	.	.	.	.	T	16.91	3.252195	0.59212	.	.	ENSG00000143190	ENST00000367866;ENST00000429375;ENST00000367865;ENST00000420254;ENST00000541643;ENST00000367862;ENST00000443275	D;D;T;T;T;T;T	0.86562	-2.14;-2.11;0.93;0.93;0.93;0.93;0.93	5.5	5.5	0.81552	.	7739.210000	0.00166	N	0.000000	D	0.87014	0.6072	L	0.27053	0.805	0.44162	D	0.996967	D;D;D;D;D	0.69078	0.995;0.981;0.997;0.997;0.995	D;D;D;D;D	0.78314	0.969;0.959;0.986;0.991;0.969	T	0.76214	-0.3041	9	0.21540	T	0.41	.	15.9047	0.79419	0.0:0.0:0.0:1.0	.	487;527;539;525;527	B4E029;P14859-4;P14859-2;P14859-3;P14859	.;.;.;.;PO2F1_HUMAN	P	550;487;525;527;527;539;435	ENSP00000356840:S550P;ENSP00000401217:S487P;ENSP00000356839:S525P;ENSP00000414660:S527P;ENSP00000441285:S527P;ENSP00000356836:S539P;ENSP00000415993:S435P	ENSP00000356836:S539P	S	+	1	0	POU2F1	165647912	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	7.472000	0.80996	2.206000	0.71126	0.528000	0.53228	TCC		0.592	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_002697		3	65	0	0	0	0.004672	0	3	65				
PRRC2C	23215	broad.mit.edu	37	1	171504671	171504671	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:171504671G>A	ENST00000338920.4	+	13	2209	c.1972G>A	c.(1972-1974)Gct>Act	p.A658T	PRRC2C_ENST00000392078.3_Missense_Mutation_p.A660T|PRRC2C_ENST00000367742.3_Missense_Mutation_p.A660T|PRRC2C_ENST00000426496.2_Missense_Mutation_p.A658T	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	658					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										ACCTCGGCCGGCTGTATTATC	0.443																																							uc010pmg.1		NA																	0					0						c.(1972-1974)GCT>ACT		HBxAg transactivated protein 2							123.0	133.0	130.0					1																	171504671		2203	4300	6503	SO:0001583	missense	23215						protein C-terminus binding	g.chr1:171504671G>A	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.1972G>A	1.37:g.171504671G>A	ENSP00000343629:p.Ala658Thr						p.A658T	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN			13	2238	+			658					Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	37	c.1972G>A	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	G	15.81	2.943407	0.53079	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080;ENST00000483654	T;T;T;T	0.09538	2.97;2.97;2.97;2.97	5.29	5.29	0.74685	.	0.188317	0.26048	N	0.026658	T	0.11793	0.0287	L	0.53249	1.67	0.39400	D	0.966575	P	0.49559	0.925	P	0.47162	0.54	T	0.01684	-1.1296	10	0.54805	T	0.06	.	18.9371	0.92590	0.0:0.0:1.0:0.0	.	658	Q9Y520-4	.	T	660;659;658;660;658;415;417	ENSP00000375928:A660T;ENSP00000410219:A658T;ENSP00000356716:A660T;ENSP00000343629:A658T	ENSP00000343629:A658T	A	+	1	0	PRRC2C	169771295	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	3.613000	0.54152	2.459000	0.83118	0.655000	0.94253	GCT		0.443	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172		25	151	0	0	0	0.004656	0	25	151				
RFWD2	64326	broad.mit.edu	37	1	176153798	176153798	+	Silent	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:176153798T>C	ENST00000367669.3	-	2	952	c.438A>G	c.(436-438)gcA>gcG	p.A146A	RFWD2_ENST00000308769.8_Silent_p.A146A	NM_022457.5	NP_071902.2	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2, E3 ubiquitin protein ligase	146					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin protein ligase activity (GO:0061630)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						TTGTCATGTATGCTTCTTCAA	0.279																																					Ovarian(134;1413 1765 5706 35534 51541)	Ovarian(134;1413 1765 5706 35534 51541)	uc001gku.1		NA																	0					0						c.(436-438)GCA>GCG		ring finger and WD repeat domain 2 isoform a							107.0	118.0	114.0					1																	176153798		2200	4296	6496	SO:0001819	synonymous_variant	64326				DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest	centrosome|cytosol|focal adhesion|nuclear speck	protein binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr1:176153798T>C	AK001278	CCDS30944.1, CCDS44279.1	1q25.1-q25.2	2013-01-09	2012-02-23		ENSG00000143207	ENSG00000143207		"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	17440	protein-coding gene	gene with protein product		608067	"""ring finger and WD repeat domain 2"""			10395541	Standard	XM_005245447		Approved	FLJ10416, COP1, RNF200	uc001gku.1	Q8NHY2	OTTHUMG00000034986	ENST00000367669.3:c.438A>G	1.37:g.176153798T>C						RFWD2_uc001gkv.1_Silent_p.A146A|RFWD2_uc001gkw.1_5'UTR|RFWD2_uc001gkt.1_Silent_p.A5A	p.A146A	NM_022457	NP_071902	Q8NHY2	RFWD2_HUMAN			2	694	-			146			RING-type.		E9PKI0|Q504W6|Q6H103|Q9H6L7|X5D9B4	Silent	SNP	ENST00000367669.3	37	c.438A>G	CCDS30944.1																																																																																				0.279	RFWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084672.2	NM_022457		28	146	0	0	0	0.009535	0	28	146				
PRG4	10216	broad.mit.edu	37	1	186275895	186275895	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:186275895G>A	ENST00000445192.2	+	7	1089	c.1044G>A	c.(1042-1044)aaG>aaA	p.K348K	PRG4_ENST00000367484.3_Silent_p.K307K|PRG4_ENST00000367485.4_Silent_p.K255K|PRG4_ENST00000367486.3_Silent_p.K305K|PRG4_ENST00000367483.4_Silent_p.K307K	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	348	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CCACTCCCAAGGAGCCCACGC	0.547																																							uc001gru.3		NA																	0				skin(1)	1						c.(1042-1044)AAG>AAA		proteoglycan 4 isoform A							140.0	147.0	144.0					1																	186275895		2203	4300	6503	SO:0001819	synonymous_variant	10216				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity	g.chr1:186275895G>A	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1044G>A	1.37:g.186275895G>A						PRG4_uc001grt.3_Silent_p.K307K|PRG4_uc009wyl.2_Silent_p.K255K|PRG4_uc009wym.2_Silent_p.K214K|PRG4_uc010poo.1_RNA	p.K348K	NM_005807	NP_005798	Q92954	PRG4_HUMAN			7	1095	+			348			59 X 8 AA repeats of K-X-P-X-P-T-T-X.|1.		Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	37	c.1044G>A	CCDS1369.1																																																																																				0.547	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807		54	134	0	0	0	0.01441	0	54	134				
CFHR2	3080	broad.mit.edu	37	1	196927062	196927062	+	Nonsense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:196927062G>T	ENST00000367415.5	+	4	572	c.472G>T	c.(472-474)Gga>Tga	p.G158*	CFHR2_ENST00000476712.2_Nonsense_Mutation_p.G142*|CFHR2_ENST00000496448.1_3'UTR|CFHR2_ENST00000367421.3_Nonsense_Mutation_p.G158*	NM_005666.2	NP_005657.1	P36980	FHR2_HUMAN	complement factor H-related 2	158	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						TATTGACAATGGAGACATTAC	0.373																																							uc001gtq.1		NA																	0				skin(2)|ovary(1)	3						c.(472-474)GGA>TGA		H factor (complement)-like 3 precursor							140.0	129.0	133.0					1																	196927062		2203	4300	6503	SO:0001587	stop_gained	3080					extracellular region		g.chr1:196927062G>T	X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367415.5:c.472G>T	1.37:g.196927062G>T	ENSP00000356385:p.Gly158*					CFHR2_uc001gtr.1_Nonsense_Mutation_p.G34*	p.G158*	NM_005666	NP_005657	P36980	FHR2_HUMAN			4	549	+			158			Sushi 3.		Q14310|Q5T9T1	Nonsense_Mutation	SNP	ENST00000367415.5	37	c.472G>T	CCDS30959.1	.	.	.	.	.	.	.	.	.	.	.	12.76	2.035189	0.35893	.	.	ENSG00000080910	ENST00000367421;ENST00000367415	.	.	.	4.25	4.25	0.50352	.	0.793109	0.10293	N	0.692057	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.1516	0.65389	0.0:0.0:1.0:0.0	.	.	.	.	X	158	.	ENSP00000356385:G158X	G	+	1	0	CFHR2	195193685	1.000000	0.71417	0.682000	0.30024	0.101000	0.19017	5.300000	0.65721	1.881000	0.54492	0.514000	0.50259	GGA		0.373	CFHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088815.2	NM_005666		13	91	1	0	4.36969e-10	0.001855	6.41358e-10	13	91				
ASPM	259266	broad.mit.edu	37	1	197065239	197065239	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:197065239C>A	ENST00000367409.4	-	19	9132	c.8876G>T	c.(8875-8877)tGc>tTc	p.C2959F	ASPM_ENST00000367408.1_Missense_Mutation_p.C624F|ASPM_ENST00000294732.7_Missense_Mutation_p.C1374F	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2959	IQ 34. {ECO:0000255|PROSITE- ProRule:PRU00116}.|IQ 35. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TTGAATCTTGCAGGCAGCTTT	0.328																																							uc001gtu.2		NA																	0				ovary(4)|central_nervous_system(2)	6						c.(8875-8877)TGC>TTC		asp (abnormal spindle)-like, microcephaly							172.0	192.0	185.0					1																	197065239		2203	4299	6502	SO:0001583	missense	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197065239C>A	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.8876G>T	1.37:g.197065239C>A	ENSP00000356379:p.Cys2959Phe					ASPM_uc001gtv.2_Missense_Mutation_p.C1374F|ASPM_uc001gtw.3_Missense_Mutation_p.C807F	p.C2959F	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN			19	9133	-			2959			IQ 35.|IQ 34.		Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	c.8876G>T	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	C	17.02	3.283261	0.59867	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408;ENST00000367406	T;T;T	0.25414	1.8;1.8;1.8	5.21	4.09	0.47781	.	0.325031	0.30649	N	0.009172	T	0.39489	0.1080	L	0.57536	1.79	0.20821	N	0.999844	D;P;D	0.69078	0.971;0.948;0.997	P;P;D	0.71184	0.837;0.694;0.972	T	0.17410	-1.0370	10	0.12766	T	0.61	.	10.6801	0.45809	0.0:0.8445:0.0:0.1555	.	945;1374;2959	E7EQ84;Q4G1H1;Q8IZT6	.;.;ASPM_HUMAN	F	2959;1374;624;945	ENSP00000356379:C2959F;ENSP00000294732:C1374F;ENSP00000356378:C624F	ENSP00000294732:C1374F	C	-	2	0	ASPM	195331862	0.993000	0.37304	1.000000	0.80357	0.993000	0.82548	0.627000	0.24506	2.418000	0.82041	0.563000	0.77884	TGC		0.328	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136		69	168	1	0	2.23399e-28	0.01441	4.21022e-28	69	168				
CRB1	23418	broad.mit.edu	37	1	197396975	197396975	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:197396975G>A	ENST00000367400.3	+	7	2655	c.2520G>A	c.(2518-2520)gaG>gaA	p.E840E	CRB1_ENST00000535699.1_Silent_p.E771E|CRB1_ENST00000367399.2_Silent_p.E728E|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000544212.1_Silent_p.E321E|CRB1_ENST00000367397.1_Silent_p.E221E	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	840	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						ACAAGCAAGAGACTGAACTTA	0.388																																							uc001gtz.2		NA																	0				ovary(5)|skin(3)|large_intestine(1)	9						c.(2518-2520)GAG>GAA		crumbs homolog 1 precursor							96.0	93.0	94.0					1																	197396975		2203	4300	6503	SO:0001819	synonymous_variant	23418				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding	g.chr1:197396975G>A		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2520G>A	1.37:g.197396975G>A						CRB1_uc010poz.1_Silent_p.E771E|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Silent_p.E728E|CRB1_uc010ppb.1_Intron|CRB1_uc010ppc.1_RNA|CRB1_uc010ppd.1_Silent_p.E321E|CRB1_uc001gub.1_Silent_p.E489E	p.E840E	NM_201253	NP_957705	P82279	CRUM1_HUMAN			7	2655	+			840			Extracellular (Potential).|Laminin G-like 2.		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Silent	SNP	ENST00000367400.3	37	c.2520G>A	CCDS1390.1																																																																																				0.388	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253		10	24	0	0	0	0.008291	0	10	24				
KIF21B	23046	broad.mit.edu	37	1	200978394	200978394	+	Splice_Site	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:200978394C>A	ENST00000422435.2	-	2	580	c.264G>T	c.(262-264)caG>caT	p.Q88H	KIF21B_ENST00000461742.2_Splice_Site_p.Q88H|KIF21B_ENST00000360529.5_Splice_Site_p.Q88H|KIF21B_ENST00000332129.2_Splice_Site_p.Q88H	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	88	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						GATGGCTTACCTGCCCATAGG	0.562																																							uc001gvs.1		NA																	0				ovary(3)|skin(3)	6						c.(262-264)CAG>CAT		kinesin family member 21B							85.0	76.0	79.0					1																	200978394		2203	4300	6503	SO:0001630	splice_region_variant	23046				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr1:200978394C>A	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.264+1G>T	1.37:g.200978394C>A						KIF21B_uc001gvr.1_Missense_Mutation_p.Q88H|KIF21B_uc009wzl.1_Missense_Mutation_p.Q88H|KIF21B_uc010ppn.1_Missense_Mutation_p.Q88H	p.Q88H	NM_017596	NP_060066	O75037	KI21B_HUMAN			2	581	-			88			Kinesin-motor.|ATP (By similarity).		B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	37	c.264G>T	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.644731	0.67358	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04	4.19	3.27	0.37495	Kinesin, motor domain (5);	0.000000	0.85682	D	0.000000	D	0.89945	0.6862	M	0.93978	3.48	0.80722	D	1	D;D;D;D	0.71674	0.998;0.998;0.996;0.998	D;D;D;D	0.83275	0.996;0.996;0.995;0.994	D	0.91659	0.5341	9	.	.	.	.	12.2637	0.54665	0.0:0.9166:0.0:0.0834	.	88;88;88;88	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	H	88	ENSP00000328494:Q88H;ENSP00000353724:Q88H;ENSP00000433808:Q88H;ENSP00000411831:Q88H	.	Q	-	3	2	KIF21B	199245017	1.000000	0.71417	1.000000	0.80357	0.676000	0.39594	5.874000	0.69652	1.111000	0.41721	0.650000	0.86243	CAG		0.562	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	Missense_Mutation	13	25	1	0	2.27111e-07	0.013537	2.99523e-07	13	25				
PPP1R12B	4660	broad.mit.edu	37	1	202318255	202318255	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:202318255G>T	ENST00000608999.1	+	1	429	c.276G>T	c.(274-276)ttG>ttT	p.L92F	PPP1R12B_ENST00000356764.2_Missense_Mutation_p.L92F|PPP1R12B_ENST00000336894.4_Missense_Mutation_p.L92F|PPP1R12B_ENST00000480184.1_Missense_Mutation_p.L92F	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B	92					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			TGGACGGCTTGACAGCCCTGC	0.572																																							uc001gya.1		NA																	0				ovary(3)	3						c.(274-276)TTG>TTT		protein phosphatase 1, regulatory (inhibitor)							42.0	39.0	40.0					1																	202318255		2203	4299	6502	SO:0001583	missense	4660				regulation of muscle contraction|signal transduction	cytoplasm	enzyme activator activity	g.chr1:202318255G>T	AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.276G>T	1.37:g.202318255G>T	ENSP00000476755:p.Leu92Phe					PPP1R12B_uc001gxy.2_Missense_Mutation_p.L92F|PPP1R12B_uc009xad.1_5'UTR|PPP1R12B_uc009xae.1_Missense_Mutation_p.L92F|PPP1R12B_uc001gxz.1_Missense_Mutation_p.L92F	p.L92F	NM_002481	NP_002472	O60237	MYPT2_HUMAN	BRCA - Breast invasive adenocarcinoma(75;0.166)		1	420	+			92			ANK 2.		A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Missense_Mutation	SNP	ENST00000608999.1	37	c.276G>T	CCDS1426.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.020768	0.75275	.	.	ENSG00000077157	ENST00000406302;ENST00000336894;ENST00000480184;ENST00000356764	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	5.32	5.32	0.75619	Ankyrin repeat-containing domain (3);	0.000000	0.41294	D	0.000918	T	0.69975	0.3171	L	0.28740	0.885	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.996;1.0;0.999;0.999	T	0.71820	-0.4477	10	0.62326	D	0.03	.	16.0227	0.80509	0.0:0.0:1.0:0.0	.	92;92;92;92	O60237-2;O60237;F8W8M3;Q2TAI8	.;MYPT2_HUMAN;.;.	F	92	ENSP00000384496:L92F;ENSP00000337897:L92F;ENSP00000417159:L92F;ENSP00000349206:L92F	ENSP00000337897:L92F	L	+	3	2	PPP1R12B	200584878	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.609000	0.24238	2.766000	0.95052	0.655000	0.94253	TTG		0.572	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000099166.3	NM_032105		23	41	1	0	2.21704e-12	0.00278	3.52182e-12	23	41				
IKBKE	9641	broad.mit.edu	37	1	206666379	206666379	+	Missense_Mutation	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:206666379A>G	ENST00000367120.3	+	19	2232	c.1859A>G	c.(1858-1860)cAc>cGc	p.H620R	IKBKE_ENST00000537984.1_Missense_Mutation_p.H535R|C1orf147_ENST00000367119.1_Missense_Mutation_p.V52A	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	620	Interaction with DDX3X.				immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					ACCAGGAACCACCTGCGCCTG	0.582																																							uc001hdz.1		NA																	0				ovary(3)|lung(3)|central_nervous_system(1)|skin(1)	8						c.(1858-1860)CAC>CGC		IKK-related kinase epsilon							42.0	34.0	37.0					1																	206666379		2201	4296	6497	SO:0001583	missense	9641				DNA damage response, signal transduction resulting in induction of apoptosis|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane|PML body	ATP binding|IkappaB kinase activity|NF-kappaB-inducing kinase activity|protein binding	g.chr1:206666379A>G	AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.1859A>G	1.37:g.206666379A>G	ENSP00000356087:p.His620Arg					IKBKE_uc009xbv.1_Missense_Mutation_p.H620R|IKBKE_uc001hea.1_Missense_Mutation_p.H535R	p.H620R	NM_014002	NP_054721	Q14164	IKKE_HUMAN			19	2227	+	Breast(84;0.137)		620					D3DT78|Q3B754|Q3KR43|Q5JTS6	Missense_Mutation	SNP	ENST00000367120.3	37	c.1859A>G	CCDS30996.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.12|12.12	1.843650|1.843650	0.32606|0.32606	.|.	.|.	ENSG00000143466|ENSG00000162888	ENST00000367120;ENST00000537984|ENST00000367119	T;T|T	0.13778|0.76578	2.56;2.56|-1.03	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	0.424880|.	0.25890|.	N|.	0.027637|.	T|T	0.81550|0.81550	0.4846|0.4846	M|M	0.62723|0.62723	1.935|1.935	0.24342|0.24342	N|N	0.994958|0.994958	P;B|.	0.39576|.	0.679;0.02|.	B;B|.	0.38458|.	0.274;0.017|.	T|T	0.76066|0.76066	-0.3095|-0.3095	10|7	0.12766|0.87932	T|D	0.61|0	0.0814|0.0814	12.1339|12.1339	0.53959|0.53959	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	535;620|.	Q3B754;Q14164|.	.;IKKE_HUMAN|.	R|A	620;535|52	ENSP00000356087:H620R;ENSP00000444529:H535R|ENSP00000356086:V52A	ENSP00000356087:H620R|ENSP00000356086:V52A	H|V	+|-	2|2	0|0	IKBKE|C1orf147	204733002|204733002	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.476000|0.476000	0.33039|0.33039	4.247000|4.247000	0.58750|0.58750	2.134000|2.134000	0.65973|0.65973	0.459000|0.459000	0.35465|0.35465	CAC|GTG		0.582	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088484.1			4	16	0	0	0	0.000602	0	4	16				
KCNK2	3776	broad.mit.edu	37	1	215342686	215342686	+	Missense_Mutation	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:215342686T>C	ENST00000444842.2	+	4	770	c.620T>C	c.(619-621)gTg>gCg	p.V207A	KCNK2_ENST00000391894.2_Missense_Mutation_p.V192A|KCNK2_ENST00000391895.2_Missense_Mutation_p.V203A	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	207					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	attgccaaagtggaAGATACG	0.338																																							uc001hkq.2		NA																	0					0						c.(619-621)GTG>GCG		potassium channel, subfamily K, member 2 isoform	Dofetilide(DB00204)						102.0	100.0	100.0					1																	215342686		2203	4300	6503	SO:0001583	missense	3776						outward rectifier potassium channel activity	g.chr1:215342686T>C	AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.620T>C	1.37:g.215342686T>C	ENSP00000394033:p.Val207Ala					KCNK2_uc001hko.2_Missense_Mutation_p.V203A|KCNK2_uc009xdm.2_RNA|KCNK2_uc001hkp.2_RNA|KCNK2_uc010pua.1_RNA|KCNK2_uc001hkr.3_Missense_Mutation_p.V192A	p.V207A	NM_001017425	NP_001017425	O95069	KCNK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	4	789	+			207			Cytoplasmic (Potential).		A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	ENST00000444842.2	37	c.620T>C	CCDS41467.1	.	.	.	.	.	.	.	.	.	.	T	17.64	3.440294	0.63067	.	.	ENSG00000082482	ENST00000391895;ENST00000391894;ENST00000444842	T;T;T	0.21543	2.0;2.0;2.0	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.26159	0.0638	L	0.47190	1.495	0.80722	D	1	B;B;B	0.21225	0.053;0.034;0.014	B;B;B	0.31946	0.138;0.045;0.077	T	0.02471	-1.1154	10	0.37606	T	0.19	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	192;207;203	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	A	203;192;207	ENSP00000375765:V203A;ENSP00000375764:V192A;ENSP00000394033:V207A	ENSP00000375764:V192A	V	+	2	0	KCNK2	213409309	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.367000	0.80283	0.528000	0.53228	GTG		0.338	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217		13	36	0	0	0	0.013537	0	13	36				
USH2A	7399	broad.mit.edu	37	1	216369929	216369929	+	Nonsense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:216369929G>T	ENST00000307340.3	-	19	4603	c.4217C>A	c.(4216-4218)tCa>tAa	p.S1406*	USH2A_ENST00000366943.2_Nonsense_Mutation_p.S1406*|USH2A_ENST00000366942.3_Nonsense_Mutation_p.S1406*|RP5-1099E6.3_ENST00000420867.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1406	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTGTTGAGGTGATTGTTCAGA	0.393										HNSCC(13;0.011)																													uc001hku.1		NA																	0				ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26						c.(4216-4218)TCA>TAA		usherin isoform B							188.0	172.0	178.0					1																	216369929		2203	4300	6503	SO:0001587	stop_gained	7399				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	g.chr1:216369929G>T	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.4217C>A	1.37:g.216369929G>T	ENSP00000305941:p.Ser1406*	HNSCC(13;0.011)				USH2A_uc001hkv.2_Nonsense_Mutation_p.S1406*	p.S1406*	NM_206933	NP_996816	O75445	USH2A_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	19	4604	-			1406			Extracellular (Potential).|Fibronectin type-III 4.		Q5VVM9|Q6S362|Q9NS27	Nonsense_Mutation	SNP	ENST00000307340.3	37	c.4217C>A	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	45	11.687960	0.99591	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	.	.	.	5.96	1.97	0.26223	.	0.931367	0.08784	N	0.894218	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	1.8301	0.03128	0.2858:0.1378:0.4498:0.1267	.	.	.	.	X	1406	.	ENSP00000305941:S1406X	S	-	2	0	USH2A	214436552	0.001000	0.12720	0.007000	0.13788	0.327000	0.28475	0.293000	0.19029	0.839000	0.34971	0.655000	0.94253	TCA		0.393	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123		14	69	1	0	1.15088e-07	0.004007	1.5337e-07	14	69				
MARK1	4139	broad.mit.edu	37	1	220792037	220792037	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:220792037C>G	ENST00000366917.4	+	9	1115	c.849C>G	c.(847-849)gaC>gaG	p.D283E	MARK1_ENST00000402574.1_Missense_Mutation_p.D148E|MARK1_ENST00000366918.4_Missense_Mutation_p.D261E					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		TGTCCACAGACTGTGAAAATC	0.338																																							uc001hmn.3		NA																	0				ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10						c.(847-849)GAC>GAG		MAP/microtubule affinity-regulating kinase 1							86.0	88.0	87.0					1																	220792037		2203	4300	6503	SO:0001583	missense	4139				intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	g.chr1:220792037C>G	AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.849C>G	1.37:g.220792037C>G	ENSP00000355884:p.Asp283Glu					MARK1_uc009xdw.2_Missense_Mutation_p.D283E|MARK1_uc010pun.1_Missense_Mutation_p.D283E|MARK1_uc001hmm.3_Missense_Mutation_p.D261E	p.D283E	NM_018650	NP_061120	Q9P0L2	MARK1_HUMAN		GBM - Glioblastoma multiforme(131;0.0407)	9	1446	+			283			Protein kinase.			Missense_Mutation	SNP	ENST00000366917.4	37	c.849C>G	CCDS31029.2	.	.	.	.	.	.	.	.	.	.	C	33	5.247439	0.95305	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.62232	0.04;0.04;0.04	5.85	5.85	0.93711	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62841	0.2461	N	0.04043	-0.29	0.80722	D	1	B;B;D;P	0.52996	0.414;0.361;0.957;0.923	P;B;D;D	0.66847	0.452;0.276;0.947;0.917	T	0.70956	-0.4731	10	0.51188	T	0.08	.	20.1731	0.98165	0.0:1.0:0.0:0.0	.	283;148;283;261	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	E	148;261;283	ENSP00000386017:D148E;ENSP00000355885:D261E;ENSP00000355884:D283E	ENSP00000355884:D283E	D	+	3	2	MARK1	218858660	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	6.039000	0.70972	2.768000	0.95171	0.655000	0.94253	GAC		0.338	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090899.1			5	53	0	0	0	0.000602	0	5	53				
CCDC185	164127	broad.mit.edu	37	1	223567834	223567834	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:223567834G>T	ENST00000366875.3	+	1	1120	c.1017G>T	c.(1015-1017)gtG>gtT	p.V339V		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		339										breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		GGAAGAACGTGCCCCCGGGGG	0.687																																							uc001hoa.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1015-1017)GTG>GTT		hypothetical protein LOC164127							12.0	13.0	13.0					1																	223567834		2157	4273	6430	SO:0001819	synonymous_variant	164127							g.chr1:223567834G>T																												ENST00000366875.3:c.1017G>T	1.37:g.223567834G>T							p.V339V	NM_152610	NP_689823	Q8N715	CA065_HUMAN		GBM - Glioblastoma multiforme(131;0.0704)	1	1120	+			339					Q8N746|Q8NA93	Silent	SNP	ENST00000366875.3	37	c.1017G>T	CCDS1537.1																																																																																				0.687	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092718.1			6	12	1	0	0.00116845	0.001168	0.00128549	6	12				
LBR	3930	broad.mit.edu	37	1	225609925	225609925	+	Nonsense_Mutation	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:225609925T>A	ENST00000338179.2	-	3	345	c.220A>T	c.(220-222)Aga>Tga	p.R74*	LBR_ENST00000272163.4_Nonsense_Mutation_p.R74*|LBR_ENST00000487054.1_5'Flank	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	74					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		CCTCGGCGTCTGGAAGGGGAA	0.527																																							uc001hoy.2		NA																	0				ovary(1)|skin(1)	2						c.(220-222)AGA>TGA		lamin B receptor							56.0	52.0	54.0					1																	225609925		2203	4300	6503	SO:0001587	stop_gained	3930				cholesterol biosynthetic process	integral to nuclear inner membrane	chromo shadow domain binding|delta14-sterol reductase activity|DNA binding|lamin binding|receptor activity	g.chr1:225609925T>A	L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.220A>T	1.37:g.225609925T>A	ENSP00000339883:p.Arg74*					LBR_uc001hoz.2_Nonsense_Mutation_p.R74*|LBR_uc001hpa.1_Nonsense_Mutation_p.R74*	p.R74*	NM_002296	NP_002287	Q14739	LBR_HUMAN		GBM - Glioblastoma multiforme(131;0.117)	3	363	-	Breast(184;0.165)		74			Nucleoplasmic (Potential).		B2R5P3|Q14740|Q53GU7|Q59FE6	Nonsense_Mutation	SNP	ENST00000338179.2	37	c.220A>T	CCDS1545.1	.	.	.	.	.	.	.	.	.	.	T	38	7.049865	0.98029	.	.	ENSG00000143815	ENST00000272163;ENST00000338179;ENST00000425080	.	.	.	6.03	2.4	0.29515	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.1051	14.3282	0.66534	0.0:0.0:0.5573:0.4426	.	.	.	.	X	74	.	ENSP00000272163:R74X	R	-	1	2	LBR	223676548	0.995000	0.38212	0.997000	0.53966	0.983000	0.72400	0.744000	0.26245	0.149000	0.19098	0.533000	0.62120	AGA		0.527	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296		14	59	0	0	0	0.00245	0	14	59				
LEFTY2	7044	broad.mit.edu	37	1	226125399	226125399	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:226125399C>G	ENST00000366820.5	-	4	1191	c.843G>C	c.(841-843)tgG>tgC	p.W281C	LEFTY2_ENST00000420304.2_Missense_Mutation_p.W247C|RP4-559A3.6_ENST00000513672.1_RNA|LEFTY2_ENST00000474493.1_5'Flank	NM_003240.3	NP_003231.2	O00292	LFTY2_HUMAN	left-right determination factor 2	281					blood coagulation (GO:0007596)|cell growth (GO:0016049)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16	Breast(184;0.197)					GCTCCAGCACCCAGTTCTTGG	0.652																																					Colon(172;116 2643 9098 43333)	Colon(172;116 2643 9098 43333)	uc001hpt.1		NA																	0					0						c.(841-843)TGG>TGC		endometrial bleeding associated factor							24.0	27.0	26.0					1																	226125399		2203	4300	6503	SO:0001583	missense	7044				cell growth|multicellular organismal development|platelet activation|platelet degranulation|transforming growth factor beta receptor signaling pathway	extracellular space|platelet alpha granule lumen	cytokine activity|growth factor activity|transforming growth factor beta receptor binding	g.chr1:226125399C>G	U81523	CCDS1549.1, CCDS53479.1	1q42.1	2008-07-18	2004-11-17	2004-11-17	ENSG00000143768	ENSG00000143768			3122	protein-coding gene	gene with protein product	"""transforming growth factor, beta-4 (endometrial bleeding-associated factor; LEFTY A)"""	601877	"""endometrial bleeding associated factor (left-right determination, factor A; transforming growth factor beta superfamily)"""	TGFB4, EBAF		9153275	Standard	NM_001172425		Approved	LEFTA, LEFTYA	uc001hpt.2	O00292	OTTHUMG00000037441	ENST00000366820.5:c.843G>C	1.37:g.226125399C>G	ENSP00000355785:p.Trp281Cys					LEFTY2_uc010pvk.1_Missense_Mutation_p.W247C|LEFTY2_uc009xek.1_3'UTR	p.W281C	NM_003240	NP_003231	O00292	LFTY2_HUMAN			4	923	-	Breast(184;0.197)		281					B3KNH4|B4E332|E9PDM4|O75611|Q5TE89|Q8NBQ9	Missense_Mutation	SNP	ENST00000366820.5	37	c.843G>C	CCDS1549.1	.	.	.	.	.	.	.	.	.	.	c	16.87	3.242357	0.58995	.	.	ENSG00000143768	ENST00000420304;ENST00000366820	D;D	0.93076	-3.16;-3.16	5.1	5.1	0.69264	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.97564	0.9202	M	0.92268	3.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.98494	1.0611	10	0.87932	D	0	.	18.4701	0.90771	0.0:1.0:0.0:0.0	.	247;281	E9PDM4;O00292	.;LFTY2_HUMAN	C	247;281	ENSP00000388009:W247C;ENSP00000355785:W281C	ENSP00000355785:W281C	W	-	3	0	LEFTY2	224192022	1.000000	0.71417	1.000000	0.80357	0.223000	0.24884	6.956000	0.76013	2.518000	0.84900	0.561000	0.74099	TGG		0.652	LEFTY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091152.1	NM_003240		14	26	0	0	0	0.001855	0	14	26				
SLC35F3	148641	broad.mit.edu	37	1	234367270	234367270	+	Nonsense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:234367270C>T	ENST00000366617.3	+	2	412	c.184C>T	c.(184-186)Caa>Taa	p.Q62*	SLC35F3_ENST00000366618.3_Nonsense_Mutation_p.Q131*			Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	62					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			CTCCCGGGCGCAACTCAAGAA	0.731																																							uc001hwa.1		NA																	0				ovary(2)	2						c.(184-186)CAA>TAA		solute carrier family 35, member F3							90.0	80.0	83.0					1																	234367270		2203	4299	6502	SO:0001587	stop_gained	148641				transport	integral to membrane		g.chr1:234367270C>T		CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366617.3:c.184C>T	1.37:g.234367270C>T	ENSP00000355576:p.Gln62*					SLC35F3_uc001hvy.1_Nonsense_Mutation_p.Q131*	p.Q62*	NM_173508	NP_775779	Q8IY50	S35F3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00531)		2	412	+	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	62					Q5TDD6|Q8N9C9	Nonsense_Mutation	SNP	ENST00000366617.3	37	c.184C>T		.	.	.	.	.	.	.	.	.	.	C	38	6.946970	0.97956	.	.	ENSG00000183780	ENST00000366618;ENST00000366617	.	.	.	4.57	4.57	0.56435	.	0.109289	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-7.5942	17.5216	0.87789	0.0:1.0:0.0:0.0	.	.	.	.	X	131;62	.	ENSP00000355576:Q62X	Q	+	1	0	SLC35F3	232433893	1.000000	0.71417	0.877000	0.34402	0.592000	0.36648	6.839000	0.75364	2.351000	0.79841	0.491000	0.48974	CAA		0.731	SLC35F3-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000128322.1	NM_173508		15	110	0	0	0	0.00499	0	15	110				
ACTN2	88	broad.mit.edu	37	1	236902752	236902752	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:236902752A>T	ENST00000366578.4	+	10	1193	c.1027A>T	c.(1027-1029)Atc>Ttc	p.I343F	ACTN2_ENST00000542672.1_Missense_Mutation_p.I343F|ACTN2_ENST00000546208.1_Intron|ACTN2_ENST00000492634.1_3'UTR	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	343					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			CCAGCTGGAGATCAACTTCAA	0.582																																							uc001hyf.2		NA																	0				ovary(4)|skin(1)	5						c.(1027-1029)ATC>TTC		actinin, alpha 2							147.0	117.0	127.0					1																	236902752		2203	4300	6503	SO:0001583	missense	88				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding	g.chr1:236902752A>T	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1027A>T	1.37:g.236902752A>T	ENSP00000355537:p.Ile343Phe					ACTN2_uc001hyg.2_Missense_Mutation_p.I135F|ACTN2_uc009xgi.1_Missense_Mutation_p.I343F|ACTN2_uc010pxu.1_Intron|ACTN2_uc001hyh.2_Missense_Mutation_p.I31F	p.I343F	NM_001103	NP_001094	P35609	ACTN2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00168)		10	1231	+	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	343			Spectrin 1.		B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	c.1027A>T	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.906393	0.92107	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000545611	T;T	0.56611	0.45;0.45	5.51	5.51	0.81932	.	0.088771	0.85682	D	0.000000	T	0.72285	0.3441	M	0.73962	2.25	0.80722	D	1	P;P;D	0.53619	0.862;0.919;0.961	P;P;D	0.71414	0.594;0.821;0.973	T	0.75775	-0.3199	10	0.72032	D	0.01	.	15.6112	0.76721	1.0:0.0:0.0:0.0	.	343;113;343	B2RCS5;Q59FD9;P35609	.;.;ACTN2_HUMAN	F	343;343;112	ENSP00000443495:I343F;ENSP00000355537:I343F	ENSP00000355537:I343F	I	+	1	0	ACTN2	234969375	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.293000	0.96082	2.089000	0.63090	0.454000	0.30748	ATC		0.582	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103		16	88	0	0	0	0.003163	0	16	88				
MTR	4548	broad.mit.edu	37	1	237024505	237024505	+	Missense_Mutation	SNP	T	T	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:237024505T>G	ENST00000366577.5	+	20	2518	c.2124T>G	c.(2122-2124)atT>atG	p.I708M	MTR_ENST00000535889.1_Intron	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	708	B12-binding N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00666}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	TCAATATAATTGAAGGACCCC	0.343																																							uc001hyi.3		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(2122-2124)ATT>ATG		5-methyltetrahydrofolate-homocysteine	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)						84.0	87.0	86.0					1																	237024505		2203	4300	6503	SO:0001583	missense	4548				nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding	g.chr1:237024505T>G	U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.2124T>G	1.37:g.237024505T>G	ENSP00000355536:p.Ile708Met					MTR_uc010pxw.1_Missense_Mutation_p.I301M|MTR_uc010pxx.1_Intron|MTR_uc010pxy.1_Missense_Mutation_p.I562M	p.I708M	NM_000254	NP_000245	Q99707	METH_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	20	2547	+	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	708			B12-binding N-terminal.		A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Missense_Mutation	SNP	ENST00000366577.5	37	c.2124T>G	CCDS1614.1	.	.	.	.	.	.	.	.	.	.	T	18.73	3.686174	0.68157	.	.	ENSG00000116984	ENST00000417743;ENST00000366577;ENST00000366576	T;D	0.89196	-1.14;-2.48	5.85	-4.92	0.03075	Methionine synthase, cobalamin (vitamin B12)-binding module, cap (4);	0.000000	0.85682	D	0.000000	D	0.97087	0.9048	H	0.99995	5.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94642	0.7831	10	0.87932	D	0	-20.6663	13.9809	0.64304	0.0:0.4879:0.0:0.5121	.	708;708	B7ZLW8;Q99707	.;METH_HUMAN	M	562;708;262	ENSP00000355536:I708M;ENSP00000355535:I262M	ENSP00000355535:I262M	I	+	3	3	MTR	235091128	0.038000	0.19896	0.922000	0.36590	0.983000	0.72400	-0.766000	0.04725	-1.006000	0.03412	-0.899000	0.02877	ATT		0.343	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	NM_000254		13	75	0	0	0	0.00245	0	13	75				
RYR2	6262	broad.mit.edu	37	1	237993846	237993846	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:237993846G>T	ENST00000366574.2	+	103	14989	c.14672G>T	c.(14671-14673)tGt>tTt	p.C4891F	RYR2_ENST00000542537.1_Missense_Mutation_p.C4875F|RYR2_ENST00000360064.6_Missense_Mutation_p.C4897F	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4891					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGCTTCATCTGTGGGATAGGC	0.428																																							uc001hyl.1		NA																	0				ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33						c.(14671-14673)TGT>TTT		cardiac muscle ryanodine receptor							215.0	198.0	203.0					1																	237993846		1937	4152	6089	SO:0001583	missense	6262				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding	g.chr1:237993846G>T	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14672G>T	1.37:g.237993846G>T	ENSP00000355533:p.Cys4891Phe					RYR2_uc010pyb.1_Intron	p.C4891F	NM_001035	NP_001026	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)		103	14792	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	4891					Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	c.14672G>T	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486274	0.84854	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.99429	-5.89;-5.88;-5.88	5.52	5.52	0.82312	.	0.000000	0.64402	D	0.000001	D	0.99321	0.9762	H	0.96208	3.785	0.80722	D	1	B	0.29432	0.244	B	0.26416	0.069	D	0.98948	1.0793	10	0.87932	D	0	-11.2573	19.4432	0.94831	0.0:0.0:1.0:0.0	.	4891	Q92736	RYR2_HUMAN	F	4891;4897;4875	ENSP00000355533:C4891F;ENSP00000353174:C4897F;ENSP00000443798:C4875F	ENSP00000353174:C4897F	C	+	2	0	RYR2	236060469	1.000000	0.71417	0.998000	0.56505	0.806000	0.45545	9.809000	0.99208	2.578000	0.87016	0.655000	0.94253	TGT		0.428	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035		20	139	1	0	7.21436e-19	0.008871	1.30555e-18	20	139				
CHRM3	1131	broad.mit.edu	37	1	240071786	240071786	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:240071786C>T	ENST00000255380.4	+	5	1814	c.1035C>T	c.(1033-1035)tcC>tcT	p.S345S		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	345					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CTGCTGCCTCCCTGGAGAACT	0.567																																							uc001hyp.2		NA																	0				ovary(4)|skin(1)	5						c.(1033-1035)TCC>TCT		cholinergic receptor, muscarinic 3	Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)						42.0	34.0	37.0					1																	240071786		2201	4299	6500	SO:0001819	synonymous_variant	1131				cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity	g.chr1:240071786C>T	U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1035C>T	1.37:g.240071786C>T							p.S345S	NM_000740	NP_000731	P20309	ACM3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		5	1814	+	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	345			Cytoplasmic (By similarity).		Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Silent	SNP	ENST00000255380.4	37	c.1035C>T	CCDS1616.1																																																																																				0.567	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095644.2	NM_000740		11	26	0	0	0	0.008291	0	11	26				
OR13G1	441933	broad.mit.edu	37	1	247836182	247836182	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:247836182C>A	ENST00000359688.2	-	1	183	c.162G>T	c.(160-162)acG>acT	p.T54T	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CATACATGGGCGTATGCAAGG	0.418																																							uc001idi.1		NA																	0				skin(1)	1						c.(160-162)ACG>ACT		olfactory receptor, family 13, subfamily G,							90.0	70.0	77.0					1																	247836182		2203	4300	6503	SO:0001819	synonymous_variant	441933				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:247836182C>A	AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.162G>T	1.37:g.247836182C>A							p.T54T	NM_001005487	NP_001005487	Q8NGZ3	O13G1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.017)		1	162	-	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		54			Helical; Name=2; (Potential).		B2RN80|Q5T2T2|Q6IF86	Silent	SNP	ENST00000359688.2	37	c.162G>T	CCDS31094.1																																																																																				0.418	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096869.1	NM_001005487		17	35	1	0	3.52763e-06	0.00499	4.34642e-06	17	35				
OR11L1	391189	broad.mit.edu	37	1	248004298	248004298	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:248004298C>A	ENST00000355784.2	-	1	956	c.901G>T	c.(901-903)Gtt>Ttt	p.V301F		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	301						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ACCTTTCTAACAGCTTCTTTG	0.393																																							uc001idn.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(901-903)GTT>TTT		olfactory receptor, family 11, subfamily L,							91.0	87.0	88.0					1																	248004298		2203	4300	6503	SO:0001583	missense	391189				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248004298C>A	AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.901G>T	1.37:g.248004298C>A	ENSP00000348033:p.Val301Phe						p.V301F	NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		1	901	-	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		301			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000355784.2	37	c.901G>T	CCDS31098.1	.	.	.	.	.	.	.	.	.	.	C	4.336	0.061819	0.08339	.	.	ENSG00000197591	ENST00000355784	T	0.35605	1.3	3.91	1.86	0.25419	.	0.279231	0.18742	U	0.132422	T	0.13243	0.0321	N	0.03304	-0.355	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.11251	-1.0595	10	0.54805	T	0.06	.	2.034	0.03535	0.2851:0.3784:0.2336:0.1029	.	301	Q8NGX0	O11L1_HUMAN	F	301	ENSP00000348033:V301F	ENSP00000348033:V301F	V	-	1	0	OR11L1	246070921	0.000000	0.05858	0.320000	0.25306	0.658000	0.38924	-2.099000	0.01346	1.007000	0.39238	0.543000	0.68304	GTT		0.393	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096850.1	NM_001001959		28	69	1	0	2.48779e-11	0.005443	3.83711e-11	28	69				
OR2W3	343171	broad.mit.edu	37	1	248059468	248059468	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:248059468G>A	ENST00000360358.3	+	1	580	c.580G>A	c.(580-582)Gcc>Acc	p.A194T	OR2W3_ENST00000537741.1_Missense_Mutation_p.A194T	NM_001001957.2	NP_001001957.2	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W, member 3	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(2)|large_intestine(2)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	49	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CAGCACTGTGGCCATCGAAGG	0.602																																							uc001idp.1		NA																	0				ovary(1)|breast(1)|pancreas(1)	3						c.(580-582)GCC>ACC		olfactory receptor, family 2, subfamily W,							141.0	120.0	127.0					1																	248059468		2203	4300	6503	SO:0001583	missense	343171				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248059468G>A	N75737	CCDS31099.1	1q44	2012-08-09		2004-03-10	ENSG00000238243	ENSG00000238243		"""GPCR / Class A : Olfactory receptors"""	15021	protein-coding gene	gene with protein product				OR2W8P, OR2W3P		14983052	Standard	NM_001001957		Approved	OST718	uc010pzb.2	Q7Z3T1	OTTHUMG00000040204	ENST00000360358.3:c.580G>A	1.37:g.248059468G>A	ENSP00000353516:p.Ala194Thr					OR2W3_uc010pzb.1_Missense_Mutation_p.A194T	p.A194T	NM_001001957	NP_001001957	Q7Z3T1	OR2W3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		3	849	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		194			Extracellular (Potential).		Q6IF06|Q8NG86	Missense_Mutation	SNP	ENST00000360358.3	37	c.580G>A	CCDS31099.1	.	.	.	.	.	.	.	.	.	.	G	1.831	-0.469792	0.04445	.	.	ENSG00000238243	ENST00000537741;ENST00000360358	T;T	0.00076	8.76;8.76	4.96	1.88	0.25563	GPCR, rhodopsin-like superfamily (1);	0.868891	0.10087	N	0.717696	T	0.00073	0.0002	N	0.12853	0.265	0.09310	N	1	B	0.20550	0.046	B	0.22152	0.038	T	0.03433	-1.1037	10	0.21540	T	0.41	.	2.2761	0.04103	0.1752:0.2676:0.4303:0.1269	.	194	Q7Z3T1	OR2W3_HUMAN	T	194	ENSP00000445853:A194T;ENSP00000353516:A194T	ENSP00000353516:A194T	A	+	1	0	OR2W3	246126091	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-0.078000	0.11375	0.809000	0.34255	0.603000	0.83216	GCC		0.602	OR2W3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096861.1	NM_001001957		11	124	0	0	0	0.00333	0	11	124				
OR2T8	343172	broad.mit.edu	37	1	248085207	248085207	+	Missense_Mutation	SNP	G	G	T	rs151007478	byFrequency	TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:248085207G>T	ENST00000319968.4	+	1	888	c.888G>T	c.(886-888)aaG>aaT	p.K296N		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	296						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GTGAGGTGAAGGGAGCCCTGA	0.463																																							uc010pzc.1		NA																	0					0						c.(886-888)AAG>AAT		olfactory receptor, family 2, subfamily T,							154.0	149.0	151.0					1																	248085207		2203	4300	6503	SO:0001583	missense	343172				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr1:248085207G>T		CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.888G>T	1.37:g.248085207G>T	ENSP00000326225:p.Lys296Asn						p.K296N	NM_001005522	NP_001005522	A6NH00	OR2T8_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0319)		1	888	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	296			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000319968.4	37	c.888G>T	CCDS31100.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.276879	0.59758	.	.	ENSG00000177462	ENST00000319968	T	0.40756	1.02	3.54	-2.28	0.06826	.	0.258640	0.19945	U	0.102541	T	0.41259	0.1151	M	0.74389	2.26	0.09310	N	1	P	0.48998	0.918	P	0.49502	0.613	T	0.29027	-1.0025	10	0.33940	T	0.23	.	3.5991	0.08018	0.3494:0.0:0.3744:0.2762	.	296	A6NH00	OR2T8_HUMAN	N	296	ENSP00000326225:K296N	ENSP00000326225:K296N	K	+	3	2	OR2T8	246151830	0.000000	0.05858	0.013000	0.15412	0.684000	0.39900	-0.902000	0.04088	-0.089000	0.12484	0.536000	0.68110	AAG		0.463	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096862.1	NM_001005522		63	157	1	0	1.02016e-41	0.01441	1.95735e-41	63	157				
OR2L13	284521	broad.mit.edu	37	1	248154016	248154016	+	Intron	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:248154016G>T	ENST00000366478.2	+	1	194					NM_175911.2	NP_787107.1	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			GATCTTGGATGATAGGCTCCA	0.438																																							uc001idv.1		NA																	0					0						c.(202-204)ATG>ATT		RecName: Full=Olfactory receptor 2L5; AltName: Full=Olfactory receptor OR1-53;																																				SO:0001627	intron_variant	26247							g.chr1:248154016G>T	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000366478.2:c.-144+53330G>T	1.37:g.248154016G>T						OR2L13_uc001ids.2_Intron	p.M68I	NR_002145						1	448	+								Q5VUR5	Missense_Mutation	SNP	ENST00000366478.2	37	c.204G>T	CCDS1637.1																																																																																				0.438	OR2L13-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_175911		20	125	1	0	4.63292e-17	0.008871	8.1977e-17	20	125				
SH3BP5L	80851	broad.mit.edu	37	1	249106196	249106196	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:249106196C>A	ENST00000366472.5	-	7	2314	c.1085G>T	c.(1084-1086)aGt>aTt	p.S362I	SH3BP5L_ENST00000411742.2_Missense_Mutation_p.S330I|SH3BP5L_ENST00000475978.1_5'UTR	NM_030645.1	NP_085148.1	Q7L8J4	3BP5L_HUMAN	SH3-binding domain protein 5-like	362										endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			GCCGTCCAGACTGACGTGGTC	0.692																																							uc001iew.1		NA																	0					0						c.(1084-1086)AGT>ATT		SH3-binding domain protein 5-like							12.0	15.0	14.0					1																	249106196		2199	4294	6493	SO:0001583	missense	80851							g.chr1:249106196C>A	AB051507	CCDS31126.1	1q44	2008-02-05			ENSG00000175137	ENSG00000175137			29360	protein-coding gene	gene with protein product							Standard	NM_030645		Approved	KIAA1720	uc001iew.1	Q7L8J4	OTTHUMG00000040389	ENST00000366472.5:c.1085G>T	1.37:g.249106196C>A	ENSP00000355428:p.Ser362Ile					SH3BP5L_uc010pzp.1_Missense_Mutation_p.S255I|SH3BP5L_uc010pzq.1_Missense_Mutation_p.S330I|SH3BP5L_uc001iev.1_Missense_Mutation_p.S243I	p.S362I	NM_030645	NP_085148	Q7L8J4	3BP5L_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00805)		7	1637	-	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	362					B4DQ94|Q96FI5|Q9BQH8|Q9C0E3	Missense_Mutation	SNP	ENST00000366472.5	37	c.1085G>T	CCDS31126.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158439	0.78114	.	.	ENSG00000175137	ENST00000366472;ENST00000411742	.	.	.	4.27	4.27	0.50696	.	0.000000	0.85682	D	0.000000	T	0.63977	0.2557	L	0.27053	0.805	0.58432	D	0.999997	D;D;D;D	0.71674	0.998;0.998;0.998;0.998	D;D;D;D	0.78314	0.991;0.991;0.987;0.991	T	0.68659	-0.5350	9	0.87932	D	0	-20.0032	14.5707	0.68208	0.0:1.0:0.0:0.0	.	330;255;362;220	B4DQ94;B4DSF1;Q7L8J4;Q96MW4	.;.;3BP5L_HUMAN;.	I	362;330	.	ENSP00000355428:S362I	S	-	2	0	SH3BP5L	247072819	1.000000	0.71417	0.996000	0.52242	0.720000	0.41350	6.680000	0.74518	2.373000	0.80994	0.313000	0.20887	AGT		0.692	SH3BP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097140.1	NM_030645		9	23	1	0	1.76689e-08	0.006214	2.45209e-08	9	23				
GDI2	2665	broad.mit.edu	37	10	5808594	5808594	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr10:5808594G>A	ENST00000380191.4	-	9	1289	c.999C>T	c.(997-999)taC>taT	p.Y333Y	GDI2_ENST00000380132.4_Silent_p.Y337Y|GDI2_ENST00000380181.3_Silent_p.Y288Y|GDI2_ENST00000479928.1_5'UTR	NM_001115156.1|NM_001494.3	NP_001108628.1|NP_001485.2	P50395	GDIB_HUMAN	GDP dissociation inhibitor 2	333					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|Rab GDP-dissociation inhibitor activity (GO:0005093)|Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|large_intestine(1)|lung(6)|urinary_tract(1)	10						TCATGCAGACGTAGATATCTA	0.448																																							uc001iil.3		NA																	0					0						c.(997-999)TAC>TAT		GDP dissociation inhibitor 2 isoform 1							83.0	75.0	78.0					10																	5808594		2203	4300	6503	SO:0001819	synonymous_variant	2665				protein transport|small GTPase mediated signal transduction	cell surface|cytosol|membrane	protein binding|Rab GDP-dissociation inhibitor activity	g.chr10:5808594G>A	D13988	CCDS7071.1, CCDS44352.1	10p15	2010-03-16			ENSG00000057608	ENSG00000057608			4227	protein-coding gene	gene with protein product	"""rab GDP-dissociation"""	600767				9434952	Standard	NM_001494		Approved	RABGDIB	uc001iil.4	P50395	OTTHUMG00000017607	ENST00000380191.4:c.999C>T	10.37:g.5808594G>A						GDI2_uc001iim.3_Silent_p.Y288Y|GDI2_uc009xid.2_Silent_p.Y337Y	p.Y333Y	NM_001494	NP_001485	P50395	GDIB_HUMAN			9	1290	-			333					O43928|Q5SX88|Q9UQM6	Silent	SNP	ENST00000380191.4	37	c.999C>T	CCDS7071.1																																																																																				0.448	GDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046580.1	NM_001494		11	72	0	0	0	0.008291	0	11	72				
PRKCQ	5588	broad.mit.edu	37	10	6527227	6527227	+	Missense_Mutation	SNP	C	C	A	rs549529749		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr10:6527227C>A	ENST00000263125.5	-	10	1004	c.905G>T	c.(904-906)cGc>cTc	p.R302L	PRKCQ_ENST00000397176.2_Missense_Mutation_p.R302L|PRKCQ_ENST00000539722.1_Missense_Mutation_p.R177L	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	302					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	TCTTAAGCAGCGAGCCTGGAT	0.488													.|||	1	0.000199681	0.0008	0.0	5008	,	,		18707	0.0		0.0	False		,,,				2504	0.0				Ovarian(50;572 1126 10530 25349 30594)	Ovarian(50;572 1126 10530 25349 30594)	uc001ijj.1		NA																	0				ovary(3)|lung(2)|large_intestine(1)	6						c.(904-906)CGC>CTC		protein kinase C, theta							113.0	108.0	110.0					10																	6527227		2203	4300	6503	SO:0001583	missense	5588				axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity	g.chr10:6527227C>A	L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.905G>T	10.37:g.6527227C>A	ENSP00000263125:p.Arg302Leu					PRKCQ_uc009xim.1_Missense_Mutation_p.R302L|PRKCQ_uc001iji.1_Missense_Mutation_p.R335L|PRKCQ_uc009xin.1_Missense_Mutation_p.R266L|PRKCQ_uc010qax.1_Missense_Mutation_p.R177L	p.R302L	NM_006257	NP_006248	Q04759	KPCT_HUMAN			10	980	-			302					B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	ENST00000263125.5	37	c.905G>T	CCDS7079.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	11.82|11.82	1.753715|1.753715	0.31046|0.31046	.|.	.|.	ENSG00000065675|ENSG00000065675	ENST00000397178|ENST00000263125;ENST00000397176;ENST00000539722	.|T;T;T	.|0.68903	.|-0.36;-0.32;-0.35	5.22|5.22	4.31|4.31	0.51392|0.51392	.|.	.|0.046760	.|0.85682	.|D	.|0.000000	T|T	0.61160|0.61160	0.2325|0.2325	L|L	0.32530|0.32530	0.975|0.975	0.58432|0.58432	D|D	0.999996|0.999996	.|P;P;P;B	.|0.38370	.|0.476;0.628;0.611;0.289	.|B;B;B;B	.|0.43701	.|0.178;0.326;0.428;0.058	T|T	0.59043|0.59043	-0.7528|-0.7528	5|10	.|0.31617	.|T	.|0.26	.|.	14.4542|14.4542	0.67407|0.67407	0.0:0.853:0.147:0.0|0.0:0.853:0.147:0.0	.|.	.|177;74;302;302	.|B4DF52;Q5JUN8;Q04759-2;Q04759	.|.;.;.;KPCT_HUMAN	S|L	75|302;302;177	.|ENSP00000263125:R302L;ENSP00000380361:R302L;ENSP00000441752:R177L	.|ENSP00000263125:R302L	A|R	-|-	1|2	0|0	PRKCQ|PRKCQ	6567233|6567233	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.250000|0.250000	0.25880|0.25880	5.242000|5.242000	0.65389|0.65389	1.315000|1.315000	0.45114|0.45114	-0.175000|-0.175000	0.13238|0.13238	GCT|CGC		0.488	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257		20	89	1	0	8.00594e-06	0.007413	9.65868e-06	20	89				
GPR158	57512	broad.mit.edu	37	10	25701316	25701316	+	Nonsense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr10:25701316C>T	ENST00000376351.3	+	4	1608	c.1249C>T	c.(1249-1251)Cga>Tga	p.R417*		NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	417					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TAAGTATTTACGACTTGCCAT	0.512																																							uc001isj.2		NA																	0				ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						c.(1249-1251)CGA>TGA		G protein-coupled receptor 158 precursor							260.0	226.0	238.0					10																	25701316		2203	4300	6503	SO:0001587	stop_gained	57512					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr10:25701316C>T	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1249C>T	10.37:g.25701316C>T	ENSP00000365529:p.Arg417*						p.R417*	NM_020752	NP_065803	Q5T848	GP158_HUMAN			4	1309	+			417			Extracellular (Potential).		Q6QR81|Q9ULT3	Nonsense_Mutation	SNP	ENST00000376351.3	37	c.1249C>T	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	C	42	9.510353	0.99190	.	.	ENSG00000151025	ENST00000376351	.	.	.	6.16	3.25	0.37280	.	0.000000	0.53938	D	0.000042	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.5634	0.76269	0.3616:0.6384:0.0:0.0	.	.	.	.	X	417	.	ENSP00000365529:R417X	R	+	1	2	GPR158	25741322	1.000000	0.71417	0.975000	0.42487	0.970000	0.65996	2.899000	0.48679	0.441000	0.26529	-0.158000	0.13435	CGA		0.512	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110		7	223	0	0	0	0.006214	0	7	223				
GAD2	2572	broad.mit.edu	37	10	26559665	26559665	+	Missense_Mutation	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr10:26559665A>G	ENST00000376261.3	+	10	1575	c.1072A>G	c.(1072-1074)Aag>Gag	p.K358E	GAD2_ENST00000259271.3_Missense_Mutation_p.K358E	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	358					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CAAAAAGTATAAGATCTGGAT	0.468																																							uc001isp.2		NA																	0				central_nervous_system(1)|skin(1)	2						c.(1072-1074)AAG>GAG		glutamate decarboxylase 2	L-Glutamic Acid(DB00142)						139.0	134.0	136.0					10																	26559665		2203	4300	6503	SO:0001583	missense	2572				glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding	g.chr10:26559665A>G	AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.1072A>G	10.37:g.26559665A>G	ENSP00000365437:p.Lys358Glu					GAD2_uc001isq.2_Missense_Mutation_p.K358E	p.K358E	NM_001134366	NP_001127838	Q05329	DCE2_HUMAN			10	1575	+			358					Q9UD87	Missense_Mutation	SNP	ENST00000376261.3	37	c.1072A>G	CCDS7149.1	.	.	.	.	.	.	.	.	.	.	A	14.33	2.503131	0.44558	.	.	ENSG00000136750	ENST00000376261;ENST00000259271	T;T	0.38077	1.16;1.16	5.76	5.76	0.90799	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.328845	0.40469	N	0.001081	T	0.35799	0.0944	L	0.47016	1.485	0.80722	D	1	B	0.09022	0.002	B	0.15052	0.012	T	0.10730	-1.0617	10	0.62326	D	0.03	-8.6735	15.7416	0.77901	1.0:0.0:0.0:0.0	.	358	Q05329	DCE2_HUMAN	E	358	ENSP00000365437:K358E;ENSP00000259271:K358E	ENSP00000259271:K358E	K	+	1	0	GAD2	26599671	1.000000	0.71417	0.976000	0.42696	0.976000	0.68499	5.772000	0.68889	2.213000	0.71641	0.523000	0.50628	AAG		0.468	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818		22	111	0	0	0	0.014323	0	22	111				
PCDH15	65217	broad.mit.edu	37	10	56128918	56128918	+	Missense_Mutation	SNP	T	T	A	rs538604534		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr10:56128918T>A	ENST00000320301.6	-	5	830	c.436A>T	c.(436-438)Act>Tct	p.T146S	PCDH15_ENST00000373965.2_Missense_Mutation_p.T146S|PCDH15_ENST00000395432.2_Missense_Mutation_p.T146S|PCDH15_ENST00000395446.1_Missense_Mutation_p.T146S|PCDH15_ENST00000361849.3_Missense_Mutation_p.T146S|PCDH15_ENST00000395445.1_Missense_Mutation_p.T146S|PCDH15_ENST00000395430.1_Missense_Mutation_p.T146S|PCDH15_ENST00000373955.1_Missense_Mutation_p.T146S|PCDH15_ENST00000395438.1_Missense_Mutation_p.T146S|PCDH15_ENST00000395433.1_Missense_Mutation_p.T124S|PCDH15_ENST00000395442.1_Missense_Mutation_p.T146S|PCDH15_ENST00000373957.3_Missense_Mutation_p.T124S|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000414778.1_Missense_Mutation_p.T151S|PCDH15_ENST00000395440.1_Missense_Mutation_p.T146S|PCDH15_ENST00000437009.1_Missense_Mutation_p.T146S	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	146	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TGCTTGAAAGTGGGTGAGTTG	0.408										HNSCC(58;0.16)																													uc001jju.1		NA																	0				pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13						c.(436-438)ACT>TCT		protocadherin 15 isoform CD1-4 precursor							168.0	128.0	141.0					10																	56128918		2203	4300	6503	SO:0001583	missense	65217				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding	g.chr10:56128918T>A	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.436A>T	10.37:g.56128918T>A	ENSP00000322604:p.Thr146Ser	HNSCC(58;0.16)				PCDH15_uc010qhq.1_Missense_Mutation_p.T151S|PCDH15_uc010qhr.1_Missense_Mutation_p.T146S|PCDH15_uc010qhs.1_Missense_Mutation_p.T151S|PCDH15_uc010qht.1_Missense_Mutation_p.T146S|PCDH15_uc010qhu.1_Missense_Mutation_p.T146S|PCDH15_uc001jjv.1_Missense_Mutation_p.T124S|PCDH15_uc010qhv.1_Missense_Mutation_p.T146S|PCDH15_uc010qhw.1_Missense_Mutation_p.T146S|PCDH15_uc010qhx.1_Missense_Mutation_p.T146S|PCDH15_uc010qhy.1_Missense_Mutation_p.T151S|PCDH15_uc010qhz.1_Missense_Mutation_p.T146S|PCDH15_uc010qia.1_Missense_Mutation_p.T124S|PCDH15_uc010qib.1_Missense_Mutation_p.T124S|PCDH15_uc001jjw.2_Missense_Mutation_p.T146S	p.T146S	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN			5	831	-		Melanoma(3;0.117)|Lung SC(717;0.238)	146			Cadherin 1.|Extracellular (Potential).		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	c.436A>T	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	T	9.097	1.003068	0.19121	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07;2.07;2.07;2.42;2.07;2.07;2.07;2.07;2.07;2.07;2.07	5.52	4.32	0.51571	Cadherin (1);Cadherin-like (1);	.	.	.	.	T	0.12475	0.0303	N	0.12182	0.205	0.09310	N	1	P;B;B;B;B;B;P;B;B;B;B;B;B;B;B	0.38992	0.653;0.059;0.035;0.035;0.057;0.035;0.653;0.021;0.059;0.035;0.021;0.007;0.013;0.021;0.035	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.39339	0.297;0.017;0.017;0.017;0.053;0.017;0.297;0.016;0.017;0.017;0.01;0.004;0.025;0.016;0.017	T	0.12066	-1.0562	9	0.14252	T	0.57	.	11.6595	0.51339	0.0:0.0:0.2294:0.7706	.	124;146;146;151;146;146;146;146;146;146;146;151;146;124;146	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	S	146;151;146;146;146;146;146;146;146;146;124;124;146;146;151;146;146	ENSP00000363076:T146S;ENSP00000410304:T151S;ENSP00000378826:T146S;ENSP00000378832:T146S;ENSP00000378833:T146S;ENSP00000378829:T146S;ENSP00000378827:T146S;ENSP00000378820:T146S;ENSP00000354950:T146S;ENSP00000378821:T124S;ENSP00000363068:T124S;ENSP00000322604:T146S;ENSP00000378818:T146S;ENSP00000412628:T146S;ENSP00000363066:T146S	ENSP00000322604:T146S	T	-	1	0	PCDH15	55798924	0.983000	0.35010	0.994000	0.49952	0.959000	0.62525	3.775000	0.55349	2.093000	0.63338	0.477000	0.44152	ACT		0.408	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056		7	27	0	0	0	0.00308	0	7	27				
HERC4	26091	broad.mit.edu	37	10	69700789	69700789	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr10:69700789A>T	ENST00000395198.3	-	21	2682	c.2435T>A	c.(2434-2436)gTg>gAg	p.V812E	HERC4_ENST00000412272.2_Intron|HERC4_ENST00000277817.6_Missense_Mutation_p.V702E|HERC4_ENST00000373700.4_Missense_Mutation_p.V804E|HERC4_ENST00000395187.2_3'UTR	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	812	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						ATGGAGGTCCACAATGGTACA	0.333																																							uc001jng.3		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(2434-2436)GTG>GAG		hect domain and RLD 4 isoform a							105.0	110.0	109.0					10																	69700789		2203	4300	6503	SO:0001583	missense	26091				cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity	g.chr10:69700789A>T	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.2435T>A	10.37:g.69700789A>T	ENSP00000378624:p.Val812Glu					HERC4_uc009xpq.2_Missense_Mutation_p.V345E|HERC4_uc001jnf.3_RNA|HERC4_uc001jnh.3_Missense_Mutation_p.V804E|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Missense_Mutation_p.V548E	p.V812E	NM_022079	NP_071362	Q5GLZ8	HERC4_HUMAN			21	2746	-			812			HECT.		Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	ENST00000395198.3	37	c.2435T>A	CCDS41533.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.678247	0.88542	.	.	ENSG00000148634	ENST00000277817;ENST00000395198;ENST00000373700	T;T;T	0.59906	0.23;0.23;0.23	5.66	5.66	0.87406	HECT (4);	0.058232	0.64402	D	0.000002	T	0.82135	0.4971	H	0.94698	3.57	0.80722	D	1	D;D;D;D	0.69078	0.991;0.993;0.984;0.997	P;D;D;D	0.68192	0.844;0.956;0.921;0.953	D	0.87468	0.2412	10	0.87932	D	0	.	15.8772	0.79173	1.0:0.0:0.0:0.0	.	702;662;804;812	Q5GLZ8-6;Q5VXS9;Q5GLZ8-2;Q5GLZ8	.;.;.;HERC4_HUMAN	E	702;812;804	ENSP00000277817:V702E;ENSP00000378624:V812E;ENSP00000362804:V804E	ENSP00000277817:V702E	V	-	2	0	HERC4	69370795	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.310000	0.96267	2.147000	0.66899	0.528000	0.53228	GTG		0.333	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359262.1	NM_015601		19	70	0	0	0	0.010504	0	19	70				
GRID1	2894	broad.mit.edu	37	10	87484184	87484184	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr10:87484184C>A	ENST00000327946.7	-	11	1868	c.1783G>T	c.(1783-1785)Gcc>Tcc	p.A595S	GRID1_ENST00000536331.1_Missense_Mutation_p.A166S	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	595					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CTGGGCTGGGCAGCACTCTGA	0.542										Multiple Myeloma(13;0.14)																													uc001kdl.1		NA																	0				ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10						c.(1783-1785)GCC>TCC		glutamate receptor, ionotropic, delta 1	L-Glutamic Acid(DB00142)						55.0	53.0	54.0					10																	87484184		2203	4300	6503	SO:0001583	missense	2894					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity	g.chr10:87484184C>A	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1783G>T	10.37:g.87484184C>A	ENSP00000330148:p.Ala595Ser	Multiple Myeloma(13;0.14)				GRID1_uc009xsu.1_RNA|GRID1_uc010qmf.1_Missense_Mutation_p.A166S	p.A595S	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN			11	1884	-			595			Cytoplasmic (Potential).		B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	c.1783G>T	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	C	1.504	-0.551340	0.03996	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.52057	0.68;0.68	5.61	-1.66	0.08265	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	1.668810	0.05453	U	0.549838	T	0.14830	0.0358	N	0.01473	-0.845	0.20307	N	0.999913	B	0.02656	0.0	B	0.04013	0.001	T	0.25293	-1.0136	10	0.02654	T	1	.	2.9129	0.05743	0.3656:0.4218:0.0944:0.1182	.	595	Q9ULK0	GRID1_HUMAN	S	595;166	ENSP00000330148:A595S;ENSP00000444455:A166S	ENSP00000330148:A595S	A	-	1	0	GRID1	87474164	0.000000	0.05858	0.029000	0.17559	0.917000	0.54804	-0.684000	0.05173	-0.161000	0.10983	0.650000	0.86243	GCC		0.542	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613		7	36	1	0	8.12818e-05	0.001984	9.31233e-05	7	36				
OPN4	94233	broad.mit.edu	37	10	88415988	88415988	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr10:88415988G>T	ENST00000241891.5	+	2	388	c.221G>T	c.(220-222)gGc>gTc	p.G74V	OPN4_ENST00000372071.2_Missense_Mutation_p.G74V	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	74					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						TATACCCTGGGCACAGTGATC	0.622																																							uc001kdq.2		NA																	0				ovary(1)	1						c.(220-222)GGC>GTC		opsin 4 isoform 1							153.0	139.0	144.0					10																	88415988		2203	4300	6503	SO:0001583	missense	94233				phototransduction|protein-chromophore linkage|regulation of circadian rhythm|rhythmic process|visual perception	integral to membrane|plasma membrane	11-cis retinal binding|G-protein coupled photoreceptor activity	g.chr10:88415988G>T	AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.221G>T	10.37:g.88415988G>T	ENSP00000241891:p.Gly74Val					OPN4_uc001kdp.2_Missense_Mutation_p.G74V|OPN4_uc010qmk.1_Missense_Mutation_p.G74V	p.G74V	NM_033282	NP_150598	Q9UHM6	OPN4_HUMAN			2	448	+			74			Helical; Name=1; (Potential).		B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Missense_Mutation	SNP	ENST00000241891.5	37	c.221G>T	CCDS7376.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.791318	0.90367	.	.	ENSG00000122375	ENST00000372071;ENST00000241891;ENST00000443292	T;T;T	0.38077	1.16;1.16;1.16	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.65396	0.2687	M	0.82630	2.6	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.988;0.988;1.0	T	0.70212	-0.4934	10	0.87932	D	0	.	18.2914	0.90131	0.0:0.0:1.0:0.0	.	74;74;74	C9JWU6;Q9UHM6;Q9UHM6-2	.;OPN4_HUMAN;.	V	74	ENSP00000361141:G74V;ENSP00000241891:G74V;ENSP00000393132:G74V	ENSP00000241891:G74V	G	+	2	0	OPN4	88405968	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.562000	0.82300	2.576000	0.86940	0.561000	0.74099	GGC		0.622	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049158.2	NM_033282		11	94	1	0	0.000673444	0.008291	0.000748663	11	94				
CEP55	55165	broad.mit.edu	37	10	95276916	95276916	+	Nonsense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr10:95276916G>T	ENST00000371485.3	+	6	1208	c.904G>T	c.(904-906)Gag>Tag	p.E302*		NM_001127182.1|NM_018131.4	NP_001120654|NP_060601	Q53EZ4	CEP55_HUMAN	centrosomal protein 55kDa	302					establishment of protein localization (GO:0045184)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|midbody (GO:0030496)				kidney(1)|large_intestine(5)|lung(6)|stomach(1)	13		Colorectal(252;0.207)				GCATAAAACAGAGAAGATACA	0.368																																							uc009xug.2		NA																	0					0						c.(904-906)GAG>TAG		centrosomal protein 55kDa							122.0	130.0	128.0					10																	95276916		2203	4300	6503	SO:0001587	stop_gained	55165				cell division|mitosis	centriole|cleavage furrow|midbody		g.chr10:95276916G>T	AK001402	CCDS7428.1	10q24.1	2014-02-20	2005-12-01	2005-12-01	ENSG00000138180	ENSG00000138180			1161	protein-coding gene	gene with protein product	"""cancer/testis antigen 111"""	610000	"""chromosome 10 open reading frame 3"""	C10orf3		16198290	Standard	NM_018131		Approved	FLJ10540, CT111	uc009xug.3	Q53EZ4	OTTHUMG00000018774	ENST00000371485.3:c.904G>T	10.37:g.95276916G>T	ENSP00000360540:p.Glu302*					CEP55_uc001kiq.3_Nonsense_Mutation_p.E302*	p.E302*	NM_001127182	NP_001120654	Q53EZ4	CEP55_HUMAN			6	1086	+		Colorectal(252;0.207)	302			Potential.		B2RDG8|Q32WF5|Q3MV20|Q5VY28|Q6N034|Q96H32|Q9NVS7	Nonsense_Mutation	SNP	ENST00000371485.3	37	c.904G>T	CCDS7428.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.275791|5.275791	0.95459|0.95459	.|.	.|.	ENSG00000138180|ENSG00000138180	ENST00000371485;ENST00000358339|ENST00000445435	.|.	.|.	.|.	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	0.091170|.	0.85682|.	D|.	0.000000|.	.|T	.|0.72120	.|0.3421	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72279	.|-0.4340	.|3	0.87932|.	D|.	0|.	-18.553|-18.553	16.2022|16.2022	0.82088|0.82088	0.0:0.1329:0.8671:0.0|0.0:0.1329:0.8671:0.0	.|.	.|.	.|.	.|.	X|H	302|141	.|.	ENSP00000351102:E302X|.	E|Q	+|+	1|3	0|2	CEP55|CEP55	95266906|95266906	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.817000|0.817000	0.46193|0.46193	5.255000|5.255000	0.65462|0.65462	2.710000|2.710000	0.92621|0.92621	0.561000|0.561000	0.74099|0.74099	GAG|CAG		0.368	CEP55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049434.1	NM_018131		24	80	1	0	6.32553e-13	0.004656	1.02528e-12	24	80				
AS3MT	57412	broad.mit.edu	37	10	104638606	104638606	+	Splice_Site	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr10:104638606G>T	ENST00000369880.3	+	9	820	c.743G>T	c.(742-744)gGt>gTt	p.G248V	C10orf32-ASMT_ENST00000299353.6_3'UTR	NM_020682.3	NP_065733.2	Q9HBK9	AS3MT_HUMAN	arsenite methyltransferase	248					arsonoacetate metabolic process (GO:0018872)|toxin metabolic process (GO:0009404)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	arsenite methyltransferase activity (GO:0030791)|methylarsonite methyltransferase activity (GO:0030792)			large_intestine(1)|lung(6)	7		Colorectal(252;0.122)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;5.87e-09)|all cancers(201;1.58e-07)|BRCA - Breast invasive adenocarcinoma(275;0.223)		CTATTTTTAGGTGACTGTCGT	0.413																																							uc001kwk.2		NA																	0					0						c.(742-744)GGT>GTT		arsenic (+3 oxidation state) methyltransferase							128.0	118.0	121.0					10																	104638606		1909	4130	6039	SO:0001630	splice_region_variant	57412				arsonoacetate metabolic process|toxin metabolic process	cytosol	arsenite methyltransferase activity|methylarsonite methyltransferase activity	g.chr10:104638606G>T	AF226730	CCDS41567.1	10q24.33	2014-05-09	2014-05-09		ENSG00000214435	ENSG00000214435	2.1.1.137		17452	protein-coding gene	gene with protein product		611806	"""arsenic (+3 oxidation state) methyltransferase"""			11790780	Standard	NM_020682		Approved	CYT19	uc001kwk.3	Q9HBK9	OTTHUMG00000018972	ENST00000369880.3:c.743-1G>T	10.37:g.104638606G>T						AS3MT_uc001kwj.2_Missense_Mutation_p.G250V|AS3MT_uc009xxh.2_Missense_Mutation_p.G248V	p.G248V	NM_020682	NP_065733	Q9HBK9	AS3MT_HUMAN		Epithelial(162;5.87e-09)|all cancers(201;1.58e-07)|BRCA - Breast invasive adenocarcinoma(275;0.223)	9	883	+		Colorectal(252;0.122)|all_hematologic(284;0.152)|Breast(234;0.198)	248					A6NP79|Q0VDK3|Q0VDK4|Q5PZ02	Missense_Mutation	SNP	ENST00000369880.3	37	c.743G>T	CCDS41567.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.621311	0.87460	.	.	ENSG00000214435	ENST00000369880	T	0.31247	1.5	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.61887	0.2383	M	0.86651	2.83	0.44194	D	0.997017	D;D;D	0.89917	1.0;0.998;0.998	D;D;D	0.70935	0.971;0.948;0.948	T	0.66838	-0.5822	8	.	.	.	.	18.1191	0.89565	0.0:0.0:1.0:0.0	.	248;248;248	Q0VDK3;Q9HBK9;Q0VDK4	.;AS3MT_HUMAN;.	V	248	ENSP00000358896:G248V	.	G	+	2	0	AS3MT	104628596	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.828000	0.92047	2.569000	0.86673	0.561000	0.74099	GGT		0.413	AS3MT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050107.1	NM_020682	Missense_Mutation	10	33	1	0	7.48243e-07	0.006214	9.64839e-07	10	33				
ATRNL1	26033	broad.mit.edu	37	10	117026348	117026348	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr10:117026348A>T	ENST00000355044.3	+	12	1973	c.1847A>T	c.(1846-1848)aAg>aTg	p.K616M		NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	616	PSI 1.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CCAAATTGCAAGGCTTTCAGA	0.338																																							uc001lcg.2		NA																	0				ovary(5)|lung(1)|central_nervous_system(1)	7						c.(1846-1848)AAG>ATG		attractin-like 1 precursor							92.0	101.0	98.0					10																	117026348		2203	4299	6502	SO:0001583	missense	26033					integral to membrane	sugar binding	g.chr10:117026348A>T	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.1847A>T	10.37:g.117026348A>T	ENSP00000347152:p.Lys616Met						p.K616M	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)	12	2233	+		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)	616			PSI 1.|Kelch 6.|Extracellular (Potential).		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	37	c.1847A>T	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	A	14.85	2.659759	0.47572	.	.	ENSG00000107518	ENST00000355044	T	0.67865	-0.29	5.77	4.59	0.56863	.	0.213333	0.47852	D	0.000215	T	0.43456	0.1248	N	0.08118	0	0.80722	D	1	P	0.36495	0.556	B	0.31191	0.125	T	0.52888	-0.8515	10	0.54805	T	0.06	-20.2926	12.2703	0.54702	0.8731:0.0:0.0:0.1269	.	616	Q5VV63	ATRN1_HUMAN	M	616	ENSP00000347152:K616M	ENSP00000347152:K616M	K	+	2	0	ATRNL1	117016338	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.232000	0.51302	2.194000	0.70268	0.377000	0.23210	AAG		0.338	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349		20	70	0	0	0	0.008871	0	20	70				
GFRA1	2674	broad.mit.edu	37	10	118030531	118030531	+	Missense_Mutation	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr10:118030531T>C	ENST00000355422.6	-	3	687	c.137A>G	c.(136-138)tAc>tGc	p.Y46C	GFRA1_ENST00000439649.3_Missense_Mutation_p.Y46C|GFRA1_ENST00000369236.1_Missense_Mutation_p.Y46C|GFRA1_ENST00000490345.1_5'Flank	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	46					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		TAGCGTGCGGTACTTGGTGCT	0.642																																					Ovarian(128;329 1725 45498 46808 50759)	Ovarian(128;329 1725 45498 46808 50759)	uc001lcj.2		NA																	0				ovary(1)|pancreas(1)	2						c.(136-138)TAC>TGC		GDNF family receptor alpha 1 isoform a							71.0	59.0	63.0					10																	118030531		2203	4300	6503	SO:0001583	missense	2674				axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity	g.chr10:118030531T>C	AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.137A>G	10.37:g.118030531T>C	ENSP00000347591:p.Tyr46Cys					GFRA1_uc001lci.2_Missense_Mutation_p.Y46C|GFRA1_uc009xyr.2_Missense_Mutation_p.Y46C	p.Y46C	NM_005264	NP_005255	P56159	GFRA1_HUMAN		all cancers(201;0.0337)	3	835	-		Lung NSC(174;0.21)	46			1.		A8KA21|O15507|O43912	Missense_Mutation	SNP	ENST00000355422.6	37	c.137A>G	CCDS44481.1	.	.	.	.	.	.	.	.	.	.	T	19.04	3.750268	0.69533	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000369234	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	3.95	3.95	0.45737	GDNF/GAS1 (2);	0.000000	0.85682	D	0.000000	T	0.77618	0.4157	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.72338	0.977;0.939	T	0.79303	-0.1859	10	0.87932	D	0	-21.4137	9.1326	0.36854	0.2373:0.0:0.0:0.7627	.	46;46	P56159;P56159-2	GFRA1_HUMAN;.	C	46	ENSP00000393725:Y46C;ENSP00000358239:Y46C;ENSP00000347591:Y46C;ENSP00000358237:Y46C	ENSP00000347591:Y46C	Y	-	2	0	GFRA1	118020521	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.897000	0.56273	1.662000	0.50781	0.449000	0.29647	TAC		0.642	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793		7	67	0	0	0	0.00308	0	7	67				
TACC2	10579	broad.mit.edu	37	10	123970146	123970146	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr10:123970146G>T	ENST00000369005.1	+	9	6546	c.6206G>T	c.(6205-6207)cGg>cTg	p.R2069L	TACC2_ENST00000515603.1_Missense_Mutation_p.R2024L|TACC2_ENST00000358010.1_Missense_Mutation_p.R215L|TACC2_ENST00000369001.1_5'UTR|TACC2_ENST00000360561.3_Missense_Mutation_p.R147L|TACC2_ENST00000260733.3_Missense_Mutation_p.R147L|TACC2_ENST00000453444.2_Missense_Mutation_p.R2073L|TACC2_ENST00000515273.1_Missense_Mutation_p.R2073L|TACC2_ENST00000369000.1_5'UTR|TACC2_ENST00000368999.1_Missense_Mutation_p.R147L|TACC2_ENST00000513429.1_Missense_Mutation_p.R215L|TACC2_ENST00000369004.3_Missense_Mutation_p.R147L|TACC2_ENST00000334433.3_Missense_Mutation_p.R2069L	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	2069					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				GTGAACACACGGAGGAAGTCC	0.517																																							uc001lfv.2		NA																	0				ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10						c.(6205-6207)CGG>CTG		transforming, acidic coiled-coil containing							127.0	116.0	119.0					10																	123970146		2203	4300	6503	SO:0001583	missense	10579					microtubule organizing center|nucleus	nuclear hormone receptor binding	g.chr10:123970146G>T	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.6206G>T	10.37:g.123970146G>T	ENSP00000358001:p.Arg2069Leu					TACC2_uc001lfw.2_Missense_Mutation_p.R215L|TACC2_uc009xzx.2_Missense_Mutation_p.R2024L|TACC2_uc010qtv.1_Missense_Mutation_p.R2073L|TACC2_uc001lfx.2_5'UTR|TACC2_uc001lfy.2_5'UTR|TACC2_uc001lfz.2_Missense_Mutation_p.R147L|TACC2_uc001lga.2_Missense_Mutation_p.R147L|TACC2_uc009xzy.2_Missense_Mutation_p.R147L|TACC2_uc001lgb.2_Missense_Mutation_p.R104L|TACC2_uc010qtw.1_Missense_Mutation_p.R164L	p.R2069L	NM_206862	NP_996744	O95359	TACC2_HUMAN			9	6566	+		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)	2069					Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	c.6206G>T	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.136265	0.56936	.	.	ENSG00000138162	ENST00000369005;ENST00000513429;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000358010;ENST00000453444;ENST00000340076;ENST00000360561;ENST00000368999;ENST00000369004;ENST00000260733;ENST00000514539	T;T;T;T;T;T;T;T;T;T;T;T	0.11063	3.74;3.32;3.83;3.81;3.74;3.32;3.83;3.14;3.2;3.16;3.19;2.81	5.5	4.59	0.56863	.	0.251703	0.21140	N	0.079499	T	0.31104	0.0786	M	0.65975	2.015	0.39672	D	0.970777	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0;0.999;0.999;0.999;1.0	D;D;D;D;D;D;D;D;D	0.91635	0.999;0.998;0.994;0.998;0.998;0.997;0.997;0.997;0.998	T	0.05566	-1.0877	10	0.28530	T	0.3	-19.4861	16.4129	0.83725	0.0:0.1316:0.8684:0.0	.	164;2073;147;2024;2073;147;147;215;2069	E9PGB3;E9PBC6;D6RAA5;E7EMZ9;B7ZMJ9;O95359-6;O95359-1;O95359-5;O95359	.;.;.;.;.;.;.;.;TACC2_HUMAN	L	2069;215;2073;2024;2069;215;2073;2059;147;147;147;147;164	ENSP00000358001:R2069L;ENSP00000425062:R215L;ENSP00000424467:R2073L;ENSP00000427618:R2024L;ENSP00000334280:R2069L;ENSP00000350701:R215L;ENSP00000395048:R2073L;ENSP00000353763:R147L;ENSP00000357995:R147L;ENSP00000422815:R147L;ENSP00000260733:R147L;ENSP00000420967:R164L	ENSP00000260733:R147L	R	+	2	0	TACC2	123960136	0.988000	0.35896	0.965000	0.40720	0.543000	0.35085	3.606000	0.54095	1.300000	0.44818	0.655000	0.94253	CGG		0.517	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1			18	83	1	0	1.67942e-08	0.006122	2.35118e-08	18	83				
MUC2	4583	broad.mit.edu	37	11	1104128	1104128	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:1104128C>T	ENST00000441003.2	+	49	8346	c.8319C>T	c.(8317-8319)agC>agT	p.S2773S		NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	5135					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TGGTCCTGAGCTGCCCCAATG	0.682																																							uc001lsx.1		NA																	0				lung(1)|breast(1)	2						c.(15403-15405)AGC>AGT		mucin 2 precursor	Pranlukast(DB01411)						14.0	20.0	18.0					11																	1104128		2045	4180	6225	SO:0001819	synonymous_variant	4583					inner mucus layer|outer mucus layer	protein binding	g.chr11:1104128C>T	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.8319C>T	11.37:g.1104128C>T							p.S5135S	NM_002457	NP_002448	Q02817	MUC2_HUMAN		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	52	15432	+		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)	5135			CTCK.		Q14878	Silent	SNP	ENST00000441003.2	37	c.15405C>T																																																																																					0.682	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457		4	24	0	0	0	0.009096	0	4	24				
OR51E2	81285	broad.mit.edu	37	11	4703067	4703067	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:4703067C>A	ENST00000396950.3	-	2	1114	c.875G>T	c.(874-876)gGt>gTt	p.G292V		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	292					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		GGTTTTGGCACCATAGATGAT	0.507																																							uc001lzk.2		NA																	0				lung(3)|ovary(2)	5						c.(874-876)GGT>GTT		olfactory receptor, family 51, subfamily E,							162.0	129.0	140.0					11																	4703067		2201	4298	6499	SO:0001583	missense	81285				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:4703067C>A	AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.875G>T	11.37:g.4703067C>A	ENSP00000380153:p.Gly292Val						p.G292V	NM_030774	NP_110401	Q9H255	O51E2_HUMAN		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)	2	1119	-		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)	292			Helical; Name=7; (Potential).		B2RA63|Q6IF94	Missense_Mutation	SNP	ENST00000396950.3	37	c.875G>T	CCDS7751.1	.	.	.	.	.	.	.	.	.	.	C	18.41	3.618244	0.66787	.	.	ENSG00000167332	ENST00000396950	T	0.37058	1.22	5.18	3.2	0.36748	.	0.313431	0.23137	N	0.051507	T	0.49029	0.1533	L	0.49699	1.58	0.58432	D	0.999993	P	0.51449	0.945	P	0.56823	0.807	T	0.56450	-0.7977	10	0.87932	D	0	.	15.6117	0.76727	0.0:0.7236:0.2764:0.0	.	292	Q9H255	O51E2_HUMAN	V	292	ENSP00000380153:G292V	ENSP00000380153:G292V	G	-	2	0	OR51E2	4659643	0.046000	0.20272	0.976000	0.42696	0.938000	0.57974	2.987000	0.49378	1.389000	0.46526	0.655000	0.94253	GGT		0.507	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257198.1	NM_030774		10	50	1	0	7.48243e-07	0.006214	9.64839e-07	10	50				
OR2D2	120776	broad.mit.edu	37	11	6913354	6913354	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:6913354G>C	ENST00000299459.2	-	1	476	c.378C>G	c.(376-378)atC>atG	p.I126M		NM_003700.1	NP_003691.1	Q9H210	OR2D2_HUMAN	olfactory receptor, family 2, subfamily D, member 2	126					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	18		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GAGGATTGCAGATTGCAACAT	0.493																																							uc010rau.1		NA																	0				central_nervous_system(1)|skin(1)	2						c.(376-378)ATC>ATG		olfactory receptor, family 2, subfamily D,							138.0	108.0	118.0					11																	6913354		2201	4296	6497	SO:0001583	missense	120776				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:6913354G>C	AB065824	CCDS31416.1	11p15.4	2012-08-09			ENSG00000166368	ENSG00000166368		"""GPCR / Class A : Olfactory receptors"""	8244	protein-coding gene	gene with protein product		608494		OR2D1		9787077	Standard	NM_003700		Approved	OR11-610, hg27	uc010rau.2	Q9H210	OTTHUMG00000165741	ENST00000299459.2:c.378C>G	11.37:g.6913354G>C	ENSP00000299459:p.Ile126Met						p.I126M	NM_003700	NP_003691	Q9H210	OR2D2_HUMAN		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)	1	378	-		Medulloblastoma(188;0.0523)|all_neural(188;0.236)	126			Cytoplasmic (Potential).		B9EIL5|O95224|Q6IF28|Q8NGH4|Q96R52	Missense_Mutation	SNP	ENST00000299459.2	37	c.378C>G	CCDS31416.1	.	.	.	.	.	.	.	.	.	.	g	15.09	2.730164	0.48939	.	.	ENSG00000166368	ENST00000299459	T	0.59083	0.29	5.23	3.35	0.38373	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000125	T	0.78175	0.4242	H	0.97440	4.005	0.29111	N	0.880865	D	0.67145	0.996	P	0.60682	0.878	T	0.74515	-0.3640	10	0.87932	D	0	-12.2501	4.3806	0.11291	0.0831:0.155:0.6015:0.1604	.	126	Q9H210	OR2D2_HUMAN	M	126	ENSP00000299459:I126M	ENSP00000299459:I126M	I	-	3	3	OR2D2	6869930	0.947000	0.32204	0.943000	0.38184	0.860000	0.49131	-0.003000	0.12901	0.898000	0.36418	-0.148000	0.13756	ATC		0.493	OR2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385986.1	NM_003700		14	63	0	0	0	0.003163	0	14	63				
SYT9	143425	broad.mit.edu	37	11	7324419	7324419	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:7324419C>T	ENST00000318881.6	+	2	532	c.295C>T	c.(295-297)Ctt>Ttt	p.L99F	SYT9_ENST00000396716.2_Missense_Mutation_p.L67F	NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	99					positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.L99F(1)		NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		CCAGGAGCCCCTTAACTACAT	0.547																																							uc001mfe.2		NA																	1	Substitution - Missense(1)		NS(1)	ovary(2)|large_intestine(1)	3						c.(295-297)CTT>TTT		synaptotagmin IX							172.0	158.0	163.0					11																	7324419		2201	4296	6497	SO:0001583	missense	143425					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity	g.chr11:7324419C>T	AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.295C>T	11.37:g.7324419C>T	ENSP00000324419:p.Leu99Phe					SYT9_uc001mfd.2_RNA|SYT9_uc009yfi.2_RNA	p.L99F	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN		Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)	2	532	+			99			Cytoplasmic (Potential).			Missense_Mutation	SNP	ENST00000318881.6	37	c.295C>T	CCDS7778.1	.	.	.	.	.	.	.	.	.	.	C	13.55	2.270281	0.40194	.	.	ENSG00000170743	ENST00000396716;ENST00000318881	T;T	0.57273	0.41;0.47	5.93	4.07	0.47477	.	0.100807	0.43110	N	0.000619	T	0.38799	0.1054	L	0.60455	1.87	0.41319	D	0.987164	P	0.37864	0.61	B	0.28139	0.086	T	0.33137	-0.9880	10	0.07030	T	0.85	.	11.0829	0.48070	0.0:0.8464:0.0:0.1536	.	99	Q86SS6	SYT9_HUMAN	F	67;99	ENSP00000379944:L67F;ENSP00000324419:L99F	ENSP00000324419:L99F	L	+	1	0	SYT9	7280995	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.372000	0.44257	1.520000	0.48965	0.655000	0.94253	CTT		0.547	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384483.1	NM_175733		31	110	0	0	0	0.012213	0	31	110				
NLRP10	338322	broad.mit.edu	37	11	7982838	7982838	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:7982838G>T	ENST00000328600.2	-	2	482	c.321C>A	c.(319-321)cgC>cgA	p.R107R		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	107					defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CCTCTAGGCAGCGCACATGCT	0.512																																							uc001mfv.1		NA																	0				lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9						c.(319-321)CGC>CGA		NLR family, pyrin domain containing 10							69.0	69.0	69.0					11																	7982838		2201	4296	6497	SO:0001819	synonymous_variant	338322						ATP binding	g.chr11:7982838G>T	AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.321C>A	11.37:g.7982838G>T							p.R107R	NM_176821	NP_789791	Q86W26	NAL10_HUMAN		Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)	2	338	-			107					Q2M3C4|Q6JGT0	Silent	SNP	ENST00000328600.2	37	c.321C>A	CCDS7784.1																																																																																				0.512	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821		18	67	1	0	3.51602e-12	0.008871	5.55757e-12	18	67				
KCNC1	3746	broad.mit.edu	37	11	17793517	17793517	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:17793517G>A	ENST00000379472.3	+	2	906	c.876G>A	c.(874-876)gaG>gaA	p.E292E	KCNC1_ENST00000265969.6_Silent_p.E292E	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	292					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	TCTACCTGGAGGTGGGGCTGA	0.572																																							uc001mnk.3		NA																	0				upper_aerodigestive_tract(1)	1						c.(874-876)GAG>GAA		Shaw-related voltage-gated potassium channel							122.0	112.0	116.0					11																	17793517		2200	4293	6493	SO:0001819	synonymous_variant	3746					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr11:17793517G>A	M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.876G>A	11.37:g.17793517G>A						KCNC1_uc009yhc.1_Silent_p.E292E	p.E292E	NM_004976	NP_004967	P48547	KCNC1_HUMAN			2	931	+			292			Helical; Name=Segment S3; (Potential).		K4DI87	Silent	SNP	ENST00000379472.3	37	c.876G>A	CCDS7827.1																																																																																				0.572	KCNC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389389.1	NM_004976		13	92	0	0	0	0.001855	0	13	92				
GAS2	2620	broad.mit.edu	37	11	22707280	22707280	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:22707280C>T	ENST00000454584.2	+	3	517	c.212C>T	c.(211-213)gCa>gTa	p.A71V	GAS2_ENST00000533092.1_3'UTR|GAS2_ENST00000433790.1_Missense_Mutation_p.A71V|GAS2_ENST00000278187.3_Missense_Mutation_p.A71V|RNA5SP338_ENST00000410495.1_RNA	NM_001143830.1	NP_001137302.1	O43903	GAS2_HUMAN	growth arrest-specific 2	71	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|regulation of cell shape (GO:0008360)	actin filament (GO:0005884)|cytosol (GO:0005829)|membrane (GO:0016020)				breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(4)|stomach(1)	24						TGTCAACTTGCAGAAACTATG	0.388																																							uc009yie.2		NA																	0				ovary(1)|skin(1)	2						c.(211-213)GCA>GTA		growth arrest-specific 2							103.0	100.0	101.0					11																	22707280		2203	4300	6503	SO:0001583	missense	2620				cell cycle arrest|cellular component disassembly involved in apoptosis|regulation of cell shape	actin filament|cytosol|membrane		g.chr11:22707280C>T	BC040470	CCDS7858.1	11p14.3	2005-10-11			ENSG00000148935	ENSG00000148935			4167	protein-coding gene	gene with protein product		602835				9521882	Standard	NM_005256		Approved		uc001mqo.3	O43903	OTTHUMG00000166071	ENST00000454584.2:c.212C>T	11.37:g.22707280C>T	ENSP00000401145:p.Ala71Val					GAS2_uc001mqm.2_Missense_Mutation_p.A71V|GAS2_uc001mqn.2_RNA|GAS2_uc001mqo.2_Missense_Mutation_p.A71V	p.A71V	NM_001143830	NP_001137302	O43903	GAS2_HUMAN			3	518	+			71			CH.		B2R9C8|D3DQZ0|Q6ICV8|Q7Z3X8	Missense_Mutation	SNP	ENST00000454584.2	37	c.212C>T	CCDS7858.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.284390	0.80803	.	.	ENSG00000148935	ENST00000528582;ENST00000454584;ENST00000533363;ENST00000278187;ENST00000534801;ENST00000532398;ENST00000433790	D;D;D;D;D;D;D	0.94613	-3.47;-3.47;-3.47;-3.47;-3.47;-3.47;-3.47	5.42	4.51	0.55191	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.95401	0.8507	L	0.56199	1.76	0.58432	D	0.999998	P	0.35481	0.504	P	0.51777	0.679	D	0.94547	0.7750	10	0.41790	T	0.15	-8.4408	14.737	0.69422	0.0:0.9299:0.0:0.0701	.	71	O43903	GAS2_HUMAN	V	71	ENSP00000432584:A71V;ENSP00000401145:A71V;ENSP00000434478:A71V;ENSP00000278187:A71V;ENSP00000433182:A71V;ENSP00000435946:A71V;ENSP00000396708:A71V	ENSP00000278187:A71V	A	+	2	0	GAS2	22663856	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.073000	0.64395	1.433000	0.47394	0.655000	0.94253	GCA		0.388	GAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387717.1	NM_177553		10	51	0	0	0	0.001855	0	10	51				
BBOX1	8424	broad.mit.edu	37	11	27147268	27147268	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:27147268G>T	ENST00000529202.1	+	7	1243	c.904G>T	c.(904-906)Gtg>Ttg	p.V302L	BBOX1_ENST00000525090.1_Missense_Mutation_p.V302L|RP11-1L12.3_ENST00000525302.1_RNA|RP11-1L12.3_ENST00000530430.1_RNA|BBOX1_ENST00000263182.3_Missense_Mutation_p.V302L|RP11-1L12.3_ENST00000526061.1_RNA|BBOX1_ENST00000528583.1_Missense_Mutation_p.V302L			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	302					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	aatatttgatgtgcctgttga	0.363																																							uc001mre.1		NA																	0				ovary(1)	1						c.(904-906)GTG>TTG		gamma-butyrobetaine dioxygenase	Succinic acid(DB00139)|Vitamin C(DB00126)						95.0	80.0	85.0					11																	27147268		2202	4299	6501	SO:0001583	missense	8424				carnitine biosynthetic process	actin cytoskeleton|cytosol|intracellular membrane-bounded organelle	gamma-butyrobetaine dioxygenase activity|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding	g.chr11:27147268G>T	AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.904G>T	11.37:g.27147268G>T	ENSP00000435781:p.Val302Leu					BBOX1_uc009yih.1_Missense_Mutation_p.V302L|BBOX1_uc001mrg.1_Missense_Mutation_p.V302L	p.V302L	NM_003986	NP_003977	O75936	BODG_HUMAN			8	1272	+			302					B2R8L7|D3DQZ1|Q6IBJ2	Missense_Mutation	SNP	ENST00000529202.1	37	c.904G>T	CCDS7862.1	.	.	.	.	.	.	.	.	.	.	G	11.93	1.784370	0.31593	.	.	ENSG00000129151	ENST00000529202;ENST00000263182;ENST00000528583;ENST00000525090	T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42	6.03	3.89	0.44902	.	0.222920	0.44483	D	0.000443	T	0.50565	0.1623	N	0.03948	-0.315	0.38871	D	0.956696	B	0.06786	0.001	B	0.11329	0.006	T	0.50617	-0.8807	10	0.02654	T	1	-2.8434	4.5955	0.12327	0.4265:0.0:0.5735:0.0	.	302	O75936	BODG_HUMAN	L	302	ENSP00000435781:V302L;ENSP00000263182:V302L;ENSP00000434918:V302L;ENSP00000433772:V302L	ENSP00000263182:V302L	V	+	1	0	BBOX1	27103844	1.000000	0.71417	0.996000	0.52242	0.661000	0.39034	1.792000	0.38754	1.469000	0.48083	0.655000	0.94253	GTG		0.363	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387946.1	NM_003986		4	31	1	0	0.00909568	0.009096	0.00960854	4	31				
QSER1	79832	broad.mit.edu	37	11	32953644	32953644	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:32953644G>T	ENST00000399302.2	+	4	788	c.453G>T	c.(451-453)ttG>ttT	p.L151F	QSER1_ENST00000527788.1_Missense_Mutation_p.L151F	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	151	Ser-rich.									breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					AATTTAGTTTGTTGCCTTCAG	0.458																																							uc001mty.2		NA																	0				ovary(3)|central_nervous_system(2)|skin(1)	6						c.(451-453)TTG>TTT		glutamine and serine rich 1							141.0	134.0	136.0					11																	32953644		1920	4142	6062	SO:0001583	missense	79832							g.chr11:32953644G>T	AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.453G>T	11.37:g.32953644G>T	ENSP00000382241:p.Leu151Phe					QSER1_uc001mtz.1_Missense_Mutation_p.L151F|QSER1_uc001mua.2_5'Flank	p.L151F	NM_001076786	NP_001070254	Q2KHR3	QSER1_HUMAN			4	720	+	Breast(20;0.158)		151			Ser-rich.		Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	ENST00000399302.2	37	c.453G>T	CCDS41631.1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.376853	0.61735	.	.	ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788	T;T	0.58210	0.51;0.35	5.18	5.18	0.71444	.	0.000000	0.51477	D	0.000081	T	0.69842	0.3156	M	0.71581	2.175	0.31444	N	0.671623	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.67011	-0.5778	10	0.10111	T	0.7	.	19.0613	0.93095	0.0:0.0:1.0:0.0	.	151;151	Q2KHR3-2;Q2KHR3	.;QSER1_HUMAN	F	151	ENSP00000382241:L151F;ENSP00000432766:L151F	ENSP00000078652:L151F	L	+	3	2	QSER1	32910220	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.059000	0.57470	2.579000	0.87056	0.655000	0.94253	TTG		0.458	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774		26	130	1	0	5.45024e-15	0.00333	9.20903e-15	26	130				
CSTF3	1479	broad.mit.edu	37	11	33108609	33108609	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:33108609C>T	ENST00000323959.4	-	18	1859	c.1720G>A	c.(1720-1722)Gaa>Aaa	p.E574K	TCP11L1_ENST00000324357.9_Intron	NM_001326.2	NP_001317.1	Q12996	CSTF3_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa	574	Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|stomach(1)	19						CTATCCACTTCATCTTTCAGA	0.438																																							uc001muh.2		NA																	0					0						c.(1720-1722)GAA>AAA		cleavage stimulation factor subunit 3 isoform 1							307.0	290.0	295.0					11																	33108609		2202	4298	6500	SO:0001583	missense	1479				mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	protein binding|RNA binding	g.chr11:33108609C>T	U15782	CCDS7883.1, CCDS44563.1, CCDS44564.1	11p13	2007-01-05	2002-08-29		ENSG00000176102	ENSG00000176102			2485	protein-coding gene	gene with protein product		600367	"""cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kD"""			7984242	Standard	XM_006718154		Approved	CstF-77	uc001muh.3	Q12996	OTTHUMG00000166268	ENST00000323959.4:c.1720G>A	11.37:g.33108609C>T	ENSP00000315791:p.Glu574Lys					TCP11L1_uc001muf.1_Intron	p.E574K	NM_001326	NP_001317	Q12996	CSTF3_HUMAN			18	1886	-			574			Pro-rich.		A8K471|D3DR04|E9PB40|Q32P22|Q96FQ8|Q96QD6|Q96QK4	Missense_Mutation	SNP	ENST00000323959.4	37	c.1720G>A	CCDS7883.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.903368	0.52333	.	.	ENSG00000176102	ENST00000323959;ENST00000537832	.	.	.	5.82	5.82	0.92795	Suppressor of forked (1);	0.000000	0.85682	D	0.000000	T	0.56514	0.1990	L	0.46157	1.445	0.80722	D	1	B	0.02656	0.0	B	0.12156	0.007	T	0.54221	-0.8326	9	0.09084	T	0.74	.	20.0966	0.97849	0.0:1.0:0.0:0.0	.	574	Q12996	CSTF3_HUMAN	K	574;507	.	ENSP00000315791:E574K	E	-	1	0	CSTF3	33065185	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.751000	0.94390	0.650000	0.86243	GAA		0.438	CSTF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388801.1	NM_001326		39	230	0	0	0	0.004289	0	39	230				
OR4C46	119749	broad.mit.edu	37	11	51515712	51515712	+	Missense_Mutation	SNP	G	G	T	rs376738452		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:51515712G>T	ENST00000328188.1	+	1	431	c.431G>T	c.(430-432)gGa>gTa	p.G144V		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						CTGCTAATGGGAGTGGTGTGG	0.453																																							uc010ric.1		NA																	0				ovary(1)	1						c.(430-432)GGA>GTA		olfactory receptor, family 4, subfamily C,		G	VAL/GLY	1,4401		0,1,2200	189.0	177.0	181.0		431	-1.2	0.0	11		181	0,8592		0,0,4296	no	missense	OR4C46	NM_001004703.1	109	0,1,6496	TT,TG,GG		0.0,0.0227,0.0077	benign	144/310	51515712	1,12993	2201	4296	6497	SO:0001583	missense	119749				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:51515712G>T		CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.431G>T	11.37:g.51515712G>T	ENSP00000329056:p.Gly144Val						p.G144V	NM_001004703	NP_001004703	A6NHA9	O4C46_HUMAN			1	431	+			144			Helical; Name=4; (Potential).			Missense_Mutation	SNP	ENST00000328188.1	37	c.431G>T	CCDS31498.1	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.459585	0.00171	2.27E-4	0.0	ENSG00000185926	ENST00000328188	T	0.35421	1.31	2.48	-1.25	0.09405	GPCR, rhodopsin-like superfamily (1);	0.152670	0.30510	N	0.009480	T	0.10337	0.0253	N	0.03891	-0.335	0.09310	N	0.999997	B	0.18610	0.029	B	0.29077	0.098	T	0.24404	-1.0161	10	0.02654	T	1	.	1.3303	0.02133	0.1257:0.182:0.3234:0.369	.	144	A6NHA9	O4C46_HUMAN	V	144	ENSP00000329056:G144V	ENSP00000329056:G144V	G	+	2	0	OR4C46	51372288	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.009000	0.13219	-0.409000	0.07553	-1.368000	0.01194	GGA		0.453	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391155.1	NM_001004703		24	159	1	0	7.87624e-14	0.00278	1.29643e-13	24	159				
TRIM48	79097	broad.mit.edu	37	11	55032685	55032685	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:55032685G>A	ENST00000417545.2	+	2	440	c.354G>A	c.(352-354)atG>atA	p.M118I		NM_024114.3	NP_077019.2	Q8IWZ4	TRI48_HUMAN	tripartite motif containing 48	102						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(13)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						CAAAGAAGATGTTCTGTGAAG	0.532																																							uc010rid.1		NA																	0					0						c.(352-354)ATG>ATA		tripartite motif-containing 48							80.0	73.0	76.0					11																	55032685		2187	4260	6447	SO:0001583	missense	79097					intracellular	zinc ion binding	g.chr11:55032685G>A	AF521869	CCDS7947.2	11q12	2013-01-09	2011-01-25		ENSG00000150244	ENSG00000150244		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19021	protein-coding gene	gene with protein product			"""tripartite motif-containing 48"""				Standard	NM_024114		Approved	RNF101	uc010rid.2	Q8IWZ4	OTTHUMG00000157011	ENST00000417545.2:c.354G>A	11.37:g.55032685G>A	ENSP00000402414:p.Met118Ile						p.M118I	NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN			2	440	+			102			B box-type.		Q9BUW4	Missense_Mutation	SNP	ENST00000417545.2	37	c.354G>A	CCDS7947.2	.	.	.	.	.	.	.	.	.	.	g	8.132	0.783204	0.16189	.	.	ENSG00000150244	ENST00000417545	T	0.39787	1.06	0.596	0.596	0.17496	Zinc finger, B-box (3);	.	.	.	.	T	0.20170	0.0485	N	0.10916	0.065	0.20638	N	0.999872	B	0.06786	0.001	B	0.20577	0.03	T	0.22906	-1.0203	9	0.25751	T	0.34	.	4.4726	0.11720	0.0:0.4247:0.5752:1.0E-4	.	102	Q8IWZ4	TRI48_HUMAN	I	118	ENSP00000402414:M118I	ENSP00000402414:M118I	M	+	3	0	TRIM48	54789261	0.940000	0.31905	0.877000	0.34402	0.792000	0.44763	-1.076000	0.03420	0.629000	0.30376	0.413000	0.27773	ATG		0.532	TRIM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347088.1			9	87	0	0	0	0.004482	0	9	87				
OR5D13	390142	broad.mit.edu	37	11	55541127	55541127	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:55541127G>A	ENST00000361760.1	+	1	214	c.214G>A	c.(214-216)Gac>Aac	p.D72N		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	72						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				GTCCTTGACAGACTTCTGTTT	0.388																																							uc010ril.1		NA																	0				ovary(1)|pancreas(1)|skin(1)	3						c.(214-216)GAC>AAC		olfactory receptor, family 5, subfamily D,							175.0	163.0	167.0					11																	55541127		2200	4296	6496	SO:0001583	missense	390142				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55541127G>A	BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.214G>A	11.37:g.55541127G>A	ENSP00000354800:p.Asp72Asn						p.D72N	NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN			1	214	+		all_epithelial(135;0.196)	72			Helical; Name=2; (Potential).		Q6IF68|Q6IFC9	Missense_Mutation	SNP	ENST00000361760.1	37	c.214G>A	CCDS31507.1	.	.	.	.	.	.	.	.	.	.	G	16.41	3.116229	0.56505	.	.	ENSG00000198877	ENST00000361760	T	0.01165	5.24	3.52	3.52	0.40303	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35067	U	0.003464	T	0.09905	0.0243	M	0.93898	3.47	0.39885	D	0.973687	D	0.89917	1.0	D	0.97110	1.0	T	0.04347	-1.0958	10	0.72032	D	0.01	-12.6085	14.2111	0.65764	0.0:0.0:1.0:0.0	.	72	Q8NGL4	OR5DD_HUMAN	N	72	ENSP00000354800:D72N	ENSP00000354800:D72N	D	+	1	0	OR5D13	55297703	0.960000	0.32886	0.776000	0.31678	0.005000	0.04900	3.596000	0.54024	2.001000	0.58596	0.486000	0.48141	GAC		0.388	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391511.1	NM_001001967		27	109	0	0	0	0.004656	0	27	109				
TRIM51	84767	broad.mit.edu	37	11	55653015	55653015	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:55653015C>A	ENST00000449290.2	+	2	203	c.111C>A	c.(109-111)ccC>ccA	p.P37P	TRIM51_ENST00000244891.3_5'Flank	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	37						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										TTTGCCGGCCCTGTTTGTACC	0.507																																							uc010rip.1		NA																	0					0						c.(109-111)CCC>CCA		SPRY domain containing 5							33.0	28.0	30.0					11																	55653015		692	1591	2283	SO:0001819	synonymous_variant	84767					intracellular	zinc ion binding	g.chr11:55653015C>A	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.111C>A	11.37:g.55653015C>A						SPRYD5_uc010riq.1_5'Flank	p.P37P	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN			2	203	+		all_epithelial(135;0.226)	37			RING-type.		A6NMG2	Silent	SNP	ENST00000449290.2	37	c.111C>A																																																																																					0.507	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681		9	58	1	0	1.58986e-06	0.008291	2.01341e-06	9	58				
OR10AG1	282770	broad.mit.edu	37	11	55735603	55735603	+	Missense_Mutation	SNP	G	G	C	rs150679428		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:55735603G>C	ENST00000312345.2	-	1	387	c.337C>G	c.(337-339)Cgc>Ggc	p.R113G		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R113C(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					GCCACGTAGCGGTCATAGGCC	0.428																																							uc010rit.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	skin(2)	2						c.(337-339)CGC>GGC		olfactory receptor, family 10, subfamily AG,							88.0	86.0	86.0					11																	55735603		2201	4296	6497	SO:0001583	missense	282770				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55735603G>C	AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.337C>G	11.37:g.55735603G>C	ENSP00000311477:p.Arg113Gly						p.R113G	NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN			1	337	-	Esophageal squamous(21;0.0137)		113			Cytoplasmic (Potential).		B2RNH4|Q6IEU3	Missense_Mutation	SNP	ENST00000312345.2	37	c.337C>G	CCDS31514.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.880504	0.33255	.	.	ENSG00000174970	ENST00000312345	T	0.77620	-1.11	5.47	4.56	0.56223	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000159	D	0.89602	0.6762	H	0.95504	3.68	0.29162	N	0.877675	D	0.71674	0.998	D	0.69824	0.966	D	0.85537	0.1213	10	0.87932	D	0	.	7.4436	0.27198	0.0851:0.0:0.7504:0.1645	.	113	Q8NH19	O10AG_HUMAN	G	113	ENSP00000311477:R113G	ENSP00000311477:R113G	R	-	1	0	OR10AG1	55492179	0.972000	0.33761	0.961000	0.40146	0.030000	0.12068	1.405000	0.34635	1.357000	0.45904	0.477000	0.44152	CGC		0.428	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391531.1	NM_001005491		13	47	0	0	0	0.013537	0	13	47				
OR10AG1	282770	broad.mit.edu	37	11	55735739	55735739	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:55735739G>T	ENST00000312345.2	-	1	251	c.201C>A	c.(199-201)atC>atA	p.I67I		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					TTGGGATAATGATTGTTACAT	0.348																																							uc010rit.1		NA																	0				skin(2)	2						c.(199-201)ATC>ATA		olfactory receptor, family 10, subfamily AG,							67.0	75.0	72.0					11																	55735739		2200	4295	6495	SO:0001819	synonymous_variant	282770				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55735739G>T	AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.201C>A	11.37:g.55735739G>T							p.I67I	NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN			1	201	-	Esophageal squamous(21;0.0137)		67			Extracellular (Potential).		B2RNH4|Q6IEU3	Silent	SNP	ENST00000312345.2	37	c.201C>A	CCDS31514.1																																																																																				0.348	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391531.1	NM_001005491		14	63	1	0	9.05144e-12	0.001855	1.40972e-11	14	63				
OR8H2	390151	broad.mit.edu	37	11	55872682	55872682	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:55872682A>T	ENST00000313503.1	+	1	164	c.164A>T	c.(163-165)cAg>cTg	p.Q55L		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	55						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					CTGGACCTCCAGCTTCACACT	0.423										HNSCC(53;0.14)																													uc010riy.1		NA																	0				ovary(1)|skin(1)	2						c.(163-165)CAG>CTG		olfactory receptor, family 8, subfamily H,							271.0	245.0	254.0					11																	55872682		2201	4294	6495	SO:0001583	missense	390151				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55872682A>T	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.164A>T	11.37:g.55872682A>T	ENSP00000323982:p.Gln55Leu	HNSCC(53;0.14)					p.Q55L	NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN			1	164	+	Esophageal squamous(21;0.00693)		55			Cytoplasmic (Potential).		Q6IFC1	Missense_Mutation	SNP	ENST00000313503.1	37	c.164A>T	CCDS31518.1	.	.	.	.	.	.	.	.	.	.	a	8.316	0.823166	0.16678	.	.	ENSG00000181767	ENST00000313503	T	0.00580	6.43	3.58	1.17	0.20885	GPCR, rhodopsin-like superfamily (1);	0.408147	0.21259	N	0.077502	T	0.00695	0.0023	L	0.49256	1.55	0.09310	N	1	P	0.44044	0.825	B	0.41813	0.367	T	0.52079	-0.8623	10	0.66056	D	0.02	.	7.6157	0.28156	0.6724:0.0:0.3276:0.0	.	55	Q8N162	OR8H2_HUMAN	L	55	ENSP00000323982:Q55L	ENSP00000323982:Q55L	Q	+	2	0	OR8H2	55629258	0.000000	0.05858	0.452000	0.26994	0.184000	0.23303	-0.249000	0.08842	0.488000	0.27723	0.362000	0.22060	CAG		0.423	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200		61	278	0	0	0	0.01441	0	61	278				
OR5J2	282775	broad.mit.edu	37	11	55944520	55944520	+	Missense_Mutation	SNP	G	G	A	rs573804726		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:55944520G>A	ENST00000312298.1	+	1	427	c.427G>A	c.(427-429)Gag>Aag	p.E143K		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					AAAGTGTGTGGAGCTTGTCAC	0.458																																							uc010rjb.1		NA																	0				ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4						c.(427-429)GAG>AAG		olfactory receptor, family 5, subfamily J,							166.0	152.0	157.0					11																	55944520		2201	4296	6497	SO:0001583	missense	282775				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:55944520G>A	AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.427G>A	11.37:g.55944520G>A	ENSP00000310788:p.Glu143Lys						p.E143K	NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN			1	427	+	Esophageal squamous(21;0.00693)		143			Helical; Name=4; (Potential).		Q6IEU5	Missense_Mutation	SNP	ENST00000312298.1	37	c.427G>A	CCDS31522.1	.	.	.	.	.	.	.	.	.	.	G	1.537	-0.542816	0.04053	.	.	ENSG00000174957	ENST00000312298	T	0.00076	8.76	4.67	2.45	0.29901	GPCR, rhodopsin-like superfamily (1);	1.283540	0.05419	N	0.543970	T	0.00073	0.0002	N	0.00980	-1.08	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.06899	-1.0801	10	0.27082	T	0.32	.	12.0473	0.53487	0.0:0.5492:0.4508:0.0	.	143	Q8NH18	OR5J2_HUMAN	K	143	ENSP00000310788:E143K	ENSP00000310788:E143K	E	+	1	0	OR5J2	55701096	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-1.204000	0.03017	1.066000	0.40716	0.584000	0.79450	GAG		0.458	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391544.1	NM_001005492		22	89	0	0	0	0.010504	0	22	89				
OR9G4	283189	broad.mit.edu	37	11	56510406	56510406	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:56510406G>T	ENST00000302957.3	-	1	881	c.882C>A	c.(880-882)acC>acA	p.T294T		NM_001005284.1	NP_001005284.1	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G, member 4	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						GGTTGATCACGGTGTAGAACA	0.438																																							uc010rjo.1		NA																	0				ovary(2)|skin(1)	3						c.(880-882)ACC>ACA		olfactory receptor, family 9, subfamily G,							197.0	163.0	175.0					11																	56510406		2201	4296	6497	SO:0001819	synonymous_variant	283189				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56510406G>T	BK004400	CCDS31537.1	11q11	2012-08-09			ENSG00000172457	ENSG00000172457		"""GPCR / Class A : Olfactory receptors"""	15322	protein-coding gene	gene with protein product							Standard	NM_001005284		Approved		uc010rjo.2	Q8NGQ1	OTTHUMG00000166932	ENST00000302957.3:c.882C>A	11.37:g.56510406G>T							p.T294T	NM_001005284	NP_001005284	Q8NGQ1	OR9G4_HUMAN			1	882	-			294			Helical; Name=7; (Potential).		Q6IF62|Q96RA9	Silent	SNP	ENST00000302957.3	37	c.882C>A	CCDS31537.1																																																																																				0.438	OR9G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391945.1	NM_001005284		11	74	1	0	5.16669e-11	0.010729	7.85484e-11	11	74				
OR9Q1	219956	broad.mit.edu	37	11	57947124	57947124	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:57947124G>T	ENST00000335397.3	+	3	524	c.208G>T	c.(208-210)Gac>Tac	p.D70Y		NM_001005212.3	NP_001005212.1	Q8NGQ5	OR9Q1_HUMAN	olfactory receptor, family 9, subfamily Q, member 1	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Breast(21;0.222)				CGCTTTCATGGACGTCTGCTA	0.498																																							uc001nmj.2		NA																	0				ovary(1)	1						c.(208-210)GAC>TAC		olfactory receptor, family 9, subfamily Q,							216.0	191.0	199.0					11																	57947124		2201	4296	6497	SO:0001583	missense	219956				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:57947124G>T	AB065734	CCDS31543.1	11q12.1	2012-08-09				ENSG00000186509		"""GPCR / Class A : Olfactory receptors"""	14724	protein-coding gene	gene with protein product							Standard	NM_001005212		Approved		uc001nmj.3	Q8NGQ5		ENST00000335397.3:c.208G>T	11.37:g.57947124G>T	ENSP00000334934:p.Asp70Tyr						p.D70Y	NM_001005212	NP_001005212	Q8NGQ5	OR9Q1_HUMAN			3	524	+		Breast(21;0.222)	70			Helical; Name=2; (Potential).		Q2TAN3|Q96RA7	Missense_Mutation	SNP	ENST00000335397.3	37	c.208G>T	CCDS31543.1	.	.	.	.	.	.	.	.	.	.	G	17.36	3.369731	0.61624	.	.	ENSG00000186509	ENST00000335397	T	0.01185	5.21	4.84	4.84	0.62591	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000072	T	0.16385	0.0394	H	0.99238	4.48	0.52501	D	0.999958	D	0.89917	1.0	D	0.91635	0.999	T	0.36939	-0.9727	10	0.87932	D	0	-25.0809	17.4797	0.87669	0.0:0.0:1.0:0.0	.	70	Q8NGQ5	OR9Q1_HUMAN	Y	70	ENSP00000334934:D70Y	ENSP00000334934:D70Y	D	+	1	0	OR9Q1	57703700	1.000000	0.71417	0.990000	0.47175	0.565000	0.35776	5.162000	0.64942	2.680000	0.91292	0.563000	0.77884	GAC		0.498	OR9Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394538.2	NM_001005212		29	144	1	0	1.7881e-09	0.008361	2.57697e-09	29	144				
OR4D6	219983	broad.mit.edu	37	11	59225093	59225093	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:59225093C>T	ENST00000300127.2	+	1	683	c.660C>T	c.(658-660)gtC>gtT	p.V220V		NM_001004708.1	NP_001004708.1	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D, member 6	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	34						CCTACACTGTCATTCTGGTGA	0.567																																							uc010rku.1		NA																	0				ovary(1)	1						c.(658-660)GTC>GTT		olfactory receptor, family 4, subfamily D,							134.0	116.0	122.0					11																	59225093		2201	4295	6496	SO:0001819	synonymous_variant	219983				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59225093C>T	AB065803	CCDS31562.1	11q12.1	2012-08-09			ENSG00000166884	ENSG00000166884		"""GPCR / Class A : Olfactory receptors"""	15175	protein-coding gene	gene with protein product							Standard	NM_001004708		Approved		uc010rku.2	Q8NGJ1	OTTHUMG00000167340	ENST00000300127.2:c.660C>T	11.37:g.59225093C>T							p.V220V	NM_001004708	NP_001004708	Q8NGJ1	OR4D6_HUMAN			1	660	+			220			Cytoplasmic (Potential).		B2RNP7|Q6IFF5|Q96R74	Silent	SNP	ENST00000300127.2	37	c.660C>T	CCDS31562.1																																																																																				0.567	OR4D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394234.1	NM_001004708		18	93	0	0	0	0.006122	0	18	93				
OR4D11	219986	broad.mit.edu	37	11	59271238	59271238	+	Missense_Mutation	SNP	C	C	T	rs114830141	byFrequency	TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:59271238C>T	ENST00000313253.1	+	1	190	c.190C>T	c.(190-192)Cgc>Tgc	p.R64C		NM_001004706.1	NP_001004706.1	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D, member 11	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29						CTTCCTGCTCCGCAATCTAGC	0.488													c|||	2	0.000399361	0.0	0.0	5008	,	,		20601	0.001		0.001	False		,,,				2504	0.0						uc001noa.1		NA																	0				ovary(1)|skin(1)	2						c.(190-192)CGC>TGC		olfactory receptor, family 4, subfamily D,		C	CYS/ARG	1,4401	2.1+/-5.4	0,1,2200	211.0	205.0	207.0		190	1.5	0.8	11	dbSNP_132	207	3,8587	3.0+/-9.4	0,3,4292	yes	missense	OR4D11	NM_001004706.1	180	0,4,6492	TT,TC,CC		0.0349,0.0227,0.0308	benign	64/312	59271238	4,12988	2201	4295	6496	SO:0001583	missense	219986				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:59271238C>T	AB065810	CCDS31563.1	11q12.1	2012-08-09		2004-03-10	ENSG00000176200	ENSG00000176200		"""GPCR / Class A : Olfactory receptors"""	15174	protein-coding gene	gene with protein product				OR4D11P			Standard	NM_001004706		Approved		uc001noa.1	Q8NGI4	OTTHUMG00000167342	ENST00000313253.1:c.190C>T	11.37:g.59271238C>T	ENSP00000320077:p.Arg64Cys						p.R64C	NM_001004706	NP_001004706	Q8NGI4	OR4DB_HUMAN			1	190	+			64			Helical; Name=2; (Potential).			Missense_Mutation	SNP	ENST00000313253.1	37	c.190C>T	CCDS31563.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	c	8.445	0.851669	0.17034	2.27E-4	3.49E-4	ENSG00000176200	ENST00000313253	T	0.01981	4.52	5.45	1.5	0.22942	GPCR, rhodopsin-like superfamily (1);	0.433417	0.19678	N	0.108590	T	0.01976	0.0062	N	0.25789	0.76	0.09310	N	1	B	0.15719	0.014	B	0.15870	0.014	T	0.44345	-0.9334	10	0.45353	T	0.12	-12.5559	8.5039	0.33175	0.1038:0.6636:0.0:0.2326	.	64	Q8NGI4	OR4DB_HUMAN	C	64	ENSP00000320077:R64C	ENSP00000320077:R64C	R	+	1	0	OR4D11	59027814	0.000000	0.05858	0.756000	0.31282	0.789000	0.44602	-3.107000	0.00601	-0.161000	0.10983	-2.317000	0.00253	CGC		0.488	OR4D11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394236.1	NM_001004706		52	217	0	0	0	0.01441	0	52	217				
MRPL16	54948	broad.mit.edu	37	11	59573868	59573868	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:59573868G>T	ENST00000300151.4	-	4	921	c.708C>A	c.(706-708)acC>acA	p.T236T		NM_017840.3	NP_060310.1	Q9NX20	RM16_HUMAN	mitochondrial ribosomal protein L16	236					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(1)|liver(1)|lung(8)	11						TCCCCTTGTGGGTCAAGTCAT	0.463																																							uc001noh.2		NA																	0				central_nervous_system(1)	1						c.(706-708)ACC>ACA		mitochondrial ribosomal protein L16 precursor							226.0	210.0	215.0					11																	59573868		2201	4295	6496	SO:0001819	synonymous_variant	54948						rRNA binding	g.chr11:59573868G>T	AF183428	CCDS7976.1	11q12.1	2012-09-13			ENSG00000166902	ENSG00000166902		"""Mitochondrial ribosomal proteins / large subunits"""	14476	protein-coding gene	gene with protein product		611829					Standard	NM_017840		Approved	FLJ20484, PNAS-111	uc001noh.2	Q9NX20	OTTHUMG00000167410	ENST00000300151.4:c.708C>A	11.37:g.59573868G>T							p.T236T	NM_017840	NP_060310	Q9NX20	RM16_HUMAN			4	922	-			236					Q9BYD0|Q9HB70	Silent	SNP	ENST00000300151.4	37	c.708C>A	CCDS7976.1																																																																																				0.463	MRPL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394521.1	NM_017840		44	178	1	0	3.4345e-17	0.011902	6.1111e-17	44	178				
OOSP2	219990	broad.mit.edu	37	11	59814444	59814444	+	Silent	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:59814444T>A	ENST00000278855.2	+	4	560	c.375T>A	c.(373-375)tcT>tcA	p.S125S		NM_173801.3	NP_776162.2	Q86WS3	OOSP2_HUMAN		125						extracellular region (GO:0005576)				breast(1)|lung(9)|ovary(2)|prostate(2)|skin(1)	15						CACCAGTTTCTACTGAGAATG	0.373																																							uc001nol.2		NA																	0				ovary(2)|skin(1)	3						c.(373-375)TCT>TCA		placenta-specific 1-like precursor							162.0	158.0	159.0					11																	59814444		2201	4295	6496	SO:0001819	synonymous_variant	219990					extracellular region		g.chr11:59814444T>A																												ENST00000278855.2:c.375T>A	11.37:g.59814444T>A							p.S125S	NM_173801	NP_776162	Q86WS3	PLACL_HUMAN			4	560	+			125					E9PJA4|Q8N9U6	Silent	SNP	ENST00000278855.2	37	c.375T>A	CCDS7979.1																																																																																				0.373	PLAC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394411.1			22	93	0	0	0	0.00333	0	22	93				
MS4A13	503497	broad.mit.edu	37	11	60310044	60310044	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:60310044C>T	ENST00000527948.1	+	3	740	c.182C>T	c.(181-183)cCt>cTt	p.P61L	MS4A13_ENST00000378186.2_Missense_Mutation_p.P152L|MS4A13_ENST00000437058.2_Missense_Mutation_p.P93L|MS4A13_ENST00000378185.2_Missense_Mutation_p.P112L			Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 13	0						integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(1)|lung(2)|skin(2)	8						GAGAGCACTCCTTAAAAACCC	0.358																																							uc001nps.2		NA																	0					0						c.(454-456)CCT>CTT		membrane-spanning 4-domains, subfamily A, member							85.0	87.0	86.0					11																	60310044		2203	4300	6503	SO:0001583	missense	503497					integral to membrane		g.chr11:60310044C>T	AY324188	CCDS31571.1, CCDS41653.1, CCDS60801.1	11q12.2	2005-12-05	2005-12-05		ENSG00000204979	ENSG00000204979			16674	protein-coding gene	gene with protein product							Standard	NM_001012417		Approved		uc001nps.3	Q5J8X5	OTTHUMG00000167615	ENST00000527948.1:c.182C>T	11.37:g.60310044C>T	ENSP00000432713:p.Pro61Leu					MS4A13_uc009ync.2_Missense_Mutation_p.P112L|MS4A13_uc009ynd.2_Missense_Mutation_p.P93L	p.P152L	NM_001012417	NP_001012417	Q5J8X5	M4A13_HUMAN			7	778	+			152					E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	ENST00000527948.1	37	c.455C>T		.	.	.	.	.	.	.	.	.	.	C	10.38	1.334366	0.24253	.	.	ENSG00000204979	ENST00000378186;ENST00000378185;ENST00000437058;ENST00000527948	T;T;T;T	0.50001	2.14;1.79;1.35;0.76	4.37	-2.76	0.05896	.	1.694450	0.03168	N	0.170348	T	0.25606	0.0623	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.22347	-1.0219	10	0.87932	D	0	-22.5894	3.075	0.06243	0.3236:0.2744:0.0:0.4021	.	93;112;152	Q5J8X5-3;Q5J8X5-2;Q5J8X5	.;.;M4A13_HUMAN	L	152;112;93;61	ENSP00000367428:P152L;ENSP00000367427:P112L;ENSP00000415535:P93L;ENSP00000432713:P61L	ENSP00000367427:P112L	P	+	2	0	MS4A13	60066620	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.842000	0.27627	-0.514000	0.06488	-2.561000	0.00173	CCT		0.358	MS4A13-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000395411.1	NM_001012417		3	8	0	0	0	0.004672	0	3	8				
SYT7	9066	broad.mit.edu	37	11	61295600	61295600	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:61295600C>A	ENST00000263846.4	-	5	736	c.409G>T	c.(409-411)Ggc>Tgc	p.G137C	SYT7_ENST00000540677.1_Missense_Mutation_p.G212C|SYT7_ENST00000542670.1_Missense_Mutation_p.G345C|SYT7_ENST00000540831.1_5'UTR|SYT7_ENST00000535826.1_Missense_Mutation_p.G256C|SYT7_ENST00000542836.1_Missense_Mutation_p.G181C|SYT7_ENST00000539008.1_Missense_Mutation_p.G420C	NM_004200.3	NP_004191.2	O43581	SYT7_HUMAN	synaptotagmin VII	137	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|plasma membrane repair (GO:0001778)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(4)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TGGATCCGGCCCAGGTTCTCT	0.647																																							uc001nrv.2		NA																	0				ovary(3)|pancreas(1)	4						c.(409-411)GGC>TGC		synaptotagmin VII							54.0	61.0	59.0					11																	61295600		2202	4299	6501	SO:0001583	missense	9066					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity	g.chr11:61295600C>A	AF038535	CCDS31577.1, CCDS58139.1, CCDS73298.1	11q12-q13.1	2013-01-21			ENSG00000011347	ENSG00000011347		"""Synaptotagmins"""	11514	protein-coding gene	gene with protein product		604146	"""prostate cancer associated protein 7"""	PCANAP7		9615227	Standard	NM_001252065		Approved	IPCA-7, SYT-VII, MGC150517	uc009ynr.3	O43581	OTTHUMG00000168199	ENST00000263846.4:c.409G>T	11.37:g.61295600C>A	ENSP00000263846:p.Gly137Cys					SYT7_uc009ynr.2_Missense_Mutation_p.G212C	p.G137C	NM_004200	NP_004191	O43581	SYT7_HUMAN			5	415	-			137			C2 1.|Cytoplasmic (Potential).		F5GZU9|Q08AH6	Missense_Mutation	SNP	ENST00000263846.4	37	c.409G>T	CCDS31577.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691003	0.88735	.	.	ENSG00000011347	ENST00000263846;ENST00000540677;ENST00000539008;ENST00000542836;ENST00000542670;ENST00000535826;ENST00000545053	T;T;T;T;T;T;D	0.94457	2.5;2.5;2.5;2.5;2.5;2.5;-3.43	4.44	4.44	0.53790	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.98270	0.9427	H	0.96996	3.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99709	1.1006	10	0.87932	D	0	.	17.5426	0.87852	0.0:1.0:0.0:0.0	.	212;137	F5GZU9;O43581	.;SYT7_HUMAN	C	137;212;420;181;345;256;137	ENSP00000263846:G137C;ENSP00000444201:G212C;ENSP00000439694:G420C;ENSP00000444568:G181C;ENSP00000444019:G345C;ENSP00000437720:G256C;ENSP00000443576:G137C	ENSP00000263846:G137C	G	-	1	0	SYT7	61052176	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.574000	0.82434	2.420000	0.82092	0.561000	0.74099	GGC		0.647	SYT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398733.1	NM_004200		24	66	1	0	6.36457e-07	0.003954	8.2571e-07	24	66				
TMEM179B	374395	broad.mit.edu	37	11	62557391	62557391	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:62557391G>C	ENST00000333449.4	+	5	537	c.532G>C	c.(532-534)Gtg>Ctg	p.V178L	TMEM223_ENST00000527073.1_Intron|TMEM223_ENST00000525631.1_Intron|TMEM179B_ENST00000533861.1_3'UTR|NXF1_ENST00000533048.1_5'Flank	NM_199337.2	NP_955369.1	Q7Z7N9	T179B_HUMAN	transmembrane protein 179B	178						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|liver(1)|lung(1)	4						ATTGTGGTGTGTGGTCTTGGT	0.557																																							uc001nvd.3		NA																	0					0						c.(532-534)GTG>CTG		transmembrane protein 179B							218.0	209.0	212.0					11																	62557391		2201	4299	6500	SO:0001583	missense	374395					integral to membrane		g.chr11:62557391G>C	BC051355	CCDS8036.1	11q12.3	2007-11-26			ENSG00000185475	ENSG00000185475			33744	protein-coding gene	gene with protein product							Standard	NM_199337		Approved		uc001nvd.4	Q7Z7N9	OTTHUMG00000167611	ENST00000333449.4:c.532G>C	11.37:g.62557391G>C	ENSP00000333697:p.Val178Leu						p.V178L	NM_199337	NP_955369	Q7Z7N9	T179B_HUMAN			5	562	+			178			Helical; (Potential).			Missense_Mutation	SNP	ENST00000333449.4	37	c.532G>C	CCDS8036.1	.	.	.	.	.	.	.	.	.	.	G	4.253	0.045891	0.08196	.	.	ENSG00000185475	ENST00000333449	.	.	.	5.39	0.715	0.18186	.	0.695011	0.14284	N	0.329352	T	0.07279	0.0184	N	0.00823	-1.155	0.25682	N	0.985789	B	0.02656	0.0	B	0.04013	0.001	T	0.39396	-0.9616	9	0.02654	T	1	.	7.5707	0.27907	0.0:0.3803:0.3393:0.2804	.	178	Q7Z7N9	T179B_HUMAN	L	178	.	ENSP00000333697:V178L	V	+	1	0	TMEM179B	62313967	0.984000	0.35163	0.998000	0.56505	0.991000	0.79684	0.035000	0.13797	0.317000	0.23160	-0.268000	0.10319	GTG		0.557	TMEM179B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395362.2	NM_199337		21	184	0	0	0	0.012319	0	21	184				
NRXN2	9379	broad.mit.edu	37	11	64393933	64393933	+	Splice_Site	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:64393933A>G	ENST00000377551.1	-	19	4059		c.e19+1		NRXN2_ENST00000301894.2_Splice_Site|NRXN2_ENST00000265459.6_Splice_Site|NRXN2_ENST00000377559.3_Intron|NRXN2_ENST00000409571.1_Splice_Site			Q9P2S2	NRX2A_HUMAN	neurexin 2						adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						CTGGTTAATTACCTTTGTCGA	0.433																																							uc001oap.2		NA																	0				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						c.e5+1		neurexin 2 isoform beta precursor							53.0	55.0	54.0					11																	64393933		2201	4297	6498	SO:0001630	splice_region_variant	9379				cell adhesion	integral to membrane		g.chr11:64393933A>G		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.3847+1T>C	11.37:g.64393933A>G						NRXN2_uc001oar.2_Splice_Site_p.G1283_splice|NRXN2_uc001oas.2_Intron|NRXN2_uc001oao.2_5'Flank|NRXN2_uc001oaq.2_Splice_Site_p.G950_splice	p.G237_splice	NM_138734	NP_620063	P58401	NRX2B_HUMAN			5	1220	-								A7E2C1|Q9Y2D6	Splice_Site	SNP	ENST00000377551.1	37	c.709_splice	CCDS8077.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.182482	0.78677	.	.	ENSG00000110076	ENST00000301894;ENST00000377551;ENST00000265459;ENST00000409571	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2406	0.54540	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NRXN2	64150509	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.057000	0.93889	2.068000	0.61886	0.533000	0.62120	.		0.433	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	Intron	15	37	0	0	0	0.00245	0	15	37				
MAP4K2	5871	broad.mit.edu	37	11	64564003	64564003	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:64564003C>A	ENST00000294066.2	-	23	1686	c.1595G>T	c.(1594-1596)tGg>tTg	p.W532L	MAP4K2_ENST00000377350.3_Missense_Mutation_p.W524L	NM_004579.3	NP_004570.2	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase kinase 2	532	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JUN kinase activity (GO:0007257)|immune response (GO:0006955)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|positive regulation of JNK cascade (GO:0046330)|protein phosphorylation (GO:0006468)|vesicle targeting (GO:0006903)	Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(1)|lung(3)|ovary(1)|pancreas(1)|urinary_tract(2)	8						GCAGTAGAGCCAGGAGCAGCG	0.657																																							uc001obh.2		NA																	0				ovary(1)|pancreas(1)	2						c.(1594-1596)TGG>TTG		mitogen-activated protein kinase kinase kinase							81.0	79.0	80.0					11																	64564003		2201	4297	6498	SO:0001583	missense	5871				activation of JUN kinase activity|immune response|positive regulation of JNK cascade|vesicle targeting	basolateral plasma membrane|Golgi membrane|soluble fraction	ATP binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chr11:64564003C>A	BC047865	CCDS8082.1	11q13.1	2011-06-09			ENSG00000168067	ENSG00000168067		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6864	protein-coding gene	gene with protein product		603166		RAB8IP		7515885	Standard	NM_004579		Approved	GCK, BL44	uc001obh.3	Q12851	OTTHUMG00000045328	ENST00000294066.2:c.1595G>T	11.37:g.64564003C>A	ENSP00000294066:p.Trp532Leu					MAP4K2_uc001obg.2_5'Flank|MAP4K2_uc001obi.2_Missense_Mutation_p.W524L	p.W532L	NM_004579	NP_004570	Q12851	M4K2_HUMAN			23	1687	-			532			CNH.		Q86VU3	Missense_Mutation	SNP	ENST00000294066.2	37	c.1595G>T	CCDS8082.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.633099	0.87660	.	.	ENSG00000168067	ENST00000294066;ENST00000377350	T;T	0.05447	3.44;3.44	4.83	4.83	0.62350	Citron-like (3);	0.135959	0.53938	D	0.000055	T	0.24890	0.0604	M	0.76938	2.355	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.79108	0.992;0.992	T	0.00797	-1.1562	10	0.87932	D	0	.	13.482	0.61340	0.0:1.0:0.0:0.0	.	524;532	Q86VU3;Q12851	.;M4K2_HUMAN	L	532;524	ENSP00000294066:W532L;ENSP00000366567:W524L	ENSP00000294066:W532L	W	-	2	0	MAP4K2	64320579	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.143000	0.71756	2.247000	0.74100	0.558000	0.71614	TGG		0.657	MAP4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105239.1	NM_004579		14	77	1	0	0.000151284	0.001855	0.000171779	14	77				
POLA2	23649	broad.mit.edu	37	11	65043444	65043444	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:65043444C>T	ENST00000265465.3	+	5	967	c.436C>T	c.(436-438)Ctc>Ttc	p.L146F	POLA2_ENST00000541089.1_5'UTR	NM_002689.2	NP_002680.2	Q14181	DPOA2_HUMAN	polymerase (DNA directed), alpha 2, accessory subunit	146	Pro/Ser/Thr-rich.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|protein import into nucleus, translocation (GO:0000060)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|protein heterodimerization activity (GO:0046982)			endometrium(1)|large_intestine(2)|lung(7)|urinary_tract(1)	11					Dacarbazine(DB00851)	CCATCAGCTACTCTCACCGTC	0.483																																							uc001odj.2		NA																	0					0						c.(436-438)CTC>TTC		DNA-directed DNA polymerase alpha 2	Dacarbazine(DB00851)						131.0	113.0	119.0					11																	65043444		2201	4297	6498	SO:0001583	missense	23649				DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	nucleoplasm	DNA binding	g.chr11:65043444C>T	BC002990	CCDS8098.1	11q13	2012-05-18	2012-05-18		ENSG00000014138	ENSG00000014138		"""DNA polymerases"""	30073	protein-coding gene	gene with protein product	"""DNA polymerase alpha subunit B"", ""DNA polymerase alpha 70 kDa subunit"""		"""polymerase (DNA directed), alpha 2 (70kD subunit)"""			8223465, 11433027	Standard	NM_002689		Approved	FLJ21662	uc001odj.3	Q14181	OTTHUMG00000165951	ENST00000265465.3:c.436C>T	11.37:g.65043444C>T	ENSP00000265465:p.Leu146Phe					POLA2_uc009yqf.1_Missense_Mutation_p.L146F|POLA2_uc010rod.1_5'UTR	p.L146F	NM_002689	NP_002680	Q14181	DPOA2_HUMAN			5	778	+			146			Pro/Ser/Thr-rich.		B4DNB4|Q9BPV3	Missense_Mutation	SNP	ENST00000265465.3	37	c.436C>T	CCDS8098.1	.	.	.	.	.	.	.	.	.	.	C	11.33	1.608202	0.28623	.	.	ENSG00000014138	ENST00000265465;ENST00000532391	T	0.22134	1.97	5.71	3.64	0.41730	DNA polymerase alpha, subunit B N-terminal (1);	0.119038	0.56097	D	0.000021	T	0.11750	0.0286	N	0.17800	0.525	0.80722	D	1	B;B	0.29162	0.235;0.01	B;B	0.32465	0.146;0.021	T	0.14420	-1.0473	10	0.22109	T	0.4	-17.4011	5.0701	0.14602	0.0:0.6558:0.0:0.3442	.	106;146	E9PIQ6;Q14181	.;DPOA2_HUMAN	F	146;106	ENSP00000265465:L146F	ENSP00000265465:L146F	L	+	1	0	POLA2	64800020	1.000000	0.71417	0.994000	0.49952	0.923000	0.55619	3.410000	0.52664	1.440000	0.47531	-0.142000	0.14014	CTC		0.483	POLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387223.1	NM_002689		10	76	0	0	0	0.013537	0	10	76				
DDIAS	220042	broad.mit.edu	37	11	82643414	82643414	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:82643414G>C	ENST00000533655.1	+	6	1246	c.1034G>C	c.(1033-1035)cGa>cCa	p.R345P	C11orf82_ENST00000329143.3_Missense_Mutation_p.R44P|C11orf82_ENST00000528759.1_3'UTR|C11orf82_ENST00000525361.1_Intron|C11orf82_ENST00000430323.2_Missense_Mutation_p.R345P	NM_145018.3	NP_659455.3	Q8IXT1	DDIAS_HUMAN		345					apoptotic process (GO:0006915)|cellular response to cytokine stimulus (GO:0071345)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to hydroperoxide (GO:0071447)|cellular response to UV (GO:0034644)|hemopoiesis (GO:0030097)|mitotic cell cycle arrest (GO:0071850)|negative regulation of fibroblast apoptotic process (GO:2000270)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	33						TTGGAAATGCGAGAGCCCCTT	0.403																																							uc001ozt.2		NA																	0				ovary(2)	2						c.(1033-1035)CGA>CCA		nitric oxide-inducible gene protein							93.0	102.0	99.0					11																	82643414		2203	4300	6503	SO:0001583	missense	220042				apoptosis|cell cycle arrest	cytoplasm|nucleus		g.chr11:82643414G>C																												ENST00000533655.1:c.1034G>C	11.37:g.82643414G>C	ENSP00000435421:p.Arg345Pro					C11orf82_uc010rsr.1_Missense_Mutation_p.R44P|C11orf82_uc010rss.1_Missense_Mutation_p.R44P|C11orf82_uc009yvd.2_Intron	p.R345P	NM_145018	NP_659455	Q8IXT1	NOXIN_HUMAN			6	1278	+			345					Q96LK6|Q9H856	Missense_Mutation	SNP	ENST00000533655.1	37	c.1034G>C	CCDS8263.1	.	.	.	.	.	.	.	.	.	.	G	6.571	0.473599	0.12521	.	.	ENSG00000165490	ENST00000430323;ENST00000533655;ENST00000329143	T;T;T	0.19806	2.39;2.39;2.12	5.58	-3.43	0.04810	.	0.910862	0.09380	N	0.810032	T	0.07279	0.0184	N	0.08118	0	0.09310	N	1	P	0.36660	0.564	B	0.30179	0.112	T	0.34329	-0.9833	9	.	.	.	.	6.5367	0.22357	0.4989:0.1303:0.3709:0.0	.	345	Q8IXT1	NOXIN_HUMAN	P	345;345;44	ENSP00000414687:R345P;ENSP00000435421:R345P;ENSP00000329930:R44P	.	R	+	2	0	C11orf82	82321062	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	0.234000	0.17930	-0.435000	0.07264	-0.455000	0.05494	CGA		0.403	C11orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391936.1			38	115	0	0	0	0.004289	0	38	115				
CREBZF	58487	broad.mit.edu	37	11	85375677	85375677	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:85375677C>T	ENST00000527447.1	-	1	469	c.243G>A	c.(241-243)gaG>gaA	p.E81E	CREBZF_ENST00000398294.2_5'UTR|CREBZF_ENST00000534224.1_Intron|CREBZF_ENST00000531515.1_Intron	NM_001039618.2	NP_001034707.1	Q9NS37	ZHANG_HUMAN	CREB/ATF bZIP transcription factor	81					negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)				CCTCCATCTCCTCGGGGGAGG	0.697																																					NSCLC(172;674 2044 9050 18334 41735)	NSCLC(172;674 2044 9050 18334 41735)	uc001pas.2		NA																	0				ovary(1)	1						c.(241-243)GAG>GAA		HCF-binding transcription factor Zhangfei							39.0	46.0	44.0					11																	85375677		1866	4086	5952	SO:0001819	synonymous_variant	58487				negative regulation of gene expression, epigenetic|negative regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|response to virus	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr11:85375677C>T	AF039942	CCDS41697.1	11q14.1	2013-01-10			ENSG00000137504	ENSG00000137504		"""basic leucine zipper proteins"""	24905	protein-coding gene	gene with protein product	"""Zhangfei"""	606444				10871379	Standard	NM_001039618		Approved	ZF	uc001pas.2	Q9NS37	OTTHUMG00000133648	ENST00000527447.1:c.243G>A	11.37:g.85375677C>T						CREBZF_uc010rtc.1_RNA|CREBZF_uc010rtd.1_RNA	p.E81E	NM_001039618	NP_001034707	Q9NS37	ZHANG_HUMAN			1	506	-		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)	81					B2R8Q9|Q0P5U9|Q52LT3	Silent	SNP	ENST00000527447.1	37	c.243G>A	CCDS41697.1																																																																																				0.697	CREBZF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390191.2	NM_001039618		23	111	0	0	0	0.00333	0	23	111				
NOX4	50507	broad.mit.edu	37	11	89166020	89166020	+	Silent	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:89166020A>G	ENST00000263317.4	-	7	718	c.480T>C	c.(478-480)ccT>ccC	p.P160P	NOX4_ENST00000343727.5_Silent_p.P136P|NOX4_ENST00000535633.1_Silent_p.P136P|NOX4_ENST00000527956.1_Silent_p.P136P|NOX4_ENST00000527626.1_5'UTR|NOX4_ENST00000375979.3_Intron|NOX4_ENST00000532825.1_Silent_p.P136P|NOX4_ENST00000531342.1_Intron|NOX4_ENST00000542487.1_Silent_p.P136P|NOX4_ENST00000424319.1_Silent_p.P136P|NOX4_ENST00000525196.1_Silent_p.P160P|NOX4_ENST00000413594.2_Silent_p.P181P|NOX4_ENST00000528341.1_Silent_p.P135P|NOX4_ENST00000534731.1_Silent_p.P160P			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	160	Ferric oxidoreductase.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				CTGTCAGGCCAGGAACTATAA	0.343																																							uc001pct.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(478-480)CCT>CCC		NADPH oxidase 4 isoform a							73.0	68.0	70.0					11																	89166020		2201	4299	6500	SO:0001819	synonymous_variant	50507				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity	g.chr11:89166020A>G	AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.480T>C	11.37:g.89166020A>G						NOX4_uc009yvr.2_Silent_p.P135P|NOX4_uc001pcu.2_Silent_p.P86P|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Silent_p.P160P|NOX4_uc009yvo.2_RNA|NOX4_uc010rtu.1_5'UTR|NOX4_uc009yvp.2_Silent_p.P160P|NOX4_uc010rtv.1_Silent_p.P136P|NOX4_uc009yvq.2_Silent_p.P136P|NOX4_uc009yvs.1_RNA	p.P160P	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN			7	719	-		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)	160			Ferric oxidoreductase.|Helical; (Potential).		A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Silent	SNP	ENST00000263317.4	37	c.480T>C	CCDS8285.1																																																																																				0.343	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394054.1	NM_016931		4	16	0	0	0	0.009096	0	4	16				
FOLH1B	219595	broad.mit.edu	37	11	89413826	89413826	+	RNA	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:89413826A>T	ENST00000532352.1	+	0	1311							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						ACAGCTTGGTATACAACCTAA	0.289																																							uc001pda.2		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(496-498)GTA>GTT		folate hydrolase 1B							40.0	40.0	40.0					11																	89413826		2200	4294	6494			219595				proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity	g.chr11:89413826A>T	AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89413826A>T							p.V166V	NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN			8	1024	+			166						Silent	SNP	ENST00000532352.1	37	c.498A>T																																																																																					0.289	FOLH1B-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000395421.1	NM_153696		7	27	0	0	0	0.006214	0	7	27				
C11orf87	399947	broad.mit.edu	37	11	109294692	109294692	+	Silent	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:109294692T>A	ENST00000327419.6	+	2	736	c.333T>A	c.(331-333)ggT>ggA	p.G111G	RP11-708B6.2_ENST00000532992.1_RNA|RP11-708B6.2_ENST00000532929.1_RNA	NM_207645.3	NP_997528.2	Q6NUJ2	CK087_HUMAN	chromosome 11 open reading frame 87	111						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17						GCAGCCGCGGTGGCGGGGGGC	0.657																																							uc001pkn.2		NA																	0				ovary(2)	2						c.(331-333)GGT>GGA		hypothetical protein LOC399947 precursor							58.0	64.0	62.0					11																	109294692		2199	4298	6497	SO:0001819	synonymous_variant	399947					integral to membrane		g.chr11:109294692T>A	AB096240, BC035798	CCDS31672.1	11q22.3	2013-12-13	2013-12-13	2013-12-13	ENSG00000185742	ENSG00000185742			33788	protein-coding gene	gene with protein product	"""neuronal integral membrane protein 1"""					12477932	Standard	NM_207645		Approved	LOH11CR1A, LOC399947, NEURIM1	uc010rwb.2	Q6NUJ2		ENST00000327419.6:c.333T>A	11.37:g.109294692T>A						C11orf87_uc010rwb.1_5'Flank	p.G111G	NM_207645	NP_997528	Q6NUJ2	CK087_HUMAN			2	707	+			111			Cytoplasmic (Potential).		B4E169	Silent	SNP	ENST00000327419.6	37	c.333T>A	CCDS31672.1																																																																																				0.657	C11orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390403.1	NM_207645		17	76	0	0	0	0.014323	0	17	76				
DRD2	1813	broad.mit.edu	37	11	113281557	113281557	+	Nonsense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:113281557G>T	ENST00000362072.3	-	8	1568	c.1224C>A	c.(1222-1224)taC>taA	p.Y408*	DRD2_ENST00000355319.2_Nonsense_Mutation_p.Y410*|DRD2_ENST00000544518.1_Nonsense_Mutation_p.Y407*|RP11-159N11.3_ENST00000546284.1_RNA|DRD2_ENST00000346454.3_Nonsense_Mutation_p.Y379*|DRD2_ENST00000542968.1_Nonsense_Mutation_p.Y408*|DRD2_ENST00000538967.1_Nonsense_Mutation_p.Y410*	NM_000795.3	NP_000786.1	P14416	DRD2_HUMAN	dopamine receptor D2	408					activation of protein kinase activity (GO:0032147)|adenohypophysis development (GO:0021984)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult walking behavior (GO:0007628)|arachidonic acid secretion (GO:0050482)|associative learning (GO:0008306)|auditory behavior (GO:0031223)|axonogenesis (GO:0007409)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|branching morphogenesis of a nerve (GO:0048755)|cellular calcium ion homeostasis (GO:0006874)|cerebral cortex GABAergic interneuron migration (GO:0021853)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|feeding behavior (GO:0007631)|G-protein coupled receptor internalization (GO:0002031)|grooming behavior (GO:0007625)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, sleep (GO:0042321)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of insulin secretion (GO:0046676)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron-neuron synaptic transmission (GO:0007270)|orbitofrontal cortex development (GO:0021769)|peristalsis (GO:0030432)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|pigmentation (GO:0043473)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of receptor internalization (GO:0002092)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|prepulse inhibition (GO:0060134)|protein localization (GO:0008104)|regulation of cAMP metabolic process (GO:0030814)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of heart rate (GO:0002027)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of potassium ion transport (GO:0043266)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, GABAergic (GO:0032228)|release of sequestered calcium ion into cytosol (GO:0051209)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to hypoxia (GO:0001666)|response to inactivity (GO:0014854)|response to iron ion (GO:0010039)|response to light stimulus (GO:0009416)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to toxic substance (GO:0009636)|sensory perception of smell (GO:0007608)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|visual learning (GO:0008542)|Wnt signaling pathway (GO:0016055)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|axon terminus (GO:0043679)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|sperm flagellum (GO:0036126)|synaptic vesicle membrane (GO:0030672)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(18)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	39		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TGAAGGCGCTGTACAGGACAG	0.557																																							uc001pnz.2		NA																	0				pancreas(1)|skin(1)	2						c.(1222-1224)TAC>TAA		dopamine receptor D2 isoform long	Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Carphenazine(DB01038)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Domperidone(DB01184)|Droperidol(DB00450)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Mesoridazine(DB00933)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Sulpiride(DB00391)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Ziprasidone(DB00246)|Zuclopenthixol(DB01624)						246.0	180.0	202.0					11																	113281557		2201	4296	6497	SO:0001587	stop_gained	1813				activation of phospholipase C activity by dopamine receptor signaling pathway|adenohypophysis development|adult walking behavior|arachidonic acid secretion|axonogenesis|behavioral response to cocaine|behavioral response to ethanol|branching morphogenesis of a nerve|cerebral cortex GABAergic interneuron migration|circadian regulation of gene expression|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|intracellular protein kinase cascade|negative regulation of blood pressure|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of dopamine receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|negative regulation of synaptic transmission, glutamatergic|neurological system process involved in regulation of systemic arterial blood pressure|peristalsis|phosphatidylinositol metabolic process|positive regulation of dopamine uptake|positive regulation of growth hormone secretion|positive regulation of neuroblast proliferation|prepulse inhibition|protein localization|regulation of heart rate|regulation of long-term neuronal synaptic plasticity|regulation of potassium ion transport|regulation of sodium ion transport|regulation of synaptic transmission, GABAergic|release of sequestered calcium ion into cytosol|response to amphetamine|response to drug|response to histamine|response to morphine|sensory perception of smell|synapse assembly|temperature homeostasis|visual learning	integral to plasma membrane	dopamine D2 receptor activity|dopamine receptor activity, coupled via Gi/Go|drug binding|potassium channel regulator activity|protein binding	g.chr11:113281557G>T	M29066	CCDS8361.1, CCDS8362.1	11q22-q23	2012-08-08						"""GPCR / Class A : Dopamine receptors"""	3023	protein-coding gene	gene with protein product		126450					Standard	NM_000795		Approved		uc001poa.4	P14416		ENST00000362072.3:c.1224C>A	11.37:g.113281557G>T	ENSP00000354859:p.Tyr408*					DRD2_uc010rwv.1_Nonsense_Mutation_p.Y407*|DRD2_uc001poa.3_Nonsense_Mutation_p.Y408*|DRD2_uc001pob.3_Nonsense_Mutation_p.Y379*	p.Y408*	NM_000795	NP_000786	P14416	DRD2_HUMAN		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	7	1545	-		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)	408			Extracellular (By similarity).		Q9NZR3|Q9UPA9	Nonsense_Mutation	SNP	ENST00000362072.3	37	c.1224C>A	CCDS8361.1	.	.	.	.	.	.	.	.	.	.	G	38	6.983958	0.97983	.	.	ENSG00000149295	ENST00000355319;ENST00000346454;ENST00000362072;ENST00000544518;ENST00000542968;ENST00000538967	.	.	.	5.86	4.95	0.65309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.717	0.69277	0.0694:0.0:0.9306:0.0	.	.	.	.	X	410;379;408;407;408;410	.	ENSP00000278597:Y379X	Y	-	3	2	DRD2	112786767	1.000000	0.71417	1.000000	0.80357	0.592000	0.36648	5.666000	0.68059	1.469000	0.48083	0.655000	0.94253	TAC		0.557	DRD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395834.1	NM_000795		14	94	1	0	4.36969e-10	0.001855	6.41358e-10	14	94				
NXPE1	120400	broad.mit.edu	37	11	114392778	114392778	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:114392778A>T	ENST00000424269.1	-	5	1555	c.1556T>A	c.(1555-1557)aTg>aAg	p.M519K	NXPE1_ENST00000536271.1_Missense_Mutation_p.M235K|NXPE1_ENST00000251921.2_Missense_Mutation_p.M377K			Q8N323	NXPE1_HUMAN	neurexophilin and PC-esterase domain family, member 1	519						extracellular region (GO:0005576)											TGCAATGGTCATGTCCCAGGC	0.398																																							uc001ppa.2		NA																	0					0						c.(1129-1131)ATG>AAG		hypothetical protein LOC120400							190.0	169.0	176.0					11																	114392778		2201	4296	6497	SO:0001583	missense	120400					extracellular region		g.chr11:114392778A>T	BC029049	CCDS8372.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000095110	ENSG00000095110			28527	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member A"""	FAM55A		12477932	Standard	NM_152315		Approved	MGC34290	uc001ppa.3	Q8N323	OTTHUMG00000168284	ENST00000424269.1:c.1556T>A	11.37:g.114392778A>T	ENSP00000411690:p.Met519Lys					FAM55A_uc010rxd.1_Missense_Mutation_p.M226K	p.M377K	NM_152315	NP_689528	Q8N323	FA55A_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.02e-06)|Epithelial(105;0.000144)|all cancers(92;0.00106)	6	1547	-		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)	519					B0YJ13	Missense_Mutation	SNP	ENST00000424269.1	37	c.1130T>A		.	.	.	.	.	.	.	.	.	.	A	18.02	3.531156	0.64972	.	.	ENSG00000095110	ENST00000536271;ENST00000251921;ENST00000424269	T;T;T	0.24723	1.84;1.84;1.84	4.64	3.49	0.39957	.	0.000000	0.85682	D	0.000000	T	0.55033	0.1895	M	0.93462	3.42	0.31267	N	0.692224	D	0.76494	0.999	D	0.74674	0.984	T	0.63871	-0.6539	10	0.87932	D	0	.	6.6126	0.22759	0.7569:0.158:0.0851:0.0	.	519	Q8N323	FA55A_HUMAN	K	235;377;519	ENSP00000445200:M235K;ENSP00000251921:M377K;ENSP00000411690:M519K	ENSP00000251921:M377K	M	-	2	0	FAM55A	113897988	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.261000	0.43276	0.855000	0.35359	0.528000	0.53228	ATG		0.398	NXPE1-201	KNOWN	basic	protein_coding	protein_coding		NM_152315		22	60	0	0	0	0.014323	0	22	60				
OR6M1	390261	broad.mit.edu	37	11	123676321	123676321	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:123676321G>T	ENST00000309154.2	-	1	774	c.737C>A	c.(736-738)tCc>tAc	p.S246Y		NM_001005325.1	NP_001005325.1	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M, member 1	246						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(2)|skin(5)|urinary_tract(1)	29		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		GTGGGCAATGGAGACAACAGT	0.512																																							uc010rzz.1		NA																	0				skin(2)	2						c.(736-738)TCC>TAC		olfactory receptor, family 6, subfamily M,							103.0	88.0	93.0					11																	123676321		2202	4299	6501	SO:0001583	missense	390261				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:123676321G>T	AB065762	CCDS31696.1	11q24.1	2012-08-09			ENSG00000196099	ENSG00000196099		"""GPCR / Class A : Olfactory receptors"""	14711	protein-coding gene	gene with protein product							Standard	NM_001005325		Approved		uc010rzz.2	Q8NGM8	OTTHUMG00000166012	ENST00000309154.2:c.737C>A	11.37:g.123676321G>T	ENSP00000311038:p.Ser246Tyr						p.S246Y	NM_001005325	NP_001005325	Q8NGM8	OR6M1_HUMAN		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)	1	737	-		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)	246			Helical; Name=6; (Potential).		B2RNK0|Q6IEW9|Q96R37	Missense_Mutation	SNP	ENST00000309154.2	37	c.737C>A	CCDS31696.1	.	.	.	.	.	.	.	.	.	.	G	9.451	1.090505	0.20471	.	.	ENSG00000196099	ENST00000309154	T	0.38560	1.13	3.48	3.48	0.39840	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33057	U	0.005328	T	0.63212	0.2492	M	0.90977	3.165	0.09310	N	1	D	0.58620	0.983	P	0.58331	0.837	T	0.58934	-0.7548	10	0.87932	D	0	.	8.722	0.34447	0.0:0.2345:0.7655:0.0	.	246	Q8NGM8	OR6M1_HUMAN	Y	246	ENSP00000311038:S246Y	ENSP00000311038:S246Y	S	-	2	0	OR6M1	123181531	0.000000	0.05858	0.740000	0.30986	0.080000	0.17528	0.130000	0.15850	1.754000	0.51921	0.655000	0.94253	TCC		0.512	OR6M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387437.1	NM_001005325		13	41	1	0	2.27111e-07	0.013537	2.99523e-07	13	41				
ADAMTS8	11095	broad.mit.edu	37	11	130275652	130275652	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:130275652G>T	ENST00000257359.6	-	9	3177	c.2471C>A	c.(2470-2472)aCc>aAc	p.T824N		NM_007037.4	NP_008968.4	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 8	824	Spacer.				negative regulation of cell proliferation (GO:0008285)|phosphate ion transmembrane transport (GO:0035435)	proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)|low-affinity phosphate transmembrane transporter activity (GO:0009673)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		GATGTTGGTGGTTGCTCTCTC	0.572																																							uc001qgg.3		NA																	0				central_nervous_system(1)	1						c.(2470-2472)ACC>AAC		ADAM metallopeptidase with thrombospondin type 1							125.0	145.0	138.0					11																	130275652		2140	4266	6406	SO:0001583	missense	11095				negative regulation of cell proliferation|proteolysis	proteinaceous extracellular matrix	heparin binding|integrin binding|low affinity phosphate transmembrane transporter activity|metalloendopeptidase activity|zinc ion binding	g.chr11:130275652G>T	AF060153	CCDS41732.1	11q25	2008-07-18	2005-08-19		ENSG00000134917	ENSG00000134917		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	224	protein-coding gene	gene with protein product		605175	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8"""			10438512	Standard	NM_007037		Approved	METH2, FLJ41712, ADAM-TS8	uc001qgg.4	Q9UP79	OTTHUMG00000165656	ENST00000257359.6:c.2471C>A	11.37:g.130275652G>T	ENSP00000257359:p.Thr824Asn					ADAMTS8_uc001qgf.2_Missense_Mutation_p.T305N	p.T824N	NM_007037	NP_008968	Q9UP79	ATS8_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)	9	2829	-	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	824			Spacer.		Q9NZS0	Missense_Mutation	SNP	ENST00000257359.6	37	c.2471C>A	CCDS41732.1	.	.	.	.	.	.	.	.	.	.	G	13.64	2.296985	0.40594	.	.	ENSG00000134917	ENST00000531752;ENST00000257359;ENST00000414575	T	0.59364	0.27	5.35	3.38	0.38709	.	0.413783	0.28544	N	0.014973	T	0.44726	0.1307	L	0.55481	1.735	0.30071	N	0.810001	B;B	0.29378	0.243;0.097	B;B	0.23275	0.045;0.044	T	0.40440	-0.9563	10	0.30078	T	0.28	.	5.5567	0.17121	0.0716:0.2615:0.5318:0.1351	.	824;305	Q9UP79;B3KVX9	ATS8_HUMAN;.	N	222;824;853	ENSP00000257359:T824N	ENSP00000257359:T824N	T	-	2	0	ADAMTS8	129780862	0.086000	0.21541	0.997000	0.53966	0.938000	0.57974	1.681000	0.37618	1.225000	0.43566	0.467000	0.42956	ACC		0.572	ADAMTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385636.1	NM_007037		47	191	1	0	2.64894e-19	0.01441	4.82107e-19	47	191				
ADAMTS8	11095	broad.mit.edu	37	11	130278466	130278466	+	Silent	SNP	G	G	T	rs371305326		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:130278466G>T	ENST00000257359.6	-	8	2698	c.1992C>A	c.(1990-1992)gcC>gcA	p.A664A		NM_007037.4	NP_008968.4	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 8	664	Cys-rich.				negative regulation of cell proliferation (GO:0008285)|phosphate ion transmembrane transport (GO:0035435)	proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)|low-affinity phosphate transmembrane transporter activity (GO:0009673)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		GGTCACAGCCGGCCTTGACAC	0.627																																							uc001qgg.3		NA																	0				central_nervous_system(1)	1						c.(1990-1992)GCC>GCA		ADAM metallopeptidase with thrombospondin type 1							61.0	68.0	65.0					11																	130278466		2110	4200	6310	SO:0001819	synonymous_variant	11095				negative regulation of cell proliferation|proteolysis	proteinaceous extracellular matrix	heparin binding|integrin binding|low affinity phosphate transmembrane transporter activity|metalloendopeptidase activity|zinc ion binding	g.chr11:130278466G>T	AF060153	CCDS41732.1	11q25	2008-07-18	2005-08-19		ENSG00000134917	ENSG00000134917		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	224	protein-coding gene	gene with protein product		605175	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8"""			10438512	Standard	NM_007037		Approved	METH2, FLJ41712, ADAM-TS8	uc001qgg.4	Q9UP79	OTTHUMG00000165656	ENST00000257359.6:c.1992C>A	11.37:g.130278466G>T						ADAMTS8_uc001qgf.2_Silent_p.A145A	p.A664A	NM_007037	NP_008968	Q9UP79	ATS8_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)	8	2350	-	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	664			Cys-rich.		Q9NZS0	Silent	SNP	ENST00000257359.6	37	c.1992C>A	CCDS41732.1																																																																																				0.627	ADAMTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385636.1	NM_007037		18	117	1	0	6.94344e-10	0.006122	1.01212e-09	18	117				
IGSF9B	22997	broad.mit.edu	37	11	133799663	133799663	+	Missense_Mutation	SNP	C	C	A	rs553723993		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:133799663C>A	ENST00000321016.8	-	12	1764	c.1534G>T	c.(1534-1536)Gcc>Tcc	p.A512S	IGSF9B_ENST00000533871.2_Missense_Mutation_p.A512S			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	512	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CTGCCCGGGGCATGGGGGCTG	0.592																																							uc001qgx.3		NA																	0					0						c.(1534-1536)GCC>TCC		immunoglobulin superfamily, member 9B							65.0	73.0	70.0					11																	133799663		2019	4174	6193	SO:0001583	missense	22997					integral to membrane|plasma membrane		g.chr11:133799663C>A	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.1534G>T	11.37:g.133799663C>A	ENSP00000317980:p.Ala512Ser					IGSF9B_uc001qgy.1_Missense_Mutation_p.A354S	p.A512S	NM_014987	NP_055802	Q9UPX0	TUTLB_HUMAN		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)	12	1765	-	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)	512			Extracellular (Potential).|Fibronectin type-III 1.		G5EA26	Missense_Mutation	SNP	ENST00000321016.8	37	c.1534G>T		.	.	.	.	.	.	.	.	.	.	C	27.8	4.864259	0.91511	.	.	ENSG00000080854	ENST00000321016;ENST00000533871;ENST00000527648	T;T;T	0.61040	0.14;0.14;0.14	5.52	5.52	0.82312	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.74283	0.3696	M	0.72118	2.19	0.54753	D	0.999988	P	0.50819	0.939	P	0.61592	0.891	T	0.72776	-0.4191	9	0.41790	T	0.15	.	19.4454	0.94844	0.0:1.0:0.0:0.0	.	512	Q9UPX0	TUTLB_HUMAN	S	512;354;512	ENSP00000317980:A512S;ENSP00000436552:A354S;ENSP00000436576:A512S	ENSP00000317980:A512S	A	-	1	0	IGSF9B	133304873	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	5.818000	0.69236	2.586000	0.87340	0.655000	0.94253	GCC		0.592	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502		14	49	1	0	3.27435e-08	0.00245	4.48551e-08	14	49				
KCNA5	3741	broad.mit.edu	37	12	5154561	5154561	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:5154561C>T	ENST00000252321.3	+	1	1477	c.1248C>T	c.(1246-1248)caC>caT	p.H416H		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	416					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	TCTCCCGCCACTCCAAGGGGC	0.627																																							uc001qni.2		NA																	0				ovary(2)|breast(2)	4						c.(1246-1248)CAC>CAT		potassium voltage-gated channel, shaker-related							29.0	31.0	30.0					12																	5154561		2202	4279	6481	SO:0001819	synonymous_variant	3741					Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity	g.chr12:5154561C>T	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1248C>T	12.37:g.5154561C>T							p.H416H	NM_002234	NP_002225	P22460	KCNA5_HUMAN			1	1477	+			416			Helical; Voltage-sensor; Name=Segment S4; (Potential).		Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Silent	SNP	ENST00000252321.3	37	c.1248C>T	CCDS8536.1																																																																																				0.627	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	NM_002234		6	31	0	0	0	0.001984	0	6	31				
VWF	7450	broad.mit.edu	37	12	6181546	6181546	+	Nonsense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:6181546C>A	ENST00000261405.5	-	9	1314	c.1060G>T	c.(1060-1062)Gga>Tga	p.G354*		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	354					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	TAGCGCTTTCCGGAATGCACG	0.632																																							uc001qnn.1		NA																	0				skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12						c.(1060-1062)GGA>TGA		von Willebrand factor preproprotein	Antihemophilic Factor(DB00025)						103.0	88.0	93.0					12																	6181546		2203	4300	6503	SO:0001587	stop_gained	7450				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding	g.chr12:6181546C>A		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.1060G>T	12.37:g.6181546C>A	ENSP00000261405:p.Gly354*					VWF_uc010set.1_Nonsense_Mutation_p.G354*	p.G354*	NM_000552	NP_000543	P04275	VWF_HUMAN			9	1310	-			354					Q8TCE8|Q99806	Nonsense_Mutation	SNP	ENST00000261405.5	37	c.1060G>T	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	C	38	6.994833	0.97990	.	.	ENSG00000110799	ENST00000261405	.	.	.	5.55	5.55	0.83447	.	0.000000	0.45126	D	0.000383	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.0835	0.89451	0.0:1.0:0.0:0.0	.	.	.	.	X	354	.	ENSP00000261405:G354X	G	-	1	0	VWF	6051807	1.000000	0.71417	0.732000	0.30844	0.082000	0.17680	5.347000	0.65998	2.613000	0.88420	0.561000	0.74099	GGA		0.632	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552		17	87	1	0	5.3912e-06	0.006122	6.59155e-06	17	87				
CLEC6A	93978	broad.mit.edu	37	12	8628803	8628804	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:8628803_8628804GG>TT	ENST00000382073.3	+	5	638_639	c.452_453GG>TT	c.(451-453)tGG>tTT	p.W151F		NM_001007033.1	NP_001007034.1	Q6EIG7	CLC6A_HUMAN	C-type lectin domain family 6, member A	151	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				defense response to fungus (GO:0050832)|innate immune response (GO:0045087)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|large_intestine(2)|lung(7)	10	Lung SC(5;0.184)					aattggcaatggattgataaga	0.361																																							uc001qum.1		NA																	0				breast(1)	1						c.(451-453)TGG>TTT		dectin-2																																				SO:0001583	missense	93978				defense response to fungus|innate immune response|positive regulation of cytokine secretion|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	sugar binding	g.chr12:8628803_8628804GG>TT	AY321309	CCDS31739.1	12p13	2005-09-21	2005-02-09	2005-02-11	ENSG00000205846	ENSG00000205846		"""C-type lectin domain containing"""	14556	protein-coding gene	gene with protein product		613579	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 10"""	CLECSF10			Standard	NM_001007033		Approved	dectin-2	uc001qum.1	Q6EIG7	OTTHUMG00000168672	Exception_encountered	12.37:g.8628803_8628804delinsTT	ENSP00000371505:p.Trp151Phe						p.W151F	NM_001007033	NP_001007034	Q6EIG7	CLC6A_HUMAN			5	569_570	+	Lung SC(5;0.184)		151			Extracellular (Potential).|C-type lectin.		A2RUK3	Missense_Mutation	DNP	ENST00000382073.3	37	c.452_453GG>TT	CCDS31739.1																																																																																				0.361	CLEC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400562.1	NM_001007033		14	65	0	0	0	0.004672	0	14	65				
DDX12P	440081	broad.mit.edu	37	12	9573176	9573176	+	IGR	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:9573176G>A								RP13-735L24.1 (22963 upstream) : SNORA75 (24477 downstream)																							ACCTGGCGCAGGTACTCGTAG	0.607																																							uc010sgs.1		NA																	0					0						c.(2137-2139)CTG>TTG		DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12							96.0	100.0	99.0					12																	9573176		692	1591	2283	SO:0001628	intergenic_variant	440081							g.chr12:9573176G>A																													12.37:g.9573176G>A						DDX12_uc001qvx.3_5'Flank|DDX12_uc001qvy.1_5'Flank	p.L713L	NM_004400	NP_004391					21	2332	-									Silent	SNP		37	c.2137C>T																																																																																				0	0.607									4	34	0	0	0	0.009096	0	4	34				
GRIN2B	2904	broad.mit.edu	37	12	13769510	13769510	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:13769510C>T	ENST00000609686.1	-	5	1416	c.1207G>A	c.(1207-1209)Gat>Aat	p.D403N		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	403					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.D403N(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AGATGGTCATCCTCCTGCTCT	0.527																																							uc001rbt.2		NA																	1	Substitution - Missense(1)		skin(1)	central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12						c.(1207-1209)GAT>AAT		N-methyl-D-aspartate receptor subunit 2B	Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)						217.0	194.0	202.0					12																	13769510		2203	4300	6503	SO:0001583	missense	2904				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding	g.chr12:13769510C>T		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1207G>A	12.37:g.13769510C>T	ENSP00000477455:p.Asp403Asn						p.D403N	NM_000834	NP_000825	Q13224	NMDE2_HUMAN			5	1386	-			403			Extracellular (Potential).		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	c.1207G>A	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	C	32	5.187900	0.94923	.	.	ENSG00000150086	ENST00000279593	T	0.06608	3.28	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.10208	0.0250	L	0.53249	1.67	0.80722	D	1	P	0.42518	0.782	B	0.38921	0.285	T	0.05209	-1.0899	10	0.41790	T	0.15	.	19.4657	0.94939	0.0:1.0:0.0:0.0	.	403	Q13224	NMDE2_HUMAN	N	403	ENSP00000279593:D403N	ENSP00000279593:D403N	D	-	1	0	GRIN2B	13660777	1.000000	0.71417	0.995000	0.50966	0.884000	0.51177	7.813000	0.86123	2.579000	0.87056	0.563000	0.77884	GAT		0.527	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			15	80	0	0	0	0.003163	0	15	80				
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	uc001rgp.1	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119		Dom	yes		12	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog			"""L, E, M, O"""			pancreatic|colorectal|lung|thyroid|AML|others		5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)GGT>CGT		c-K-ras2 protein isoform a precursor							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	Cardiofaciocutaneous_syndrome|Noonan_syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	12.37:g.25398285C>G	ENSP00000256078:p.Gly12Arg	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_uc001rgq.1_Missense_Mutation_p.G12R|KRAS_uc001rgr.2_RNA	p.G12R	NM_033360	NP_203524	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)		2	215	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		12		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).	GTP.		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	c.34G>C	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360		3	10	0	0	0	0.004672	0	3	10				
ITPR2	3709	broad.mit.edu	37	12	26753039	26753039	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:26753039C>G	ENST00000381340.3	-	29	4098	c.3682G>C	c.(3682-3684)Gat>Cat	p.D1228H		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1228					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	ATCTTTTCATCATTCTGTAAG	0.343																																							uc001rhg.2		NA																	0				kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14						c.(3682-3684)GAT>CAT		inositol 1,4,5-triphosphate receptor, type 2							93.0	89.0	90.0					12																	26753039		1857	4091	5948	SO:0001583	missense	3709				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity	g.chr12:26753039C>G	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.3682G>C	12.37:g.26753039C>G	ENSP00000370744:p.Asp1228His						p.D1228H	NM_002223	NP_002214	Q14571	ITPR2_HUMAN			29	4099	-	Colorectal(261;0.0847)		1228			Cytoplasmic (Potential).		O94773	Missense_Mutation	SNP	ENST00000381340.3	37	c.3682G>C	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.636847	0.47049	.	.	ENSG00000123104	ENST00000381340	D	0.90504	-2.68	3.78	3.78	0.43462	Intracellular calcium-release channel (1);	0.102155	0.64402	D	0.000003	D	0.92541	0.7631	L	0.40543	1.245	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.92927	0.6360	10	0.59425	D	0.04	.	15.0834	0.72133	0.0:1.0:0.0:0.0	.	1228	Q14571	ITPR2_HUMAN	H	1228	ENSP00000370744:D1228H	ENSP00000370744:D1228H	D	-	1	0	ITPR2	26644306	1.000000	0.71417	0.912000	0.35992	0.271000	0.26615	7.158000	0.77470	2.423000	0.82170	0.650000	0.86243	GAT		0.343	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223		3	19	0	0	0	0.004672	0	3	19				
OVOS2	144203	broad.mit.edu	37	12	31311920	31311920	+	IGR	SNP	C	C	T	rs188062266		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:31311920C>T								RP11-551L14.1 (41515 upstream) : FAM60A (121597 downstream)																							TCAGTTGGAACGAGAGTTGGG	0.333													.|||	1	0.000199681	0.0	0.0	5008	,	,		20107	0.0		0.001	False		,,,				2504	0.0						uc010sjy.1		NA																	0					NA						c.(508-510)TCG>TCA		RecName: Full=Ovostatin homolog 1; Flags: Precursor;							150.0	146.0	147.0					12																	31311920		1824	4075	5899	SO:0001628	intergenic_variant	0							g.chr12:31311920C>T																													12.37:g.31311920C>T							p.S170S							5	510	-									Silent	SNP		37	c.510G>A																																																																																				0	0.333									13	178	0	0	0	0.001855	0	13	178				
TESPA1	9840	broad.mit.edu	37	12	55356595	55356595	+	Missense_Mutation	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:55356595A>G	ENST00000449076.1	-	9	1219	c.1087T>C	c.(1087-1089)Tgc>Cgc	p.C363R	TESPA1_ENST00000531122.1_Missense_Mutation_p.C225R|TESPA1_ENST00000532804.1_Missense_Mutation_p.C225R|TESPA1_ENST00000524622.1_Missense_Mutation_p.C225R|TESPA1_ENST00000316577.8_Missense_Mutation_p.C363R|TESPA1_ENST00000524959.1_5'Flank	NM_001136030.2	NP_001129502.1	A2RU30	TESP1_HUMAN	thymocyte expressed, positive selection associated 1	363					COP9 signalosome assembly (GO:0010387)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)											TCTTCACAGCAGAAGACACAT	0.527																																							uc001sgn.3		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1087-1089)TGC>CGC		hypothetical protein LOC9840							52.0	54.0	53.0					12																	55356595		1982	4155	6137	SO:0001583	missense	9840							g.chr12:55356595A>G	AB018291	CCDS44913.1, CCDS58240.1	12q13.2	2012-03-21	2012-03-21	2012-03-21	ENSG00000135426	ENSG00000135426			29109	protein-coding gene	gene with protein product		615664	"""KIAA0748"""	KIAA0748		9872452	Standard	NM_001136030		Approved		uc001sgn.4	A2RU30	OTTHUMG00000165407	ENST00000449076.1:c.1087T>C	12.37:g.55356595A>G	ENSP00000400892:p.Cys363Arg					KIAA0748_uc001sgl.3_Missense_Mutation_p.C225R|KIAA0748_uc001sgm.3_Missense_Mutation_p.C110R|KIAA0748_uc010spb.1_Missense_Mutation_p.C110R|KIAA0748_uc010spc.1_Missense_Mutation_p.C225R|KIAA0748_uc010spd.1_Missense_Mutation_p.C363R|KIAA0748_uc001sgo.3_RNA	p.C363R	NM_001098815	NP_001092285	A2RU30	K0748_HUMAN			9	1197	-			363					B4DPM3|B4E048|B7Z9K7|O94849|Q4G0P2|Q9P0C4	Missense_Mutation	SNP	ENST00000449076.1	37	c.1087T>C	CCDS44913.1	.	.	.	.	.	.	.	.	.	.	A	0.156	-1.086648	0.01873	.	.	ENSG00000135426	ENST00000524622;ENST00000532804;ENST00000449076;ENST00000316577;ENST00000531122	T;T;T;T;T	0.61158	0.13;0.13;0.13;0.13;0.13	3.88	1.44	0.22558	.	0.470612	0.19295	N	0.117791	T	0.33731	0.0873	N	0.19112	0.55	0.09310	N	0.999996	B	0.02656	0.0	B	0.06405	0.002	T	0.14643	-1.0465	10	0.14656	T	0.56	-0.4309	5.8146	0.18486	0.7783:0.0:0.2217:0.0	.	363	A2RU30	K0748_HUMAN	R	225;225;363;363;225	ENSP00000435622:C225R;ENSP00000432030:C225R;ENSP00000400892:C363R;ENSP00000312679:C363R;ENSP00000433098:C225R	ENSP00000312679:C363R	C	-	1	0	KIAA0748	53642862	0.006000	0.16342	0.004000	0.12327	0.014000	0.08584	0.500000	0.22562	0.303000	0.22785	-0.274000	0.10170	TGC		0.527	TESPA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383822.1	NM_001098815		13	40	0	0	0	0.001855	0	13	40				
E2F7	144455	broad.mit.edu	37	12	77421680	77421680	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:77421680C>A	ENST00000322886.7	-	11	2358	c.2123G>T	c.(2122-2124)tGt>tTt	p.C708F	E2F7_ENST00000416496.2_Missense_Mutation_p.C708F	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	708					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						AGACTGCACACAAAGATATTG	0.403																																							uc001sym.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						c.(2122-2124)TGT>TTT		E2F transcription factor 7							135.0	129.0	131.0					12																	77421680		2203	4300	6503	SO:0001583	missense	144455				cell cycle	transcription factor complex	DNA binding|identical protein binding	g.chr12:77421680C>A	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.2123G>T	12.37:g.77421680C>A	ENSP00000323246:p.Cys708Phe					E2F7_uc009zse.2_Missense_Mutation_p.C195F	p.C708F	NM_203394	NP_976328	Q96AV8	E2F7_HUMAN			11	2359	-			708					A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Missense_Mutation	SNP	ENST00000322886.7	37	c.2123G>T	CCDS9016.1	.	.	.	.	.	.	.	.	.	.	C	5.762	0.324971	0.10900	.	.	ENSG00000165891	ENST00000322886;ENST00000339887;ENST00000416496	T;T	0.15718	2.67;2.4	5.62	3.1	0.35709	.	0.189399	0.47852	D	0.000213	T	0.07188	0.0182	N	0.08118	0	0.28989	N	0.888145	B;B	0.16166	0.016;0.002	B;B	0.11329	0.006;0.001	T	0.36237	-0.9756	10	0.13853	T	0.58	-3.7273	7.4852	0.27427	0.0:0.1911:0.0:0.8089	.	708;708	Q96AV8-2;Q96AV8	.;E2F7_HUMAN	F	708;195;708	ENSP00000323246:C708F;ENSP00000393639:C708F	ENSP00000323246:C708F	C	-	2	0	E2F7	75945811	0.993000	0.37304	0.545000	0.28153	0.808000	0.45660	2.318000	0.43779	0.342000	0.23796	-0.253000	0.11424	TGT		0.403	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1	XM_084871		13	38	1	0	0.000308642	0.003163	0.000347359	13	38				
PLXNC1	10154	broad.mit.edu	37	12	94694764	94694764	+	Silent	SNP	C	C	T	rs113780946		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:94694764C>T	ENST00000258526.4	+	28	4566	c.4317C>T	c.(4315-4317)gaC>gaT	p.D1439D	PLXNC1_ENST00000547057.1_Silent_p.D486D|PLXNC1_ENST00000545312.1_Silent_p.D178D	NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	1439					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CACATATAGACGGCTGTTTGT	0.443													C|||	1	0.000199681	0.0	0.0	5008	,	,		18976	0.001		0.0	False		,,,				2504	0.0						uc001tdc.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(4315-4317)GAC>GAT		plexin C1 precursor							146.0	131.0	136.0					12																	94694764		2203	4300	6503	SO:0001819	synonymous_variant	10154				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding	g.chr12:94694764C>T	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.4317C>T	12.37:g.94694764C>T						PLXNC1_uc010sut.1_Silent_p.D486D|PLXNC1_uc009zsv.2_Silent_p.D178D	p.D1439D	NM_005761	NP_005752	O60486	PLXC1_HUMAN			28	4566	+			1439			Cytoplasmic (Potential).		Q59H25	Silent	SNP	ENST00000258526.4	37	c.4317C>T	CCDS9049.1																																																																																				0.443	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2			16	56	0	0	0	0.004007	0	16	56				
CFAP54	144535	broad.mit.edu	37	12	97137624	97137624	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:97137624C>T	ENST00000524981.4	+	54	7516	c.7493C>T	c.(7492-7494)tCt>tTt	p.S2498F				Q96N23	CL055_HUMAN		0																	TTCAAGGAATCTCCCTCTTCA	0.398																																							uc001tet.1		NA																	0				skin(6)|ovary(1)	7						c.(2767-2769)TCT>TTT		hypothetical protein LOC374467							45.0	48.0	47.0					12																	97137624		2203	4300	6503	SO:0001583	missense	374467							g.chr12:97137624C>T																												ENST00000524981.4:c.7493C>T	12.37:g.97137624C>T	ENSP00000431759:p.Ser2498Phe						p.S923F	NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN			21	2846	+			923						Missense_Mutation	SNP	ENST00000524981.4	37	c.2768C>T		.	.	.	.	.	.	.	.	.	.	C	4.882	0.164005	0.09287	.	.	ENSG00000188596	ENST00000524981;ENST00000342887	.	.	.	4.59	1.31	0.21738	.	1.573400	0.03436	N	0.208573	T	0.23611	0.0571	N	0.22421	0.69	0.09310	N	1	B	0.25667	0.131	B	0.22152	0.038	T	0.17258	-1.0375	9	0.36615	T	0.2	2.7082	2.2587	0.04061	0.386:0.3815:0.1249:0.1075	.	923	Q6ZTY8	CL063_HUMAN	F	2498;923	.	ENSP00000345466:S923F	S	+	2	0	C12orf63	95661755	0.000000	0.05858	0.001000	0.08648	0.452000	0.32318	0.631000	0.24568	0.369000	0.24510	0.561000	0.74099	TCT		0.398	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000395046.4			3	27	0	0	0	0.004672	0	3	27				
HECTD4	283450	broad.mit.edu	37	12	112669411	112669411	+	Missense_Mutation	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:112669411T>C	ENST00000430131.2	-	38	5985	c.4840A>G	c.(4840-4842)Atc>Gtc	p.I1614V	HECTD4_ENST00000550722.1_Missense_Mutation_p.I1890V|HECTD4_ENST00000377560.5_Missense_Mutation_p.I1864V			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1614					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TCTGGGTTGATAGACTCTACA	0.532																																							uc009zwc.2		NA																	0				ovary(1)|lung(1)	2						c.(4840-4842)ATC>GTC		chromosome 12 open reading frame 51							79.0	80.0	80.0					12																	112669411		1914	4134	6048	SO:0001583	missense	283450							g.chr12:112669411T>C	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.4840A>G	12.37:g.112669411T>C	ENSP00000404379:p.Ile1614Val						p.I1614V	NM_001109662	NP_001103132					32	4858	-								L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37	c.4840A>G		.	.	.	.	.	.	.	.	.	.	T	0.017	-1.505924	0.00992	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.39787	1.06;1.06;1.07	5.87	0.849	0.18972	.	.	.	.	.	T	0.18759	0.0450	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28870	-1.0030	9	0.07644	T	0.81	.	8.9293	0.35661	0.0:0.683:0.113:0.2041	.	1614	Q9Y4D8	K0614_HUMAN	V	1864;1614;1890	ENSP00000366783:I1864V;ENSP00000404379:I1614V;ENSP00000449784:I1890V	ENSP00000366783:I1864V	I	-	1	0	C12orf51	111153794	0.000000	0.05858	0.027000	0.17364	0.420000	0.31355	-0.308000	0.08156	-0.112000	0.11979	-1.317000	0.01298	ATC		0.532	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813		16	58	0	0	0	0.00499	0	16	58				
FZD10	11211	broad.mit.edu	37	12	130648510	130648510	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:130648510G>A	ENST00000229030.4	+	1	1507	c.1023G>A	c.(1021-1023)aaG>aaA	p.K341K	FZD10_ENST00000539839.1_Missense_Mutation_p.V309M|FZD10-AS1_ENST00000505807.2_RNA			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	341					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		CCGGCAAGAAGTGGGGCCACG	0.647																																							uc001uii.2		NA																	0				lung(3)|breast(1)|central_nervous_system(1)	5						c.(1021-1023)AAG>AAA		frizzled 10 precursor							50.0	47.0	48.0					12																	130648510		2203	4300	6503	SO:0001819	synonymous_variant	11211				brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding	g.chr12:130648510G>A	AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.1023G>A	12.37:g.130648510G>A						uc001uig.1_5'Flank|uc001uih.1_5'Flank	p.K341K	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)	1	1479	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		341			Cytoplasmic (Potential).			Silent	SNP	ENST00000229030.4	37	c.1023G>A	CCDS9267.1	.	.	.	.	.	.	.	.	.	.	G	11.37	1.618156	0.28801	.	.	ENSG00000111432	ENST00000539839	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	T	0.73916	0.3648	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.77286	-0.2644	5	0.87932	D	0	.	13.8884	0.63724	0.0762:0.0:0.9238:0.0	.	.	.	.	M	309	.	ENSP00000438460:V309M	V	+	1	0	FZD10	129214463	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.090000	0.50191	2.374000	0.81015	0.561000	0.74099	GTG		0.647	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				8	38	0	0	0	0.00308	0	8	38				
ZMYM2	7750	broad.mit.edu	37	13	20656961	20656961	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr13:20656961G>T	ENST00000382874.2	+	24	3799	c.3609G>T	c.(3607-3609)agG>agT	p.R1203S	ZMYM2_ENST00000494061.2_3'UTR|ZMYM2_ENST00000382869.3_Missense_Mutation_p.R1203S|ZMYM2_ENST00000382871.2_Missense_Mutation_p.R1203S	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	1203					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		ATCTCTGGAGGATAAAACAAC	0.318																																							uc001umr.2		NA																	0				lung(3)|ovary(2)|prostate(1)	6						c.(3607-3609)AGG>AGT		zinc finger protein 198							80.0	73.0	75.0					13																	20656961		1825	4073	5898	SO:0001583	missense	7750				regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding	g.chr13:20656961G>T	AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.3609G>T	13.37:g.20656961G>T	ENSP00000372327:p.Arg1203Ser					ZMYM2_uc001ums.2_Missense_Mutation_p.R1203S|ZMYM2_uc001umt.2_Missense_Mutation_p.R1203S|ZMYM2_uc001umv.2_Missense_Mutation_p.R583S|ZMYM2_uc001umw.2_Missense_Mutation_p.R656S	p.R1203S	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)	24	3907	+		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)	1203					A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	ENST00000382874.2	37	c.3609G>T	CCDS45016.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.811132	0.32053	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382874;ENST00000382871;ENST00000382870	T	0.16324	2.35	5.2	5.2	0.72013	.	0.080109	0.85682	D	0.000000	T	0.10121	0.0248	N	0.11427	0.14	0.80722	D	1	B	0.22346	0.068	B	0.18871	0.023	T	0.12682	-1.0538	10	0.46703	T	0.11	-14.2746	12.4526	0.55684	0.0774:0.0:0.9226:0.0	.	1203	Q9UBW7	ZMYM2_HUMAN	S	1203;1203;1201;1201;581	ENSP00000372322:R1203S	ENSP00000372322:R1203S	R	+	3	2	ZMYM2	19554961	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.042000	0.49815	2.573000	0.86826	0.484000	0.47621	AGG		0.318	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2	NM_003453		7	27	1	0	0.00198382	0.001984	0.00216386	7	27				
CDK8	1024	broad.mit.edu	37	13	26975623	26975623	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr13:26975623G>C	ENST00000381527.3	+	12	1634	c.1131G>C	c.(1129-1131)caG>caC	p.Q377H	CDK8_ENST00000480323.1_3'UTR|CDK8_ENST00000536792.1_3'UTR	NM_001260.1	NP_001251.1	P49336	CDK8_HUMAN	cyclin-dependent kinase 8	377	Poly-Gln.				gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	25	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		AGCAGCAGCAGGGCAATAACC	0.468																																							uc001uqr.1		NA																	0				lung(2)|large_intestine(1)|ovary(1)|skin(1)	5						c.(1129-1131)CAG>CAC		cyclin-dependent kinase 8							62.0	60.0	61.0					13																	26975623		2203	4300	6503	SO:0001583	missense	1024				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity	g.chr13:26975623G>C	X85753	CCDS9317.1	13q12	2011-11-08			ENSG00000132964	ENSG00000132964		"""Cyclin-dependent kinases"""	1779	protein-coding gene	gene with protein product		603184				7568034	Standard	NM_001260		Approved	K35	uc001uqr.1	P49336	OTTHUMG00000016617	ENST00000381527.3:c.1131G>C	13.37:g.26975623G>C	ENSP00000370938:p.Gln377His					CDK8_uc001uqs.1_Missense_Mutation_p.Q376H|CDK8_uc001uqt.1_Missense_Mutation_p.Q204H	p.Q377H	NM_001260	NP_001251	P49336	CDK8_HUMAN		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)	12	1157	+	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)	377			Poly-Gln.		Q5VUF3|Q6ISB5	Missense_Mutation	SNP	ENST00000381527.3	37	c.1131G>C	CCDS9317.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.629975	0.46944	.	.	ENSG00000132964	ENST00000381527	T	0.70282	-0.47	5.82	4.04	0.47022	.	0.109625	0.64402	D	0.000005	T	0.65015	0.2651	L	0.57536	1.79	0.80722	D	1	P;P	0.44946	0.846;0.761	B;B	0.42386	0.386;0.215	T	0.67377	-0.5686	10	0.66056	D	0.02	-3.4797	6.8148	0.23824	0.1404:0.0:0.7131:0.1466	.	376;377	P49336-2;P49336	.;CDK8_HUMAN	H	377	ENSP00000370938:Q377H	ENSP00000370938:Q377H	Q	+	3	2	CDK8	25873623	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.890000	0.56220	1.422000	0.47177	0.655000	0.94253	CAG		0.468	CDK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044250.1			9	30	0	0	0	0.004482	0	9	30				
CDX2	1045	broad.mit.edu	37	13	28542718	28542718	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr13:28542718G>T	ENST00000381020.7	-	1	2558	c.426C>A	c.(424-426)ccC>ccA	p.P142P	CDX2_ENST00000548877.1_5'Flank	NM_001265.4	NP_001256.3	Q99626	CDX2_HUMAN	caudal type homeobox 2	142					anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|endosome to lysosome transport (GO:0008333)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|large_intestine(1)|lung(6)	9	all_cancers(110;0.191)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0407)|all cancers(112;0.0491)|OV - Ovarian serous cystadenocarcinoma(117;0.199)		CAGGAGGGCCGGGGTTGAGCG	0.741			T	ETV6	AML																																		uc001urv.2		NA		Dom	yes		13	13q12.3	1045	T	caudal type homeo box transcription factor 2			L	ETV6		AML		0				lung(1)	1						c.(424-426)CCC>CCA		caudal type homeobox 2							13.0	16.0	15.0					13																	28542718		2163	4184	6347	SO:0001819	synonymous_variant	1045				organ morphogenesis|transcription from RNA polymerase II promoter		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr13:28542718G>T	Y13709	CCDS9328.1	13q12.2	2012-03-09	2007-07-09		ENSG00000165556	ENSG00000165556		"""Homeoboxes / ANTP class : HOXL subclass"""	1806	protein-coding gene	gene with protein product		600297	"""caudal type homeo box transcription factor 2"""	CDX3		7698771	Standard	NM_001265		Approved		uc001urv.4	Q99626	OTTHUMG00000016640	ENST00000381020.7:c.426C>A	13.37:g.28542718G>T							p.P142P	NM_001265	NP_001256	Q99626	CDX2_HUMAN	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0407)|all cancers(112;0.0491)|OV - Ovarian serous cystadenocarcinoma(117;0.199)	1	600	-	all_cancers(110;0.191)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	142					O00503|Q5VTU7|Q969L8|Q9UD92	Silent	SNP	ENST00000381020.7	37	c.426C>A	CCDS9328.1																																																																																				0.741	CDX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044312.5			6	6	1	0	5.9392e-07	0.001168	7.72096e-07	6	6				
MTUS2	23281	broad.mit.edu	37	13	29608247	29608247	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr13:29608247A>T	ENST00000431530.3	+	2	2519	c.2461A>T	c.(2461-2463)Agt>Tgt	p.S821C		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	811	Localization to the growing distal tip of microtubules.|Mediates interaction with MAPRE1.|Sufficient for interaction with KIF2C.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CAGTCTCTACAGTTCCGATCC	0.453																																							uc001usl.3		NA																	0					0						c.(2461-2463)AGT>TGT		hypothetical protein LOC23281 isoform a							104.0	106.0	105.0					13																	29608247		2105	4217	6322	SO:0001583	missense	23281					cytoplasm|microtubule	microtubule binding|protein homodimerization activity	g.chr13:29608247A>T	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2461A>T	13.37:g.29608247A>T	ENSP00000392057:p.Ser821Cys						p.S821C	NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN			2	2519	+			811			Sufficient for interaction with KIF2C.|Localization to the growing distal tip of microtubules.|Mediates interaction with MAPRE1.		A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	37	c.2461A>T	CCDS45022.1	.	.	.	.	.	.	.	.	.	.	A	13.77	2.336502	0.41398	.	.	ENSG00000132938	ENST00000431530	T	0.12465	2.68	5.27	-0.469	0.12142	.	2.045250	0.01945	N	0.042223	T	0.13114	0.0318	L	0.36672	1.1	0.09310	N	1	D	0.55800	0.973	B	0.43331	0.416	T	0.26573	-1.0099	9	.	.	.	.	6.0399	0.19728	0.5446:0.192:0.2633:0.0	.	811	Q5JR59	MTUS2_HUMAN	C	821	ENSP00000392057:S821C	.	S	+	1	0	MTUS2	28506247	0.049000	0.20398	0.086000	0.20670	0.017000	0.09413	0.863000	0.27913	0.096000	0.17463	-0.290000	0.09829	AGT		0.453	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270		10	42	0	0	0	0.006214	0	10	42				
HNRNPA1L2	144983	broad.mit.edu	37	13	53216956	53216956	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr13:53216956G>T	ENST00000357495.2	+	1	389	c.329G>T	c.(328-330)gGt>gTt	p.G110V	HNRNPA1L2_ENST00000398039.1_Missense_Mutation_p.G110V|HNRNPA1L2_ENST00000342657.3_Missense_Mutation_p.G110V			Q32P51	RA1L2_HUMAN	heterogeneous nuclear ribonucleoprotein A1-like 2	110	Globular B domain.|RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|mRNA transport (GO:0051028)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			cervix(1)|large_intestine(1)|lung(5)	7						ATATTTGTTGGTGGCATTAAA	0.408																																							uc001vgx.1		NA																	0					0						c.(328-330)GGT>GTT		heterogeneous nuclear ribonucleoprotein A1-like							17.0	19.0	19.0					13																	53216956		1370	2621	3991	SO:0001583	missense	144983				mRNA processing|mRNA transport|RNA splicing	cytoplasm|spliceosomal complex	nucleotide binding|RNA binding	g.chr13:53216956G>T		CCDS31980.1	13q14.3	2013-02-12			ENSG00000139675	ENSG00000139675		"""RNA binding motif (RRM) containing"""	27067	protein-coding gene	gene with protein product						12477932	Standard	NM_001011724		Approved	LOC144983	uc001vgy.1	Q32P51	OTTHUMG00000016972	ENST00000357495.2:c.329G>T	13.37:g.53216956G>T	ENSP00000350090:p.Gly110Val					HNRNPA1L2_uc001vgy.1_Missense_Mutation_p.G110V|HNRNPA1L2_uc001vgz.1_Missense_Mutation_p.G110V	p.G110V	NM_001011724	NP_001011724	Q32P51	RA1L2_HUMAN			7	1402	+			110			Globular B domain.|RRM 2.		Q5TBS2	Missense_Mutation	SNP	ENST00000357495.2	37	c.329G>T	CCDS31980.1	.	.	.	.	.	.	.	.	.	.	g	15.91	2.973641	0.53720	.	.	ENSG00000139675	ENST00000342657;ENST00000398039;ENST00000357495	D;D;D	0.91124	-2.79;-2.79;-2.79	0.352	0.352	0.16051	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.43579	U	0.000544	D	0.95965	0.8686	H	0.97415	4	0.58432	D	0.999995	D	0.89917	1.0	D	0.83275	0.996	D	0.93608	0.6936	10	0.87932	D	0	.	6.5752	0.22562	2.0E-4:0.0:0.9998:0.0	.	110	Q32P51	RA1L2_HUMAN	V	110	ENSP00000341285:G110V;ENSP00000381119:G110V;ENSP00000350090:G110V	ENSP00000341285:G110V	G	+	2	0	HNRNPA1L2	52114957	1.000000	0.71417	0.882000	0.34594	0.438000	0.31896	6.482000	0.73613	0.455000	0.26910	0.089000	0.15464	GGT		0.408	HNRNPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045098.1	NM_001011724		3	26	1	0	0.004672	0.004672	0.00501021	3	26				
OLFM4	10562	broad.mit.edu	37	13	53624469	53624469	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr13:53624469A>T	ENST00000219022.2	+	5	1174	c.1096A>T	c.(1096-1098)Aat>Tat	p.N366Y		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	366	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		AACTCTCCCTAATGCTGCCTA	0.403																																							uc001vhl.2		NA																	0				skin(1)	1						c.(1096-1098)AAT>TAT		olfactomedin 4 precursor							204.0	199.0	201.0					13																	53624469		2203	4300	6503	SO:0001583	missense	10562				cell adhesion	extracellular space		g.chr13:53624469A>T	AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.1096A>T	13.37:g.53624469A>T	ENSP00000219022:p.Asn366Tyr					OLFM4_uc001vhk.1_3'UTR	p.N366Y	NM_006418	NP_006409	Q6UX06	OLFM4_HUMAN		GBM - Glioblastoma multiforme(99;3.13e-08)	5	1096	+		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)	366			Olfactomedin-like.		O95362|Q5VWG0|Q86T22	Missense_Mutation	SNP	ENST00000219022.2	37	c.1096A>T	CCDS9440.1	.	.	.	.	.	.	.	.	.	.	A	12.53	1.965187	0.34659	.	.	ENSG00000102837	ENST00000219022	T	0.11495	2.77	5.92	-11.8	0.00035	Olfactomedin-like (3);	1.326390	0.04476	N	0.376908	T	0.09862	0.0242	L	0.47716	1.5	0.09310	N	1	B	0.20459	0.045	B	0.24394	0.053	T	0.14615	-1.0466	10	0.30854	T	0.27	.	14.165	0.65471	0.1625:0.0769:0.6873:0.0733	.	366	Q6UX06	OLFM4_HUMAN	Y	366	ENSP00000219022:N366Y	ENSP00000219022:N366Y	N	+	1	0	OLFM4	52522470	0.000000	0.05858	0.000000	0.03702	0.350000	0.29205	-3.780000	0.00368	-2.523000	0.00496	-1.080000	0.02220	AAT		0.403	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045112.2	NM_006418		30	140	0	0	0	0.008361	0	30	140				
PCDH17	27253	broad.mit.edu	37	13	58207657	58207657	+	Missense_Mutation	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr13:58207657T>A	ENST00000377918.3	+	1	1003	c.977T>A	c.(976-978)cTg>cAg	p.L326Q		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	326	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		GCCCGAGACCTGGGGCCTAAC	0.597																																					Melanoma(72;952 1291 1619 12849 33676)	Melanoma(72;952 1291 1619 12849 33676)	uc001vhq.1		NA																	0				ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7						c.(976-978)CTG>CAG		protocadherin 17 precursor							80.0	78.0	79.0					13																	58207657		2203	4300	6503	SO:0001583	missense	27253				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	g.chr13:58207657T>A	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.977T>A	13.37:g.58207657T>A	ENSP00000367151:p.Leu326Gln					PCDH17_uc010aec.1_Missense_Mutation_p.L326Q	p.L326Q	NM_001040429	NP_001035519	O14917	PCD17_HUMAN		GBM - Glioblastoma multiforme(99;1.06e-05)	1	1869	+		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)	326			Extracellular (Potential).|Cadherin 3.		A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	c.977T>A	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	T	8.367	0.834452	0.16820	.	.	ENSG00000118946	ENST00000377918	T	0.50813	0.73	5.57	5.57	0.84162	Cadherin (4);Cadherin-like (1);	0.134991	0.51477	D	0.000098	T	0.30417	0.0764	N	0.12182	0.205	0.33418	D	0.579556	B;B	0.30686	0.073;0.29	B;B	0.34931	0.052;0.192	T	0.44982	-0.9292	9	.	.	.	.	10.8963	0.47025	0.1402:0.0:0.0:0.8598	.	326;326	O14917-2;O14917	.;PCD17_HUMAN	Q	326	ENSP00000367151:L326Q	.	L	+	2	0	PCDH17	57105658	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	3.939000	0.56591	2.133000	0.65898	0.528000	0.53228	CTG		0.597	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429		11	71	0	0	0	0.008291	0	11	71				
NALCN	259232	broad.mit.edu	37	13	101726022	101726022	+	Missense_Mutation	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr13:101726022T>C	ENST00000251127.6	-	37	4192	c.4111A>G	c.(4111-4113)Aat>Gat	p.N1371D		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1371					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GAAGAAAAATTTGCATGCCTA	0.358																																							uc001vox.1		NA																	0				ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16						c.(4111-4113)AAT>GAT		voltage gated channel like 1							57.0	55.0	55.0					13																	101726022		2203	4300	6503	SO:0001583	missense	259232					integral to membrane	sodium channel activity|voltage-gated ion channel activity	g.chr13:101726022T>C	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4111A>G	13.37:g.101726022T>C	ENSP00000251127:p.Asn1371Asp						p.N1371D	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN			37	4300	-	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		1371			Extracellular (Potential).		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	c.4111A>G	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.899771	0.91962	.	.	ENSG00000102452	ENST00000251127	D	0.98835	-5.17	5.75	5.75	0.90469	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99384	0.9783	H	0.94698	3.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98648	1.0678	10	0.72032	D	0.01	.	16.0707	0.80928	0.0:0.0:0.0:1.0	.	1371	Q8IZF0	NALCN_HUMAN	D	1371	ENSP00000251127:N1371D	ENSP00000251127:N1371D	N	-	1	0	NALCN	100524023	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.040000	0.89188	2.194000	0.70268	0.533000	0.62120	AAT		0.358	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867		3	33	0	0	0	0.004672	0	3	33				
SLC10A2	6555	broad.mit.edu	37	13	103710636	103710636	+	Missense_Mutation	SNP	G	G	C	rs371460461		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr13:103710636G>C	ENST00000245312.3	-	2	1070	c.474C>G	c.(472-474)atC>atG	p.I158M		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	158					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)			breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	AGGGAATTACGATGCTCCCAG	0.502																																							uc001vpy.3		NA																	0				ovary(3)|skin(1)	4						c.(472-474)ATC>ATG		solute carrier family 10 (sodium/bile acid							139.0	122.0	128.0					13																	103710636		2203	4300	6503	SO:0001583	missense	6555				bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity	g.chr13:103710636G>C	U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.474C>G	13.37:g.103710636G>C	ENSP00000245312:p.Ile158Met						p.I158M	NM_000452	NP_000443	Q12908	NTCP2_HUMAN			2	1071	-	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)		158			Helical; (Potential).		A1L4F4|Q13839	Missense_Mutation	SNP	ENST00000245312.3	37	c.474C>G	CCDS9506.1	.	.	.	.	.	.	.	.	.	.	G	10.65	1.409983	0.25465	.	.	ENSG00000125255	ENST00000245312	T	0.11604	2.76	5.74	-0.703	0.11261	.	0.047079	0.85682	D	0.000000	T	0.11965	0.0291	L	0.52573	1.65	0.26367	N	0.976951	B	0.27229	0.172	B	0.40864	0.342	T	0.27054	-1.0085	10	0.39692	T	0.17	-21.7826	4.9071	0.13804	0.5097:0.0:0.2595:0.2308	.	158	Q12908	NTCP2_HUMAN	M	158	ENSP00000245312:I158M	ENSP00000245312:I158M	I	-	3	3	SLC10A2	102508637	0.106000	0.21978	0.001000	0.08648	0.366000	0.29705	0.569000	0.23638	-0.086000	0.12550	-0.309000	0.09137	ATC		0.502	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1			15	87	0	0	0	0.00245	0	15	87				
MYO16	23026	broad.mit.edu	37	13	109707814	109707814	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr13:109707814C>T	ENST00000357550.2	+	26	3181	c.3140C>T	c.(3139-3141)tCa>tTa	p.S1047L	MYO16_ENST00000457511.2_Missense_Mutation_p.S559L|MYO16_ENST00000356711.2_Missense_Mutation_p.S1047L	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CCCAATAACTCAAAGCTGCCA	0.403																																							uc001vqt.1		NA																	0				ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10						c.(3139-3141)TCA>TTA		myosin heavy chain Myr 8							125.0	120.0	122.0					13																	109707814		2203	4299	6502	SO:0001583	missense	23026				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity	g.chr13:109707814C>T		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3140C>T	13.37:g.109707814C>T	ENSP00000350160:p.Ser1047Leu					MYO16_uc010agk.1_Missense_Mutation_p.S1069L|MYO16_uc001vqu.1_Missense_Mutation_p.S847L|MYO16_uc010tjh.1_Missense_Mutation_p.S559L	p.S1047L	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)		27	3266	+	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		1047			Myosin head-like 2.			Missense_Mutation	SNP	ENST00000357550.2	37	c.3140C>T	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	C	16.20	3.057133	0.55325	.	.	ENSG00000041515	ENST00000356711;ENST00000357550;ENST00000375857;ENST00000457511	D;D;D	0.87412	-2.25;-2.25;-2.25	5.21	5.21	0.72293	Myosin head, motor domain (2);	0.000000	0.36200	U	0.002724	T	0.79100	0.4389	N	0.25201	0.72	0.41136	D	0.985924	B;P;B	0.43352	0.098;0.804;0.078	B;B;B	0.37144	0.116;0.242;0.065	T	0.79120	-0.1934	9	.	.	.	.	17.7758	0.88506	0.0:1.0:0.0:0.0	.	559;1047;1047	F8W883;Q9Y6X6-2;Q9Y6X6	.;.;MYO16_HUMAN	L	1047;1047;835;559	ENSP00000349145:S1047L;ENSP00000350160:S1047L;ENSP00000401633:S559L	.	S	+	2	0	MYO16	108505815	0.388000	0.25197	0.689000	0.30133	0.897000	0.52465	3.375000	0.52410	2.424000	0.82194	0.561000	0.74099	TCA		0.403	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011		15	53	0	0	0	0.00245	0	15	53				
OR4Q3	441669	broad.mit.edu	37	14	20216098	20216098	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr14:20216098G>T	ENST00000331723.1	+	1	512	c.512G>T	c.(511-513)gGg>gTg	p.G171V		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	171						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCTTTCTGTGGGCCCAATGAA	0.512																																							uc010tkt.1		NA																	0				breast(3)	3						c.(511-513)GGG>GTG		olfactory receptor, family 4, subfamily Q,							144.0	130.0	135.0					14																	20216098		2203	4300	6503	SO:0001583	missense	441669				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:20216098G>T	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.512G>T	14.37:g.20216098G>T	ENSP00000330049:p.Gly171Val						p.G171V	NM_172194	NP_751944	Q8NH05	OR4Q3_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)	1	512	+	all_cancers(95;0.00108)		171			Extracellular (Potential).		Q6IEX4	Missense_Mutation	SNP	ENST00000331723.1	37	c.512G>T	CCDS32020.1	.	.	.	.	.	.	.	.	.	.	.	12.80	2.046863	0.36085	.	.	ENSG00000182652	ENST00000331723	T	0.38401	1.14	4.09	4.09	0.47781	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40908	U	0.000997	T	0.66076	0.2753	M	0.93808	3.46	0.51233	D	0.999917	P	0.46395	0.877	P	0.59948	0.866	T	0.76005	-0.3117	10	0.87932	D	0	.	13.8329	0.63391	0.0:0.0:1.0:0.0	.	171	Q8NH05	OR4Q3_HUMAN	V	171	ENSP00000330049:G171V	ENSP00000330049:G171V	G	+	2	0	OR4Q3	19285938	0.995000	0.38212	0.994000	0.49952	0.824000	0.46624	2.350000	0.44063	2.105000	0.64084	0.406000	0.27484	GGG		0.512	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2			8	104	1	0	0.00621372	0.006214	0.00663005	8	104				
OR4E2	26686	broad.mit.edu	37	14	22133904	22133904	+	Missense_Mutation	SNP	G	G	T	rs540451655		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr14:22133904G>T	ENST00000408935.1	+	1	608	c.608G>T	c.(607-609)aGt>aTt	p.S203I		NM_001001912.1	NP_001001912.1	Q8NGC2	OR4E2_HUMAN	olfactory receptor, family 4, subfamily E, member 2	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0137)		GTGACCAATAGTGGAACCATC	0.493																																							uc010tmd.1		NA																	0				ovary(2)|pancreas(1)|skin(1)	4						c.(607-609)AGT>ATT		olfactory receptor, family 4, subfamily E,							169.0	158.0	162.0					14																	22133904		2006	4190	6196	SO:0001583	missense	26686				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr14:22133904G>T		CCDS41916.1	14q11.2	2013-09-23			ENSG00000221977	ENSG00000221977		"""GPCR / Class A : Olfactory receptors"""	8297	protein-coding gene	gene with protein product							Standard	NM_001001912		Approved		uc010tmd.2	Q8NGC2	OTTHUMG00000168979	ENST00000408935.1:c.608G>T	14.37:g.22133904G>T	ENSP00000386195:p.Ser203Ile						p.S203I	NM_001001912	NP_001001912	Q8NGC2	OR4E2_HUMAN		GBM - Glioblastoma multiforme(265;0.0137)	1	608	+	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)	203			Helical; Name=5; (Potential).		Q6IET6|Q96R62	Missense_Mutation	SNP	ENST00000408935.1	37	c.608G>T	CCDS41916.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.772829	0.49680	.	.	ENSG00000221977	ENST00000408935	T	0.38240	1.15	5.58	5.58	0.84498	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44688	U	0.000438	T	0.61862	0.2381	M	0.76002	2.32	0.37104	D	0.900035	D	0.76494	0.999	D	0.80764	0.994	T	0.68606	-0.5364	10	0.87932	D	0	.	17.4093	0.87481	0.0:0.0:1.0:0.0	.	203	Q8NGC2	OR4E2_HUMAN	I	203	ENSP00000386195:S203I	ENSP00000386195:S203I	S	+	2	0	OR4E2	21203744	0.000000	0.05858	1.000000	0.80357	0.788000	0.44548	0.676000	0.25247	2.777000	0.95525	0.585000	0.79938	AGT		0.493	OR4E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401874.1			22	60	1	0	4.35082e-09	0.010504	6.20016e-09	22	60				
AKAP6	9472	broad.mit.edu	37	14	33291625	33291625	+	Missense_Mutation	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr14:33291625A>G	ENST00000280979.4	+	13	4776	c.4606A>G	c.(4606-4608)Atg>Gtg	p.M1536V	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1536					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		ATCTCATGAAATGGATCGCAT	0.358																																					Melanoma(49;821 1200 7288 13647 42351)	Melanoma(49;821 1200 7288 13647 42351)	uc001wrq.2		NA																	0				breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21						c.(4606-4608)ATG>GTG		A-kinase anchor protein 6							101.0	105.0	104.0					14																	33291625		2203	4300	6503	SO:0001583	missense	9472				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding	g.chr14:33291625A>G	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.4606A>G	14.37:g.33291625A>G	ENSP00000280979:p.Met1536Val						p.M1536V	NM_004274	NP_004265	Q13023	AKAP6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)	13	4776	+	Breast(36;0.0388)|Prostate(35;0.15)		1536					A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	37	c.4606A>G	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	A	7.721	0.697122	0.15106	.	.	ENSG00000151320	ENST00000280979	T	0.04654	3.58	5.79	4.62	0.57501	.	0.336402	0.32987	N	0.005402	T	0.06962	0.0177	L	0.60455	1.87	0.80722	D	1	B	0.22480	0.07	B	0.16722	0.016	T	0.09509	-1.0671	10	0.72032	D	0.01	-6.152	9.7491	0.40464	0.7083:0.0:0.0:0.2917	.	1536	Q13023	AKAP6_HUMAN	V	1536	ENSP00000280979:M1536V	ENSP00000280979:M1536V	M	+	1	0	AKAP6	32361376	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.366000	0.34193	0.980000	0.38523	0.528000	0.53228	ATG		0.358	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274		4	78	0	0	0	0.009096	0	4	78				
FSCB	84075	broad.mit.edu	37	14	44976080	44976080	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr14:44976080G>C	ENST00000340446.4	-	1	402	c.111C>G	c.(109-111)agC>agG	p.S37R	RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000556228.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	37						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		AGCTGCCTTTGCTTCCAGAAG	0.413																																							uc001wvn.2		NA																	0				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9						c.(109-111)AGC>AGG		fibrous sheath CABYR binding protein							209.0	202.0	204.0					14																	44976080		2203	4300	6503	SO:0001583	missense	84075					cilium		g.chr14:44976080G>C	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.111C>G	14.37:g.44976080G>C	ENSP00000344579:p.Ser37Arg						p.S37R	NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN		GBM - Glioblastoma multiforme(112;0.128)	1	420	-			37					Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	ENST00000340446.4	37	c.111C>G	CCDS9679.1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.585593	0.28268	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.19105	2.17	5.49	1.6	0.23607	.	.	.	.	.	T	0.28764	0.0713	L	0.31065	0.9	0.24826	N	0.992552	D	0.76494	0.999	D	0.72075	0.976	T	0.11397	-1.0589	9	0.44086	T	0.13	0.1213	7.252	0.26154	0.3679:0.0:0.6321:0.0	.	37	Q5H9T9	FSCB_HUMAN	R	37	ENSP00000344579:S37R	ENSP00000344579:S37R	S	-	3	2	FSCB	44045830	0.816000	0.29132	0.630000	0.29268	0.622000	0.37654	0.136000	0.15974	0.094000	0.17404	0.555000	0.69702	AGC		0.413	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135		34	128	0	0	0	0.012213	0	34	128				
L2HGDH	79944	broad.mit.edu	37	14	50734574	50734574	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr14:50734574C>A	ENST00000267436.4	-	8	1358	c.961G>T	c.(961-963)Ggc>Tgc	p.G321C	L2HGDH_ENST00000261699.4_Missense_Mutation_p.G321C|L2HGDH_ENST00000421284.3_Missense_Mutation_p.G321C			Q9H9P8	L2HDH_HUMAN	L-2-hydroxyglutarate dehydrogenase	321					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2-hydroxyglutarate dehydrogenase activity (GO:0047545)			kidney(1)|large_intestine(4)|lung(3)|ovary(2)	10	all_epithelial(31;0.000599)|Breast(41;0.0102)					CAAATACTGCCATCCATCCTT	0.413																																							uc001wxu.2		NA																	0				ovary(2)	2						c.(961-963)GGC>TGC		L-2-hydroxyglutarate dehydrogenase precursor							117.0	104.0	108.0					14																	50734574		2203	4300	6503	SO:0001583	missense	79944				2-oxoglutarate metabolic process|cellular protein metabolic process	integral to mitochondrial inner membrane	2-hydroxyglutarate dehydrogenase activity	g.chr14:50734574C>A		CCDS9698.1	14q22.1	2006-04-28	2005-05-25	2005-05-25	ENSG00000087299	ENSG00000087299	1.1.99.2		20499	protein-coding gene	gene with protein product	"""2-hydroxyglutarate dehydrogenase"""	609584	"""chromosome 14 open reading frame 160"""	C14orf160		16005139	Standard	NM_024884		Approved	FLJ12618	uc001wxu.3	Q9H9P8	OTTHUMG00000140289	ENST00000267436.4:c.961G>T	14.37:g.50734574C>A	ENSP00000267436:p.Gly321Cys					L2HGDH_uc010tqn.1_Missense_Mutation_p.G321C|L2HGDH_uc010tqo.1_Missense_Mutation_p.G321C	p.G321C	NM_024884	NP_079160	Q9H9P8	L2HDH_HUMAN			8	1040	-	all_epithelial(31;0.000599)|Breast(41;0.0102)		321					Q9BRR1	Missense_Mutation	SNP	ENST00000267436.4	37	c.961G>T	CCDS9698.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.016278	0.93404	.	.	ENSG00000087299	ENST00000261699;ENST00000267436;ENST00000421284	D;D;D	0.83335	-1.71;-1.71;-1.71	5.55	5.55	0.83447	FAD dependent oxidoreductase (1);	0.000000	0.85682	D	0.000000	D	0.95242	0.8457	H	0.98682	4.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96669	0.9495	10	0.87932	D	0	-31.7923	19.8888	0.96921	0.0:1.0:0.0:0.0	.	321;321	C9JVN9;Q9H9P8	.;L2HDH_HUMAN	C	321	ENSP00000261699:G321C;ENSP00000267436:G321C;ENSP00000405559:G321C	ENSP00000261699:G321C	G	-	1	0	L2HGDH	49804324	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	7.722000	0.84778	2.784000	0.95788	0.643000	0.83706	GGC		0.413	L2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276870.2	NM_024884		24	68	1	0	7.16444e-05	0.003954	8.25271e-05	24	68				
NIN	51199	broad.mit.edu	37	14	51239122	51239122	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr14:51239122C>A	ENST00000382041.3	-	9	1068	c.878G>T	c.(877-879)cGg>cTg	p.R293L	NIN_ENST00000530997.2_Missense_Mutation_p.R293L|NIN_ENST00000245441.5_Missense_Mutation_p.R293L|NIN_ENST00000324330.9_Missense_Mutation_p.R293L|NIN_ENST00000453196.1_Missense_Mutation_p.R293L|NIN_ENST00000382043.4_Missense_Mutation_p.R293L|NIN_ENST00000389868.3_Missense_Mutation_p.R293L	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	293					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					GGAGAAGACCCGAAAGCCAAT	0.522			T	PDGFRB	MPD																																		uc001wym.2		NA		Dom	yes		14	14q24	51199	T	ninein (GSK3B interacting protein)			L	PDGFRB		MPD		0				skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6						c.(877-879)CGG>CTG		ninein isoform 5							112.0	87.0	96.0					14																	51239122		2203	4300	6503	SO:0001583	missense	51199				centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding	g.chr14:51239122C>A	AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.878G>T	14.37:g.51239122C>A	ENSP00000371472:p.Arg293Leu					NIN_uc001wyi.2_Missense_Mutation_p.R293L|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Missense_Mutation_p.R293L|NIN_uc010tqp.1_Missense_Mutation_p.R299L|NIN_uc001wyo.2_Missense_Mutation_p.R293L|NIN_uc001wyp.1_Missense_Mutation_p.R255L	p.R293L	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN			9	1069	-	all_epithelial(31;0.00244)|Breast(41;0.127)		293					A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	ENST00000382041.3	37	c.878G>T	CCDS32079.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.511933	0.85389	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196;ENST00000453401	D;T;D;T;D;D;T	0.95069	-3.6;-0.29;-3.6;1.56;-3.6;-3.6;1.96	5.65	5.65	0.86999	EF-hand-like domain (1);	0.105297	0.64402	D	0.000003	D	0.96531	0.8868	M	0.64404	1.975	0.54753	D	0.999989	D;D;D;D;D	0.76494	0.999;0.996;0.999;0.967;0.998	D;D;D;P;D	0.80764	0.972;0.92;0.983;0.467;0.994	D	0.96684	0.9506	10	0.72032	D	0.01	-21.0773	15.829	0.78736	0.0:0.8642:0.1358:0.0	.	299;293;293;293;293	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;.;NIN_HUMAN;.;.	L	293;293;293;293;299;293;293;293;255	ENSP00000245441:R293L;ENSP00000374518:R293L;ENSP00000371474:R293L;ENSP00000371472:R293L;ENSP00000324210:R293L;ENSP00000412391:R293L;ENSP00000398641:R255L	ENSP00000245441:R293L	R	-	2	0	NIN	50308872	0.994000	0.37717	1.000000	0.80357	0.966000	0.64601	3.111000	0.50360	2.670000	0.90874	0.563000	0.77884	CGG		0.522	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946		12	47	1	0	6.40141e-05	0.010729	7.40054e-05	12	47				
NID2	22795	broad.mit.edu	37	14	52481130	52481130	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr14:52481130G>T	ENST00000216286.5	-	16	3294	c.3295C>A	c.(3295-3297)Cca>Aca	p.P1099T	NID2_ENST00000541773.1_Missense_Mutation_p.P998T	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	1099					basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					GTCACATCTGGCCGGGGCGTG	0.622											OREG0022678	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc001wzo.2		NA																	0				pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7						c.(3295-3297)CCA>ACA		nidogen 2 precursor							67.0	65.0	66.0					14																	52481130		2203	4300	6503	SO:0001583	missense	22795					basement membrane	calcium ion binding|collagen binding	g.chr14:52481130G>T	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.3295C>A	14.37:g.52481130G>T	ENSP00000216286:p.Pro1099Thr		OREG0022678	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	985	NID2_uc010tqs.1_Missense_Mutation_p.P1051T|NID2_uc010tqt.1_Missense_Mutation_p.P1099T|NID2_uc001wzp.2_Missense_Mutation_p.P1099T	p.P1099T	NM_007361	NP_031387	Q14112	NID2_HUMAN			16	3529	-	Breast(41;0.0639)|all_epithelial(31;0.123)		1099					A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	c.3295C>A	CCDS9706.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.5|22.5	4.299128|4.299128	0.81025|0.81025	.|.	.|.	ENSG00000087303|ENSG00000087303	ENST00000556572|ENST00000216286;ENST00000316204;ENST00000541773;ENST00000395707	.|D;D	.|0.84070	.|-1.8;-1.64	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.89708|0.89708	0.6793|0.6793	M|M	0.68728|0.68728	2.09|2.09	0.58432|0.58432	D|D	0.999998|0.999998	.|P;D;D;D	.|0.89917	.|0.855;1.0;1.0;0.988	.|B;D;D;P	.|0.97110	.|0.443;1.0;1.0;0.883	D|D	0.83803|0.83803	0.0237|0.0237	5|10	.|0.09590	.|T	.|0.72	.|.	20.4745|20.4745	0.99168|0.99168	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|693;998;1101;1099	.|E7EPP3;Q14112-2;Q5CZI2;Q14112	.|.;.;.;NID2_HUMAN	D|T	367|1099;693;998;1101	.|ENSP00000216286:P1099T;ENSP00000443730:P998T	.|ENSP00000216286:P1099T	A|P	-|-	2|1	0|0	NID2|NID2	51550880|51550880	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.698000|0.698000	0.40448|0.40448	5.893000|5.893000	0.69798|0.69798	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCC|CCA		0.622	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1			17	45	1	0	2.23348e-06	0.004007	2.77877e-06	17	45				
OTX2	5015	broad.mit.edu	37	14	57268600	57268600	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr14:57268600C>A	ENST00000555006.1	-	4	1131	c.723G>T	c.(721-723)caG>caT	p.Q241H	RP11-1085N6.6_ENST00000602485.1_lincRNA|OTX2_ENST00000408990.3_Missense_Mutation_p.Q241H|OTX2_ENST00000554788.1_3'UTR|OTX2_ENST00000339475.5_Missense_Mutation_p.Q249H			P32243	OTX2_HUMAN	orthodenticle homeobox 2	241					axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					CTCCATATCCCTGGGTGGAAA	0.512																																							uc001xcp.2		NA																	0				ovary(1)	1						c.(721-723)CAG>CAT		orthodenticle homeobox 2 isoform b							114.0	113.0	113.0					14																	57268600		2203	4300	6503	SO:0001583	missense	5015				axon guidance|forebrain development|midbrain development|positive regulation of embryonic development|positive regulation of gastrulation|primitive streak formation|protein complex assembly|regulation of fibroblast growth factor receptor signaling pathway|regulation of smoothened signaling pathway	growth cone|nucleus|protein complex	eukaryotic initiation factor 4E binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding	g.chr14:57268600C>A	AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338	ENST00000555006.1:c.723G>T	14.37:g.57268600C>A	ENSP00000452336:p.Gln241His					OTX2_uc010aou.2_Missense_Mutation_p.Q241H|OTX2_uc001xcq.2_Missense_Mutation_p.Q249H	p.Q241H	NM_172337	NP_758840	P32243	OTX2_HUMAN			3	894	-	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)		241					B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	Missense_Mutation	SNP	ENST00000555006.1	37	c.723G>T	CCDS41960.1	.	.	.	.	.	.	.	.	.	.	C	12.12	1.842699	0.32606	.	.	ENSG00000165588	ENST00000339475;ENST00000408990;ENST00000555006	D;D;D	0.91124	-2.79;-2.77;-2.77	5.65	5.65	0.86999	.	0.000000	0.44285	D	0.000465	D	0.94079	0.8102	M	0.86343	2.81	0.80722	D	1	B;P	0.45474	0.021;0.859	B;P	0.49887	0.016;0.625	D	0.92932	0.6364	10	0.35671	T	0.21	.	18.891	0.92403	0.0:1.0:0.0:0.0	.	249;241	F1T0D1;P32243	.;OTX2_HUMAN	H	249;241;241	ENSP00000343819:Q249H;ENSP00000386185:Q241H;ENSP00000452336:Q241H	ENSP00000343819:Q249H	Q	-	3	2	OTX2	56338353	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.702000	0.61817	2.941000	0.99782	0.655000	0.94253	CAG		0.512	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411522.1	NM_021728.		29	68	1	0	1.16021e-09	0.007291	1.67967e-09	29	68				
KCNH5	27133	broad.mit.edu	37	14	63417043	63417043	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr14:63417043C>A	ENST00000322893.7	-	7	1445	c.1177G>T	c.(1177-1179)Gct>Tct	p.A393S	KCNH5_ENST00000420622.2_Missense_Mutation_p.A393S|KCNH5_ENST00000394964.2_Missense_Mutation_p.A335S|KCNH5_ENST00000394968.1_Missense_Mutation_p.A335S	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	393					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		ATGCTCAAAGCCAGCTGGTAG	0.498																																							uc001xfx.2		NA																	0				ovary(4)|skin(4)|central_nervous_system(1)	9						c.(1177-1179)GCT>TCT		potassium voltage-gated channel, subfamily H,							143.0	132.0	135.0					14																	63417043		2203	4300	6503	SO:0001583	missense	27133				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity	g.chr14:63417043C>A	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.1177G>T	14.37:g.63417043C>A	ENSP00000321427:p.Ala393Ser					KCNH5_uc001xfy.2_Missense_Mutation_p.A393S|KCNH5_uc001xfz.1_Missense_Mutation_p.A335S|KCNH5_uc001xga.2_Missense_Mutation_p.A335S	p.A393S	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)	7	1228	-			393			Extracellular (Potential).		C9JP98	Missense_Mutation	SNP	ENST00000322893.7	37	c.1177G>T	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.638861	0.47153	.	.	ENSG00000140015	ENST00000322893;ENST00000420622;ENST00000394968;ENST00000394964	D;D;D;D	0.98987	-5.3;-5.11;-5.11;-5.1	5.75	5.75	0.90469	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.96661	0.8910	N	0.13235	0.315	0.80722	D	1	B;B;B;B	0.20368	0.044;0.043;0.017;0.021	B;B;B;B	0.25614	0.062;0.026;0.026;0.048	D	0.93593	0.6923	10	0.28530	T	0.3	.	19.9598	0.97242	0.0:1.0:0.0:0.0	.	335;335;393;393	Q86XI1;Q8NCM2-3;Q8NCM2-2;Q8NCM2	.;.;.;KCNH5_HUMAN	S	393;393;335;335	ENSP00000321427:A393S;ENSP00000395439:A393S;ENSP00000378419:A335S;ENSP00000378415:A335S	ENSP00000321427:A393S	A	-	1	0	KCNH5	62486796	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.716000	0.92895	0.655000	0.94253	GCT		0.498	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318		15	68	1	0	1.52009e-12	0.003163	2.42681e-12	15	68				
CCDC88C	440193	broad.mit.edu	37	14	91749723	91749723	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr14:91749723G>A	ENST00000389857.6	-	26	4666	c.4580C>T	c.(4579-4581)aCa>aTa	p.T1527I	CCDC88C_ENST00000331194.7_Missense_Mutation_p.T51I	NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1527					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GGAAGGGGCTGTAGTGGTGGC	0.647																																							uc010aty.2		NA																	0				ovary(3)	3						c.(4579-4581)ACA>ATA		DVL-binding protein DAPLE							39.0	50.0	47.0					14																	91749723		2023	4175	6198	SO:0001583	missense	440193				microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association	g.chr14:91749723G>A		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.4580C>T	14.37:g.91749723G>A	ENSP00000374507:p.Thr1527Ile					CCDC88C_uc001xzj.2_Missense_Mutation_p.T51I|CCDC88C_uc001xzi.2_5'UTR	p.T1527I	NM_001080414	NP_001073883	Q9P219	DAPLE_HUMAN			26	4679	-		all_cancers(154;0.0468)	1527					Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	ENST00000389857.6	37	c.4580C>T	CCDS45151.1	.	.	.	.	.	.	.	.	.	.	G	4.253	0.045896	0.08196	.	.	ENSG00000015133	ENST00000389857;ENST00000427583;ENST00000331194	T;T	0.43294	2.58;0.95	5.54	4.54	0.55810	.	0.999773	0.08089	U	0.999666	T	0.34978	0.0916	L	0.44542	1.39	0.09310	N	1	B;B	0.19200	0.0;0.034	B;B	0.21708	0.0;0.036	T	0.19224	-1.0312	10	0.51188	T	0.08	-0.7063	4.1671	0.10312	0.2474:0.0:0.7526:0.0	.	1527;51	Q9P219;Q9P219-2	DAPLE_HUMAN;.	I	1527;51;51	ENSP00000374507:T1527I;ENSP00000330332:T51I	ENSP00000330332:T51I	T	-	2	0	CCDC88C	90819476	0.158000	0.22850	0.006000	0.13384	0.001000	0.01503	3.725000	0.54970	2.609000	0.88269	0.563000	0.77884	ACA		0.647	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353		5	31	0	0	0	0.000602	0	5	31				
SYNE3	161176	broad.mit.edu	37	14	95899631	95899631	+	Missense_Mutation	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr14:95899631T>C	ENST00000334258.5	-	15	2668	c.2654A>G	c.(2653-2655)tAc>tGc	p.Y885C	SYNE3_ENST00000554873.1_Missense_Mutation_p.Y642C|SYNE3_ENST00000557275.1_Missense_Mutation_p.Y880C	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	885					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						CTTGGACTTGTACAGCATCCA	0.572																																							uc001yei.3		NA																	0				central_nervous_system(1)	1						c.(2653-2655)TAC>TGC		nesprin-3							116.0	108.0	111.0					14																	95899631		2203	4300	6503	SO:0001583	missense	161176				cytoskeletal anchoring at nuclear membrane	integral to membrane|nuclear outer membrane|SUN-KASH complex	actin binding	g.chr14:95899631T>C	AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.2654A>G	14.37:g.95899631T>C	ENSP00000334308:p.Tyr885Cys					C14orf49_uc010avi.2_Missense_Mutation_p.Y880C	p.Y885C	NM_152592	NP_689805	Q6ZMZ3	SYNE3_HUMAN		COAD - Colon adenocarcinoma(157;0.245)	15	2669	-		all_cancers(154;0.0937)	885			Cytoplasmic (Potential).		A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	ENST00000334258.5	37	c.2654A>G	CCDS9935.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.143247	0.77888	.	.	ENSG00000176438	ENST00000334258;ENST00000554873;ENST00000557275	T;T;T	0.32988	2.66;1.43;2.73	5.93	5.93	0.95920	.	0.000000	0.38217	N	0.001777	T	0.56031	0.1958	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.59731	-0.7399	10	0.72032	D	0.01	-24.5731	13.903	0.63817	0.0:0.0:0.0:1.0	.	880;885	Q6ZMZ3-2;Q6ZMZ3	.;SYNE3_HUMAN	C	885;642;880	ENSP00000334308:Y885C;ENSP00000452154:Y642C;ENSP00000450562:Y880C	ENSP00000334308:Y885C	Y	-	2	0	C14orf49	94969384	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.175000	0.65021	2.271000	0.75665	0.533000	0.62120	TAC		0.572	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420529.2	NM_152592		24	105	0	0	0	0.003954	0	24	105				
DYNC1H1	1778	broad.mit.edu	37	14	102452915	102452915	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr14:102452915G>T	ENST00000360184.4	+	8	2517	c.2353G>T	c.(2353-2355)Gtt>Ttt	p.V785F		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	785	Interaction with DYNC1LI2. {ECO:0000250}.|Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GATCGAGAGCGTTCGTACCTA	0.532																																							uc001yks.2		NA																	0				ovary(7)|central_nervous_system(2)|pancreas(1)	10						c.(2353-2355)GTT>TTT		cytoplasmic dynein 1 heavy chain 1							150.0	136.0	141.0					14																	102452915		2203	4300	6503	SO:0001583	missense	1778				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding	g.chr14:102452915G>T	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.2353G>T	14.37:g.102452915G>T	ENSP00000348965:p.Val785Phe						p.V785F	NM_001376	NP_001367	Q14204	DYHC1_HUMAN			8	2517	+			785			Interaction with DYNC1LI2 (By similarity).|Stem (By similarity).		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	c.2353G>T	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.566451	0.86439	.	.	ENSG00000197102	ENST00000360184	T	0.61510	0.1	5.6	5.6	0.85130	Dynein heavy chain, domain-1 (1);	0.117629	0.56097	D	0.000021	T	0.76126	0.3944	M	0.74546	2.27	0.80722	D	1	D	0.58620	0.983	D	0.63597	0.916	T	0.78242	-0.2280	10	0.87932	D	0	.	19.6087	0.95589	0.0:0.0:1.0:0.0	.	785	Q14204	DYHC1_HUMAN	F	785	ENSP00000348965:V785F	ENSP00000348965:V785F	V	+	1	0	DYNC1H1	101522668	1.000000	0.71417	0.661000	0.29709	0.944000	0.59088	9.465000	0.97660	2.639000	0.89480	0.655000	0.94253	GTT		0.532	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376		19	107	1	0	1.33834e-09	0.007413	1.93315e-09	19	107				
AHNAK2	113146	broad.mit.edu	37	14	105413664	105413664	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr14:105413664C>G	ENST00000333244.5	-	7	8243	c.8124G>C	c.(8122-8124)caG>caC	p.Q2708H	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2708						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCTGGCCAGCCTGGACCTCCA	0.612																																							uc010axc.1		NA																	0				ovary(1)	1						c.(8122-8124)CAG>CAC		AHNAK nucleoprotein 2							135.0	150.0	145.0					14																	105413664		1949	4131	6080	SO:0001583	missense	113146					nucleus		g.chr14:105413664C>G	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8124G>C	14.37:g.105413664C>G	ENSP00000353114:p.Gln2708His					AHNAK2_uc001ypx.2_Missense_Mutation_p.Q2608H	p.Q2708H	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	8244	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	2708					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.8124G>C	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	10.66	1.413034	0.25465	.	.	ENSG00000185567	ENST00000333244	T	0.00848	5.62	3.28	1.33	0.21861	.	.	.	.	.	T	0.01387	0.0045	M	0.72118	2.19	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39742	-0.9599	9	0.42905	T	0.14	.	4.7699	0.13150	0.0:0.5509:0.1854:0.2637	.	2708	Q8IVF2	AHNK2_HUMAN	H	2708	ENSP00000353114:Q2708H	ENSP00000353114:Q2708H	Q	-	3	2	AHNAK2	104484709	0.000000	0.05858	0.002000	0.10522	0.026000	0.11368	-0.212000	0.09319	1.367000	0.46095	0.313000	0.20887	CAG		0.612	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		39	244	0	0	0	0.005524	0	39	244				
AHNAK2	113146	broad.mit.edu	37	14	105417186	105417186	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr14:105417186C>T	ENST00000333244.5	-	7	4721	c.4602G>A	c.(4600-4602)ggG>ggA	p.G1534G	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1534						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCTTGAGGTCCCCCTGCATGG	0.652																																							uc010axc.1		NA																	0				ovary(1)	1						c.(4600-4602)GGG>GGA		AHNAK nucleoprotein 2							124.0	109.0	114.0					14																	105417186		1953	4071	6024	SO:0001819	synonymous_variant	113146					nucleus		g.chr14:105417186C>T	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.4602G>A	14.37:g.105417186C>T						AHNAK2_uc001ypx.2_Silent_p.G1434G	p.G1534G	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	4722	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	1534					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	c.4602G>A	CCDS45177.1																																																																																				0.652	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		12	267	0	0	0	0.01441	0	12	267				
AHNAK2	113146	broad.mit.edu	37	14	105417188	105417188	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr14:105417188C>T	ENST00000333244.5	-	7	4719	c.4600G>A	c.(4600-4602)Ggg>Agg	p.G1534R	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1534						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TTGAGGTCCCCCTGCATGGAG	0.652																																							uc010axc.1		NA																	0				ovary(1)	1						c.(4600-4602)GGG>AGG		AHNAK nucleoprotein 2							125.0	108.0	114.0					14																	105417188		1951	4073	6024	SO:0001583	missense	113146					nucleus		g.chr14:105417188C>T	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.4600G>A	14.37:g.105417188C>T	ENSP00000353114:p.Gly1534Arg					AHNAK2_uc001ypx.2_Missense_Mutation_p.G1434R	p.G1534R	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)		7	4720	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	1534					Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	c.4600G>A	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	16.23	3.063737	0.55432	.	.	ENSG00000185567	ENST00000333244	T	0.03358	3.96	4.16	3.27	0.37495	.	.	.	.	.	T	0.09069	0.0224	M	0.89601	3.045	0.09310	N	1	P	0.50156	0.932	B	0.43301	0.415	T	0.26430	-1.0103	9	0.18276	T	0.48	.	9.7343	0.40379	0.0:0.894:0.0:0.106	.	1534	Q8IVF2	AHNK2_HUMAN	R	1534	ENSP00000353114:G1534R	ENSP00000353114:G1534R	G	-	1	0	AHNAK2	104488233	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.755000	0.26405	0.732000	0.32470	0.485000	0.47835	GGG		0.652	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420		11	273	0	0	0	0.01441	0	11	273				
OR4M2	390538	broad.mit.edu	37	15	22368804	22368804	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr15:22368804A>T	ENST00000332663.2	+	1	327	c.229A>T	c.(229-231)Aca>Tca	p.T77S	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CTCTTCCATTACAGCCCCTGA	0.433																																							uc010tzu.1		NA																	0				ovary(1)	1						c.(229-231)ACA>TCA		olfactory receptor, family 4, subfamily M,							414.0	356.0	376.0					15																	22368804		2203	4300	6503	SO:0001583	missense	390538				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22368804A>T	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.229A>T	15.37:g.22368804A>T	ENSP00000329467:p.Thr77Ser					LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	p.T77S	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	1	229	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	77			Helical; Name=2; (Potential).		B9EH16|Q6IEY2	Missense_Mutation	SNP	ENST00000332663.2	37	c.229A>T	CCDS32172.1	.	.	.	.	.	.	.	.	.	.	.	16.02	3.004946	0.54254	.	.	ENSG00000182974	ENST00000332663	T	0.00892	5.57	2.5	2.5	0.30297	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000177	T	0.02727	0.0082	M	0.75777	2.31	0.25005	N	0.991446	D	0.56035	0.974	P	0.54889	0.763	T	0.28396	-1.0045	10	0.46703	T	0.11	-7.3791	8.5824	0.33637	1.0:0.0:0.0:0.0	.	77	Q8NGB6	OR4M2_HUMAN	S	77	ENSP00000329467:T77S	ENSP00000329467:T77S	T	+	1	0	OR4M2	19870168	0.424000	0.25490	0.978000	0.43139	0.930000	0.56654	4.720000	0.61944	1.167000	0.42706	0.368000	0.22195	ACA		0.433	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414921.1			47	540	0	0	0	0.011902	0	47	540				
OR4M2	390538	broad.mit.edu	37	15	22368830	22368830	+	Missense_Mutation	SNP	C	C	G	rs267604128		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr15:22368830C>G	ENST00000332663.2	+	1	353	c.255C>G	c.(253-255)ttC>ttG	p.F85L	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TCATAGACTTCTTTGTGGAGA	0.443																																							uc010tzu.1		NA																	0				ovary(1)	1						c.(253-255)TTC>TTG		olfactory receptor, family 4, subfamily M,							367.0	315.0	333.0					15																	22368830		2203	4300	6503	SO:0001583	missense	390538				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr15:22368830C>G	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.255C>G	15.37:g.22368830C>G	ENSP00000329467:p.Phe85Leu					LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	p.F85L	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)	1	255	+		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	85			Extracellular (Potential).		B9EH16|Q6IEY2	Missense_Mutation	SNP	ENST00000332663.2	37	c.255C>G	CCDS32172.1	.	.	.	.	.	.	.	.	.	.	.	7.304	0.613665	0.14066	.	.	ENSG00000182974	ENST00000332663	T	0.00912	5.55	2.5	1.52	0.23074	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000144	T	0.00724	0.0024	N	0.11364	0.135	0.29085	N	0.88246	D	0.56968	0.978	P	0.52514	0.701	T	0.34502	-0.9826	10	0.02654	T	1	-17.9208	4.1867	0.10402	0.0:0.6132:0.2385:0.1483	.	85	Q8NGB6	OR4M2_HUMAN	L	85	ENSP00000329467:F85L	ENSP00000329467:F85L	F	+	3	2	OR4M2	19870194	0.000000	0.05858	1.000000	0.80357	0.973000	0.67179	-0.923000	0.04000	0.361000	0.24292	0.448000	0.29417	TTC		0.443	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414921.1			17	522	0	0	0	0.004007	0	17	522				
RPS8P10	388076	broad.mit.edu	37	15	22440455	22440455	+	IGR	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr15:22440455G>A								RP11-2F9.4 (4278 upstream) : IGHV1OR15-1 (7926 downstream)																							TTCTTCCTCAGGAGTCAGCTT	0.463																																							uc001yug.2		NA																	0					NA						c.(391-393)CCT>CTT		full-length cDNA clone CS0DI014YE21 of Placenta Cot 25-normalized of Homo sapiens (human).																																				SO:0001628	intergenic_variant	0							g.chr15:22440455G>A																													15.37:g.22440455G>A							p.P131L							1	411	-									Missense_Mutation	SNP		37	c.392C>T																																																																																				0	0.463									4	26	0	0	0	0.009096	0	4	26				
RYR3	6263	broad.mit.edu	37	15	34077909	34077909	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr15:34077909C>A	ENST00000389232.4	+	66	9385	c.9315C>A	c.(9313-9315)ccC>ccA	p.P3105P	RYR3_ENST00000415757.3_Silent_p.P3105P	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3105					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CTGACATCCCCCAGCTGGAAG	0.527																																							uc001zhi.2		NA																	0				ovary(5)|central_nervous_system(4)|lung(1)	10						c.(9313-9315)CCC>CCA		ryanodine receptor 3							59.0	67.0	64.0					15																	34077909		2140	4267	6407	SO:0001819	synonymous_variant	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:34077909C>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.9315C>A	15.37:g.34077909C>A						RYR3_uc010bar.2_Silent_p.P3105P	p.P3105P	NM_001036	NP_001027	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	66	9385	+		all_lung(180;7.18e-09)	3105					O15175|Q15412	Silent	SNP	ENST00000389232.4	37	c.9315C>A	CCDS45210.1																																																																																				0.527	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			4	62	1	0	0.00909568	0.009096	0.00960854	4	62				
PAK6	56924	broad.mit.edu	37	15	40564615	40564615	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr15:40564615G>A	ENST00000542403.2	+	4	1160	c.1049G>A	c.(1048-1050)gGa>gAa	p.G350E	PAK6_ENST00000455577.2_Missense_Mutation_p.G350E|RP11-133K1.2_ENST00000558658.1_3'UTR|PAK6_ENST00000441369.1_Missense_Mutation_p.G350E|PAK6_ENST00000560346.1_Missense_Mutation_p.G350E|PAK6_ENST00000453867.1_Missense_Mutation_p.G350E|PAK6_ENST00000260404.4_Missense_Mutation_p.G350E	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	350	Linker.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		TCCCCAGCGGGATCCCCCCGC	0.677																																							uc010bbl.2		NA																	0				lung(5)|large_intestine(1)|ovary(1)|skin(1)	8						c.(1048-1050)GGA>GAA		p21-activated kinase 6							47.0	49.0	48.0					15																	40564615		2203	4299	6502	SO:0001583	missense	56924						ATP binding|protein binding|protein serine/threonine kinase activity	g.chr15:40564615G>A	AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.1049G>A	15.37:g.40564615G>A	ENSP00000439597:p.Gly350Glu					PAK6_uc010bbm.2_Missense_Mutation_p.G350E|PAK6_uc001zky.3_Missense_Mutation_p.G350E|PAK6_uc010bbn.2_Missense_Mutation_p.G350E|PAK6_uc001zlb.2_Missense_Mutation_p.G350E	p.G350E	NM_001128628	NP_001122100	Q9NQU5	PAK6_HUMAN		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)	6	1489	+		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)	350			Linker.		A8K2G2|B3KYB0|G5E9R2	Missense_Mutation	SNP	ENST00000542403.2	37	c.1049G>A	CCDS10054.1	.	.	.	.	.	.	.	.	.	.	G	9.865	1.197334	0.22037	.	.	ENSG00000137843	ENST00000441369;ENST00000453867;ENST00000455577;ENST00000260404;ENST00000542403	T;T;T;T;T	0.73681	-0.72;-0.72;-0.77;-0.72;-0.72	4.69	4.69	0.59074	.	0.158430	0.56097	D	0.000028	T	0.65260	0.2674	L	0.29908	0.895	0.42174	D	0.991655	P;P	0.46912	0.818;0.886	B;P	0.45829	0.299;0.494	T	0.64453	-0.6404	10	0.02654	T	1	.	18.0181	0.89247	0.0:0.0:1.0:0.0	.	350;350	Q9NQU5;G5E9R2	PAK6_HUMAN;.	E	350	ENSP00000406873:G350E;ENSP00000401153:G350E;ENSP00000409465:G350E;ENSP00000260404:G350E;ENSP00000439597:G350E	ENSP00000260404:G350E	G	+	2	0	PAK6	38351907	1.000000	0.71417	0.960000	0.40013	0.448000	0.32197	5.292000	0.65673	2.318000	0.78349	0.555000	0.69702	GGA		0.677	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000418355.1			11	49	0	0	0	0.008291	0	11	49				
NDUFAF1	51103	broad.mit.edu	37	15	41687110	41687110	+	Missense_Mutation	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr15:41687110T>C	ENST00000260361.4	-	3	1087	c.706A>G	c.(706-708)Atg>Gtg	p.M236V		NM_016013.3	NP_057097.2	Q9Y375	CIA30_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 1	236					mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|mitochondrial respiratory chain complex I (GO:0005747)	unfolded protein binding (GO:0051082)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	12		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;8e-17)|GBM - Glioblastoma multiforme(113;1.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.114)		TAACTATACATCTGATTCGTC	0.473																																							uc001znx.2		NA																	0				ovary(1)	1						c.(706-708)ATG>GTG		NADH dehydrogenase (ubiquinone) 1 alpha							114.0	99.0	104.0					15																	41687110		2203	4300	6503	SO:0001583	missense	51103				mitochondrial electron transport, NADH to ubiquinone|protein complex assembly	mitochondrial respiratory chain complex I	unfolded protein binding	g.chr15:41687110T>C	AF151823	CCDS10075.1	15q11.2-q21.3	2012-10-12	2012-05-08		ENSG00000137806	ENSG00000137806		"""Mitochondrial respiratory chain complex assembly factors"""	18828	protein-coding gene	gene with protein product		606934				11935339, 10810093	Standard	NM_016013		Approved	CIA30, CGI-65	uc001znx.3	Q9Y375	OTTHUMG00000130340	ENST00000260361.4:c.706A>G	15.37:g.41687110T>C	ENSP00000260361:p.Met236Val					NDUFAF1_uc010bcf.2_RNA	p.M236V	NM_016013	NP_057097	Q9Y375	CIA30_HUMAN		OV - Ovarian serous cystadenocarcinoma(18;8e-17)|GBM - Glioblastoma multiforme(113;1.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.114)	3	1088	-		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)	236					Q9BVZ5	Missense_Mutation	SNP	ENST00000260361.4	37	c.706A>G	CCDS10075.1	.	.	.	.	.	.	.	.	.	.	T	10.90	1.481668	0.26598	.	.	ENSG00000137806	ENST00000260361	T	0.75704	-0.96	5.63	3.17	0.36434	NADH:ubiquinone oxidoreductase intermediate-associated protein 30 (1);Galactose-binding domain-like (1);	0.153604	0.64402	D	0.000005	T	0.58466	0.2124	L	0.28504	0.86	0.33647	D	0.608034	B	0.11235	0.004	B	0.18263	0.021	T	0.58323	-0.7656	10	0.20519	T	0.43	-9.7811	8.5617	0.33514	0.1041:0.0:0.3786:0.5173	.	236	Q9Y375	CIA30_HUMAN	V	236	ENSP00000260361:M236V	ENSP00000260361:M236V	M	-	1	0	NDUFAF1	39474402	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	1.783000	0.38664	1.068000	0.40764	-0.440000	0.05779	ATG		0.473	NDUFAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252692.2	NM_016013		12	51	0	0	0	0.010729	0	12	51				
SORD	6652	broad.mit.edu	37	15	45365705	45365705	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr15:45365705G>T	ENST00000267814.9	+	9	1231	c.1051G>T	c.(1051-1053)Gac>Tac	p.D351Y	SORD_ENST00000559562.1_3'UTR|SORD_ENST00000558580.1_Missense_Mutation_p.D330Y|RP11-109D20.2_ENST00000560967.1_RNA	NM_003104.5	NP_003095.2	Q00796	DHSO_HUMAN	sorbitol dehydrogenase	351					fructose biosynthetic process (GO:0046370)|glucose metabolic process (GO:0006006)|L-xylitol catabolic process (GO:0051160)|L-xylitol metabolic process (GO:0051164)|sorbitol catabolic process (GO:0006062)|sperm motility (GO:0030317)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)	carbohydrate binding (GO:0030246)|L-iditol 2-dehydrogenase activity (GO:0003939)|NAD binding (GO:0051287)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(3)|lung(4)	9		all_cancers(109;3.43e-12)|all_epithelial(112;2.33e-10)|Lung NSC(122;6.01e-07)|all_lung(180;4.38e-06)|Melanoma(134;0.0122)		all cancers(107;1.6e-18)|GBM - Glioblastoma multiforme(94;4.95e-07)|COAD - Colon adenocarcinoma(120;0.0704)|Colorectal(133;0.0706)		GCTCAAGTGTGACCCCAGTGA	0.507																																							uc001zul.3		NA																	0					0						c.(1051-1053)GAC>TAC		sorbitol dehydrogenase	NADH(DB00157)						40.0	50.0	46.0					15																	45365705		2088	4268	6356	SO:0001583	missense	6652				fructose biosynthetic process|glucose metabolic process|L-xylitol catabolic process|sorbitol catabolic process|sperm motility	cilium|extracellular space|flagellum|membrane fraction|mitochondrial membrane|soluble fraction	L-iditol 2-dehydrogenase activity|NAD binding|sugar binding|zinc ion binding	g.chr15:45365705G>T		CCDS10116.1	15q15-q21.1	2012-10-02			ENSG00000140263	ENSG00000140263	1.1.1.14		11184	protein-coding gene	gene with protein product		182500				7782086	Standard	NM_003104		Approved		uc001zul.4	Q00796	OTTHUMG00000131265	ENST00000267814.9:c.1051G>T	15.37:g.45365705G>T	ENSP00000267814:p.Asp351Tyr					SORD_uc001zum.3_3'UTR|SORD_uc010bdz.2_Missense_Mutation_p.D272Y	p.D351Y	NM_003104	NP_003095	Q00796	DHSO_HUMAN		all cancers(107;1.6e-18)|GBM - Glioblastoma multiforme(94;4.95e-07)|COAD - Colon adenocarcinoma(120;0.0704)|Colorectal(133;0.0706)	9	1192	+		all_cancers(109;3.43e-12)|all_epithelial(112;2.33e-10)|Lung NSC(122;6.01e-07)|all_lung(180;4.38e-06)|Melanoma(134;0.0122)	351					B2R655|B7Z3A6|J3JZZ5|Q16682|Q9UMD6	Missense_Mutation	SNP	ENST00000267814.9	37	c.1051G>T	CCDS10116.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.037944	0.75617	.	.	ENSG00000140263	ENST00000267814	T	0.02421	4.3	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.15739	0.0379	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.00106	-1.2055	10	0.49607	T	0.09	-3.7055	18.2799	0.90096	0.0:0.0:1.0:0.0	.	272;351	B4DKI2;Q00796	.;DHSO_HUMAN	Y	351	ENSP00000267814:D351Y	ENSP00000267814:D351Y	D	+	1	0	SORD	43152997	1.000000	0.71417	1.000000	0.80357	0.610000	0.37248	9.294000	0.96088	2.577000	0.86979	0.563000	0.77884	GAC		0.507	SORD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254033.3			13	65	1	0	9.22233e-05	0.004656	0.000105469	13	65				
SEMA6D	80031	broad.mit.edu	37	15	48052056	48052056	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr15:48052056G>C	ENST00000316364.5	+	2	500	c.61G>C	c.(61-63)Gtc>Ctc	p.V21L	SEMA6D_ENST00000389428.3_Missense_Mutation_p.V21L|SEMA6D_ENST00000389433.2_Missense_Mutation_p.V21L|SEMA6D_ENST00000558816.1_Missense_Mutation_p.V21L|SEMA6D_ENST00000355997.3_Missense_Mutation_p.V21L|SEMA6D_ENST00000558014.1_Missense_Mutation_p.V21L|SEMA6D_ENST00000537942.1_Missense_Mutation_p.V21L|SEMA6D_ENST00000354744.4_Missense_Mutation_p.V21L|SEMA6D_ENST00000389425.3_Missense_Mutation_p.V21L|SEMA6D_ENST00000358066.4_Missense_Mutation_p.V21L|SEMA6D_ENST00000536845.2_Missense_Mutation_p.V21L|SEMA6D_ENST00000389432.2_Missense_Mutation_p.V21L	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	21					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GTTGAGGGCAGTCAGCTTTCC	0.483																																							uc010bek.2		NA																	0				skin(3)|breast(1)	4						c.(61-63)GTC>CTC		semaphorin 6D isoform 4 precursor							189.0	146.0	160.0					15																	48052056		2198	4297	6495	SO:0001583	missense	80031				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity	g.chr15:48052056G>C	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.61G>C	15.37:g.48052056G>C	ENSP00000324857:p.Val21Leu					SEMA6D_uc001zvw.2_Missense_Mutation_p.V21L|SEMA6D_uc001zvx.1_Missense_Mutation_p.V21L|SEMA6D_uc001zvy.2_Missense_Mutation_p.V21L|SEMA6D_uc001zvz.2_Missense_Mutation_p.V21L|SEMA6D_uc001zwa.2_Missense_Mutation_p.V21L|SEMA6D_uc001zwb.2_Missense_Mutation_p.V21L|SEMA6D_uc001zwc.2_Missense_Mutation_p.V21L	p.V21L	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)	2	421	+		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)	21			Extracellular (Potential).		A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	37	c.61G>C	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.941874	0.34283	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428;ENST00000355997;ENST00000389425	T;T;T;T;T;T;T;T;T;T	0.26373	2.35;2.31;2.31;2.31;2.35;2.35;2.35;2.35;2.28;1.74	5.37	3.46	0.39613	.	0.172229	0.50627	N	0.000111	T	0.23014	0.0556	L	0.44542	1.39	0.58432	D	0.999998	B;B;B;B;B	0.26195	0.069;0.002;0.144;0.003;0.069	B;B;B;B;B	0.28553	0.062;0.005;0.091;0.009;0.062	T	0.03829	-1.1000	10	0.48119	T	0.1	.	11.2616	0.49087	0.0693:0.1274:0.8034:0.0	.	21;21;21;21;21	Q8NFY4-3;A6NM95;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;.;SEM6D_HUMAN;.	L	21	ENSP00000442040:V21L;ENSP00000446152:V21L;ENSP00000324857:V21L;ENSP00000374084:V21L;ENSP00000374083:V21L;ENSP00000346786:V21L;ENSP00000350770:V21L;ENSP00000374079:V21L;ENSP00000348276:V21L;ENSP00000374076:V21L	ENSP00000324857:V21L	V	+	1	0	SEMA6D	45839348	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	3.922000	0.56462	0.729000	0.32403	-0.137000	0.14449	GTC		0.483	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966		17	83	0	0	0	0.008871	0	17	83				
FAM227B	196951	broad.mit.edu	37	15	49800432	49800432	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr15:49800432C>G	ENST00000299338.6	-	11	1291	c.988G>C	c.(988-990)Gac>Cac	p.D330H	FAM227B_ENST00000561064.1_Missense_Mutation_p.D296H	NM_152647.2	NP_689860.2	Q96M60	F227B_HUMAN	family with sequence similarity 227, member B	330																	TCTTGACTGTCTGCAATTCTT	0.338																																							uc001zxl.2		NA																	0				ovary(1)	1						c.(988-990)GAC>CAC		hypothetical protein LOC196951							157.0	149.0	152.0					15																	49800432		2196	4295	6491	SO:0001583	missense	196951							g.chr15:49800432C>G		CCDS32237.1	15q21.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000166262	ENSG00000166262			26543	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 33"""	C15orf33			Standard	NM_152647		Approved	FLJ32800	uc001zxl.2	Q96M60	OTTHUMG00000172328	ENST00000299338.6:c.988G>C	15.37:g.49800432C>G	ENSP00000299338:p.Asp330His					C15orf33_uc001zxm.2_Missense_Mutation_p.D296H	p.D330H	NM_152647	NP_689860	Q96M60	CO033_HUMAN		all cancers(107;3.45e-08)|GBM - Glioblastoma multiforme(94;0.000124)	11	1282	-		all_lung(180;0.00187)	330					Q86WS2	Missense_Mutation	SNP	ENST00000299338.6	37	c.988G>C	CCDS32237.1	.	.	.	.	.	.	.	.	.	.	C	5.826	0.336668	0.11013	.	.	ENSG00000166262	ENST00000299338;ENST00000354658	.	.	.	3.71	-2.76	0.05896	.	1.810880	0.03170	N	0.170585	T	0.17280	0.0415	N	0.08118	0	0.09310	N	1	B;B	0.29531	0.216;0.247	B;B	0.31337	0.089;0.128	T	0.13845	-1.0494	9	0.52906	T	0.07	-7.3424	0.2155	0.00161	0.3593:0.1478:0.1828:0.3101	.	296;330	Q96M60-2;Q96M60	.;CO033_HUMAN	H	330;296	.	ENSP00000299338:D330H	D	-	1	0	C15orf33	47587724	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.095000	0.15127	-0.230000	0.09840	-0.262000	0.10625	GAC		0.338	FAM227B-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417872.1	NM_152647		5	45	0	0	0	0.000602	0	5	45				
ISLR2	57611	broad.mit.edu	37	15	74425301	74425301	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr15:74425301G>T	ENST00000361742.3	+	4	975	c.206G>T	c.(205-207)gGg>gTg	p.G69V	ISLR2_ENST00000435464.1_Missense_Mutation_p.G69V|ISLR2_ENST00000565540.1_Missense_Mutation_p.G69V|ISLR2_ENST00000561975.1_Intron|ISLR2_ENST00000445793.1_Missense_Mutation_p.G69V|ISLR2_ENST00000419208.1_Missense_Mutation_p.G69V|ISLR2_ENST00000453268.2_Missense_Mutation_p.G69V|ISLR2_ENST00000565159.1_Missense_Mutation_p.G69V	NM_001130136.1|NM_020851.2	NP_001123608.1|NP_065902.1	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing leucine-rich repeat 2	69					positive regulation of axon extension (GO:0045773)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36						CTGCGGCGCGGGGCCTTCGCC	0.637																																							uc002axd.2		NA																	0					0						c.(205-207)GGG>GTG		immunoglobulin superfamily containing							60.0	51.0	54.0					15																	74425301		2198	4297	6495	SO:0001583	missense	57611				positive regulation of axon extension	cell surface|integral to membrane|plasma membrane		g.chr15:74425301G>T		CCDS10259.1	15q24.1	2013-01-11			ENSG00000167178	ENSG00000167178		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29286	protein-coding gene	gene with protein product		614179				10819331, 12975309	Standard	NM_001130136		Approved	KIAA1465	uc010bjf.3	Q6UXK2	OTTHUMG00000137624	ENST00000361742.3:c.206G>T	15.37:g.74425301G>T	ENSP00000355402:p.Gly69Val					ISLR2_uc002axe.2_Missense_Mutation_p.G69V|ISLR2_uc010bjg.2_Missense_Mutation_p.G69V|ISLR2_uc010bjf.2_Missense_Mutation_p.G69V	p.G69V	NM_001130136	NP_001123608	Q6UXK2	ISLR2_HUMAN			4	975	+			69			LRR 1.|Extracellular (Potential).		A8K352|Q9P263	Missense_Mutation	SNP	ENST00000361742.3	37	c.206G>T	CCDS10259.1	.	.	.	.	.	.	.	.	.	.	G	11.51	1.660936	0.29515	.	.	ENSG00000167178	ENST00000445793;ENST00000361742;ENST00000435464;ENST00000453268;ENST00000395121;ENST00000419208	T;T;T;T;T	0.59638	0.25;0.25;0.25;0.25;0.25	4.66	4.66	0.58398	.	0.447061	0.24254	N	0.040144	T	0.72095	0.3418	M	0.76574	2.34	0.33751	D	0.620644	D	0.67145	0.996	P	0.62491	0.903	T	0.81597	-0.0860	10	0.56958	D	0.05	.	13.4793	0.61326	0.0:0.2908:0.7091:0.0	.	69	Q6UXK2	ISLR2_HUMAN	V	69	ENSP00000403244:G69V;ENSP00000355402:G69V;ENSP00000411443:G69V;ENSP00000411834:G69V;ENSP00000408872:G69V	ENSP00000355402:G69V	G	+	2	0	ISLR2	72212354	0.996000	0.38824	1.000000	0.80357	0.228000	0.25075	4.267000	0.58877	2.151000	0.67156	0.407000	0.27541	GGG		0.637	ISLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269046.1	NM_020851		18	61	1	0	1.67942e-08	0.006122	2.35118e-08	18	61				
CIB2	10518	broad.mit.edu	37	15	78401674	78401674	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr15:78401674C>T	ENST00000258930.3	-	4	577	c.249G>A	c.(247-249)gaG>gaA	p.E83E	CIB2_ENST00000560618.1_Silent_p.E40E|CIB2_ENST00000557846.1_Silent_p.E34E|CIB2_ENST00000539011.1_Silent_p.E40E	NM_006383.2	NP_006374.1	O75838	CIB2_HUMAN	calcium and integrin binding family member 2	83	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion homeostasis (GO:0055074)|photoreceptor cell maintenance (GO:0045494)	blood microparticle (GO:0072562)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|photoreceptor inner segment (GO:0001917)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	11						TGAGGTTCCCCTCACCATCCT	0.512																																							uc002bdb.1		NA																	0					0						c.(247-249)GAG>GAA		DNA-dependent protein kinase catalytic							110.0	92.0	98.0					15																	78401674		2196	4293	6489	SO:0001819	synonymous_variant	10518						calcium ion binding	g.chr15:78401674C>T	BC047381	CCDS10296.1, CCDS61722.1, CCDS61723.1	15q24	2013-01-10			ENSG00000136425	ENSG00000136425		"""EF-hand domain containing"""	24579	protein-coding gene	gene with protein product		605564	"""deafness, autosomal recessive 48"", ""Usher syndrome 1J (autosomal recessive)"""	DFNB48, USH1J		9931475, 23023331	Standard	NM_006383		Approved	KIP2	uc002bdb.2	O75838	OTTHUMG00000143731	ENST00000258930.3:c.249G>A	15.37:g.78401674C>T						CIB2_uc002bdc.1_Silent_p.E40E|CIB2_uc010ums.1_Silent_p.E83E	p.E83E	NM_006383	NP_006374	O75838	CIB2_HUMAN			4	570	-			83			EF-hand 1.		B4DDF0|H0YM71|Q05BT6	Silent	SNP	ENST00000258930.3	37	c.249G>A	CCDS10296.1																																																																																				0.512	CIB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289798.1	NM_006383		4	69	0	0	0	0.009096	0	4	69				
ZNF592	9640	broad.mit.edu	37	15	85345586	85345586	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr15:85345586C>G	ENST00000560079.2	+	11	4054	c.3766C>G	c.(3766-3768)Cag>Gag	p.Q1256E	ZNF592_ENST00000299927.3_Missense_Mutation_p.Q1256E	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	1256					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			ACAGGCCTCTCAGGACCAGGA	0.622																																							uc002bld.2		NA																	0				ovary(4)|skin(2)	6						c.(3766-3768)CAG>GAG		zinc finger protein 592							25.0	27.0	27.0					15																	85345586		2202	4298	6500	SO:0001583	missense	9640				cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr15:85345586C>G	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.3766C>G	15.37:g.85345586C>G	ENSP00000452877:p.Gln1256Glu					ZNF592_uc010upb.1_RNA	p.Q1256E	NM_014630	NP_055445	Q92610	ZN592_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0587)		11	4102	+			1256					Q2M1T2|Q504Y9	Missense_Mutation	SNP	ENST00000560079.2	37	c.3766C>G	CCDS32317.1	.	.	.	.	.	.	.	.	.	.	C	13.40	2.225115	0.39300	.	.	ENSG00000166716	ENST00000299927	T	0.00611	6.23	4.83	3.88	0.44766	.	0.317240	0.25997	N	0.026977	T	0.00412	0.0013	N	0.08118	0	0.26197	N	0.979504	B	0.20052	0.041	B	0.17433	0.018	T	0.47129	-0.9141	10	0.27082	T	0.32	-16.1468	10.6756	0.45783	0.0:0.8063:0.1937:0.0	.	1256	Q92610	ZN592_HUMAN	E	1256	ENSP00000299927:Q1256E	ENSP00000299927:Q1256E	Q	+	1	0	ZNF592	83146590	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.684000	0.37649	1.198000	0.43158	0.655000	0.94253	CAG		0.622	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630		3	38	0	0	0	0.004672	0	3	38				
ACAN	176	broad.mit.edu	37	15	89401442	89401442	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr15:89401442G>A	ENST00000561243.1	+	11	5626	c.5626G>A	c.(5626-5628)Gga>Aga	p.G1876R	ACAN_ENST00000559004.1_Missense_Mutation_p.G1876R|ACAN_ENST00000439576.2_Missense_Mutation_p.G1876R|ACAN_ENST00000352105.7_Missense_Mutation_p.G1876R			P16112	PGCA_HUMAN	aggrecan	1881	CS-2.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GGATGTCAGTGGACAGTTTTC	0.507																																							uc010upo.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(5626-5628)GGA>AGA		aggrecan isoform 2 precursor							59.0	61.0	60.0					15																	89401442		2005	4167	6172	SO:0001583	missense	176				cell adhesion		hyaluronic acid binding|sugar binding	g.chr15:89401442G>A	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.5626G>A	15.37:g.89401442G>A	ENSP00000453342:p.Gly1876Arg					ACAN_uc010upp.1_Missense_Mutation_p.G1876R|ACAN_uc002bna.2_RNA	p.G1876R	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.146)		12	6000	+	Lung NSC(78;0.0392)|all_lung(78;0.077)		1876					Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	c.5626G>A	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	G	15.88	2.964645	0.53507	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.08008	3.58;3.14	5.56	5.56	0.83823	.	0.279100	0.19369	N	0.115950	T	0.33614	0.0869	M	0.81239	2.535	0.25527	N	0.987314	D;D	0.76494	0.999;0.999	D;D	0.75484	0.98;0.986	T	0.08371	-1.0725	10	0.72032	D	0.01	-6.8308	18.5131	0.90925	0.0:0.0:1.0:0.0	.	1876;1876	E7ENV9;E7EX88	.;.	R	1876;1876;1762	ENSP00000387356:G1876R;ENSP00000341615:G1876R	ENSP00000268134:G1762R	G	+	1	0	ACAN	87202446	1.000000	0.71417	0.999000	0.59377	0.259000	0.26198	7.142000	0.77339	2.618000	0.88619	0.655000	0.94253	GGA		0.507	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135		10	41	0	0	0	0.006214	0	10	41				
FAM169B	283777	broad.mit.edu	37	15	98995202	98995202	+	Silent	SNP	C	C	A	rs539154606	byFrequency	TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr15:98995202C>A	ENST00000558256.1	-	5	471	c.222G>T	c.(220-222)ctG>ctT	p.L74L	FAM169B_ENST00000332908.4_Silent_p.L74L	NM_182562.2	NP_872368.2	Q8N8A8	F169B_HUMAN	family with sequence similarity 169, member B	74										large_intestine(3)|lung(3)|urinary_tract(1)	7						AGACAGGCAGCAGGTAGCATG	0.587													C|||	4	0.000798722	0.0	0.0	5008	,	,		20354	0.004		0.0	False		,,,				2504	0.0						uc002buk.1		NA																	0					0						c.(220-222)CTG>CTT		hypothetical protein LOC283777							71.0	77.0	75.0					15																	98995202		2097	4226	6323	SO:0001819	synonymous_variant	283777							g.chr15:98995202C>A		CCDS45360.1	15q26.3	2008-08-08			ENSG00000185087	ENSG00000185087			26835	protein-coding gene	gene with protein product							Standard	NM_182562		Approved	FLJ39743, KIAA0888L	uc002buk.1	Q8N8A8		ENST00000558256.1:c.222G>T	15.37:g.98995202C>A							p.L74L	NM_182562	NP_872368	Q8N8A8	F169B_HUMAN			5	472	-			74					B5MDL8	Silent	SNP	ENST00000558256.1	37	c.222G>T	CCDS45360.1																																																																																				0.587	FAM169B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415488.1	NM_182562		8	37	1	0	2.17888e-05	0.006214	2.55607e-05	8	37				
TPSD1	23430	broad.mit.edu	37	16	1308196	1308196	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr16:1308196G>T	ENST00000211076.3	+	4	805	c.657G>T	c.(655-657)gcG>gcT	p.A219A	PRSS29P_ENST00000568091.1_lincRNA|TPSD1_ENST00000397534.2_Silent_p.A212A|RP11-616M22.5_ENST00000566997.1_RNA	NM_012217.2	NP_036349.1	Q9BZJ3	TRYD_HUMAN	tryptase delta 1	219	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	20		Hepatocellular(780;0.00369)				TGCTGTGTGCGGGGAGCGAAA	0.622																																							uc002clb.1		NA																	0					0						c.(655-657)GCG>GCT		tryptase delta 1 precursor							52.0	54.0	53.0					16																	1308196		2198	4299	6497	SO:0001819	synonymous_variant	23430				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr16:1308196G>T	AF206664	CCDS10432.1	16p13.3	2008-07-29			ENSG00000095917	ENSG00000095917	3.4.21.59		14118	protein-coding gene	gene with protein product	"""mMCP-7-like II"", ""mMCP-7-like I"", ""MMCP-7-LIKE-2"""	609272				9920877	Standard	NM_012217		Approved		uc002clb.1	Q9BZJ3	OTTHUMG00000128511	ENST00000211076.3:c.657G>T	16.37:g.1308196G>T						TPSD1_uc010brm.1_Silent_p.A148A	p.A219A	NM_012217	NP_036349	Q9BZJ3	TRYD_HUMAN			4	666	+		Hepatocellular(780;0.00369)	219			Peptidase S1.		O95824|Q8TDI6|Q96L36|Q96RZ5|Q9H2Y6|Q9UQI8	Silent	SNP	ENST00000211076.3	37	c.657G>T	CCDS10432.1																																																																																				0.622	TPSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250320.2			12	29	1	0	5.50884e-06	0.013537	6.65869e-06	12	29				
TPSD1	23430	broad.mit.edu	37	16	1308350	1308350	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr16:1308350C>A	ENST00000211076.3	+	5	850	c.702C>A	c.(700-702)ccC>ccA	p.P234P	PRSS29P_ENST00000568091.1_lincRNA|TPSD1_ENST00000397534.2_Silent_p.P227P|RP11-616M22.5_ENST00000566997.1_RNA	NM_012217.2	NP_036349.1	Q9BZJ3	TRYD_HUMAN	tryptase delta 1	234	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	20		Hepatocellular(780;0.00369)				CTGGAGGGCCCCTGGTCTGCA	0.667																																							uc002clb.1		NA																	0					0						c.(700-702)CCC>CCA		tryptase delta 1 precursor							82.0	80.0	81.0					16																	1308350		2199	4300	6499	SO:0001819	synonymous_variant	23430				proteolysis	extracellular region	serine-type endopeptidase activity	g.chr16:1308350C>A	AF206664	CCDS10432.1	16p13.3	2008-07-29			ENSG00000095917	ENSG00000095917	3.4.21.59		14118	protein-coding gene	gene with protein product	"""mMCP-7-like II"", ""mMCP-7-like I"", ""MMCP-7-LIKE-2"""	609272				9920877	Standard	NM_012217		Approved		uc002clb.1	Q9BZJ3	OTTHUMG00000128511	ENST00000211076.3:c.702C>A	16.37:g.1308350C>A							p.P234P	NM_012217	NP_036349	Q9BZJ3	TRYD_HUMAN			5	711	+		Hepatocellular(780;0.00369)	234			Peptidase S1.		O95824|Q8TDI6|Q96L36|Q96RZ5|Q9H2Y6|Q9UQI8	Silent	SNP	ENST00000211076.3	37	c.702C>A	CCDS10432.1																																																																																				0.667	TPSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250320.2			17	68	1	0	3.52763e-06	0.00499	4.34642e-06	17	68				
PDILT	204474	broad.mit.edu	37	16	20370659	20370659	+	Silent	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr16:20370659T>C	ENST00000302451.4	-	12	1985	c.1737A>G	c.(1735-1737)aaA>aaG	p.K579K		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	579					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						CTTCCTTGACTTTTGGTTTCT	0.443																																							uc002dhc.1		NA																	0				large_intestine(1)	1						c.(1735-1737)AAA>AAG		protein disulfide isomerase-like, testis							156.0	148.0	151.0					16																	20370659		2203	4300	6503	SO:0001819	synonymous_variant	204474				cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity	g.chr16:20370659T>C		CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.1737A>G	16.37:g.20370659T>C							p.K579K	NM_174924	NP_777584	Q8N807	PDILT_HUMAN			12	1960	-			579					Q8IVQ5	Silent	SNP	ENST00000302451.4	37	c.1737A>G	CCDS10584.1																																																																																				0.443	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924		36	140	0	0	0	0.003755	0	36	140				
SULT1A1	6817	broad.mit.edu	37	16	28620185	28620185	+	De_novo_Start_OutOfFrame	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr16:28620185G>A	ENST00000569554.1	-	0	56				SULT1A1_ENST00000395609.1_Intron|SULT1A1_ENST00000350842.4_Intron|SULT1A1_ENST00000395607.1_Intron|SULT1A1_ENST00000314752.7_Intron			P50225	ST1A1_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1						3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|estrogen metabolic process (GO:0008210)|flavonoid metabolic process (GO:0009812)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid sulfotransferase activity (GO:0050294)|sulfotransferase activity (GO:0008146)			endometrium(2)|kidney(7)|large_intestine(2)|lung(2)|ovary(1)|stomach(2)	16					Acetaminophen(DB00316)|Tamoxifen(DB00675)	ATGTTCCTGCGTCAGGGGCCA	0.597																																							uc002dqi.2		NA																	0					0						c.(-10--6)GACGC>GATGC		sulfotransferase family, cytosolic, 1A,																																						6817				3'-phosphoadenosine 5'-phosphosulfate metabolic process|catecholamine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|xenobiotic metabolic process	cytosol	aryl sulfotransferase activity|flavonol 3-sulfotransferase activity	g.chr16:28620185G>A	U52852	CCDS10637.1, CCDS32420.1	16p12.1	2008-02-05			ENSG00000196502	ENSG00000196502	2.8.2.1	"""Sulfotransferases, cytosolic"""	11453	protein-coding gene	gene with protein product		171150		STP, STP1		8288252, 8912648	Standard	NM_177534		Approved	P-PST	uc002dqj.3	P50225	OTTHUMG00000131765	ENST00000569554.1:c.-9C>T	16.37:g.28620185G>A						uc010vct.1_Intron|SULT1A1_uc002dqj.2_Intron|SULT1A1_uc002dqk.2_Translation_Start_Site|SULT1A1_uc002dql.2_Intron|SULT1A1_uc002dqm.2_Intron|SULT1A1_uc002dqn.2_Intron|SULT1A1_uc002dqo.2_Intron|SULT1A1_uc002dqp.2_Intron		NM_177534	NP_803878	P50225	ST1A1_HUMAN			1	465	-								Q2NL71|Q86U58|Q92818|Q9BVU6|Q9UGG7	Translation_Start_Site	SNP	ENST00000569554.1	37	c.-8C>T	CCDS32420.1																																																																																				0.597	SULT1A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430985.1	NM_001055		6	140	0	0	0	0.001984	0	6	140				
BCKDK	10295	broad.mit.edu	37	16	31121042	31121042	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr16:31121042C>A	ENST00000394951.1	+	5	936	c.313C>A	c.(313-315)Cgc>Agc	p.R105S	AC135050.1_ENST00000517000.2_RNA|BCKDK_ENST00000219794.6_Missense_Mutation_p.R105S|BCKDK_ENST00000394950.3_Missense_Mutation_p.R105S|BCKDK_ENST00000287507.3_Missense_Mutation_p.R105S			O14874	BCKD_HUMAN	branched chain ketoacid dehydrogenase kinase	105					branched-chain amino acid catabolic process (GO:0009083)|cellular amino acid catabolic process (GO:0009063)|phosphorylation (GO:0016310)|protein phosphorylation (GO:0006468)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrion (GO:0005739)	[3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity (GO:0047323)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|stomach(1)	2						GATTGCTCACCGCATCAAGGG	0.567																																							uc002eaw.3		NA																	0				stomach(1)|breast(1)	2						c.(313-315)CGC>AGC		branched chain ketoacid dehydrogenase kinase							84.0	77.0	79.0					16																	31121042		2197	4300	6497	SO:0001583	missense	10295				branched chain family amino acid catabolic process|peptidyl-histidine phosphorylation	mitochondrial alpha-ketoglutarate dehydrogenase complex	[3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity|ATP binding|protein binding|protein serine/threonine kinase activity|two-component sensor activity	g.chr16:31121042C>A	AF026548	CCDS10705.1, CCDS45467.1, CCDS61917.1	16p11.2	2008-05-14			ENSG00000103507	ENSG00000103507			16902	protein-coding gene	gene with protein product		614901				1889817	Standard	NM_005881		Approved		uc002eaw.5	O14874	OTTHUMG00000047356	ENST00000394951.1:c.313C>A	16.37:g.31121042C>A	ENSP00000378405:p.Arg105Ser					BCKDK_uc002eav.3_Missense_Mutation_p.R105S|BCKDK_uc010cah.2_RNA|BCKDK_uc010cai.2_Missense_Mutation_p.R105S	p.R105S	NM_005881	NP_005872	O14874	BCKD_HUMAN			4	629	+			105					A8MY43|Q6FGL4|Q96G95|Q96IN5	Missense_Mutation	SNP	ENST00000394951.1	37	c.313C>A	CCDS10705.1	.	.	.	.	.	.	.	.	.	.	C	30	5.055488	0.93793	.	.	ENSG00000103507	ENST00000394951;ENST00000219794;ENST00000394950;ENST00000287507	T;T;T;T	0.36157	1.27;1.27;1.27;1.27	5.69	5.69	0.88448	Branched-chain alpha-ketoacid dehydrogenase kinase/Pyruvate dehydrogenase kinase, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.71558	0.3354	H	0.94698	3.57	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.74023	0.982;0.966	T	0.79245	-0.1883	10	0.62326	D	0.03	-8.2768	18.5641	0.91111	0.0:1.0:0.0:0.0	.	105;105	Q96G95;O14874	.;BCKD_HUMAN	S	105	ENSP00000378405:R105S;ENSP00000219794:R105S;ENSP00000378404:R105S;ENSP00000287507:R105S	ENSP00000219794:R105S	R	+	1	0	BCKDK	31028543	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	6.840000	0.75369	2.684000	0.91462	0.655000	0.94253	CGC		0.567	BCKDK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108514.1	NM_005881		8	70	1	0	2.17888e-05	0.006214	2.55607e-05	8	70				
ABCC11	85320	broad.mit.edu	37	16	48212511	48212511	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr16:48212511C>A	ENST00000394747.1	-	23	3694	c.3345G>T	c.(3343-3345)atG>atT	p.M1115I	ABCC11_ENST00000353782.5_Missense_Mutation_p.M1115I|ABCC11_ENST00000356608.2_Missense_Mutation_p.M1115I|ABCC11_ENST00000394748.1_Missense_Mutation_p.M1115I|ABCC11_ENST00000565329.1_5'UTR	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	1115					organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	ACCCCACCTTCATGTACTGCA	0.587																																							uc002eff.1		NA																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(3343-3345)ATG>ATT		ATP-binding cassette, sub-family C, member 11							119.0	104.0	109.0					16																	48212511		2201	4300	6501	SO:0001583	missense	85320	Cerumen_Type				integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr16:48212511C>A	AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.3345G>T	16.37:g.48212511C>A	ENSP00000378230:p.Met1115Ile					ABCC11_uc002efg.1_Missense_Mutation_p.M1115I|ABCC11_uc002efh.1_Missense_Mutation_p.M1115I|ABCC11_uc010cbg.1_RNA	p.M1115I	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN			23	3695	-		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)	1115			Cytoplasmic (Potential).		Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	ENST00000394747.1	37	c.3345G>T	CCDS10732.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.212752	0.00289	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747	D;D;D;D	0.94138	-3.36;-3.36;-3.36;-3.36	3.75	1.77	0.24775	ABC transporter, transmembrane domain, type 1 (1);	0.731342	0.12923	N	0.428016	T	0.80314	0.4600	N	0.03608	-0.345	0.80722	D	1	B;B	0.10296	0.003;0.001	B;B	0.10450	0.005;0.0	T	0.66035	-0.6023	10	0.14656	T	0.56	-6.0715	5.8506	0.18691	0.0:0.7578:0.0:0.2422	.	1115;1115	Q96J66-2;Q96J66	.;ABCCB_HUMAN	I	1115	ENSP00000311326:M1115I;ENSP00000349017:M1115I;ENSP00000378231:M1115I;ENSP00000378230:M1115I	ENSP00000311326:M1115I	M	-	3	0	ABCC11	46770012	0.996000	0.38824	0.645000	0.29479	0.137000	0.21094	0.168000	0.16622	0.289000	0.22422	0.462000	0.41574	ATG		0.587	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1	NM_032583		17	88	1	0	6.94344e-10	0.006122	1.01212e-09	17	88				
SALL1	6299	broad.mit.edu	37	16	51175648	51175648	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr16:51175648C>T	ENST00000251020.4	-	2	518	c.485G>A	c.(484-486)gGc>gAc	p.G162D	SALL1_ENST00000541611.1_Intron|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.G65D|SALL1_ENST00000562674.1_5'Flank	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	162	Poly-Gly.				adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GGAgctgccgccgccgccgct	0.627																																					GBM(103;1352 1446 1855 4775 8890)	GBM(103;1352 1446 1855 4775 8890)	uc010vgs.1		NA																	0				skin(5)|ovary(3)	8						c.(484-486)GGC>GAC		sal-like 1 isoform a							29.0	29.0	29.0					16																	51175648		2198	4300	6498	SO:0001583	missense	6299				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr16:51175648C>T	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.485G>A	16.37:g.51175648C>T	ENSP00000251020:p.Gly162Asp					SALL1_uc010vgr.1_Missense_Mutation_p.G65D|SALL1_uc010cbv.2_Intron	p.G162D	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	COAD - Colon adenocarcinoma(2;0.24)		2	516	-		all_cancers(37;0.0322)	162			Poly-Gly.		Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	c.485G>A	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.375006	0.00015	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.06068	3.36;3.35	0.75	-0.582	0.11709	.	.	.	.	.	T	0.02380	0.0073	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47711	-0.9096	9	0.09338	T	0.73	.	2.8269	0.05488	0.0:0.3895:0.0:0.6105	.	162	Q9NSC2	SALL1_HUMAN	D	162;65;126	ENSP00000251020:G162D;ENSP00000407914:G65D	ENSP00000251020:G162D	G	-	2	0	SALL1	49733149	0.974000	0.33945	0.002000	0.10522	0.077000	0.17291	0.472000	0.22116	-0.225000	0.09913	0.184000	0.17185	GGC		0.627	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968		21	44	0	0	0	0.008871	0	21	44				
RLTPR	146206	broad.mit.edu	37	16	67679982	67679982	+	Splice_Site	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr16:67679982A>T	ENST00000334583.6	+	4	576	c.248A>T	c.(247-249)cAg>cTg	p.Q83L	RLTPR_ENST00000545661.1_Splice_Site_p.Q83L	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	83					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		ACACCCCCTCAGGTGAGACAC	0.622																																							uc002etn.2		NA																	0				breast(1)	1						c.(247-249)CAG>CTG		RGD motif, leucine rich repeats, tropomodulin							85.0	93.0	90.0					16																	67679982		2088	4219	6307	SO:0001630	splice_region_variant	146206							g.chr16:67679982A>T	AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.249+1A>T	16.37:g.67679982A>T						RLTPR_uc010cel.1_Missense_Mutation_p.Q83L|RLTPR_uc010vjr.1_Missense_Mutation_p.Q83L	p.Q83L	NM_001013838	NP_001013860	Q6F5E8	LR16C_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)	4	368	+		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)	83			LRR 1.		B8X2Z3	Missense_Mutation	SNP	ENST00000334583.6	37	c.248A>T	CCDS45513.1	.	.	.	.	.	.	.	.	.	.	A	14.00	2.404338	0.42613	.	.	ENSG00000159753	ENST00000334583;ENST00000545661	T;T	0.16324	2.42;2.35	4.57	3.48	0.39840	.	0.464097	0.23199	N	0.050806	T	0.14570	0.0352	L	0.54323	1.7	0.34897	D	0.746122	B;B	0.20261	0.043;0.043	B;B	0.16722	0.016;0.016	T	0.12344	-1.0551	10	0.54805	T	0.06	-22.025	3.4059	0.07340	0.6916:0.0:0.1094:0.199	.	83;83	B8X2Z3;Q6F5E8	.;LR16C_HUMAN	L	83	ENSP00000334958:Q83L;ENSP00000441481:Q83L	ENSP00000334958:Q83L	Q	+	2	0	RLTPR	66237483	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	1.594000	0.36697	0.805000	0.34159	0.459000	0.35465	CAG		0.622	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467858.1	NM_001013838	Missense_Mutation	23	104	0	0	0	0.014323	0	23	104				
SF3B3	23450	broad.mit.edu	37	16	70590926	70590926	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr16:70590926G>T	ENST00000302516.5	+	15	2215	c.2004G>T	c.(2002-2004)ggG>ggT	p.G668G		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	668					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				TGAATATTGGGCTACAGGTAA	0.507																																							uc002ezf.2		NA																	0				ovary(1)	1						c.(2002-2004)GGG>GGT		splicing factor 3b, subunit 3							107.0	101.0	103.0					16																	70590926		2198	4300	6498	SO:0001819	synonymous_variant	23450				protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding	g.chr16:70590926G>T	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.2004G>T	16.37:g.70590926G>T							p.G668G	NM_012426	NP_036558	Q15393	SF3B3_HUMAN			15	2215	+		Ovarian(137;0.0694)	668					Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Silent	SNP	ENST00000302516.5	37	c.2004G>T	CCDS10894.1																																																																																				0.507	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426		10	37	1	0	1.76689e-08	0.006214	2.45209e-08	10	37				
TAT	6898	broad.mit.edu	37	16	71604215	71604215	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr16:71604215C>A	ENST00000355962.4	-	9	1131	c.998G>T	c.(997-999)cGc>cTc	p.R333L	RP11-432I5.1_ENST00000561529.1_RNA	NM_000353.2	NP_000344.1	P17735	ATTY_HUMAN	tyrosine aminotransferase	333					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|L-phenylalanine catabolic process (GO:0006559)|response to glucocorticoid (GO:0051384)|response to mercury ion (GO:0046689)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|L-tyrosine:2-oxoglutarate aminotransferase activity (GO:0004838)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(3)	29		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)	TCCCGGGGTGCGACATAGGAT	0.552																																					Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)	Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)	uc002fap.2		NA																	0				ovary(2)	2						c.(997-999)CGC>CTC		tyrosine aminotransferase	L-Glutamic Acid(DB00142)|L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Pyridoxal Phosphate(DB00114)						68.0	64.0	66.0					16																	71604215		2198	4300	6498	SO:0001583	missense	6898				2-oxoglutarate metabolic process|glutamate metabolic process|L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	1-aminocyclopropane-1-carboxylate synthase activity|L-tyrosine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding	g.chr16:71604215C>A		CCDS10903.1	16q22.1	2012-10-02			ENSG00000198650	ENSG00000198650	2.6.1.5		11573	protein-coding gene	gene with protein product		613018					Standard	NM_000353		Approved		uc002fap.2	P17735	OTTHUMG00000137590	ENST00000355962.4:c.998G>T	16.37:g.71604215C>A	ENSP00000348234:p.Arg333Leu						p.R333L	NM_000353	NP_000344	P17735	ATTY_HUMAN		Kidney(780;0.0157)	9	1097	-		Ovarian(137;0.125)	333					B2R8I1|D3DWS2	Missense_Mutation	SNP	ENST00000355962.4	37	c.998G>T	CCDS10903.1	.	.	.	.	.	.	.	.	.	.	C	17.47	3.396602	0.62177	.	.	ENSG00000198650	ENST00000355962	D	0.90620	-2.7	5.74	5.74	0.90152	Tyrosine aminotransferase (1);Aminotransferase, class I/classII (1);Tyrosine/nicotianamine aminotransferase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.156544	0.64402	D	0.000017	T	0.79528	0.4461	N	0.11560	0.145	0.51012	D	0.999901	P	0.44006	0.824	B	0.34590	0.186	T	0.81895	-0.0723	10	0.42905	T	0.14	-19.4547	13.1719	0.59604	0.0:0.9275:0.0:0.0725	.	333	P17735	ATTY_HUMAN	L	333	ENSP00000348234:R333L	ENSP00000348234:R333L	R	-	2	0	TAT	70161716	0.873000	0.30073	0.993000	0.49108	0.691000	0.40173	1.534000	0.36051	2.712000	0.92718	0.650000	0.86243	CGC		0.552	TAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268989.1			11	57	1	0	1.58986e-06	0.008291	2.01341e-06	11	57				
TP53	7157	broad.mit.edu	37	17	7578290	7578290	+	Splice_Site	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr17:7578290C>T	ENST00000269305.4	-	6	749		c.e6-1		TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(40)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGGCCAGACCTAAGAGCAAT	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		54	Unknown(40)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	p.?(24)|p.0?(7)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)	upper_aerodigestive_tract(11)|lung(9)|large_intestine(6)|central_nervous_system(5)|ovary(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|liver(3)|oesophagus(2)|breast(2)|stomach(1)|genital_tract(1)|eye(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CD043957|CS011574|CS083991	TP53	D|S		c.e6-1	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							82.0	74.0	76.0					17																	7578290		2203	4300	6503	SO:0001630	splice_region_variant	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7578290C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.560-1G>A	17.37:g.7578290C>T		HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Splice_Site_p.G187_splice|TP53_uc002gih.2_Splice_Site_p.G187_splice|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Splice_Site_p.G55_splice|TP53_uc010cng.1_Splice_Site_p.G55_splice|TP53_uc002gii.1_Splice_Site_p.G55_splice|TP53_uc010cnh.1_Splice_Site_p.G187_splice|TP53_uc010cni.1_Splice_Site_p.G187_splice|TP53_uc002gij.2_Splice_Site_p.G187_splice|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Splice_Site_p.G94_splice|TP53_uc002gio.2_Splice_Site_p.G55_splice|TP53_uc010vug.1_Intron	p.G187_splice	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	6	754	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)						Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	37	c.560_splice	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	9.113	1.007143	0.19199	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.67	4.67	0.58626	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.89	0.79291	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519015	1.000000	0.71417	0.995000	0.50966	0.031000	0.12232	3.449000	0.52950	2.539000	0.85634	0.655000	0.94253	.		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron	10	40	0	0	0	0.006214	0	10	40				
MYH13	8735	broad.mit.edu	37	17	10247257	10247257	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr17:10247257G>C	ENST00000418404.3	-	15	1917	c.1754C>G	c.(1753-1755)gCc>gGc	p.A585G	MYH13_ENST00000252172.4_Missense_Mutation_p.A585G|RP11-401O9.3_ENST00000577743.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	585	Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CACGGTGCCGGCATAGTGCAC	0.547																																							uc002gmk.1		NA																	0				ovary(4)|skin(2)	6						c.(1753-1755)GCC>GGC		myosin, heavy polypeptide 13, skeletal muscle							128.0	123.0	125.0					17																	10247257		2203	4300	6503	SO:0001583	missense	8735				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	g.chr17:10247257G>C	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.1754C>G	17.37:g.10247257G>C	ENSP00000404570:p.Ala585Gly					MYH13_uc010vvf.1_Missense_Mutation_p.A260G	p.A585G	NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN			16	1844	-			585			Myosin head-like.		O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	c.1754C>G	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	G	17.70	3.454823	0.63290	.	.	ENSG00000006788	ENST00000252172;ENST00000418404	D	0.93366	-3.21	4.33	4.33	0.51752	Myosin head, motor domain (2);	.	.	.	.	D	0.98337	0.9448	H	0.99842	4.835	0.53688	D	0.999976	P	0.44877	0.845	P	0.59825	0.864	D	0.99628	1.0985	9	0.87932	D	0	.	17.3785	0.87399	0.0:0.0:1.0:0.0	.	585	Q9UKX3	MYH13_HUMAN	G	585;260	ENSP00000252172:A585G	ENSP00000252172:A585G	A	-	2	0	MYH13	10187982	1.000000	0.71417	0.221000	0.23827	0.268000	0.26511	9.576000	0.98192	2.401000	0.81631	0.491000	0.48974	GCC		0.547	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802		22	78	0	0	0	0.00333	0	22	78				
MYH8	4626	broad.mit.edu	37	17	10295913	10295913	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr17:10295913C>A	ENST00000403437.2	-	38	5608	c.5514G>T	c.(5512-5514)gaG>gaT	p.E1838D	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1838					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CTTTAACAGCCTCTGCATTAC	0.438									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																														uc002gmm.2		NA																	0				skin(6)|ovary(3)|breast(2)	11						c.(5512-5514)GAG>GAT		myosin, heavy chain 8, skeletal muscle,							199.0	186.0	190.0					17																	10295913		2202	4300	6502	SO:0001583	missense	4626	Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling	Familial Cancer Database	Carney Complex Variant	muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle	g.chr17:10295913C>A		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.5514G>T	17.37:g.10295913C>A	ENSP00000384330:p.Glu1838Asp					uc002gml.1_Intron	p.E1838D	NM_002472	NP_002463	P13535	MYH8_HUMAN			38	5609	-			1838			Potential.		Q14910	Missense_Mutation	SNP	ENST00000403437.2	37	c.5514G>T	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	C	12.71	2.019891	0.35606	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.80214	-1.35	5.03	0.771	0.18504	Myosin tail (1);	0.000000	0.42053	U	0.000761	T	0.66877	0.2834	L	0.41027	1.25	0.37478	D	0.915877	B	0.21688	0.059	B	0.29077	0.098	T	0.51988	-0.8635	10	0.20046	T	0.44	.	3.7758	0.08659	0.2565:0.3471:0.0:0.3964	.	1838	P13535	MYH8_HUMAN	D	1838	ENSP00000384330:E1838D	ENSP00000252173:E1838D	E	-	3	2	MYH8	10236638	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	-2.158000	0.01281	0.309000	0.22966	0.650000	0.86243	GAG		0.438	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472		17	106	1	0	8.10497e-08	0.010504	1.09615e-07	17	106				
SPECC1	92521	broad.mit.edu	37	17	20108350	20108350	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr17:20108350G>T	ENST00000261503.5	+	4	1039	c.988G>T	c.(988-990)Gac>Tac	p.D330Y	AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395530.2_Missense_Mutation_p.D249Y|SPECC1_ENST00000536879.1_Intron|SPECC1_ENST00000395522.2_Missense_Mutation_p.D249Y|SPECC1_ENST00000395525.3_Missense_Mutation_p.D249Y|SPECC1_ENST00000584527.1_5'Flank|SPECC1_ENST00000395529.3_Missense_Mutation_p.D330Y|SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000395527.4_Missense_Mutation_p.D330Y	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	330	Ser-rich.			D -> N (in Ref. 5; AAH50058). {ECO:0000305}.	cell adhesion (GO:0007155)	nucleus (GO:0005634)		p.D330N(2)		breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		AGATGCTTCCGACTTTGAGCA	0.458																																							uc002gwq.2		NA																	2	Substitution - Missense(2)		prostate(1)|central_nervous_system(1)		0						c.(988-990)GAC>TAC		spectrin domain with coiled-coils 1 NSP5b3b							127.0	134.0	132.0					17																	20108350		2203	4300	6503	SO:0001583	missense	92521					nucleus		g.chr17:20108350G>T	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.988G>T	17.37:g.20108350G>T	ENSP00000261503:p.Asp330Tyr					CYTSB_uc010cqx.2_Missense_Mutation_p.D330Y|CYTSB_uc002gwr.2_Missense_Mutation_p.D330Y|CYTSB_uc002gws.2_Missense_Mutation_p.D330Y|CYTSB_uc002gwv.2_Missense_Mutation_p.D249Y|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gww.2_Missense_Mutation_p.D106Y|CYTSB_uc002gwt.2_Missense_Mutation_p.D249Y|CYTSB_uc002gwu.2_Missense_Mutation_p.D249Y	p.D330Y	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN			4	1133	+			330	D -> N (in Ref. 5; AAH50058).		Ser-rich.		B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	ENST00000261503.5	37	c.988G>T	CCDS32590.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248225	0.80024	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529;ENST00000395522;ENST00000395527;ENST00000395525	T;T;T;T	0.66995	-0.24;2.75;2.75;2.75	5.38	5.38	0.77491	.	0.043107	0.85682	D	0.000000	T	0.80210	0.4581	M	0.63843	1.955	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.993	T	0.81147	-0.1065	10	0.66056	D	0.02	-35.3493	17.0048	0.86390	0.0:0.0:1.0:0.0	.	330;249;249;330;330	A8MV89;Q5M775-4;Q5M775-3;Q5M775-2;Q5M775	.;.;.;.;CYTSB_HUMAN	Y	330;330;330;249;249;249	ENSP00000261503:D330Y;ENSP00000378900:D330Y;ENSP00000378893:D249Y;ENSP00000378896:D249Y	ENSP00000261503:D330Y	D	+	1	0	SPECC1	20048942	1.000000	0.71417	0.900000	0.35374	0.981000	0.71138	9.176000	0.94839	2.698000	0.92095	0.655000	0.94253	GAC		0.458	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904		18	185	1	0	2.39187e-15	0.008871	4.09576e-15	18	185				
C17orf75	64149	broad.mit.edu	37	17	30665284	30665284	+	Missense_Mutation	SNP	C	C	A	rs374214863		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr17:30665284C>A	ENST00000577809.1	-	4	483	c.434G>T	c.(433-435)cGt>cTt	p.R145L	C17orf75_ENST00000225805.4_Missense_Mutation_p.R145L|RP11-227G15.3_ENST00000581915.1_RNA	NM_022344.3	NP_071739.2	Q9HAS0	NJMU_HUMAN	chromosome 17 open reading frame 75	145										ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			TGAAGGGTTACGTTCAGAGTC	0.373																																							uc002hhg.2		NA																	0				ovary(1)	1						c.(433-435)CGT>CTT		hypothetical protein LOC64149							139.0	134.0	135.0					17																	30665284		1839	4099	5938	SO:0001583	missense	64149				spermatogenesis			g.chr17:30665284C>A	AB062437	CCDS58537.1	17q11.2	2013-01-21			ENSG00000108666	ENSG00000108666			30173	protein-coding gene	gene with protein product							Standard	NM_022344		Approved	NJMU-R1	uc002hhg.3	Q9HAS0		ENST00000577809.1:c.434G>T	17.37:g.30665284C>A	ENSP00000464275:p.Arg145Leu						p.R145L	NM_022344	NP_071739	Q9HAS0	NJMU_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.239)		4	465	-		Breast(31;0.116)|Ovarian(249;0.182)	145					Q7Z2H4	Missense_Mutation	SNP	ENST00000577809.1	37	c.434G>T	CCDS58537.1	.	.	.	.	.	.	.	.	.	.	c	6.266	0.417123	0.11870	.	.	ENSG00000108666	ENST00000225805	.	.	.	5.68	-0.517	0.11947	.	1.004320	0.08004	N	0.989319	T	0.08980	0.0222	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34079	-0.9843	9	0.11485	T	0.65	-21.2127	2.0961	0.03668	0.1588:0.1371:0.1879:0.5162	.	145	Q9HAS0	NJMU_HUMAN	L	145	.	ENSP00000225805:R145L	R	-	2	0	C17orf75	27689397	0.000000	0.05858	0.014000	0.15608	0.382000	0.30200	0.025000	0.13577	0.111000	0.17947	-1.193000	0.01689	CGT		0.373	C17orf75-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447204.1	NM_022344		27	137	1	0	8.24728e-16	0.004656	1.43148e-15	27	137				
KRT12	3859	broad.mit.edu	37	17	39023359	39023359	+	Missense_Mutation	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr17:39023359A>G	ENST00000251643.4	-	1	103	c.80T>C	c.(79-81)aTa>aCa	p.I27T		NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	27	Head.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	GGGTCTGCCTATCACACTCTG	0.602																																							uc002hvk.2		NA																	0				ovary(1)	1						c.(79-81)ATA>ACA		keratin 12							55.0	57.0	56.0					17																	39023359		2203	4300	6503	SO:0001583	missense	3859				visual perception	intermediate filament	structural molecule activity	g.chr17:39023359A>G		CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.80T>C	17.37:g.39023359A>G	ENSP00000251643:p.Ile27Thr						p.I27T	NM_000223	NP_000214	Q99456	K1C12_HUMAN			1	104	-		Breast(137;0.000301)	27			Head.		B2R9E0	Missense_Mutation	SNP	ENST00000251643.4	37	c.80T>C	CCDS11378.1	.	.	.	.	.	.	.	.	.	.	A	4.128	0.021999	0.08006	.	.	ENSG00000187242	ENST00000251643	D	0.81579	-1.51	5.61	-1.51	0.08664	.	1.531570	0.03956	N	0.289308	T	0.61299	0.2336	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47923	-0.9079	10	0.15499	T	0.54	.	8.2379	0.31638	0.3084:0.0:0.5821:0.1095	.	27	Q99456	K1C12_HUMAN	T	27	ENSP00000251643:I27T	ENSP00000251643:I27T	I	-	2	0	KRT12	36276885	0.000000	0.05858	0.000000	0.03702	0.435000	0.31806	0.141000	0.16076	-0.159000	0.11021	0.533000	0.62120	ATA		0.602	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257214.2	NM_000223		8	73	0	0	0	0.008291	0	8	73				
DNAJC7	7266	broad.mit.edu	37	17	40134324	40134324	+	Nonsense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr17:40134324C>A	ENST00000457167.4	-	11	1416	c.1180G>T	c.(1180-1182)Gag>Tag	p.E394*	DNAJC7_ENST00000426588.3_Nonsense_Mutation_p.E338*|DNAJC7_ENST00000316603.7_Nonsense_Mutation_p.E338*	NM_003315.3	NP_003306.3	Q99615	DNJC7_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 7	394	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				chaperone cofactor-dependent protein refolding (GO:0070389)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	heat shock protein binding (GO:0031072)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9		all_cancers(22;0.00273)|Breast(137;0.00104)|all_epithelial(22;0.0305)				ATCTCGTCCTCAGAGGCATTC	0.498																																					Colon(63;618 1117 8600 10857 19751)	Colon(63;618 1117 8600 10857 19751)	uc002hyo.2		NA																	0				ovary(1)	1						c.(1180-1182)GAG>TAG		DnaJ (Hsp40) homolog, subfamily C, member 7							130.0	114.0	119.0					17																	40134324		1951	4151	6102	SO:0001587	stop_gained	7266				chaperone cofactor-dependent protein refolding	cytoplasm|cytoskeleton|nucleus	heat shock protein binding|unfolded protein binding	g.chr17:40134324C>A	U46571	CCDS45677.1, CCDS45678.1	17q11.2	2013-01-10				ENSG00000168259		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	12392	protein-coding gene	gene with protein product		601964		TTC2		8836031, 11147971	Standard	NR_029431		Approved	TPR2	uc002hyo.3	Q99615		ENST00000457167.4:c.1180G>T	17.37:g.40134324C>A	ENSP00000406463:p.Glu394*					DNAJC7_uc010cxu.2_Nonsense_Mutation_p.E338*|DNAJC7_uc010cxv.2_Intron|DNAJC7_uc010wgb.1_Nonsense_Mutation_p.E338*|DNAJC7_uc010wgc.1_Nonsense_Mutation_p.E252*|DNAJC7_uc002hyp.2_Nonsense_Mutation_p.E338*	p.E394*	NM_003315	NP_003306	Q99615	DNJC7_HUMAN			11	1417	-		all_cancers(22;0.00273)|Breast(137;0.00104)|all_epithelial(22;0.0305)	394			J.		Q7Z784	Nonsense_Mutation	SNP	ENST00000457167.4	37	c.1180G>T	CCDS45677.1	.	.	.	.	.	.	.	.	.	.	C	37	6.321954	0.97471	.	.	ENSG00000168259	ENST00000457167;ENST00000426588;ENST00000316603	.	.	.	6.08	6.08	0.98989	.	0.043472	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	0.1153	20.6634	0.99662	0.0:1.0:0.0:0.0	.	.	.	.	X	394;338;338	.	ENSP00000313311:E338X	E	-	1	0	DNAJC7	37387850	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.894000	0.99253	0.655000	0.94253	GAG		0.498	DNAJC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453366.2			10	73	1	0	0.000442599	0.006214	0.000496366	10	73				
NPEPPS	9520	broad.mit.edu	37	17	45668224	45668224	+	Missense_Mutation	SNP	T	T	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr17:45668224T>G	ENST00000322157.4	+	10	1474	c.1237T>G	c.(1237-1239)Tta>Gta	p.L413V	NPEPPS_ENST00000530173.1_Missense_Mutation_p.L409V|NPEPPS_ENST00000525037.1_3'UTR|NPEPPS_ENST00000544660.1_Missense_Mutation_p.L333V	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	413					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						GCTTGACGCCTTAGATAACAG	0.408																																							uc002ilr.3		NA																	0					0						c.(1237-1239)TTA>GTA		aminopeptidase puromycin sensitive							102.0	74.0	83.0					17																	45668224		1850	4083	5933	SO:0001583	missense	9520				proteolysis	cytosol|nucleus	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding	g.chr17:45668224T>G	Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.1237T>G	17.37:g.45668224T>G	ENSP00000320324:p.Leu413Val					NPEPPS_uc010wkt.1_Missense_Mutation_p.L409V|NPEPPS_uc010wku.1_Missense_Mutation_p.L377V|NPEPPS_uc010wkv.1_5'UTR	p.L413V	NM_006310	NP_006301	P55786	PSA_HUMAN			10	1460	+			413					B7Z463|Q6P145|Q9NP16|Q9UEM2	Missense_Mutation	SNP	ENST00000322157.4	37	c.1237T>G	CCDS45721.1	.	.	.	.	.	.	.	.	.	.	T	19.06	3.754779	0.69648	.	.	ENSG00000141279	ENST00000530173;ENST00000322157;ENST00000539572;ENST00000544660;ENST00000527964;ENST00000527360	T;T;T;T;T	0.02863	4.13;4.13;4.13;4.13;4.13	5.58	4.51	0.55191	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.13670	0.0331	M	0.80847	2.515	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.995	D;D;D	0.85130	0.997;0.994;0.967	T	0.00123	-1.2026	10	0.87932	D	0	.	8.5282	0.33317	0.0:0.1487:0.0:0.8513	.	413;409;413	A6NEC2;E9PLK3;P55786	PSAL_HUMAN;.;PSA_HUMAN	V	409;413;400;333;96;110	ENSP00000433287:L409V;ENSP00000320324:L413V;ENSP00000442461:L333V;ENSP00000435639:L96V;ENSP00000435966:L110V	ENSP00000320324:L413V	L	+	1	2	NPEPPS	43023223	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.026000	0.49689	0.957000	0.37930	0.482000	0.46254	TTA		0.408	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384269.1	NM_006310		12	161	0	0	0	0.004007	0	12	161				
CACNA1G	8913	broad.mit.edu	37	17	48692748	48692748	+	Missense_Mutation	SNP	G	G	T	rs372802826		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr17:48692748G>T	ENST00000359106.5	+	27	4786	c.4786G>T	c.(4786-4788)Gac>Tac	p.D1596Y	CACNA1G_ENST00000442258.2_Missense_Mutation_p.D1555Y|CACNA1G_ENST00000507609.1_Missense_Mutation_p.D1596Y|CACNA1G_ENST00000513689.2_Missense_Mutation_p.D1551Y|CACNA1G_ENST00000507510.2_Missense_Mutation_p.D1596Y|CACNA1G_ENST00000507336.1_Missense_Mutation_p.D1585Y|CACNA1G_ENST00000502264.1_Missense_Mutation_p.D1573Y|CACNA1G_ENST00000505165.1_Missense_Mutation_p.D1596Y|CACNA1G_ENST00000510115.1_Missense_Mutation_p.D1562Y|CACNA1G_ENST00000515165.1_Missense_Mutation_p.D1596Y|CACNA1G_ENST00000503485.1_Missense_Mutation_p.D1562Y|CACNA1G_ENST00000515411.1_Missense_Mutation_p.D1578Y|CACNA1G_ENST00000514717.1_Missense_Mutation_p.D1539Y|CACNA1G_ENST00000429973.2_Missense_Mutation_p.D1578Y|CACNA1G_ENST00000515765.1_Missense_Mutation_p.D1585Y|CACNA1G_ENST00000512389.1_Missense_Mutation_p.D1585Y|CACNA1G_ENST00000513964.1_Missense_Mutation_p.D1551Y|CACNA1G_ENST00000507896.1_Missense_Mutation_p.D1585Y|CACNA1G_ENST00000360761.4_Missense_Mutation_p.D1573Y|CACNA1G_ENST00000358244.5_Missense_Mutation_p.D1562Y|CACNA1G_ENST00000354983.4_Missense_Mutation_p.D1562Y|CACNA1G_ENST00000352832.5_Missense_Mutation_p.D1562Y|CACNA1G_ENST00000510366.1_Missense_Mutation_p.D1544Y|CACNA1G_ENST00000514181.1_Missense_Mutation_p.D1578Y|CACNA1G_ENST00000514079.1_Missense_Mutation_p.D1603Y	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1596					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	TTACTACTCCGACTACTCCCG	0.632																																							uc002irk.1		NA																	0				breast(1)	1						c.(4786-4788)GAC>TAC		voltage-dependent calcium channel alpha 1G	Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)						59.0	63.0	61.0					17																	48692748		2022	4178	6200	SO:0001583	missense	8913				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity	g.chr17:48692748G>T	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.4786G>T	17.37:g.48692748G>T	ENSP00000352011:p.Asp1596Tyr					CACNA1G_uc002irj.1_Missense_Mutation_p.D1562Y|CACNA1G_uc002irl.1_Missense_Mutation_p.D1573Y|CACNA1G_uc002irm.1_Missense_Mutation_p.D1562Y|CACNA1G_uc002irn.1_Missense_Mutation_p.D1555Y|CACNA1G_uc002iro.1_Missense_Mutation_p.D1562Y|CACNA1G_uc002irp.1_Missense_Mutation_p.D1596Y|CACNA1G_uc002irq.1_Missense_Mutation_p.D1573Y|CACNA1G_uc002irr.1_Missense_Mutation_p.D1596Y|CACNA1G_uc002irs.1_Missense_Mutation_p.D1585Y|CACNA1G_uc002irt.1_Missense_Mutation_p.D1578Y|CACNA1G_uc002irv.1_Missense_Mutation_p.D1585Y|CACNA1G_uc002irw.1_Missense_Mutation_p.D1573Y|CACNA1G_uc002iru.1_Missense_Mutation_p.D1562Y|CACNA1G_uc002irx.1_Missense_Mutation_p.D1509Y|CACNA1G_uc002iry.1_Missense_Mutation_p.D1498Y|CACNA1G_uc002irz.1_Missense_Mutation_p.D1509Y|CACNA1G_uc002isa.1_Missense_Mutation_p.D1475Y|CACNA1G_uc002isb.1_Missense_Mutation_p.D1516Y|CACNA1G_uc002isc.1_Missense_Mutation_p.D1498Y|CACNA1G_uc002isd.1_Missense_Mutation_p.D1491Y|CACNA1G_uc002ise.1_Missense_Mutation_p.D1464Y|CACNA1G_uc002isf.1_Missense_Mutation_p.D1491Y|CACNA1G_uc002isg.1_Missense_Mutation_p.D1457Y|CACNA1G_uc002ish.1_Missense_Mutation_p.D1464Y|CACNA1G_uc002isi.1_Missense_Mutation_p.D1452Y	p.D1596Y	NM_018896	NP_061496	O43497	CAC1G_HUMAN	BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		27	5158	+	Breast(11;6.7e-17)		1596			IV.|Cytoplasmic (Potential).		D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	37	c.4786G>T	CCDS45730.1	.	.	.	.	.	.	.	.	.	.	g	16.46	3.130820	0.56828	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97161	-4.17;-4.16;-4.11;-4.18;-4.15;-4.19;-4.27;-4.23;-4.24;-4.26;-4.13;-4.13;-4.15;-4.15;-4.1;-4.2;-4.18;-4.13;-4.19;-4.17;-4.14;-4.21;-4.13;-4.19;-4.19	4.75	4.75	0.60458	.	0.051625	0.85682	D	0.000000	D	0.98327	0.9445	M	0.79258	2.445	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;P;D;D;D	0.89917	0.999;0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;0.994;1.0;0.999;0.993;0.999;0.995;1.0;1.0;1.0;0.927;1.0;0.998;0.988	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;P;D;P;D;D;D;P;D;D;P	0.97110	0.995;0.977;0.999;0.999;1.0;0.999;0.999;0.99;0.999;0.996;0.987;0.976;0.957;0.987;0.991;0.887;0.956;0.879;0.99;0.996;0.998;0.887;0.987;0.96;0.849	D	0.99651	1.0991	10	0.72032	D	0.01	.	17.7327	0.88383	0.0:0.0:1.0:0.0	.	1539;1551;1544;1578;1551;1578;1603;1562;1596;1585;1596;1573;1585;1585;1578;1585;1596;1573;1596;1562;1555;1562;1573;1596;1562	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.	Y	1573;1562;1562;1555;1573;1585;1551;1539;1544;1562;1596;1585;1551;1596;1562;1596;1578;1585;1603;1562;1596;1578;1578;1596;1585	ENSP00000353990:D1573Y;ENSP00000339302:D1562Y;ENSP00000347078:D1562Y;ENSP00000409759:D1555Y;ENSP00000425522:D1573Y;ENSP00000426261:D1585Y;ENSP00000425451:D1551Y;ENSP00000422407:D1539Y;ENSP00000426814:D1544Y;ENSP00000427238:D1562Y;ENSP00000423112:D1596Y;ENSP00000420918:D1585Y;ENSP00000426172:D1551Y;ENSP00000423045:D1596Y;ENSP00000427173:D1562Y;ENSP00000426098:D1596Y;ENSP00000425698:D1578Y;ENSP00000426232:D1585Y;ENSP00000423317:D1603Y;ENSP00000350979:D1562Y;ENSP00000352011:D1596Y;ENSP00000414388:D1578Y;ENSP00000423155:D1578Y;ENSP00000422268:D1596Y;ENSP00000421518:D1585Y	ENSP00000339302:D1562Y	D	+	1	0	CACNA1G	46047747	1.000000	0.71417	0.950000	0.38849	0.840000	0.47671	3.193000	0.50997	2.170000	0.68504	0.462000	0.41574	GAC		0.632	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896		9	51	1	0	0.000274275	0.004482	0.000309227	9	51				
MPO	4353	broad.mit.edu	37	17	56349109	56349109	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr17:56349109C>A	ENST00000225275.3	-	11	2113	c.1937G>T	c.(1936-1938)gGc>gTc	p.G646V	MPO_ENST00000340482.3_Missense_Mutation_p.G678V	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	646					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	CTCGGACACGCCGCCCATCCA	0.612																																							uc002ivu.1		NA																	0				ovary(2)|large_intestine(1)|pancreas(1)	4						c.(1936-1938)GGC>GTC		myeloperoxidase	Cefdinir(DB00535)						80.0	55.0	63.0					17																	56349109		2203	4300	6503	SO:0001583	missense	4353				anti-apoptosis|hydrogen peroxide catabolic process|low-density lipoprotein particle remodeling	extracellular space|lysosome|nucleus|stored secretory granule	chromatin binding|heme binding|heparin binding|peroxidase activity	g.chr17:56349109C>A		CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.1937G>T	17.37:g.56349109C>A	ENSP00000225275:p.Gly646Val						p.G646V	NM_000250	NP_000241	P05164	PERM_HUMAN			11	2114	-			646					A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	ENST00000225275.3	37	c.1937G>T	CCDS11604.1	.	.	.	.	.	.	.	.	.	.	C	14.76	2.632198	0.46944	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.70399	-0.48;-0.48	5.16	5.16	0.70880	.	0.158791	0.56097	N	0.000036	D	0.86003	0.5829	M	0.89658	3.05	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.88517	0.3093	10	0.87932	D	0	-16.7071	12.8431	0.57815	0.0:0.7217:0.2783:0.0	.	646	P05164	PERM_HUMAN	V	678;646	ENSP00000344419:G678V;ENSP00000225275:G646V	ENSP00000225275:G646V	G	-	2	0	MPO	53704108	0.980000	0.34600	0.181000	0.23098	0.351000	0.29236	2.628000	0.46477	2.420000	0.82092	0.563000	0.77884	GGC		0.612	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443971.1			15	53	1	0	1.99824e-07	0.00499	2.65183e-07	15	53				
TEX14	56155	broad.mit.edu	37	17	56694958	56694958	+	Nonsense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr17:56694958G>A	ENST00000240361.8	-	6	662	c.577C>T	c.(577-579)Cga>Tga	p.R193*	TEX14_ENST00000389934.3_Nonsense_Mutation_p.R193*|TEX14_ENST00000349033.5_Nonsense_Mutation_p.R193*			Q8IWB6	TEX14_HUMAN	testis expressed 14	193					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TTAAGCAGTCGGTTAGGAGAG	0.393																																							uc010dcz.1		NA																	0				stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17						c.(577-579)CGA>TGA		testis expressed sequence 14 isoform a							85.0	83.0	84.0					17																	56694958		2203	4300	6503	SO:0001587	stop_gained	56155					cytoplasm	ATP binding|protein kinase activity	g.chr17:56694958G>A	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.577C>T	17.37:g.56694958G>A	ENSP00000240361:p.Arg193*					TEX14_uc002iwr.1_Nonsense_Mutation_p.R193*|TEX14_uc002iws.1_Nonsense_Mutation_p.R193*|TEX14_uc010dda.1_Intron	p.R193*	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN			6	695	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		193					A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Nonsense_Mutation	SNP	ENST00000240361.8	37	c.577C>T	CCDS56042.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.394969	0.83011	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	.	.	.	5.07	1.79	0.24919	.	0.109407	0.39544	N	0.001321	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.1307	7.0265	0.24942	0.0837:0.0:0.4535:0.4628	.	.	.	.	X	193	.	ENSP00000240361:R193X	R	-	1	2	TEX14	54049957	0.024000	0.19004	0.899000	0.35326	0.872000	0.50106	1.473000	0.35387	0.679000	0.31345	-0.932000	0.02703	CGA		0.393	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1			5	77	0	0	0	0.001984	0	5	77				
ABCA8	10351	broad.mit.edu	37	17	66924151	66924151	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr17:66924151G>T	ENST00000269080.2	-	9	1316	c.1179C>A	c.(1177-1179)gaC>gaA	p.D393E	ABCA8_ENST00000586539.1_Missense_Mutation_p.D393E|ABCA8_ENST00000430352.2_Missense_Mutation_p.D393E	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	393					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GATTTGAGCCGTCCGATGGAT	0.338																																							uc002jhp.2		NA																	0				ovary(2)|skin(1)	3						c.(1177-1179)GAC>GAA		ATP-binding cassette, sub-family A member 8							70.0	70.0	70.0					17																	66924151		2203	4300	6503	SO:0001583	missense	10351					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	g.chr17:66924151G>T	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.1179C>A	17.37:g.66924151G>T	ENSP00000269080:p.Asp393Glu					ABCA8_uc002jhq.2_Missense_Mutation_p.D393E|ABCA8_uc010wqq.1_Missense_Mutation_p.D393E|ABCA8_uc010wqr.1_Missense_Mutation_p.D332E|ABCA8_uc002jhr.2_Missense_Mutation_p.D393E	p.D393E	NM_007168	NP_009099	O94911	ABCA8_HUMAN			9	1358	-	Breast(10;4.56e-13)		393					A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	37	c.1179C>A	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	G	6.211	0.407065	0.11754	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225;ENST00000542396	D;D	0.86562	-2.12;-2.14	4.35	-8.7	0.00851	.	0.864900	0.09786	N	0.756006	T	0.68137	0.2968	L	0.28694	0.88	0.09310	N	1	B;B;B;B;B	0.26120	0.117;0.03;0.142;0.005;0.03	B;B;B;B;B	0.26416	0.041;0.048;0.069;0.028;0.048	T	0.61691	-0.7011	10	0.07175	T	0.84	.	2.5731	0.04799	0.5261:0.1894:0.1887:0.0957	.	332;393;393;393;393	F5H6Z4;A1L3U3;B4DJ11;C9JQE6;O94911	.;.;.;.;ABCA8_HUMAN	E	393;393;332;24	ENSP00000269080:D393E;ENSP00000402814:D393E	ENSP00000269080:D393E	D	-	3	2	ABCA8	64435746	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.250000	0.00540	-1.294000	0.02360	-1.131000	0.01979	GAC		0.338	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168		8	32	1	0	5.18039e-06	0.00308	6.34598e-06	8	32				
KIF19	124602	broad.mit.edu	37	17	72345400	72345400	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr17:72345400C>A	ENST00000389916.4	+	10	1263	c.1125C>A	c.(1123-1125)atC>atA	p.I375I		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	375					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						GGGGCGAGATCCAGCGACTCA	0.637																																							uc002jkm.3		NA																	0					0						c.(1123-1125)ATC>ATA		kinesin family member 19							65.0	57.0	60.0					17																	72345400		2203	4300	6503	SO:0001819	synonymous_variant	124602				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity	g.chr17:72345400C>A	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.1125C>A	17.37:g.72345400C>A						KIF19_uc002jkj.2_Silent_p.I375I|KIF19_uc002jkk.2_Silent_p.I333I|KIF19_uc002jkl.2_Silent_p.I333I	p.I375I	NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN			10	1263	+			375			Potential.		A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Silent	SNP	ENST00000389916.4	37	c.1125C>A	CCDS32718.2																																																																																				0.637	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209		10	51	1	0	1.58986e-06	0.008291	2.01341e-06	10	51				
GAA	2548	broad.mit.edu	37	17	78082517	78082517	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr17:78082517G>T	ENST00000302262.3	+	8	1435	c.1216G>T	c.(1216-1218)Gac>Tac	p.D406Y	GAA_ENST00000390015.3_Missense_Mutation_p.D406Y	NM_000152.3	NP_000143.2	P10253	LYAG_HUMAN	glucosidase, alpha; acid	406					cardiac muscle contraction (GO:0060048)|diaphragm contraction (GO:0002086)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|heart morphogenesis (GO:0003007)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|maltose metabolic process (GO:0000023)|muscle cell cellular homeostasis (GO:0046716)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|regulation of the force of heart contraction (GO:0002026)|sucrose metabolic process (GO:0005985)|tissue development (GO:0009888)|vacuolar sequestering (GO:0043181)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)|Miglitol(DB00491)	GAACGACCTGGACTACATGGA	0.667																																							uc002jxo.2		NA																	0				ovary(1)	1						c.(1216-1218)GAC>TAC		acid alpha-glucosidase preproprotein	Acarbose(DB00284)						32.0	28.0	29.0					17																	78082517		2200	4300	6500	SO:0001583	missense	2548				cardiac muscle contraction|diaphragm contraction|glycogen catabolic process|lysosome organization|tongue morphogenesis|vacuolar sequestering|ventricular cardiac muscle tissue morphogenesis	lysosomal membrane	carbohydrate binding|maltose alpha-glucosidase activity	g.chr17:78082517G>T		CCDS32760.1	17q25.2-q25.3	2014-09-17	2008-08-01				3.2.1.20		4065	protein-coding gene	gene with protein product	"""Pompe disease"", ""glycogen storage disease type II"""	606800					Standard	NM_000152		Approved		uc002jxq.3	P10253		ENST00000302262.3:c.1216G>T	17.37:g.78082517G>T	ENSP00000305692:p.Asp406Tyr					GAA_uc002jxp.2_Missense_Mutation_p.D406Y|GAA_uc002jxq.2_Missense_Mutation_p.D406Y	p.D406Y	NM_001079803	NP_001073271	P10253	LYAG_HUMAN	OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		9	1398	+	all_neural(118;0.117)		406					Q09GN4|Q14351|Q16302|Q8IWE7	Missense_Mutation	SNP	ENST00000302262.3	37	c.1216G>T	CCDS32760.1	.	.	.	.	.	.	.	.	.	.	G	15.68	2.905024	0.52333	.	.	ENSG00000171298	ENST00000302262;ENST00000390015	D;D	0.93133	-3.17;-3.17	4.42	4.42	0.53409	Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.97411	0.9153	M	0.92412	3.305	0.54753	D	0.999983	D	0.76494	0.999	D	0.75484	0.986	D	0.98773	1.0729	10	0.87932	D	0	-38.27	17.012	0.86409	0.0:0.0:1.0:0.0	.	406	P10253	LYAG_HUMAN	Y	406	ENSP00000305692:D406Y;ENSP00000374665:D406Y	ENSP00000305692:D406Y	D	+	1	0	GAA	75697112	1.000000	0.71417	1.000000	0.80357	0.007000	0.05969	9.243000	0.95416	1.995000	0.58328	0.313000	0.20887	GAC		0.667	GAA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437441.1			9	27	1	0	3.09899e-07	0.004482	4.07021e-07	9	27				
SMCHD1	23347	broad.mit.edu	37	18	2762143	2762143	+	Missense_Mutation	SNP	T	T	C	rs201217574		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:2762143T>C	ENST00000320876.6	+	36	4813	c.4475T>C	c.(4474-4476)gTa>gCa	p.V1492A	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Missense_Mutation_p.V1492A	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1492					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						GTGAAGTTAGTACCTAAAATT	0.368																																							uc002klm.3		NA																	0					0						c.(4474-4476)GTA>GCA		structural maintenance of chromosomes flexible							188.0	174.0	178.0					18																	2762143		1853	4101	5954	SO:0001583	missense	23347				chromosome organization		ATP binding	g.chr18:2762143T>C	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.4475T>C	18.37:g.2762143T>C	ENSP00000326603:p.Val1492Ala					SMCHD1_uc002klk.3_RNA|SMCHD1_uc002kll.3_RNA	p.V1492A	NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN			36	4664	+			1492					O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	37	c.4475T>C	CCDS45822.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	T	12.43	1.934390	0.34096	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.21191	2.02;2.02	5.34	5.34	0.76211	.	0.196823	0.43110	D	0.000619	T	0.19208	0.0461	L	0.36672	1.1	0.33366	D	0.572959	B	0.29037	0.231	B	0.29862	0.108	T	0.18681	-1.0329	10	0.27785	T	0.31	-20.8035	15.3144	0.74062	0.0:0.0:0.0:1.0	.	1492	A6NHR9	SMHD1_HUMAN	A	1492	ENSP00000326603:V1492A;ENSP00000261598:V1492A	ENSP00000261598:V1492A	V	+	2	0	SMCHD1	2752143	1.000000	0.71417	0.997000	0.53966	0.911000	0.54048	5.769000	0.68865	2.016000	0.59253	0.528000	0.53228	GTA		0.368	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2			17	61	0	0	0	0.008871	0	17	61				
LRRC30	339291	broad.mit.edu	37	18	7231664	7231664	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:7231664G>T	ENST00000383467.2	+	1	542	c.528G>T	c.(526-528)gcG>gcT	p.A176A		NM_001105581.1	NP_001099051.1	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	176								p.A176A(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						ACTTCTTCGCGCACATCCCCA	0.552																																							uc010wzk.1		NA																	1	Substitution - coding silent(1)		large_intestine(1)	ovary(1)|liver(1)	2						c.(526-528)GCG>GCT		leucine rich repeat containing 30							96.0	103.0	100.0					18																	7231664		2112	4226	6338	SO:0001819	synonymous_variant	339291							g.chr18:7231664G>T		CCDS42409.1	18p11.23	2005-01-06				ENSG00000206422			30219	protein-coding gene	gene with protein product							Standard	NM_001105581		Approved		uc010wzk.2	A6NM36		ENST00000383467.2:c.528G>T	18.37:g.7231664G>T							p.A176A	NM_001105581	NP_001099051	A6NM36	LRC30_HUMAN			1	528	+			176			LRR 5.			Silent	SNP	ENST00000383467.2	37	c.528G>T	CCDS42409.1																																																																																				0.552	LRRC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442140.1	XM_292678		24	118	1	0	4.26978e-12	0.00333	6.71567e-12	24	118				
PTPRM	5797	broad.mit.edu	37	18	7888243	7888243	+	Silent	SNP	G	G	A	rs202244854		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:7888243G>A	ENST00000332175.8	+	3	1373	c.336G>A	c.(334-336)ggG>ggA	p.G112G	PTPRM_ENST00000400053.4_Silent_p.G50G|PTPRM_ENST00000400060.4_Silent_p.G112G|PTPRM_ENST00000580170.1_Silent_p.G112G	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	112	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				CTCCTCCGGGGTTACTCAATG	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		15984	0.001		0.0	False		,,,				2504	0.0						uc002knn.3		NA																	0				lung(3)|ovary(2)|central_nervous_system(1)	6						c.(334-336)GGG>GGA		protein tyrosine phosphatase, receptor type, M							94.0	94.0	94.0					18																	7888243		2203	4300	6503	SO:0001819	synonymous_variant	5797				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr18:7888243G>A	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.336G>A	18.37:g.7888243G>A						PTPRM_uc010dkv.2_Silent_p.G112G	p.G112G	NM_002845	NP_002836	P28827	PTPRM_HUMAN			3	839	+		Colorectal(10;0.234)	112			MAM.|Extracellular (Potential).		A7MBN1|D3DUH8|J3QL11	Silent	SNP	ENST00000332175.8	37	c.336G>A	CCDS11840.1																																																																																				0.483	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1			21	83	0	0	0	0.008871	0	21	83				
PIEZO2	63895	broad.mit.edu	37	18	10696216	10696216	+	Missense_Mutation	SNP	A	A	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:10696216A>C	ENST00000503781.3	-	43	6706	c.6707T>G	c.(6706-6708)aTg>aGg	p.M2236R	PIEZO2_ENST00000285141.4_Missense_Mutation_p.M91R|PIEZO2_ENST00000302079.6_Missense_Mutation_p.M2236R|PIEZO2_ENST00000538948.1_Missense_Mutation_p.M193R|PIEZO2_ENST00000580640.1_Missense_Mutation_p.M2261R	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2236					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										AATGAGGACCATCACCAAAAA	0.522																																							uc002kor.3		NA																	0				ovary(1)	1						c.(577-579)ATG>AGG		family with sequence similarity 38, member B							72.0	70.0	71.0					18																	10696216		2203	4300	6503	SO:0001583	missense	63895					integral to membrane	ion channel activity	g.chr18:10696216A>C	AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.6707T>G	18.37:g.10696216A>C	ENSP00000421377:p.Met2236Arg					FAM38B_uc002koq.2_Missense_Mutation_p.M91R	p.M193R	NM_022068	NP_071351	Q9H5I5	PIEZ2_HUMAN			5	718	-			2236			Helical; (Potential).		B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	ENST00000503781.3	37	c.578T>G		.	.	.	.	.	.	.	.	.	.	A	23.0	4.363805	0.82353	.	.	ENSG00000154864	ENST00000503781;ENST00000302079;ENST00000538948;ENST00000285141	D;D;D	0.84944	-1.92;-1.92;-1.92	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.93194	0.7832	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94318	0.7551	10	0.87932	D	0	.	15.6989	0.77528	1.0:0.0:0.0:0.0	.	193	D6RFZ0	.	R	193;2236;193;91	ENSP00000303316:M2236R;ENSP00000443129:M193R;ENSP00000285141:M91R	ENSP00000285141:M91R	M	-	2	0	FAM38B	10686216	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.867000	0.92314	2.111000	0.64477	0.533000	0.62120	ATG		0.522	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068		11	57	0	0	0	0.010729	0	11	57				
RNMT	8731	broad.mit.edu	37	18	13731900	13731900	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:13731900A>T	ENST00000383314.2	+	3	624	c.384A>T	c.(382-384)aaA>aaT	p.K128N	RNMT_ENST00000592764.1_Missense_Mutation_p.K128N|RNMT_ENST00000543302.2_Missense_Mutation_p.K128N|RNMT_ENST00000535051.1_Intron|RNMT_ENST00000262173.3_Missense_Mutation_p.K128N|RNMT_ENST00000589866.1_Missense_Mutation_p.K128N			O43148	MCES_HUMAN	RNA (guanine-7-) methyltransferase	128	mRNA cap 0 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00895}.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|RNA (guanine-N7)-methylation (GO:0036265)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|receptor complex (GO:0043235)	mRNA (guanine-N7-)-methyltransferase activity (GO:0004482)|RNA binding (GO:0003723)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|skin(2)	18						ATAAGAGAAAAATAGCACTTG	0.348																																					GBM(29;474 594 19092 36647 41529)	GBM(29;474 594 19092 36647 41529)	uc002ksk.1		NA																	0					0						c.(382-384)AAA>AAT		RNA (guanine-7-) methyltransferase							54.0	64.0	61.0					18																	13731900		2203	4295	6498	SO:0001583	missense	8731				mRNA capping|transcription from RNA polymerase II promoter|viral reproduction	nucleoplasm	mRNA (guanine-N7-)-methyltransferase activity|RNA binding	g.chr18:13731900A>T	AF067791	CCDS11867.1	18p11.21	2008-05-14			ENSG00000101654	ENSG00000101654	2.1.1.56		10075	protein-coding gene	gene with protein product		603514				9828141, 9705270	Standard	NM_003799		Approved	RG7MT1	uc002ksl.1	O43148	OTTHUMG00000131718	ENST00000383314.2:c.384A>T	18.37:g.13731900A>T	ENSP00000372804:p.Lys128Asn					RNMT_uc002ksl.1_Missense_Mutation_p.K128N|RNMT_uc002ksm.1_Missense_Mutation_p.K128N|RNMT_uc010dlk.2_Missense_Mutation_p.K128N|RNMT_uc010xae.1_Intron	p.K128N	NM_003799	NP_003790	O43148	MCES_HUMAN			2	451	+			128			Nuclear localization signal.		B0YJ90|D3DUJ5|O94996|Q9UIJ9	Missense_Mutation	SNP	ENST00000383314.2	37	c.384A>T	CCDS11867.1	.	.	.	.	.	.	.	.	.	.	A	10.94	1.493447	0.26774	.	.	ENSG00000101654	ENST00000383314;ENST00000543302;ENST00000262173	.	.	.	5.43	4.27	0.50696	.	0.000000	0.64402	D	0.000006	T	0.34832	0.0911	L	0.36672	1.1	0.80722	D	1	B;B	0.33755	0.424;0.174	B;B	0.27076	0.076;0.057	T	0.14090	-1.0485	9	0.32370	T	0.25	-8.6181	5.1485	0.14998	0.7561:0.0:0.0857:0.1582	.	128;128	O43148-2;O43148	.;MCES_HUMAN	N	128	.	ENSP00000262173:K128N	K	+	3	2	RNMT	13721900	0.919000	0.31177	0.782000	0.31804	0.522000	0.34438	1.441000	0.35035	1.004000	0.39156	0.533000	0.62120	AAA		0.348	RNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254636.1	NM_003799		13	77	0	0	0	0.001855	0	13	77				
CABLES1	91768	broad.mit.edu	37	18	20832975	20832975	+	Missense_Mutation	SNP	G	G	A	rs370752492		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:20832975G>A	ENST00000256925.7	+	8	1498	c.1498G>A	c.(1498-1500)Gag>Aag	p.E500K	CABLES1_ENST00000585061.1_Intron|CABLES1_ENST00000420687.2_Missense_Mutation_p.E235K|TMEM241_ENST00000450466.2_Intron|CABLES1_ENST00000400473.2_Missense_Mutation_p.E173K	NM_001100619.2	NP_001094089.1	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1	500					blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|nervous system development (GO:0007399)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)	cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)	11	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					GGACATGAACGAGACCTTCAA	0.488																																							uc002kuc.2		NA																	0				breast(1)	1						c.(1498-1500)GAG>AAG		Cdk5 and Abl enzyme substrate 1 isoform 2		G	LYS/GLU,LYS/GLU	0,4356		0,0,2178	108.0	107.0	107.0		1498,703	5.6	1.0	18		107	1,8587	1.2+/-3.3	0,1,4293	no	missense,missense	CABLES1	NM_001100619.2,NM_138375.2	56,56	0,1,6471	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	500/634,235/369	20832975	1,12943	2178	4294	6472	SO:0001583	missense	91768				blood coagulation|cell cycle|cell division|regulation of cell cycle|regulation of cell division	cytosol|nucleus	cyclin-dependent protein kinase regulator activity|protein binding	g.chr18:20832975G>A	BC037218	CCDS42417.1, CCDS42418.1, CCDS58615.1	18q11.2	2005-08-16				ENSG00000134508			25097	protein-coding gene	gene with protein product		609194				12477932	Standard	NM_138375		Approved	HsT2563, FLJ35924	uc002kuc.2	Q8TDN4		ENST00000256925.7:c.1498G>A	18.37:g.20832975G>A	ENSP00000256925:p.Glu500Lys					C18orf45_uc010xaq.1_Intron|CABLES1_uc002kub.2_Missense_Mutation_p.E3K|CABLES1_uc002kud.2_Missense_Mutation_p.E235K	p.E500K	NM_001100619	NP_001094089	Q8TDN4	CABL1_HUMAN			8	1498	+	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)		500					B4DK60|Q8N3Y8|Q8NA22|Q9BTG1	Missense_Mutation	SNP	ENST00000256925.7	37	c.1498G>A	CCDS42417.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.976520	0.92982	0.0	1.16E-4	ENSG00000134508	ENST00000400473;ENST00000256925;ENST00000420687	T;T;T	0.17054	2.3;2.3;2.3	5.56	5.56	0.83823	Cyclin-like (1);	0.085474	0.85682	D	0.000000	T	0.49270	0.1547	M	0.84846	2.72	0.80722	D	1	P;D	0.89917	0.814;1.0	B;D	0.77004	0.197;0.989	T	0.49943	-0.8885	10	0.52906	T	0.07	-25.9425	19.9626	0.97256	0.0:0.0:1.0:0.0	.	235;500	Q8TDN4-2;Q8TDN4	.;CABL1_HUMAN	K	173;500;235	ENSP00000383321:E173K;ENSP00000256925:E500K;ENSP00000413851:E235K	ENSP00000256925:E500K	E	+	1	0	CABLES1	19086973	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.784000	0.95788	0.644000	0.83932	GAG		0.488	CABLES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445198.2	NM_138375		9	57	0	0	0	0.010729	0	9	57				
C18orf8	29919	broad.mit.edu	37	18	21110037	21110037	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:21110037C>G	ENST00000269221.3	+	17	1650	c.1540C>G	c.(1540-1542)Ctc>Gtc	p.L514V	C18orf8_ENST00000591367.1_3'UTR|C18orf8_ENST00000590868.1_Missense_Mutation_p.L466V	NM_013326.3	NP_037458.3	Q96DM3	MIC1_HUMAN	chromosome 18 open reading frame 8	514	Mic1.					lysosomal membrane (GO:0005765)				endometrium(9)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	21	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CCAGCACAACCTCTTTTATAT	0.398																																							uc010xax.1		NA																	0				ovary(1)	1						c.(1540-1542)CTC>GTC		colon cancer-associated protein Mic1							305.0	308.0	307.0					18																	21110037		2203	4300	6503	SO:0001583	missense	29919							g.chr18:21110037C>G	AK057192	CCDS32803.1, CCDS74199.1	18q11.2	2013-12-13			ENSG00000141452	ENSG00000141452			24326	protein-coding gene	gene with protein product	"""colon cancer associated protein Mic1"", ""macrophage inhibitory cytokine 1"""					12477932	Standard	NM_013326		Approved	MIC1, MIC-1, HsT2591	uc021uie.2	Q96DM3		ENST00000269221.3:c.1540C>G	18.37:g.21110037C>G	ENSP00000269221:p.Leu514Val					C18orf8_uc002kul.2_RNA|C18orf8_uc010xay.1_Missense_Mutation_p.L138V|NPC1_uc010dlu.1_Intron	p.L514V	NM_013326	NP_037458	Q96DM3	MIC1_HUMAN			18	1661	+	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)		514			Mic1.		Q9BU17|Q9Y5M0	Missense_Mutation	SNP	ENST00000269221.3	37	c.1540C>G	CCDS32803.1	.	.	.	.	.	.	.	.	.	.	C	16.03	3.006960	0.54361	.	.	ENSG00000141452	ENST00000269221;ENST00000544799;ENST00000540942;ENST00000542734	.	.	.	5.39	4.52	0.55395	Colon cancer-associated Mic1-like (1);	0.086995	0.41938	D	0.000787	T	0.48943	0.1528	L	0.54323	1.7	0.80722	D	1	P;P	0.49307	0.922;0.92	P;P	0.45753	0.492;0.473	T	0.42616	-0.9441	9	0.29301	T	0.29	-4.3761	9.0331	0.36271	0.0:0.7879:0.0:0.2121	.	357;514	B7Z2Y1;Q96DM3	.;MIC1_HUMAN	V	514;357;466;357	.	ENSP00000269221:L514V	L	+	1	0	C18orf8	19364035	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	3.046000	0.49846	1.271000	0.44313	0.655000	0.94253	CTC		0.398	C18orf8-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445386.1	NM_013326		67	340	0	0	0	0.01441	0	67	340				
DSG3	1830	broad.mit.edu	37	18	29056010	29056010	+	Silent	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:29056010T>C	ENST00000257189.4	+	16	2870	c.2787T>C	c.(2785-2787)ggT>ggC	p.G929G		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	929					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TGCAGCATGGTAACTATTTAG	0.498																																							uc002kws.2		NA																	0				skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9						c.(2785-2787)GGT>GGC		desmoglein 3 preproprotein							157.0	141.0	146.0					18																	29056010		2203	4300	6503	SO:0001819	synonymous_variant	1830				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding	g.chr18:29056010T>C	M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.2787T>C	18.37:g.29056010T>C						DSG3_uc002kwt.2_Silent_p.G211G	p.G929G	NM_001944	NP_001935	P32926	DSG3_HUMAN	OV - Ovarian serous cystadenocarcinoma(10;0.00504)		16	2896	+			929			Desmoglein repeat 1.|Cytoplasmic (Potential).		A8K2V2	Silent	SNP	ENST00000257189.4	37	c.2787T>C	CCDS11898.1																																																																																				0.498	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254949.1	NM_001944		21	97	0	0	0	0.008871	0	21	97				
GAREM	64762	broad.mit.edu	37	18	29867127	29867127	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:29867127C>A	ENST00000269209.6	-	4	1436	c.1433G>T	c.(1432-1434)tGt>tTt	p.C478F	GAREM_ENST00000399218.4_Missense_Mutation_p.C478F|RP11-344B2.2_ENST00000579580.1_RNA|GAREM_ENST00000578619.1_5'Flank			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	478					cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										AAACTGATCACATCTGTTCTT	0.537																																							uc002kxl.2		NA																	0				ovary(1)|skin(1)	2						c.(1432-1434)TGT>TTT		family with sequence similarity 59, member A							135.0	127.0	130.0					18																	29867127		2203	4300	6503	SO:0001583	missense	64762							g.chr18:29867127C>A	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.1433G>T	18.37:g.29867127C>A	ENSP00000269209:p.Cys478Phe					FAM59A_uc002kxk.1_Missense_Mutation_p.C478F	p.C478F	NM_022751	NP_073588	Q9H706	FA59A_HUMAN			4	1489	-			478					Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	ENST00000269209.6	37	c.1433G>T	CCDS56057.1	.	.	.	.	.	.	.	.	.	.	C	8.808	0.934451	0.18206	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.14022	2.54;2.54	5.26	5.26	0.73747	.	0.285366	0.44688	D	0.000429	T	0.07728	0.0194	N	0.08118	0	0.58432	D	0.999998	B;B	0.33103	0.294;0.397	B;B	0.26202	0.022;0.067	T	0.40831	-0.9542	10	0.16896	T	0.51	-17.395	19.3995	0.94621	0.0:1.0:0.0:0.0	.	478;478	Q9H706;Q9H706-3	FA59A_HUMAN;.	F	478	ENSP00000382165:C478F;ENSP00000269209:C478F	ENSP00000269209:C478F	C	-	2	0	FAM59A	28121125	1.000000	0.71417	0.873000	0.34254	0.916000	0.54674	3.238000	0.51352	2.890000	0.99128	0.655000	0.94253	TGT		0.537	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751		27	106	1	0	1.2476e-16	0.00632	2.18931e-16	27	106				
ASXL3	80816	broad.mit.edu	37	18	31319709	31319709	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:31319709C>G	ENST00000269197.5	+	11	2341	c.2341C>G	c.(2341-2343)Ccg>Gcg	p.P781A		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	781	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GCCACTCTCCCCGCAGAAAGA	0.463																																							uc010dmg.1		NA																	0				ovary(2)|pancreas(1)	3						c.(2341-2343)CCG>GCG		additional sex combs like 3							37.0	39.0	39.0					18																	31319709		1892	4119	6011	SO:0001583	missense	80816				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding	g.chr18:31319709C>G	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.2341C>G	18.37:g.31319709C>G	ENSP00000269197:p.Pro781Ala					ASXL3_uc002kxq.2_Missense_Mutation_p.P488A	p.P781A	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN			11	2396	+			781			Ser-rich.		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	c.2341C>G	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	6.256	0.415441	0.11870	.	.	ENSG00000141431	ENST00000269197	T	0.15487	2.42	6.04	4.05	0.47172	.	0.736921	0.12683	N	0.447839	T	0.13030	0.0316	L	0.34521	1.04	0.33978	D	0.647605	B	0.28055	0.199	B	0.25506	0.061	T	0.14062	-1.0486	10	0.42905	T	0.14	.	7.4411	0.27183	0.2927:0.6146:0.0:0.0927	.	781	Q9C0F0	ASXL3_HUMAN	A	781	ENSP00000269197:P781A	ENSP00000269197:P781A	P	+	1	0	ASXL3	29573707	0.022000	0.18835	0.699000	0.30290	0.212000	0.24457	0.966000	0.29331	0.701000	0.31803	0.563000	0.77884	CCG		0.463	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2			17	71	0	0	0	0.004007	0	17	71				
NOL4	8715	broad.mit.edu	37	18	31538265	31538265	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:31538265C>G	ENST00000261592.5	-	7	1471	c.1174G>C	c.(1174-1176)Gac>Cac	p.D392H	NOL4_ENST00000535384.1_Missense_Mutation_p.D107H|NOL4_ENST00000269185.4_Missense_Mutation_p.D278H|NOL4_ENST00000589544.1_Missense_Mutation_p.D392H|NOL4_ENST00000535475.1_Missense_Mutation_p.D237H|NOL4_ENST00000538587.1_Missense_Mutation_p.D318H	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	392						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						TCCGAATCGTCATGGTCCTCG	0.488																																							uc010dmi.2		NA																	0				ovary(3)	3						c.(1174-1176)GAC>CAC		nucleolar protein 4							267.0	228.0	241.0					18																	31538265		2203	4300	6503	SO:0001583	missense	8715					nucleolus	RNA binding	g.chr18:31538265C>G	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1174G>C	18.37:g.31538265C>G	ENSP00000261592:p.Asp392His					NOL4_uc010xbs.1_Missense_Mutation_p.D107H|NOL4_uc002kxr.3_Missense_Mutation_p.D228H|NOL4_uc010xbt.1_Missense_Mutation_p.D318H|NOL4_uc010dmh.2_Missense_Mutation_p.D318H|NOL4_uc010xbu.1_Missense_Mutation_p.D392H|NOL4_uc002kxt.3_Missense_Mutation_p.D392H|NOL4_uc010xbv.1_Missense_Mutation_p.D141H|NOL4_uc010xbw.1_Missense_Mutation_p.D278H	p.D392H	NM_003787	NP_003778	O94818	NOL4_HUMAN			7	1403	-			392					B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	37	c.1174G>C	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	C	14.27	2.485815	0.44147	.	.	ENSG00000101746	ENST00000261592;ENST00000269185;ENST00000399171;ENST00000535384;ENST00000535475;ENST00000538587	T;T	0.81078	-1.45;-1.45	5.39	5.39	0.77823	.	0.399360	0.25500	N	0.030260	T	0.81536	0.4843	L	0.34521	1.04	0.45046	D	0.998062	P;P;D;P;P;P;B;B	0.56287	0.671;0.853;0.975;0.853;0.616;0.915;0.384;0.25	B;P;P;P;P;P;B;B	0.52267	0.435;0.694;0.647;0.575;0.495;0.647;0.398;0.151	D	0.83935	0.0308	10	0.87932	D	0	-4.4586	19.1443	0.93458	0.0:1.0:0.0:0.0	.	278;141;107;318;392;107;392;237	B4DLW2;F8W825;B7Z3Z7;B4DSQ0;O94818;F5H1E3;O94818-2;B3KRF4	.;.;.;.;NOL4_HUMAN;.;.;.	H	392;278;141;107;237;318	ENSP00000445733:D107H;ENSP00000443472:D318H	ENSP00000261592:D392H	D	-	1	0	NOL4	29792263	1.000000	0.71417	0.756000	0.31282	0.752000	0.42762	7.484000	0.81180	2.501000	0.84356	0.557000	0.71058	GAC		0.488	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787		31	172	0	0	0	0.012213	0	31	172				
DCC	1630	broad.mit.edu	37	18	50450202	50450202	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:50450202C>A	ENST00000442544.2	+	4	1439	c.823C>A	c.(823-825)Cga>Aga	p.R275R	DCC_ENST00000412726.1_Silent_p.R123R	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	275	Ig-like C2-type 3.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TACCTGGTTACGAGGCGAGGA	0.373																																							uc002lfe.1		NA																	0				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17						c.(823-825)CGA>AGA		netrin receptor DCC precursor							131.0	107.0	115.0					18																	50450202		2203	4300	6503	SO:0001819	synonymous_variant	1630				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane		g.chr18:50450202C>A	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.823C>A	18.37:g.50450202C>A						DCC_uc010xdr.1_Silent_p.R123R	p.R275R	NM_005215	NP_005206	P43146	DCC_HUMAN		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)	4	1410	+		all_cancers(7;0.11)|all_epithelial(6;0.00126)	275			Extracellular (Potential).|Ig-like C2-type 3.			Silent	SNP	ENST00000442544.2	37	c.823C>A	CCDS11952.1																																																																																				0.373	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215		9	42	1	0	4.68919e-08	0.008291	6.39617e-08	9	42				
ST8SIA3	51046	broad.mit.edu	37	18	55024500	55024500	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:55024500A>T	ENST00000324000.3	+	3	2693	c.659A>T	c.(658-660)aAc>aTc	p.N220I		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	220					cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid biosynthetic process (GO:0006688)|N-glycan processing (GO:0006491)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		AAATATTACAACAATCTCTTG	0.423																																							uc002lgn.2		NA																	0				breast(1)|skin(1)	2						c.(658-660)AAC>ATC		ST8 alpha-N-acetyl-neuraminide							55.0	56.0	56.0					18																	55024500		2203	4299	6502	SO:0001583	missense	51046				glycosphingolipid biosynthetic process|N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity	g.chr18:55024500A>T	AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511		"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C			Standard	NM_015879		Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.659A>T	18.37:g.55024500A>T	ENSP00000320431:p.Asn220Ile						p.N220I	NM_015879	NP_056963	O43173	SIA8C_HUMAN		READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)	3	1016	+			220			Lumenal (Potential).		A8K0F2|Q6B085|Q9NS41	Missense_Mutation	SNP	ENST00000324000.3	37	c.659A>T	CCDS32834.1	.	.	.	.	.	.	.	.	.	.	A	19.30	3.801191	0.70567	.	.	ENSG00000177511	ENST00000541833;ENST00000324000	T	0.15718	2.4	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.43277	0.1240	M	0.80422	2.495	0.80722	D	1	D	0.71674	0.998	D	0.66196	0.942	T	0.33033	-0.9884	10	0.41790	T	0.15	-23.318	15.897	0.79341	1.0:0.0:0.0:0.0	.	220	O43173	SIA8C_HUMAN	I	327;220	ENSP00000320431:N220I	ENSP00000320431:N220I	N	+	2	0	ST8SIA3	53175498	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.936000	0.92931	2.238000	0.73509	0.533000	0.62120	AAC		0.423	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449765.1	NM_015879		12	55	0	0	0	0.010729	0	12	55				
CDH19	28513	broad.mit.edu	37	18	64172450	64172450	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:64172450G>T	ENST00000262150.2	-	12	2210	c.1918C>A	c.(1918-1920)Caa>Aaa	p.Q640K	CDH19_ENST00000540086.1_3'UTR	NM_021153.3	NP_066976.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	0	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				TCATCATATTGGAATATATTC	0.388																																							uc002lkc.1		NA																	0				ovary(1)|skin(1)	2						c.(1918-1920)CAA>AAA		cadherin 19, type 2 preproprotein							138.0	142.0	140.0					18																	64172450		2203	4300	6503	SO:0001583	missense	28513				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr18:64172450G>T	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000262150.2:c.1918C>A	18.37:g.64172450G>T	ENSP00000262150:p.Gln640Lys					CDH19_uc010dql.1_RNA|CDH19_uc010xey.1_3'UTR	p.Q640K	NM_021153	NP_066976	Q9H159	CAD19_HUMAN			12	2056	-		Esophageal squamous(42;0.0132)	640			Cytoplasmic (Potential).		O15098	Missense_Mutation	SNP	ENST00000262150.2	37	c.1918C>A	CCDS11994.1	.	.	.	.	.	.	.	.	.	.	g	1.427	-0.571261	0.03882	.	.	ENSG00000071991	ENST00000262150	T	0.75154	-0.91	5.18	-2.37	0.06643	Cadherin, cytoplasmic domain (1);	0.567120	0.20971	N	0.082400	T	0.35566	0.0936	N	0.01789	-0.72	0.58432	D	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.42292	-0.9460	10	0.02654	T	1	.	6.5082	0.22206	0.3276:0.0:0.2391:0.4333	.	640	Q9H159	CAD19_HUMAN	K	640	ENSP00000262150:Q640K	ENSP00000262150:Q640K	Q	-	1	0	CDH19	62323430	0.021000	0.18746	0.174000	0.22961	0.230000	0.25150	0.151000	0.16283	-0.208000	0.10171	-1.069000	0.02264	CAA		0.388	CDH19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256219.1	NM_021153		22	187	1	0	1.55795e-14	0.012319	2.61161e-14	22	187				
RTTN	25914	broad.mit.edu	37	18	67812964	67812965	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:67812964_67812965CC>AA	ENST00000255674.6	-	18	2650_2651	c.2364_2365GG>TT	c.(2362-2367)ggGGct>ggTTct	p.A789S	RTTN_ENST00000437017.1_Missense_Mutation_p.A789S|RTTN_ENST00000454359.1_Missense_Mutation_p.A789S	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	789					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				TTTGTATCAGCCCCTTCTTCAC	0.421																																							uc002lkp.2		NA																	0				ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8						c.(2362-2367)GGGGCT>GGTTCT		rotatin																																				SO:0001583	missense	25914						binding	g.chr18:67812964_67812965CC>AA	AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.2364_2365delinsAA	18.37:g.67812964_67812965delinsAA	ENSP00000255674:p.Ala789Ser					RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_5'UTR	p.A789S	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN			18	2432_2433	-		Esophageal squamous(42;0.129)	789					Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	DNP	ENST00000255674.6	37	c.2364_2365GG>TT	CCDS42443.1																																																																																				0.421	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1	NM_173630		9	92	0	0	0	0.004672	0	9	92				
ZADH2	284273	broad.mit.edu	37	18	72913562	72913562	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:72913562C>A	ENST00000322342.3	-	2	1232	c.943G>T	c.(943-945)Gcc>Tcc	p.A315S	ZADH2_ENST00000537114.2_Missense_Mutation_p.A192S	NM_175907.4	NP_787103.1	Q8N4Q0	ZADH2_HUMAN	zinc binding alcohol dehydrogenase domain containing 2	315						mitochondrion (GO:0005739)|peroxisome (GO:0005777)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(3)|lung(8)|skin(1)	15		Esophageal squamous(42;0.131)|Prostate(75;0.155)		READ - Rectum adenocarcinoma(2;0.0276)|BRCA - Breast invasive adenocarcinoma(31;0.216)		TGGCTCATGGCTGCTTGATAC	0.522																																							uc002llx.2		NA																	0					0						c.(943-945)GCC>TCC		zinc binding alcohol dehydrogenase domain							80.0	76.0	77.0					18																	72913562		2203	4300	6503	SO:0001583	missense	284273					peroxisome	oxidoreductase activity|zinc ion binding	g.chr18:72913562C>A	BC033780	CCDS12008.1	18q22.3	2008-05-29	2008-05-29		ENSG00000180011	ENSG00000180011			28697	protein-coding gene	gene with protein product						12477932	Standard	NM_175907		Approved	MGC45594	uc002llx.3	Q8N4Q0	OTTHUMG00000132858	ENST00000322342.3:c.943G>T	18.37:g.72913562C>A	ENSP00000323678:p.Ala315Ser					ZADH2_uc010dqv.2_Missense_Mutation_p.A192S	p.A315S	NM_175907	NP_787103	Q8N4Q0	ZADH2_HUMAN		READ - Rectum adenocarcinoma(2;0.0276)|BRCA - Breast invasive adenocarcinoma(31;0.216)	2	1211	-		Esophageal squamous(42;0.131)|Prostate(75;0.155)	315					A8KA15|B4DZ91	Missense_Mutation	SNP	ENST00000322342.3	37	c.943G>T	CCDS12008.1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.311203	0.23821	.	.	ENSG00000180011	ENST00000322342;ENST00000537114	T;T	0.05447	3.44;3.44	5.61	3.77	0.43336	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.126422	0.53938	N	0.000059	T	0.11239	0.0274	M	0.73372	2.23	0.25035	N	0.991241	B	0.06786	0.001	B	0.29267	0.1	T	0.34229	-0.9837	10	0.22109	T	0.4	-20.302	13.5987	0.62007	0.2826:0.7174:0.0:0.0	.	315	Q8N4Q0	ZADH2_HUMAN	S	315;192	ENSP00000323678:A315S;ENSP00000440111:A192S	ENSP00000323678:A315S	A	-	1	0	ZADH2	71042550	0.998000	0.40836	0.047000	0.18901	0.315000	0.28087	3.718000	0.54919	-0.743000	0.04784	0.524000	0.50904	GCC		0.522	ZADH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256332.1	NM_175907		10	67	1	0	1.76689e-08	0.006214	2.45209e-08	10	67				
AZU1	566	broad.mit.edu	37	19	831859	831859	+	Silent	SNP	G	G	A	rs200997500		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:831859G>A	ENST00000233997.2	+	5	759	c.738G>A	c.(736-738)ccG>ccA	p.P246P		NM_001700.3	NP_001691.1	P20160	CAP7_HUMAN	azurocidin 1	246					cellular extravasation (GO:0045123)|defense response to Gram-negative bacterium (GO:0050829)|glial cell migration (GO:0008347)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|macrophage chemotaxis (GO:0048246)|microglial cell activation (GO:0001774)|monocyte activation (GO:0042117)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell adhesion (GO:0045785)|positive regulation of fractalkine biosynthetic process (GO:0050754)|positive regulation of interleukin-1 beta biosynthetic process (GO:0050725)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of phagocytosis (GO:0050766)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of vascular permeability (GO:0043114)	azurophil granule (GO:0042582)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)|toxic substance binding (GO:0015643)			NS(1)|endometrium(1)|kidney(1)|lung(4)|pancreas(1)|upper_aerodigestive_tract(2)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCAACAACCCGGGACCGGGGC	0.711													G|||	1	0.000199681	0.0	0.0	5008	,	,		11386	0.001		0.0	False		,,,				2504	0.0						uc002lpz.1		NA																	0				pancreas(1)	1						c.(736-738)CCG>CCA		azurocidin 1 preproprotein							29.0	35.0	33.0					19																	831859		2192	4280	6472	SO:0001819	synonymous_variant	566				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cellular extravasation|defense response to Gram-negative bacterium|glial cell migration|induction of positive chemotaxis|inflammatory response|macrophage chemotaxis|microglial cell activation|monocyte activation|positive regulation of cell adhesion|positive regulation of fractalkine biosynthetic process|positive regulation of interleukin-1 beta biosynthetic process|positive regulation of MHC class II biosynthetic process|positive regulation of phagocytosis|positive regulation of tumor necrosis factor biosynthetic process|proteolysis|regulation of vascular permeability	azurophil granule|extracellular region	heparin binding|serine-type endopeptidase activity|toxin binding	g.chr19:831859G>A	X58794	CCDS12044.1	19p13.3	2012-03-30	2008-08-01		ENSG00000172232	ENSG00000172232			913	protein-coding gene	gene with protein product	"""cationic antimicrobial protein 37"", ""heparin-binding protein"", ""neutrophil azurocidin"""	162815				1919011	Standard	NM_001700		Approved	AZU, CAP37, AZAMP, HBP, NAZC, HUMAZUR	uc002lpz.1	P20160		ENST00000233997.2:c.738G>A	19.37:g.831859G>A							p.P246P	NM_001700	NP_001691	P20160	CAP7_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	5	754	+		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)	246					P80014|Q52LG4|Q9UCM1|Q9UCT5	Silent	SNP	ENST00000233997.2	37	c.738G>A	CCDS12044.1																																																																																				0.711	AZU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457472.2	NM_001700		12	77	0	0	0	0.003163	0	12	77				
GTF2F1	2962	broad.mit.edu	37	19	6380303	6380303	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:6380303G>C	ENST00000394456.5	-	13	2007	c.1543C>G	c.(1543-1545)Ctc>Gtc	p.L515V	GTF2F1_ENST00000429701.2_Missense_Mutation_p.L430V|PSPN_ENST00000597721.1_5'Flank	NM_002096.2	NP_002087.2	P35269	T2FA_HUMAN	general transcription factor IIF, polypeptide 1, 74kDa	515					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cell junction (GO:0030054)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIF complex (GO:0005674)	catalytic activity (GO:0003824)|DNA binding (GO:0003677)|phosphatase activator activity (GO:0019211)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)	16						CACTCCTTGAGGGAGAAGTGC	0.552																																							uc002meq.2		NA																	0					0						c.(1543-1545)CTC>GTC		general transcription factor IIF, polypeptide 1,							194.0	175.0	182.0					19																	6380303		2203	4300	6503	SO:0001583	missense	2962				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|response to virus|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cell junction|transcription factor TFIIF complex	catalytic activity|DNA binding|phosphatase activator activity|transcription coactivator activity|transcription factor binding	g.chr19:6380303G>C		CCDS12165.1	19p13.3	2010-03-23	2002-08-29		ENSG00000125651	ENSG00000125651		"""General transcription factors"""	4652	protein-coding gene	gene with protein product		189968	"""general transcription factor IIF, polypeptide 1 (74kD subunit)"""			1734284	Standard	NM_002096		Approved	TFIIF, BTF4, RAP74, TF2F1	uc002meq.2	P35269	OTTHUMG00000168087	ENST00000394456.5:c.1543C>G	19.37:g.6380303G>C	ENSP00000377969:p.Leu515Val					GTF2F1_uc010xjb.1_Missense_Mutation_p.L336V|GTF2F1_uc010xjc.1_Missense_Mutation_p.L430V	p.L515V	NM_002096	NP_002087	P35269	T2FA_HUMAN			13	1828	-			515					B2RCS0|Q9BWN0	Missense_Mutation	SNP	ENST00000394456.5	37	c.1543C>G	CCDS12165.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.402356	0.62288	.	.	ENSG00000125651	ENST00000394456;ENST00000429701	T;T	0.56941	0.43;0.43	4.62	2.49	0.30216	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.64402	D	0.000003	T	0.68054	0.2959	M	0.76328	2.33	0.50813	D	0.999891	D;D;D	0.76494	0.992;0.999;0.998	D;D;D	0.76071	0.987;0.978;0.953	T	0.68911	-0.5284	10	0.66056	D	0.02	-42.7959	9.9039	0.41364	0.1707:0.0:0.8293:0.0	.	430;413;515	E7EUG6;B4DDB5;P35269	.;.;T2FA_HUMAN	V	515;430	ENSP00000377969:L515V;ENSP00000392107:L430V	ENSP00000377969:L515V	L	-	1	0	GTF2F1	6331303	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	7.014000	0.76380	0.681000	0.31386	0.655000	0.94253	CTC		0.552	GTF2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398033.1	NM_002096		30	176	0	0	0	0.00632	0	30	176				
EMR1	2015	broad.mit.edu	37	19	6897259	6897259	+	Missense_Mutation	SNP	C	C	A	rs577316799		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:6897259C>A	ENST00000312053.4	+	4	375	c.338C>A	c.(337-339)tCt>tAt	p.S113Y	EMR1_ENST00000450315.3_Missense_Mutation_p.S113Y|AC020895.1_ENST00000580648.1_RNA|EMR1_ENST00000381404.4_Intron|EMR1_ENST00000601198.1_3'UTR|EMR1_ENST00000381407.5_Intron|EMR1_ENST00000250572.8_Missense_Mutation_p.S113Y	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	113	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					GATGGTTTCTCTTCTCCCACT	0.502																																							uc002mfw.2		NA																	0				ovary(3)|lung(1)|skin(1)	5						c.(337-339)TCT>TAT		egf-like module containing, mucin-like, hormone							66.0	62.0	63.0					19																	6897259		2203	4300	6503	SO:0001583	missense	2015				cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity	g.chr19:6897259C>A	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.338C>A	19.37:g.6897259C>A	ENSP00000311545:p.Ser113Tyr					EMR1_uc010dvc.2_Missense_Mutation_p.S113Y|EMR1_uc010dvb.2_Intron|EMR1_uc010xji.1_Intron|EMR1_uc010xjj.1_Missense_Mutation_p.S113Y	p.S113Y	NM_001974	NP_001965	Q14246	EMR1_HUMAN			4	376	+	all_hematologic(4;0.166)		113			Extracellular (Potential).|EGF-like 2; calcium-binding (Potential).		A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	ENST00000312053.4	37	c.338C>A	CCDS12175.1	.	.	.	.	.	.	.	.	.	.	C	7.065	0.567180	0.13560	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000250572;ENST00000450315	D;D;D	0.92446	-3.04;-3.04;-3.04	3.88	3.88	0.44766	EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.92192	0.7524	L	0.38531	1.155	0.21897	N	0.999482	B;D;D	0.89917	0.001;1.0;0.978	B;D;P	0.74023	0.004;0.982;0.77	T	0.83223	-0.0067	9	0.13470	T	0.59	.	11.2507	0.49024	0.0:1.0:0.0:0.0	.	113;113;113	E7EPX9;Q14246-2;Q14246	.;.;EMR1_HUMAN	Y	113	ENSP00000311545:S113Y;ENSP00000250572:S113Y;ENSP00000405974:S113Y	ENSP00000250572:S113Y	S	+	2	0	EMR1	6848259	0.687000	0.27671	0.975000	0.42487	0.791000	0.44710	0.321000	0.19558	2.008000	0.58898	0.563000	0.77884	TCT		0.502	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458485.1			11	38	1	0	1.33987e-11	0.008291	2.0716e-11	11	38				
ZNF799	90576	broad.mit.edu	37	19	12501876	12501876	+	Nonsense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:12501876C>A	ENST00000430385.3	-	4	1536	c.1336G>T	c.(1336-1338)Gag>Tag	p.E446*	ZNF799_ENST00000419318.1_Nonsense_Mutation_p.E414*|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	446					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						TAGGGTTTCTCTCCAGTATGA	0.383																																							uc010dyt.2		NA																	0				breast(3)|ovary(2)|skin(1)	6						c.(1336-1338)GAG>TAG		zinc finger protein 799							84.0	87.0	86.0					19																	12501876		2203	4299	6502	SO:0001587	stop_gained	90576				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12501876C>A	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1336G>T	19.37:g.12501876C>A	ENSP00000411084:p.Glu446*					ZNF799_uc002mts.3_Intron	p.E446*	NM_001080821	NP_001074290	Q96GE5	ZN799_HUMAN			4	1486	-			446						Nonsense_Mutation	SNP	ENST00000430385.3	37	c.1336G>T	CCDS45989.1	.	.	.	.	.	.	.	.	.	.	C	44	10.988829	0.99499	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	.	.	.	1.31	1.31	0.21738	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	3.6106	0.08058	0.0:0.7514:0.0:0.2486	.	.	.	.	X	414;446	.	ENSP00000415278:E414X	E	-	1	0	ZNF799	12362876	0.771000	0.28555	0.661000	0.29709	0.972000	0.66771	1.812000	0.38952	1.021000	0.39600	0.430000	0.28490	GAG		0.383	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2	NM_001080821		21	81	1	0	2.4624e-09	0.008871	3.54074e-09	21	81				
CYP4F2	8529	broad.mit.edu	37	19	15990654	15990654	+	Missense_Mutation	SNP	C	C	A	rs372871763		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:15990654C>A	ENST00000221700.6	-	10	1264	c.1169G>T	c.(1168-1170)cGg>cTg	p.R390L		NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2											NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GGGATGCAGCCGCAGGCTCTC	0.612																																							uc002nbs.1		NA																	0				ovary(1)|skin(1)	2						c.(1168-1170)CGG>CTG		cytochrome P450, family 4, subfamily F,							91.0	95.0	94.0					19																	15990654		2203	4300	6503	SO:0001583	missense	8529				leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding	g.chr19:15990654C>A	U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.1169G>T	19.37:g.15990654C>A	ENSP00000221700:p.Arg390Leu					CYP4F2_uc010xot.1_Missense_Mutation_p.R241L	p.R390L	NM_001082	NP_001073	P78329	CP4F2_HUMAN			10	1219	-			390						Missense_Mutation	SNP	ENST00000221700.6	37	c.1169G>T	CCDS12336.1	.	.	.	.	.	.	.	.	.	.	c	14.84	2.655430	0.47467	.	.	ENSG00000186115	ENST00000221700;ENST00000392846	D	0.97480	-4.4	2.78	1.72	0.24424	.	0.000000	0.64402	U	0.000005	D	0.98953	0.9644	H	0.99368	4.535	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97246	0.9894	10	0.87932	D	0	.	7.54	0.27733	0.0:0.8612:0.0:0.1388	.	390	P78329	CP4F2_HUMAN	L	390;241	ENSP00000221700:R390L	ENSP00000221700:R390L	R	-	2	0	CYP4F2	15851654	1.000000	0.71417	0.399000	0.26333	0.325000	0.28411	6.801000	0.75170	0.476000	0.27440	0.491000	0.48974	CGG		0.612	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460372.3	NM_001082		28	137	1	0	1.74197e-06	0.00632	2.20166e-06	28	137				
FCHO1	23149	broad.mit.edu	37	19	17892527	17892528	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:17892527_17892528CC>AA	ENST00000596536.1	+	23	2118_2119	c.1835_1836CC>AA	c.(1834-1836)tCC>tAA	p.S612*	FCHO1_ENST00000595033.1_Nonsense_Mutation_p.S562*|FCHO1_ENST00000600676.1_Nonsense_Mutation_p.S612*|FCHO1_ENST00000594202.1_Nonsense_Mutation_p.S612*|FCHO1_ENST00000389133.4_Nonsense_Mutation_p.S612*|FCHO1_ENST00000596951.1_Nonsense_Mutation_p.S612*|FCHO1_ENST00000252771.7_Nonsense_Mutation_p.S612*|FCHO1_ENST00000539407.1_Nonsense_Mutation_p.S612*|FCHO1_ENST00000597512.1_Nonsense_Mutation_p.S619*	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	612	Mediates interaction with AGFG1, CALM, DAB2, EPS15, EPS15R, ITSN1 and clathrin.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						CCAGGAGTCTCCCGGGGTCCGA	0.629																																							uc010ebb.2		NA																	0				breast(1)	1						c.(1834-1836)TCC>TAA		FCH domain only 1 isoform b																																				SO:0001587	stop_gained	23149							g.chr19:17892527_17892528CC>AA	AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		Exception_encountered	19.37:g.17892527_17892528delinsAA	ENSP00000470731:p.Ser612*					FCHO1_uc002nhg.3_Nonsense_Mutation_p.S612*|FCHO1_uc002nhh.2_Nonsense_Mutation_p.S612*|FCHO1_uc010xpw.1_Nonsense_Mutation_p.S562*|FCHO1_uc002nhi.2_Nonsense_Mutation_p.S68*|FCHO1_uc002nhj.2_5'UTR	p.S612*	NM_001161358	NP_001154830	O14526	FCHO1_HUMAN			22	2024_2025	+			612					A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Nonsense_Mutation	DNP	ENST00000596536.1	37	c.1835_1836CC>AA	CCDS32955.1																																																																																				0.629	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466946.2	NM_015122		28	129	0	0	0	0.004672	0	28	129				
ZNF91	7644	broad.mit.edu	37	19	23544912	23544912	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:23544912C>A	ENST00000300619.7	-	4	1074	c.869G>T	c.(868-870)gGa>gTa	p.G290V	ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000397082.2_Missense_Mutation_p.G258V	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	290					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				GGGTTTCTCTCCAGTGTGTAT	0.378																																							uc002nre.2		NA																	0					0						c.(868-870)GGA>GTA		zinc finger protein 91							90.0	96.0	94.0					19																	23544912		2196	4291	6487	SO:0001583	missense	7644					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:23544912C>A	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.869G>T	19.37:g.23544912C>A	ENSP00000300619:p.Gly290Val					ZNF91_uc010xrj.1_Missense_Mutation_p.G258V	p.G290V	NM_003430	NP_003421	Q05481	ZNF91_HUMAN			4	982	-		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)	290					A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	c.869G>T	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	C	14.48	2.546518	0.45383	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.23552	1.9;4.74	1.56	1.56	0.23342	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41604	0.1166	M	0.64997	1.995	0.54753	D	0.999988	D;D	0.76494	0.999;0.999	P;D	0.65140	0.888;0.932	T	0.33497	-0.9866	9	0.59425	D	0.04	.	10.0684	0.42317	0.0:1.0:0.0:0.0	.	258;290	Q05481-2;Q05481	.;ZNF91_HUMAN	V	290;258	ENSP00000300619:G290V;ENSP00000380272:G258V	ENSP00000300619:G290V	G	-	2	0	ZNF91	23336752	0.002000	0.14202	0.017000	0.16124	0.003000	0.03518	0.285000	0.18883	0.854000	0.35336	0.162000	0.16502	GGA		0.378	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430		8	71	1	0	0.000673444	0.008291	0.000748663	8	71				
ZNF536	9745	broad.mit.edu	37	19	31040324	31040324	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:31040324G>T	ENST00000355537.3	+	4	3945	c.3798G>T	c.(3796-3798)tcG>tcT	p.S1266S		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1266					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					ACATGCTGTCGGTCCTCAGGG	0.587																																							uc002nsu.1		NA																	0				ovary(7)|large_intestine(2)|skin(2)	11						c.(3796-3798)TCG>TCT		zinc finger protein 536							34.0	33.0	33.0					19																	31040324		2194	4278	6472	SO:0001819	synonymous_variant	9745				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding	g.chr19:31040324G>T		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3798G>T	19.37:g.31040324G>T						ZNF536_uc010edd.1_Silent_p.S1266S	p.S1266S	NM_014717	NP_055532	O15090	ZN536_HUMAN			4	3936	+	Esophageal squamous(110;0.0834)		1266					A2RU18	Silent	SNP	ENST00000355537.3	37	c.3798G>T	CCDS32984.1																																																																																				0.587	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717		6	31	1	0	0.00198382	0.001984	0.00216386	6	31				
SHKBP1	92799	broad.mit.edu	37	19	41086559	41086559	+	Missense_Mutation	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:41086559A>G	ENST00000291842.5	+	8	699	c.650A>G	c.(649-651)tAc>tGc	p.Y217C	SHKBP1_ENST00000600733.1_Missense_Mutation_p.Y217C	NM_138392.3	NP_612401.2	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	217					protein homooligomerization (GO:0051260)					breast(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(3)|urinary_tract(1)	29			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTAGTCTGCTACAGGTGCTTG	0.587																																							uc002oob.2		NA																	0				ovary(1)|pancreas(1)	2						c.(649-651)TAC>TGC		SH3KBP1 binding protein 1							131.0	128.0	129.0					19																	41086559		2203	4300	6503	SO:0001583	missense	92799					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr19:41086559A>G	AF258553	CCDS12560.1	19q13.2	2013-01-10				ENSG00000160410		"""WD repeat domain containing"""	19214	protein-coding gene	gene with protein product						11152963	Standard	NM_138392		Approved	PP203, Sb1	uc002oob.3	Q8TBC3		ENST00000291842.5:c.650A>G	19.37:g.41086559A>G	ENSP00000291842:p.Tyr217Cys					SHKBP1_uc002ooc.2_Missense_Mutation_p.Y217C|SHKBP1_uc002ood.2_Missense_Mutation_p.Y217C|SHKBP1_uc010xvl.1_Missense_Mutation_p.Y140C|SHKBP1_uc002ooe.2_Missense_Mutation_p.Y54C|SHKBP1_uc002oof.2_Missense_Mutation_p.Y54C|SHKBP1_uc010xvm.1_Missense_Mutation_p.Y54C|SHKBP1_uc010xvn.1_Missense_Mutation_p.Y95C	p.Y217C	NM_138392	NP_612401	Q8TBC3	SHKB1_HUMAN	Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)		8	699	+			217					Q8N2I6|Q8WY93|Q96IB8	Missense_Mutation	SNP	ENST00000291842.5	37	c.650A>G	CCDS12560.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.075427	0.76415	.	.	ENSG00000160410	ENST00000291842;ENST00000446701	T	0.61274	0.12	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.76800	0.4038	M	0.81497	2.545	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D;D	0.85130	0.996;0.994;0.997;0.997;0.996;0.996;0.994	T	0.80589	-0.1315	10	0.87932	D	0	-16.1661	14.2925	0.66289	1.0:0.0:0.0:0.0	.	95;54;140;54;217;217;217	B4DLI0;B4DUW2;B4DUV2;B3KVX8;Q8TBC3-2;B2R6W9;Q8TBC3	.;.;.;.;.;.;SHKB1_HUMAN	C	217;54	ENSP00000291842:Y217C	ENSP00000291842:Y217C	Y	+	2	0	SHKBP1	45778399	1.000000	0.71417	0.999000	0.59377	0.941000	0.58515	8.421000	0.90259	2.022000	0.59522	0.374000	0.22700	TAC		0.587	SHKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462613.2	NM_138392		8	62	0	0	0	0.00308	0	8	62				
TMEM145	284339	broad.mit.edu	37	19	42821947	42821947	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:42821947G>C	ENST00000301204.3	+	12	1028	c.987G>C	c.(985-987)tgG>tgC	p.W329C	TMEM145_ENST00000598766.1_Missense_Mutation_p.W353C	NM_173633.2	NP_775904.2	Q8NBT3	TM145_HUMAN	transmembrane protein 145	329					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	27		Prostate(69;0.00682)				CCTACGTGTGGTTCTGCTATG	0.557																																							uc002otk.1		NA																	0					0						c.(985-987)TGG>TGC		transmembrane protein 145							191.0	148.0	163.0					19																	42821947		2203	4300	6503	SO:0001583	missense	284339					integral to membrane		g.chr19:42821947G>C	AK075286	CCDS12603.1	19q13.2	2008-02-05				ENSG00000167619			26912	protein-coding gene	gene with protein product							Standard	NM_173633		Approved	FLJ90805	uc002otk.1	Q8NBT3		ENST00000301204.3:c.987G>C	19.37:g.42821947G>C	ENSP00000301204:p.Trp329Cys						p.W329C	NM_173633	NP_775904	Q8NBT3	TM145_HUMAN			12	1039	+		Prostate(69;0.00682)	329			Helical; (Potential).			Missense_Mutation	SNP	ENST00000301204.3	37	c.987G>C	CCDS12603.1	.	.	.	.	.	.	.	.	.	.	G	19.43	3.826656	0.71143	.	.	ENSG00000167619	ENST00000301204	T	0.50277	0.75	4.45	4.45	0.53987	Rhodopsin-like GPCR transmembrane domain (1);	0.253701	0.34046	N	0.004309	T	0.67439	0.2893	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.71842	-0.4470	10	0.62326	D	0.03	-13.0525	14.9514	0.71077	0.0:0.0:1.0:0.0	.	329	Q8NBT3	TM145_HUMAN	C	329	ENSP00000301204:W329C	ENSP00000301204:W329C	W	+	3	0	TMEM145	47513787	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.861000	0.87004	2.198000	0.70561	0.591000	0.81541	TGG		0.557	TMEM145-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463737.1	NM_173633		22	77	0	0	0	0.014323	0	22	77				
ELSPBP1	64100	broad.mit.edu	37	19	48517427	48517427	+	Splice_Site	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:48517427G>T	ENST00000339841.2	+	3	248		c.e3-1		ELSPBP1_ENST00000597519.1_Intron	NM_022142.4	NP_071425.3	Q96BH3	ESPB1_HUMAN	epididymal sperm binding protein 1						single fertilization (GO:0007338)	extracellular region (GO:0005576)				NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(6)	10		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)		CTGCCCTTCAGGGATGCATGA	0.453																																							uc002pht.2		NA																	0					0						c.e3-1		epididymal sperm binding protein 1 precursor							235.0	202.0	213.0					19																	48517427		2203	4300	6503	SO:0001630	splice_region_variant	64100				single fertilization	extracellular region		g.chr19:48517427G>T	AJ278478	CCDS12708.1	19q13.33	2009-09-17							14417	protein-coding gene	gene with protein product	"""epididymal protein 12"""	607443					Standard	NM_022142		Approved	HE12, E12, EDDM12	uc002pht.3	Q96BH3		ENST00000339841.2:c.71-1G>T	19.37:g.48517427G>T							p.G24_splice	NM_022142	NP_071425	Q96BH3	ESPB1_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)	3	226	+		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)						Q96RT0|Q9H4C8	Splice_Site	SNP	ENST00000339841.2	37	c.71_splice	CCDS12708.1	.	.	.	.	.	.	.	.	.	.	G	10.98	1.504014	0.26949	.	.	ENSG00000169393	ENST00000339841	.	.	.	3.27	3.27	0.37495	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3103	0.43704	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ELSPBP1	53209239	0.762000	0.28451	0.787000	0.31911	0.039000	0.13416	2.705000	0.47127	2.113000	0.64589	0.544000	0.68410	.		0.453	ELSPBP1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465207.1		Intron	40	116	1	0	3.7052e-28	0.013114	6.9418e-28	40	116				
CD33	945	broad.mit.edu	37	19	51742847	51742847	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:51742847G>T	ENST00000262262.4	+	7	1020	c.999G>T	c.(997-999)gaG>gaT	p.E333D	CD33_ENST00000600557.1_3'UTR|CD33_ENST00000421133.2_Missense_Mutation_p.E206D	NM_001772.3	NP_001763.3	P20138	CD33_HUMAN	CD33 molecule	333					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(15)|skin(1)|stomach(1)	24		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	CTACTGTGGAGATGGATGAGG	0.507																																							uc002pwa.2		NA																	0					0						c.(997-999)GAG>GAT		CD33 antigen isoform 1 precursor	Gemtuzumab ozogamicin(DB00056)						118.0	101.0	107.0					19																	51742847		2203	4300	6503	SO:0001583	missense	945				cell adhesion|cell-cell signaling|negative regulation of cell proliferation	external side of plasma membrane|integral to plasma membrane	receptor activity|sugar binding	g.chr19:51742847G>T	M23197	CCDS33084.1, CCDS46157.1, CCDS54299.1	19q13.3	2013-01-29	2006-03-28		ENSG00000105383	ENSG00000105383		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1659	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 3"""	159590	"""CD33 antigen (gp67)"""			3139766, 9465907	Standard	NM_001772		Approved	SIGLEC3, SIGLEC-3, p67, FLJ00391	uc002pwa.2	P20138		ENST00000262262.4:c.999G>T	19.37:g.51742847G>T	ENSP00000262262:p.Glu333Asp					CD33_uc010eos.1_3'UTR|CD33_uc010eot.1_Missense_Mutation_p.E206D|CD33_uc010eou.1_RNA	p.E333D	NM_001772	NP_001763	P20138	CD33_HUMAN		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	7	1039	+		all_neural(266;0.0199)	333			Cytoplasmic (Potential).		B4E3P8|C9JEN7|F8WAL2|Q8TD24	Missense_Mutation	SNP	ENST00000262262.4	37	c.999G>T	CCDS33084.1	.	.	.	.	.	.	.	.	.	.	G	3.042	-0.197194	0.06259	.	.	ENSG00000105383	ENST00000262262;ENST00000421133	T;T	0.04758	3.56;3.56	2.51	1.43	0.22495	.	.	.	.	.	T	0.04543	0.0124	L	0.55481	1.735	0.09310	N	0.999999	B;B	0.33694	0.067;0.421	B;B	0.24006	0.034;0.05	T	0.39143	-0.9628	9	0.26408	T	0.33	.	6.6483	0.22947	0.0:0.0:0.7193:0.2807	.	206;333	C9JEN7;P20138	.;CD33_HUMAN	D	333;206	ENSP00000262262:E333D;ENSP00000410126:E206D	ENSP00000262262:E333D	E	+	3	2	CD33	56434659	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.013000	0.12678	0.594000	0.29761	0.313000	0.20887	GAG		0.507	CD33-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464199.2	NM_001772		8	44	1	0	0.00307968	0.00308	0.00334771	8	44				
ZNF578	147660	broad.mit.edu	37	19	53015320	53015320	+	Silent	SNP	C	C	T	rs376877936		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:53015320C>T	ENST00000421239.2	+	6	1930	c.1686C>T	c.(1684-1686)agC>agT	p.S562S	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	562					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		GAATTCATAGCGGAGAGAAAC	0.388																																							uc002pzp.3		NA																	0					0						c.(1684-1686)AGC>AGT		zinc finger protein 578		C		1,4397		0,1,2198	58.0	63.0	61.0		1686	-3.0	0.0	19		61	0,8598		0,0,4299	no	coding-synonymous	ZNF578	NM_001099694.1		0,1,6497	TT,TC,CC		0.0,0.0227,0.0077		562/591	53015320	1,12995	2199	4299	6498	SO:0001819	synonymous_variant	147660				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53015320C>T	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.1686C>T	19.37:g.53015320C>T							p.S562S	NM_001099694	NP_001093164	Q96N58	ZN578_HUMAN		GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)	6	1930	+			337					B4DR51|I3L1Y6	Silent	SNP	ENST00000421239.2	37	c.1686C>T	CCDS54310.1																																																																																				0.388	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472		8	46	0	0	0	0.004482	0	8	46				
NLRP12	91662	broad.mit.edu	37	19	54310871	54310871	+	Silent	SNP	C	C	A	rs375229272		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:54310871C>A	ENST00000324134.6	-	4	2289	c.2121G>T	c.(2119-2121)gcG>gcT	p.A707A	NLRP12_ENST00000354278.3_Silent_p.A707A|NLRP12_ENST00000345770.5_Silent_p.A708A|NLRP12_ENST00000351894.4_Silent_p.A707A|NLRP12_ENST00000391773.1_Silent_p.A708A|NLRP12_ENST00000391772.1_Silent_p.A708A|NLRP12_ENST00000391775.3_Silent_p.A707A|NLRP12_ENST00000535162.1_Silent_p.A707A	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	707					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TGCACAGGGCCGCTGCCAGAT	0.567																																							uc002qch.3		NA																	0				ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7						c.(2119-2121)GCG>GCT		NLR family, pyrin domain containing 12 isoform							106.0	90.0	96.0					19																	54310871		2203	4300	6503	SO:0001819	synonymous_variant	91662				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding	g.chr19:54310871C>A	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.2121G>T	19.37:g.54310871C>A						NLRP12_uc010eqw.2_5'UTR|NLRP12_uc002qci.3_Silent_p.A707A|NLRP12_uc002qcj.3_Silent_p.A708A|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Silent_p.A708A	p.A707A	NM_144687	NP_653288	P59046	NAL12_HUMAN		GBM - Glioblastoma multiforme(134;0.026)	4	2341	-	Ovarian(34;0.19)		707					A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	ENST00000324134.6	37	c.2121G>T	CCDS12864.1																																																																																				0.567	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687		9	45	1	0	7.48243e-07	0.006214	9.64839e-07	9	45				
LAIR2	3904	broad.mit.edu	37	19	55019118	55019118	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:55019118G>A	ENST00000301202.2	+	3	205	c.83G>A	c.(82-84)aGa>aAa	p.R28K	LAIR2_ENST00000351841.2_Missense_Mutation_p.R28K	NM_002288.4	NP_002279.2	Q6ISS4	LAIR2_HUMAN	leukocyte-associated immunoglobulin-like receptor 2	28						extracellular region (GO:0005576)				central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)	18	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0967)		GCCCTTCCCAGACCCTCCATC	0.567																																							uc002qgc.2		NA																	0				ovary(1)	1						c.(82-84)AGA>AAA		leukocyte-associated immunoglobulin-like							121.0	134.0	130.0					19																	55019118		2203	4300	6503	SO:0001583	missense	3904					extracellular region	receptor activity	g.chr19:55019118G>A	AF013250	CCDS12897.1, CCDS12898.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167618	ENSG00000167618		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6478	protein-coding gene	gene with protein product		602993	"""leukocyte-associated Ig-like receptor 2"""			9285412	Standard	XM_005277264		Approved	CD306	uc002qgc.3	Q6ISS4	OTTHUMG00000065697	ENST00000301202.2:c.83G>A	19.37:g.55019118G>A	ENSP00000301202:p.Arg28Lys					LAIR2_uc002qga.1_RNA|LAIR2_uc002qgb.1_RNA|LAIR2_uc002qgd.2_Missense_Mutation_p.R28K|LAIR2_uc010erl.2_Missense_Mutation_p.R28K	p.R28K	NM_002288	NP_002279	Q6ISS4	LAIR2_HUMAN		GBM - Glioblastoma multiforme(193;0.0967)	3	205	+	Ovarian(34;0.19)		28					Q6PEZ4	Missense_Mutation	SNP	ENST00000301202.2	37	c.83G>A	CCDS12897.1	.	.	.	.	.	.	.	.	.	.	G	10.72	1.429140	0.25726	.	.	ENSG00000167618	ENST00000412608;ENST00000452094;ENST00000301202;ENST00000351841	T;T;T	0.18502	2.21;3.11;3.29	3.12	-4.02	0.04034	Immunoglobulin-like fold (1);	1.793800	0.02848	N	0.128722	T	0.16085	0.0387	N	0.05487	-0.04	0.09310	N	1	P;D;P	0.61697	0.532;0.99;0.711	B;D;B	0.72982	0.227;0.979;0.247	T	0.46484	-0.9188	10	0.02654	T	1	.	8.1637	0.31213	0.7231:0.0:0.2769:0.0	.	22;28;28	C9JFQ0;Q6ISS4-2;Q6ISS4	.;.;LAIR2_HUMAN	K	22;10;28;28	ENSP00000390729:R22K;ENSP00000301202:R28K;ENSP00000301203:R28K	ENSP00000301202:R28K	R	+	2	0	LAIR2	59710930	0.000000	0.05858	0.000000	0.03702	0.602000	0.36980	-2.788000	0.00768	-0.980000	0.03524	0.313000	0.20887	AGA		0.567	LAIR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140801.1			38	156	0	0	0	0.00623	0	38	156				
LILRB1	10859	broad.mit.edu	37	19	55148268	55148268	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:55148268C>A	ENST00000396331.1	+	16	2249	c.1892C>A	c.(1891-1893)cCa>cAa	p.P631Q	LILRB1_ENST00000396317.1_Missense_Mutation_p.P615Q|LILRB1_ENST00000418536.2_Missense_Mutation_p.P615Q|AC009892.10_ENST00000456337.1_Intron|LILRB1_ENST00000396327.3_Missense_Mutation_p.P632Q|LILRB1_ENST00000427581.2_Missense_Mutation_p.P682Q|LILRB1_ENST00000448689.1_3'UTR|LILRB1_ENST00000434867.2_Missense_Mutation_p.P631Q|LILRB1_ENST00000396315.1_Missense_Mutation_p.P633Q|LILRB1_ENST00000396332.4_Missense_Mutation_p.P632Q|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000324602.7_Missense_Mutation_p.P633Q|LILRB1_ENST00000396321.2_Missense_Mutation_p.P631Q	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	631					cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		GAGCCTCCTCCATCCCAGGAA	0.652										HNSCC(37;0.09)																													uc002qgj.2		NA																	0				large_intestine(1)|ovary(1)|skin(1)	3						c.(1891-1893)CCA>CAA		leukocyte immunoglobulin-like receptor,							97.0	84.0	88.0					19																	55148268		2203	4300	6503	SO:0001583	missense	10859				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity	g.chr19:55148268C>A	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1892C>A	19.37:g.55148268C>A	ENSP00000379622:p.Pro631Gln	HNSCC(37;0.09)				LILRB1_uc002qgl.2_Missense_Mutation_p.P632Q|LILRB1_uc002qgk.2_Missense_Mutation_p.P632Q|LILRB1_uc002qgm.2_Missense_Mutation_p.P633Q|LILRB1_uc010erq.2_Missense_Mutation_p.P615Q|LILRB1_uc010err.2_RNA	p.P631Q	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN		GBM - Glioblastoma multiforme(193;0.0188)	16	2232	+			631			Cytoplasmic (Potential).		A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	ENST00000396331.1	37	c.1892C>A	CCDS42617.1	.	.	.	.	.	.	.	.	.	.	C	7.747	0.702560	0.15172	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T	0.00594	6.48;6.41;6.48;6.43;6.43;6.48;6.47;6.33;6.41;6.43	2.1	2.1	0.27182	.	.	.	.	.	T	0.00967	0.0032	M	0.70275	2.135	0.09310	N	1	B;B;B;B;B	0.30727	0.068;0.152;0.068;0.292;0.055	B;B;B;B;B	0.35470	0.072;0.094;0.072;0.203;0.035	T	0.36407	-0.9749	9	0.51188	T	0.08	.	7.7611	0.28953	0.0:1.0:0.0:0.0	.	615;633;632;632;631	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	Q	631;615;631;632;633;631;632;682;615;633	ENSP00000379614:P631Q;ENSP00000391514:P615Q;ENSP00000379622:P631Q;ENSP00000379618:P632Q;ENSP00000315997:P633Q;ENSP00000405243:P631Q;ENSP00000379623:P632Q;ENSP00000395004:P682Q;ENSP00000379610:P615Q;ENSP00000379608:P633Q	ENSP00000315997:P633Q	P	+	2	0	LILRB1	59840080	0.000000	0.05858	0.001000	0.08648	0.088000	0.18126	0.095000	0.15127	1.516000	0.48900	0.194000	0.17425	CCA		0.652	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4			18	65	1	0	8.10497e-08	0.010504	1.09615e-07	18	65				
TNNI3	7137	broad.mit.edu	37	19	55665404	55665404	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:55665404G>A	ENST00000344887.5	-	7	685	c.543C>T	c.(541-543)acC>acT	p.T181T	TNNI3_ENST00000588882.1_Silent_p.T156T|TNNI3_ENST00000590463.1_5'Flank	NM_000363.4	NP_000354.4	P19429	TNNI3_HUMAN	troponin I type 3 (cardiac)	181					cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|heart contraction (GO:0060047)|heart development (GO:0007507)|muscle filament sliding (GO:0030049)|negative regulation of ATPase activity (GO:0032780)|regulation of smooth muscle contraction (GO:0006940)|regulation of systemic arterial blood pressure by ischemic conditions (GO:0001980)|vasculogenesis (GO:0001570)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytosol (GO:0005829)|sarcomere (GO:0030017)|troponin complex (GO:0005861)	actin binding (GO:0003779)|calcium channel inhibitor activity (GO:0019855)|calcium-dependent protein binding (GO:0048306)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|troponin C binding (GO:0030172)|troponin T binding (GO:0031014)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		TCACCTTCTCGGTGTCCTCCT	0.622																																							uc002qjg.3		NA																	0				lung(1)|pancreas(1)	2						c.(541-543)ACC>ACT		troponin I, cardiac							65.0	69.0	68.0					19																	55665404		2054	4215	6269	SO:0001819	synonymous_variant	7137				cardiac muscle contraction|cellular calcium ion homeostasis|muscle filament sliding|negative regulation of ATPase activity|regulation of systemic arterial blood pressure by ischemic conditions|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin binding|calcium channel inhibitor activity|calcium-dependent protein binding|protein domain specific binding|protein kinase binding|troponin C binding|troponin T binding	g.chr19:55665404G>A	M64247	CCDS42628.1	19q13.4	2014-09-17	2005-09-12			ENSG00000129991			11947	protein-coding gene	gene with protein product		191044	"""troponin I, cardiac"", ""cardiomyopathy, dilated 2A (autosomal recessive)"""	CMD2A		9605869, 9241277, 10806205	Standard	NM_000363		Approved	TNNC1, CMH7	uc002qjg.4	P19429		ENST00000344887.5:c.543C>T	19.37:g.55665404G>A						TNNI3_uc010yft.1_Silent_p.T173T	p.T181T	NM_000363	NP_000354	P19429	TNNI3_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)	7	543	-			181						Silent	SNP	ENST00000344887.5	37	c.543C>T	CCDS42628.1																																																																																				0.622	TNNI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452098.1			24	96	0	0	0	0.003954	0	24	96				
TNNI3	7137	broad.mit.edu	37	19	55665459	55665459	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:55665459G>T	ENST00000344887.5	-	7	630	c.488C>A	c.(487-489)gCt>gAt	p.A163D	TNNI3_ENST00000588882.1_Missense_Mutation_p.A138D|TNNI3_ENST00000590463.1_5'Flank	NM_000363.4	NP_000354.4	P19429	TNNI3_HUMAN	troponin I type 3 (cardiac)	163					cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|heart contraction (GO:0060047)|heart development (GO:0007507)|muscle filament sliding (GO:0030049)|negative regulation of ATPase activity (GO:0032780)|regulation of smooth muscle contraction (GO:0006940)|regulation of systemic arterial blood pressure by ischemic conditions (GO:0001980)|vasculogenesis (GO:0001570)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytosol (GO:0005829)|sarcomere (GO:0030017)|troponin complex (GO:0005861)	actin binding (GO:0003779)|calcium channel inhibitor activity (GO:0019855)|calcium-dependent protein binding (GO:0048306)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|troponin C binding (GO:0030172)|troponin T binding (GO:0031014)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		GGACTCCTTAGCCCGGGCCCC	0.607																																							uc002qjg.3		NA																	0				lung(1)|pancreas(1)	2						c.(487-489)GCT>GAT		troponin I, cardiac							50.0	55.0	53.0					19																	55665459		1975	4169	6144	SO:0001583	missense	7137				cardiac muscle contraction|cellular calcium ion homeostasis|muscle filament sliding|negative regulation of ATPase activity|regulation of systemic arterial blood pressure by ischemic conditions|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin binding|calcium channel inhibitor activity|calcium-dependent protein binding|protein domain specific binding|protein kinase binding|troponin C binding|troponin T binding	g.chr19:55665459G>T	M64247	CCDS42628.1	19q13.4	2014-09-17	2005-09-12			ENSG00000129991			11947	protein-coding gene	gene with protein product		191044	"""troponin I, cardiac"", ""cardiomyopathy, dilated 2A (autosomal recessive)"""	CMD2A		9605869, 9241277, 10806205	Standard	NM_000363		Approved	TNNC1, CMH7	uc002qjg.4	P19429		ENST00000344887.5:c.488C>A	19.37:g.55665459G>T	ENSP00000341838:p.Ala163Asp					TNNI3_uc010yft.1_Missense_Mutation_p.A155D	p.A163D	NM_000363	NP_000354	P19429	TNNI3_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)	7	488	-			163						Missense_Mutation	SNP	ENST00000344887.5	37	c.488C>A	CCDS42628.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.689738	0.48097	.	.	ENSG00000129991	ENST00000344887	D	0.91996	-2.95	4.72	3.68	0.42216	.	0.674084	0.13582	N	0.377318	D	0.84229	0.5426	N	0.20986	0.625	0.37282	D	0.907877	B	0.31241	0.315	B	0.29267	0.1	T	0.82337	-0.0507	10	0.62326	D	0.03	-28.9192	5.9993	0.19511	0.0937:0.0:0.6066:0.2997	.	163	P19429	TNNI3_HUMAN	D	163	ENSP00000341838:A163D	ENSP00000341838:A163D	A	-	2	0	TNNI3	60357271	1.000000	0.71417	0.991000	0.47740	0.990000	0.78478	5.556000	0.67307	1.111000	0.41721	0.585000	0.79938	GCT		0.607	TNNI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452098.1			16	73	1	0	3.32936e-07	0.006122	4.36379e-07	16	73				
NLRP4	147945	broad.mit.edu	37	19	56369531	56369531	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:56369531C>G	ENST00000301295.6	+	3	1194	c.772C>G	c.(772-774)Cag>Gag	p.Q258E	NLRP4_ENST00000346986.5_Missense_Mutation_p.Q258E|NLRP4_ENST00000587891.1_Missense_Mutation_p.Q183E	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	258	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		ACGGCCGGTGCAGGTGCTTCT	0.577																																							uc002qmd.3		NA																	0				ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15						c.(772-774)CAG>GAG		NLR family, pyrin domain containing 4							75.0	81.0	79.0					19																	56369531		2203	4300	6503	SO:0001583	missense	147945						ATP binding	g.chr19:56369531C>G	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.772C>G	19.37:g.56369531C>G	ENSP00000301295:p.Gln258Glu					NLRP4_uc002qmf.2_Missense_Mutation_p.Q183E|NLRP4_uc010etf.2_Missense_Mutation_p.Q89E	p.Q258E	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN		GBM - Glioblastoma multiforme(193;0.0606)	3	1194	+		Colorectal(82;0.0002)|Ovarian(87;0.221)	258			NACHT.		Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	c.772C>G	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	C	9.236	1.037174	0.19669	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	T;T	0.77877	-1.13;-1.13	4.1	-5.44	0.02624	NACHT nucleoside triphosphatase (1);	.	.	.	.	T	0.52108	0.1714	N	0.16201	0.385	0.09310	N	1	P;B;B	0.40834	0.73;0.355;0.408	B;B;B	0.39876	0.312;0.074;0.088	T	0.51973	-0.8637	9	0.05833	T	0.94	.	8.2824	0.31908	0.4542:0.2513:0.2944:0.0	.	258;183;258	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	E	258	ENSP00000301295:Q258E;ENSP00000344787:Q258E	ENSP00000301295:Q258E	Q	+	1	0	NLRP4	61061343	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.083000	0.11286	-0.647000	0.05444	0.655000	0.94253	CAG		0.577	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444		19	103	0	0	0	0.007413	0	19	103				
ZNF835	90485	broad.mit.edu	37	19	57175196	57175196	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:57175196G>A	ENST00000537055.2	-	2	1602	c.1371C>T	c.(1369-1371)aaC>aaT	p.N457N		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	457					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						GGTAGGAGCGGTTGCTGAAGG	0.672																																							uc010ygo.1		NA																	0				pancreas(3)|skin(1)	4						c.(1435-1437)AAC>AAT		zinc finger protein 835							72.0	80.0	77.0					19																	57175196		2202	4300	6502	SO:0001819	synonymous_variant	90485							g.chr19:57175196G>A	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.1371C>T	19.37:g.57175196G>A						ZNF835_uc010ygn.1_Silent_p.N457N	p.N479N	NM_001005850	NP_001005850					2	1437	-								B7Z5Y0|G3V1S0	Silent	SNP	ENST00000537055.2	37	c.1437C>T	CCDS56105.1																																																																																				0.672	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850		37	110	0	0	0	0.003271	0	37	110				
ZSCAN22	342945	broad.mit.edu	37	19	58846460	58846460	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:58846460C>T	ENST00000329665.4	+	2	439	c.292C>T	c.(292-294)Ctg>Ttg	p.L98L		NM_181846.2	NP_862829.1	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	98	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|pancreas(1)|prostate(2)	16		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		GGAGCAGTTCCTGGGTGCGCT	0.662																																							uc002qsc.2		NA																	0				pancreas(1)	1						c.(292-294)CTG>TTG		zinc finger and SCAN domain containing 22							35.0	37.0	36.0					19																	58846460		2203	4300	6503	SO:0001819	synonymous_variant	342945				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:58846460C>T	M20675	CCDS12975.1	19q13.43	2013-01-08	2006-09-20	2006-09-20				"""-"", ""Zinc fingers, C2H2-type"""	4929	protein-coding gene	gene with protein product	"""oncogene HKR2"""	165260	"""zinc finger protein 50"", ""GLI-Kruppel family member HKR2"""	ZNF50, HKR2		2850480, 1505991	Standard	NM_181846		Approved		uc002qsc.2	P10073		ENST00000329665.4:c.292C>T	19.37:g.58846460C>T						ZSCAN22_uc010yhz.1_Silent_p.L98L	p.L98L	NM_181846	NP_862829	P10073	ZSC22_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)	2	439	+		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)	98			SCAN box.		Q15922|Q7Z3L8	Silent	SNP	ENST00000329665.4	37	c.292C>T	CCDS12975.1																																																																																				0.662	ZSCAN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466765.1	NM_181846		7	49	0	0	0	0.001984	0	7	49				
MYT1L	23040	broad.mit.edu	37	2	1983535	1983535	+	Silent	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:1983535G>C	ENST00000399161.2	-	6	762	c.15C>G	c.(13-15)acC>acG	p.T5T	MYT1L_ENST00000428368.2_Silent_p.T5T	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	5					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GCTTCTCCTCGGTGTCCACCT	0.617																																							uc002qxe.2		NA																	0				ovary(5)|central_nervous_system(1)	6						c.(13-15)ACC>ACG		myelin transcription factor 1-like							46.0	52.0	50.0					2																	1983535		1993	4168	6161	SO:0001819	synonymous_variant	23040				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr2:1983535G>C	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.15C>G	2.37:g.1983535G>C						MYT1L_uc002qxd.2_Silent_p.T5T|MYT1L_uc002qxf.1_RNA	p.T5T	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)	6	842	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)	5					A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	ENST00000399161.2	37	c.15C>G																																																																																					0.617	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025		9	25	0	0	0	0.006214	0	9	25				
GRHL1	29841	broad.mit.edu	37	2	10126264	10126264	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:10126264G>T	ENST00000324907.9	+	9	1259	c.1123G>T	c.(1123-1125)Gtg>Ttg	p.V375L	GRHL1_ENST00000405379.2_Missense_Mutation_p.V375L|GRHL1_ENST00000324883.5_Missense_Mutation_p.V186L	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	375					cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		TTTCATCTCTGTGAACTGCTT	0.423																																							uc002raa.2		NA																	0				pancreas(1)|skin(1)	2						c.(1123-1125)GTG>TTG		grainyhead-like 1							176.0	180.0	179.0					2																	10126264		2203	4300	6503	SO:0001583	missense	29841				cellular lipid metabolic process|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding	g.chr2:10126264G>T	AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.1123G>T	2.37:g.10126264G>T	ENSP00000324693:p.Val375Leu					GRHL1_uc002rab.2_RNA|GRHL1_uc002rad.2_Missense_Mutation_p.V186L|GRHL1_uc010yjb.1_Missense_Mutation_p.V224L	p.V375L	NM_198182	NP_937825	Q9NZI5	GRHL1_HUMAN		Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)	9	1294	+	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		375					A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Missense_Mutation	SNP	ENST00000324907.9	37	c.1123G>T	CCDS33144.2	.	.	.	.	.	.	.	.	.	.	G	32	5.150660	0.94645	.	.	ENSG00000134317	ENST00000405379;ENST00000324883;ENST00000324907	T;T;T	0.19250	2.16;2.16;2.16	5.72	5.72	0.89469	CP2 transcription factor (1);	0.000000	0.85682	D	0.000000	T	0.47893	0.1470	M	0.66506	2.035	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.74348	0.94;0.983	T	0.39663	-0.9603	10	0.66056	D	0.02	-24.0338	19.8751	0.96867	0.0:0.0:1.0:0.0	.	186;375	Q9NZI5-2;Q9NZI5	.;GRHL1_HUMAN	L	375;186;375	ENSP00000384209:V375L;ENSP00000324494:V186L;ENSP00000324693:V375L	ENSP00000324494:V186L	V	+	1	0	GRHL1	10043715	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.695000	0.91970	0.655000	0.94253	GTG		0.423	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323543.2	NM_014552		50	177	1	0	1.51926e-22	0.01441	2.80512e-22	50	177				
KCNF1	3754	broad.mit.edu	37	2	11053359	11053359	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:11053359C>A	ENST00000295082.1	+	1	1297	c.807C>A	c.(805-807)agC>agA	p.S269R		NM_002236.4	NP_002227.2	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F, member 1	269					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(2)|skin(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		TCTACGTGAGCCTCACGCTCA	0.617																																							uc002rax.2		NA																	0				ovary(1)	1						c.(805-807)AGC>AGA		potassium voltage-gated channel, subfamily F,							62.0	52.0	55.0					2																	11053359		2203	4300	6503	SO:0001583	missense	3754					voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr2:11053359C>A	AF033382	CCDS1676.1	2p25	2011-07-05			ENSG00000162975	ENSG00000162975		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6246	protein-coding gene	gene with protein product		603787		KCNF		9434767, 16382104	Standard	NM_002236		Approved	Kv5.1, kH1, IK8	uc002rax.3	Q9H3M0	OTTHUMG00000119054	ENST00000295082.1:c.807C>A	2.37:g.11053359C>A	ENSP00000295082:p.Ser269Arg						p.S269R	NM_002236	NP_002227	Q9H3M0	KCNF1_HUMAN		Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)	1	1297	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)		269			Helical; Name=Segment S3; (Potential).		O43527|Q585L3	Missense_Mutation	SNP	ENST00000295082.1	37	c.807C>A	CCDS1676.1	.	.	.	.	.	.	.	.	.	.	c	14.01	2.407340	0.42715	.	.	ENSG00000162975	ENST00000295082	D	0.98666	-5.06	4.96	4.96	0.65561	Ion transport (1);	0.270097	0.42053	D	0.000775	D	0.97303	0.9118	L	0.46741	1.465	0.38714	D	0.953287	B	0.30889	0.299	B	0.32724	0.151	D	0.98055	1.0390	10	0.66056	D	0.02	.	18.6023	0.91253	0.0:1.0:0.0:0.0	.	269	Q9H3M0	KCNF1_HUMAN	R	269	ENSP00000295082:S269R	ENSP00000295082:S269R	S	+	3	2	KCNF1	10970810	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.038000	0.41184	2.461000	0.83175	0.651000	0.88453	AGC		0.617	KCNF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239265.1	NM_002236		10	42	1	0	0.000673444	0.008291	0.000748663	10	42				
UBXN2A	165324	broad.mit.edu	37	2	24205881	24205881	+	Nonsense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:24205881G>T	ENST00000309033.4	+	5	647	c.403G>T	c.(403-405)Gga>Tga	p.G135*	UBXN2A_ENST00000446425.2_3'UTR|UBXN2A_ENST00000404924.1_Nonsense_Mutation_p.G135*|UBXN2A_ENST00000535786.1_Nonsense_Mutation_p.G135*	NM_181713.3	NP_859064.2	P68543	UBX2A_HUMAN	UBX domain protein 2A	135					regulation of gene expression (GO:0010468)|regulation of protein catabolic process (GO:0042176)|regulation of protein ubiquitination (GO:0031396)	cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)				endometrium(1)|large_intestine(3)|liver(1)|lung(6)	11						GCCCTTTTCAGGACAGGGTCA	0.368																																							uc010exy.2		NA																	0					0						c.(403-405)GGA>TGA		UBX domain containing 4							89.0	93.0	92.0					2																	24205881		2203	4300	6503	SO:0001587	stop_gained	165324							g.chr2:24205881G>T	BC037901	CCDS1704.1	2p24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000173960	ENSG00000173960		"""UBX domain containing"""	27265	protein-coding gene	gene with protein product			"""UBX domain containing 4"""	UBXD4		12477932	Standard	NM_181713		Approved		uc002ren.3	P68543	OTTHUMG00000125497	ENST00000309033.4:c.403G>T	2.37:g.24205881G>T	ENSP00000312107:p.Gly135*					UBXN2A_uc002rem.2_RNA|UBXN2A_uc002ren.2_Nonsense_Mutation_p.G135*|UBXN2A_uc010ykj.1_Nonsense_Mutation_p.G135*	p.G135*	NM_181713	NP_859064	P68543	UBX2A_HUMAN			6	871	+			135					A8K577|B7ZKP8|Q569G8	Nonsense_Mutation	SNP	ENST00000309033.4	37	c.403G>T	CCDS1704.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883046	0.91740	.	.	ENSG00000173960	ENST00000404924;ENST00000309033;ENST00000535786	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-28.7475	17.724	0.88360	0.0:0.0:1.0:0.0	.	.	.	.	X	135	.	ENSP00000312107:G135X	G	+	1	0	UBXN2A	24059385	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.631000	0.74277	2.555000	0.86185	0.563000	0.77884	GGA		0.368	UBXN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246824.2	NM_181713		11	31	1	0	1.5842e-08	0.001855	2.2326e-08	11	31				
GPR113	165082	broad.mit.edu	37	2	26569027	26569027	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:26569027C>T	ENST00000333478.6	-	1	658	c.76G>A	c.(76-78)Ggc>Agc	p.G26S	EPT1_ENST00000260585.7_5'UTR|GPR113_ENST00000459892.1_5'Flank|GPR113_ENST00000541401.1_5'UTR	NM_153835.3	NP_722577.2	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	83					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTGCCCAGCCGGTGTGGTGC	0.677																																							uc010eyk.1		NA																	0				ovary(4)	4						c.(76-78)GGC>AGC		G-protein coupled receptor 113 isoform 3							41.0	46.0	44.0					2																	26569027		2122	4233	6355	SO:0001583	missense	165082				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr2:26569027C>T	AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000333478.6:c.76G>A	2.37:g.26569027C>T	ENSP00000327396:p.Gly26Ser					EPT1_uc010ykz.1_5'UTR|EPT1_uc010eyl.1_RNA|GPR113_uc002rhb.1_5'Flank|GPR113_uc002rhc.1_5'UTR|GPR113_uc002rhd.1_RNA	p.G26S	NM_153835	NP_722577	Q8IZF5	GP113_HUMAN			1	659	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	ENST00000333478.6	37	c.76G>A	CCDS33159.2	.	.	.	.	.	.	.	.	.	.	C	11.45	1.643467	0.29246	.	.	ENSG00000173567	ENST00000333478;ENST00000433584	T	0.27256	1.68	5.82	-5.21	0.02815	.	.	.	.	.	T	0.08935	0.0221	.	.	.	0.20196	N	0.999925	B	0.23490	0.086	B	0.17722	0.019	T	0.32745	-0.9895	8	0.12766	T	0.61	.	2.6542	0.05008	0.1881:0.2462:0.3836:0.1821	.	26	Q8IZF5-2	.	S	26	ENSP00000327396:G26S	ENSP00000327396:G26S	G	-	1	0	GPR113	26422531	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.662000	0.05305	-1.653000	0.01500	-0.208000	0.12717	GGC		0.677	GPR113-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317218.1	NM_153835		3	18	0	0	0	0.004672	0	3	18				
PREB	10113	broad.mit.edu	37	2	27355541	27355541	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:27355541C>G	ENST00000260643.2	-	5	935	c.682G>C	c.(682-684)Gtg>Ctg	p.V228L	PREB_ENST00000406567.3_Missense_Mutation_p.V228L|PREB_ENST00000416802.1_5'Flank	NM_013388.4	NP_037520.1	Q9HCU5	PREB_HUMAN	prolactin regulatory element binding	228					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCTGTGTCACCAGCTGATCC	0.532																																							uc002rix.1		NA																	0				ovary(1)	1						c.(682-684)GTG>CTG		prolactin regulatory element binding protein							105.0	100.0	102.0					2																	27355541		2203	4300	6503	SO:0001583	missense	10113				COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane|nucleus	DNA binding|guanyl-nucleotide exchange factor activity|protein binding	g.chr2:27355541C>G		CCDS1738.1	2p23	2013-01-10			ENSG00000138073	ENSG00000138073		"""WD repeat domain containing"""	9356	protein-coding gene	gene with protein product		606395				10194769, 12735795	Standard	NM_013388		Approved	SEC12	uc002rix.1	Q9HCU5	OTTHUMG00000097076	ENST00000260643.2:c.682G>C	2.37:g.27355541C>G	ENSP00000260643:p.Val228Leu					PREB_uc002riy.1_Missense_Mutation_p.V156L|PREB_uc002riz.1_RNA|PREB_uc002rja.1_Missense_Mutation_p.V228L	p.V228L	NM_013388	NP_037520	Q9HCU5	PREB_HUMAN			5	935	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		228			Cytoplasmic (Potential).|WD 2.		Q53SZ8|Q9UH94	Missense_Mutation	SNP	ENST00000260643.2	37	c.682G>C	CCDS1738.1	.	.	.	.	.	.	.	.	.	.	C	0.253	-1.004825	0.02112	.	.	ENSG00000138073	ENST00000260643;ENST00000406567;ENST00000546336	T;T	0.27890	1.64;5.03	5.76	2.89	0.33648	Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.237069	0.42964	N	0.000623	T	0.12220	0.0297	N	0.05078	-0.115	0.31918	N	0.613852	B;B	0.10296	0.003;0.003	B;B	0.06405	0.002;0.001	T	0.20672	-1.0268	10	0.13853	T	0.58	-6.6944	7.2705	0.26254	0.0:0.5806:0.3321:0.0873	.	228;228	B5MC98;Q9HCU5	.;PREB_HUMAN	L	228	ENSP00000260643:V228L;ENSP00000384032:V228L	ENSP00000260643:V228L	V	-	1	0	PREB	27209045	0.990000	0.36364	1.000000	0.80357	0.111000	0.19643	0.902000	0.28459	0.723000	0.32274	0.655000	0.94253	GTG		0.532	PREB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214195.1	NM_013388		12	71	0	0	0	0.013537	0	12	71				
MAP4K3	8491	broad.mit.edu	37	2	39494378	39494378	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:39494378C>A	ENST00000263881.3	-	27	2308	c.1984G>T	c.(1984-1986)Gta>Tta	p.V662L	MAP4K3_ENST00000341681.5_Missense_Mutation_p.V641L|MAP4K3_ENST00000536018.1_Missense_Mutation_p.V215L|MAP4K3_ENST00000437545.1_Missense_Mutation_p.V578L	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	662	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				TTTGCTGATACAGAAAATTTC	0.348																																							uc002rro.2		NA																	0				ovary(3)|lung(3)|stomach(1)|pancreas(1)	8						c.(1984-1986)GTA>TTA		mitogen-activated protein kinase kinase kinase							109.0	110.0	110.0					2																	39494378		2203	4300	6503	SO:0001583	missense	8491				JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chr2:39494378C>A	AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.1984G>T	2.37:g.39494378C>A	ENSP00000263881:p.Val662Leu					MAP4K3_uc002rrp.2_Missense_Mutation_p.V641L|MAP4K3_uc010yns.1_Missense_Mutation_p.V215L	p.V662L	NM_003618	NP_003609	Q8IVH8	M4K3_HUMAN			27	2075	-		all_hematologic(82;0.211)	662			CNH.		Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Missense_Mutation	SNP	ENST00000263881.3	37	c.1984G>T	CCDS1803.1	.	.	.	.	.	.	.	.	.	.	C	6.756	0.508345	0.12883	.	.	ENSG00000011566	ENST00000263881;ENST00000437545;ENST00000341681;ENST00000536018	T;T;T;T	0.04406	3.63;3.63;3.63;3.63	5.42	5.42	0.78866	Citron-like (3);	0.000000	0.85682	D	0.000000	T	0.03695	0.0105	N	0.11818	0.18	0.58432	D	0.999999	B;B	0.13594	0.005;0.008	B;B	0.21546	0.016;0.035	T	0.29305	-1.0016	10	0.02654	T	1	.	19.6002	0.95559	0.0:1.0:0.0:0.0	.	641;662	Q8IVH8-3;Q8IVH8	.;M4K3_HUMAN	L	662;578;641;215	ENSP00000263881:V662L;ENSP00000416958:V578L;ENSP00000345434:V641L;ENSP00000440580:V215L	ENSP00000263881:V662L	V	-	1	0	MAP4K3	39347882	0.999000	0.42202	1.000000	0.80357	0.983000	0.72400	3.286000	0.51724	2.691000	0.91804	0.655000	0.94253	GTA		0.348	MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219966.2	NM_003618		10	57	1	0	0.00829132	0.008291	0.00883206	10	57				
SLC8A1	6546	broad.mit.edu	37	2	40656493	40656493	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:40656493G>T	ENST00000403092.1	-	2	961	c.928C>A	c.(928-930)Ctg>Atg	p.L310M	SLC8A1_ENST00000542024.1_Missense_Mutation_p.L310M|SLC8A1_ENST00000405269.1_Missense_Mutation_p.L310M|SLC8A1_ENST00000406785.2_Missense_Mutation_p.L310M|SLC8A1_ENST00000408028.2_Missense_Mutation_p.L310M|SLC8A1_ENST00000406391.2_Missense_Mutation_p.L310M|SLC8A1_ENST00000332839.4_Missense_Mutation_p.L310M|SLC8A1_ENST00000542756.1_Missense_Mutation_p.L310M|SLC8A1_ENST00000405901.3_Missense_Mutation_p.L310M|SLC8A1_ENST00000402441.1_Missense_Mutation_p.L310M			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	310					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TCCACCTCCAGAACCAGAGCA	0.423																																							uc002rrx.2		NA																	0				ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						c.(928-930)CTG>ATG		solute carrier family 8 (sodium/calcium	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						131.0	137.0	135.0					2																	40656493		2203	4300	6503	SO:0001583	missense	6546				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding	g.chr2:40656493G>T		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.928C>A	2.37:g.40656493G>T	ENSP00000384763:p.Leu310Met					SLC8A1_uc002rry.2_Missense_Mutation_p.L310M|SLC8A1_uc002rrz.2_Missense_Mutation_p.L310M|SLC8A1_uc002rsa.2_Missense_Mutation_p.L310M|SLC8A1_uc002rsd.3_Missense_Mutation_p.L310M|SLC8A1_uc002rsb.1_Missense_Mutation_p.L310M|SLC8A1_uc010fan.1_Missense_Mutation_p.L310M|SLC8A1_uc002rsc.1_Missense_Mutation_p.L310M	p.L310M	NM_021097	NP_066920	P32418	NAC1_HUMAN			1	952	-			310			Cytoplasmic (Potential).		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	c.928C>A	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	G	8.714	0.912730	0.17907	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.29397	1.58;1.61;1.62;1.61;1.58;1.58;1.62;1.57;1.58;1.59	5.96	4.14	0.48551	Heat shock protein DnaJ, N-terminal (1);	0.066434	0.64402	D	0.000007	T	0.36303	0.0962	N	0.19112	0.55	0.58432	D	0.999999	P;D;P;P;P	0.76494	0.88;0.999;0.584;0.563;0.627	P;D;P;B;B	0.87578	0.806;0.998;0.647;0.233;0.348	T	0.09662	-1.0664	10	0.33940	T	0.23	.	10.3701	0.44049	0.1641:0.0:0.8359:0.0	.	310;310;310;310;310	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	M	310	ENSP00000383886:L310M;ENSP00000440727:L310M;ENSP00000384763:L310M;ENSP00000385678:L310M;ENSP00000385188:L310M;ENSP00000385535:L310M;ENSP00000332931:L310M;ENSP00000384908:L310M;ENSP00000385811:L310M;ENSP00000443515:L310M	ENSP00000332931:L310M	L	-	1	2	SLC8A1	40509997	0.984000	0.35163	1.000000	0.80357	0.998000	0.95712	1.144000	0.31565	1.507000	0.48752	0.655000	0.94253	CTG		0.423	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097		28	160	1	0	2.08973e-25	0.005443	3.89227e-25	28	160				
SLC3A1	6519	broad.mit.edu	37	2	44508605	44508605	+	Silent	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:44508605A>G	ENST00000260649.6	+	3	766	c.690A>G	c.(688-690)acA>acG	p.T230T	SLC3A1_ENST00000409741.1_Silent_p.T230T|SLC3A1_ENST00000409387.1_Silent_p.T230T|SLC3A1_ENST00000409229.3_Silent_p.T230T|SLC3A1_ENST00000410056.3_Silent_p.T230T	NM_000341.3	NP_000332.2	Q07837	SLC31_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 1	230					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|basic amino acid transport (GO:0015802)|carbohydrate metabolic process (GO:0005975)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|vacuolar membrane (GO:0005774)	amino acid transmembrane transporter activity (GO:0015171)|basic amino acid transmembrane transporter activity (GO:0015174)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|L-cystine transmembrane transporter activity (GO:0015184)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(3)	26		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	GGACACGGACAGGAAAATATA	0.363																																							uc002ruc.3		NA																	0					0						c.(688-690)ACA>ACG		solute carrier family 3, member 1	L-Cystine(DB00138)						91.0	88.0	89.0					2																	44508605		2203	4300	6503	SO:0001819	synonymous_variant	6519				carbohydrate metabolic process|cellular amino acid metabolic process|ion transport	integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity|catalytic activity|cation binding|L-cystine transmembrane transporter activity	g.chr2:44508605A>G		CCDS1819.1	2p16.3	2013-07-19	2013-07-19		ENSG00000138079	ENSG00000138079		"""Solute carriers"""	11025	protein-coding gene	gene with protein product		104614	"""solute carrier family 3 (cystine, dibasic and neutral amino acid transporters, activator of cystine, dibasic and neutral amino acid transport), member 1"""			8486766, 9186880	Standard	NM_000341		Approved	CSNU1, D2H, RBAT, ATR1, NBAT	uc002ruc.4	Q07837	OTTHUMG00000128759	ENST00000260649.6:c.690A>G	2.37:g.44508605A>G						SLC3A1_uc002rty.2_Silent_p.T230T|SLC3A1_uc002rtz.2_Silent_p.T230T|SLC3A1_uc002rua.2_Silent_p.T230T|SLC3A1_uc002rub.2_Silent_p.T230T	p.T230T	NM_000341	NP_000332	Q07837	SLC31_HUMAN			3	768	+		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	230			Extracellular (Potential).		A8K0S1|O00658|Q15295|Q4J6B4|Q4J6B5|Q4J6B6|Q4J6B7|Q4J6B8|Q4J6B9|Q52M92|Q52M94	Silent	SNP	ENST00000260649.6	37	c.690A>G	CCDS1819.1																																																																																				0.363	SLC3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250676.1	NM_000341		10	22	0	0	0	0.008291	0	10	22				
FSHR	2492	broad.mit.edu	37	2	49210102	49210102	+	Missense_Mutation	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:49210102A>G	ENST00000406846.2	-	8	736	c.617T>C	c.(616-618)tTa>tCa	p.L206S	FSHR_ENST00000469138.1_5'UTR|FSHR_ENST00000304421.4_Missense_Mutation_p.L180S|FSHR_ENST00000346173.3_Missense_Mutation_p.L206S|FSHR_ENST00000541117.1_5'UTR	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	206					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	CAATTCTTCTAAATTATTATT	0.408									Gonadal Dysgenesis, 46 XX																														uc002rww.2		NA																	0				ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8						c.(616-618)TTA>TCA		follicle stimulating hormone receptor isoform 1	Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)						87.0	87.0	87.0					2																	49210102		2203	4300	6503	SO:0001583	missense	2492	Gonadal_Dysgenesis_46_XX	Familial Cancer Database		female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding	g.chr2:49210102A>G		CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.617T>C	2.37:g.49210102A>G	ENSP00000384708:p.Leu206Ser					FSHR_uc002rwx.2_Missense_Mutation_p.L206S|FSHR_uc010fbn.2_Missense_Mutation_p.L180S	p.L206S	NM_000145	NP_000136	P23945	FSHR_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		8	691	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	206			LRR 7.|Extracellular (Potential).		A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	ENST00000406846.2	37	c.617T>C	CCDS1843.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.009212	0.75046	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000454032	T;D;T;D	0.92752	-0.51;-3.1;-0.51;-3.1	5.53	5.53	0.82687	.	0.000000	0.64402	D	0.000001	D	0.97139	0.9065	H	0.95224	3.64	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.98047	1.0385	9	.	.	.	.	13.536	0.61646	1.0:0.0:0.0:0.0	.	180;206;206	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	S	206;206;180;206	ENSP00000384708:L206S;ENSP00000333908:L206S;ENSP00000306780:L180S;ENSP00000415504:L206S	.	L	-	2	0	FSHR	49063606	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.395000	0.73228	2.324000	0.78689	0.533000	0.62120	TTA		0.408	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2			10	27	0	0	0	0.006214	0	10	27				
NRXN1	9378	broad.mit.edu	37	2	50723093	50723093	+	Missense_Mutation	SNP	G	G	A	rs201070863		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:50723093G>A	ENST00000406316.2	-	15	4496	c.3020C>T	c.(3019-3021)aCa>aTa	p.T1007I	NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000406859.3_Missense_Mutation_p.T1007I|NRXN1_ENST00000402717.3_Missense_Mutation_p.T999I|NRXN1_ENST00000404971.1_Missense_Mutation_p.T1047I|NRXN1_ENST00000401669.2_Missense_Mutation_p.T1007I|NRXN1_ENST00000401710.1_Missense_Mutation_p.T16I|NRXN1_ENST00000405472.3_Missense_Mutation_p.T999I	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1007	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TGTGATTTTTGTGTCAATCTT	0.473																																							uc010fbq.2		NA																	0				ovary(2)	2						c.(3139-3141)ACA>ATA		neurexin 1 isoform alpha2 precursor							211.0	198.0	202.0					2																	50723093		2087	4222	6309	SO:0001583	missense	9378				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding	g.chr2:50723093G>A	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3020C>T	2.37:g.50723093G>A	ENSP00000384311:p.Thr1007Ile					NRXN1_uc002rxb.3_Missense_Mutation_p.T679I|NRXN1_uc002rxe.3_Missense_Mutation_p.T1007I|NRXN1_uc002rxc.1_RNA	p.T1047I	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)		15	4617	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	c.3140C>T	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.642752	0.87859	.	.	ENSG00000179915	ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T;T	0.79554	-1.28;-1.25;-1.25;-1.25;-1.25;-1.25;-1.25	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.89139	0.6630	M	0.69523	2.12	0.48762	D	0.999701	D;D;D	0.67145	0.962;0.991;0.996	P;P;D	0.70016	0.706;0.887;0.967	D	0.87259	0.2278	10	0.39692	T	0.17	.	19.9823	0.97331	0.0:0.0:1.0:0.0	.	1047;1007;999	Q9ULB1-3;F8WB18;A7E294	.;.;.	I	16;1047;1007;999;1007;1048;999;1007	ENSP00000385580:T16I;ENSP00000385142:T1047I;ENSP00000384311:T1007I;ENSP00000434015:T999I;ENSP00000385017:T1007I;ENSP00000385434:T999I;ENSP00000385681:T1007I	ENSP00000385017:T1007I	T	-	2	0	NRXN1	50576597	1.000000	0.71417	0.998000	0.56505	0.803000	0.45373	9.810000	0.99221	2.801000	0.96364	0.655000	0.94253	ACA		0.473	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2			7	36	0	0	0	0.001984	0	7	36				
COMMD1	150684	broad.mit.edu	37	2	62228008	62228008	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:62228008G>C	ENST00000311832.5	+	2	385	c.353G>C	c.(352-354)gGg>gCg	p.G118A	COMMD1_ENST00000538736.1_Missense_Mutation_p.G118A|COMMD1_ENST00000472729.1_3'UTR	NM_152516.2	NP_689729.1	Q8N668	COMD1_HUMAN	copper metabolism (Murr1) domain containing 1	118	COMM. {ECO:0000255|PROSITE- ProRule:PRU00602}.				copper ion homeostasis (GO:0055070)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of protein ubiquitination (GO:0031398)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			large_intestine(1)|liver(2)|lung(5)|ovary(1)	9	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;4.73e-07)|Epithelial(17;0.0216)|all cancers(80;0.0934)			TGGAATAGCGGGCTTCGGGGC	0.502																																							uc002sbp.2		NA																	0				ovary(1)	1						c.(352-354)GGG>GCG		MURR1							63.0	68.0	66.0					2																	62228008		2203	4300	6503	SO:0001583	missense	150684				copper ion homeostasis|negative regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|regulation of proteasomal ubiquitin-dependent protein catabolic process	cell junction|Cul2-RING ubiquitin ligase complex|cytoplasm|nucleolus	copper ion binding|protein homodimerization activity	g.chr2:62228008G>C	BC022046	CCDS1869.1	2p15	2004-03-02	2004-02-13	2004-02-18	ENSG00000173163	ENSG00000173163			23024	protein-coding gene	gene with protein product	"""copper metabolism gene MURR1"""	607238	"""chromosome 2 open reading frame 5 (MURR1)"""	C2orf5		9001233, 11809725	Standard	NM_152516		Approved	MURR1, MGC27155	uc002sbp.3	Q8N668	OTTHUMG00000129445	ENST00000311832.5:c.353G>C	2.37:g.62228008G>C	ENSP00000308236:p.Gly118Ala					COMMD1_uc002sbq.1_RNA	p.G118A	NM_152516	NP_689729	Q8N668	COMD1_HUMAN	LUSC - Lung squamous cell carcinoma(7;4.73e-07)|Epithelial(17;0.0216)|all cancers(80;0.0934)		2	364	+	Lung NSC(7;0.035)|all_lung(7;0.0691)		118			COMM.		B4DFQ4|Q96GS0	Missense_Mutation	SNP	ENST00000311832.5	37	c.353G>C	CCDS1869.1	.	.	.	.	.	.	.	.	.	.	G	6.198	0.404735	0.11754	.	.	ENSG00000173163	ENST00000311832;ENST00000538736	T;T	0.08984	3.03;3.03	5.88	3.99	0.46301	COMM domain (1);	0.776505	0.12995	N	0.422110	T	0.04679	0.0127	N	0.22421	0.69	0.09310	N	1	B	0.17038	0.02	B	0.17979	0.02	T	0.44406	-0.9330	10	0.11794	T	0.64	.	2.5575	0.04764	0.1555:0.2336:0.4747:0.1362	.	118	Q8N668	COMD1_HUMAN	A	118	ENSP00000308236:G118A;ENSP00000438961:G118A	ENSP00000308236:G118A	G	+	2	0	COMMD1	62081512	0.960000	0.32886	0.328000	0.25416	0.931000	0.56810	1.568000	0.36418	1.514000	0.48869	0.460000	0.39030	GGG		0.502	COMMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251607.2	NM_152516		16	49	0	0	0	0.004007	0	16	49				
OTX1	5013	broad.mit.edu	37	2	63283419	63283419	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:63283419G>A	ENST00000282549.2	+	5	1309	c.1033G>A	c.(1033-1035)Gac>Aac	p.D345N	OTX1_ENST00000366671.3_Missense_Mutation_p.D345N	NM_014562.3	NP_055377.1	P32242	OTX1_HUMAN	orthodenticle homeobox 1	345					anterior/posterior pattern specification (GO:0009952)|diencephalon morphogenesis (GO:0048852)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Lung NSC(7;0.121)|all_lung(7;0.211)					GGACTATAAGGACCAAGCCTC	0.577																																							uc002scd.2		NA																	0				pancreas(2)	2						c.(1033-1035)GAC>AAC		orthodenticle homeobox 1							49.0	50.0	50.0					2																	63283419		2203	4300	6503	SO:0001583	missense	5013					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:63283419G>A		CCDS1873.1	2p15	2011-06-20	2007-02-15		ENSG00000115507	ENSG00000115507		"""Homeoboxes / PRD class"""	8521	protein-coding gene	gene with protein product		600036	"""orthodenticle (Drosophila) homolog 1"", ""orthodenticle homolog 1 (Drosophila)"""			7959790	Standard	NM_001199770		Approved		uc002scd.3	P32242	OTTHUMG00000129454	ENST00000282549.2:c.1033G>A	2.37:g.63283419G>A	ENSP00000282549:p.Asp345Asn					OTX1_uc010ypt.1_Missense_Mutation_p.D279N	p.D345N	NM_014562	NP_055377	P32242	OTX1_HUMAN			5	1281	+	Lung NSC(7;0.121)|all_lung(7;0.211)		345					A6NHA2|B3KTJ4|Q53TG6	Missense_Mutation	SNP	ENST00000282549.2	37	c.1033G>A	CCDS1873.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.544053	0.86022	.	.	ENSG00000115507	ENST00000366671;ENST00000282549	D;D	0.94376	-3.41;-3.41	3.93	3.93	0.45458	.	0.110374	0.64402	D	0.000015	D	0.90566	0.7043	L	0.39898	1.24	0.80722	D	1	P	0.46784	0.884	B	0.43274	0.414	D	0.91972	0.5587	10	0.66056	D	0.02	.	15.2352	0.73422	0.0:0.0:1.0:0.0	.	345	P32242	OTX1_HUMAN	N	345	ENSP00000355631:D345N;ENSP00000282549:D345N	ENSP00000282549:D345N	D	+	1	0	OTX1	63136923	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.551000	0.98112	2.179000	0.69175	0.561000	0.74099	GAC		0.577	OTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251617.1			8	61	0	0	0	0.004482	0	8	61				
SPRED2	200734	broad.mit.edu	37	2	65540999	65540999	+	Missense_Mutation	SNP	C	C	T	rs375121510		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:65540999C>T	ENST00000356388.4	-	6	1082	c.893G>A	c.(892-894)cGg>cAg	p.R298Q	SPRED2_ENST00000474228.1_5'Flank|SPRED2_ENST00000443619.2_Missense_Mutation_p.R295Q	NM_181784.2	NP_861449.2	Q7Z698	SPRE2_HUMAN	sprouty-related, EVH1 domain containing 2	298					inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(7)|ovary(2)|upper_aerodigestive_tract(3)	34						CTTCCGCCGCCGCGACTTGCC	0.682																																							uc002sdr.3		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(892-894)CGG>CAG		sprouty-related protein with EVH-1 domain 2		C	GLN/ARG,GLN/ARG	0,4404		0,0,2202	45.0	51.0	49.0		884,893	4.9	1.0	2		49	1,8593		0,1,4296	no	missense,missense	SPRED2	NM_001128210.1,NM_181784.2	43,43	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	295/416,298/419	65540999	1,12997	2202	4297	6499	SO:0001583	missense	200734				inactivation of MAPK activity|multicellular organismal development	transport vesicle membrane	stem cell factor receptor binding	g.chr2:65540999C>T	AF052178	CCDS33211.1, CCDS46308.1	2p14	2003-06-02			ENSG00000198369	ENSG00000198369			17722	protein-coding gene	gene with protein product		609292					Standard	NM_181784		Approved	Spred-2, FLJ21897, FLJ31917	uc002sdr.4	Q7Z698	OTTHUMG00000152737	ENST00000356388.4:c.893G>A	2.37:g.65540999C>T	ENSP00000348753:p.Arg298Gln					SPRED2_uc010fcw.2_Missense_Mutation_p.R295Q	p.R298Q	NM_181784	NP_861449	Q7Z698	SPRE2_HUMAN			6	1428	-			298					A1L3V4|B7Z5K7|D6W5F7|E9PEP0|Q2NKX6	Missense_Mutation	SNP	ENST00000356388.4	37	c.893G>A	CCDS33211.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.462853	0.63513	0.0	1.16E-4	ENSG00000198369	ENST00000356388;ENST00000443619;ENST00000452315;ENST00000421087	T;T;T;T	0.77229	-1.07;-1.07;-1.08;-0.08	5.75	4.88	0.63580	.	0.148926	0.42682	D	0.000674	T	0.74642	0.3743	M	0.67953	2.075	0.38505	D	0.948332	D;P	0.53885	0.963;0.824	B;B	0.38683	0.279;0.06	T	0.80585	-0.1317	10	0.66056	D	0.02	-7.7619	14.8881	0.70584	0.0:0.9313:0.0:0.0687	.	295;298	E9PEP0;Q7Z698	.;SPRE2_HUMAN	Q	298;295;313;180	ENSP00000348753:R298Q;ENSP00000393697:R295Q;ENSP00000390595:R313Q;ENSP00000407627:R180Q	ENSP00000348753:R298Q	R	-	2	0	SPRED2	65394503	1.000000	0.71417	0.966000	0.40874	0.932000	0.56968	3.292000	0.51772	1.438000	0.47492	0.655000	0.94253	CGG		0.682	SPRED2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000327632.1			30	127	0	0	0	0.003271	0	30	127				
DUSP11	8446	broad.mit.edu	37	2	74007070	74007070	+	Nonsense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:74007070C>T	ENST00000272444.3	-	1	214	c.173G>A	c.(172-174)tGg>tAg	p.W58*	DUSP11_ENST00000480948.1_5'Flank|DUSP11_ENST00000377706.4_Nonsense_Mutation_p.W11*|DUSP11_ENST00000443070.1_Nonsense_Mutation_p.W58*	NM_003584.2	NP_003575.2	O75319	DUS11_HUMAN	dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)	11					peptidyl-tyrosine dephosphorylation (GO:0035335)|polynucleotide 5' dephosphorylation (GO:0098507)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|phosphatase activity (GO:0016791)|poly(A) RNA binding (GO:0044822)|polynucleotide 5'-phosphatase activity (GO:0004651)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|skin(1)	12						TCTCCGGCCCCAGCCACTGCG	0.622											OREG0014714	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc002sjp.2		NA																	0				skin(1)	1						c.(172-174)TGG>TAG		dual specificity phosphatase 11							80.0	74.0	76.0					2																	74007070		2203	4300	6503	SO:0001587	stop_gained	8446				RNA processing	nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity|RNA binding	g.chr2:74007070C>T	AF023917	CCDS1928.2	2p13.1	2011-06-09			ENSG00000144048	ENSG00000144048		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3066	protein-coding gene	gene with protein product		603092				9685386	Standard	NM_003584		Approved	PIR1	uc002sjp.3	O75319	OTTHUMG00000129816	ENST00000272444.3:c.173G>A	2.37:g.74007070C>T	ENSP00000272444:p.Trp58*		OREG0014714	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1149	DUSP11_uc002sjq.3_Nonsense_Mutation_p.W58*	p.W58*	NM_003584	NP_003575	O75319	DUS11_HUMAN			1	215	-			11					B2RCT8|Q6AI47|Q9BWE3	Nonsense_Mutation	SNP	ENST00000272444.3	37	c.173G>A	CCDS1928.2	.	.	.	.	.	.	.	.	.	.	C	33	5.256270	0.95336	.	.	ENSG00000144048	ENST00000272444;ENST00000443070;ENST00000377706;ENST00000452812	.	.	.	4.6	4.6	0.57074	.	1.518080	0.03679	N	0.245268	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0805	13.2135	0.59839	0.0:1.0:0.0:0.0	.	.	.	.	X	58;58;11;9	.	ENSP00000272444:W58X	W	-	2	0	DUSP11	73860578	0.020000	0.18652	0.018000	0.16275	0.153000	0.21895	2.953000	0.49105	2.834000	0.97654	0.655000	0.94253	TGG		0.622	DUSP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252047.3			17	79	0	0	0	0.00499	0	17	79				
MOGS	7841	broad.mit.edu	37	2	74689757	74689757	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:74689757C>T	ENST00000233616.4	-	4	1321	c.1159G>A	c.(1159-1161)Gag>Aag	p.E387K	MOGS_ENST00000452063.2_Missense_Mutation_p.E281K|MOGS_ENST00000409065.1_3'UTR|MOGS_ENST00000462443.1_5'Flank	NM_006302.2	NP_006293.2	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase	387					cellular protein metabolic process (GO:0044267)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosidase activity (GO:0015926)|mannosyl-oligosaccharide glucosidase activity (GO:0004573)			cervix(1)|endometrium(6)|large_intestine(3)|lung(10)|prostate(1)|urinary_tract(2)	23						AAAACCTGCTCGCCAGAGCTC	0.587																																							uc010ffj.2		NA																	0					0						c.(1159-1161)GAG>AAG		mannosyl-oligosaccharide glucosidase isoform 1							103.0	111.0	108.0					2																	74689757		1916	4126	6042	SO:0001583	missense	7841				oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|membrane fraction	mannosyl-oligosaccharide glucosidase activity	g.chr2:74689757C>T	X87237	CCDS42700.1, CCDS54370.1	2p13.1	2012-01-31			ENSG00000115275	ENSG00000115275	3.2.1.106		24862	protein-coding gene	gene with protein product	"""glucosidase I"", ""processing A-glucosidase I"""	601336				7635146, 8786151	Standard	NM_006302		Approved	GCS1, CWH41, DER7	uc010ffj.3	Q13724	OTTHUMG00000152886	ENST00000233616.4:c.1159G>A	2.37:g.74689757C>T	ENSP00000233616:p.Glu387Lys					MOGS_uc010ffh.2_Missense_Mutation_p.E112K|MOGS_uc010yrt.1_Missense_Mutation_p.E268K|MOGS_uc010ffi.2_Missense_Mutation_p.E281K	p.E387K	NM_006302	NP_006293	Q13724	MOGS_HUMAN			4	1322	-			387			Lumenal (Potential).		A8K938|F5H6D0|Q17RN9|Q8TCT5	Missense_Mutation	SNP	ENST00000233616.4	37	c.1159G>A	CCDS42700.1	.	.	.	.	.	.	.	.	.	.	C	14.13	2.442166	0.43326	.	.	ENSG00000115275	ENST00000233616;ENST00000452063;ENST00000448666	T;T;T	0.37752	1.18;1.18;1.18	4.73	4.73	0.59995	.	0.127219	0.52532	D	0.000066	T	0.26048	0.0635	L	0.35593	1.075	0.80722	D	1	D	0.57899	0.981	B	0.41466	0.358	T	0.01725	-1.1287	10	0.27785	T	0.31	-20.1181	11.0114	0.47665	0.0:0.8117:0.1883:0.0	.	387	Q13724	MOGS_HUMAN	K	387;281;281	ENSP00000233616:E387K;ENSP00000388201:E281K;ENSP00000410992:E281K	ENSP00000233616:E387K	E	-	1	0	MOGS	74543265	0.240000	0.23847	0.972000	0.41901	0.913000	0.54294	0.561000	0.23515	2.458000	0.83093	0.655000	0.94253	GAG		0.587	MOGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328382.1	NM_006302		27	177	0	0	0	0.005443	0	27	177				
RETSAT	54884	broad.mit.edu	37	2	85576626	85576626	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:85576626C>A	ENST00000295802.4	-	5	990	c.878G>T	c.(877-879)cGa>cTa	p.R293L	RETSAT_ENST00000263854.6_Missense_Mutation_p.R293L|RETSAT_ENST00000457495.2_Missense_Mutation_p.R232L	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	293					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	GGAACCCCCTCGGGGATAAAA	0.577																																							uc002spd.2		NA																	0				ovary(2)	2						c.(877-879)CGA>CTA		all-trans-13,14-dihydroretinol saturase	Vitamin A(DB00162)						88.0	83.0	85.0					2																	85576626		2203	4300	6503	SO:0001583	missense	54884				retinol metabolic process	endoplasmic reticulum membrane|nuclear outer membrane	all-trans-retinol 13,14-reductase activity|electron carrier activity	g.chr2:85576626C>A	AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.878G>T	2.37:g.85576626C>A	ENSP00000295802:p.Arg293Leu					RETSAT_uc010fge.2_RNA|RETSAT_uc010ysm.1_Missense_Mutation_p.R232L|RETSAT_uc010fgf.2_Missense_Mutation_p.R84L	p.R293L	NM_017750	NP_060220	Q6NUM9	RETST_HUMAN			5	1069	-			293					A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Missense_Mutation	SNP	ENST00000295802.4	37	c.878G>T	CCDS1972.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.82|13.82	2.350134|2.350134	0.41599|0.41599	.|.	.|.	ENSG00000042445|ENSG00000042445	ENST00000449375;ENST00000409984|ENST00000295802;ENST00000263854;ENST00000457495	.|T;T;T	.|0.59083	.|0.29;0.29;0.29	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	.|0.293306	.|0.32884	.|N	.|0.005530	.|T	.|0.58963	.|0.2159	M|M	0.69248|0.69248	2.105|2.105	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.26577	.|0.153;0.153;0.053	.|B;B;B	.|0.28139	.|0.086;0.086;0.018	.|T	.|0.54450	.|-0.8292	.|10	.|0.42905	.|T	.|0.14	-1.6789|-1.6789	16.7537|16.7537	0.85493|0.85493	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|232;232;293	.|G5E9N3;B4DKE1;Q6NUM9	.|.;.;RETST_HUMAN	X|L	82;232|293;293;232	.|ENSP00000295802:R293L;ENSP00000263854:R293L;ENSP00000405040:R232L	.|ENSP00000263854:R293L	E|R	-|-	1|2	0|0	RETSAT|RETSAT	85430137|85430137	0.033000|0.033000	0.19621|0.19621	0.997000|0.997000	0.53966|0.53966	0.984000|0.984000	0.73092|0.73092	1.172000|1.172000	0.31908|0.31908	2.559000|2.559000	0.86315|0.86315	0.563000|0.563000	0.77884|0.77884	GAG|CGA		0.577	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252489.1	NM_017750		14	67	1	0	3.27435e-08	0.00245	4.48551e-08	14	67				
THNSL2	55258	broad.mit.edu	37	2	88474273	88474273	+	Missense_Mutation	SNP	G	G	T	rs149024211	byFrequency	TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:88474273G>T	ENST00000324166.5	+	2	2030	c.339G>T	c.(337-339)aaG>aaT	p.K113N	THNSL2_ENST00000402102.1_Missense_Mutation_p.K113N|THNSL2_ENST00000343544.4_Missense_Mutation_p.K113N|THNSL2_ENST00000377254.3_Missense_Mutation_p.K113N|THNSL2_ENST00000449349.1_Missense_Mutation_p.K81N|THNSL2_ENST00000358591.2_Missense_Mutation_p.K113N	NM_018271.4	NP_060741.3	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2 (S. cerevisiae)	113					2-oxobutyrate biosynthetic process (GO:0046360)|dephosphorylation (GO:0016311)|serine family amino acid catabolic process (GO:0009071)	extracellular space (GO:0005615)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|serine binding (GO:0070905)			breast(4)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	27						ATGCATTTAAGGACCTGTCCC	0.522													G|||	5	0.000998403	0.003	0.0014	5008	,	,		22450	0.0		0.0	False		,,,				2504	0.0						uc002ssz.3		NA																	0				ovary(1)	1						c.(337-339)AAG>AAT		threonine synthase-like 2		G	ASN/LYS	3,4403	6.2+/-15.9	0,3,2200	242.0	178.0	199.0		339	3.7	1.0	2	dbSNP_134	199	0,8600		0,0,4300	yes	missense	THNSL2	NM_018271.4	94	0,3,6500	TT,TG,GG		0.0,0.0681,0.0231	probably-damaging	113/485	88474273	3,13003	2203	4300	6503	SO:0001583	missense	55258				threonine biosynthetic process		threonine synthase activity	g.chr2:88474273G>T		CCDS2002.2, CCDS58718.1, CCDS74539.1	2p11.2	2007-06-20			ENSG00000144115	ENSG00000144115			25602	protein-coding gene	gene with protein product		611261				17034760	Standard	NM_018271		Approved	FLJ10916	uc021vkr.1	Q86YJ6	OTTHUMG00000130314	ENST00000324166.5:c.339G>T	2.37:g.88474273G>T	ENSP00000327323:p.Lys113Asn					THNSL2_uc002ssv.2_RNA|THNSL2_uc002ssw.3_Missense_Mutation_p.K113N|THNSL2_uc002ssx.3_Missense_Mutation_p.K81N|THNSL2_uc002sta.3_Intron|THNSL2_uc002ssy.3_Missense_Mutation_p.K113N|THNSL2_uc010fhe.2_Translation_Start_Site	p.K113N	NM_018271	NP_060741	Q86YJ6	THNS2_HUMAN			3	492	+			113					B3KTB1|B5MDX8|B7WPF8|D9ZZB8|Q6P2M7|Q6PI27|Q9NV54	Missense_Mutation	SNP	ENST00000324166.5	37	c.339G>T	CCDS2002.2	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	20.2	3.955604	0.73902	6.81E-4	0.0	ENSG00000144115	ENST00000358591;ENST00000377254;ENST00000402102;ENST00000419759;ENST00000449349;ENST00000343544;ENST00000324166	D;D;D;T;D;D;D	0.99711	-6.49;-6.49;-6.49;0.93;-6.49;-6.49;-6.49	5.63	3.71	0.42584	Threonine synthase (1);Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.000000	0.85682	D	0.000000	D	0.99789	0.9911	H	0.97896	4.1	0.52099	D	0.999941	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98012	1.0366	10	0.87932	D	0	.	8.0758	0.30716	0.2645:0.0:0.7355:0.0	.	113;81;113	Q86YJ6;C9JU10;Q86YJ6-2	THNS2_HUMAN;.;.	N	113;113;113;113;81;113;113	ENSP00000351402:K113N;ENSP00000366464:K113N;ENSP00000384475:K113N;ENSP00000391300:K113N;ENSP00000407553:K81N;ENSP00000339563:K113N;ENSP00000327323:K113N	ENSP00000327323:K113N	K	+	3	2	THNSL2	88255388	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.086000	0.50159	0.634000	0.30469	-0.258000	0.10820	AAG		0.522	THNSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252662.1	NM_018271		21	80	1	0	4.35082e-09	0.010504	6.20016e-09	21	80				
CNGA3	1261	broad.mit.edu	37	2	99013028	99013028	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:99013028G>T	ENST00000272602.2	+	7	1434	c.1395G>T	c.(1393-1395)aaG>aaT	p.K465N	CNGA3_ENST00000436404.2_Missense_Mutation_p.K447N|CNGA3_ENST00000393504.1_Missense_Mutation_p.K465N|CNGA3_ENST00000409937.1_Missense_Mutation_p.K469N			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	465					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						ACAAGCTGAAGGCTGAGATCG	0.577																																							uc002syt.2		NA																	0				ovary(5)|upper_aerodigestive_tract(1)	6						c.(1393-1395)AAG>AAT		cyclic nucleotide gated channel alpha 3 isoform							64.0	58.0	60.0					2																	99013028		2203	4300	6503	SO:0001583	missense	1261				signal transduction|visual perception	integral to membrane	cGMP binding	g.chr2:99013028G>T	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1395G>T	2.37:g.99013028G>T	ENSP00000272602:p.Lys465Asn					CNGA3_uc002syu.2_Missense_Mutation_p.K447N|CNGA3_uc010fij.2_Missense_Mutation_p.K469N	p.K465N	NM_001298	NP_001289	Q16281	CNGA3_HUMAN			8	1812	+			465					E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	37	c.1395G>T	CCDS2034.1	.	.	.	.	.	.	.	.	.	.	G	13.97	2.396154	0.42512	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.97328	-4.34;-4.34;-4.34;-4.34	4.92	3.13	0.36017	Cyclic nucleotide-binding-like (1);	0.046101	0.85682	D	0.000000	D	0.97324	0.9125	M	0.90252	3.1	0.58432	D	0.999999	P;P;D	0.53312	0.458;0.458;0.959	B;B;P	0.48524	0.313;0.23;0.58	D	0.96379	0.9280	10	0.87932	D	0	.	10.1813	0.42970	0.164:0.0:0.836:0.0	.	469;447;465	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	N	465;447;465;469	ENSP00000377140:K465N;ENSP00000410070:K447N;ENSP00000272602:K465N;ENSP00000386761:K469N	ENSP00000272602:K465N	K	+	3	2	CNGA3	98379460	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.026000	0.41069	0.693000	0.31634	0.558000	0.71614	AAG		0.577	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298		14	32	1	0	9.31168e-06	0.001855	1.11705e-05	14	32				
NPAS2	4862	broad.mit.edu	37	2	101591311	101591311	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:101591311A>T	ENST00000335681.5	+	13	1472	c.1187A>T	c.(1186-1188)gAc>gTc	p.D396V	AC016738.3_ENST00000433012.1_RNA|NPAS2_ENST00000542504.1_Missense_Mutation_p.D461V|AC016738.3_ENST00000446644.1_RNA|AC016738.3_ENST00000439150.1_RNA	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	396					cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AACACACTCGACGTGGGTGCC	0.527																																							uc002tap.1		NA																	0				ovary(3)|upper_aerodigestive_tract(1)	4						c.(1186-1188)GAC>GTC		neuronal PAS domain protein 2							100.0	87.0	91.0					2																	101591311		2203	4300	6503	SO:0001583	missense	4862				central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity	g.chr2:101591311A>T	U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.1187A>T	2.37:g.101591311A>T	ENSP00000338283:p.Asp396Val					NPAS2_uc010yvt.1_Missense_Mutation_p.D461V|NPAS2_uc010fit.1_5'UTR	p.D396V	NM_002518	NP_002509	Q99743	NPAS2_HUMAN			13	1473	+			396					Q4ZFV9|Q53SQ3|Q86V96|Q99629	Missense_Mutation	SNP	ENST00000335681.5	37	c.1187A>T	CCDS2048.1	.	.	.	.	.	.	.	.	.	.	A	10.56	1.384142	0.25031	.	.	ENSG00000170485	ENST00000335681;ENST00000542504	T;T	0.05996	3.38;3.36	6.17	6.17	0.99709	.	0.389995	0.31601	N	0.007361	T	0.12603	0.0306	L	0.56769	1.78	0.52099	D	0.99994	P;P	0.39940	0.696;0.57	B;B	0.43838	0.433;0.184	T	0.00706	-1.1601	10	0.49607	T	0.09	.	15.3933	0.74767	1.0:0.0:0.0:0.0	.	461;396	F5H027;Q99743	.;NPAS2_HUMAN	V	396;461	ENSP00000338283:D396V;ENSP00000438428:D461V	ENSP00000338283:D396V	D	+	2	0	NPAS2	100957743	0.998000	0.40836	0.085000	0.20634	0.053000	0.15095	4.243000	0.58721	2.371000	0.80710	0.533000	0.62120	GAC		0.527	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253168.3			7	53	0	0	0	0.001984	0	7	53				
MAP4K4	9448	broad.mit.edu	37	2	102476325	102476325	+	Splice_Site	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:102476325A>T	ENST00000347699.4	+	15	1703	c.1703A>T	c.(1702-1704)gAg>gTg	p.E568V	MAP4K4_ENST00000350198.4_Splice_Site_p.E537V|MAP4K4_ENST00000324219.4_Splice_Site_p.E568V|MAP4K4_ENST00000425019.1_Splice_Site_p.E537V|MAP4K4_ENST00000302217.5_Splice_Site_p.E421V|MAP4K4_ENST00000413150.2_Splice_Site_p.E537V|MAP4K4_ENST00000456652.1_Splice_Site_p.E421V|MAP4K4_ENST00000350878.4_Splice_Site_p.E517V	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	568					intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CGAGCGCGAGAGGTATCCTCT	0.542																																							uc002tbg.2		NA																	0				stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						c.(1702-1704)GAG>GTG		mitogen-activated protein kinase kinase kinase							20.0	25.0	23.0					2																	102476325		2096	4229	6325	SO:0001630	splice_region_variant	9448				intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity	g.chr2:102476325A>T	AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.1704+1A>T	2.37:g.102476325A>T						MAP4K4_uc002tbc.2_Missense_Mutation_p.E568V|MAP4K4_uc002tbd.2_Missense_Mutation_p.E537V|MAP4K4_uc002tbe.2_Missense_Mutation_p.E537V|MAP4K4_uc002tbf.2_Missense_Mutation_p.E537V|MAP4K4_uc010yvy.1_Missense_Mutation_p.E537V|MAP4K4_uc002tbh.2_Missense_Mutation_p.E537V|MAP4K4_uc002tbi.2_Missense_Mutation_p.E421V|MAP4K4_uc010yvz.1_Missense_Mutation_p.E517V|MAP4K4_uc002tbk.2_Missense_Mutation_p.E77V|MAP4K4_uc002tbj.1_Missense_Mutation_p.E433V	p.E568V	NM_145687	NP_663720	O95819	M4K4_HUMAN			15	1758	+			568					O75172|Q9NST7	Missense_Mutation	SNP	ENST00000347699.4	37	c.1703A>T	CCDS56130.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.60|12.60	1.986901|1.986901	0.35036|0.35036	.|.	.|.	ENSG00000071054|ENSG00000071054	ENST00000425019;ENST00000324219;ENST00000350198;ENST00000302217;ENST00000413150;ENST00000456652;ENST00000347699;ENST00000417294;ENST00000350878;ENST00000418101|ENST00000421882	T;T;T;T;T;T;T;T;T;T|T	0.64803|0.54479	-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12|0.57	6.08|6.08	6.08|6.08	0.98989|0.98989	.|.	0.165528|.	0.51477|.	D|.	0.000082|.	T|T	0.61451|0.61451	0.2348|0.2348	L|L	0.54323|0.54323	1.7|1.7	0.27703|0.27703	N|N	0.945724|0.945724	B;B;B;B;B;P;B;D;P;D;P|.	0.67145|.	0.437;0.437;0.437;0.437;0.437;0.573;0.091;0.973;0.573;0.996;0.527|.	B;B;B;B;B;B;B;P;B;D;B|.	0.77557|.	0.115;0.115;0.115;0.115;0.115;0.23;0.038;0.885;0.23;0.99;0.146|.	T|T	0.58375|0.58375	-0.7647|-0.7647	10|7	0.33940|0.44086	T|T	0.23|0.13	.|.	16.6512|16.6512	0.85203|0.85203	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	517;537;421;517;421;537;568;537;537;537;568|.	B7Z388;B7Z3V5;E7EX83;E7ESS2;C9J840;O95819-4;O95819;E7EN19;G3XAA2;O95819-2;G5E948|.	.;.;.;.;.;.;M4K4_HUMAN;.;.;.;.|.	V|S	537;568;537;421;537;421;568;499;517;157|307	ENSP00000392830:E537V;ENSP00000313644:E568V;ENSP00000281111:E537V;ENSP00000303600:E421V;ENSP00000389752:E537V;ENSP00000387370:E421V;ENSP00000314363:E568V;ENSP00000409720:E499V;ENSP00000343658:E517V;ENSP00000414766:E157V|ENSP00000396066:R307S	ENSP00000303600:E421V|ENSP00000396066:R307S	E|R	+|+	2|3	0|2	MAP4K4|MAP4K4	101842757|101842757	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.284000|0.284000	0.27059|0.27059	5.711000|5.711000	0.68400|0.68400	2.333000|2.333000	0.79357|0.79357	0.482000|0.482000	0.46254|0.46254	GAG|AGA		0.542	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339839.1	NM_004834	Missense_Mutation	3	12	0	0	0	0.004672	0	3	12				
ACOXL	55289	broad.mit.edu	37	2	111850528	111850528	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:111850528G>T	ENST00000389811.4	+	18	1841	c.1617G>T	c.(1615-1617)acG>acT	p.T539T	ACOXL_ENST00000439055.1_Silent_p.T509T			Q9NUZ1	ACOXL_HUMAN	acyl-CoA oxidase-like	539					fatty acid beta-oxidation (GO:0006635)	peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)			kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(1)	21						TGGCCAGCACGAGGATCAGGA	0.483																																							uc002tgr.3		NA																	0					0						c.(1615-1617)ACG>ACT		acyl-Coenzyme A oxidase-like 2							82.0	79.0	80.0					2																	111850528		2203	4300	6503	SO:0001819	synonymous_variant	55289				fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity	g.chr2:111850528G>T		CCDS46389.1	2q13	2010-06-30	2010-04-30		ENSG00000153093	ENSG00000153093			25621	protein-coding gene	gene with protein product			"""acyl-Coenzyme A oxidase-like"""				Standard	NM_001142807		Approved	FLJ11042	uc010yxk.1	Q9NUZ1	OTTHUMG00000131257	ENST00000389811.4:c.1617G>T	2.37:g.111850528G>T						ACOXL_uc010fkc.2_Silent_p.T509T|ACOXL_uc010yxk.1_Silent_p.T509T	p.T539T	NM_001105516	NP_001098986	Q9NUZ1	ACOXL_HUMAN			18	1841	+			539					A2RRB7|B7WPB3|B7WPP7|E9PB20|Q53R27|Q53R31|Q53SC6|Q8TCE7	Silent	SNP	ENST00000389811.4	37	c.1617G>T																																																																																					0.483	ACOXL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000254024.2	NM_018308		14	60	1	0	4.3838e-07	0.001855	5.7223e-07	14	60				
CNTNAP5	129684	broad.mit.edu	37	2	125521700	125521700	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:125521700G>T	ENST00000431078.1	+	16	2870	c.2506G>T	c.(2506-2508)Gac>Tac	p.D836Y		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	836	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TGGCATTAAAGACTTCATTCG	0.373																																							uc002tno.2		NA																	0				ovary(10)	10						c.(2506-2508)GAC>TAC		contactin associated protein-like 5 precursor							117.0	111.0	113.0					2																	125521700		1831	4074	5905	SO:0001583	missense	129684				cell adhesion|signal transduction	integral to membrane	receptor binding	g.chr2:125521700G>T	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2506G>T	2.37:g.125521700G>T	ENSP00000399013:p.Asp836Tyr					CNTNAP5_uc010flu.2_Missense_Mutation_p.D837Y	p.D836Y	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.248)	16	2870	+			836			Laminin G-like 3.|Extracellular (Potential).		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	c.2506G>T	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.537178	0.85812	.	.	ENSG00000155052	ENST00000431078	D	0.84370	-1.84	5.75	5.75	0.90469	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.250114	0.27113	N	0.020876	D	0.95503	0.8539	H	0.99026	4.405	0.80722	D	1	D	0.55172	0.97	P	0.59948	0.866	D	0.97083	0.9785	10	0.87932	D	0	.	18.9356	0.92584	0.0:0.0:1.0:0.0	.	836	Q8WYK1	CNTP5_HUMAN	Y	836	ENSP00000399013:D836Y	ENSP00000399013:D836Y	D	+	1	0	CNTNAP5	125238170	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.739000	0.84976	2.724000	0.93272	0.655000	0.94253	GAC		0.373	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3			16	68	1	0	1.02788e-11	0.00499	1.59309e-11	16	68				
MYO7B	4648	broad.mit.edu	37	2	128324281	128324281	+	Nonsense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:128324281G>T	ENST00000409816.2	+	4	381	c.349G>T	c.(349-351)Gag>Tag	p.E117*	MYO7B_ENST00000428314.1_Nonsense_Mutation_p.E117*|MYO7B_ENST00000389524.4_Nonsense_Mutation_p.E117*			Q6PIF6	MYO7B_HUMAN	myosin VIIB	117	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CTACACCCTGGAGCAGGTACA	0.592																																							uc002top.2		NA																	0				ovary(1)|pancreas(1)	2						c.(349-351)GAG>TAG		myosin VIIB							32.0	37.0	35.0					2																	128324281		2017	4160	6177	SO:0001587	stop_gained	4648					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity	g.chr2:128324281G>T		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.349G>T	2.37:g.128324281G>T	ENSP00000386461:p.Glu117*						p.E117*	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.0753)	5	402	+	Colorectal(110;0.1)		117			Myosin head-like.		Q14786|Q8TEE1	Nonsense_Mutation	SNP	ENST00000409816.2	37	c.349G>T	CCDS46405.1	.	.	.	.	.	.	.	.	.	.	G	38	6.726131	0.97792	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	.	.	.	5.55	5.55	0.83447	.	0.134561	0.49305	D	0.000149	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	19.5117	0.95144	0.0:0.0:1.0:0.0	.	.	.	.	X	117	.	ENSP00000374175:E117X	E	+	1	0	MYO7B	128040751	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	9.747000	0.98863	2.595000	0.87683	0.561000	0.74099	GAG		0.592	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001		6	20	1	0	0.00116845	0.001168	0.00128549	6	20				
NCKAP5	344148	broad.mit.edu	37	2	133541991	133541991	+	Missense_Mutation	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:133541991T>C	ENST00000409261.1	-	14	2766	c.2393A>G	c.(2392-2394)cAa>cGa	p.Q798R	NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.Q798R	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	798										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TGTCAGATTTTGCTTTTGATA	0.468																																							uc002ttp.2		NA																	0					0						c.(2392-2394)CAA>CGA		Nck-associated protein 5 isoform 1							157.0	157.0	157.0					2																	133541991		1862	4112	5974	SO:0001583	missense	344148						protein binding	g.chr2:133541991T>C	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2393A>G	2.37:g.133541991T>C	ENSP00000387128:p.Gln798Arg					NCKAP5_uc002ttq.2_Intron	p.Q798R	NM_207363	NP_997246	O14513	NCKP5_HUMAN			14	2767	-			798					B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	c.2393A>G	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	t	6.244	0.413233	0.11812	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.41400	1.0;1.0	4.97	2.48	0.30137	.	0.436713	0.16704	U	0.202995	T	0.22003	0.0530	L	0.29908	0.895	0.80722	D	1	B	0.33583	0.418	B	0.27796	0.083	T	0.05451	-1.0884	10	0.08381	T	0.77	.	6.0675	0.19871	0.1524:0.0:0.3577:0.4899	.	798	O14513	NCKP5_HUMAN	R	798	ENSP00000387128:Q798R;ENSP00000380603:Q798R	ENSP00000380603:Q798R	Q	-	2	0	NCKAP5	133258461	0.980000	0.34600	0.901000	0.35422	0.519000	0.34347	0.037000	0.13840	0.335000	0.23614	0.529000	0.55759	CAA		0.468	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481		36	162	0	0	0	0.003755	0	36	162				
KYNU	8942	broad.mit.edu	37	2	143715264	143715264	+	Silent	SNP	C	C	A	rs147103103	byFrequency	TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:143715264C>A	ENST00000264170.4	+	7	820	c.562C>A	c.(562-564)Cgg>Agg	p.R188R	KYNU_ENST00000375773.2_Silent_p.R188R|KYNU_ENST00000409512.1_Silent_p.R188R	NM_003937.2	NP_003928.1			kynureninase											large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		AGAAAGTATGCGGATGATAAA	0.308																																							uc002tvl.2		NA																	0				skin(2)	2						c.(562-564)CGG>AGG		kynureninase (L-kynurenine hydrolase) isoform a	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)						111.0	108.0	109.0					2																	143715264		2203	4299	6502	SO:0001819	synonymous_variant	8942				anthranilate metabolic process|NAD biosynthetic process|quinolinate biosynthetic process|response to interferon-gamma|response to vitamin B6	cytosol|mitochondrion|soluble fraction	kynureninase activity|protein homodimerization activity	g.chr2:143715264C>A	U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000264170.4:c.562C>A	2.37:g.143715264C>A						KYNU_uc002tvk.2_Silent_p.R188R|KYNU_uc010fnm.2_Silent_p.R188R	p.R188R	NM_003937	NP_003928	Q16719	KYNU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.072)	7	692	+			188						Silent	SNP	ENST00000264170.4	37	c.562C>A	CCDS2183.1																																																																																				0.308	KYNU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254772.1	NM_001032998		10	24	1	0	2.80697e-09	0.010729	4.01807e-09	10	24				
TTN	7273	broad.mit.edu	37	2	179446892	179446892	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:179446892G>T	ENST00000591111.1	-	265	61505	c.61281C>A	c.(61279-61281)acC>acA	p.T20427T	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Silent_p.T13128T|TTN_ENST00000460472.2_Silent_p.T13003T|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Silent_p.T13195T|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000589042.1_Silent_p.T22068T|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342992.6_Silent_p.T19500T|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA			Q8WZ42	TITIN_HUMAN	titin	20427	Fibronectin type-III 48. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTGATCTTTGGTTATGTTGC	0.433																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(58498-58500)ACC>ACA		titin isoform N2-A							79.0	77.0	78.0					2																	179446892		1875	4132	6007	SO:0001819	synonymous_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179446892G>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.61281C>A	2.37:g.179446892G>T						uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.T13195T|TTN_uc010zfi.1_Silent_p.T13128T|TTN_uc010zfj.1_Silent_p.T13003T	p.T19500T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		264	58724	-			20427					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37	c.58500C>A																																																																																					0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		15	93	1	0	3.27435e-08	0.00245	4.48551e-08	15	93				
TTN	7273	broad.mit.edu	37	2	179455328	179455328	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:179455328G>C	ENST00000591111.1	-	254	56425	c.56201C>G	c.(56200-56202)cCt>cGt	p.P18734R	TTN_ENST00000359218.5_Missense_Mutation_p.P11435R|TTN_ENST00000460472.2_Missense_Mutation_p.P11310R|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P11502R|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P20375R|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P17807R|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA			Q8WZ42	TITIN_HUMAN	titin	18734	Fibronectin type-III 36. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGATTAATAGGTGGTCCAGG	0.448																																							uc010zfg.1		NA																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(53419-53421)CCT>CGT		titin isoform N2-A							101.0	100.0	100.0					2																	179455328		1890	4111	6001	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179455328G>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.56201C>G	2.37:g.179455328G>C	ENSP00000465570:p.Pro18734Arg					uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P11502R|TTN_uc010zfi.1_Missense_Mutation_p.P11435R|TTN_uc010zfj.1_Missense_Mutation_p.P11310R	p.P17807R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		253	53644	-			18734					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.53420C>G		.	.	.	.	.	.	.	.	.	.	G	12.34	1.909729	0.33721	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61	6.11	6.11	0.99139	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.91106	0.7200	H	0.98111	4.15	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.93279	0.6658	9	0.87932	D	0	.	20.7342	0.99715	0.0:0.0:1.0:0.0	.	11310;11435;11502;18734	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	17807;11310;11502;11435;11308	ENSP00000343764:P17807R;ENSP00000434586:P11310R;ENSP00000340554:P11502R;ENSP00000352154:P11435R	ENSP00000340554:P11502R	P	-	2	0	TTN	179163574	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.970000	0.88000	2.906000	0.99361	0.655000	0.94253	CCT		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		19	113	0	0	0	0.012319	0	19	113				
ZNF804A	91752	broad.mit.edu	37	2	185800718	185800718	+	Nonsense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:185800718C>T	ENST00000302277.6	+	4	1189	c.595C>T	c.(595-597)Caa>Taa	p.Q199*		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	199							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AAAAAATAACCAAGTTGGGGA	0.398																																							uc002uph.2		NA																	0				ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						c.(595-597)CAA>TAA		zinc finger protein 804A							64.0	67.0	66.0					2																	185800718		2203	4299	6502	SO:0001587	stop_gained	91752					intracellular	zinc ion binding	g.chr2:185800718C>T	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.595C>T	2.37:g.185800718C>T	ENSP00000303252:p.Gln199*						p.Q199*	NM_194250	NP_919226	Q7Z570	Z804A_HUMAN			4	1189	+			199					A7E253|Q6ZN26	Nonsense_Mutation	SNP	ENST00000302277.6	37	c.595C>T	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	C	39	7.316618	0.98207	.	.	ENSG00000170396	ENST00000302277	.	.	.	5.32	3.31	0.37934	.	0.387187	0.21754	N	0.069635	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-9.4282	13.8155	0.63290	0.2283:0.7717:0.0:0.0	.	.	.	.	X	199	.	ENSP00000303252:Q199X	Q	+	1	0	ZNF804A	185508963	0.038000	0.19896	0.075000	0.20258	0.965000	0.64279	2.204000	0.42761	2.490000	0.84030	0.467000	0.42956	CAA		0.398	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250		5	53	0	0	0	0.000602	0	5	53				
PGAP1	80055	broad.mit.edu	37	2	197712671	197712671	+	Splice_Site	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:197712671C>A	ENST00000354764.4	-	21	2066	c.1952G>T	c.(1951-1953)gGg>gTg	p.G651V	PGAP1_ENST00000409475.1_3'UTR	NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	651					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)			breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						TAAAACTTACCCCAACAGAAA	0.294																																							uc002utw.2		NA																	0				ovary(3)|central_nervous_system(1)	4						c.(1951-1953)GGG>GTG		GPI deacylase							98.0	95.0	96.0					2																	197712671		2203	4295	6498	SO:0001630	splice_region_variant	80055				attachment of GPI anchor to protein|C-terminal protein lipidation|intracellular protein transport|myo-inositol transport	integral to membrane|intrinsic to endoplasmic reticulum membrane	nuclease activity|phosphoric ester hydrolase activity	g.chr2:197712671C>A		CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.1952+1G>T	2.37:g.197712671C>A						PGAP1_uc002utx.2_Missense_Mutation_p.G477V|PGAP1_uc002uty.1_3'UTR|PGAP1_uc010fsi.2_5'Flank	p.G651V	NM_024989	NP_079265	Q75T13	PGAP1_HUMAN			21	2066	-			651			Helical; (Potential).		Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	ENST00000354764.4	37	c.1952G>T	CCDS2318.1	.	.	.	.	.	.	.	.	.	.	C	17.66	3.443553	0.63067	.	.	ENSG00000197121	ENST00000354764	.	.	.	4.2	4.2	0.49525	.	0.212476	0.43579	D	0.000543	T	0.54711	0.1875	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	T	0.48387	-0.9040	9	0.25106	T	0.35	-6.1239	10.3971	0.44207	0.0:0.9099:0.0:0.0901	.	651	Q75T13	PGAP1_HUMAN	V	651	.	ENSP00000346809:G651V	G	-	2	0	PGAP1	197420916	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.611000	0.54132	2.162000	0.67917	0.655000	0.94253	GGG		0.294	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256103.5	NM_024989	Missense_Mutation	4	34	1	0	0.00909568	0.009096	0.00960854	4	34				
ANKRD44	91526	broad.mit.edu	37	2	197878371	197878372	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:197878371_197878372CC>AA	ENST00000328737.2	-	18	1788_1789	c.1712_1713GG>TT	c.(1711-1713)aGG>aTT	p.R571I	ANKRD44_ENST00000337207.5_Missense_Mutation_p.R571I|ANKRD44_ENST00000450567.1_Missense_Mutation_p.R571I|ANKRD44_ENST00000282272.8_Missense_Mutation_p.R588I			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	596								p.R411M(1)|p.R571M(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CTTTCTCATCCCTGATGTCCAG	0.52																																							uc002uua.1		NA																	2	Substitution - Missense(2)		lung(2)	ovary(4)|skin(1)	5						c.(1711-1713)AGG>ATT		ankyrin repeat domain 44																																				SO:0001583	missense	91526						protein binding	g.chr2:197878371_197878372CC>AA	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.1712_1713delinsAA	2.37:g.197878371_197878372delinsAA	ENSP00000331516:p.Arg571Ile					ANKRD44_uc002utz.3_Missense_Mutation_p.R303I	p.R571I	NM_153697	NP_710181	Q8N8A2	ANR44_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.246)		18	1789_1790	-			596					Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Missense_Mutation	DNP	ENST00000328737.2	37	c.1712_1713GG>TT																																																																																					0.520	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697		32	200	0	0	0	0.004672	0	32	200				
SF3B1	23451	broad.mit.edu	37	2	198274687	198274687	+	Silent	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:198274687A>G	ENST00000335508.6	-	7	802	c.711T>C	c.(709-711)ggT>ggC	p.G237G		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	237	Interaction with PPP1R8.|U2AF homology region; mediates interaction with RMB39.				anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CCTTTGCACGACCTGGTGTCT	0.473			Mis		myelodysplastic syndrome																																		uc002uue.2		NA		Dom	yes		2	2q33.1	23451		"""splicing factor 3b, subunit 1, 155kDa"""			L					0				pancreas(3)|ovary(1)|breast(1)|skin(1)	6						c.(709-711)GGT>GGC		splicing factor 3b, subunit 1 isoform 1							105.0	99.0	101.0					2																	198274687		2203	4300	6503	SO:0001819	synonymous_variant	23451				nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding	g.chr2:198274687A>G	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.711T>C	2.37:g.198274687A>G							p.G237G	NM_012433	NP_036565	O75533	SF3B1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.246)		7	759	-			237			Interaction with PPP1R8.		E9PCH3	Silent	SNP	ENST00000335508.6	37	c.711T>C	CCDS33356.1																																																																																				0.473	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2			18	69	0	0	0	0.006122	0	18	69				
ZDBF2	57683	broad.mit.edu	37	2	207174855	207174855	+	Missense_Mutation	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:207174855T>C	ENST00000374423.3	+	5	5989	c.5603T>C	c.(5602-5604)gTt>gCt	p.V1868A		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1868							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						ACCAAAAAAGTTTCTTCGAAG	0.413																																							uc002vbp.2		NA																	0				ovary(3)	3						c.(5602-5604)GTT>GCT		zinc finger, DBF-type containing 2							66.0	63.0	64.0					2																	207174855		1895	4120	6015	SO:0001583	missense	57683						nucleic acid binding|zinc ion binding	g.chr2:207174855T>C	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.5603T>C	2.37:g.207174855T>C	ENSP00000363545:p.Val1868Ala						p.V1868A	NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN			5	5853	+			1868					Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	c.5603T>C	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	T	13.44	2.237483	0.39498	.	.	ENSG00000204186	ENST00000374423	T	0.46063	0.88	5.48	-5.05	0.02955	.	.	.	.	.	T	0.20536	0.0494	N	0.22421	0.69	0.09310	N	1	B	0.22276	0.067	B	0.19148	0.024	T	0.24476	-1.0159	9	0.46703	T	0.11	.	1.3099	0.02095	0.3456:0.0966:0.2967:0.2611	.	1868	Q9HCK1	ZDBF2_HUMAN	A	1868	ENSP00000363545:V1868A	ENSP00000363545:V1868A	V	+	2	0	ZDBF2	206883100	0.000000	0.05858	0.004000	0.12327	0.390000	0.30446	0.018000	0.13422	-0.338000	0.08413	0.451000	0.29950	GTT		0.413	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923		5	42	0	0	0	0.000602	0	5	42				
ZDBF2	57683	broad.mit.edu	37	2	207176110	207176110	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:207176110G>T	ENST00000374423.3	+	5	7244	c.6858G>T	c.(6856-6858)atG>atT	p.M2286I		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2286							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						CAAGCGCTATGGCAAATCCTC	0.507																																							uc002vbp.2		NA																	0				ovary(3)	3						c.(6856-6858)ATG>ATT		zinc finger, DBF-type containing 2							33.0	34.0	34.0					2																	207176110		1910	4141	6051	SO:0001583	missense	57683						nucleic acid binding|zinc ion binding	g.chr2:207176110G>T	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.6858G>T	2.37:g.207176110G>T	ENSP00000363545:p.Met2286Ile						p.M2286I	NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN			5	7108	+			2286					Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	c.6858G>T	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.021855	0.00042	.	.	ENSG00000204186	ENST00000374423	T	0.37235	1.21	5.24	-10.5	0.00291	.	.	.	.	.	T	0.08758	0.0217	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09840	-1.0656	9	0.12103	T	0.63	.	3.623	0.08103	0.1608:0.3489:0.3341:0.1562	.	2286	Q9HCK1	ZDBF2_HUMAN	I	2286	ENSP00000363545:M2286I	ENSP00000363545:M2286I	M	+	3	0	ZDBF2	206884355	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.925000	0.00169	-4.237000	0.00062	-4.070000	0.00012	ATG		0.507	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923		3	17	1	0	0.004672	0.004672	0.00501021	3	17				
MAP2	4133	broad.mit.edu	37	2	210560641	210560641	+	Silent	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:210560641C>G	ENST00000360351.4	+	7	4253	c.3747C>G	c.(3745-3747)ctC>ctG	p.L1249L	MAP2_ENST00000361559.4_Intron|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000447185.1_Silent_p.L1245L	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1249					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	ATAAACTGCTCTTCCGCTCAG	0.483																																					Pancreas(27;423 979 28787 29963)	Pancreas(27;423 979 28787 29963)	uc002vde.1		NA																	0				ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17						c.(3745-3747)CTC>CTG		microtubule-associated protein 2 isoform 1	Estramustine(DB01196)						91.0	95.0	94.0					2																	210560641		2203	4300	6503	SO:0001819	synonymous_variant	4133				central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity	g.chr2:210560641C>G		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.3747C>G	2.37:g.210560641C>G						MAP2_uc002vdc.1_Silent_p.L1249L|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Silent_p.L1245L	p.L1249L	NM_002374	NP_002365	P11137	MAP2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	7	3995	+		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)	1249					Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	ENST00000360351.4	37	c.3747C>G	CCDS2384.1																																																																																				0.483	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538		11	65	0	0	0	0.008291	0	11	65				
MYL1	4632	broad.mit.edu	37	2	211163206	211163206	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:211163206G>T	ENST00000352451.3	-	3	389	c.242C>A	c.(241-243)gCt>gAt	p.A81D	MYL1_ENST00000496436.1_5'UTR|MYL1_ENST00000341685.4_Missense_Mutation_p.A37D	NM_079420.2	NP_524144.1	P05976	MYL1_HUMAN	myosin, light chain 1, alkali; skeletal, fast	81	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cardiac muscle contraction (GO:0060048)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|sarcomere (GO:0030017)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	16				Epithelial(149;0.00573)|Lung(261;0.0422)|LUSC - Lung squamous cell carcinoma(261;0.0444)|all cancers(144;0.057)		TGTGCCCAGAGCTCGAAGGAC	0.463																																							uc002vec.2		NA																	0				ovary(1)	1						c.(241-243)GCT>GAT		fast skeletal myosin alkali light chain 1							148.0	138.0	142.0					2																	211163206		2203	4300	6503	SO:0001583	missense	4632				muscle filament sliding|muscle organ development	cytosol|muscle myosin complex|sarcomere	calcium ion binding|structural constituent of muscle	g.chr2:211163206G>T		CCDS2390.1, CCDS2391.1	2q33-q34	2013-01-10	2006-09-29		ENSG00000168530	ENSG00000168530		"""Myosins / Light chain"", ""EF-hand domain containing"""	7582	protein-coding gene	gene with protein product		160780	"""myosin, light polypeptide 1, alkali; skeletal, fast"""			2304459, 3422212	Standard	NM_079422		Approved		uc002vec.3	P05976	OTTHUMG00000132992	ENST00000352451.3:c.242C>A	2.37:g.211163206G>T	ENSP00000307280:p.Ala81Asp					MYL1_uc002veb.2_Missense_Mutation_p.A37D	p.A81D	NM_079420	NP_524144	P05976	MYL1_HUMAN		Epithelial(149;0.00573)|Lung(261;0.0422)|LUSC - Lung squamous cell carcinoma(261;0.0444)|all cancers(144;0.057)	3	371	-			81			EF-hand 1.		B2R4N6|B2R4T6|P06741|Q6IBD5	Missense_Mutation	SNP	ENST00000352451.3	37	c.242C>A	CCDS2390.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.914998	0.92178	.	.	ENSG00000168530	ENST00000341685;ENST00000352451	D;D	0.87029	-2.2;-2.2	5.22	5.22	0.72569	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.94905	0.8353	M	0.89658	3.05	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.85130	0.997;0.986	D	0.95735	0.8778	10	0.87932	D	0	.	18.8527	0.92238	0.0:0.0:1.0:0.0	.	81;37	P05976;P05976-2	MYL1_HUMAN;.	D	37;81	ENSP00000343321:A37D;ENSP00000307280:A81D	ENSP00000343321:A37D	A	-	2	0	MYL1	210871451	1.000000	0.71417	0.999000	0.59377	0.874000	0.50279	9.869000	0.99810	2.451000	0.82905	0.650000	0.86243	GCT		0.463	MYL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256566.2	NM_079420		10	96	1	0	2.17888e-05	0.006214	2.55607e-05	10	96				
ERBB4	2066	broad.mit.edu	37	2	212537946	212537946	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:212537946C>A	ENST00000342788.4	-	14	1969	c.1659G>T	c.(1657-1659)gtG>gtT	p.V553V	ERBB4_ENST00000402597.1_Silent_p.V553V|ERBB4_ENST00000436443.1_Silent_p.V553V	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	553	Cys-rich.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	GGTCACACTCCACACAGATGG	0.468										TSP Lung(8;0.080)																													uc002veg.1		NA																	0				lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33						c.(1657-1659)GTG>GTT		v-erb-a erythroblastic leukemia viral oncogene							131.0	105.0	114.0					2																	212537946		2203	4300	6503	SO:0001819	synonymous_variant	2066				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity	g.chr2:212537946C>A	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.1659G>T	2.37:g.212537946C>A		TSP Lung(8;0.080)				ERBB4_uc002veh.1_Silent_p.V553V|ERBB4_uc010zji.1_Silent_p.V553V|ERBB4_uc010zjj.1_Silent_p.V553V|ERBB4_uc010fut.1_Silent_p.V553V	p.V553V	NM_005235	NP_005226	Q15303	ERBB4_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	14	1757	-		Renal(323;0.06)|Lung NSC(271;0.197)	553			Extracellular (Potential).|Cys-rich.		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Silent	SNP	ENST00000342788.4	37	c.1659G>T	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	C	8.936	0.964687	0.18583	.	.	ENSG00000178568	ENST00000260943	.	.	.	5.33	-1.24	0.09435	.	.	.	.	.	T	0.39886	0.1095	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23762	-1.0179	4	.	.	.	.	1.7053	0.02881	0.1184:0.4224:0.191:0.2681	.	.	.	.	L	553	.	.	W	-	2	0	ERBB4	212246191	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	0.848000	0.27710	-0.289000	0.09038	0.557000	0.71058	TGG		0.468	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599		13	76	1	0	2.62699e-14	0.003163	4.3921e-14	13	76				
CXCR2	3579	broad.mit.edu	37	2	218999542	218999542	+	Missense_Mutation	SNP	G	G	A	rs201134932		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:218999542G>A	ENST00000318507.2	+	3	445	c.18G>A	c.(16-18)atG>atA	p.M6I		NM_001557.3	NP_001548.1	P25025	CXCR2_HUMAN	chemokine (C-X-C motif) receptor 2	6					cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(11)|skin(1)|stomach(1)	22						ATTTTAACATGGAGAGTGACA	0.403																																							uc002vgz.1		NA																	0				lung(1)|breast(1)	2						c.(16-18)ATG>ATA		interleukin 8 receptor beta							72.0	70.0	70.0					2																	218999542		2203	4300	6503	SO:0001583	missense	3579				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cellular defense response|dendritic cell chemotaxis|inflammatory response|neutrophil activation|neutrophil chemotaxis|positive regulation of cell proliferation	cell surface|integral to plasma membrane|mast cell granule	interleukin-8 receptor activity	g.chr2:218999542G>A	U11869	CCDS2408.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000180871	ENSG00000180871		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6027	protein-coding gene	gene with protein product		146928	"""interleukin 8 receptor, beta"""	IL8RB		1427896	Standard	NM_001557		Approved	CMKAR2, CD182	uc002vha.2	P25025	OTTHUMG00000133107	ENST00000318507.2:c.18G>A	2.37:g.218999542G>A	ENSP00000319635:p.Met6Ile					CXCR2_uc002vha.1_Missense_Mutation_p.M6I|CXCR2_uc002vhb.1_Missense_Mutation_p.M6I	p.M6I	NM_001557	NP_001548	P25025	CXCR2_HUMAN			4	243	+			6			Extracellular (Potential).		Q8IUZ1|Q9P2T6|Q9P2T7	Missense_Mutation	SNP	ENST00000318507.2	37	c.18G>A	CCDS2408.1	.	.	.	.	.	.	.	.	.	.	G	6.407	0.443251	0.12164	.	.	ENSG00000180871	ENST00000453237;ENST00000415392;ENST00000449014;ENST00000318507;ENST00000454148;ENST00000428565;ENST00000418878	T;T;T;T;T	0.63580	0.08;2.03;-0.05;1.99;1.15	4.67	0.68	0.17980	.	3.888990	0.00166	N	0.000005	T	0.47801	0.1465	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23511	-1.0186	10	0.22706	T	0.39	.	8.3656	0.32385	0.0:0.1517:0.4262:0.4221	.	6	P25025	CXCR2_HUMAN	I	6	ENSP00000413686:M6I;ENSP00000392348:M6I;ENSP00000319635:M6I;ENSP00000415148:M6I;ENSP00000392698:M6I	ENSP00000319635:M6I	M	+	3	0	CXCR2	218707787	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.010000	0.13242	0.017000	0.15025	0.556000	0.70494	ATG		0.403	CXCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256772.2	NM_001557		11	91	0	0	0	0.008291	0	11	91				
DOCK10	55619	broad.mit.edu	37	2	225729643	225729643	+	Silent	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:225729643T>C	ENST00000258390.7	-	12	1486	c.1419A>G	c.(1417-1419)agA>agG	p.R473R	DOCK10_ENST00000409592.3_Silent_p.R467R	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	473					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CTTCTGATTGTCTTGGAGTGA	0.448																																							uc010fwz.1		NA																	0				ovary(2)	2						c.(1417-1419)AGA>AGG		dedicator of cytokinesis 10							200.0	191.0	194.0					2																	225729643		1938	4147	6085	SO:0001819	synonymous_variant	55619						GTP binding	g.chr2:225729643T>C	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.1419A>G	2.37:g.225729643T>C						DOCK10_uc002vob.2_Silent_p.R467R|DOCK10_uc002vod.1_Silent_p.R473R	p.R473R	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)	12	1658	-		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)	473					B3FL70|O75178|Q9NW06|Q9NXI8	Silent	SNP	ENST00000258390.7	37	c.1419A>G	CCDS46528.1																																																																																				0.448	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1			8	199	0	0	0	0.006214	0	8	199				
SPHKAP	80309	broad.mit.edu	37	2	228884712	228884712	+	Silent	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:228884712A>T	ENST00000392056.3	-	7	904	c.858T>A	c.(856-858)tcT>tcA	p.S286S	SPHKAP_ENST00000344657.5_Silent_p.S286S	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	286						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GGTTTTCTGGAGATCGTTCTG	0.443																																							uc002vpq.2		NA																	0				skin(5)|ovary(4)|lung(1)	10						c.(856-858)TCT>TCA		sphingosine kinase type 1-interacting protein							245.0	257.0	253.0					2																	228884712		2203	4300	6503	SO:0001819	synonymous_variant	80309					cytoplasm	protein binding	g.chr2:228884712A>T		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.858T>A	2.37:g.228884712A>T						SPHKAP_uc002vpp.2_Silent_p.S286S|SPHKAP_uc010zlx.1_Silent_p.S286S	p.S286S	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)	7	905	-		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)	286					Q68DA3|Q68DR8|Q9C0I5	Silent	SNP	ENST00000392056.3	37	c.858T>A	CCDS46537.1																																																																																				0.443	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623		24	198	0	0	0	0.00278	0	24	198				
SDCBP2	27111	broad.mit.edu	37	20	1298980	1298980	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr20:1298980C>G	ENST00000360779.3	-	4	380	c.207G>C	c.(205-207)caG>caC	p.Q69H	SDCBP2_ENST00000339987.3_Missense_Mutation_p.Q69H|SDCBP2_ENST00000381812.1_Missense_Mutation_p.Q69H	NM_080489.4	NP_536737.3	Q9H190	SDCB2_HUMAN	syndecan binding protein (syntenin) 2	69				Q -> H (in Ref. 2; CAC21716). {ECO:0000305}.	intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	7						CCTCTGGAATCTGAAGCAGGC	0.493																																							uc002wev.3		NA																	0				large_intestine(1)|skin(1)	2						c.(205-207)CAG>CAC		syndecan binding protein 2 isoform a							85.0	87.0	86.0					20																	1298980		1888	4117	6005	SO:0001583	missense	27111				intracellular signal transduction|intracellular transport|nervous system development	cytoplasm	protein C-terminus binding|protein heterodimerization activity|protein homodimerization activity	g.chr20:1298980C>G	AF131809	CCDS13013.1, CCDS42848.1	20p13	2008-07-02			ENSG00000125775	ENSG00000125775			15756	protein-coding gene	gene with protein product						11152476	Standard	NM_080489		Approved	ST-2, SITAC18	uc021vzn.1	Q9H190	OTTHUMG00000031661	ENST00000360779.3:c.207G>C	20.37:g.1298980C>G	ENSP00000354013:p.Gln69His					FKBP1A_uc010gac.2_Missense_Mutation_p.Q69H|SDCBP2_uc010zpq.1_Missense_Mutation_p.Q69H	p.Q69H	NM_080489	NP_536737	Q9H190	SDCB2_HUMAN			4	336	-			69	Q -> H (in Ref. 2; CAC21716).				O95892|Q5W0X1|Q9BZ42|Q9H567|Q9NRY8	Missense_Mutation	SNP	ENST00000360779.3	37	c.207G>C	CCDS42848.1	.	.	.	.	.	.	.	.	.	.	C	10.39	1.336716	0.24253	.	.	ENSG00000125775	ENST00000381812;ENST00000360779;ENST00000339987	T;T;T	0.32515	1.45;1.45;1.45	4.94	1.72	0.24424	.	0.366777	0.25780	N	0.028342	T	0.34164	0.0888	L	0.52364	1.645	0.09310	N	1	D;B	0.59767	0.986;0.052	P;B	0.56216	0.794;0.022	T	0.07558	-1.0766	10	0.34782	T	0.22	-20.1752	5.0126	0.14321	0.1642:0.654:0.0:0.1819	.	69;69	B4DKI5;Q9H190	.;SDCB2_HUMAN	H	69	ENSP00000371233:Q69H;ENSP00000354013:Q69H;ENSP00000342935:Q69H	ENSP00000342935:Q69H	Q	-	3	2	SDCBP2	1246980	0.125000	0.22332	0.038000	0.18304	0.236000	0.25371	0.501000	0.22578	0.649000	0.30751	0.655000	0.94253	CAG		0.493	SDCBP2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077513.2	NM_080489		10	40	0	0	0	0.013537	0	10	40				
FASTKD5	60493	broad.mit.edu	37	20	3128895	3128895	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr20:3128895C>G	ENST00000380266.3	-	2	1143	c.822G>C	c.(820-822)aaG>aaC	p.K274N	UBOX5_ENST00000217173.2_Intron|UBOX5_ENST00000348031.2_Intron|UBOX5-AS1_ENST00000446537.1_RNA	NM_021826.4	NP_068598.1	Q7L8L6	FAKD5_HUMAN	FAST kinase domains 5	274					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(2)	19						AGGATAGATCCTTCCAGTGCA	0.383																																							uc002whz.2		NA																	0					0						c.(820-822)AAG>AAC		FAST kinase domains 5							59.0	62.0	61.0					20																	3128895		2203	4300	6503	SO:0001583	missense	60493				apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity	g.chr20:3128895C>G	BC007413	CCDS13048.1	20p13	2006-07-07			ENSG00000215251	ENSG00000215251			25790	protein-coding gene	gene with protein product		614272				11347906	Standard	NM_021826		Approved	FLJ13149	uc002whz.4	Q7L8L6	OTTHUMG00000031727	ENST00000380266.3:c.822G>C	20.37:g.3128895C>G	ENSP00000369618:p.Lys274Asn					uc002whv.1_Intron|UBOX5_uc002whw.2_Intron|UBOX5_uc002whx.2_Intron|UBOX5_uc002why.1_Intron	p.K274N	NM_021826	NP_068598	Q7L8L6	FAKD5_HUMAN			2	1133	-			274					Q96JN3|Q9H5D1|Q9H8Y3	Missense_Mutation	SNP	ENST00000380266.3	37	c.822G>C	CCDS13048.1	.	.	.	.	.	.	.	.	.	.	C	1.872	-0.459917	0.04508	.	.	ENSG00000215251	ENST00000380266	T	0.17854	2.25	5.77	0.8	0.18672	.	0.573081	0.17747	N	0.163351	T	0.07098	0.0180	N	0.17082	0.46	0.28762	N	0.900851	P	0.37441	0.595	B	0.31016	0.123	T	0.33954	-0.9848	10	0.18276	T	0.48	.	6.5458	0.22404	0.0:0.3284:0.1232:0.5484	.	274	Q7L8L6	FAKD5_HUMAN	N	274	ENSP00000369618:K274N	ENSP00000369618:K274N	K	-	3	2	FASTKD5	3076895	0.983000	0.35010	0.928000	0.36995	0.159000	0.22180	0.153000	0.16323	0.125000	0.18397	-0.606000	0.04082	AAG		0.383	FASTKD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077701.2	NM_021826		13	47	0	0	0	0.013537	0	13	47				
FLRT3	23767	broad.mit.edu	37	20	14307338	14307338	+	Missense_Mutation	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr20:14307338T>C	ENST00000378053.3	-	2	1071	c.815A>G	c.(814-816)cAg>cGg	p.Q272R	FLRT3_ENST00000462077.1_5'Flank|FLRT3_ENST00000341420.4_Missense_Mutation_p.Q272R|MACROD2_ENST00000217246.4_Intron|MACROD2_ENST00000310348.4_Intron	NM_013281.3	NP_037413.1	Q9NZU0	FLRT3_HUMAN	fibronectin leucine rich transmembrane protein 3	272					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Colorectal(1;0.0464)	COAD - Colon adenocarcinoma(2;0.129)	Colorectal(1;0.0393)		TCGATAGAGCTGCCTTAGATA	0.403																																							uc002wov.1		NA																	0				kidney(1)	1						c.(814-816)CAG>CGG		fibronectin leucine rich transmembrane protein 3							48.0	50.0	50.0					20																	14307338		2203	4300	6503	SO:0001583	missense	23767				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity	g.chr20:14307338T>C	AF169677	CCDS13121.1	20p11	2013-02-11			ENSG00000125848	ENSG00000125848		"""Fibronectin type III domain containing"""	3762	protein-coding gene	gene with protein product		604808				10644439	Standard	NM_198391		Approved		uc002wow.2	Q9NZU0	OTTHUMG00000031914	ENST00000378053.3:c.815A>G	20.37:g.14307338T>C	ENSP00000367292:p.Gln272Arg					MACROD2_uc002wot.2_Intron|MACROD2_uc002wou.2_Intron|FLRT3_uc002wow.1_Missense_Mutation_p.Q272R	p.Q272R	NM_198391	NP_938205	Q9NZU0	FLRT3_HUMAN	COAD - Colon adenocarcinoma(2;0.129)	Colorectal(1;0.0393)	3	1282	-		Colorectal(1;0.0464)	272			Extracellular (Potential).|LRR 10.		D3DW20|Q542Z9|Q96K39|Q96K42|Q96KB1|Q9P259	Missense_Mutation	SNP	ENST00000378053.3	37	c.815A>G	CCDS13121.1	.	.	.	.	.	.	.	.	.	.	T	0.742	-0.776107	0.02951	.	.	ENSG00000125848	ENST00000378053;ENST00000341420;ENST00000541882	T;T	0.55930	0.49;0.49	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.35335	0.0928	N	0.12663	0.25	0.58432	D	0.999998	B	0.15930	0.015	B	0.19946	0.027	T	0.22452	-1.0216	10	0.11182	T	0.66	-6.6797	16.3217	0.82953	0.0:0.0:0.0:1.0	.	272	Q9NZU0	FLRT3_HUMAN	R	272	ENSP00000367292:Q272R;ENSP00000339912:Q272R	ENSP00000339912:Q272R	Q	-	2	0	FLRT3	14255338	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.167000	0.64972	2.251000	0.74343	0.528000	0.53228	CAG		0.403	FLRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078075.1	NM_013281		16	52	0	0	0	0.004007	0	16	52				
FRG1B	284802	broad.mit.edu	37	20	29625877	29625877	+	Missense_Mutation	SNP	G	G	A	rs7266938	byFrequency	TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr20:29625877G>A	ENST00000278882.3	+	5	501	c.121G>A	c.(121-123)Gcc>Acc	p.A41T	FRG1B_ENST00000439954.2_Missense_Mutation_p.A46T|FRG1B_ENST00000358464.4_Missense_Mutation_p.A41T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	41								p.A41T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GTACAGAATCGCCCTGAAATC	0.358																																							uc010ztl.1		NA																	2	Substitution - Missense(2)		urinary_tract(2)		0						c.(31-33)GCC>ACC		Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.																																				SO:0001583	missense	284802							g.chr20:29625877G>A			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.121G>A	20.37:g.29625877G>A	ENSP00000278882:p.Ala41Thr					FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron	p.A11T							2	63	+								C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37	c.31G>A		.	.	.	.	.	.	.	.	.	.	g	8.740	0.918766	0.17982	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.62498	0.02	1.68	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.48277	0.1491	.	.	.	0.52099	D	0.999942	B	0.24186	0.099	B	0.27715	0.082	T	0.43956	-0.9359	9	0.33940	T	0.23	.	9.3557	0.38164	0.0:0.0:1.0:0.0	rs7266938;rs7266938	46	F5H5R5	.	T	41;46;41	ENSP00000408863:A46T	ENSP00000278882:A41T	A	+	1	0	FRG1B	28239538	1.000000	0.71417	0.993000	0.49108	0.033000	0.12548	5.232000	0.65332	1.250000	0.43966	0.184000	0.17185	GCC		0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579		3	39	0	0	0	0.009096	0	3	39				
PPP1R16B	26051	broad.mit.edu	37	20	37546820	37546820	+	Silent	SNP	C	C	G	rs138542212	byFrequency	TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr20:37546820C>G	ENST00000299824.1	+	11	1404	c.1215C>G	c.(1213-1215)ccC>ccG	p.P405P	PPP1R16B_ENST00000373331.2_Silent_p.P363P	NM_015568.2	NP_056383.1	Q96T49	PP16B_HUMAN	protein phosphatase 1, regulatory subunit 16B	405					regulation of filopodium assembly (GO:0051489)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(23)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	49		Myeloproliferative disorder(115;0.00878)				TGGAGAAGCCCGTGCTACTCT	0.557													C|||	2	0.000399361	0.0	0.0	5008	,	,		19756	0.0		0.0	False		,,,				2504	0.002						uc002xje.2		NA																	0				upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3						c.(1213-1215)CCC>CCG		protein phosphatase 1 regulatory inhibitor							109.0	117.0	114.0					20																	37546820		2203	4300	6503	SO:0001819	synonymous_variant	26051				regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding	g.chr20:37546820C>G	AB020630	CCDS13309.1, CCDS54462.1	20q11.23	2013-01-10	2011-10-04		ENSG00000101445	ENSG00000101445		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	15850	protein-coding gene	gene with protein product	"""TGF-beta-inhibited membrane-associated protein"", ""ankyrin repeat domain protein 4"""	613275	"""protein phosphatase 1, regulatory (inhibitor) subunit 16B"""			10048485, 12055102	Standard	NM_001172735		Approved	KIAA0823, TIMAP, ANKRD4	uc002xje.3	Q96T49	OTTHUMG00000032465	ENST00000299824.1:c.1215C>G	20.37:g.37546820C>G						PPP1R16B_uc010ggc.2_Silent_p.P363P	p.P405P	NM_015568	NP_056383	Q96T49	PP16B_HUMAN			11	1404	+		Myeloproliferative disorder(115;0.00878)	405					A2RRR6|E9PFS8|O94912|Q5W9G4|Q9NQG4	Silent	SNP	ENST00000299824.1	37	c.1215C>G	CCDS13309.1	.	.	.	.	.	.	.	.	.	.	C	4.297	0.054289	0.08291	.	.	ENSG00000101445	ENST00000438192	T	0.71103	-0.54	5.44	-1.61	0.08399	.	0.258612	0.37857	N	0.001902	T	0.52500	0.1738	.	.	.	0.51482	D	0.999924	.	.	.	.	.	.	T	0.21449	-1.0245	7	0.16896	T	0.51	.	3.1596	0.06516	0.1791:0.4495:0.0873:0.2841	.	.	.	.	R	306	ENSP00000403600:P306R	ENSP00000403600:P306R	P	+	2	0	PPP1R16B	36980234	0.001000	0.12720	0.995000	0.50966	0.637000	0.38172	-2.535000	0.00940	-0.175000	0.10725	-1.961000	0.00478	CCG		0.557	PPP1R16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079220.2	NM_015568		36	133	0	0	0	0.004878	0	36	133				
TOX2	84969	broad.mit.edu	37	20	42680134	42680134	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr20:42680134C>A	ENST00000358131.5	+	4	835	c.627C>A	c.(625-627)acC>acA	p.T209T	TOX2_ENST00000372999.1_Silent_p.T158T|TOX2_ENST00000341197.4_Silent_p.T200T|TOX2_ENST00000423191.2_Silent_p.T158T|TOX2_ENST00000435864.2_3'UTR	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	209					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			AGTCAGCGACCCCCTCTCCCT	0.627																																							uc002xlf.3		NA																	0				ovary(1)	1						c.(625-627)ACC>ACA		TOX high mobility group box family member 2							41.0	37.0	39.0					20																	42680134		2203	4300	6503	SO:0001819	synonymous_variant	84969				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding	g.chr20:42680134C>A	BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.627C>A	20.37:g.42680134C>A						TOX2_uc010ggo.2_Silent_p.T200T|TOX2_uc002xle.3_Silent_p.T158T|TOX2_uc010ggp.2_Silent_p.T158T|TOX2_uc002xlg.2_Silent_p.T158T|TOX2_uc010zwk.1_Silent_p.T78T	p.T209T	NM_001098798	NP_001092268	Q96NM4	TOX2_HUMAN	COAD - Colon adenocarcinoma(18;0.00189)		4	644	+		Myeloproliferative disorder(115;0.00452)	209					A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Silent	SNP	ENST00000358131.5	37	c.627C>A	CCDS42875.1																																																																																				0.627	TOX2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079329.2			8	24	1	0	0.00448238	0.004482	0.00485591	8	24				
PDE9A	5152	broad.mit.edu	37	21	44152188	44152188	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr21:44152188G>A	ENST00000291539.6	+	6	511	c.451G>A	c.(451-453)Gaa>Aaa	p.E151K	PDE9A_ENST00000539837.1_Intron|PDE9A_ENST00000335440.6_Intron|PDE9A_ENST00000335512.4_Missense_Mutation_p.E91K|AP001627.1_ENST00000437426.1_RNA|PDE9A_ENST00000470987.1_3'UTR|PDE9A_ENST00000398236.3_Missense_Mutation_p.E65K|PDE9A_ENST00000398229.3_Intron|PDE9A_ENST00000398227.3_Intron|PDE9A_ENST00000380328.2_Intron|PDE9A_ENST00000398232.3_Missense_Mutation_p.E84K|PDE9A_ENST00000398234.3_Missense_Mutation_p.E50K|PDE9A_ENST00000398224.3_Missense_Mutation_p.E24K|PDE9A_ENST00000328862.6_Missense_Mutation_p.E125K|PDE9A_ENST00000349112.3_Intron|PDE9A_ENST00000398225.3_Missense_Mutation_p.E110K	NM_002606.2	NP_002597.1	O76083	PDE9A_HUMAN	phosphodiesterase 9A	151					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|metabolic process (GO:0008152)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)	p.E151*(1)		breast(1)|endometrium(4)|large_intestine(6)|lung(8)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Caffeine(DB00201)	AGAGAGAGAAGAATTAATCCA	0.488																																							uc002zbm.2		NA																	1	Substitution - Nonsense(1)		large_intestine(1)	ovary(1)|skin(1)	2						c.(451-453)GAA>AAA		phosphodiesterase 9A isoform a							94.0	87.0	89.0					21																	44152188		2203	4300	6503	SO:0001583	missense	5152				platelet activation|signal transduction	cytosol|endoplasmic reticulum|Golgi apparatus|perinuclear region of cytoplasm|ruffle membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding|protein binding	g.chr21:44152188G>A	AF048837	CCDS13690.1, CCDS33567.1, CCDS33568.1, CCDS33569.1, CCDS33570.1, CCDS33571.1, CCDS42941.1, CCDS42942.1, CCDS42943.1, CCDS42944.1, CCDS42945.1, CCDS42946.1, CCDS42947.1	21q22.3	2005-11-29			ENSG00000160191	ENSG00000160191	3.1.4.17	"""Phosphodiesterases"""	8795	protein-coding gene	gene with protein product		602973				9624146	Standard	NM_001001584		Approved		uc002zbm.3	O76083	OTTHUMG00000086825	ENST00000291539.6:c.451G>A	21.37:g.44152188G>A	ENSP00000291539:p.Glu151Lys					PDE9A_uc002zbn.2_Missense_Mutation_p.E24K|PDE9A_uc002zbo.2_Intron|PDE9A_uc002zbp.2_5'UTR|PDE9A_uc002zbq.2_Intron|PDE9A_uc002zbs.2_Intron|PDE9A_uc002zbr.2_5'UTR|PDE9A_uc002zbt.2_Intron|PDE9A_uc002zbu.2_Intron|PDE9A_uc002zbv.2_Intron|PDE9A_uc002zbw.2_Intron|PDE9A_uc002zbx.2_Missense_Mutation_p.E91K|PDE9A_uc002zby.2_Intron|PDE9A_uc002zbz.2_Missense_Mutation_p.E43K|PDE9A_uc002zca.2_Missense_Mutation_p.E110K|PDE9A_uc002zcb.2_Missense_Mutation_p.E125K|PDE9A_uc002zcc.2_Missense_Mutation_p.E50K|PDE9A_uc002zcd.2_Missense_Mutation_p.E65K|PDE9A_uc002zce.2_Missense_Mutation_p.E84K|PDE9A_uc002zcf.2_Intron|PDE9A_uc002zcg.2_5'UTR|PDE9A_uc002zch.2_5'UTR	p.E151K	NM_002606	NP_002597	O76083	PDE9A_HUMAN			6	514	+			151					B2RBI5|B4DFI5|D3DSJ8|D3DSJ9|O75490|O75491|O95225|Q53Y40|Q5QD39|Q86SF7|Q86SI6|Q86SJ3|Q86WN3|Q86WN4|Q86WN5|Q86WN6|Q86WN7|Q86WN8|Q86WN9|Q86WP0	Missense_Mutation	SNP	ENST00000291539.6	37	c.451G>A	CCDS13690.1	.	.	.	.	.	.	.	.	.	.	G	15.62	2.886951	0.52014	.	.	ENSG00000160191	ENST00000335512;ENST00000291539;ENST00000398232;ENST00000398234;ENST00000398236;ENST00000328862;ENST00000398225;ENST00000398224	T;T;T;T;T;T;T;T	0.71934	-0.61;-0.44;-0.47;-0.55;-0.53;-0.45;-0.44;-0.55	5.15	5.15	0.70609	.	7739.210000	0.00166	N	0.000000	T	0.80160	0.4572	L	0.48642	1.525	0.80722	D	1	D;D;P;P;D;P;P;B;P	0.57899	0.971;0.981;0.852;0.853;0.971;0.828;0.853;0.142;0.77	P;P;B;P;P;B;P;B;B	0.59056	0.779;0.851;0.281;0.628;0.779;0.397;0.592;0.189;0.424	T	0.66114	-0.6004	10	0.12766	T	0.61	.	16.4177	0.83748	0.0:0.0:1.0:0.0	.	84;65;50;125;110;43;91;24;151	O76083-13;O76083-8;O76083-6;O76083-15;O76083-14;O76083-16;O76083-2;O76083-3;O76083	.;.;.;.;.;.;.;.;PDE9A_HUMAN	K	91;151;84;50;65;125;110;24	ENSP00000335242:E91K;ENSP00000291539:E151K;ENSP00000381287:E84K;ENSP00000381289:E50K;ENSP00000381291:E65K;ENSP00000328699:E125K;ENSP00000381281:E110K;ENSP00000381280:E24K	ENSP00000291539:E151K	E	+	1	0	PDE9A	43025257	1.000000	0.71417	0.991000	0.47740	0.425000	0.31504	4.809000	0.62591	2.385000	0.81259	0.650000	0.86243	GAA		0.488	PDE9A-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195466.1			9	27	0	0	0	0.008291	0	9	27				
NDUFV3	4731	broad.mit.edu	37	21	44317035	44317035	+	Splice_Site	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr21:44317035A>T	ENST00000340344.4	+	2	114		c.e2-1		NDUFV3_ENST00000354250.2_Splice_Site|NDUFV3_ENST00000460259.1_Splice_Site	NM_001001503.1	NP_001001503.1	P56181	NDUV3_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	10				STAD - Stomach adenocarcinoma(101;0.0606)		TTCTTTTGTCAGACTATGCTC	0.388																																							uc002zcn.2		NA																	0				ovary(2)	2						c.e2-2		NADH-ubiquinone oxidoreductase flavoprotein 3	NADH(DB00157)						83.0	83.0	83.0					21																	44317035		2203	4300	6503	SO:0001630	splice_region_variant	4731				mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I|nucleus	NADH dehydrogenase (ubiquinone) activity	g.chr21:44317035A>T		CCDS33572.1, CCDS33573.1	21q22.3	2011-07-04	2002-08-29		ENSG00000160194	ENSG00000160194	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7719	protein-coding gene	gene with protein product	"""complex I 10kDa subunit"""	602184	"""NADH dehydrogenase (ubiquinone) flavoprotein 3 (10kD)"""			9344673	Standard	NM_021075		Approved	CI-10k	uc002zcm.3	P56181	OTTHUMG00000086823	ENST00000340344.4:c.49-1A>T	21.37:g.44317035A>T						NDUFV3_uc002zcm.2_Splice_Site_p.T17_splice	p.T17_splice	NM_001001503	NP_001001503	P56181	NDUV3_HUMAN		STAD - Stomach adenocarcinoma(101;0.0606)	2	115	+								A8K0M1|J3KNX7|Q6FGD3|Q8WU60|Q9HCR5	Splice_Site	SNP	ENST00000340344.4	37	c.49_splice	CCDS33573.1	.	.	.	.	.	.	.	.	.	.	A	10.36	1.328725	0.24167	.	.	ENSG00000160194	ENST00000354250;ENST00000340344	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9008	0.52682	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NDUFV3	43190104	0.993000	0.37304	0.891000	0.34965	0.106000	0.19336	3.561000	0.53770	2.116000	0.64780	0.533000	0.62120	.		0.388	NDUFV3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195448.2		Intron	3	57	0	0	0	0.001168	0	3	57				
AIRE	326	broad.mit.edu	37	21	45711088	45711088	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr21:45711088C>A	ENST00000291582.5	+	8	1117	c.990C>A	c.(988-990)atC>atA	p.I330I	AIRE_ENST00000329347.4_Silent_p.I123I|AIRE_ENST00000355347.4_Silent_p.I123I	NM_000383.3	NP_000374.1	O43918	AIRE_HUMAN	autoimmune regulator	330					humoral immune response (GO:0006959)|immune response (GO:0006955)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|transcription regulatory region DNA binding (GO:0044212)|translation regulator activity (GO:0045182)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)|urinary_tract(1)	14				Colorectal(79;0.0806)		TCCGGGAGATCCCCAGGTGAG	0.701									Autoimmune PolyEndocrinopathy Candidiasis Ectodermal Dystrophy																														uc002zei.2		NA																	0				skin(1)	1						c.(988-990)ATC>ATA		autoimmune regulator isoform 1							32.0	28.0	29.0					21																	45711088		2200	4293	6493	SO:0001819	synonymous_variant	326	Autoimmune_PolyEndocrinopathy_Candidiasis_Ectodermal_Dystrophy	Familial Cancer Database	APECED	positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	chromatin binding|histone binding|transcription regulatory region DNA binding|translation regulator activity|zinc ion binding	g.chr21:45711088C>A	AB006684	CCDS13706.1	21q22.3	2014-09-17	2007-06-20		ENSG00000160224	ENSG00000160224		"""Zinc fingers, PHD-type"""	360	protein-coding gene	gene with protein product	"""autoimmune polyendocrinopathy candidiasis ectodermal dystrophy"""	607358	"""autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)"""	APECED		9398840	Standard	NM_000383		Approved	PGA1, APS1	uc002zei.3	O43918	OTTHUMG00000086921	ENST00000291582.5:c.990C>A	21.37:g.45711088C>A						AIRE_uc010gpq.2_RNA|AIRE_uc002zej.2_Silent_p.I133I|AIRE_uc010gpr.2_Silent_p.I133I	p.I330I	NM_000383	NP_000374	O43918	AIRE_HUMAN		Colorectal(79;0.0806)	8	1117	+			330			PHD-type 1.		B2RP50|O43922|O43932|O75745	Silent	SNP	ENST00000291582.5	37	c.990C>A	CCDS13706.1																																																																																				0.701	AIRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195842.2			10	24	1	0	0.00621372	0.006214	0.00663005	10	24				
MCM5	4174	broad.mit.edu	37	22	35809931	35809931	+	Silent	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr22:35809931A>T	ENST00000216122.4	+	9	1309	c.1155A>T	c.(1153-1155)acA>acT	p.T385T	MCM5_ENST00000465557.1_3'UTR|MCM5_ENST00000382011.5_Silent_p.T342T	NM_006739.3	NP_006730.2	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	385	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.T385T(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29						ACCCTGGGACAGCCAAGTCCC	0.577																																							uc003anu.3		NA																	1	Substitution - coding silent(1)		endometrium(1)	ovary(1)	1						c.(1153-1155)ACA>ACT		minichromosome maintenance complex component 5							107.0	97.0	101.0					22																	35809931		2203	4300	6503	SO:0001819	synonymous_variant	4174				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding	g.chr22:35809931A>T		CCDS13915.1	22q13.1-q13.2	2007-04-04	2007-04-04		ENSG00000100297	ENSG00000100297			6948	protein-coding gene	gene with protein product		602696	"""minichromosome maintenance deficient (S. cerevisiae) 5 (cell division cycle 46)"", ""MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)"""	CDC46		8751386, 10591208	Standard	NM_006739		Approved		uc003anu.4	P33992	OTTHUMG00000150961	ENST00000216122.4:c.1155A>T	22.37:g.35809931A>T						MCM5_uc010gwr.2_Silent_p.T194T|MCM5_uc003anv.3_Silent_p.T342T|MCM5_uc010gws.1_Intron|MCM5_uc003anw.1_Silent_p.T169T	p.T385T	NM_006739	NP_006730	P33992	MCM5_HUMAN			9	1249	+			385			MCM.|ATP (Potential).		O60785|Q14578|Q9BTJ4|Q9BWL8	Silent	SNP	ENST00000216122.4	37	c.1155A>T	CCDS13915.1																																																																																				0.577	MCM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320661.3			9	52	0	0	0	0.006214	0	9	52				
MLC1	23209	broad.mit.edu	37	22	50518354	50518354	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr22:50518354G>C	ENST00000311597.5	-	5	1022	c.416C>G	c.(415-417)gCa>gGa	p.A139G	MLC1_ENST00000395876.2_Missense_Mutation_p.A139G|MLC1_ENST00000535444.1_Missense_Mutation_p.A60G|MLC1_ENST00000450140.2_Intron|MLC1_ENST00000538737.1_Intron|MLC1_ENST00000431262.2_Missense_Mutation_p.A109G	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1	139					caveolin-mediated endocytosis (GO:0072584)|cellular response to cholesterol (GO:0071397)|ion transport (GO:0006811)|positive regulation of intracellular transport (GO:0032388)|protein oligomerization (GO:0051259)|regulation of response to osmotic stress (GO:0047484)|transport (GO:0006810)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		CACGTTTATTGCTGATGGGTT	0.463																																							uc003bjg.1		NA																	0				pancreas(1)	1						c.(415-417)GCA>GGA		megalencephalic leukoencephalopathy with							191.0	167.0	175.0					22																	50518354		2203	4300	6503	SO:0001583	missense	23209					basolateral plasma membrane|endosome|integral to membrane|integral to membrane of membrane fraction	ion channel activity	g.chr22:50518354G>C	D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427			17082	protein-coding gene	gene with protein product		605908				7584026, 7584028	Standard	XR_430476		Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.416C>G	22.37:g.50518354G>C	ENSP00000310375:p.Ala139Gly					MLC1_uc011arl.1_Intron|MLC1_uc003bjh.1_Missense_Mutation_p.A139G|MLC1_uc011arm.1_Missense_Mutation_p.A109G|MLC1_uc011arn.1_Missense_Mutation_p.A60G|MLC1_uc011aro.1_Intron	p.A139G	NM_139202	NP_631941	Q15049	MLC1_HUMAN		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)	5	689	-		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)	139					B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	Missense_Mutation	SNP	ENST00000311597.5	37	c.416C>G	CCDS14083.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.670762	0.67814	.	.	ENSG00000100427	ENST00000395876;ENST00000311597;ENST00000431262;ENST00000535444;ENST00000442311	D;D;D;D;D	0.96041	-3.85;-3.85;-3.47;-3.69;-3.89	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.97365	0.9138	M	0.70275	2.135	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	D	0.98124	1.0427	10	0.87932	D	0	-17.4468	17.3334	0.87272	0.0:0.0:1.0:0.0	.	109;139	B7Z659;Q15049	.;MLC1_HUMAN	G	139;139;109;60;109	ENSP00000379216:A139G;ENSP00000310375:A139G;ENSP00000415877:A109G;ENSP00000438910:A60G;ENSP00000401385:A109G	ENSP00000310375:A139G	A	-	2	0	MLC1	48860481	1.000000	0.71417	0.899000	0.35326	0.105000	0.19272	8.507000	0.90522	2.368000	0.80403	0.561000	0.74099	GCA		0.463	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316979.2	NM_015166		18	63	0	0	0	0.008871	0	18	63				
HDAC11	79885	broad.mit.edu	37	3	13546070	13546070	+	Missense_Mutation	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:13546070A>G	ENST00000295757.3	+	10	1114	c.931A>G	c.(931-933)Atc>Gtc	p.I311V	HDAC11_ENST00000402271.1_Missense_Mutation_p.I232V|HDAC11_ENST00000437379.2_Missense_Mutation_p.I283V|HDAC11_ENST00000433119.1_3'UTR|HDAC11_ENST00000404040.1_Missense_Mutation_p.I211V|HDAC11_ENST00000522202.1_Missense_Mutation_p.I260V|HDAC11_ENST00000446613.2_Missense_Mutation_p.I119V|HDAC11_ENST00000402259.1_Missense_Mutation_p.I145V|HDAC11_ENST00000404548.1_3'UTR	NM_024827.3	NP_079103.2	Q96DB2	HDA11_HUMAN	histone deacetylase 11	311	Histone deacetylase.				chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|oligodendrocyte development (GO:0014003)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(4)|prostate(3)	13						CACAGCCCGCATCATTGCTGA	0.612																																							uc003bxy.2		NA																	0				ovary(2)	2						c.(931-933)ATC>GTC		histone deacetylase 11 isoform 1							90.0	81.0	84.0					3																	13546070		2203	4300	6503	SO:0001583	missense	79885				regulation of transcription, DNA-dependent|transcription, DNA-dependent	histone deacetylase complex|plasma membrane	histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|transcription factor binding	g.chr3:13546070A>G	AK025426	CCDS2615.1, CCDS46760.1	3p25.1	2008-07-18			ENSG00000163517	ENSG00000163517	3.5.1.98		19086	protein-coding gene	gene with protein product		607226				11948178	Standard	NM_001136041		Approved		uc003bxy.3	Q96DB2	OTTHUMG00000129800	ENST00000295757.3:c.931A>G	3.37:g.13546070A>G	ENSP00000295757:p.Ile311Val					HDAC11_uc010heb.2_3'UTR|HDAC11_uc011aux.1_Missense_Mutation_p.I119V|HDAC11_uc011auy.1_Missense_Mutation_p.I260V	p.I311V	NM_024827	NP_079103	Q96DB2	HDA11_HUMAN			10	1064	+			311			Histone deacetylase.		B4DDK1|Q9H6I7|Q9H6X3|Q9NTC9	Missense_Mutation	SNP	ENST00000295757.3	37	c.931A>G	CCDS2615.1	.	.	.	.	.	.	.	.	.	.	A	6.790	0.514760	0.12944	.	.	ENSG00000163517	ENST00000295757;ENST00000402259;ENST00000402271;ENST00000446613;ENST00000404040;ENST00000522202;ENST00000437379	T;T;T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39;-0.39;-0.39	5.38	4.21	0.49690	Histone deacetylase domain (2);	0.055444	0.64402	D	0.000001	T	0.41236	0.1150	N	0.03050	-0.425	0.41598	D	0.988832	B;B	0.15141	0.012;0.012	B;B	0.18871	0.023;0.023	T	0.43245	-0.9403	10	0.87932	D	0	-8.2572	9.6697	0.40004	0.915:0.0:0.085:0.0	.	260;311	B4DDK1;Q96DB2	.;HDA11_HUMAN	V	311;145;232;119;211;260;283	ENSP00000295757:I311V;ENSP00000384706:I145V;ENSP00000384123:I232V;ENSP00000401487:I119V;ENSP00000385475:I211V;ENSP00000429794:I260V;ENSP00000395188:I283V	ENSP00000295757:I311V	I	+	1	0	HDAC11	13521070	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.990000	0.63876	2.035000	0.60131	0.459000	0.35465	ATC		0.612	HDAC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252028.5	NM_024827		7	65	0	0	0	0.001984	0	7	65				
WNT7A	7476	broad.mit.edu	37	3	13896107	13896107	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:13896107C>A	ENST00000285018.4	-	3	796	c.492G>T	c.(490-492)aaG>aaT	p.K164N		NM_004625.3	NP_004616.2	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family, member 7A	164					asymmetric protein localization (GO:0008105)|canonical Wnt signaling pathway (GO:0060070)|cartilage condensation (GO:0001502)|cell fate commitment (GO:0045165)|cell proliferation in forebrain (GO:0021846)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system vasculogenesis (GO:0022009)|cerebellar granule cell differentiation (GO:0021707)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment of cell polarity (GO:0030010)|lens fiber cell development (GO:0070307)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neurogenesis (GO:0050768)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|non-canonical Wnt signaling pathway (GO:0035567)|oviduct development (GO:0060066)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of axon diameter (GO:0031133)|response to estradiol (GO:0032355)|sex differentiation (GO:0007548)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|stem cell development (GO:0048864)|synapse organization (GO:0050808)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway involved in wound healing, spreading of epidermal cells (GO:0035659)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	24						CCACAAAGACCTTGGCGAAGC	0.612																																							uc003bye.1		NA																	0				ovary(2)|breast(1)	3						c.(490-492)AAG>AAT		wingless-type MMTV integration site family,							108.0	118.0	115.0					3																	13896107		2203	4300	6503	SO:0001583	missense	7476				activation of JUN kinase activity|anterior/posterior pattern formation|canonical Wnt receptor signaling pathway|cell proliferation in forebrain|cellular response to transforming growth factor beta stimulus|central nervous system vasculogenesis|cerebellar granule cell differentiation|dorsal/ventral pattern formation|embryonic axis specification|embryonic digit morphogenesis|embryonic forelimb morphogenesis|embryonic leg morphogenesis|lens fiber cell development|negative regulation of neurogenesis|palate development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of JNK cascade|positive regulation of synaptogenesis|positive regulation of transcription from RNA polymerase II promoter|regulation of axon diameter|satellite cell activation|satellite cell maintenance involved in skeletal muscle regeneration|sex differentiation|uterus development|Wnt receptor signaling pathway involved in wound healing, spreading of epidermal cells|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	cytokine activity|frizzled binding|receptor agonist activity|signal transducer activity	g.chr3:13896107C>A	D83175	CCDS2616.1	3p25	2008-07-18			ENSG00000154764	ENSG00000154764		"""Wingless-type MMTV integration sites"""	12786	protein-coding gene	gene with protein product	"""proto-oncogene Wnt7a protein"""	601570				8893824, 9161407	Standard	NM_004625		Approved		uc003bye.1	O00755	OTTHUMG00000129803	ENST00000285018.4:c.492G>T	3.37:g.13896107C>A	ENSP00000285018:p.Lys164Asn						p.K164N	NM_004625	NP_004616	O00755	WNT7A_HUMAN			3	797	-			164					Q96H90|Q9Y560	Missense_Mutation	SNP	ENST00000285018.4	37	c.492G>T	CCDS2616.1	.	.	.	.	.	.	.	.	.	.	C	18.62	3.663434	0.67700	.	.	ENSG00000154764	ENST00000285018	T	0.78003	-1.14	5.11	4.22	0.49857	.	0.104089	0.64402	D	0.000005	T	0.81442	0.4823	M	0.76838	2.35	0.53005	D	0.999968	B	0.27286	0.174	B	0.40565	0.333	T	0.82778	-0.0289	10	0.87932	D	0	.	11.0955	0.48141	0.0:0.8178:0.0:0.1822	.	164	O00755	WNT7A_HUMAN	N	164	ENSP00000285018:K164N	ENSP00000285018:K164N	K	-	3	2	WNT7A	13871108	0.982000	0.34865	1.000000	0.80357	0.997000	0.91878	0.654000	0.24918	2.386000	0.81285	0.561000	0.74099	AAG		0.612	WNT7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252031.2	NM_004625		15	184	1	0	3.27435e-08	0.00245	4.48551e-08	15	184				
C3orf20	84077	broad.mit.edu	37	3	14798940	14798940	+	Missense_Mutation	SNP	T	T	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:14798940T>G	ENST00000253697.3	+	13	2455	c.2003T>G	c.(2002-2004)cTg>cGg	p.L668R	C3orf20_ENST00000412910.1_Missense_Mutation_p.L546R|C3orf20_ENST00000435614.1_Missense_Mutation_p.L546R	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	668						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						GACTGCCCGCTGGTGCTGCGG	0.672																																							uc003byy.2		NA																	0				ovary(3)|skin(1)	4						c.(2002-2004)CTG>CGG		hypothetical protein LOC84077							45.0	45.0	45.0					3																	14798940		2203	4300	6503	SO:0001583	missense	84077					cytoplasm|integral to membrane		g.chr3:14798940T>G	AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.2003T>G	3.37:g.14798940T>G	ENSP00000253697:p.Leu668Arg					C3orf20_uc003byz.2_Missense_Mutation_p.L546R|C3orf20_uc003bza.2_Missense_Mutation_p.L546R|C3orf20_uc003bzb.1_Missense_Mutation_p.L169R|C3orf20_uc011avj.1_5'UTR	p.L668R	NM_032137	NP_115513	Q8ND61	CC020_HUMAN			13	2407	+			668					Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	ENST00000253697.3	37	c.2003T>G	CCDS33706.1	.	.	.	.	.	.	.	.	.	.	T	14.64	2.595711	0.46318	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.12672	2.94;2.66;2.66	4.95	4.95	0.65309	.	0.000000	0.39615	N	0.001301	T	0.34687	0.0906	M	0.72479	2.2	0.36908	D	0.890746	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.999	T	0.40515	-0.9559	10	0.87932	D	0	-15.3045	11.0227	0.47728	0.0:0.0:0.0:1.0	.	546;668	Q8ND61-2;Q8ND61	.;CC020_HUMAN	R	668;546;546	ENSP00000253697:L668R;ENSP00000402933:L546R;ENSP00000396081:L546R	ENSP00000253697:L668R	L	+	2	0	C3orf20	14773944	0.999000	0.42202	0.927000	0.36925	0.196000	0.23810	4.015000	0.57152	1.864000	0.54056	0.247000	0.18012	CTG		0.672	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137		13	46	0	0	0	0.013537	0	13	46				
ZFYVE20	64145	broad.mit.edu	37	3	15116382	15116382	+	Missense_Mutation	SNP	C	C	A	rs139040870		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:15116382C>A	ENST00000253699.3	-	14	1875	c.1262G>T	c.(1261-1263)cGa>cTa	p.R421L	ZFYVE20_ENST00000476527.2_Missense_Mutation_p.R421L	NM_022340.2	NP_071735.2	Q9H1K0	RBNS5_HUMAN	zinc finger, FYVE domain containing 20	421	Necessary for the interaction with EHD1.|Necessary for the interaction with RAB4A.				blood coagulation (GO:0007596)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	endosome (GO:0005768)|endosome membrane (GO:0010008)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|skin(3)|stomach(1)|urinary_tract(2)	26						GTTGGCCGCTCGAGAAGCCAG	0.632																																							uc003bzm.1		NA																	0				skin(2)	2						c.(1261-1263)CGA>CTA		FYVE-finger-containing Rab5 effector protein		C	LEU/ARG	0,4406		0,0,2203	36.0	40.0	39.0		1262	0.6	0.0	3	dbSNP_134	39	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZFYVE20	NM_022340.2	102	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	benign	421/785	15116382	1,13005	2203	4300	6503	SO:0001583	missense	64145				blood coagulation|endosome transport|protein transport	early endosome membrane|plasma membrane	protein binding|zinc ion binding	g.chr3:15116382C>A	AY009133	CCDS2623.1	3p25.1	2014-01-15			ENSG00000131381	ENSG00000131381		"""Zinc fingers, FYVE domain containing"""	20759	protein-coding gene	gene with protein product		609511				11062261	Standard	XR_427283		Approved	Rabenosyn-5	uc003bzm.1	Q9H1K0	OTTHUMG00000129860	ENST00000253699.3:c.1262G>T	3.37:g.15116382C>A	ENSP00000253699:p.Arg421Leu					ZFYVE20_uc010hek.1_Missense_Mutation_p.R421L	p.R421L	NM_022340	NP_071735	Q9H1K0	RBNS5_HUMAN			14	1876	-			421			Necessary for the interaction with RAB4A.|Necessary for the interaction with EHD1.		B4DWY8|C9J4P5|Q3KP30|Q59EY8|Q8NAQ1	Missense_Mutation	SNP	ENST00000253699.3	37	c.1262G>T	CCDS2623.1	.	.	.	.	.	.	.	.	.	.	C	9.443	1.088560	0.20390	0.0	1.16E-4	ENSG00000131381	ENST00000253699;ENST00000476527	T;T	0.52526	0.66;0.66	5.54	0.643	0.17770	.	0.506976	0.21105	N	0.080089	T	0.30039	0.0752	L	0.38175	1.15	0.09310	N	1	B	0.18610	0.029	B	0.12156	0.007	T	0.15694	-1.0428	10	0.21540	T	0.41	0.5825	5.5315	0.16987	0.1206:0.5322:0.0:0.3472	.	421	Q9H1K0	RBNS5_HUMAN	L	421	ENSP00000253699:R421L;ENSP00000422551:R421L	ENSP00000253699:R421L	R	-	2	0	ZFYVE20	15091386	0.001000	0.12720	0.000000	0.03702	0.752000	0.42762	0.067000	0.14510	-0.163000	0.10946	-0.440000	0.05779	CGA		0.632	ZFYVE20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252102.2	NM_022340		9	63	1	0	1.58986e-06	0.008291	2.01341e-06	9	63				
COLQ	8292	broad.mit.edu	37	3	15499779	15499779	+	Missense_Mutation	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:15499779T>C	ENST00000383788.5	-	13	993	c.868A>G	c.(868-870)Aga>Gga	p.R290G	COLQ_ENST00000383781.4_Missense_Mutation_p.R280G|COLQ_ENST00000435459.2_Missense_Mutation_p.R280G|COLQ_ENST00000383786.5_Missense_Mutation_p.R256G|COLQ_ENST00000383785.2_3'UTR|COLQ_ENST00000603808.1_Missense_Mutation_p.R290G|COLQ_ENST00000383787.2_Missense_Mutation_p.R281G	NM_005677.3	NP_005668.2	Q9Y215	COLQ_HUMAN	collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase	290	Collagen-like 2.				acetylcholine catabolic process in synaptic cleft (GO:0001507)|asymmetric protein localization (GO:0008105)	basal lamina (GO:0005605)|cell junction (GO:0030054)|collagen trimer (GO:0005581)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(4)|lung(10)|skin(3)	19						CAAAGACATCTTCCTGGAGGC	0.507																																							uc003bzx.2		NA																	0					0						c.(868-870)AGA>GGA		acetylcholinesterase collagen-like tail subunit							125.0	122.0	123.0					3																	15499779		2203	4300	6503	SO:0001583	missense	8292				acetylcholine catabolic process in synaptic cleft|asymmetric protein localization	basal lamina|cell junction|collagen|extracellular space|synaptic cleft		g.chr3:15499779T>C	AF057036	CCDS33709.1, CCDS43057.1, CCDS46768.1	3p	2008-07-18			ENSG00000206561	ENSG00000206561			2226	protein-coding gene	gene with protein product	"""single strand of homotrimeric collagen-like tail subunit of asymmetric acetylcholinesterase"", ""collagenic tail of endplate acetylcholinesterase"", ""AChE Q subunit"", ""acetylcholinesterase-associated collagen"""	603033				9689136	Standard	NM_005677		Approved	EAD	uc003bzx.3	Q9Y215	OTTHUMG00000156233	ENST00000383788.5:c.868A>G	3.37:g.15499779T>C	ENSP00000373298:p.Arg290Gly					COLQ_uc003bzv.2_Missense_Mutation_p.R280G|COLQ_uc003bzz.2_Missense_Mutation_p.R281G|COLQ_uc010heo.2_Missense_Mutation_p.R256G|COLQ_uc003cac.1_RNA|COLQ_uc003cae.1_Missense_Mutation_p.R149G|COLQ_uc003cad.1_RNA	p.R290G	NM_005677	NP_005668	Q9Y215	COLQ_HUMAN			13	994	-			290			Collagen-like 2.		B3KY09|Q6DK18|Q6YH18|Q6YH19|Q6YH20|Q6YH21|Q9NP18|Q9NP19|Q9NP20|Q9NP21|Q9NP22|Q9NP23|Q9NP24|Q9UP88	Missense_Mutation	SNP	ENST00000383788.5	37	c.868A>G	CCDS33709.1	.	.	.	.	.	.	.	.	.	.	T	16.32	3.091284	0.55968	.	.	ENSG00000206561	ENST00000383787;ENST00000383781;ENST00000435459;ENST00000383788;ENST00000420589;ENST00000454772;ENST00000383786	D;D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81;-2.81	5.94	3.45	0.39498	.	0.139729	0.64402	D	0.000010	D	0.90150	0.6922	L	0.54323	1.7	0.80722	D	1	P;B;P;D	0.58268	0.921;0.342;0.936;0.982	B;B;P;P	0.49887	0.359;0.154;0.492;0.625	D	0.88249	0.2915	10	0.49607	T	0.09	-11.0626	12.7779	0.57459	0.0:0.0:0.2587:0.7413	.	256;281;290;280	Q9Y215-3;Q9Y215-5;Q9Y215;Q9Y215-2	.;.;COLQ_HUMAN;.	G	281;280;280;290;280;290;256	ENSP00000373297:R281G;ENSP00000373291:R280G;ENSP00000402511:R280G;ENSP00000373298:R290G;ENSP00000373296:R256G	ENSP00000373291:R280G	R	-	1	2	COLQ	15474783	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.969000	0.40510	0.449000	0.26747	0.459000	0.35465	AGA		0.507	COLQ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000343575.1	NM_005677		14	72	0	0	0	0.00245	0	14	72				
KCNH8	131096	broad.mit.edu	37	3	19575454	19575454	+	Missense_Mutation	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:19575454T>A	ENST00000328405.2	+	16	3453	c.3187T>A	c.(3187-3189)Ttc>Atc	p.F1063I		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	1063	Ser-rich.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						TGTGAGTTCCTTCAGTCTGGA	0.483																																					NSCLC(124;1625 1765 8018 24930 42026)	NSCLC(124;1625 1765 8018 24930 42026)	uc003cbk.1		NA																	0				lung(4)|ovary(1)	5						c.(3187-3189)TTC>ATC		potassium voltage-gated channel, subfamily H,							66.0	64.0	64.0					3																	19575454		2203	4300	6503	SO:0001583	missense	131096					integral to membrane	two-component sensor activity	g.chr3:19575454T>A	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.3187T>A	3.37:g.19575454T>A	ENSP00000328813:p.Phe1063Ile					KCNH8_uc010hex.1_Missense_Mutation_p.F524I	p.F1063I	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN			16	3382	+			1063			Ser-rich.|Cytoplasmic (Potential).		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	c.3187T>A	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	T	12.26	1.883817	0.33255	.	.	ENSG00000183960	ENST00000328405	D	0.98400	-4.91	5.5	3.16	0.36331	.	0.254877	0.19830	U	0.105101	D	0.94696	0.8289	L	0.40543	1.245	0.80722	D	1	B	0.20368	0.044	B	0.15870	0.014	D	0.90171	0.4235	9	.	.	.	.	6.1399	0.20253	0.0:0.4119:0.0:0.5881	.	1063	Q96L42	KCNH8_HUMAN	I	1063	ENSP00000328813:F1063I	.	F	+	1	0	KCNH8	19550458	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.229000	0.32600	0.938000	0.37419	0.533000	0.62120	TTC		0.483	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633		9	70	0	0	0	0.004482	0	9	70				
MYRIP	25924	broad.mit.edu	37	3	39942332	39942332	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:39942332G>A	ENST00000302541.6	+	2	367	c.25G>A	c.(25-27)Ggt>Agt	p.G9S	MYRIP_ENST00000396217.3_5'UTR|MYRIP_ENST00000425621.1_Missense_Mutation_p.G9S|MYRIP_ENST00000444716.1_Missense_Mutation_p.G9S	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	9	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		GGACCTGTCTGGTTTGACTGA	0.418																																							uc003cka.2		NA																	0				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						c.(25-27)GGT>AGT		myosin VIIA and Rab interacting protein							167.0	156.0	159.0					3																	39942332		2203	4300	6503	SO:0001583	missense	25924				intracellular protein transport		actin binding|zinc ion binding	g.chr3:39942332G>A	AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.25G>A	3.37:g.39942332G>A	ENSP00000301972:p.Gly9Ser					MYRIP_uc010hhu.2_RNA|MYRIP_uc010hhv.2_Missense_Mutation_p.G9S|MYRIP_uc010hhw.2_5'UTR|MYRIP_uc010hhx.1_Missense_Mutation_p.G9S	p.G9S	NM_015460	NP_056275	Q8NFW9	MYRIP_HUMAN		KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)	2	160	+			9			RabBD.		B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Missense_Mutation	SNP	ENST00000302541.6	37	c.25G>A	CCDS2689.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.701302	0.48307	.	.	ENSG00000170011	ENST00000444716;ENST00000302541;ENST00000425621	T;T;T	0.75704	-0.96;-0.96;-0.96	5.37	2.55	0.30701	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE/PHD-type (1);	0.081242	0.46758	N	0.000261	T	0.54711	0.1875	N	0.22421	0.69	0.43499	D	0.995744	B;B;B	0.21071	0.01;0.018;0.051	B;B;B	0.15052	0.005;0.012;0.008	T	0.40194	-0.9576	9	.	.	.	.	7.7805	0.29062	0.3431:0.0:0.6569:0.0	.	9;9;9	B3KWW4;G3XAI8;Q8NFW9	.;.;MYRIP_HUMAN	S	9	ENSP00000398665:G9S;ENSP00000301972:G9S;ENSP00000389323:G9S	.	G	+	1	0	MYRIP	39917336	1.000000	0.71417	0.862000	0.33874	0.999000	0.98932	3.296000	0.51802	0.766000	0.33244	0.650000	0.86243	GGT		0.418	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254181.2	NM_015460		19	91	0	0	0	0.00278	0	19	91				
COL7A1	1294	broad.mit.edu	37	3	48628953	48628953	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:48628953G>T	ENST00000328333.8	-	12	1687	c.1580C>A	c.(1579-1581)tCc>tAc	p.S527Y	COL7A1_ENST00000454817.1_Missense_Mutation_p.S527Y	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	527	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region (NC1).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGGGCTCCAGGACACTCGCAC	0.642																																							uc003ctz.2		NA																	0				ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11						c.(1579-1581)TCC>TAC		alpha 1 type VII collagen precursor							65.0	71.0	69.0					3																	48628953		2203	4300	6503	SO:0001583	missense	1294				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity	g.chr3:48628953G>T	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.1580C>A	3.37:g.48628953G>T	ENSP00000332371:p.Ser527Tyr						p.S527Y	NM_000094	NP_000085	Q02388	CO7A1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)	12	1581	-			527			Fibronectin type-III 4.|Nonhelical region (NC1).		Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	c.1580C>A	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	G	13.13	2.144044	0.37825	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	T;T	0.61742	0.08;0.08	4.82	4.82	0.62117	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.154041	0.30410	N	0.009698	T	0.66548	0.2800	L	0.40543	1.245	0.35003	D	0.756122	D	0.67145	0.996	D	0.64877	0.93	T	0.75351	-0.3348	10	0.66056	D	0.02	.	15.4917	0.75611	0.0:0.1485:0.8515:0.0	.	527	Q02388	CO7A1_HUMAN	Y	527	ENSP00000332371:S527Y;ENSP00000412569:S527Y	ENSP00000332371:S527Y	S	-	2	0	COL7A1	48603957	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.282000	0.51693	2.613000	0.88420	0.561000	0.74099	TCC		0.642	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094		14	95	1	0	2.61681e-11	0.00245	4.01665e-11	14	95				
PARP3	10039	broad.mit.edu	37	3	51978525	51978525	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:51978525G>A	ENST00000417220.2	+	5	920	c.432G>A	c.(430-432)gtG>gtA	p.V144V	PARP3_ENST00000431474.1_Silent_p.V144V|RRP9_ENST00000232888.6_5'Flank|PARP3_ENST00000398755.3_Silent_p.V151V			Q9Y6F1	PARP3_HUMAN	poly (ADP-ribose) polymerase family, member 3	144					DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|positive regulation of DNA ligation (GO:0051106)|protein ADP-ribosylation (GO:0006471)|protein localization to site of double-strand break (GO:1990166)|regulation of mitotic spindle organization (GO:0060236)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	catalytic activity (GO:0003824)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ACCACTTTGTGTCTCACCCGG	0.517																																							uc003dby.2		NA																	0				ovary(1)	1						c.(430-432)GTG>GTA		poly (ADP-ribose) polymerase family, member 3							122.0	139.0	134.0					3																	51978525		2073	4202	6275	SO:0001819	synonymous_variant	10039				DNA repair|protein ADP-ribosylation	centriole|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding	g.chr3:51978525G>A	AF083068	CCDS43097.1, CCDS46839.1	3p22.2-p21.1	2010-07-14	2004-08-20	2004-08-26	ENSG00000041880	ENSG00000041880	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	273	protein-coding gene	gene with protein product	"""poly(ADP-ribose) synthetase-3"", ""NAD+ ADP-ribosyltransferase 3"", ""poly(ADP-ribose) polymerase 3"""	607726	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 3"""	ADPRTL3		10329013	Standard	NM_001003931		Approved	ADPRT3, IRT1, hPARP-3, pADPRT-3	uc003dbz.3	Q9Y6F1	OTTHUMG00000156931	ENST00000417220.2:c.432G>A	3.37:g.51978525G>A						RRP9_uc003dbw.1_5'Flank|PARP3_uc003dbz.2_Silent_p.V151V	p.V144V	NM_005485	NP_005476	Q9Y6F1	PARP3_HUMAN		BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	4	803	+			144					Q8NER9|Q96CG2|Q9UG81	Silent	SNP	ENST00000417220.2	37	c.432G>A	CCDS43097.1																																																																																				0.517	PARP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348612.2	NM_005485.4		20	149	0	0	0	0.010504	0	20	149				
ACTR8	93973	broad.mit.edu	37	3	53904143	53904143	+	Missense_Mutation	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:53904143T>A	ENST00000335754.3	-	12	1697	c.1597A>T	c.(1597-1599)Agc>Tgc	p.S533C	ACTR8_ENST00000488802.1_5'UTR|ACTR8_ENST00000482349.1_Missense_Mutation_p.S422C|ACTR8_ENST00000231909.7_Missense_Mutation_p.S238C	NM_022899.4	NP_075050.3	Q9H981	ARP8_HUMAN	ARP8 actin-related protein 8 homolog (yeast)	533					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	ATP binding (GO:0005524)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		AGGATGGAGCTGTACATCTTC	0.443																																							uc003dhd.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1597-1599)AGC>TGC		actin-related protein 8							174.0	152.0	160.0					3																	53904143		2203	4300	6503	SO:0001583	missense	93973				cell division|DNA recombination|DNA repair|mitosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex	protein binding	g.chr3:53904143T>A		CCDS2875.1	3p21.31	2011-07-06	2001-11-28		ENSG00000113812	ENSG00000113812		"""INO80 complex subunits"""	14672	protein-coding gene	gene with protein product	"""INO80 complex subunit N"""		"""ARP8 (actin-related protein 8, yeast) homolog"""			18163988, 16230350	Standard	NM_022899		Approved	INO80N	uc003dhd.3	Q9H981	OTTHUMG00000158279	ENST00000335754.3:c.1597A>T	3.37:g.53904143T>A	ENSP00000336842:p.Ser533Cys					ACTR8_uc003dhb.2_Missense_Mutation_p.S238C|ACTR8_uc003dhc.2_Missense_Mutation_p.S422C	p.S533C	NM_022899	NP_075050	Q9H981	ARP8_HUMAN		BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)	12	1656	-			533					B3KSW7|Q8N566|Q9H663	Missense_Mutation	SNP	ENST00000335754.3	37	c.1597A>T	CCDS2875.1	.	.	.	.	.	.	.	.	.	.	T	17.92	3.506365	0.64410	.	.	ENSG00000113812	ENST00000335754;ENST00000482349;ENST00000231909	D;D;D	0.97850	-3.55;-3.55;-4.57	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.98188	0.9401	M	0.69185	2.1	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.74348	0.983;0.912	D	0.98331	1.0533	10	0.44086	T	0.13	-3.0685	13.8947	0.63764	0.0:0.0:0.0:1.0	.	533;238	Q9H981;Q9H981-3	ARP8_HUMAN;.	C	533;422;238	ENSP00000336842:S533C;ENSP00000419429:S422C;ENSP00000231909:S238C	ENSP00000231909:S238C	S	-	1	0	ACTR8	53879183	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.674000	0.83992	2.081000	0.62600	0.533000	0.62120	AGC		0.443	ACTR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350562.2	NM_022899		12	66	0	0	0	0.00245	0	12	66				
EBLN2	55096	broad.mit.edu	37	3	73111553	73111553	+	Silent	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:73111553C>G	ENST00000533473.1	+	1	744	c.321C>G	c.(319-321)gcC>gcG	p.A107A	PPP4R2_ENST00000295862.9_Intron|PPP4R2_ENST00000356692.5_Intron|PPP4R2_ENST00000394284.3_Intron	NM_018029.3	NP_060499.3	Q6P2I7	EBLN2_HUMAN	endogenous Bornavirus-like nucleoprotein 2	107										endometrium(1)|large_intestine(3)|lung(1)|prostate(1)	6						AAAAAGCAGCCAAGTCTATGC	0.423																																							uc003dpj.2		NA																	0					0						c.(319-321)GCC>GCG		hypothetical protein LOC55096							56.0	52.0	53.0					3																	73111553		1908	4112	6020	SO:0001819	synonymous_variant	55096						protein binding	g.chr3:73111553C>G		CCDS54608.1	3p13	2011-06-03			ENSG00000255423	ENSG00000255423			25493	protein-coding gene	gene with protein product	"""endogenous Borna-like N element 2"""	613250				20054395, 20686665	Standard	NM_018029		Approved		uc003dpj.3	Q6P2I7	OTTHUMG00000165897	ENST00000533473.1:c.321C>G	3.37:g.73111553C>G						PPP4R2_uc003dph.1_Intron|PPP4R2_uc003dpi.1_Intron	p.A107A	NM_018029	NP_060499	Q6P2I7	EBLN2_HUMAN		Epithelial(33;3.9e-05)|BRCA - Breast invasive adenocarcinoma(55;7.72e-05)|LUSC - Lung squamous cell carcinoma(21;0.00156)|Lung(16;0.00487)|KIRC - Kidney renal clear cell carcinoma(39;0.012)|Kidney(39;0.0139)	1	744	+		Prostate(10;0.0187)|Lung SC(41;0.236)	107					Q8WWH3|Q9NW89	Silent	SNP	ENST00000533473.1	37	c.321C>G	CCDS54608.1																																																																																				0.423	EBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386932.1	NM_018029		4	20	0	0	0	0.009096	0	4	20				
EPHA3	2042	broad.mit.edu	37	3	89499492	89499492	+	Missense_Mutation	SNP	C	C	A	rs559771730		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:89499492C>A	ENST00000336596.2	+	15	2887	c.2662C>A	c.(2662-2664)Ctg>Atg	p.L888M	EPHA3_ENST00000494014.1_Missense_Mutation_p.L888M	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	888					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TCCCGGCAGCCTGAAGATCAT	0.443										TSP Lung(6;0.00050)																													uc003dqy.2		NA																	0				lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33						c.(2662-2664)CTG>ATG		ephrin receptor EphA3 isoform a precursor							70.0	65.0	67.0					3																	89499492		2203	4300	6503	SO:0001583	missense	2042					extracellular region|integral to plasma membrane	ATP binding	g.chr3:89499492C>A	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2662C>A	3.37:g.89499492C>A	ENSP00000337451:p.Leu888Met	TSP Lung(6;0.00050)				EPHA3_uc010hon.1_RNA	p.L888M	NM_005233	NP_005224	P29320	EPHA3_HUMAN		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)	15	2887	+	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)	888			Cytoplasmic (Potential).		Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	c.2662C>A	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.685251	0.88639	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	T;T	0.64260	-0.09;-0.09	5.66	5.66	0.87406	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.80763	0.4685	M	0.78223	2.4	0.80722	D	1	D	0.71674	0.998	D	0.83275	0.996	T	0.80281	-0.1448	9	.	.	.	.	19.7534	0.96277	0.0:1.0:0.0:0.0	.	888	P29320	EPHA3_HUMAN	M	888	ENSP00000337451:L888M;ENSP00000419190:L888M	.	L	+	1	2	EPHA3	89582182	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.960000	0.63673	2.673000	0.90976	0.650000	0.86243	CTG		0.443	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233		10	50	1	0	0.000442599	0.006214	0.000496366	10	50				
PROS1	5627	broad.mit.edu	37	3	93615497	93615497	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:93615497C>A	ENST00000394236.3	-	9	1204	c.888G>T	c.(886-888)aaG>aaT	p.K296N	PROS1_ENST00000407433.1_Missense_Mutation_p.K165N	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	296					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)			endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	GTAATTCATACTTTGTGTCAA	0.363																																							uc003drb.3		NA																	0				large_intestine(1)	1						c.(886-888)AAG>AAT		protein S, alpha preproprotein	Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)						80.0	87.0	85.0					3																	93615497		2203	4300	6503	SO:0001583	missense	5627				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity	g.chr3:93615497C>A		CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.888G>T	3.37:g.93615497C>A	ENSP00000377783:p.Lys296Asn					PROS1_uc010hoo.2_Missense_Mutation_p.K165N|PROS1_uc003dqz.3_Missense_Mutation_p.K165N	p.K296N	NM_000313	NP_000304	P07225	PROS_HUMAN			9	1229	-			296					A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	ENST00000394236.3	37	c.888G>T	CCDS2923.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.649574	0.00785	.	.	ENSG00000184500	ENST00000394236;ENST00000407433	T;T	0.78364	-1.17;-1.17	4.04	1.5	0.22942	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.113265	0.64402	N	0.000015	T	0.34279	0.0892	N	0.00251	-1.775	0.25246	N	0.989711	B	0.02656	0.0	B	0.01281	0.0	T	0.43893	-0.9363	10	0.07990	T	0.79	.	5.7816	0.18310	0.7307:0.1769:0.0924:0.0	.	296	P07225	PROS_HUMAN	N	296;165	ENSP00000377783:K296N;ENSP00000385794:K165N	ENSP00000377783:K296N	K	-	3	2	PROS1	95098187	1.000000	0.71417	0.999000	0.59377	0.389000	0.30415	1.642000	0.37207	0.126000	0.18424	0.305000	0.20034	AAG		0.363	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313		33	136	1	0	1.07637e-12	0.004878	1.72707e-12	33	136				
C3orf30	152405	broad.mit.edu	37	3	118865732	118865732	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:118865732C>A	ENST00000295622.1	+	1	736	c.696C>A	c.(694-696)gtC>gtA	p.V232V	IGSF11_ENST00000425327.2_5'Flank|IGSF11_ENST00000441144.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank|IGSF11_ENST00000354673.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	232										NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		GGTCATCCGTCCCATCTGACC	0.488																																							uc003ecb.1		NA																	0				ovary(2)	2						c.(694-696)GTC>GTA		hypothetical protein LOC152405							95.0	97.0	97.0					3																	118865732		2203	4300	6503	SO:0001819	synonymous_variant	152405							g.chr3:118865732C>A	AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.696C>A	3.37:g.118865732C>A						IGSF11_uc003eby.2_5'Flank|IGSF11_uc003ebz.2_5'Flank|IGSF11_uc010hqs.2_5'Flank|C3orf30_uc011biw.1_Silent_p.V232V	p.V232V	NM_152539	NP_689752	Q96M34	CC030_HUMAN		GBM - Glioblastoma multiforme(114;0.222)	1	736	+			232					A1L4B7	Silent	SNP	ENST00000295622.1	37	c.696C>A	CCDS2984.1	.	.	.	.	.	.	.	.	.	.	C	1.774	-0.483706	0.04383	.	.	ENSG00000163424	ENST00000460150;ENST00000473121	.	.	.	2.76	-3.01	0.05463	.	.	.	.	.	T	0.32255	0.0823	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35798	-0.9774	4	.	.	.	2.7375	9.9994	0.41920	0.1331:0.3564:0.5105:0.0	.	.	.	.	T	196;25	.	.	P	+	1	0	C3orf30	120348422	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.866000	0.04245	-0.811000	0.04369	-1.644000	0.00765	CCC		0.488	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354838.1	NM_152539		15	85	1	0	4.14922e-12	0.004007	6.54221e-12	15	85				
C3orf30	152405	broad.mit.edu	37	3	118865747	118865747	+	Missense_Mutation	SNP	T	T	A	rs200739931		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:118865747T>A	ENST00000295622.1	+	1	751	c.711T>A	c.(709-711)agT>agA	p.S237R	IGSF11_ENST00000425327.2_5'Flank|IGSF11_ENST00000441144.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank|IGSF11_ENST00000354673.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	237								p.S237R(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		CTGACCAAAGTCCTTCTGTAC	0.458																																							uc003ecb.1		NA																	1	Substitution - Missense(1)		large_intestine(1)	ovary(2)	2						c.(709-711)AGT>AGA		hypothetical protein LOC152405							94.0	96.0	95.0					3																	118865747		2203	4300	6503	SO:0001583	missense	152405							g.chr3:118865747T>A	AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.711T>A	3.37:g.118865747T>A	ENSP00000295622:p.Ser237Arg					IGSF11_uc003eby.2_5'Flank|IGSF11_uc003ebz.2_5'Flank|IGSF11_uc010hqs.2_5'Flank|C3orf30_uc011biw.1_Missense_Mutation_p.S237R	p.S237R	NM_152539	NP_689752	Q96M34	CC030_HUMAN		GBM - Glioblastoma multiforme(114;0.222)	1	751	+			237					A1L4B7	Missense_Mutation	SNP	ENST00000295622.1	37	c.711T>A	CCDS2984.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	7.143|7.143	0.582174|0.582174	0.13749|0.13749	.|.	.|.	ENSG00000163424|ENSG00000163424	ENST00000295622;ENST00000470341|ENST00000460150;ENST00000473121	T|T;T	0.36699|0.32988	1.24|1.43;1.43	2.88|2.88	-4.97|-4.97	0.03029|0.03029	.|.	0.847693|0.847693	0.10287|0.10287	N|N	0.692832|0.692832	T|T	0.06962|0.06962	0.0177|0.0177	N|N	0.01576|0.01576	-0.805|-0.805	0.09310|0.09310	N|N	1|1	B;B|.	0.12630|.	0.006;0.006|.	B;B|.	0.06405|.	0.002;0.002|.	T|T	0.28933|0.28933	-1.0028|-1.0028	10|8	0.13470|0.14656	T|T	0.59|0.56	.|.	0.8514|0.8514	0.01173|0.01173	0.3472:0.296:0.2061:0.1506|0.3472:0.296:0.2061:0.1506	.|.	237;237|.	E9PFE5;Q96M34|.	.;CC030_HUMAN|.	R|T	237|201;30	ENSP00000295622:S237R|ENSP00000418207:S201T;ENSP00000419675:S30T	ENSP00000295622:S237R|ENSP00000418207:S201T	S|S	+|+	3|1	2|0	C3orf30|C3orf30	120348437|120348437	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.052000|0.052000	0.14988|0.14988	-0.232000|-0.232000	0.09055|0.09055	-1.094000|-1.094000	0.03054|0.03054	0.172000|0.172000	0.16884|0.16884	AGT|TCC		0.458	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354838.1	NM_152539		7	85	0	0	0	0.008291	0	7	85				
C3orf30	152405	broad.mit.edu	37	3	118865753	118865753	+	Silent	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:118865753T>C	ENST00000295622.1	+	1	757	c.717T>C	c.(715-717)tcT>tcC	p.S239S	IGSF11_ENST00000425327.2_5'Flank|IGSF11_ENST00000441144.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank|IGSF11_ENST00000354673.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	239										NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		AAAGTCCTTCTGTACAGATTG	0.463																																							uc003ecb.1		NA																	0				ovary(2)	2						c.(715-717)TCT>TCC		hypothetical protein LOC152405							93.0	95.0	94.0					3																	118865753		2203	4300	6503	SO:0001819	synonymous_variant	152405							g.chr3:118865753T>C	AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.717T>C	3.37:g.118865753T>C						IGSF11_uc003eby.2_5'Flank|IGSF11_uc003ebz.2_5'Flank|IGSF11_uc010hqs.2_5'Flank|C3orf30_uc011biw.1_Silent_p.S239S	p.S239S	NM_152539	NP_689752	Q96M34	CC030_HUMAN		GBM - Glioblastoma multiforme(114;0.222)	1	757	+			239					A1L4B7	Silent	SNP	ENST00000295622.1	37	c.717T>C	CCDS2984.1	.	.	.	.	.	.	.	.	.	.	T	4.551	0.102283	0.08731	.	.	ENSG00000163424	ENST00000460150;ENST00000473121	.	.	.	2.98	-4.81	0.03180	.	.	.	.	.	T	0.17066	0.0410	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24870	-1.0148	4	.	.	.	.	1.1277	0.01739	0.1392:0.2004:0.321:0.3393	.	.	.	.	R	203;32	.	.	C	+	1	0	C3orf30	120348443	0.015000	0.18098	0.000000	0.03702	0.035000	0.12851	1.077000	0.30741	-1.048000	0.03238	0.172000	0.16884	TGT		0.463	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354838.1	NM_152539		7	84	0	0	0	0.004482	0	7	84				
C3orf30	152405	broad.mit.edu	37	3	118865771	118865771	+	Silent	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:118865771A>G	ENST00000295622.1	+	1	775	c.735A>G	c.(733-735)ggA>ggG	p.G245G	IGSF11_ENST00000425327.2_5'Flank|IGSF11_ENST00000441144.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank|IGSF11_ENST00000354673.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	245										NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		TTGACAGTGGATCGTCCGTAC	0.463																																							uc003ecb.1		NA																	0				ovary(2)	2						c.(733-735)GGA>GGG		hypothetical protein LOC152405							94.0	95.0	95.0					3																	118865771		2203	4300	6503	SO:0001819	synonymous_variant	152405							g.chr3:118865771A>G	AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.735A>G	3.37:g.118865771A>G						IGSF11_uc003eby.2_5'Flank|IGSF11_uc003ebz.2_5'Flank|IGSF11_uc010hqs.2_5'Flank|C3orf30_uc011biw.1_Silent_p.G245G	p.G245G	NM_152539	NP_689752	Q96M34	CC030_HUMAN		GBM - Glioblastoma multiforme(114;0.222)	1	775	+			245					A1L4B7	Silent	SNP	ENST00000295622.1	37	c.735A>G	CCDS2984.1	.	.	.	.	.	.	.	.	.	.	A	4.573	0.106353	0.08780	.	.	ENSG00000163424	ENST00000460150;ENST00000473121	.	.	.	4.04	0.0905	0.14464	.	.	.	.	.	T	0.19046	0.0457	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21690	-1.0238	4	.	.	.	.	0.5158	0.00603	0.4474:0.1809:0.1973:0.1744	.	.	.	.	V	209;38	.	.	I	+	1	0	C3orf30	120348461	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	0.466000	0.22019	0.012000	0.14892	0.460000	0.39030	ATC		0.463	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354838.1	NM_152539		5	81	0	0	0	0.00308	0	5	81				
C3orf30	152405	broad.mit.edu	37	3	118865774	118865774	+	Silent	SNP	G	G	A	rs182702669		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:118865774G>A	ENST00000295622.1	+	1	778	c.738G>A	c.(736-738)tcG>tcA	p.S246S	IGSF11_ENST00000425327.2_5'Flank|IGSF11_ENST00000441144.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank|IGSF11_ENST00000354673.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	246								p.S246S(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		ACAGTGGATCGTCCGTACCAT	0.468													G|||	1	0.000199681	0.0	0.0014	5008	,	,		24733	0.0		0.0	False		,,,				2504	0.0						uc003ecb.1		NA																	1	Substitution - coding silent(1)		lung(1)	ovary(2)	2						c.(736-738)TCG>TCA		hypothetical protein LOC152405							93.0	95.0	94.0					3																	118865774		2203	4300	6503	SO:0001819	synonymous_variant	152405							g.chr3:118865774G>A	AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.738G>A	3.37:g.118865774G>A						IGSF11_uc003eby.2_5'Flank|IGSF11_uc003ebz.2_5'Flank|IGSF11_uc010hqs.2_5'Flank|C3orf30_uc011biw.1_Silent_p.S246S	p.S246S	NM_152539	NP_689752	Q96M34	CC030_HUMAN		GBM - Glioblastoma multiforme(114;0.222)	1	778	+			246					A1L4B7	Silent	SNP	ENST00000295622.1	37	c.738G>A	CCDS2984.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	2.980	-0.210418	0.06140	.	.	ENSG00000163424	ENST00000460150;ENST00000473121	.	.	.	4.04	-2.39	0.06602	.	.	.	.	.	T	0.28896	0.0717	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31052	-0.9957	4	.	.	.	.	7.0415	0.25023	0.2883:0.2148:0.4969:0.0	.	.	.	.	I	210;39	.	.	V	+	1	0	C3orf30	120348464	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.025000	0.12413	-0.861000	0.04094	-2.364000	0.00238	GTC		0.468	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354838.1	NM_152539		5	80	0	0	0	0.00308	0	5	80				
PLA1A	51365	broad.mit.edu	37	3	119325679	119325679	+	Silent	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:119325679T>C	ENST00000273371.4	+	2	204	c.132T>C	c.(130-132)ttT>ttC	p.F44F	PLA1A_ENST00000488919.1_Intron|PLA1A_ENST00000494440.1_Silent_p.F28F|PLA1A_ENST00000495992.1_Silent_p.F44F	NM_015900.3	NP_056984.1	Q53H76	PLA1A_HUMAN	phospholipase A1 member A	44					lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|phosphatidylserine metabolic process (GO:0006658)	extracellular vesicular exosome (GO:0070062)	phosphatidylcholine 1-acylhydrolase activity (GO:0008970)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CCAACCTTTTTGAAGGCACCG	0.512																																							uc003ecu.2		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(130-132)TTT>TTC		phospholipase A1 member A precursor							118.0	118.0	118.0					3																	119325679		2203	4300	6503	SO:0001819	synonymous_variant	51365				lipid catabolic process|phosphatidylserine metabolic process	extracellular region	phospholipase A1 activity	g.chr3:119325679T>C	AF035268	CCDS2991.1, CCDS56268.1, CCDS56269.1	3q13.13-q13.2	2002-11-28			ENSG00000144837	ENSG00000144837			17661	protein-coding gene	gene with protein product		607460				10196188	Standard	NM_015900		Approved	ps-PLA1	uc003ecu.3	Q53H76	OTTHUMG00000159425	ENST00000273371.4:c.132T>C	3.37:g.119325679T>C						PLA1A_uc003ecv.2_Silent_p.F44F|PLA1A_uc003ecw.2_RNA|PLA1A_uc011bjc.1_Intron	p.F44F	NM_015900	NP_056984	Q53H76	PLA1A_HUMAN			2	171	+			44					B2R8V2|B4DXA2|O95991|Q86WX6|Q9UPD2	Silent	SNP	ENST00000273371.4	37	c.132T>C	CCDS2991.1																																																																																				0.512	PLA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355252.2			31	155	0	0	0	0.012213	0	31	155				
GTF2E1	2960	broad.mit.edu	37	3	120489651	120489651	+	Silent	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:120489651A>G	ENST00000283875.5	+	3	618	c.525A>G	c.(523-525)acA>acG	p.T175T		NM_005513.2	NP_005504.2	P29083	T2EA_HUMAN	general transcription factor IIE, polypeptide 1, alpha 56kDa	175					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)	22				GBM - Glioblastoma multiforme(114;0.159)		ATGCACGCACACTTTTGGCAA	0.428																																							uc003edz.3		NA																	0				ovary(1)	1						c.(523-525)ACA>ACG		general transcription factor IIE, polypeptide 1,							229.0	220.0	223.0					3																	120489651		2203	4300	6503	SO:0001819	synonymous_variant	2960				interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding|zinc ion binding	g.chr3:120489651A>G	S67859	CCDS3002.1	3q21-q24	2010-03-23	2002-08-29		ENSG00000153767	ENSG00000153767		"""General transcription factors"""	4650	protein-coding gene	gene with protein product		189962	"""general transcription factor IIE, polypeptide 1 (alpha subunit, 56kD)"""			1454543, 8162052	Standard	NM_005513		Approved	TFIIE-A, FE	uc003edz.4	P29083	OTTHUMG00000159667	ENST00000283875.5:c.525A>G	3.37:g.120489651A>G							p.T175T	NM_005513	NP_005504	P29083	T2EA_HUMAN		GBM - Glioblastoma multiforme(114;0.159)	3	639	+			175					Q16103	Silent	SNP	ENST00000283875.5	37	c.525A>G	CCDS3002.1																																																																																				0.428	GTF2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356770.1	NM_005513		30	223	0	0	0	0.008361	0	30	223				
GOLGB1	2804	broad.mit.edu	37	3	121414623	121414623	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:121414623C>A	ENST00000340645.5	-	13	4857	c.4732G>T	c.(4732-4734)Ggt>Tgt	p.G1578C	GOLGB1_ENST00000393667.3_Missense_Mutation_p.G1583C	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1578					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TCAGTAAGACCCTCTAGAGCT	0.383																																							uc003eei.3		NA																	0				ovary(6)|breast(2)|skin(2)	10						c.(4732-4734)GGT>TGT		golgi autoantigen, golgin subfamily b,							131.0	138.0	135.0					3																	121414623		2203	4300	6503	SO:0001583	missense	2804				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding	g.chr3:121414623C>A	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.4732G>T	3.37:g.121414623C>A	ENSP00000341848:p.Gly1578Cys					GOLGB1_uc010hrc.2_Missense_Mutation_p.G1583C|GOLGB1_uc003eej.3_Missense_Mutation_p.G1544C|GOLGB1_uc011bjm.1_Missense_Mutation_p.G1464C|GOLGB1_uc010hrd.1_Missense_Mutation_p.G1542C	p.G1578C	NM_004487	NP_004478	Q14789	GOGB1_HUMAN		GBM - Glioblastoma multiforme(114;0.0989)	13	4858	-			1578			Cytoplasmic (Potential).|Potential.		B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	37	c.4732G>T	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.371201	0.42003	.	.	ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517	T;T;T	0.30182	2.19;2.18;1.54	5.76	4.89	0.63831	.	0.185567	0.38381	N	0.001703	T	0.52125	0.1715	M	0.68952	2.095	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.77557	0.99;0.99;0.984;0.984;0.931	T	0.54536	-0.8279	10	0.62326	D	0.03	.	12.386	0.55333	0.0:0.9192:0.0:0.0808	.	1503;1542;1583;1583;1578	F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.;.;.;.;GOGB1_HUMAN	C	1578;1583;1542	ENSP00000341848:G1578C;ENSP00000377275:G1583C;ENSP00000418231:G1542C	ENSP00000341848:G1578C	G	-	1	0	GOLGB1	122897313	0.713000	0.27926	0.998000	0.56505	0.997000	0.91878	2.038000	0.41184	1.430000	0.47334	0.655000	0.94253	GGT		0.383	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487		14	91	1	0	9.31168e-06	0.001855	1.11705e-05	14	91				
PODXL2	50512	broad.mit.edu	37	3	127379625	127379625	+	Missense_Mutation	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:127379625A>G	ENST00000342480.6	+	3	793	c.754A>G	c.(754-756)Aca>Gca	p.T252A		NM_015720.2	NP_056535.1	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2	252					leukocyte tethering or rolling (GO:0050901)	integral component of plasma membrane (GO:0005887)	glycosaminoglycan binding (GO:0005539)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	26						CACCCCAACTACAGTGACTCC	0.627																																							uc003ejq.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(754-756)ACA>GCA		podocalyxin-like 2 precursor							40.0	44.0	43.0					3																	127379625		2203	4300	6503	SO:0001583	missense	50512				leukocyte tethering or rolling	integral to plasma membrane	glycosaminoglycan binding|protein binding	g.chr3:127379625A>G	AF219137	CCDS3044.1	3q21.3	2005-02-18			ENSG00000114631	ENSG00000114631			17936	protein-coding gene	gene with protein product	"""endoglycan"""					10722749	Standard	NM_015720		Approved	PODLX2, endoglycan	uc003ejq.3	Q9NZ53	OTTHUMG00000159642	ENST00000342480.6:c.754A>G	3.37:g.127379625A>G	ENSP00000345359:p.Thr252Ala						p.T252A	NM_015720	NP_056535	Q9NZ53	PDXL2_HUMAN			3	778	+			252			Extracellular (Potential).		Q6UVY4|Q8WUV6	Missense_Mutation	SNP	ENST00000342480.6	37	c.754A>G	CCDS3044.1	.	.	.	.	.	.	.	.	.	.	A	5.268	0.234856	0.09969	.	.	ENSG00000114631	ENST00000342480;ENST00000302192	T	0.25085	1.82	4.67	-1.44	0.08856	.	0.300709	0.28828	N	0.014013	T	0.12305	0.0299	L	0.32530	0.975	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.15464	-1.0436	10	0.23302	T	0.38	-0.2066	1.2588	0.01997	0.5197:0.1549:0.187:0.1384	.	252	Q9NZ53	PDXL2_HUMAN	A	252	ENSP00000345359:T252A	ENSP00000304498:T252A	T	+	1	0	PODXL2	128862315	0.001000	0.12720	0.001000	0.08648	0.140000	0.21249	0.530000	0.23036	-0.416000	0.07473	0.402000	0.26972	ACA		0.627	PODXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356638.1	NM_015720		11	62	0	0	0	0.008291	0	11	62				
DNAJC13	23317	broad.mit.edu	37	3	132226082	132226082	+	Splice_Site	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:132226082G>T	ENST00000260818.6	+	43	5248	c.5000G>T	c.(4999-5001)gGt>gTt	p.G1667V		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1667					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						TTTAAAAAGGGTGATTGTGAC	0.308																																							uc003eor.2		NA																	0				ovary(1)|breast(1)	2						c.(4999-5001)GGT>GTT		DnaJ (Hsp40) homolog, subfamily C, member 13							129.0	132.0	131.0					3																	132226082		2203	4300	6503	SO:0001630	splice_region_variant	23317						heat shock protein binding	g.chr3:132226082G>T	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.4999-1G>T	3.37:g.132226082G>T							p.G1667V	NM_015268	NP_056083	O75165	DJC13_HUMAN			43	5065	+			1667					Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	ENST00000260818.6	37	c.5000G>T	CCDS33857.1	.	.	.	.	.	.	.	.	.	.	G	17.71	3.457344	0.63401	.	.	ENSG00000138246	ENST00000260818;ENST00000538066	T	0.20069	2.1	5.75	5.75	0.90469	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.51702	0.1690	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.47100	-0.9143	10	0.42905	T	0.14	.	19.938	0.97149	0.0:0.0:1.0:0.0	.	1667	O75165	DJC13_HUMAN	V	1667;314	ENSP00000260818:G1667V	ENSP00000260818:G1667V	G	+	2	0	DNAJC13	133708772	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.524000	0.98036	2.701000	0.92244	0.585000	0.79938	GGT		0.308	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268	Missense_Mutation	9	59	1	0	0.00448238	0.004482	0.00485591	9	59				
CLSTN2	64084	broad.mit.edu	37	3	140185493	140185493	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:140185493C>A	ENST00000458420.3	+	8	1454	c.1264C>A	c.(1264-1266)Cgc>Agc	p.R422S		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	422					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						GCACAACTGCCGCCTCGTCTT	0.542										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)	GBM(45;858 913 3709 36904 37282)	uc003etn.2		NA																	0				skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						c.(1264-1266)CGC>AGC		calsyntenin 2 precursor							88.0	81.0	84.0					3																	140185493		2203	4300	6503	SO:0001583	missense	64084				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding	g.chr3:140185493C>A	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.1264C>A	3.37:g.140185493C>A	ENSP00000402460:p.Arg422Ser	HNSCC(16;0.037)				CLSTN2_uc003etm.2_Missense_Mutation_p.R422S	p.R422S	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN			8	1454	+			422			Extracellular (Potential).		B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	c.1264C>A	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.620391	0.87460	.	.	ENSG00000158258	ENST00000458420	T	0.02140	4.43	5.2	5.2	0.72013	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.052800	0.85682	D	0.000000	T	0.12008	0.0292	M	0.81497	2.545	0.80722	D	1	D	0.56287	0.975	P	0.60682	0.878	T	0.00033	-1.2269	10	0.87932	D	0	-4.9903	16.2868	0.82725	0.0:1.0:0.0:0.0	.	422	Q9H4D0	CSTN2_HUMAN	S	422	ENSP00000402460:R422S	ENSP00000402460:R422S	R	+	1	0	CLSTN2	141668183	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.745000	0.62125	2.706000	0.92434	0.655000	0.94253	CGC		0.542	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131		4	72	1	0	1.024e-07	0.000602	1.38197e-07	4	72				
ZIC4	84107	broad.mit.edu	37	3	147108970	147108970	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:147108970C>T	ENST00000383075.3	-	4	1264	c.752G>A	c.(751-753)cGt>cAt	p.R251H	ZIC4_ENST00000525172.2_Missense_Mutation_p.R301H|ZIC4_ENST00000425731.3_Missense_Mutation_p.R289H|ZIC4_ENST00000473123.1_Missense_Mutation_p.R251H|ZIC4_ENST00000472749.2_5'UTR|ZIC4_ENST00000484399.1_Missense_Mutation_p.R251H|ZIC4_ENST00000491672.1_Missense_Mutation_p.R45H	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	251						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						ATGCTTCTTACGGTCGCTGCT	0.617																																							uc003ewd.1		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(751-753)CGT>CAT		zinc finger protein of the cerebellum 4							37.0	39.0	38.0					3																	147108970		2201	4300	6501	SO:0001583	missense	84107					nucleus	DNA binding|zinc ion binding	g.chr3:147108970C>T	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.752G>A	3.37:g.147108970C>T	ENSP00000372553:p.Arg251His					ZIC4_uc003ewc.1_Missense_Mutation_p.R181H|ZIC4_uc011bno.1_Missense_Mutation_p.R301H	p.R251H	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN			4	1025	-			251			C2H2-type 4.		A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	ENST00000383075.3	37	c.752G>A	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	C	32	5.116027	0.94339	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000491672	T;T;T;T;T;T	0.15139	3.18;2.45;2.45;3.18;3.18;3.18	4.94	4.07	0.47477	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.148363	0.31167	N	0.008124	T	0.31231	0.0790	L	0.38175	1.15	0.51233	D	0.999915	D;D	0.89917	1.0;1.0	D;D	0.91635	0.995;0.999	T	0.41484	-0.9506	9	0.87932	D	0	.	13.2362	0.59971	0.0:0.9227:0.0:0.0773	.	301;251	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	H	251;289;301;251;251;45	ENSP00000372553:R251H;ENSP00000397695:R289H;ENSP00000435509:R301H;ENSP00000417855:R251H;ENSP00000420775:R251H;ENSP00000418277:R45H	ENSP00000372553:R251H	R	-	2	0	ZIC4	148591660	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.734000	0.84928	1.067000	0.40740	0.462000	0.41574	CGT		0.617	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1			5	39	0	0	0	0.001984	0	5	39				
ZIC4	84107	broad.mit.edu	37	3	147113693	147113693	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:147113693C>A	ENST00000383075.3	-	3	1146	c.634G>T	c.(634-636)Ggg>Tgg	p.G212W	ZIC4_ENST00000525172.2_Missense_Mutation_p.G262W|ZIC4_ENST00000425731.3_Missense_Mutation_p.G250W|ZIC4_ENST00000473123.1_Missense_Mutation_p.G212W|ZIC4_ENST00000484399.1_Missense_Mutation_p.G212W|ZIC4_ENST00000491672.1_Intron	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	212						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						AAGACCTTCCCACACCCCGGG	0.537																																							uc003ewd.1		NA																	0				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						c.(634-636)GGG>TGG		zinc finger protein of the cerebellum 4							78.0	90.0	86.0					3																	147113693		2197	4300	6497	SO:0001583	missense	84107					nucleus	DNA binding|zinc ion binding	g.chr3:147113693C>A	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.634G>T	3.37:g.147113693C>A	ENSP00000372553:p.Gly212Trp					ZIC4_uc003ewc.1_Missense_Mutation_p.G142W|ZIC4_uc011bno.1_Missense_Mutation_p.G262W	p.G212W	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN			3	907	-			212			C2H2-type 3.		A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	ENST00000383075.3	37	c.634G>T	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.547806	0.86022	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000462748	D;D;D;D;D;D	0.97710	-4.5;-4.5;-4.5;-4.5;-4.5;-4.5	5.27	5.27	0.74061	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47093	D	0.000258	D	0.98927	0.9636	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.994;1.0	D	0.99790	1.1031	10	0.87932	D	0	.	18.8843	0.92370	0.0:1.0:0.0:0.0	.	262;212	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	W	212;250;262;212;212;212	ENSP00000372553:G212W;ENSP00000397695:G250W;ENSP00000435509:G262W;ENSP00000417855:G212W;ENSP00000420775:G212W;ENSP00000420627:G212W	ENSP00000372553:G212W	G	-	1	0	ZIC4	148596383	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.089000	0.71384	2.460000	0.83146	0.561000	0.74099	GGG		0.537	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1			29	128	1	0	4.87955e-14	0.005443	8.05253e-14	29	128				
SLITRK3	22865	broad.mit.edu	37	3	164906009	164906009	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:164906009C>A	ENST00000475390.1	-	2	3053	c.2610G>T	c.(2608-2610)gtG>gtT	p.V870V	SLITRK3_ENST00000241274.3_Silent_p.V870V			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	870					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						GAGGAAACAGCACCACCCCAC	0.587										HNSCC(40;0.11)																													uc003fej.3		NA																	0				ovary(6)|skin(3)|pancreas(1)	10						c.(2608-2610)GTG>GTT		slit and trk like 3 protein precursor							68.0	64.0	65.0					3																	164906009		2203	4300	6503	SO:0001819	synonymous_variant	22865					integral to membrane		g.chr3:164906009C>A	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2610G>T	3.37:g.164906009C>A		HNSCC(40;0.11)				SLITRK3_uc003fek.2_Silent_p.V870V	p.V870V	NM_014926	NP_055741	O94933	SLIK3_HUMAN			2	3054	-			870			Cytoplasmic (Potential).		Q1RMY6	Silent	SNP	ENST00000475390.1	37	c.2610G>T	CCDS3197.1																																																																																				0.587	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926		21	120	1	0	7.45023e-12	0.010504	1.16604e-11	21	120				
KLHL6	89857	broad.mit.edu	37	3	183209738	183209738	+	Missense_Mutation	SNP	C	C	A	rs146413670	byFrequency	TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:183209738C>A	ENST00000341319.3	-	7	1878	c.1843G>T	c.(1843-1845)Gtg>Ttg	p.V615L		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	615					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			GCTCCGGGCACGATCCTGCGG	0.667																																							uc003flr.2		NA																	0				haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3						c.(1843-1845)GTG>TTG		kelch-like 6							54.0	51.0	52.0					3																	183209738		2203	4300	6503	SO:0001583	missense	89857							g.chr3:183209738C>A	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1843G>T	3.37:g.183209738C>A	ENSP00000341342:p.Val615Leu					KLHL6_uc003fls.1_RNA|KLHL6_uc003flt.1_3'UTR|KLHL6_uc010hxk.1_RNA	p.V615L	NM_130446	NP_569713	Q8WZ60	KLHL6_HUMAN	all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)		7	1901	-	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		615					B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	ENST00000341319.3	37	c.1843G>T	CCDS3245.2	.	.	.	.	.	.	.	.	.	.	C	16.43	3.122072	0.56613	.	.	ENSG00000172578	ENST00000341319	T	0.74002	-0.8	5.65	5.65	0.86999	.	0.183712	0.48767	D	0.000165	T	0.56277	0.1974	N	0.08118	0	0.37660	D	0.922759	B	0.09022	0.002	B	0.09377	0.004	T	0.58741	-0.7583	10	0.59425	D	0.04	.	12.9871	0.58598	0.0:0.9259:0.0:0.0741	.	615	Q8WZ60	KLHL6_HUMAN	L	615	ENSP00000341342:V615L	ENSP00000341342:V615L	V	-	1	0	KLHL6	184692432	1.000000	0.71417	0.991000	0.47740	0.568000	0.35870	4.301000	0.59086	2.669000	0.90835	0.484000	0.47621	GTG		0.667	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446		12	90	1	0	5.50884e-06	0.013537	6.65869e-06	12	90				
EIF4A2	1974	broad.mit.edu	37	3	186503788	186503788	+	Silent	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:186503788T>C	ENST00000323963.5	+	5	529	c.465T>C	c.(463-465)atT>atC	p.I155I	SNORA81_ENST00000408493.2_RNA|SNORD2_ENST00000459163.1_RNA|RP11-573D15.9_ENST00000577781.1_RNA|SNORA63_ENST00000363450.1_RNA|SNORA63_ENST00000363548.1_RNA|EIF4A2_ENST00000356531.5_Silent_p.I60I|SNORA4_ENST00000584302.1_RNA|EIF4A2_ENST00000440191.2_Silent_p.I156I			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	155	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		CACCACATATTGTTGTTGGTA	0.383			T	BCL6	NHL																																		uc003fqs.2		NA		Dom	yes		3	3q27.3	1974	T	"""eukaryotic translation initiation factor 4A, isoform 2"""			L	BCL6		NHL		0				ovary(2)|breast(2)	4						c.(463-465)ATT>ATC		eukaryotic translation initiation factor 4A2							90.0	84.0	86.0					3																	186503788		2203	4300	6503	SO:0001819	synonymous_variant	1974				interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|protein binding|translation initiation factor activity	g.chr3:186503788T>C	D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.465T>C	3.37:g.186503788T>C						EIF4A2_uc003fqt.2_RNA|EIF4A2_uc003fqu.2_Silent_p.I156I|EIF4A2_uc003fqv.2_Silent_p.I60I|EIF4A2_uc003fqw.2_Silent_p.I60I|EIF4A2_uc011bsb.1_Silent_p.I28I|MIR1248_hsa-mir-1248|MI0006383_5'Flank|SNORA81_uc010hyv.1_5'Flank|SNORA63_uc010hyw.1_5'Flank|SNORA4_uc010hyx.1_5'Flank	p.I155I	NM_001967	NP_001958	Q14240	IF4A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)	5	504	+	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		155			Helicase ATP-binding.		D3DNU9|Q53XJ6|Q96B90|Q96EA8	Silent	SNP	ENST00000323963.5	37	c.465T>C	CCDS3282.1																																																																																				0.383	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1	NM_001967		6	49	0	0	0	0.001168	0	6	49				
LRRC15	131578	broad.mit.edu	37	3	194081447	194081447	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:194081447G>T	ENST00000347624.3	-	2	411	c.326C>A	c.(325-327)gCc>gAc	p.A109D	LRRC15_ENST00000428839.1_Missense_Mutation_p.A115D|LRRC15_ENST00000439944.2_Missense_Mutation_p.A115D	NM_130830.4	NP_570843.2	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15	109					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of cell migration (GO:0030335)|receptor-mediated virion attachment to host cell (GO:0046813)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)			biliary_tract(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(20)|ovary(4)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		CTTGTTGTTGGCGAGGCTGAG	0.602																																							uc003ftu.2		NA																	0				ovary(3)	3						c.(325-327)GCC>GAC		leucine rich repeat containing 15 isoform b							59.0	60.0	59.0					3																	194081447		2203	4300	6503	SO:0001583	missense	131578					integral to membrane		g.chr3:194081447G>T	AB071037	CCDS3306.1, CCDS46984.1	3q29	2008-02-05			ENSG00000172061	ENSG00000172061			20818	protein-coding gene	gene with protein product						12923058	Standard	NM_001135057		Approved	LIB	uc003ftu.3	Q8TF66	OTTHUMG00000156048	ENST00000347624.3:c.326C>A	3.37:g.194081447G>T	ENSP00000306276:p.Ala109Asp					LRRC15_uc003ftt.2_Missense_Mutation_p.A115D	p.A109D	NM_130830	NP_570843	Q8TF66	LRC15_HUMAN	OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)	2	412	-	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		109			LRR 3.|Extracellular (Potential).		Q495Q6|Q7RTN7	Missense_Mutation	SNP	ENST00000347624.3	37	c.326C>A	CCDS3306.1	.	.	.	.	.	.	.	.	.	.	G	19.94	3.920748	0.73213	.	.	ENSG00000172061	ENST00000347624;ENST00000439944;ENST00000428839	T;T;T	0.58060	0.36;0.36;0.36	4.8	4.8	0.61643	.	0.170771	0.39985	N	0.001215	T	0.42854	0.1221	N	0.04245	-0.25	0.38139	D	0.9384	D;D	0.56746	0.968;0.977	P;P	0.53593	0.688;0.73	T	0.43621	-0.9380	10	0.15499	T	0.54	.	18.7514	0.91818	0.0:0.0:1.0:0.0	.	109;115	Q8TF66;Q8TF66-2	LRC15_HUMAN;.	D	109;115;115	ENSP00000306276:A109D;ENSP00000389128:A115D;ENSP00000413707:A115D	ENSP00000306276:A109D	A	-	2	0	LRRC15	195562742	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	2.812000	0.47994	2.602000	0.87976	0.462000	0.41574	GCC		0.602	LRRC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342858.2			7	71	1	0	2.0095e-06	0.001984	2.5099e-06	7	71				
TACC3	10460	broad.mit.edu	37	4	1733028	1733028	+	Splice_Site	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:1733028G>A	ENST00000313288.4	+	6	1697	c.1591G>A	c.(1591-1593)Gtt>Att	p.V531I		NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	531					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			CCCCGCTGAGGGTACGTTGCC	0.622																																					Ovarian(120;482 2294 11894 35824)	Ovarian(120;482 2294 11894 35824)	uc003gdo.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(1591-1593)GTT>ATT		transforming, acidic coiled-coil containing							54.0	57.0	56.0					4																	1733028		2203	4300	6503	SO:0001630	splice_region_variant	10460					centrosome		g.chr4:1733028G>A	AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.1591+1G>A	4.37:g.1733028G>A						TACC3_uc010ibz.2_Missense_Mutation_p.V531I|TACC3_uc003gdp.2_Missense_Mutation_p.V171I|TACC3_uc010ica.2_5'UTR	p.V531I	NM_006342	NP_006333	Q9Y6A5	TACC3_HUMAN	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)		6	1699	+		Breast(71;0.212)|all_epithelial(65;0.241)	531					Q2NKK4|Q3KQS5|Q9UMQ1	Missense_Mutation	SNP	ENST00000313288.4	37	c.1591G>A	CCDS3352.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.678908	0.47886	.	.	ENSG00000013810	ENST00000485989;ENST00000313288	T;T	0.51325	0.71;2.83	4.02	4.02	0.46733	.	0.297465	0.23228	N	0.050499	T	0.49064	0.1535	L	0.41710	1.295	0.43279	D	0.995242	B;D;B	0.64830	0.166;0.994;0.021	B;P;B	0.52909	0.093;0.713;0.023	T	0.51060	-0.8753	10	0.59425	D	0.04	-20.5367	11.8341	0.52312	0.0:0.0:1.0:0.0	.	531;171;531	B4DYJ1;C9JWI7;Q9Y6A5	.;.;TACC3_HUMAN	I	171;531	ENSP00000419210:V171I;ENSP00000326550:V531I	ENSP00000326550:V531I	V	+	1	0	TACC3	1702826	0.999000	0.42202	0.922000	0.36590	0.285000	0.27093	3.917000	0.56424	2.227000	0.72691	0.462000	0.41574	GTT		0.622	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000203730.2		Missense_Mutation	16	56	0	0	0	0.00499	0	16	56				
LYAR	55646	broad.mit.edu	37	4	4275328	4275328	+	Missense_Mutation	SNP	C	C	A	rs79312020		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:4275328C>A	ENST00000343470.4	-	8	1141	c.901G>T	c.(901-903)Gat>Tat	p.D301Y	LYAR_ENST00000452476.1_Missense_Mutation_p.D301Y	NM_017816.2	NP_060286	Q9NX58	LYAR_HUMAN	Ly1 antibody reactive	301	Lys-rich.					nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(6)|liver(2)|lung(5)|ovary(1)|prostate(1)	17				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GGAGCCTCATCGTCTTCTGGT	0.478																																							uc011bvy.1		NA																	0					0						c.(901-903)GAT>TAT		Ly1 antibody reactive homolog							121.0	118.0	119.0					4																	4275328		2203	4300	6503	SO:0001583	missense	55646					nucleolus	metal ion binding|protein binding	g.chr4:4275328C>A	AL136750	CCDS3374.1	4p16.3	2013-01-10	2012-12-07		ENSG00000145220	ENSG00000145220		"""Zinc fingers, C2HC-type containing"""	26021	protein-coding gene	gene with protein product			"""Ly1 antibody reactive homolog (mouse)"""			11230166, 8491376	Standard	NM_001145725		Approved	ZC2HC2, ZLYAR	uc003ght.3	Q9NX58	OTTHUMG00000125477	ENST00000343470.4:c.901G>T	4.37:g.4275328C>A	ENSP00000345917:p.Asp301Tyr					LYAR_uc011bvx.1_Missense_Mutation_p.D184Y|LYAR_uc003ght.2_Missense_Mutation_p.D301Y	p.D301Y	NM_001145725	NP_001139197	Q9NX58	LYAR_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (64;0.168)	8	1044	-			301			Lys-rich.		D3DVS4|Q6FI78|Q9NYS1	Missense_Mutation	SNP	ENST00000343470.4	37	c.901G>T	CCDS3374.1	.	.	.	.	.	.	.	.	.	.	C	8.453	0.853515	0.17106	.	.	ENSG00000145220	ENST00000343470;ENST00000452476	T;T	0.32515	1.45;1.45	5.24	0.837	0.18896	.	0.985279	0.08318	N	0.964262	T	0.17534	0.0421	N	0.19112	0.55	0.09310	N	1	B	0.15141	0.012	B	0.04013	0.001	T	0.28459	-1.0043	10	0.56958	D	0.05	-0.5422	2.8892	0.05671	0.0923:0.2926:0.3989:0.2162	.	301	Q9NX58	LYAR_HUMAN	Y	301	ENSP00000345917:D301Y;ENSP00000397367:D301Y	ENSP00000345917:D301Y	D	-	1	0	LYAR	4326229	0.013000	0.17824	0.001000	0.08648	0.003000	0.03518	0.133000	0.15912	0.310000	0.22990	-0.794000	0.03295	GAT		0.478	LYAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246800.2	NM_017816		17	84	1	0	3.52763e-06	0.00499	4.34642e-06	17	84				
CCKAR	886	broad.mit.edu	37	4	26483303	26483303	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:26483303C>A	ENST00000295589.3	-	5	1438	c.1244G>T	c.(1243-1245)aGg>aTg	p.R415M		NM_000730.2	NP_000721.1	P32238	CCKAR_HUMAN	cholecystokinin A receptor	415					axonogenesis (GO:0007409)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|feeding behavior (GO:0007631)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to nutrient (GO:0007584)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cholecystokinin receptor activity (GO:0004951)			NS(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|pancreas(1)|skin(1)	29		Breast(46;0.0503)			Ceruletide(DB00403)	GTACGAGAACCTGGACAGAGA	0.642																																							uc003gse.1		NA																	0				lung(3)|pancreas(1)	4						c.(1243-1245)AGG>ATG		cholecystokinin A receptor	Ceruletide(DB00403)						107.0	106.0	107.0					4																	26483303		2203	4300	6503	SO:0001583	missense	886				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration|response to nutrient	integral to plasma membrane	cholecystokinin receptor activity	g.chr4:26483303C>A	L19315	CCDS3438.1	4p15.2	2013-09-20			ENSG00000163394	ENSG00000163394		"""GPCR / Class A : Cholecystokinin receptors"""	1570	protein-coding gene	gene with protein product		118444					Standard	NM_000730		Approved		uc003gse.1	P32238	OTTHUMG00000128567	ENST00000295589.3:c.1244G>T	4.37:g.26483303C>A	ENSP00000295589:p.Arg415Met						p.R415M	NM_000730	NP_000721	P32238	CCKAR_HUMAN			5	1397	-		Breast(46;0.0503)	415			Cytoplasmic (Potential).		B2R9Z5	Missense_Mutation	SNP	ENST00000295589.3	37	c.1244G>T	CCDS3438.1	.	.	.	.	.	.	.	.	.	.	C	12.92	2.083677	0.36758	.	.	ENSG00000163394	ENST00000295589	T	0.56776	0.44	5.47	4.63	0.57726	.	0.222095	0.43110	D	0.000612	T	0.64670	0.2619	M	0.64997	1.995	0.30666	N	0.75393	D	0.67145	0.996	P	0.61201	0.885	T	0.68334	-0.5436	10	0.62326	D	0.03	.	11.0788	0.48047	0.0:0.8385:0.0:0.1615	.	415	P32238	CCKAR_HUMAN	M	415	ENSP00000295589:R415M	ENSP00000295589:R415M	R	-	2	0	CCKAR	26092401	1.000000	0.71417	0.960000	0.40013	0.013000	0.08279	3.187000	0.50950	1.311000	0.45024	0.563000	0.77884	AGG		0.642	CCKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250418.2			24	131	1	0	3.6726e-16	0.003954	6.42705e-16	24	131				
KIT	3815	broad.mit.edu	37	4	55602663	55602663	+	Splice_Site	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:55602663G>A	ENST00000288135.5	+	18	2581		c.e18-1			NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog						actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TTCTATTACAGGCTCGACTAC	0.403		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																														uc010igr.2		1	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	Mis|O	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	Piebald trait	"""L, M, O, E"""		GIST|epithelioma	GIST|AML|TGCT|mastocytosis|mucosal melanoma		0				soft_tissue(3273)|haematopoietic_and_lymphoid_tissue(1572)|skin(99)|testis(49)|bone(21)|genital_tract(18)|kidney(17)|ovary(16)|salivary_gland(15)|large_intestine(11)|thymus(6)|lung(6)|central_nervous_system(4)|NS(3)|eye(2)|endometrium(2)|breast(1)|stomach(1)|autonomic_ganglia(1)|pancreas(1)	5118	GRCh37	CS022109	KIT	S		c.e18-1		v-kit Hardy-Zuckerman 4 feline sarcoma viral	Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)						104.0	102.0	103.0					4																	55602663		2203	4300	6503	SO:0001630	splice_region_variant	3815	Mast_Cell_disease_Familial_Clustering_of|Piebaldism|Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Gastrointestinal_Stromal_Tumors	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	male gonad development|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular space|integral to membrane	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity	g.chr4:55602663G>A	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2485-1G>A	4.37:g.55602663G>A						KIT_uc010igs.2_Splice_Site_p.A825_splice	p.A829_splice	NM_000222	NP_000213	P10721	KIT_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	18	2572	+	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)							B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Splice_Site	SNP	ENST00000288135.5	37	c.2485_splice	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	G	11.43	1.636028	0.29068	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	.	.	.	5.7	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6861	0.77411	0.0:0.0:0.8617:0.1383	.	.	.	.	.	-1	.	.	.	+	.	.	KIT	55297420	1.000000	0.71417	0.982000	0.44146	0.017000	0.09413	9.710000	0.98732	1.387000	0.46486	-0.181000	0.13052	.		0.403	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		Intron	18	86	0	0	0	0.007413	0	18	86				
KIAA1211	57482	broad.mit.edu	37	4	57182249	57182249	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:57182249G>T	ENST00000504228.1	+	6	2686	c.2581G>T	c.(2581-2583)Gac>Tac	p.D861Y	KIAA1211_ENST00000264229.6_Missense_Mutation_p.D861Y|KIAA1211_ENST00000541073.1_Missense_Mutation_p.D854Y			Q6ZU35	K1211_HUMAN	KIAA1211	861										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CTTCAACTGCGACCAACAGGC	0.552																																							uc003hbk.2		NA																	0				ovary(1)|skin(1)	2						c.(2581-2583)GAC>TAC		hypothetical protein LOC57482							49.0	58.0	55.0					4																	57182249		2186	4286	6472	SO:0001583	missense	57482							g.chr4:57182249G>T	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.2581G>T	4.37:g.57182249G>T	ENSP00000423366:p.Asp861Tyr					KIAA1211_uc010iha.2_Missense_Mutation_p.D854Y|KIAA1211_uc011bzz.1_Missense_Mutation_p.D771Y|KIAA1211_uc003hbm.1_Missense_Mutation_p.D747Y	p.D861Y	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN			8	2972	+	Glioma(25;0.08)|all_neural(26;0.101)		861					Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	ENST00000504228.1	37	c.2581G>T	CCDS43230.1	.	.	.	.	.	.	.	.	.	.	G	18.83	3.707527	0.68615	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073;ENST00000546221	T;T;T	0.18502	2.22;2.22;2.21	4.97	4.97	0.65823	.	.	.	.	.	T	0.42743	0.1216	M	0.68952	2.095	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.997	T	0.34453	-0.9828	9	0.87932	D	0	-37.0864	18.4305	0.90623	0.0:0.0:1.0:0.0	.	854;854;861	B7ZVZ4;F5H1N7;Q6ZU35	.;.;K1211_HUMAN	Y	861;861;854;771	ENSP00000264229:D861Y;ENSP00000423366:D861Y;ENSP00000444006:D854Y	ENSP00000264229:D861Y	D	+	1	0	KIAA1211	56877006	1.000000	0.71417	0.969000	0.41365	0.397000	0.30659	9.122000	0.94380	2.579000	0.87056	0.561000	0.74099	GAC		0.552	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722		6	44	1	0	0.00116845	0.001168	0.00128549	6	44				
LPHN3	23284	broad.mit.edu	37	4	62598746	62598746	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:62598746G>C	ENST00000514591.1	+	7	998	c.669G>C	c.(667-669)gaG>gaC	p.E223D	LPHN3_ENST00000514157.1_Missense_Mutation_p.E223D|LPHN3_ENST00000506720.1_Missense_Mutation_p.E291D|LPHN3_ENST00000507164.1_Missense_Mutation_p.E291D|LPHN3_ENST00000508693.1_Missense_Mutation_p.E291D|LPHN3_ENST00000504896.1_Missense_Mutation_p.E223D|LPHN3_ENST00000545650.1_Missense_Mutation_p.E223D|LPHN3_ENST00000506700.1_Missense_Mutation_p.E223D|LPHN3_ENST00000509896.1_Missense_Mutation_p.E291D|LPHN3_ENST00000508946.1_Missense_Mutation_p.E223D|LPHN3_ENST00000514996.1_Missense_Mutation_p.E223D|LPHN3_ENST00000512091.2_Missense_Mutation_p.E223D|LPHN3_ENST00000511324.1_Missense_Mutation_p.E291D|LPHN3_ENST00000506746.1_Missense_Mutation_p.E291D|LPHN3_ENST00000507625.1_Missense_Mutation_p.E291D			Q9HAR2	LPHN3_HUMAN	latrophilin 3	223	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						TCAACAAAGAGCGCACCAGGA	0.448																																							uc010ihh.2		NA																	0				lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						c.(667-669)GAG>GAC		latrophilin 3 precursor							82.0	76.0	78.0					4																	62598746		1913	4118	6031	SO:0001583	missense	23284				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding	g.chr4:62598746G>C	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.669G>C	4.37:g.62598746G>C	ENSP00000422533:p.Glu223Asp					LPHN3_uc003hcq.3_Missense_Mutation_p.E223D|LPHN3_uc010ihg.1_Missense_Mutation_p.E291D|LPHN3_uc003hcs.1_Missense_Mutation_p.E52D	p.E223D	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN			5	842	+			223			Extracellular (Potential).|Olfactomedin-like.		E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	c.669G>C	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.743886	0.49151	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000534975;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89270	-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49;-2.49	5.26	0.0748	0.14396	.	0.000000	0.85682	D	0.000000	D	0.92031	0.7475	M	0.70903	2.155	0.41524	D	0.98841	D;D;D	0.69078	0.997;0.997;0.974	D;D;D	0.79108	0.992;0.992;0.969	D	0.90120	0.4198	10	0.87932	D	0	.	9.3759	0.38283	0.483:0.0:0.517:0.0	.	223;291;223	E9PE04;E7EN28;Q9HAR2-2	.;.;.	D	223;223;291;291;223;223;223;223;223;291;291;291;223;223;223;291;291;223	ENSP00000423388:E223D;ENSP00000422533:E223D;ENSP00000423787:E291D;ENSP00000425033:E291D;ENSP00000424120:E223D;ENSP00000439831:E223D;ENSP00000421476:E291D;ENSP00000424030:E291D;ENSP00000421372:E291D;ENSP00000425201:E223D;ENSP00000423434:E223D;ENSP00000421627:E223D;ENSP00000420931:E291D;ENSP00000425884:E291D;ENSP00000424258:E223D	ENSP00000280009:E223D	E	+	3	2	LPHN3	62281341	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	1.166000	0.31834	-0.053000	0.13289	-0.262000	0.10625	GAG		0.448	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1			8	42	0	0	0	0.004482	0	8	42				
TMPRSS11D	9407	broad.mit.edu	37	4	68688116	68688116	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:68688116G>T	ENST00000283916.6	-	10	1294	c.1196C>A	c.(1195-1197)cCa>cAa	p.P399Q	TMPRSS11D_ENST00000545541.1_Missense_Mutation_p.P282Q|UBA6-AS1_ENST00000500538.2_RNA	NM_004262.2	NP_004253.1	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	399	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)|respiratory gaseous exchange (GO:0007585)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						ATACACTCCTGGCTTATCCGG	0.517																																							uc003hdq.2		NA																	0				ovary(1)	1						c.(1195-1197)CCA>CAA		transmembrane protease, serine 11D							160.0	142.0	148.0					4																	68688116		2203	4300	6503	SO:0001583	missense	9407				proteolysis|respiratory gaseous exchange	extracellular region|integral to plasma membrane	serine-type endopeptidase activity	g.chr4:68688116G>T	AB002134	CCDS3518.1	4q13.2	2010-04-13			ENSG00000153802	ENSG00000153802		"""Serine peptidases / Transmembrane"""	24059	protein-coding gene	gene with protein product	"""airway trypsin like protease"""	605369				9565616, 9070615	Standard	XM_005265710		Approved		uc003hdq.3	O60235	OTTHUMG00000129300	ENST00000283916.6:c.1196C>A	4.37:g.68688116G>T	ENSP00000283916:p.Pro399Gln					LOC550112_uc003hdl.3_Intron|TMPRSS11D_uc003hdp.2_Missense_Mutation_p.P180Q|TMPRSS11D_uc011caj.1_Missense_Mutation_p.P282Q	p.P399Q	NM_004262	NP_004253	O60235	TM11D_HUMAN			10	1261	-			399			Peptidase S1.|Extracellular (Potential).		Q08AF6	Missense_Mutation	SNP	ENST00000283916.6	37	c.1196C>A	CCDS3518.1	.	.	.	.	.	.	.	.	.	.	G	17.65	3.442352	0.63067	.	.	ENSG00000153802	ENST00000283916;ENST00000545541	T;T	0.67865	-0.29;-0.29	5.78	5.78	0.91487	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.53938	D	0.000055	D	0.88695	0.6506	H	0.97265	3.97	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	D	0.92161	0.5736	10	0.87932	D	0	.	17.5056	0.87745	0.0:0.0:1.0:0.0	.	399	O60235	TM11D_HUMAN	Q	399;282	ENSP00000283916:P399Q;ENSP00000442045:P282Q	ENSP00000283916:P399Q	P	-	2	0	TMPRSS11D	68370711	1.000000	0.71417	0.928000	0.36995	0.082000	0.17680	6.856000	0.75450	2.742000	0.94016	0.650000	0.86243	CCA		0.517	TMPRSS11D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251430.3	NM_004262		20	135	1	0	4.96729e-08	0.008871	6.74662e-08	20	135				
UGT2B27P	54569	broad.mit.edu	37	4	69870707	69870707	+	IGR	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:69870707A>T								UGT2A3 (53198 upstream) : UGT2B7 (46486 downstream)																							GTGGTACTGGAACCAGGTGAG	0.488																																						Melanoma(133;755 1763 25578 26334 46021)	uc011cao.1		NA																	0				skin(3)|ovary(2)	5						c.(1342-1344)TTC>TAC		RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;							144.0	108.0	119.0					4																	69870707		692	1591	2283	SO:0001628	intergenic_variant	7365				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:69870707A>T																													4.37:g.69870707A>T						UGT2B10_uc011can.1_Missense_Mutation_p.F364Y	p.F448Y			P36537	UDB10_HUMAN			9	1479	-			485						Missense_Mutation	SNP		37	c.1343T>A																																																																																				0	0.488									32	164	0	0	0	0.013726	0	32	164				
UGT2B4	7363	broad.mit.edu	37	4	70360873	70360873	+	Missense_Mutation	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:70360873T>A	ENST00000305107.6	-	1	753	c.707A>T	c.(706-708)tAc>tTc	p.Y236F	UGT2B4_ENST00000512583.1_Missense_Mutation_p.Y236F|UGT2B4_ENST00000381096.3_Missense_Mutation_p.Y100F|UGT2B4_ENST00000506580.1_Intron	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	236					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	AACTTCACTGTAGAACTGATC	0.333																																							uc003hek.3		NA																	0				skin(2)	2						c.(706-708)TAC>TTC		UDP glucuronosyltransferase 2B4 precursor							54.0	55.0	54.0					4																	70360873		2163	4292	6455	SO:0001583	missense	7363				estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:70360873T>A	BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.707A>T	4.37:g.70360873T>A	ENSP00000305221:p.Tyr236Phe					UGT2B4_uc011cap.1_Missense_Mutation_p.Y100F|UGT2B4_uc003hel.3_Missense_Mutation_p.Y236F	p.Y236F	NM_021139	NP_066962	P06133	UD2B4_HUMAN			1	754	-			236					A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Missense_Mutation	SNP	ENST00000305107.6	37	c.707A>T	CCDS43234.1	.	.	.	.	.	.	.	.	.	.	T	11.11	1.542359	0.27563	.	.	ENSG00000156096	ENST00000512583;ENST00000305107;ENST00000381096	T;T;T	0.61510	0.1;0.1;0.1	2.4	1.07	0.20283	.	0.000000	0.56097	U	0.000023	T	0.54581	0.1867	M	0.66506	2.035	0.25343	N	0.988937	B;B;B	0.27229	0.051;0.172;0.129	B;B;B	0.37387	0.17;0.16;0.248	T	0.51849	-0.8653	10	0.46703	T	0.11	.	6.0132	0.19588	0.2294:0.0:0.0:0.7706	.	100;236;236	A6NCP7;G5E9X8;P06133	.;.;UD2B4_HUMAN	F	236;236;100	ENSP00000421290:Y236F;ENSP00000305221:Y236F;ENSP00000370486:Y100F	ENSP00000305221:Y236F	Y	-	2	0	UGT2B4	70395462	1.000000	0.71417	0.054000	0.19295	0.057000	0.15508	3.825000	0.55730	0.130000	0.18549	0.248000	0.18094	TAC		0.333	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139		11	54	0	0	0	0.001855	0	11	54				
ALB	213	broad.mit.edu	37	4	74285336	74285336	+	Nonsense_Mutation	SNP	G	G	T	rs75709682		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:74285336G>T	ENST00000503124.1	+	11	1522	c.1315G>T	c.(1315-1317)Gag>Tag	p.E439*	ALB_ENST00000401494.3_Nonsense_Mutation_p.E474*|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000295897.4_Nonsense_Mutation_p.E589*|ALB_ENST00000509063.1_Nonsense_Mutation_p.E589*|ALB_ENST00000415165.2_Nonsense_Mutation_p.E397*			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGACGATAAGGAGACCTGCTT	0.428																																							uc003hgs.3		NA																	0				ovary(3)|skin(3)	6	GRCh37	CM900419	ALB	M	rs75709682	c.(1765-1767)GAG>TAG		albumin preproprotein	Acenocoumarol(DB01418)|Acitretin(DB00459)|Alfentanil(DB00802)|Aluminium(DB01370)|Auranofin(DB00995)|Bismuth(DB01402)|Captopril(DB01197)|Carboplatin(DB00958)|Cefalotin(DB00456)|Cefazolin(DB01327)|Cefonicid(DB01328)|Cefoperazone(DB01329)|Chlorpheniramine(DB01114)|Chlorpromazine(DB00477)|Ciprofloxacin(DB00537)|Clonazepam(DB01068)|Cloxacillin(DB01147)|Cytarabine(DB00987)|Dantrolene(DB01219)|Diclofenac(DB00586)|Diflunisal(DB00861)|Digitoxin(DB01396)|Estrone(DB00655)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Flurbiprofen(DB00712)|Gadobenate Dimeglumine(DB00743)|Gatifloxacin(DB01044)|Gliclazide(DB01120)|Halothane(DB01159)|Human Serum Albumin(DB00062)|Hyaluronidase(DB00070)|Ibuprofen(DB01050)|Insulin-detemir(DB01307)|Insulin-glargine(DB01308)|Iodipamide(DB04711)|Ketoprofen(DB01009)|Levamisole(DB00848)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Mefenamic acid(DB00784)|Mephenytoin(DB00532)|Methotrexate(DB00563)|Nortriptyline(DB00540)|Oxazepam(DB00842)|Paclitaxel(DB01229)|Phenprocoumon(DB00946)|Probenecid(DB01032)|Propofol(DB00818)|Pyridoxine(DB00165)|Salicyclic acid(DB00936)|Saquinavir(DB01232)|Serum albumin(DB00096)|Serum albumin iodonated(DB00064)|Sodium lauryl sulfate(DB00815)|Sucralfate(DB00364)|Sulfamethizole(DB00576)|Sulindac(DB00605)|Suprofen(DB00870)|Testosterone(DB00624)|Xanthophyll(DB00137)						148.0	145.0	146.0					4																	74285336		2203	4300	6503	SO:0001587	stop_gained	213				bile acid and bile salt transport|bile acid metabolic process|cellular response to starvation|hemolysis by symbiont of host erythrocytes|lipoprotein metabolic process|maintenance of mitochondrion location|negative regulation of apoptosis|platelet activation|platelet degranulation|sodium-independent organic anion transport|transmembrane transport	extracellular space|platelet alpha granule lumen|protein complex	antioxidant activity|chaperone binding|copper ion binding|DNA binding|drug binding|fatty acid binding|pyridoxal phosphate binding|toxin binding	g.chr4:74285336G>T	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.1315G>T	4.37:g.74285336G>T	ENSP00000421027:p.Glu439*					ALB_uc003hgw.3_Nonsense_Mutation_p.E397*|ALB_uc011cbe.1_Nonsense_Mutation_p.E268*|ALB_uc003hgt.3_Nonsense_Mutation_p.E589*|ALB_uc010iii.2_Nonsense_Mutation_p.E474*|ALB_uc003hgu.3_Nonsense_Mutation_p.E439*|ALB_uc003hgv.3_Nonsense_Mutation_p.E268*|ALB_uc011cbf.1_Nonsense_Mutation_p.E479*|ALB_uc010iij.2_RNA|ALB_uc003hgx.3_Nonsense_Mutation_p.E268*	p.E589*	NM_000477	NP_000468	P02768	ALBU_HUMAN	Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		13	1838	+	Breast(15;0.00102)		589		E -> K (in Osaka-1).	Albumin 3.		B5MEM5|Q96IF6|Q96JG4|Q96MA8	Nonsense_Mutation	SNP	ENST00000503124.1	37	c.1765G>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.71|19.71	3.877635|3.877635	0.72294|0.72294	.|.	.|.	ENSG00000163631|ENSG00000163631	ENST00000295897;ENST00000415165;ENST00000329326;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202|ENST00000511370	.|.	.|.	.|.	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	0.297143|.	0.33253|.	N|.	0.005120|.	.|T	.|0.52805	.|0.1757	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.62383	.|-0.6866	.|3	0.72032|.	D|.	0.01|.	-26.3314|-26.3314	8.9684|8.9684	0.35890|0.35890	0.0771:0.1503:0.7726:0.0|0.0771:0.1503:0.7726:0.0	.|.	.|.	.|.	.|.	X|V	589;397;376;439;589;474;598|433	.|.	ENSP00000295897:E589X|.	E|G	+|+	1|2	0|0	ALB|ALB	74504200|74504200	0.991000|0.991000	0.36638|0.36638	0.977000|0.977000	0.42913|0.42913	0.037000|0.037000	0.13140|0.13140	3.137000|3.137000	0.50562|0.50562	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	GAG|GGA		0.428	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477		13	75	1	0	1.3612e-06	0.003163	1.74114e-06	13	75				
BMP3	651	broad.mit.edu	37	4	81967361	81967361	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:81967361C>T	ENST00000282701.2	+	2	1106	c.786C>T	c.(784-786)caC>caT	p.H262H		NM_001201.2	NP_001192.2	P12645	BMP3_HUMAN	bone morphogenetic protein 3	262					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|growth (GO:0040007)|ossification (GO:0001503)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	BMP receptor binding (GO:0070700)|receptor binding (GO:0005102)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	29						TACAGGGACACCGGAATTTTC	0.498																																							uc003hmg.3		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(784-786)CAC>CAT		bone morphogenetic protein 3 preproprotein							87.0	88.0	87.0					4																	81967361		2203	4300	6503	SO:0001819	synonymous_variant	651				cartilage development|cell differentiation|cell-cell signaling|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity	g.chr4:81967361C>T	M22491	CCDS3588.1	4q21	2013-02-06	2008-05-22		ENSG00000152785	ENSG00000152785		"""Bone morphogenetic proteins"""	1070	protein-coding gene	gene with protein product	"""osteogenin"""	112263	"""bone morphogenetic protein 3 (osteogenic)"""				Standard	NM_001201		Approved		uc003hmg.4	P12645	OTTHUMG00000130292	ENST00000282701.2:c.786C>T	4.37:g.81967361C>T							p.H262H	NM_001201	NP_001192	P12645	BMP3_HUMAN			2	1106	+			262					Q4VAS5	Silent	SNP	ENST00000282701.2	37	c.786C>T	CCDS3588.1																																																																																				0.498	BMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252634.1			17	97	0	0	0	0.004007	0	17	97				
AFF1	4299	broad.mit.edu	37	4	88055667	88055667	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:88055667C>T	ENST00000307808.6	+	19	3752	c.3332C>T	c.(3331-3333)gCc>gTc	p.A1111V	AFF1_ENST00000395146.4_Missense_Mutation_p.A1119V|AFF1_ENST00000544085.1_Missense_Mutation_p.A750V	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	1111					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		CCTTCTCCTGCCAGCTCCGTA	0.567																																							uc003hqj.3		NA																	0				breast(1)	1						c.(3331-3333)GCC>GTC		myeloid/lymphoid or mixed-lineage leukemia							257.0	269.0	265.0					4																	88055667		2203	4300	6503	SO:0001583	missense	4299					nucleus	sequence-specific DNA binding transcription factor activity	g.chr4:88055667C>T	L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.3332C>T	4.37:g.88055667C>T	ENSP00000305689:p.Ala1111Val					AFF1_uc011ccz.1_Missense_Mutation_p.A1119V|AFF1_uc003hqk.3_Missense_Mutation_p.A1112V|AFF1_uc011cda.1_Missense_Mutation_p.A750V	p.A1111V	NM_005935	NP_005926	P51825	AFF1_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.000233)	19	3739	+		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)	1111					B4DTU1|E9PBM3	Missense_Mutation	SNP	ENST00000307808.6	37	c.3332C>T	CCDS3616.1	.	.	.	.	.	.	.	.	.	.	C	19.96	3.922876	0.73213	.	.	ENSG00000172493	ENST00000395146;ENST00000307808;ENST00000544085	T;T;T	0.66995	-0.24;-0.24;-0.24	5.51	5.51	0.81932	.	0.598230	0.17182	N	0.183834	T	0.76271	0.3964	L	0.38953	1.18	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.993;0.993	T	0.74377	-0.3685	10	0.41790	T	0.15	-24.9725	19.0285	0.92944	0.0:1.0:0.0:0.0	.	1119;1112;1111	E9PBM3;Q14C88;P51825	.;.;AFF1_HUMAN	V	1119;1111;750	ENSP00000378578:A1119V;ENSP00000305689:A1111V;ENSP00000440843:A750V	ENSP00000305689:A1111V	A	+	2	0	AFF1	88274691	0.998000	0.40836	1.000000	0.80357	0.911000	0.54048	3.215000	0.51169	2.591000	0.87537	0.313000	0.20887	GCC		0.567	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253053.3	NM_005935		83	374	0	0	0	0.01441	0	83	374				
ADH1B	125	broad.mit.edu	37	4	100231927	100231927	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:100231927C>T	ENST00000305046.8	-	8	1165	c.1098G>A	c.(1096-1098)ggG>ggA	p.G366G	ADH1B_ENST00000394887.3_Silent_p.G326G			P00325	ADH1B_HUMAN	alcohol dehydrogenase 1B (class I), beta polypeptide	366					ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	33				OV - Ovarian serous cystadenocarcinoma(123;1.02e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	TCTACCTTTTCCCAGAGTGAA	0.338																																							uc003hus.3		NA																	0				ovary(1)|breast(1)	2						c.(1096-1098)GGG>GGA		class I alcohol dehydrogenase, beta subunit	Fomepizole(DB01213)|NADH(DB00157)						74.0	74.0	74.0					4																	100231927		2202	4300	6502	SO:0001819	synonymous_variant	125				ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|zinc ion binding	g.chr4:100231927C>T	AF153821	CCDS34033.1, CCDS68761.1	4q23	2008-02-05	2007-11-06		ENSG00000196616	ENSG00000196616	1.1.1.1	"""Alcohol dehydrogenases"""	250	protein-coding gene	gene with protein product		103720		ADH2		3006456	Standard	NM_000668		Approved		uc003hus.4	P00325	OTTHUMG00000161413	ENST00000305046.8:c.1098G>A	4.37:g.100231927C>T						ADH1A_uc011ceg.1_Intron|ADH1B_uc003hut.3_Silent_p.G326G|ADH1B_uc011ceh.1_Silent_p.G211G|ADH1B_uc011cei.1_Silent_p.G326G	p.G366G	NM_000668	NP_000659	P00325	ADH1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;1.02e-07)	8	1182	-			366					A8MYN5|B4DRS9|B4DVC3|Q13711|Q4ZGI9|Q96KI7	Silent	SNP	ENST00000305046.8	37	c.1098G>A	CCDS34033.1																																																																																				0.338	ADH1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364853.1	NM_000668		13	41	0	0	0	0.013537	0	13	41				
CENPE	1062	broad.mit.edu	37	4	104101595	104101595	+	Missense_Mutation	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:104101595T>A	ENST00000265148.3	-	13	1204	c.1115A>T	c.(1114-1116)gAa>gTa	p.E372V	CENPE_ENST00000380026.3_Missense_Mutation_p.E372V|CENPE_ENST00000509120.1_5'UTR	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	372					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTGGTCTTTTTCCATTGCCTG	0.353																																							uc003hxb.1		NA																	0				ovary(5)|breast(4)	9						c.(1114-1116)GAA>GTA		centromere protein E							70.0	70.0	70.0					4																	104101595		2203	4300	6503	SO:0001583	missense	1062				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity	g.chr4:104101595T>A	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.1115A>T	4.37:g.104101595T>A	ENSP00000265148:p.Glu372Val					CENPE_uc003hxc.1_Missense_Mutation_p.E372V	p.E372V	NM_001813	NP_001804	Q02224	CENPE_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)	13	1205	-			372			Potential.		A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	c.1115A>T	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	T	18.41	3.617651	0.66787	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026;ENST00000503705	T;T;T	0.71817	-0.6;-0.58;-0.27	5.23	5.23	0.72850	.	.	.	.	.	D	0.82449	0.5039	M	0.78456	2.415	0.41969	D	0.990748	D;D	0.89917	1.0;0.999	D;D	0.79108	0.992;0.941	D	0.84502	0.0617	9	0.66056	D	0.02	.	10.7098	0.45977	0.0:0.0:0.1597:0.8403	.	372;372	Q02224-3;Q02224	.;CENPE_HUMAN	V	372	ENSP00000265148:E372V;ENSP00000369365:E372V;ENSP00000423981:E372V	ENSP00000265148:E372V	E	-	2	0	CENPE	104321044	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	4.817000	0.62650	2.096000	0.63516	0.460000	0.39030	GAA		0.353	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				5	43	0	0	0	0.001984	0	5	43				
PITX2	5308	broad.mit.edu	37	4	111539669	111539669	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:111539669A>T	ENST00000354925.2	-	7	2271	c.566T>A	c.(565-567)cTa>cAa	p.L189Q	PITX2_ENST00000556049.1_5'UTR|PITX2_ENST00000394598.2_Missense_Mutation_p.L189Q|PITX2_ENST00000306732.3_Missense_Mutation_p.L196Q|PITX2_ENST00000355080.5_Missense_Mutation_p.L143Q|PITX2_ENST00000394595.3_Silent_p.P120P	NM_001204397.1	NP_001191326.1	Q99697	PITX2_HUMAN	paired-like homeodomain 2	189					atrial cardiac muscle tissue morphogenesis (GO:0055009)|atrioventricular valve development (GO:0003171)|camera-type eye development (GO:0043010)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|deltoid tuberosity development (GO:0035993)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic hindlimb morphogenesis (GO:0035116)|endodermal digestive tract morphogenesis (GO:0061031)|extraocular skeletal muscle development (GO:0002074)|female gonad development (GO:0008585)|hair cell differentiation (GO:0035315)|hypothalamus cell migration (GO:0021855)|in utero embryonic development (GO:0001701)|iris morphogenesis (GO:0061072)|left lung morphogenesis (GO:0060460)|left/right axis specification (GO:0070986)|male gonad development (GO:0008584)|myoblast fusion (GO:0007520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|patterning of blood vessels (GO:0001569)|positive regulation of DNA binding (GO:0043388)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin secreting cell differentiation (GO:0060127)|pulmonary myocardium development (GO:0003350)|pulmonary vein morphogenesis (GO:0060577)|regulation of cell migration (GO:0030334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|response to vitamin A (GO:0033189)|somatotropin secreting cell differentiation (GO:0060126)|spleen development (GO:0048536)|subthalamic nucleus development (GO:0021763)|superior vena cava morphogenesis (GO:0060578)|vascular smooth muscle cell differentiation (GO:0035886)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)|ribonucleoprotein complex binding (GO:0043021)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(3)|large_intestine(1)|lung(5)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		CTTGGTGGATAGGGAGGCGGA	0.547																																							uc003iad.2		NA																	0					0						c.(565-567)CTA>CAA		paired-like homeodomain transcription factor 2							84.0	73.0	76.0					4																	111539669		2203	4300	6503	SO:0001583	missense	5308				determination of left/right symmetry|organ morphogenesis	transcription factor complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription factor binding	g.chr4:111539669A>T	U69961	CCDS3692.1, CCDS3693.1, CCDS3694.1	4q25	2011-06-20	2007-07-12		ENSG00000164093	ENSG00000164093		"""Homeoboxes / PRD class"""	9005	protein-coding gene	gene with protein product		601542	"""paired-like homeodomain transcription factor 2"""	IRID2, IHG2, RIEG, RIEG1, RGS		9539779, 7581385	Standard	NM_000325		Approved	IGDS, RS, Brx1, Otlx2, ARP1	uc021xqr.1	Q99697	OTTHUMG00000132837	ENST00000354925.2:c.566T>A	4.37:g.111539669A>T	ENSP00000347004:p.Leu189Gln					PITX2_uc003iac.2_Missense_Mutation_p.L196Q|PITX2_uc003iae.2_Missense_Mutation_p.L143Q|PITX2_uc010iml.2_Missense_Mutation_p.L60Q|PITX2_uc003iaf.2_Missense_Mutation_p.L189Q	p.L189Q	NM_153426	NP_700475	Q99697	PITX2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;0.00222)	5	1148	-		Hepatocellular(203;0.217)	189					A8K6C6|B2RA02|B3KXS0|O60578|O60579|O60580|Q3KQX9|Q9BY17	Missense_Mutation	SNP	ENST00000354925.2	37	c.566T>A	CCDS3692.1	.	.	.	.	.	.	.	.	.	.	A	17.57	3.422660	0.62733	.	.	ENSG00000164093	ENST00000306732;ENST00000394598;ENST00000355080;ENST00000354925;ENST00000511837;ENST00000556049	D;D;D;D;D;T	0.94138	-3.03;-3.15;-3.29;-3.15;-3.36;-1.04	4.89	4.89	0.63831	.	0.065835	0.64402	D	0.000008	D	0.96880	0.8981	M	0.87547	2.89	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;1.0;1.0	D;D;D;D	0.91635	0.995;0.991;0.998;0.999	D	0.97411	1.0002	10	0.62326	D	0.03	.	14.9871	0.71356	1.0:0.0:0.0:0.0	.	143;143;189;196	A8K6C6;Q99697-3;Q99697;Q99697-2	.;.;PITX2_HUMAN;.	Q	196;189;143;189;189;113	ENSP00000304169:L196Q;ENSP00000378097:L189Q;ENSP00000347192:L143Q;ENSP00000347004:L189Q;ENSP00000421454:L189Q;ENSP00000450938:L113Q	ENSP00000304169:L196Q	L	-	2	0	PITX2	111759118	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.139000	0.94554	2.190000	0.69967	0.460000	0.39030	CTA		0.547	PITX2-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256308.2			13	50	0	0	0	0.013537	0	13	50				
ANK2	287	broad.mit.edu	37	4	114158754	114158754	+	Splice_Site	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:114158754G>T	ENST00000357077.4	+	7	722		c.e7-1		ANK2_ENST00000506722.1_Splice_Site|ANK2_ENST00000264366.6_Splice_Site|ANK2_ENST00000394537.3_Splice_Site	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal						atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.?(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CACTGCTTCAGATGATGGTGA	0.363																																							uc003ibe.3		NA																	1	Unknown(1)		lung(1)	central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14						c.e7-1		ankyrin 2 isoform 1							223.0	204.0	211.0					4																	114158754		2203	4300	6503	SO:0001630	splice_region_variant	287				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding	g.chr4:114158754G>T	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.670-1G>T	4.37:g.114158754G>T						ANK2_uc003ibd.3_Splice_Site_p.M203_splice|ANK2_uc003ibf.3_Splice_Site_p.M224_splice|ANK2_uc003ibc.2_Splice_Site_p.M200_splice|ANK2_uc011cgb.1_Splice_Site_p.M239_splice	p.M224_splice	NM_001148	NP_001139	Q01484	ANK2_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)	7	770	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)						Q01485|Q08AC7|Q08AC8|Q7Z3L5	Splice_Site	SNP	ENST00000357077.4	37	c.670_splice	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.820170	0.90873	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0845	0.97795	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ANK2	114378203	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.813000	0.99286	2.821000	0.97095	0.650000	0.86243	.		0.363	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	Intron	12	56	1	0	0.00185496	0.001855	0.00203726	12	56				
TRPC3	7222	broad.mit.edu	37	4	122831533	122831533	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:122831533C>A	ENST00000379645.3	-	6	1641	c.1568G>T	c.(1567-1569)tGg>tTg	p.W523L	TRPC3_ENST00000513531.1_Missense_Mutation_p.W395L|TRPC3_ENST00000264811.5_Missense_Mutation_p.W450L	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	438					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						ACATTCAGACCACATCATTCC	0.463																																							uc003ieg.2		NA																	0				ovary(2)	2						c.(1567-1569)TGG>TTG		transient receptor potential cation channel,							135.0	125.0	128.0					4																	122831533		2203	4300	6503	SO:0001583	missense	7222				axon guidance|phototransduction|platelet activation	integral to plasma membrane	protein binding|store-operated calcium channel activity	g.chr4:122831533C>A	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.1568G>T	4.37:g.122831533C>A	ENSP00000368966:p.Trp523Leu					TRPC3_uc010inr.2_Missense_Mutation_p.W395L|TRPC3_uc003ief.2_Missense_Mutation_p.W450L|TRPC3_uc011cgl.1_Missense_Mutation_p.W187L	p.W523L	NM_001130698	NP_001124170	Q13507	TRPC3_HUMAN			6	1642	-			438			Helical; (Potential).		A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	37	c.1568G>T	CCDS47130.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.348916	0.82132	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	D;D;D	0.98075	-4.7;-4.7;-4.7	5.57	5.57	0.84162	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.98043	0.9355	M	0.77103	2.36	0.80722	D	1	B;P;P	0.40000	0.081;0.502;0.698	B;P;P	0.48524	0.122;0.458;0.58	D	0.98256	1.0496	10	0.48119	T	0.1	2.7601	19.5342	0.95242	0.0:1.0:0.0:0.0	.	438;395;523	Q13507;E9PCJ9;Q5G1L5	TRPC3_HUMAN;.;.	L	450;523;395	ENSP00000264811:W450L;ENSP00000368966:W523L;ENSP00000426899:W395L	ENSP00000264811:W450L	W	-	2	0	TRPC3	123050983	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.729000	0.84864	2.623000	0.88846	0.561000	0.74099	TGG		0.463	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305		14	61	1	0	4.3838e-07	0.001855	5.7223e-07	14	61				
KIAA0922	23240	broad.mit.edu	37	4	154525149	154525149	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:154525149C>T	ENST00000409663.3	+	25	3034	c.2982C>T	c.(2980-2982)gcC>gcT	p.A994A	KIAA0922_ENST00000440693.1_Silent_p.A911A|KIAA0922_ENST00000409959.3_Silent_p.A995A	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	994						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				CAGCTGCGGCCAGCAGCACCA	0.512																																							uc003inm.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(2980-2982)GCC>GCT		hypothetical protein LOC23240 isoform 2							50.0	45.0	47.0					4																	154525149		2203	4300	6503	SO:0001819	synonymous_variant	23240					integral to membrane		g.chr4:154525149C>T	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.2982C>T	4.37:g.154525149C>T						KIAA0922_uc010ipp.2_Silent_p.A995A|KIAA0922_uc010ipq.2_Silent_p.A763A	p.A994A	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN			25	3034	+	all_hematologic(180;0.093)	Renal(120;0.118)	994			Cytoplasmic (Potential).		B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Silent	SNP	ENST00000409663.3	37	c.2982C>T	CCDS3783.2																																																																																				0.512	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196		8	70	0	0	0	0.004482	0	8	70				
FAM198B	51313	broad.mit.edu	37	4	159048600	159048600	+	Missense_Mutation	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:159048600T>C	ENST00000296530.8	-	5	2140	c.1519A>G	c.(1519-1521)Atc>Gtc	p.I507V	FAM198B_ENST00000585682.1_Missense_Mutation_p.I507V|FAM198B_ENST00000393807.5_Missense_Mutation_p.I515V	NM_016613.6	NP_057697.2	Q6UWH4	F198B_HUMAN	family with sequence similarity 198, member B	507						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(14)|skin(2)|urinary_tract(1)	26						TGTGCATTGATATAGGTGATA	0.338																																							uc003ipp.3		NA																	0					0						c.(1519-1521)ATC>GTC		hypothetical protein LOC51313 isoform 2							223.0	232.0	229.0					4																	159048600		2203	4300	6503	SO:0001583	missense	51313					Golgi membrane|integral to membrane		g.chr4:159048600T>C		CCDS3798.1, CCDS34087.1	4q32.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000164125	ENSG00000164125			25312	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 18"""	C4orf18		12975309	Standard	NM_001031700		Approved	FLJ38155, DKFZp434L142	uc003ipr.4	Q6UWH4	OTTHUMG00000161537	ENST00000296530.8:c.1519A>G	4.37:g.159048600T>C	ENSP00000296530:p.Ile507Val					FAM198B_uc003ipq.3_Missense_Mutation_p.I515V|FAM198B_uc003ipr.3_Missense_Mutation_p.I507V	p.I507V	NM_016613	NP_057697	Q6UWH4	F198B_HUMAN			5	1971	-			507			Extracellular (Potential).		Q498Z3|Q6IAF9|Q6ZMF2|Q86XL0	Missense_Mutation	SNP	ENST00000296530.8	37	c.1519A>G	CCDS3798.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.171886	0.78452	.	.	ENSG00000164125	ENST00000337222;ENST00000296530;ENST00000393807	T;T	0.35236	1.32;1.32	5.92	5.92	0.95590	.	0.096661	0.64402	D	0.000002	T	0.61426	0.2346	M	0.79123	2.44	0.80722	D	1	D;D	0.71674	0.998;0.995	D;D	0.66847	0.947;0.92	T	0.65685	-0.6108	10	0.72032	D	0.01	-32.2661	16.3631	0.83280	0.0:0.0:0.0:1.0	.	515;507	Q6UWH4-2;Q6UWH4	.;F198B_HUMAN	V	507;507;515	ENSP00000296530:I507V;ENSP00000377396:I515V	ENSP00000296530:I507V	I	-	1	0	FAM198B	159268050	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.644000	0.61397	2.266000	0.75297	0.533000	0.62120	ATC		0.338	FAM198B-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365230.1	NM_001031700, NM_016613		35	157	0	0	0	0.005524	0	35	157				
RAPGEF2	9693	broad.mit.edu	37	4	160252815	160252815	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:160252815G>A	ENST00000264431.4	+	9	1545	c.1126G>A	c.(1126-1128)Gcg>Acg	p.A376T		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	376	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		GTTGAATATCGCGTGTGCTGC	0.403																																							uc003iqg.3		NA																	0				lung(2)|upper_aerodigestive_tract(1)|skin(1)	4						c.(1126-1128)GCG>ACG		Rap guanine nucleotide exchange factor 2							122.0	111.0	114.0					4																	160252815		1873	4110	5983	SO:0001583	missense	9693				cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity	g.chr4:160252815G>A	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.1126G>A	4.37:g.160252815G>A	ENSP00000264431:p.Ala376Thr						p.A376T	NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN		COAD - Colon adenocarcinoma(41;0.0817)	9	1436	+	all_hematologic(180;0.24)		376			N-terminal Ras-GEF.		D3DP27	Missense_Mutation	SNP	ENST00000264431.4	37	c.1126G>A	CCDS43277.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.98|19.98	3.926581|3.926581	0.73327|0.73327	.|.	.|.	ENSG00000109756|ENSG00000109756	ENST00000264431|ENST00000512056	T|.	0.28895|.	1.59|.	5.39|5.39	5.39|5.39	0.77823|0.77823	PDZ/DHR/GLGF (1);Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78910|0.78910	0.4358|0.4358	M|M	0.79805|0.79805	2.47|2.47	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.81914|.	0.995|.	T|T	0.79436|0.79436	-0.1804|-0.1804	10|5	0.87932|.	D|.	0|.	.|.	19.1678|19.1678	0.93563|0.93563	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	376|.	Q9Y4G8|.	RPGF2_HUMAN|.	T|H	376|13	ENSP00000264431:A376T|.	ENSP00000264431:A376T|.	A|R	+|+	1|2	0|0	RAPGEF2|RAPGEF2	160472265|160472265	1.000000|1.000000	0.71417|0.71417	0.977000|0.977000	0.42913|0.42913	0.054000|0.054000	0.15201|0.15201	9.869000|9.869000	0.99810|0.99810	2.535000|2.535000	0.85469|0.85469	0.467000|0.467000	0.42956|0.42956	GCG|CGC		0.403	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	NM_014247		13	69	0	0	0	0.003163	0	13	69				
NPY1R	4886	broad.mit.edu	37	4	164247633	164247633	+	Missense_Mutation	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:164247633A>G	ENST00000296533.2	-	2	605	c.74T>C	c.(73-75)cTt>cCt	p.L25P	NPY1R_ENST00000509586.1_Intron	NM_000909.5	NP_000900.1	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	25					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose metabolic process (GO:0006006)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|regulation of blood pressure (GO:0008217)|regulation of multicellular organism growth (GO:0040014)|sensory perception of pain (GO:0019233)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			breast(1)|cervix(1)|large_intestine(4)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)	30	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				AAAAGCCAGAAGCTGGGCATT	0.378																																							uc003iqm.1		NA																	0				lung(1)|pancreas(1)	2						c.(73-75)CTT>CCT		neuropeptide Y receptor Y1							97.0	94.0	95.0					4																	164247633		2203	4300	6503	SO:0001583	missense	4886				inhibition of adenylate cyclase activity by G-protein signaling pathway|outflow tract morphogenesis	integral to plasma membrane	protein binding	g.chr4:164247633A>G		CCDS34089.1	4q31.3-q32	2012-08-08				ENSG00000164128		"""GPCR / Class A : Neuropeptide receptors : Y"""	7956	protein-coding gene	gene with protein product		162641		NPYR		8095935	Standard	NM_000909		Approved		uc003iqm.2	P25929		ENST00000296533.2:c.74T>C	4.37:g.164247633A>G	ENSP00000354652:p.Leu25Pro					NPY1R_uc011cjj.1_Intron	p.L25P	NM_000909	NP_000900	P25929	NPY1R_HUMAN			2	340	-	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)	25			Extracellular (Potential).		B2R6H5	Missense_Mutation	SNP	ENST00000296533.2	37	c.74T>C	CCDS34089.1	.	.	.	.	.	.	.	.	.	.	A	2.323	-0.355134	0.05138	.	.	ENSG00000164128	ENST00000296533;ENST00000504790;ENST00000515701	T	0.37235	1.21	5.55	2.69	0.31865	.	1.764510	0.02716	N	0.113474	T	0.23727	0.0574	N	0.14661	0.345	0.09310	N	0.999999	B	0.28512	0.214	B	0.22386	0.039	T	0.18178	-1.0345	10	0.35671	T	0.21	.	6.9761	0.24677	0.6816:0.0:0.0704:0.248	.	25	P25929	NPY1R_HUMAN	P	25	ENSP00000354652:L25P	ENSP00000354652:L25P	L	-	2	0	NPY1R	164467083	0.574000	0.26684	0.618000	0.29105	0.131000	0.20780	1.753000	0.38359	0.888000	0.36160	0.528000	0.53228	CTT		0.378	NPY1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364685.1			7	49	0	0	0	0.001984	0	7	49				
NPY5R	4889	broad.mit.edu	37	4	164271488	164271488	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:164271488C>A	ENST00000515560.1	+	4	1585	c.63C>A	c.(61-63)gcC>gcA	p.A21A	NPY5R_ENST00000506953.1_Silent_p.A21A|NPY5R_ENST00000338566.3_Silent_p.A21A			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	21					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				ATACTGCTGCCACTCGGAATT	0.383																																					Melanoma(139;1287 1774 9781 19750 25599)	Melanoma(139;1287 1774 9781 19750 25599)	uc003iqn.2		NA																	0				lung(6)|skin(1)	7						c.(61-63)GCC>GCA		neuropeptide Y receptor Y5							70.0	70.0	70.0					4																	164271488		2203	4300	6503	SO:0001819	synonymous_variant	4889				cardiac left ventricle morphogenesis|outflow tract morphogenesis	integral to plasma membrane		g.chr4:164271488C>A	BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.63C>A	4.37:g.164271488C>A							p.A21A	NM_006174	NP_006165	Q15761	NPY5R_HUMAN			4	245	+	all_hematologic(180;0.166)	Prostate(90;0.109)	21			Extracellular (Potential).		Q6GTR7|Q92916	Silent	SNP	ENST00000515560.1	37	c.63C>A	CCDS3804.1																																																																																				0.383	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364633.1	NM_006174		14	50	1	0	7.93312e-07	0.00245	1.01678e-06	14	50				
TLL1	7092	broad.mit.edu	37	4	167012334	167012334	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:167012334G>C	ENST00000061240.2	+	19	3144	c.2497G>C	c.(2497-2499)Gaa>Caa	p.E833Q	TLL1_ENST00000507499.1_Missense_Mutation_p.E856Q	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	833	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TGACCACTTAGAAGTATTTGA	0.343																																							uc003irh.1		NA																	0				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7						c.(2497-2499)GAA>CAA		tolloid-like 1 precursor							99.0	97.0	97.0					4																	167012334		2203	4299	6502	SO:0001583	missense	7092				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr4:167012334G>C	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2497G>C	4.37:g.167012334G>C	ENSP00000061240:p.Glu833Gln					TLL1_uc011cjn.1_Missense_Mutation_p.E856Q|TLL1_uc011cjo.1_Missense_Mutation_p.E657Q	p.E833Q	NM_012464	NP_036596	O43897	TLL1_HUMAN		GBM - Glioblastoma multiforme(119;0.103)	19	3144	+	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)	833			CUB 4.		B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	c.2497G>C	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.938186	0.92526	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	T;T	0.22134	1.97;1.97	5.3	5.3	0.74995	CUB (5);	0.000000	0.85682	U	0.000000	T	0.44808	0.1311	M	0.72118	2.19	0.80722	D	1	D;P	0.67145	0.996;0.787	P;P	0.61328	0.887;0.614	T	0.30592	-0.9973	10	0.45353	T	0.12	.	18.9654	0.92694	0.0:0.0:1.0:0.0	.	856;833	E9PD25;O43897	.;TLL1_HUMAN	Q	833;856	ENSP00000061240:E833Q;ENSP00000426082:E856Q	ENSP00000061240:E833Q	E	+	1	0	TLL1	167231784	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.715000	0.98748	2.503000	0.84419	0.467000	0.42956	GAA		0.343	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1			7	40	0	0	0	0.004482	0	7	40				
GPM6A	2823	broad.mit.edu	37	4	176561298	176561298	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:176561298C>T	ENST00000280187.7	-	7	711	c.666G>A	c.(664-666)ggG>ggA	p.G222G	GPM6A_ENST00000506894.1_Silent_p.G211G|GPM6A_ENST00000393658.2_Silent_p.G222G|GPM6A_ENST00000506219.1_5'UTR|GPM6A_ENST00000515090.1_Silent_p.G215G	NM_005277.4	NP_005268.1	P51674	GPM6A_HUMAN	glycoprotein M6A	222					neural retina development (GO:0003407)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|positive regulation of filopodium assembly (GO:0051491)|stem cell differentiation (GO:0048863)|synapse assembly (GO:0007416)	axonal growth cone (GO:0044295)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium channel activity (GO:0005262)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		TGACTGCTGCCCCAGCTCCAG	0.428																																							uc003iuf.2		NA																	0					0						c.(664-666)GGG>GGA		glycoprotein M6A isoform 2							118.0	115.0	116.0					4																	176561298		2203	4300	6503	SO:0001819	synonymous_variant	2823					cell surface|integral to membrane		g.chr4:176561298C>T		CCDS3824.1, CCDS54822.1, CCDS58936.1	4q34	2008-08-29				ENSG00000150625			4460	protein-coding gene	gene with protein product		601275		GPM6		8661015, 18574501	Standard	NM_005277		Approved		uc003iug.4	P51674		ENST00000280187.7:c.666G>A	4.37:g.176561298C>T						GPM6A_uc011ckj.1_Silent_p.G215G|GPM6A_uc003iug.2_Silent_p.G222G|GPM6A_uc003iuh.2_Silent_p.G211G	p.G222G	NM_201591	NP_963885	P51674	GPM6A_HUMAN		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)	6	1470	-		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)	222			Helical; (Potential).		B7Z642|E9PHI5|Q92602	Silent	SNP	ENST00000280187.7	37	c.666G>A	CCDS3824.1																																																																																				0.428	GPM6A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362163.1			12	59	0	0	0	0.010729	0	12	59				
ACSL1	2180	broad.mit.edu	37	4	185694265	185694265	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:185694265G>A	ENST00000515030.1	-	10	1210	c.885C>T	c.(883-885)agC>agT	p.S295S	ACSL1_ENST00000507295.1_Silent_p.S261S|ACSL1_ENST00000504342.1_Silent_p.S295S|ACSL1_ENST00000454703.2_Silent_p.S124S|ACSL1_ENST00000281455.2_Silent_p.S295S|ACSL1_ENST00000504900.1_Silent_p.S295S|ACSL1_ENST00000513317.1_Silent_p.S295S|ACSL1_ENST00000437665.3_Silent_p.S124S			P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1	295					adiponectin-activated signaling pathway (GO:0033211)|alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|linoleic acid metabolic process (GO:0043651)|lipid biosynthetic process (GO:0008610)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid metabolic process (GO:0033559)|xenobiotic catabolic process (GO:0042178)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|liver(1)|lung(17)|ovary(2)|prostate(1)|skin(2)	38		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CTGAACAATCGCTCACTATGT	0.428																																							uc003iww.2		NA																	0				ovary(2)	2						c.(883-885)AGC>AGT		acyl-CoA synthetase long-chain family member 1	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)						125.0	114.0	118.0					4																	185694265		2203	4300	6503	SO:0001819	synonymous_variant	2180				digestion|fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|regulation of fatty acid oxidation|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity	g.chr4:185694265G>A	BC026290	CCDS3839.1, CCDS68825.1, CCDS68826.1, CCDS75213.1	4q35.1	2014-08-08	2004-02-19	2004-02-20	ENSG00000151726	ENSG00000151726	6.2.1.3	"""Acyl-CoA synthetase family"""	3569	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", ""long-chain fatty-acid-coenzyme A ligase 1"""	152425	"""fatty-acid-Coenzyme A ligase, long-chain 2"""	FACL2		2341402, 1531127	Standard	XM_005262828		Approved	LACS2, LACS, ACS1, LACS1, FACL1	uc003iwu.1	P33121	OTTHUMG00000160547	ENST00000515030.1:c.885C>T	4.37:g.185694265G>A						ACSL1_uc011ckm.1_Silent_p.S124S|ACSL1_uc003iwt.1_Silent_p.S295S|ACSL1_uc003iwu.1_Silent_p.S295S|ACSL1_uc011ckn.1_Silent_p.S261S|ACSL1_uc003iwv.1_Silent_p.S295S|ACSL1_uc010ise.1_RNA	p.S295S	NM_001995	NP_001986	P33121	ACSL1_HUMAN		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	10	1179	-		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)	295			Cytoplasmic (Potential).		B7Z452|D3DP57|P41215|Q8N8V7|Q8TA99	Silent	SNP	ENST00000515030.1	37	c.885C>T	CCDS3839.1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.263081	0.23051	.	.	ENSG00000151726	ENST00000505492	.	.	.	5.82	3.19	0.36642	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.5793	10.8397	0.46708	0.203:0.0:0.797:0.0	.	.	.	.	X	43	.	.	R	-	1	2	ACSL1	185931259	1.000000	0.71417	0.816000	0.32577	0.958000	0.62258	1.549000	0.36212	0.389000	0.25086	-0.237000	0.12165	CGA		0.428	ACSL1-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361112.2	NM_001995		11	48	0	0	0	0.001855	0	11	48				
SORBS2	8470	broad.mit.edu	37	4	186544881	186544881	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:186544881G>A	ENST00000284776.7	-	13	2199	c.1690C>T	c.(1690-1692)Ccc>Tcc	p.P564S	SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000355634.5_Missense_Mutation_p.P664S|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000418609.1_Missense_Mutation_p.P468S|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000431808.1_Missense_Mutation_p.P564S|SORBS2_ENST00000498125.1_Intron	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	564					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		CCCCGAGCGGGGGGGCCGCTT	0.582																																					Esophageal Squamous(153;41 2433 9491 36028)	Esophageal Squamous(153;41 2433 9491 36028)	uc003iyl.2		NA																	0				ovary(1)	1						c.(1690-1692)CCC>TCC		sorbin and SH3 domain containing 2 isoform 2							25.0	31.0	29.0					4																	186544881		2197	4282	6479	SO:0001583	missense	8470					actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chr4:186544881G>A		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.1690C>T	4.37:g.186544881G>A	ENSP00000284776:p.Pro564Ser					SORBS2_uc003iyh.2_Intron|SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Intron|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iym.2_Missense_Mutation_p.P664S|SORBS2_uc003iyn.1_Intron|SORBS2_uc011cku.1_Intron|SORBS2_uc011ckv.1_Missense_Mutation_p.P468S|SORBS2_uc003iyd.2_Intron|SORBS2_uc003iye.2_Intron|SORBS2_uc003iya.2_Intron|SORBS2_uc003iyb.2_Intron|SORBS2_uc003iyc.2_Intron|SORBS2_uc003iyg.2_Missense_Mutation_p.P678S|SORBS2_uc003iyf.2_Intron|SORBS2_uc003iyo.1_Intron	p.P564S	NM_021069	NP_066547	O94875	SRBS2_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)	13	2548	-		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)	564					A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	ENST00000284776.7	37	c.1690C>T	CCDS3845.1	.	.	.	.	.	.	.	.	.	.	G	3.411	-0.120261	0.06838	.	.	ENSG00000154556	ENST00000284776;ENST00000431808;ENST00000418609;ENST00000355634	T;T;T;T	0.35236	1.41;1.41;1.32;1.41	5.24	3.33	0.38152	.	0.366282	0.31381	N	0.007745	T	0.29556	0.0737	L	0.43923	1.385	0.09310	N	1	B;B;B	0.24823	0.062;0.112;0.062	B;B;B	0.24394	0.053;0.039;0.053	T	0.31081	-0.9956	10	0.87932	D	0	-5.0334	9.5479	0.39293	0.0:0.2088:0.5416:0.2496	.	468;664;564	B7Z3X6;B3KPQ7;O94875	.;.;SRBS2_HUMAN	S	564;564;468;664	ENSP00000284776:P564S;ENSP00000411764:P564S;ENSP00000397482:P468S;ENSP00000347852:P664S	ENSP00000284776:P564S	P	-	1	0	SORBS2	186781875	0.993000	0.37304	0.595000	0.28798	0.002000	0.02628	1.323000	0.33701	1.409000	0.46915	0.561000	0.74099	CCC		0.582	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603		11	68	0	0	0	0.008291	0	11	68				
LRRC14B	389257	broad.mit.edu	37	5	195068	195068	+	Missense_Mutation	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:195068T>A	ENST00000328278.3	+	2	1173	c.1145T>A	c.(1144-1146)cTg>cAg	p.L382Q	CTD-2083E4.7_ENST00000563761.1_RNA	NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	382										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						ATGCTGATCCTGGGCCTGAGC	0.662																																							uc003jal.1		NA																	0				skin(1)	1						c.(1144-1146)CTG>CAG		leucine rich repeat containing 14B							20.0	24.0	23.0					5																	195068		2119	4233	6352	SO:0001583	missense	389257							g.chr5:195068T>A		CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.1145T>A	5.37:g.195068T>A	ENSP00000327675:p.Leu382Gln						p.L382Q	NM_001080478	NP_001073947	A6NHZ5	LR14B_HUMAN			2	1173	+			382						Missense_Mutation	SNP	ENST00000328278.3	37	c.1145T>A	CCDS47184.1	.	.	.	.	.	.	.	.	.	.	T	1.923	-0.447828	0.04572	.	.	ENSG00000185028	ENST00000328278	T	0.05649	3.41	5.65	4.39	0.52855	.	0.853594	0.10808	N	0.631988	T	0.05686	0.0149	L	0.28400	0.85	0.09310	N	1	B	0.24920	0.114	B	0.20955	0.032	T	0.39187	-0.9626	10	0.48119	T	0.1	.	6.3706	0.21479	0.0:0.2293:0.0:0.7707	.	382	A6NHZ5	LR14B_HUMAN	Q	382	ENSP00000327675:L382Q	ENSP00000327675:L382Q	L	+	2	0	LRRC14B	248068	0.988000	0.35896	0.328000	0.25416	0.063000	0.16089	2.381000	0.44336	0.852000	0.35287	0.459000	0.35465	CTG		0.662	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000365393.2	NM_001080478		19	48	0	0	0	0.007413	0	19	48				
TPPP	11076	broad.mit.edu	37	5	678034	678034	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:678034G>A	ENST00000360578.5	-	2	263	c.142C>T	c.(142-144)Ctc>Ttc	p.L48F	CTD-2589H19.6_ENST00000607068.1_RNA	NM_007030.2	NP_008961.1	O94811	TPPP_HUMAN	tubulin polymerization promoting protein	48	Mediates interaction with LIMK1.				microtubule bundle formation (GO:0001578)|microtubule polymerization (GO:0046785)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein polymerization (GO:0032273)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5		Ovarian(839;0.0563)	Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)	GBM - Glioblastoma multiforme(108;0.0191)		AGGGCACTGAGCTCAGGGGAT	0.697																																							uc003jbg.3		NA																	0					0						c.(142-144)CTC>TTC		tubulin polymerization promoting protein							41.0	36.0	38.0					5																	678034		2201	4298	6499	SO:0001583	missense	11076				microtubule bundle formation|microtubule polymerization|positive regulation of protein polymerization	nucleus|perinuclear region of cytoplasm|soluble fraction	calcium ion binding|microtubule binding	g.chr5:678034G>A	AB017016	CCDS3856.1	5p15.33	2008-02-05			ENSG00000171368	ENSG00000171368			24164	protein-coding gene	gene with protein product	"""brain specific protein p25 alpha"""	608773				10083737, 12093283, 15590652, 17105200	Standard	NM_007030		Approved	p25alpha, TPPP1, p25, TPPP/p25	uc003jbh.4	O94811	OTTHUMG00000131011	ENST00000360578.5:c.142C>T	5.37:g.678034G>A	ENSP00000353785:p.Leu48Phe					TPPP_uc003jbh.3_Missense_Mutation_p.L48F	p.L48F	NM_007030	NP_008961	O94811	TPPP_HUMAN	Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)	GBM - Glioblastoma multiforme(108;0.0191)	1	860	-		Ovarian(839;0.0563)	48			Mediates interaction with LIMK1.			Missense_Mutation	SNP	ENST00000360578.5	37	c.142C>T	CCDS3856.1	.	.	.	.	.	.	.	.	.	.	g	12.42	1.933393	0.34096	.	.	ENSG00000171368	ENST00000360578	T	0.44482	0.92	5.18	4.3	0.51218	EF-hand-like domain (1);	0.281299	0.29046	N	0.013312	T	0.32133	0.0819	L	0.27053	0.805	0.37860	D	0.929704	B	0.34103	0.437	B	0.36244	0.22	T	0.32877	-0.9890	10	0.59425	D	0.04	-29.5851	11.3116	0.49366	0.0:0.1373:0.7205:0.1422	.	48	O94811	TPPP_HUMAN	F	48	ENSP00000353785:L48F	ENSP00000353785:L48F	L	-	1	0	TPPP	731034	0.881000	0.30235	0.976000	0.42696	0.758000	0.43043	0.613000	0.24299	1.141000	0.42275	0.561000	0.74099	CTC		0.697	TPPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253645.3	NM_007030		8	62	0	0	0	0.004482	0	8	62				
ADAMTS16	170690	broad.mit.edu	37	5	5239793	5239793	+	Splice_Site	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:5239793G>T	ENST00000274181.7	+	16	2416		c.e16-1			NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16						branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CCTTTATCTAGAGTATTATCA	0.458																																							uc003jdl.2		NA																	0				ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						c.e16-1		ADAM metallopeptidase with thrombospondin type 1							159.0	147.0	151.0					5																	5239793		1859	4117	5976	SO:0001630	splice_region_variant	170690				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:5239793G>T	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2279-1G>T	5.37:g.5239793G>T						ADAMTS16_uc003jdk.1_Splice_Site_p.Q760_splice	p.Q760_splice	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN			16	2417	+								C6G490|Q8IVE2	Splice_Site	SNP	ENST00000274181.7	37	c.2279_splice	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.421794	0.62622	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2879	0.90120	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAMTS16	5292793	1.000000	0.71417	0.988000	0.46212	0.632000	0.37999	8.985000	0.93487	2.615000	0.88500	0.655000	0.94253	.		0.458	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	Intron	32	105	1	0	1.03484e-13	0.005524	1.69023e-13	32	105				
MARCH6	10299	broad.mit.edu	37	5	10407232	10407232	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:10407232G>T	ENST00000274140.5	+	17	1603	c.1471G>T	c.(1471-1473)Gtc>Ttc	p.V491F	MARCH6_ENST00000449913.2_Missense_Mutation_p.V443F|MARCH6_ENST00000510792.1_Missense_Mutation_p.V189F|MARCH6_ENST00000503788.1_Missense_Mutation_p.V386F	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	491					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						TGGCTCCATTGTCCTCCTGAT	0.408																																							uc003jet.1		NA																	0				ovary(1)|breast(1)	2						c.(1471-1473)GTC>TTC		membrane-associated ring finger (C3HC4) 6							357.0	320.0	333.0					5																	10407232		2203	4300	6503	SO:0001583	missense	10299				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr5:10407232G>T	AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.1471G>T	5.37:g.10407232G>T	ENSP00000274140:p.Val491Phe					MARCH6_uc011cmu.1_Missense_Mutation_p.V443F|MARCH6_uc003jeu.1_Missense_Mutation_p.V189F|MARCH6_uc011cmv.1_Missense_Mutation_p.V386F	p.V491F	NM_005885	NP_005876	O60337	MARH6_HUMAN			17	1654	+			491			Helical; (Potential).		A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Missense_Mutation	SNP	ENST00000274140.5	37	c.1471G>T	CCDS34135.1	.	.	.	.	.	.	.	.	.	.	G	32	5.185383	0.94885	.	.	ENSG00000145495	ENST00000449913;ENST00000503788;ENST00000274140;ENST00000510792	T;T;T;T	0.39787	1.06;1.06;1.06;1.06	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.70307	0.3209	M	0.82323	2.585	0.80722	D	1	D;D;D;D	0.89917	0.998;0.999;1.0;0.999	D;D;D;D	0.87578	0.979;0.978;0.998;0.947	T	0.72947	-0.4137	10	0.87932	D	0	-25.1299	20.2723	0.98479	0.0:0.0:1.0:0.0	.	386;443;71;491	B4DKJ2;B4DT33;B2RBJ1;O60337	.;.;.;MARH6_HUMAN	F	443;386;491;189	ENSP00000414643:V443F;ENSP00000425930:V386F;ENSP00000274140:V491F;ENSP00000424512:V189F	ENSP00000274140:V491F	V	+	1	0	MARCH6	10460232	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	9.346000	0.97056	2.793000	0.96121	0.563000	0.77884	GTC		0.408	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366919.2	NM_005885		40	125	1	0	1.59932e-28	0.007835	3.02305e-28	40	125				
CTNND2	1501	broad.mit.edu	37	5	11117652	11117652	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:11117652G>T	ENST00000304623.8	-	13	2376	c.2187C>A	c.(2185-2187)gcC>gcA	p.A729A	CTNND2_ENST00000359640.2_Silent_p.A729A|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000458100.2_Silent_p.A296A|CTNND2_ENST00000503622.1_Silent_p.A392A|CTNND2_ENST00000511377.1_Silent_p.A638A	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	729					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TCCTTCTGCGGGCCTCCTCTC	0.537																																							uc003jfa.1		NA																	0				large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						c.(2185-2187)GCC>GCA		catenin (cadherin-associated protein), delta 2							169.0	134.0	146.0					5																	11117652		2203	4300	6503	SO:0001819	synonymous_variant	1501				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding	g.chr5:11117652G>T	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2187C>A	5.37:g.11117652G>T						CTNND2_uc010itt.2_Silent_p.A638A|CTNND2_uc011cmy.1_Silent_p.A392A|CTNND2_uc011cmz.1_Silent_p.A296A|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Silent_p.A296A	p.A729A	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN			13	2332	-			729			ARM 6.		B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	ENST00000304623.8	37	c.2187C>A	CCDS3881.1																																																																																				0.537	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332		20	125	1	0	5.03518e-11	0.007413	7.67323e-11	20	125				
CTNND2	1501	broad.mit.edu	37	5	11732360	11732360	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:11732360G>T	ENST00000304623.8	-	2	251	c.62C>A	c.(61-63)cCt>cAt	p.P21H	CTNND2_ENST00000359640.2_Missense_Mutation_p.P21H|CTNND2_ENST00000458100.2_5'UTR	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	21					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GGCTGATGAAGGCTGGTCTGG	0.507																																							uc003jfa.1		NA																	0				large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						c.(61-63)CCT>CAT		catenin (cadherin-associated protein), delta 2							115.0	116.0	115.0					5																	11732360		2203	4300	6503	SO:0001583	missense	1501				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding	g.chr5:11732360G>T	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.62C>A	5.37:g.11732360G>T	ENSP00000307134:p.Pro21His					CTNND2_uc011cmz.1_5'UTR|CTNND2_uc010itu.1_RNA	p.P21H	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN			2	207	-			21					B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	c.62C>A	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.670360	0.88348	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000502551;ENST00000508761	T;T	0.76186	-0.94;-1.0	5.8	5.8	0.92144	.	0.000000	0.44097	D	0.000486	T	0.66799	0.2826	N	0.08118	0	0.80722	D	1	D	0.58620	0.983	P	0.50231	0.635	T	0.73924	-0.3829	10	0.66056	D	0.02	-8.5174	17.5544	0.87886	0.0:0.0:1.0:0.0	.	21	Q9UQB3	CTND2_HUMAN	H	21;21;7;7	ENSP00000307134:P21H;ENSP00000352661:P21H	ENSP00000307134:P21H	P	-	2	0	CTNND2	11785360	1.000000	0.71417	0.985000	0.45067	0.990000	0.78478	5.571000	0.67404	2.739000	0.93911	0.643000	0.83706	CCT		0.507	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332		31	71	1	0	5.45727e-16	0.008361	9.49803e-16	31	71				
CDH12	1010	broad.mit.edu	37	5	21752095	21752095	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:21752095G>A	ENST00000382254.1	-	15	3222	c.2136C>T	c.(2134-2136)gaC>gaT	p.D712D	CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000504376.2_Silent_p.D712D|CDH12_ENST00000522262.1_Silent_p.D672D|RP11-804N13.1_ENST00000522350.1_RNA	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	712					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						AATCCCTTATGTCTGTGTTAT	0.453										HNSCC(59;0.17)																													uc010iuc.2		NA																	0				ovary(2)	2						c.(2134-2136)GAC>GAT		cadherin 12, type 2 preproprotein							243.0	213.0	223.0					5																	21752095		2203	4300	6503	SO:0001819	synonymous_variant	1010				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:21752095G>A	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2136C>T	5.37:g.21752095G>A		HNSCC(59;0.17)				CDH12_uc011cno.1_Silent_p.D672D|CDH12_uc003jgk.2_Silent_p.D712D|uc003jgj.2_Intron	p.D712D	NM_004061	NP_004052	P55289	CAD12_HUMAN			12	2594	-			712			Cytoplasmic (Potential).		B2RBT1|B7Z2U6|Q86UD2	Silent	SNP	ENST00000382254.1	37	c.2136C>T	CCDS3890.1																																																																																				0.453	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061		12	67	0	0	0	0.003163	0	12	67				
TARS	6897	broad.mit.edu	37	5	33462222	33462222	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:33462222G>A	ENST00000265112.3	+	16	2060	c.1749G>A	c.(1747-1749)aaG>aaA	p.K583K	TARS_ENST00000414361.2_Silent_p.K462K|TARS_ENST00000509410.1_3'UTR|TARS_ENST00000502553.1_Silent_p.K583K|TARS_ENST00000455217.2_Silent_p.K616K|TARS_ENST00000541634.1_Silent_p.K479K	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	583					gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)			NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	GTGATGATAAGAAAAGGCCAG	0.353																																							uc003jhy.2		NA																	0				ovary(2)	2						c.(1747-1749)AAG>AAA		threonyl-tRNA synthetase	L-Threonine(DB00156)						88.0	93.0	91.0					5																	33462222		2203	4300	6503	SO:0001819	synonymous_variant	6897				threonyl-tRNA aminoacylation	cytosol	ATP binding|protein homodimerization activity|threonine-tRNA ligase activity	g.chr5:33462222G>A	AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.1749G>A	5.37:g.33462222G>A						TARS_uc011cob.1_Silent_p.K571K|TARS_uc010iup.1_Silent_p.K524K|TARS_uc011coc.1_Silent_p.K604K|TARS_uc003jhz.2_Silent_p.K479K|TARS_uc011cod.1_Silent_p.K462K	p.K583K	NM_152295	NP_689508	P26639	SYTC_HUMAN			16	2044	+			583					A8K8I1|B4DEG8|Q96FP5|Q9BWA6	Silent	SNP	ENST00000265112.3	37	c.1749G>A	CCDS3899.1																																																																																				0.353	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207367.1	NM_152295		20	104	0	0	0	0.010504	0	20	104				
IL7R	3575	broad.mit.edu	37	5	35871178	35871178	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:35871178G>T	ENST00000303115.3	+	4	529	c.400G>T	c.(400-402)Gac>Tac	p.D134Y	IL7R_ENST00000343305.4_Missense_Mutation_p.D134Y|IL7R_ENST00000506850.1_Missense_Mutation_p.D134Y	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	134	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			GGCTCCTTTTGACCTGAGTGT	0.363			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																																uc003jjs.2		NA		Dom	yes		5	5p13	146661		interleukin 7 receptor	yes		L					0				ovary(3)|breast(1)|skin(1)	5						c.(400-402)GAC>TAC		interleukin 7 receptor precursor							59.0	61.0	60.0					5																	35871178		2203	4300	6503	SO:0001583	missense	3575				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity	g.chr5:35871178G>T	M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.400G>T	5.37:g.35871178G>T	ENSP00000306157:p.Asp134Tyr					IL7R_uc011coo.1_Missense_Mutation_p.D134Y|IL7R_uc011cop.1_RNA	p.D134Y	NM_002185	NP_002176	P16871	IL7RA_HUMAN	Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)		4	489	+	all_lung(31;0.00015)		134			Extracellular (Potential).|Fibronectin type-III.		B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	ENST00000303115.3	37	c.400G>T	CCDS3911.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.207133	0.39003	.	.	ENSG00000168685	ENST00000303115;ENST00000343305;ENST00000506850	T;T;T	0.70869	-0.52;-0.52;-0.52	5.56	2.75	0.32379	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.270254	0.37669	N	0.001993	T	0.78362	0.4271	M	0.64997	1.995	0.43430	D	0.995596	D;D	0.89917	1.0;1.0	D;D	0.71184	0.941;0.972	T	0.77161	-0.2689	10	0.62326	D	0.03	2.9795	8.6174	0.33840	0.2524:0.0:0.7476:0.0	.	134;134	D6RGV2;P16871	.;IL7RA_HUMAN	Y	134	ENSP00000306157:D134Y;ENSP00000345819:D134Y;ENSP00000421207:D134Y	ENSP00000306157:D134Y	D	+	1	0	IL7R	35906935	0.997000	0.39634	0.982000	0.44146	0.340000	0.28889	2.352000	0.44080	0.688000	0.31529	-0.150000	0.13652	GAC		0.363	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2			14	44	1	0	1.49906e-05	0.00245	1.77162e-05	14	44				
C5orf42	65250	broad.mit.edu	37	5	37169412	37169412	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:37169412G>A	ENST00000508244.1	-	33	6807	c.6714C>T	c.(6712-6714)ccC>ccT	p.P2238P	C5orf42_ENST00000274258.7_Silent_p.P1118P|C5orf42_ENST00000425232.2_Silent_p.P2238P			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	2238						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GTAAGAAAAGGGGCTGGAATT	0.443																																							uc011cpa.1		NA																	0				ovary(4)|breast(2)|skin(1)	7						c.(6712-6714)CCC>CCT		hypothetical protein LOC65250							82.0	84.0	83.0					5																	37169412		2203	4300	6503	SO:0001819	synonymous_variant	65250							g.chr5:37169412G>A		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.6714C>T	5.37:g.37169412G>A						C5orf42_uc011coy.1_Silent_p.P738P|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Silent_p.P1313P|C5orf42_uc003jkr.1_Silent_p.P271P	p.P2238P	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)		34	6945	-	all_lung(31;0.000616)		2238					A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Silent	SNP	ENST00000508244.1	37	c.6714C>T	CCDS34146.2																																																																																				0.443	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073		13	136	0	0	0	0.00245	0	13	136				
HCN1	348980	broad.mit.edu	37	5	45262209	45262209	+	Silent	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:45262209T>C	ENST00000303230.4	-	8	2544	c.2487A>G	c.(2485-2487)gcA>gcG	p.A829A		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	829					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						TCCTGCCCCCTGCCTGAAGGC	0.672																																							uc003jok.2		NA																	0				ovary(1)	1						c.(2485-2487)GCA>GCG		hyperpolarization activated cyclic							31.0	34.0	33.0					5																	45262209		2203	4299	6502	SO:0001819	synonymous_variant	348980					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity	g.chr5:45262209T>C	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.2487A>G	5.37:g.45262209T>C							p.A829A	NM_021072	NP_066550	O60741	HCN1_HUMAN			8	2512	-			829			Cytoplasmic (Potential).			Silent	SNP	ENST00000303230.4	37	c.2487A>G	CCDS3952.1																																																																																				0.672	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072		13	50	0	0	0	0.001855	0	13	50				
ACTBL2	345651	broad.mit.edu	37	5	56777820	56777820	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:56777820G>T	ENST00000423391.1	-	1	816	c.715C>A	c.(715-717)Cgg>Agg	p.R239R	AC025470.1_ENST00000584598.1_RNA|CTD-2023N9.1_ENST00000506106.1_RNA	NM_001017992.3	NP_001017992.1	Q562R1	ACTBL_HUMAN	actin, beta-like 2	239						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(3)|pancreas(1)|prostate(2)	28		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;4.24e-37)		TCATAGCTCCGTTCCGGTGAG	0.547																																							uc003jrm.2		NA																	0				ovary(3)	3						c.(715-717)CGG>AGG		actin, beta-like 2							90.0	79.0	82.0					5																	56777820		2203	4300	6503	SO:0001819	synonymous_variant	345651					cytoplasm|cytoskeleton	ATP binding	g.chr5:56777820G>T		CCDS34163.1	5q11.2	2014-08-08			ENSG00000169067	ENSG00000169067			17780	protein-coding gene	gene with protein product		614835					Standard	NM_001017992		Approved	DKFZp686D0972	uc003jrm.3	Q562R1	OTTHUMG00000162330	ENST00000423391.1:c.715C>A	5.37:g.56777820G>T							p.R239R	NM_001017992	NP_001017992	Q562R1	ACTBL_HUMAN		OV - Ovarian serous cystadenocarcinoma(10;4.24e-37)	1	817	-		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)	239					B2RPJ1|Q562R2|Q562S9|Q562X8	Silent	SNP	ENST00000423391.1	37	c.715C>A	CCDS34163.1																																																																																				0.547	ACTBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368579.1	NM_001017992		13	60	1	0	1.61879e-10	0.013537	2.41492e-10	13	60				
MSH3	4437	broad.mit.edu	37	5	80109418	80109418	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:80109418G>T	ENST00000265081.6	+	20	2751	c.2671G>T	c.(2671-2673)Gta>Tta	p.V891L		NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	891					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		CTCAGAGAGAGTAATGATAAT	0.368								Mismatch excision repair (MMR)																													Melanoma(88;1010 1399 13793 26548 36275)	Melanoma(88;1010 1399 13793 26548 36275)	uc003kgz.2		NA																	0				lung(2)|ovary(1)|breast(1)	4						c.(2671-2673)GTA>TTA	MMR	mutS homolog 3							115.0	116.0	116.0					5																	80109418		2203	4300	6503	SO:0001583	missense	4437				maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding	g.chr5:80109418G>T	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.2671G>T	5.37:g.80109418G>T	ENSP00000265081:p.Val891Leu						p.V891L	NM_002439	NP_002430	P20585	MSH3_HUMAN		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)	20	2924	+		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)	891					A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	37	c.2671G>T	CCDS34195.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.156990	0.78114	.	.	ENSG00000113318	ENST00000265081;ENST00000535995	D	0.84660	-1.88	5.72	5.72	0.89469	DNA mismatch repair protein MutS, C-terminal (2);	0.181464	0.48767	D	0.000163	T	0.80944	0.4721	N	0.10809	0.05	0.37683	D	0.923542	P	0.49783	0.928	P	0.50970	0.655	T	0.81145	-0.1066	9	.	.	.	-23.8097	19.8689	0.96843	0.0:0.0:1.0:0.0	.	891	P20585	MSH3_HUMAN	L	891;882	ENSP00000265081:V891L	.	V	+	1	0	MSH3	80145174	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	6.353000	0.73032	2.709000	0.92574	0.591000	0.81541	GTA		0.368	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439		10	56	1	0	2.74318e-10	0.006214	4.07321e-10	10	56				
ANKRD32	84250	broad.mit.edu	37	5	94030836	94030836	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:94030836C>A	ENST00000265140.5	+	21	3415	c.2996C>A	c.(2995-2997)aCc>aAc	p.T999N	ANKRD32_ENST00000493934.1_Intron	NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	999						centrosome (GO:0005813)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		CATAAAGAAACCACCAGTGTT	0.348																																							uc003kkr.3		NA																	0				ovary(2)	2						c.(2995-2997)ACC>AAC		ankyrin repeat domain 32							66.0	67.0	67.0					5																	94030836		2203	4299	6502	SO:0001583	missense	84250							g.chr5:94030836C>A	AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.2996C>A	5.37:g.94030836C>A	ENSP00000265140:p.Thr999Asn					ANKRD32_uc003kks.2_Missense_Mutation_p.T363N	p.T999N	NM_032290	NP_115666	Q9BQI6	ANR32_HUMAN		all cancers(79;3.88e-18)	21	3076	+		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)	999					B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Missense_Mutation	SNP	ENST00000265140.5	37	c.2996C>A	CCDS4071.2	.	.	.	.	.	.	.	.	.	.	C	10.46	1.356986	0.24598	.	.	ENSG00000133302	ENST00000265140	T	0.40476	1.03	5.46	4.54	0.55810	.	0.441905	0.22207	N	0.063146	T	0.27489	0.0675	N	0.24115	0.695	0.09310	N	1	B	0.16396	0.017	B	0.09377	0.004	T	0.07770	-1.0755	10	0.31617	T	0.26	.	10.5297	0.44969	0.1322:0.6385:0.2293:0.0	.	999	Q9BQI6	ANR32_HUMAN	N	999	ENSP00000265140:T999N	ENSP00000265140:T999N	T	+	2	0	ANKRD32	94056592	0.001000	0.12720	0.978000	0.43139	0.992000	0.81027	1.019000	0.30014	2.579000	0.87056	0.591000	0.81541	ACC		0.348	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241610.1	NM_032290		9	46	1	0	1.08611e-07	0.010729	1.45347e-07	9	46				
MAN2A1	4124	broad.mit.edu	37	5	109026153	109026153	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:109026153G>T	ENST00000261483.4	+	1	1087	c.35G>T	c.(34-36)aGt>aTt	p.S12I	CTC-332L22.1_ENST00000606424.1_lincRNA	NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	12					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		GTGTTCGGCAGTGCGATCTTC	0.582																																							uc003kou.1		NA																	0				ovary(1)|central_nervous_system(1)|pancreas(1)	3						c.(34-36)AGT>ATT		mannosidase, alpha, class 2A, member 1							214.0	184.0	194.0					5																	109026153		2202	4300	6502	SO:0001583	missense	4124				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding	g.chr5:109026153G>T		CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.35G>T	5.37:g.109026153G>T	ENSP00000261483:p.Ser12Ile					MAN2A1_uc003kot.1_RNA	p.S12I	NM_002372	NP_002363	Q16706	MA2A1_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)	1	998	+		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)	12			Helical; Signal-anchor for type II membrane protein; (Potential).		Q16767	Missense_Mutation	SNP	ENST00000261483.4	37	c.35G>T	CCDS34209.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.767948	0.90020	.	.	ENSG00000112893	ENST00000261483	T	0.78246	-1.16	4.6	4.6	0.57074	.	0.100836	0.64402	D	0.000003	T	0.82051	0.4953	M	0.65975	2.015	0.54753	D	0.999981	D	0.54772	0.968	P	0.51170	0.661	D	0.84522	0.0628	10	0.56958	D	0.05	-0.1343	16.5372	0.84375	0.0:0.0:1.0:0.0	.	12	Q16706	MA2A1_HUMAN	I	12	ENSP00000261483:S12I	ENSP00000261483:S12I	S	+	2	0	MAN2A1	109054052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.236000	0.78154	2.235000	0.73313	0.563000	0.77884	AGT		0.582	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1			6	29	1	0	2.0095e-06	0.001984	2.5099e-06	6	29				
SEMA6A	57556	broad.mit.edu	37	5	115813603	115813603	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:115813603C>T	ENST00000343348.6	-	15	2375	c.1588G>A	c.(1588-1590)Gac>Aac	p.D530N	CTB-118N6.3_ENST00000508640.1_RNA|CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000510263.1_Missense_Mutation_p.D530N|SEMA6A_ENST00000257414.8_Missense_Mutation_p.D530N|CTB-118N6.3_ENST00000514214.1_RNA|SEMA6A_ENST00000282394.6_Missense_Mutation_p.D62N	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	530					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		CAATATGGGTCTCTGGAGGCA	0.502																																							uc010jck.2		NA																	0				ovary(2)	2						c.(1588-1590)GAC>AAC		sema domain, transmembrane domain (TM), and							162.0	155.0	157.0					5																	115813603		1978	4155	6133	SO:0001583	missense	57556				apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity	g.chr5:115813603C>T	AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.1588G>A	5.37:g.115813603C>T	ENSP00000345512:p.Asp530Asn					SEMA6A_uc003krx.3_Missense_Mutation_p.D530N|SEMA6A_uc003krw.3_Missense_Mutation_p.D62N|SEMA6A_uc010jcj.2_Missense_Mutation_p.D74N	p.D530N	NM_020796	NP_065847	Q9H2E6	SEM6A_HUMAN		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)	15	2297	-		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)	530			Extracellular (Potential).		Q9P2H9	Missense_Mutation	SNP	ENST00000343348.6	37	c.1588G>A	CCDS47256.1	.	.	.	.	.	.	.	.	.	.	C	33	5.271512	0.95429	.	.	ENSG00000092421	ENST00000343348;ENST00000257414;ENST00000282394;ENST00000510263	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.77177	0.4092	M	0.92026	3.265	0.58432	D	0.999998	D;D;D;D	0.89917	0.999;0.999;0.998;1.0	D;D;D;D	0.79108	0.983;0.978;0.979;0.992	T	0.81134	-0.1071	10	0.87932	D	0	.	20.0532	0.97636	0.0:1.0:0.0:0.0	.	530;74;530;62	Q9H2E6;Q96SM8;Q9H2E6-2;E7ERF3	SEM6A_HUMAN;.;.;.	N	530;530;62;530	ENSP00000345512:D530N;ENSP00000257414:D530N;ENSP00000282394:D62N;ENSP00000424388:D530N	ENSP00000257414:D530N	D	-	1	0	SEMA6A	115841502	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.487000	0.81328	2.835000	0.97688	0.650000	0.86243	GAC		0.502	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371270.1	NM_020796		25	141	0	0	0	0.00632	0	25	141				
FTMT	94033	broad.mit.edu	37	5	121188294	121188294	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:121188294G>T	ENST00000321339.1	+	1	645	c.636G>T	c.(634-636)gtG>gtT	p.V212V		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	212	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		GTGACCACGTGCACAACTTAG	0.493																																							uc003kss.2		NA																	0				ovary(1)	1						c.(634-636)GTG>GTT		ferritin mitochondrial precursor							117.0	126.0	123.0					5																	121188294		2203	4300	6503	SO:0001819	synonymous_variant	94033				cellular iron ion homeostasis|iron ion transport|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity	mitochondrion	ferric iron binding|ferroxidase activity	g.chr5:121188294G>T	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.636G>T	5.37:g.121188294G>T							p.V212V	NM_177478	NP_803431	Q8N4E7	FTMT_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)	1	645	+		all_cancers(142;0.0124)|Prostate(80;0.0322)	212			Ferritin-like diiron.			Silent	SNP	ENST00000321339.1	37	c.636G>T	CCDS4128.1																																																																																				0.493	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	NM_177478		29	175	1	0	6.38683e-12	0.008361	1.00207e-11	29	175				
SNCAIP	9627	broad.mit.edu	37	5	121786272	121786272	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:121786272C>A	ENST00000261368.8	+	10	1992	c.1730C>A	c.(1729-1731)cCa>cAa	p.P577Q	CTC-210G5.1_ENST00000505546.1_RNA|SNCAIP_ENST00000414317.2_Missense_Mutation_p.P179Q|CTC-210G5.1_ENST00000506053.1_RNA|SNCAIP_ENST00000379536.2_Missense_Mutation_p.P517Q|SNCAIP_ENST00000503116.2_3'UTR|SNCAIP_ENST00000379533.2_Missense_Mutation_p.P624Q|CTC-210G5.1_ENST00000510972.1_RNA|SNCAIP_ENST00000379538.3_Missense_Mutation_p.P211Q|SNCAIP_ENST00000261367.7_Missense_Mutation_p.P624Q|SNCAIP_ENST00000542191.1_Missense_Mutation_p.P135Q|SNCAIP_ENST00000504884.2_3'UTR|CTC-210G5.1_ENST00000509993.1_RNA|CTC-210G5.1_ENST00000503529.1_RNA	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	577					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		TGGAAATCTCCAGATGCAGAT	0.483																																							uc003ksw.1		NA																	0		p.P577P(1)		ovary(1)|pancreas(1)	2						c.(1729-1731)CCA>CAA		synuclein alpha interacting protein							112.0	127.0	122.0					5																	121786272		2203	4299	6502	SO:0001583	missense	9627				cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding	g.chr5:121786272C>A	AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.1730C>A	5.37:g.121786272C>A	ENSP00000261368:p.Pro577Gln					SNCAIP_uc011cwl.1_Missense_Mutation_p.P135Q|SNCAIP_uc003ksx.1_Missense_Mutation_p.P624Q|SNCAIP_uc003ksy.1_Missense_Mutation_p.P211Q|SNCAIP_uc003ksz.1_Missense_Mutation_p.P211Q|SNCAIP_uc010jcu.2_Missense_Mutation_p.P173Q|SNCAIP_uc011cwm.1_Missense_Mutation_p.P211Q|SNCAIP_uc003kta.1_Missense_Mutation_p.P209Q|SNCAIP_uc010jcv.1_RNA|SNCAIP_uc010jcw.1_Missense_Mutation_p.P271Q|SNCAIP_uc010jcx.1_Missense_Mutation_p.P517Q|uc003ktb.1_RNA|SNCAIP_uc003ktc.1_Missense_Mutation_p.P93Q	p.P577Q	NM_005460	NP_005451	Q9Y6H5	SNCAP_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)	10	1936	+		all_cancers(142;0.00787)|Prostate(80;0.0327)	577					D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Missense_Mutation	SNP	ENST00000261368.8	37	c.1730C>A	CCDS4131.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.207661	0.58343	.	.	ENSG00000064692	ENST00000542191;ENST00000509154;ENST00000261368;ENST00000379533;ENST00000379536;ENST00000379538;ENST00000261367;ENST00000414317;ENST00000447854	T;T;T;T;T;T;T;T	0.12569	4.47;5.01;2.71;2.67;5.01;4.99;2.67;4.69	6.06	5.18	0.71444	.	0.426542	0.24873	N	0.034920	T	0.17746	0.0426	N	0.22421	0.69	0.24093	N	0.995907	P;P;P;P;P;P;D;P	0.60575	0.694;0.641;0.536;0.773;0.528;0.773;0.988;0.664	B;B;B;B;B;B;P;B	0.56700	0.296;0.1;0.094;0.277;0.261;0.277;0.804;0.143	T	0.05550	-1.0878	10	0.56958	D	0.05	-4.2163	10.6336	0.45551	0.0:0.8533:0.0:0.1467	.	517;205;179;517;211;211;624;577	D6R9G8;Q9NVG1;B7Z995;Q9Y6H5-4;Q9Y6H5-5;Q9Y6H5-2;Q9Y6H5-3;Q9Y6H5	.;.;.;.;.;.;.;SNCAP_HUMAN	Q	135;517;577;624;517;211;624;179;217	ENSP00000441681:P135Q;ENSP00000422106:P517Q;ENSP00000261368:P577Q;ENSP00000368848:P624Q;ENSP00000368851:P517Q;ENSP00000368854:P211Q;ENSP00000261367:P624Q;ENSP00000394392:P179Q	ENSP00000261367:P624Q	P	+	2	0	SNCAIP	121814171	0.891000	0.30450	0.569000	0.28460	0.780000	0.44128	2.428000	0.44749	1.547000	0.49401	0.655000	0.94253	CCA		0.483	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250888.1			29	127	1	0	5.77227e-19	0.008361	1.04756e-18	29	127				
FBN2	2201	broad.mit.edu	37	5	127595228	127595228	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:127595228C>A	ENST00000508053.1	-	71	9632	c.8658G>T	c.(8656-8658)ctG>ctT	p.L2886L	FBN2_ENST00000262464.4_Silent_p.L2886L			P35556	FBN2_HUMAN	fibrillin 2	2886					anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TGCTCTCTTCCAGTTTCTTAA	0.507																																							uc003kuu.2		NA																	0				ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15						c.(8656-8658)CTG>CTT		fibrillin 2 precursor							181.0	167.0	172.0					5																	127595228		2203	4300	6503	SO:0001819	synonymous_variant	2201				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent	g.chr5:127595228C>A	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.8658G>T	5.37:g.127595228C>A							p.L2886L	NM_001999	NP_001990	P35556	FBN2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)	65	9097	-		all_cancers(142;0.0216)|Prostate(80;0.0551)	2886					B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	37	c.8658G>T	CCDS34222.1																																																																																				0.507	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999		25	131	1	0	1.10923e-09	0.00278	1.60952e-09	25	131				
SLC27A6	28965	broad.mit.edu	37	5	128362849	128362849	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:128362849C>A	ENST00000262462.4	+	7	2289	c.1279C>A	c.(1279-1281)Cga>Aga	p.R427R	SLC27A6_ENST00000506176.1_Silent_p.R427R|SLC27A6_ENST00000395266.1_Silent_p.R427R			Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid transporter), member 6	427					long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|transmembrane transport (GO:0055085)|very long-chain fatty acid metabolic process (GO:0000038)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(2)|endometrium(1)|kidney(3)|large_intestine(11)|liver(1)|lung(20)|prostate(1)|skin(4)|stomach(1)	44		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		TCTCATTTCTCGAGTGAATGC	0.368																																							uc003kuy.2		NA																	0					0						c.(1279-1281)CGA>AGA		solute carrier family 27 (fatty acid							88.0	91.0	90.0					5																	128362849		2203	4300	6503	SO:0001819	synonymous_variant	28965				long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding	g.chr5:128362849C>A	AF064254	CCDS4145.1	5q23.3	2013-05-22			ENSG00000113396	ENSG00000113396		"""Acyl-CoA synthetase family"", ""Solute carriers"""	11000	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 2"""	604196				12556534, 10479480	Standard	XM_005271967		Approved	FATP6, VLCS-H1, FACVL2, ACSVL2	uc003kuy.3	Q9Y2P4	OTTHUMG00000128991	ENST00000262462.4:c.1279C>A	5.37:g.128362849C>A						SLC27A6_uc003kuz.2_Silent_p.R427R	p.R427R	NM_014031	NP_054750	Q9Y2P4	S27A6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)	8	1675	+		all_cancers(142;0.0483)|Prostate(80;0.055)	427					Q6IAM5|Q7Z6E6|Q86YF6	Silent	SNP	ENST00000262462.4	37	c.1279C>A	CCDS4145.1																																																																																				0.368	SLC27A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250980.1	NM_014031		11	63	1	0	3.86212e-05	0.008291	4.47304e-05	11	63				
TGFBI	7045	broad.mit.edu	37	5	135383018	135383018	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:135383018G>C	ENST00000442011.2	+	6	841	c.680G>C	c.(679-681)gGg>gCg	p.G227A	TGFBI_ENST00000305126.8_Missense_Mutation_p.G227A	NM_000358.2	NP_000349.1	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	227	FAS1 1. {ECO:0000255|PROSITE- ProRule:PRU00082}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCAACCAACGGGGTGGTGCAC	0.537																																							uc003lbf.3		NA																	0				breast(3)|ovary(1)	4						c.(679-681)GGG>GCG		transforming growth factor, beta-induced, 68kDa							170.0	166.0	167.0					5																	135383018		2126	4229	6355	SO:0001583	missense	7045				angiogenesis|cell adhesion|cell proliferation|negative regulation of cell adhesion|response to stimulus|visual perception	extracellular space|proteinaceous extracellular matrix	integrin binding	g.chr5:135383018G>C	M77349	CCDS47266.1	5q31	2008-02-05	2002-08-29		ENSG00000120708	ENSG00000120708			11771	protein-coding gene	gene with protein product		601692	"""transforming growth factor, beta-induced, 68kD"""	CSD3, LCD1, CSD1, CSD2		9463327	Standard	NM_000358		Approved	BIGH3, CDB1, CDGG1	uc003lbf.4	Q15582	OTTHUMG00000163213	ENST00000442011.2:c.680G>C	5.37:g.135383018G>C	ENSP00000416330:p.Gly227Ala					TGFBI_uc003lbg.3_5'UTR|TGFBI_uc003lbh.3_Missense_Mutation_p.G53A|TGFBI_uc011cyb.1_Missense_Mutation_p.G53A|TGFBI_uc010jed.2_5'Flank	p.G227A	NM_000358	NP_000349	Q15582	BGH3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)		6	841	+			227			FAS1 1.		D3DQB1|O14471|O14472|O14476|O43216|O43217|O43218|O43219|Q53XM1	Missense_Mutation	SNP	ENST00000442011.2	37	c.680G>C	CCDS47266.1	.	.	.	.	.	.	.	.	.	.	G	35	5.459847	0.96240	.	.	ENSG00000120708	ENST00000442011;ENST00000305126	D;D	0.93859	-3.3;-3.3	6.0	6.0	0.97389	FAS1 domain (5);	0.000000	0.85682	D	0.000000	D	0.97451	0.9166	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97429	1.0014	10	0.87932	D	0	-19.1517	20.5597	0.99324	0.0:0.0:1.0:0.0	.	227	Q15582	BGH3_HUMAN	A	227	ENSP00000416330:G227A;ENSP00000306306:G227A	ENSP00000306306:G227A	G	+	2	0	TGFBI	135410917	1.000000	0.71417	0.946000	0.38457	0.975000	0.68041	9.865000	0.99609	2.868000	0.98415	0.556000	0.70494	GGG		0.537	TGFBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372108.1			28	186	0	0	0	0.007291	0	28	186				
IK	3550	broad.mit.edu	37	5	140038606	140038606	+	Nonsense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:140038606G>T	ENST00000417647.2	+	12	1172	c.1033G>T	c.(1033-1035)Gag>Tag	p.E345*		NM_006083.3	NP_006074.2	Q13123	RED_HUMAN	IK cytokine, down-regulator of HLA II	345	17 X 2 AA tandem repeats of R-[ED].				cell-cell signaling (GO:0007267)|immune response (GO:0006955)	extracellular space (GO:0005615)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			tcgggaacgggagcgtgatcg	0.542																																							uc003lgq.2		NA																	0				large_intestine(1)	1						c.(1033-1035)GAG>TAG		RED protein							84.0	95.0	91.0					5																	140038606		2147	4271	6418	SO:0001587	stop_gained	3550				cell-cell signaling|immune response	extracellular space|nucleus|soluble fraction		g.chr5:140038606G>T	BC051295	CCDS47280.1	5q31.3	2008-08-07			ENSG00000113141	ENSG00000113141			5958	protein-coding gene	gene with protein product		600549				7970704	Standard	NM_006083		Approved		uc003lgq.3	Q13123	OTTHUMG00000163374	ENST00000417647.2:c.1033G>T	5.37:g.140038606G>T	ENSP00000396301:p.Glu345*						p.E345*	NM_006083	NP_006074	Q13123	RED_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		12	1143	+		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	345			2.|17 X 2 AA tandem repeats of R-[ED].		Q6IPD8	Nonsense_Mutation	SNP	ENST00000417647.2	37	c.1033G>T	CCDS47280.1	.	.	.	.	.	.	.	.	.	.	G	38	7.200412	0.98132	.	.	ENSG00000113141	ENST00000417647	.	.	.	4.76	4.76	0.60689	.	0.860863	0.10429	N	0.675786	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	12.7778	0.57459	0.0:0.1653:0.8347:0.0	.	.	.	.	X	345	.	ENSP00000396301:E345X	E	+	1	0	IK	140018790	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	7.139000	0.77314	2.344000	0.79699	0.655000	0.94253	GAG		0.542	IK-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372897.1	NM_006083		12	58	1	0	1.61879e-10	0.013537	2.41492e-10	12	58				
PCDHA2	56146	broad.mit.edu	37	5	140176297	140176297	+	Nonsense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:140176297G>A	ENST00000526136.1	+	1	1748	c.1748G>A	c.(1747-1749)tGg>tAg	p.W583*	PCDHA2_ENST00000378132.1_Nonsense_Mutation_p.W583*|PCDHA2_ENST00000520672.2_Nonsense_Mutation_p.W583*|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	583					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGTGCCGTGGTCGGTGGGT	0.662																																							uc003lhd.2		NA																	0				ovary(4)	4						c.(1747-1749)TGG>TAG		protocadherin alpha 2 isoform 1 precursor							119.0	109.0	112.0					5																	140176297		2203	4299	6502	SO:0001587	stop_gained	56146				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140176297G>A	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1748G>A	5.37:g.140176297G>A	ENSP00000431748:p.Trp583*					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Nonsense_Mutation_p.W583*|PCDHA2_uc011czy.1_Nonsense_Mutation_p.W583*	p.W583*	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1854	+			583			Extracellular (Potential).		O75287|Q9BTV3	Nonsense_Mutation	SNP	ENST00000526136.1	37	c.1748G>A	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	g	12.89	2.073459	0.36566	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	.	.	.	3.91	2.71	0.32032	.	0.476960	0.15058	U	0.282925	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	6.2593	0.20891	0.1454:0.0:0.6778:0.1768	.	.	.	.	X	583	.	ENSP00000367372:W583X	W	+	2	0	PCDHA2	140156481	0.001000	0.12720	0.167000	0.22817	0.007000	0.05969	0.779000	0.26746	1.917000	0.55516	0.549000	0.68633	TGG		0.662	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905		15	120	0	0	0	0.00245	0	15	120				
PCDHA5	56143	broad.mit.edu	37	5	140202930	140202930	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:140202930C>T	ENST00000529859.1	+	1	1570	c.1570C>T	c.(1570-1572)Cac>Tac	p.H524Y	PCDHA5_ENST00000378126.3_Missense_Mutation_p.H524Y|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.H524Y|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	524	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCGCTGGACCACGAGGAAGT	0.692																																							uc003lhl.2		NA																	0				ovary(1)|breast(1)|skin(1)	3						c.(1570-1572)CAC>TAC		protocadherin alpha 5 isoform 1 precursor							49.0	56.0	54.0					5																	140202930		2201	4293	6494	SO:0001583	missense	56143				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding	g.chr5:140202930C>T	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1570C>T	5.37:g.140202930C>T	ENSP00000436557:p.His524Tyr					PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Missense_Mutation_p.H524Y|PCDHA5_uc003lhj.1_Missense_Mutation_p.H524Y	p.H524Y	NM_018908	NP_061731	Q9Y5H7	PCDA5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1570	+			524			Extracellular (Potential).|Cadherin 5.		O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	c.1570C>T	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	C	0.132	-1.111799	0.01813	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.46063	0.88;0.88;0.88	3.86	3.86	0.44501	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.15003	0.0362	N	0.01284	-0.91	0.27756	N	0.943984	B;B;B	0.26195	0.102;0.144;0.144	B;B;B	0.26517	0.07;0.06;0.042	T	0.18808	-1.0325	9	0.12766	T	0.61	.	8.2113	0.31486	0.0:0.8378:0.0:0.1622	.	524;524;524	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	Y	524	ENSP00000433416:H524Y;ENSP00000436557:H524Y;ENSP00000367366:H524Y	ENSP00000367366:H524Y	H	+	1	0	PCDHA5	140183114	0.929000	0.31497	1.000000	0.80357	0.457000	0.32468	3.046000	0.49846	1.864000	0.54056	0.461000	0.40582	CAC		0.692	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908		30	150	0	0	0	0.009535	0	30	150				
PCDHB2	56133	broad.mit.edu	37	5	140474443	140474443	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:140474443G>T	ENST00000194155.4	+	1	217	c.69G>T	c.(67-69)ctG>ctT	p.L23L		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	23					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTGTTTTGCTGGGCATAGCTC	0.537																																							uc003lil.2		NA																	0				ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6						c.(67-69)CTG>CTT		protocadherin beta 2 precursor							82.0	86.0	84.0					5																	140474443		2203	4300	6503	SO:0001819	synonymous_variant	56133				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140474443G>T	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.69G>T	5.37:g.140474443G>T						PCDHB2_uc003lim.1_Intron	p.L23L	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	207	+			23					Q4KMU1	Silent	SNP	ENST00000194155.4	37	c.69G>T	CCDS4244.1																																																																																				0.537	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936		9	72	1	0	1.76689e-08	0.006214	2.45209e-08	9	72				
PCDHB3	56132	broad.mit.edu	37	5	140481091	140481091	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:140481091A>T	ENST00000231130.2	+	1	858	c.858A>T	c.(856-858)gaA>gaT	p.E286D	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	286	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATGCTTCTGAAGAAATTCGCA	0.363																																							uc003lio.2		NA																	0				ovary(1)|pancreas(1)	2						c.(856-858)GAA>GAT		protocadherin beta 3 precursor							48.0	53.0	51.0					5																	140481091		2203	4300	6503	SO:0001583	missense	56132				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140481091A>T	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.858A>T	5.37:g.140481091A>T	ENSP00000231130:p.Glu286Asp					uc003lin.2_Intron	p.E286D	NM_018937	NP_061760	Q9Y5E6	PCDB3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	858	+			286			Extracellular (Potential).|Cadherin 3.		B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	c.858A>T	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	A	10.35	1.326022	0.24080	.	.	ENSG00000113205	ENST00000231130	T	0.56776	0.44	4.93	3.76	0.43208	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.38878	0.1057	L	0.38175	1.15	0.28459	N	0.915956	B	0.02656	0.0	B	0.06405	0.002	T	0.27262	-1.0079	9	0.10377	T	0.69	.	10.364	0.44012	0.9212:0.0:0.0788:0.0	.	286	Q9Y5E6	PCDB3_HUMAN	D	286	ENSP00000231130:E286D	ENSP00000231130:E286D	E	+	3	2	PCDHB3	140461275	0.000000	0.05858	1.000000	0.80357	0.994000	0.84299	-0.583000	0.05807	0.829000	0.34733	0.533000	0.62120	GAA		0.363	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937		14	73	0	0	0	0.00245	0	14	73				
PCDHB4	56131	broad.mit.edu	37	5	140503916	140503916	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:140503916G>T	ENST00000194152.1	+	1	2336	c.2336G>T	c.(2335-2337)gGg>gTg	p.G779V		NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	779					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGGACACCGGGAGGGAAGTT	0.448																																							uc003lip.1		NA																	0				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						c.(2335-2337)GGG>GTG		protocadherin beta 4 precursor							81.0	91.0	88.0					5																	140503916		2203	4300	6503	SO:0001583	missense	56131				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding	g.chr5:140503916G>T	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.2336G>T	5.37:g.140503916G>T	ENSP00000194152:p.Gly779Val						p.G779V	NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2336	+			779			Cytoplasmic (Potential).		Q4V761	Missense_Mutation	SNP	ENST00000194152.1	37	c.2336G>T	CCDS4246.1	.	.	.	.	.	.	.	.	.	.	G	10.29	1.309597	0.23821	.	.	ENSG00000081818	ENST00000194152	T	0.14022	2.54	4.49	2.43	0.29744	.	.	.	.	.	T	0.17619	0.0423	M	0.83774	2.66	0.26203	N	0.97941	B	0.10296	0.003	B	0.18263	0.021	T	0.32640	-0.9899	9	0.56958	D	0.05	.	2.9845	0.05964	0.2651:0.0:0.5224:0.2124	.	779	Q9Y5E5	PCDB4_HUMAN	V	779	ENSP00000194152:G779V	ENSP00000194152:G779V	G	+	2	0	PCDHB4	140484100	0.014000	0.17966	0.019000	0.16419	0.056000	0.15407	0.823000	0.27366	0.455000	0.26910	0.561000	0.74099	GGG		0.448	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938		18	94	1	0	5.03518e-11	0.007413	7.67323e-11	18	94				
PCDHB6	56130	broad.mit.edu	37	5	140531365	140531365	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:140531365C>T	ENST00000231136.1	+	1	1527	c.1527C>T	c.(1525-1527)ggC>ggT	p.G509G	PCDHB6_ENST00000543635.1_Silent_p.G373G	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	509	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGACAACGGCCACCTGTTTG	0.672																																							uc003lir.2		NA																	0				skin(1)	1						c.(1525-1527)GGC>GGT		protocadherin beta 6 precursor							80.0	84.0	83.0					5																	140531365		2203	4298	6501	SO:0001819	synonymous_variant	56130				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding	g.chr5:140531365C>T	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1527C>T	5.37:g.140531365C>T						PCDHB6_uc011dah.1_Silent_p.G373G	p.G509G	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1527	+			509			Cadherin 5.|Extracellular (Potential).		B2R8R9	Silent	SNP	ENST00000231136.1	37	c.1527C>T	CCDS4248.1																																																																																				0.672	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939		36	198	0	0	0	0.005524	0	36	198				
PCDHB8	56128	broad.mit.edu	37	5	140558989	140558989	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:140558989C>A	ENST00000239444.2	+	1	1619	c.1374C>A	c.(1372-1374)acC>acA	p.T458T	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	458	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTCCTACACCCTGTTCGTCC	0.612																																							uc011dai.1		NA																	0				skin(4)	4						c.(1372-1374)ACC>ACA		protocadherin beta 8 precursor							118.0	164.0	148.0					5																	140558989		2203	4297	6500	SO:0001819	synonymous_variant	56128				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140558989C>A	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1374C>A	5.37:g.140558989C>A						PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	p.T458T	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1560	+			458			Cadherin 5.|Extracellular (Potential).		B9EGV1	Silent	SNP	ENST00000239444.2	37	c.1374C>A	CCDS4250.1																																																																																				0.612	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120		31	227	1	0	3.76114e-14	0.004289	6.25547e-14	31	227				
PCDHB10	56126	broad.mit.edu	37	5	140574002	140574002	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:140574002C>T	ENST00000239446.4	+	1	2061	c.1877C>T	c.(1876-1878)aCc>aTc	p.T626I		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	626	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGGTGCGCACCGCCAGGCTG	0.692																																							uc003lix.2		NA																	0				ovary(1)|skin(1)	2						c.(1876-1878)ACC>ATC		protocadherin beta 10 precursor							15.0	16.0	16.0					5																	140574002		1846	3550	5396	SO:0001583	missense	56126				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140574002C>T	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1877C>T	5.37:g.140574002C>T	ENSP00000239446:p.Thr626Ile						p.T626I	NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2051	+			626			Cadherin 6.|Extracellular (Potential).		Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	c.1877C>T	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	c	16.40	3.113866	0.56398	.	.	ENSG00000120324	ENST00000239446	T	0.55760	0.5	3.2	3.2	0.36748	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.72070	0.3415	M	0.88512	2.96	0.37833	D	0.928803	D	0.76494	0.999	D	0.75020	0.985	T	0.77544	-0.2548	9	0.87932	D	0	.	7.8839	0.29637	0.0:0.8786:0.0:0.1214	.	626	Q9UN67	PCDBA_HUMAN	I	626	ENSP00000239446:T626I	ENSP00000239446:T626I	T	+	2	0	PCDHB10	140554186	0.003000	0.15002	0.998000	0.56505	0.984000	0.73092	0.801000	0.27055	1.794000	0.52575	0.479000	0.44913	ACC		0.692	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		15	72	0	0	0	0.00333	0	15	72				
PCDHB10	56126	broad.mit.edu	37	5	140574378	140574378	+	Nonsense_Mutation	SNP	C	C	A	rs199821453		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:140574378C>A	ENST00000239446.4	+	1	2437	c.2253C>A	c.(2251-2253)taC>taA	p.Y751*		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	751					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCAGAGCTACCAGTATGAGG	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		15316	0.0		0.001	False		,,,				2504	0.0						uc003lix.2		NA																	0				ovary(1)|skin(1)	2						c.(2251-2253)TAC>TAA		protocadherin beta 10 precursor		C	stop/TYR	0,4406		0,0,2203	78.0	86.0	83.0		2253	3.3	1.0	5		83	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained	PCDHB10	NM_018930.3		0,1,6502	AA,AC,CC		0.0116,0.0,0.0077		751/801	140574378	1,13005	2203	4300	6503	SO:0001587	stop_gained	56126				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140574378C>A	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.2253C>A	5.37:g.140574378C>A	ENSP00000239446:p.Tyr751*						p.Y751*	NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	2427	+			751			Cytoplasmic (Potential).		Q96T99	Nonsense_Mutation	SNP	ENST00000239446.4	37	c.2253C>A	CCDS4252.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	33	5.225685	0.95173	0.0	1.16E-4	ENSG00000120324	ENST00000239446	.	.	.	3.28	3.28	0.37604	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.6055	0.33771	0.0:0.8826:0.0:0.1174	.	.	.	.	X	751	.	ENSP00000239446:Y751X	Y	+	3	2	PCDHB10	140554562	0.002000	0.14202	1.000000	0.80357	0.395000	0.30598	1.083000	0.30815	1.849000	0.53698	0.298000	0.19748	TAC		0.622	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930		24	183	1	0	9.95505e-16	0.014323	1.71853e-15	24	183				
PCDHB14	56122	broad.mit.edu	37	5	140603152	140603152	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:140603152G>A	ENST00000239449.4	+	1	75	c.75G>A	c.(73-75)cgG>cgA	p.R25R	PCDHB14_ENST00000515856.2_Intron	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	25					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GATTGTCTCGGGCAGGTACTG	0.498																																					Ovarian(141;50 1831 27899 33809 37648)	Ovarian(141;50 1831 27899 33809 37648)	uc003ljb.2		NA																	0				ovary(1)	1						c.(73-75)CGG>CGA		protocadherin beta 14 precursor							97.0	94.0	95.0					5																	140603152		2203	4300	6503	SO:0001819	synonymous_variant	56122				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140603152G>A	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.75G>A	5.37:g.140603152G>A						PCDHB14_uc011dal.1_Intron	p.R25R	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	75	+			25					B4DPE2|Q4FZA4|Q4KN11	Silent	SNP	ENST00000239449.4	37	c.75G>A	CCDS4256.1																																																																																				0.498	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934		11	42	0	0	0	0.008291	0	11	42				
PCDHGA3	56112	broad.mit.edu	37	5	140723667	140723667	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:140723667C>T	ENST00000253812.6	+	1	67	c.67C>T	c.(67-69)Ctg>Ttg	p.L23L	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	23					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGGGGACGCTGTGCGAAAC	0.557											OREG0016855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc003ljm.1		NA																	0				breast(1)	1						c.(67-69)CTG>TTG		protocadherin gamma subfamily A, 3 isoform 1							122.0	135.0	131.0					5																	140723667		2079	4246	6325	SO:0001819	synonymous_variant	56112				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140723667C>T	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.67C>T	5.37:g.140723667C>T			OREG0016855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1658	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_5'UTR|PCDHGA3_uc011dap.1_Silent_p.L23L	p.L23L	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	67	+			23					Q9Y5D4	Silent	SNP	ENST00000253812.6	37	c.67C>T	CCDS47290.1																																																																																				0.557	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916		40	220	0	0	0	0.009718	0	40	220				
PCDHGA3	56112	broad.mit.edu	37	5	140725254	140725254	+	Missense_Mutation	SNP	G	G	T	rs2879227		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:140725254G>T	ENST00000253812.6	+	1	1654	c.1654G>T	c.(1654-1656)Gtg>Ttg	p.V552L	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	552	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAACCTGTTCGTGCTGGACCA	0.617																																							uc003ljm.1		NA																	0				breast(1)	1						c.(1654-1656)GTG>TTG		protocadherin gamma subfamily A, 3 isoform 1							134.0	145.0	141.0					5																	140725254		2203	4300	6503	SO:0001583	missense	56112				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140725254G>T	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1654G>T	5.37:g.140725254G>T	ENSP00000253812:p.Val552Leu					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Missense_Mutation_p.V312L|PCDHGA3_uc011dap.1_Missense_Mutation_p.V552L	p.V552L	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	1654	+			552			Extracellular (Potential).|Cadherin 5.		Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	37	c.1654G>T	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	12.64	1.997926	0.35226	.	.	ENSG00000254245	ENST00000253812	T	0.63913	-0.07	5.42	2.64	0.31445	Cadherin (5);Cadherin conserved site (1);Cadherin-like (1);	0.318113	0.16501	U	0.211654	T	0.61223	0.2330	M	0.74881	2.28	0.20074	N	0.999934	B;B	0.30146	0.113;0.27	B;B	0.35312	0.128;0.2	T	0.57579	-0.7787	10	0.56958	D	0.05	.	7.0986	0.25323	0.4455:0.0:0.5545:0.0	.	552;552	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	L	552	ENSP00000253812:V552L	ENSP00000253812:V552L	V	+	1	0	PCDHGA3	140705438	0.003000	0.15002	0.043000	0.18650	0.938000	0.57974	0.163000	0.16520	0.776000	0.33473	0.563000	0.77884	GTG		0.617	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916		55	223	1	0	1.10885e-35	0.01441	2.12113e-35	55	223				
PCDHGA3	56112	broad.mit.edu	37	5	140725835	140725835	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:140725835G>T	ENST00000253812.6	+	1	2235	c.2235G>T	c.(2233-2235)ggG>ggT	p.G745G	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	745					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCGGACGGGGTTCGGGCTT	0.667																																							uc003ljm.1		NA																	0				breast(1)	1						c.(2233-2235)GGG>GGT		protocadherin gamma subfamily A, 3 isoform 1							49.0	61.0	57.0					5																	140725835		2203	4300	6503	SO:0001819	synonymous_variant	56112				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140725835G>T	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.2235G>T	5.37:g.140725835G>T						PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_Silent_p.G505G|PCDHGA3_uc011dap.1_Silent_p.G745G	p.G745G	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2235	+			745			Cytoplasmic (Potential).		Q9Y5D4	Silent	SNP	ENST00000253812.6	37	c.2235G>T	CCDS47290.1																																																																																				0.667	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916		16	127	1	0	3.41278e-10	0.00499	5.05568e-10	16	127				
PCDHGB1	56104	broad.mit.edu	37	5	140732157	140732157	+	Missense_Mutation	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:140732157T>A	ENST00000523390.1	+	1	2330	c.2330T>A	c.(2329-2331)cTg>cAg	p.L777Q	PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	777					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGATCTGCTGTGTGATGAT	0.433																																							uc003ljo.1		NA																	0					0						c.(2329-2331)CTG>CAG		protocadherin gamma subfamily B, 1 isoform 1							76.0	74.0	75.0					5																	140732157		1972	4166	6138	SO:0001583	missense	56104				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140732157T>A	AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.2330T>A	5.37:g.140732157T>A	ENSP00000429273:p.Leu777Gln					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGA4_uc003ljq.1_5'Flank|PCDHGB1_uc011daq.1_Missense_Mutation_p.L777Q|PCDHGA4_uc003ljp.1_5'Flank	p.L777Q	NM_018922	NP_061745	Q9Y5G3	PCDGD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	2330	+			777			Cytoplasmic (Potential).		Q3SY75|Q9Y5C8	Missense_Mutation	SNP	ENST00000523390.1	37	c.2330T>A	CCDS54923.1	.	.	.	.	.	.	.	.	.	.	.	13.80	2.344410	0.41498	.	.	ENSG00000254221	ENST00000523390	T	0.50001	0.76	4.71	3.46	0.39613	.	.	.	.	.	T	0.51398	0.1672	M	0.68593	2.085	0.22489	N	0.99906	P;P	0.42123	0.771;0.523	P;B	0.48571	0.582;0.21	T	0.36744	-0.9735	9	0.15499	T	0.54	.	10.3449	0.43901	0.1476:0.0:0.0:0.8524	.	777;777	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	Q	777	ENSP00000429273:L777Q	ENSP00000429273:L777Q	L	+	2	0	PCDHGB1	140712341	0.002000	0.14202	0.857000	0.33713	0.115000	0.19883	0.684000	0.25364	2.096000	0.63516	0.528000	0.53228	CTG		0.433	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374740.1	NM_018922		8	32	0	0	0	0.00308	0	8	32				
PCDHGA11	56105	broad.mit.edu	37	5	140801052	140801052	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:140801052C>G	ENST00000398587.2	+	1	291	c.258C>G	c.(256-258)atC>atG	p.I86M	PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000518882.1_Missense_Mutation_p.I86M|PCDHGB7_ENST00000398594.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	86	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGCTTGATCACGGCAGGCA	0.572																																							uc003lkq.1		NA																	0					0						c.(256-258)ATC>ATG		protocadherin gamma subfamily A, 11 isoform 1							40.0	49.0	46.0					5																	140801052		2167	4288	6455	SO:0001583	missense	56105				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140801052C>G	AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.258C>G	5.37:g.140801052C>G	ENSP00000381589:p.Ile86Met					PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lko.1_Missense_Mutation_p.I86M|PCDHGA11_uc003lkp.1_Missense_Mutation_p.I86M	p.I86M	NM_018914	NP_061737	Q9Y5H2	PCDGB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	516	+			86			Extracellular (Potential).|Cadherin 1.		B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	ENST00000398587.2	37	c.258C>G	CCDS47294.1	.	.	.	.	.	.	.	.	.	.	c	10.09	1.255074	0.22965	.	.	ENSG00000253873	ENST00000398587;ENST00000518882	T;T	0.28255	1.62;1.62	5.93	0.875	0.19130	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	0.508668	0.11820	U	0.526291	T	0.35885	0.0947	M	0.76002	2.32	0.09310	N	1	P;P;P	0.45176	0.852;0.822;0.809	P;P;P	0.48114	0.482;0.521;0.567	T	0.31586	-0.9938	10	0.72032	D	0.01	.	1.8999	0.03265	0.1079:0.2852:0.3069:0.3	.	86;86;86	Q9Y5H2;Q9Y5H2-3;Q9Y5H2-2	PCDGB_HUMAN;.;.	M	86	ENSP00000381589:I86M;ENSP00000428333:I86M	ENSP00000381589:I86M	I	+	3	3	PCDHGA11	140781236	0.000000	0.05858	0.602000	0.28890	0.784000	0.44337	-3.270000	0.00532	0.393000	0.25203	0.591000	0.81541	ATC		0.572	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914		18	74	0	0	0	0.010504	0	18	74				
PCDH1	5097	broad.mit.edu	37	5	141243248	141243248	+	Missense_Mutation	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:141243248T>C	ENST00000394536.3	-	3	2787	c.2648A>G	c.(2647-2649)aAa>aGa	p.K883R	PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000287008.3_Missense_Mutation_p.K883R|PCDH1_ENST00000536585.1_Missense_Mutation_p.K861R|PCDH1_ENST00000456271.1_Missense_Mutation_p.K871R	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	883					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		GTAACCACTTTTGGCCTCCCG	0.582																																					Ovarian(132;1609 1739 4190 14731 45037)	Ovarian(132;1609 1739 4190 14731 45037)	uc003llq.2		NA																	0				ovary(5)	5						c.(2647-2649)AAA>AGA		protocadherin 1 isoform 1 precursor							165.0	169.0	167.0					5																	141243248		2203	4300	6503	SO:0001583	missense	5097				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding	g.chr5:141243248T>C	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.2648A>G	5.37:g.141243248T>C	ENSP00000378043:p.Lys883Arg					PCDH1_uc003llp.2_Missense_Mutation_p.K883R|PCDH1_uc011dbf.1_Missense_Mutation_p.K861R	p.K883R	NM_002587	NP_002578	Q08174	PCDH1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)	3	2765	-		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	883			Cytoplasmic (Potential).		Q8IUP2	Missense_Mutation	SNP	ENST00000394536.3	37	c.2648A>G	CCDS43375.1	.	.	.	.	.	.	.	.	.	.	t	11.28	1.593357	0.28357	.	.	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38	4.75	4.75	0.60458	Protocadherin (1);	0.000000	0.53938	D	0.000048	T	0.51007	0.1649	M	0.72894	2.215	0.53688	D	0.999978	P;P	0.49447	0.924;0.907	P;P	0.56088	0.791;0.686	T	0.49606	-0.8922	10	0.36615	T	0.2	.	12.2391	0.54532	0.0:0.0:0.0:1.0	.	883;883	Q08174;Q08174-2	PCDH1_HUMAN;.	R	883;883;871;894;861	ENSP00000287008:K883R;ENSP00000378043:K883R;ENSP00000403497:K871R;ENSP00000350122:K894R;ENSP00000438825:K861R	ENSP00000287008:K883R	K	-	2	0	PCDH1	141223432	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	6.077000	0.71275	1.990000	0.58119	0.375000	0.23000	AAA		0.582	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420		58	244	0	0	0	0.01441	0	58	244				
ADRB2	154	broad.mit.edu	37	5	148206928	148206928	+	Missense_Mutation	SNP	C	C	A	rs147102529	byFrequency	TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:148206928C>A	ENST00000305988.4	+	1	773	c.534C>A	c.(532-534)caC>caA	p.H178Q		NM_000024.5	NP_000015	P07550	ADRB2_HUMAN	adrenoceptor beta 2, surface	178					activation of adenylate cyclase activity (GO:0007190)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|bone resorption (GO:0045453)|brown fat cell differentiation (GO:0050873)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway by arrestin (GO:0002032)|diet induced thermogenesis (GO:0002024)|endosome to lysosome transport (GO:0008333)|heat generation (GO:0031649)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of smooth muscle contraction (GO:0045986)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor-mediated endocytosis (GO:0006898)|regulation of sodium ion transport (GO:0002028)|regulation of vasodilation (GO:0042312)|response to cold (GO:0009409)|vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure (GO:0002025)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	beta2-adrenergic receptor activity (GO:0004941)|norepinephrine binding (GO:0051380)|potassium channel regulator activity (GO:0015459)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(3)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Acebutolol(DB01193)|Alprenolol(DB00866)|Amitriptyline(DB00321)|Amphetamine(DB00182)|Arbutamine(DB01102)|Arformoterol(DB01274)|Asenapine(DB06216)|Atenolol(DB00335)|Bambuterol(DB01408)|Betaxolol(DB00195)|Bethanidine(DB00217)|Bevantolol(DB01295)|Bisoprolol(DB00612)|Bopindolol(DB08807)|Bupranolol(DB08808)|Cabergoline(DB00248)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Dipivefrin(DB00449)|Dobutamine(DB00841)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Fenoterol(DB01288)|Formoterol(DB00983)|Indacaterol(DB05039)|Isoetarine(DB00221)|Isoprenaline(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Mephentermine(DB01365)|Metipranolol(DB01214)|Metoprolol(DB00264)|Mirtazapine(DB00370)|Nadolol(DB01203)|Nebivolol(DB04861)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Orciprenaline(DB00816)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Phenoxybenzamine(DB00925)|Phenylpropanolamine(DB00397)|Pindolol(DB00960)|Pirbuterol(DB01291)|Procaterol(DB01366)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Ritodrine(DB00867)|Salbutamol(DB01001)|Salmeterol(DB00938)|Sotalol(DB00489)|Terbutaline(DB00871)|Timolol(DB00373)|Trimipramine(DB00726)	GGGCCACCCACCAGGAAGCCA	0.532													C|||	4	0.000798722	0.003	0.0	5008	,	,		19966	0.0		0.0	False		,,,				2504	0.0						uc003lpr.1		NA																	0				ovary(1)	1						c.(532-534)CAC>CAA		adrenergic, beta-2-, receptor, surface	Alprenolol(DB00866)|Arformoterol(DB01274)|Bambuterol(DB01408)|Bisoprolol(DB00612)|Bitolterol(DB00901)|Bretylium(DB01158)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Epinephrine(DB00668)|Fenoterol(DB01288)|Formoterol(DB00983)|Isoproterenol(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Metipranolol(DB01214)|Nadolol(DB01203)|Norepinephrine(DB00368)|Orciprenaline(DB00816)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Pindolol(DB00960)|Pirbuterol(DB01291)|Procaterol(DB01366)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Ritodrine(DB00867)|Salbutamol(DB01001)|Salmeterol(DB00938)|Terbutaline(DB00871)|Timolol(DB00373)	C	GLN/HIS	2,4404	4.2+/-10.8	0,2,2201	215.0	188.0	197.0		534	2.6	0.4	5	dbSNP_134	197	0,8600		0,0,4300	no	missense	ADRB2	NM_000024.5	24	0,2,6501	AA,AC,CC		0.0,0.0454,0.0154	benign	178/414	148206928	2,13004	2203	4300	6503	SO:0001583	missense	154				activation of transmembrane receptor protein tyrosine kinase activity|desensitization of G-protein coupled receptor protein signaling pathway by arrestin|endosome to lysosome transport|positive regulation of MAPKKK cascade|receptor-mediated endocytosis	endosome|integral to plasma membrane|lysosome|receptor complex	beta2-adrenergic receptor activity|norepinephrine binding|potassium channel regulator activity|protein homodimerization activity	g.chr5:148206928C>A	AF022953	CCDS4292.1	5q31-q32	2012-08-08	2012-05-09		ENSG00000169252	ENSG00000169252		"""GPCR / Class A : Adrenoceptors : beta"""	286	protein-coding gene	gene with protein product		109690	"""adrenergic, beta-2-, receptor, surface"""	ADRB2R			Standard	NM_000024		Approved	ADRBR, BAR, B2AR	uc003lpr.2	P07550	OTTHUMG00000129933	ENST00000305988.4:c.534C>A	5.37:g.148206928C>A	ENSP00000305372:p.His178Gln					SH3TC2_uc003lpp.1_Intron	p.H178Q	NM_000024	NP_000015	P07550	ADRB2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		1	773	+			178			Extracellular.		B0LPE4|B2R7X2|O14823|O14824|O14825|O14826|Q4JG18|Q53GA6|Q6GMT4|Q6P4D8|Q8NEQ9|Q96EC3|Q9UCZ0|Q9UCZ1|Q9UCZ2|Q9UCZ3|Q9UH95|Q9UHA1|Q9UMZ5	Missense_Mutation	SNP	ENST00000305988.4	37	c.534C>A	CCDS4292.1	.	.	.	.	.	.	.	.	.	.	C	4.432	0.080024	0.08533	4.54E-4	0.0	ENSG00000169252	ENST00000305988	T	0.70399	-0.48	5.65	2.57	0.30868	GPCR, rhodopsin-like superfamily (1);	0.379722	0.29745	N	0.011302	T	0.46541	0.1398	N	0.16166	0.38	0.23101	N	0.998296	B	0.14805	0.011	B	0.17098	0.017	T	0.22417	-1.0217	10	0.15066	T	0.55	.	6.0826	0.19950	0.0:0.5656:0.1233:0.311	.	178	P07550	ADRB2_HUMAN	Q	178	ENSP00000305372:H178Q	ENSP00000305372:H178Q	H	+	3	2	ADRB2	148187121	0.000000	0.05858	0.372000	0.25991	0.987000	0.75469	-0.598000	0.05706	0.344000	0.23847	0.655000	0.94253	CAC		0.532	ADRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252189.1	NM_000024		24	176	1	0	5.45024e-15	0.00333	9.20903e-15	24	176				
SH3TC2	79628	broad.mit.edu	37	5	148420208	148420208	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:148420208C>A	ENST00000515425.1	-	7	865	c.764G>T	c.(763-765)gGc>gTc	p.G255V	SH3TC2_ENST00000394358.2_Missense_Mutation_p.G140V|SH3TC2_ENST00000512049.1_Missense_Mutation_p.G248V|SH3TC2_ENST00000538184.1_5'UTR	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	255					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGGAAAGGCCACAGCTTCC	0.418																																							uc003lpu.2		NA																	0				ovary(2)	2						c.(763-765)GGC>GTC		SH3 domain and tetratricopeptide repeats 2							87.0	82.0	84.0					5																	148420208		2203	4300	6503	SO:0001583	missense	79628						binding	g.chr5:148420208C>A	AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.764G>T	5.37:g.148420208C>A	ENSP00000423660:p.Gly255Val					SH3TC2_uc003lpp.1_RNA|SH3TC2_uc003lps.2_RNA|SH3TC2_uc003lpt.2_5'UTR|SH3TC2_uc010jgx.2_Missense_Mutation_p.G248V|SH3TC2_uc003lpv.1_5'UTR|SH3TC2_uc011dbz.1_Missense_Mutation_p.G140V	p.G255V	NM_024577	NP_078853	Q8TF17	S3TC2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		7	916	-			255					B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	37	c.764G>T	CCDS4293.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046397	0.75846	.	.	ENSG00000169247	ENST00000515425;ENST00000512049;ENST00000394358	T;T;T	0.33438	1.41;1.41;1.41	5.68	4.81	0.61882	Src homology-3 domain (1);	0.265538	0.33382	N	0.004969	T	0.34308	0.0893	N	0.14661	0.345	0.58432	D	0.999999	P;D;D	0.71674	0.954;0.998;0.998	P;D;D	0.63597	0.66;0.916;0.916	T	0.18681	-1.0329	10	0.87932	D	0	-13.4682	12.0337	0.53412	0.0:0.92:0.0:0.08	.	140;248;255	C9JLC3;Q14CC0;Q8TF17	.;.;S3TC2_HUMAN	V	255;248;140	ENSP00000423660:G255V;ENSP00000421860:G248V;ENSP00000377886:G140V	ENSP00000377886:G140V	G	-	2	0	SH3TC2	148400401	0.991000	0.36638	1.000000	0.80357	0.971000	0.66376	1.362000	0.34148	2.668000	0.90789	0.563000	0.77884	GGC		0.418	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577		16	57	1	0	1.67942e-08	0.006122	2.35118e-08	16	57				
FAT2	2196	broad.mit.edu	37	5	150945590	150945590	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:150945590G>T	ENST00000261800.5	-	1	2915	c.2903C>A	c.(2902-2904)gCc>gAc	p.A968D		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	968	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGTCCCATGGGCGCCATCCAT	0.607																																							uc003lue.3		NA																	0				ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6						c.(2902-2904)GCC>GAC		FAT tumor suppressor 2 precursor							49.0	52.0	51.0					5																	150945590		2203	4300	6503	SO:0001583	missense	2196				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding	g.chr5:150945590G>T	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.2903C>A	5.37:g.150945590G>T	ENSP00000261800:p.Ala968Asp					GM2A_uc011dcs.1_Intron|FAT2_uc010jhx.1_Missense_Mutation_p.A968D	p.A968D	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		1	2916	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	968			Extracellular (Potential).|Cadherin 8.		O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	c.2903C>A	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	8.630	0.893529	0.17613	.	.	ENSG00000086570	ENST00000261800	T	0.48836	0.8	5.39	1.39	0.22231	Cadherin (4);Cadherin-like (1);	0.549971	0.17741	N	0.163572	T	0.25082	0.0609	N	0.11427	0.14	0.09310	N	1	B	0.31859	0.343	B	0.40982	0.345	T	0.22591	-1.0212	10	0.11794	T	0.64	.	1.9135	0.03292	0.2634:0.1933:0.4267:0.1166	.	968	Q9NYQ8	FAT2_HUMAN	D	968	ENSP00000261800:A968D	ENSP00000261800:A968D	A	-	2	0	FAT2	150925783	0.359000	0.24955	0.178000	0.23040	0.856000	0.48823	0.832000	0.27490	-0.040000	0.13580	0.561000	0.74099	GCC		0.607	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		10	59	1	0	0.000673444	0.008291	0.000748663	10	59				
FAT2	2196	broad.mit.edu	37	5	150946786	150946786	+	Silent	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:150946786A>G	ENST00000261800.5	-	1	1719	c.1707T>C	c.(1705-1707)tgT>tgC	p.C569C		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	569	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TAGACCCTGTACAGTTGACTT	0.458																																							uc003lue.3		NA																	0				ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6						c.(1705-1707)TGT>TGC		FAT tumor suppressor 2 precursor							71.0	76.0	75.0					5																	150946786		2203	4300	6503	SO:0001819	synonymous_variant	2196				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding	g.chr5:150946786A>G	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.1707T>C	5.37:g.150946786A>G						GM2A_uc011dcs.1_Intron|FAT2_uc010jhx.1_Silent_p.C569C	p.C569C	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		1	1720	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	569			Extracellular (Potential).|Cadherin 5.		O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	37	c.1707T>C	CCDS4317.1																																																																																				0.458	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447		10	93	0	0	0	0.006214	0	10	93				
MRPL22	29093	broad.mit.edu	37	5	154320679	154320679	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:154320679G>T	ENST00000523037.1	+	1	50	c.9G>T	c.(7-9)gcG>gcT	p.A3A	MRPL22_ENST00000522038.1_Silent_p.A3A|MRPL22_ENST00000439747.3_Silent_p.A3A|GEMIN5_ENST00000285873.7_5'Flank|MRPL22_ENST00000265229.8_5'UTR	NM_014180.3	NP_054899.2	Q9NWU5	RM22_HUMAN	mitochondrial ribosomal protein L22	3					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AGATGGCGGCGGCAGTACTGG	0.562																																							uc003lvy.3		NA																	0					0						c.(7-9)GCG>GCT		mitochondrial ribosomal protein L22 isoform a							135.0	138.0	137.0					5																	154320679		2203	4300	6503	SO:0001819	synonymous_variant	29093				translation	large ribosomal subunit|mitochondrion	structural constituent of ribosome	g.chr5:154320679G>T	AB051622	CCDS4331.1, CCDS43391.1	5q33.2	2012-09-13			ENSG00000082515	ENSG00000082515		"""Mitochondrial ribosomal proteins / large subunits"""	14480	protein-coding gene	gene with protein product		611835					Standard	NM_014180		Approved	MRP-L25, RPML25, HSPC158	uc003lvy.4	Q9NWU5	OTTHUMG00000130190	ENST00000523037.1:c.9G>T	5.37:g.154320679G>T						GEMIN5_uc003lvx.3_5'Flank|GEMIN5_uc011ddk.1_5'Flank|MRPL22_uc003lvz.3_5'UTR	p.A3A	NM_014180	NP_054899	Q9NWU5	RM22_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)		1	47	+	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	3					A6NGJ8|Q5H9Q1|Q96Q51|Q9P006	Silent	SNP	ENST00000523037.1	37	c.9G>T	CCDS4331.1																																																																																				0.562	MRPL22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252508.2			22	115	1	0	3.5997e-14	0.014323	6.00264e-14	22	115				
THG1L	54974	broad.mit.edu	37	5	157158616	157158616	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:157158616G>A	ENST00000231198.7	+	1	412	c.168G>A	c.(166-168)cgG>cgA	p.R56R		NM_017872.3	NP_060342.2	Q9NWX6	THG1_HUMAN	tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)	56					protein homotetramerization (GO:0051289)|tRNA modification (GO:0006400)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|tRNA binding (GO:0000049)|tRNA guanylyltransferase activity (GO:0008193)			NS(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)	13	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGGTAGTGCGGCTGGACGGCC	0.622																																							uc003lxd.2		NA																	0					0						c.(166-168)CGG>CGA		interphase cytoplasmic foci protein 45							149.0	142.0	144.0					5																	157158616		2203	4300	6503	SO:0001819	synonymous_variant	54974				protein homotetramerization|tRNA modification	mitochondrion	GTP binding|metal ion binding|tRNA guanylyltransferase activity	g.chr5:157158616G>A	AK223119	CCDS4341.1	5q33.3	2008-02-05			ENSG00000113272	ENSG00000113272			26053	protein-coding gene	gene with protein product	"""interphase cytoplasmic foci protein 45"""					11230166	Standard	XM_005265939		Approved	ICF45, FLJ11601, FLJ20546	uc003lxd.3	Q9NWX6	OTTHUMG00000130254	ENST00000231198.7:c.168G>A	5.37:g.157158616G>A						THG1L_uc011ddu.1_5'UTR	p.R56R	NM_017872	NP_060342	Q9NWX6	THG1_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		1	294	+	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	56					D3DQJ5|Q53G12|Q7L5R3|Q9H0S2	Silent	SNP	ENST00000231198.7	37	c.168G>A	CCDS4341.1																																																																																				0.622	THG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252579.2	NM_017872		29	165	0	0	0	0.008361	0	29	165				
GABRA6	2559	broad.mit.edu	37	5	161128728	161128728	+	Nonsense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:161128728G>A	ENST00000274545.5	+	9	1744	c.1311G>A	c.(1309-1311)tgG>tgA	p.W437*	GABRA6_ENST00000523217.1_Nonsense_Mutation_p.W427*			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	437					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.W437C(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TTGTGTACTGGGTAGTTTATC	0.443										TCGA Ovarian(5;0.080)																													uc003lyu.2		NA																	1	Substitution - Missense(1)		endometrium(1)	ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12						c.(1309-1311)TGG>TGA		gamma-aminobutyric acid A receptor, alpha 6	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)						109.0	99.0	102.0					5																	161128728		2203	4300	6503	SO:0001587	stop_gained	2559				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity	g.chr5:161128728G>A		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.1311G>A	5.37:g.161128728G>A	ENSP00000274545:p.Trp437*	TCGA Ovarian(5;0.080)				GABRA6_uc003lyv.2_Nonsense_Mutation_p.W208*	p.W437*	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		9	1649	+	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	437			Helical; (Probable).		A8K096|Q4VAV2	Nonsense_Mutation	SNP	ENST00000274545.5	37	c.1311G>A	CCDS4356.1	.	.	.	.	.	.	.	.	.	.	G	38	7.157207	0.98103	.	.	ENSG00000145863	ENST00000274545;ENST00000523217	.	.	.	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.013	0.92881	0.0:0.0:1.0:0.0	.	.	.	.	X	437;427	.	ENSP00000274545:W437X	W	+	3	0	GABRA6	161061306	1.000000	0.71417	0.998000	0.56505	0.952000	0.60782	9.695000	0.98691	2.571000	0.86741	0.655000	0.94253	TGG		0.443	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2			12	55	0	0	0	0.013537	0	12	55				
GABRG2	2566	broad.mit.edu	37	5	161580240	161580240	+	Missense_Mutation	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:161580240T>A	ENST00000361925.4	+	9	1490	c.1270T>A	c.(1270-1272)Tgt>Agt	p.C424S	GABRG2_ENST00000356592.3_Missense_Mutation_p.C432S|GABRG2_ENST00000414552.2_Missense_Mutation_p.C472S|GABRG2_ENST00000393933.4_Missense_Mutation_p.C329S			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	424					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TTTTGAAGATTGTCGAACAGG	0.463																																							uc003lyz.3		NA																	0				ovary(4)|skin(1)	5						c.(1270-1272)TGT>AGT		gamma-aminobutyric acid A receptor, gamma 2							218.0	210.0	213.0					5																	161580240		2203	4300	6503	SO:0001583	missense	2566				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding	g.chr5:161580240T>A		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.1270T>A	5.37:g.161580240T>A	ENSP00000354651:p.Cys424Ser					GABRG2_uc010jjc.2_Missense_Mutation_p.C472S|GABRG2_uc003lyy.3_Missense_Mutation_p.C432S|GABRG2_uc011dej.1_Missense_Mutation_p.C329S	p.C424S	NM_000816	NP_000807	P18507	GBRG2_HUMAN	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	9	1628	+	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	424			Cytoplasmic (Probable).		F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	ENST00000361925.4	37	c.1270T>A	CCDS4358.1	.	.	.	.	.	.	.	.	.	.	T	19.26	3.792872	0.70452	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933	D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75	5.95	5.95	0.96441	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.89076	0.6612	M	0.64170	1.965	0.80722	D	1	D;D;D	0.65815	0.995;0.991;0.995	D;D;D	0.73380	0.962;0.917;0.98	D	0.86535	0.1824	10	0.22706	T	0.39	.	16.4237	0.83790	0.0:0.0:0.0:1.0	.	472;424;432	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	S	432;472;424;329	ENSP00000349000:C432S;ENSP00000410732:C472S;ENSP00000354651:C424S;ENSP00000377510:C329S	ENSP00000349000:C432S	C	+	1	0	GABRG2	161512818	1.000000	0.71417	0.989000	0.46669	0.991000	0.79684	7.946000	0.87746	2.279000	0.76181	0.533000	0.62120	TGT		0.463	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1			19	121	0	0	0	0.006122	0	19	121				
MGAT4B	11282	broad.mit.edu	37	5	179227513	179227513	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:179227513C>G	ENST00000292591.7	-	6	1040	c.690G>C	c.(688-690)gaG>gaC	p.E230D	MGAT4B_ENST00000521305.1_5'UTR|MGAT4B_ENST00000337755.5_Missense_Mutation_p.E245D|MIR1229_ENST00000408467.1_RNA	NM_014275.4	NP_055090.1	Q9UQ53	MGT4B_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B	230					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	13	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCCAAAGGACTCTCGGAGGC	0.602																																					GBM(13;414 434 4098 22176 23230)	GBM(13;414 434 4098 22176 23230)	uc003mks.2		NA																	0					0						c.(688-690)GAG>GAC		alpha-1,3-mannosyl-glycoprotein							18.0	21.0	20.0					5																	179227513		2203	4300	6503	SO:0001583	missense	11282				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding	g.chr5:179227513C>G	AB000624	CCDS4448.1, CCDS4449.1	5q35	2013-02-25	2005-11-16		ENSG00000161013	ENSG00000161013	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7048	protein-coding gene	gene with protein product		604561	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B"""			10372966	Standard	NM_014275		Approved	GnT-Ivb	uc003mks.3	Q9UQ53	OTTHUMG00000130912	ENST00000292591.7:c.690G>C	5.37:g.179227513C>G	ENSP00000292591:p.Glu230Asp					MGAT4B_uc003mkp.2_Missense_Mutation_p.E85D|MGAT4B_uc003mkq.2_Missense_Mutation_p.E85D|MGAT4B_uc003mkr.2_Missense_Mutation_p.E245D|MIR1229_hsa-mir-1229|MI0006319_5'Flank	p.E230D	NM_014275	NP_055090	Q9UQ53	MGT4B_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		6	1059	-	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	230			Lumenal (Potential).		A8MPR0|Q86TF1|Q96GH4|Q9NSK6	Missense_Mutation	SNP	ENST00000292591.7	37	c.690G>C	CCDS4448.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	13.84|13.84|13.84	2.355865|2.355865|2.355865	0.41700|0.41700|0.41700	.|.|.	.|.|.	ENSG00000161013|ENSG00000161013|ENSG00000161013	ENST00000337755;ENST00000292591;ENST00000523108|ENST00000519836|ENST00000518778;ENST00000518980;ENST00000520875;ENST00000518867	T;T;T|.|.	0.45668|.|.	0.89;0.89;0.89|.|.	4.6|4.6|4.6	2.8|2.8|2.8	0.32819|0.32819|0.32819	.|.|.	0.059490|.|.	0.64402|.|.	D|.|.	0.000003|.|.	T|T|T	0.60444|0.60444|0.60444	0.2269|0.2269|0.2269	M|M|M	0.66439|0.66439|0.66439	2.03|2.03|2.03	0.54753|0.54753|0.54753	D|D|D	0.999989|0.999989|0.999989	P;D;B;P|.|.	0.69078|.|.	0.934;0.997;0.006;0.865|.|.	P;D;B;P|.|.	0.79108|.|.	0.801;0.992;0.02;0.554|.|.	T|T|T	0.54609|0.54609|0.54609	-0.8268|-0.8268|-0.8268	10|5|5	0.20046|.|.	T|.|.	0.44|.|.	-22.8274|-22.8274|-22.8274	6.4345|6.4345|6.4345	0.21815|0.21815|0.21815	0.0:0.5521:0.0:0.4479|0.0:0.5521:0.0:0.4479|0.0:0.5521:0.0:0.4479	.|.|.	230;245;85;230|.|.	Q9UQ53;A8MPR0;E5RFS3;Q9UQ53-2|.|.	MGT4B_HUMAN;.;.;.|.|.	D|T|L	245;230;85|178|56;40;29;42	ENSP00000338487:E245D;ENSP00000292591:E230D;ENSP00000427995:E85D|.|.	ENSP00000292591:E230D|.|.	E|S|V	-|-|-	3|2|1	2|0|0	MGAT4B|MGAT4B|MGAT4B	179160119|179160119|179160119	0.995000|0.995000|0.995000	0.38212|0.38212|0.38212	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.873000|0.873000|0.873000	0.50193|0.50193|0.50193	0.473000|0.473000|0.473000	0.22132|0.22132|0.22132	0.388000|0.388000|0.388000	0.25054|0.25054|0.25054	-0.275000|-0.275000|-0.275000	0.10095|0.10095|0.10095	GAG|AGT|GTC		0.602	MGAT4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253503.3	NM_014275		4	17	0	0	0	0.009096	0	4	17				
MGAT4B	11282	broad.mit.edu	37	5	179227594	179227594	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr5:179227594G>T	ENST00000292591.7	-	6	959	c.609C>A	c.(607-609)ttC>ttA	p.F203L	MGAT4B_ENST00000521305.1_5'UTR|MGAT4B_ENST00000337755.5_Missense_Mutation_p.F218L|MIR1229_ENST00000408467.1_RNA	NM_014275.4	NP_055090.1	Q9UQ53	MGT4B_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B	203					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	13	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCTCCGTGGGGAACCTGGGGG	0.647																																					GBM(13;414 434 4098 22176 23230)	GBM(13;414 434 4098 22176 23230)	uc003mks.2		NA																	0					0						c.(607-609)TTC>TTA		alpha-1,3-mannosyl-glycoprotein							16.0	20.0	19.0					5																	179227594		2201	4297	6498	SO:0001583	missense	11282				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding	g.chr5:179227594G>T	AB000624	CCDS4448.1, CCDS4449.1	5q35	2013-02-25	2005-11-16		ENSG00000161013	ENSG00000161013	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7048	protein-coding gene	gene with protein product		604561	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B"""			10372966	Standard	NM_014275		Approved	GnT-Ivb	uc003mks.3	Q9UQ53	OTTHUMG00000130912	ENST00000292591.7:c.609C>A	5.37:g.179227594G>T	ENSP00000292591:p.Phe203Leu					MGAT4B_uc003mkp.2_Missense_Mutation_p.F58L|MGAT4B_uc003mkq.2_Missense_Mutation_p.F58L|MGAT4B_uc003mkr.2_Missense_Mutation_p.F218L|MIR1229_hsa-mir-1229|MI0006319_5'Flank	p.F203L	NM_014275	NP_055090	Q9UQ53	MGT4B_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		6	978	-	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	203			Lumenal (Potential).		A8MPR0|Q86TF1|Q96GH4|Q9NSK6	Missense_Mutation	SNP	ENST00000292591.7	37	c.609C>A	CCDS4448.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	17.95|17.95|17.95	3.513776|3.513776|3.513776	0.64522|0.64522|0.64522	.|.|.	.|.|.	ENSG00000161013|ENSG00000161013|ENSG00000161013	ENST00000337755;ENST00000292591;ENST00000523108|ENST00000518778;ENST00000518980;ENST00000520875;ENST00000518867|ENST00000519836	T;T;T|.|.	0.59224|.|.	0.28;0.28;0.28|.|.	4.61|4.61|4.61	1.83|1.83|1.83	0.25207|0.25207|0.25207	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.73606|0.73606|0.73606	0.3608|0.3608|0.3608	M|M|M	0.85630|0.85630|0.85630	2.765|2.765|2.765	0.80722|0.80722|0.80722	D|D|D	1|1|1	B;D;B;D|.|.	0.57257|.|.	0.098;0.979;0.35;0.974|.|.	B;D;B;D|.|.	0.74023|.|.	0.08;0.982;0.443;0.969|.|.	T|T|T	0.71649|0.71649|0.71649	-0.4529|-0.4529|-0.4529	10|5|5	0.87932|.|.	D|.|.	0|.|.	-27.6298|-27.6298|-27.6298	9.7713|9.7713|9.7713	0.40591|0.40591|0.40591	0.229:0.0:0.771:0.0|0.229:0.0:0.771:0.0|0.229:0.0:0.771:0.0	.|.|.	203;218;58;203|.|.	Q9UQ53;A8MPR0;E5RFS3;Q9UQ53-2|.|.	MGT4B_HUMAN;.;.;.|.|.	L|T|Y	218;203;58|29;13;2;15|151	ENSP00000338487:F218L;ENSP00000292591:F203L;ENSP00000427995:F58L|.|.	ENSP00000292591:F203L|.|.	F|P|S	-|-|-	3|1|2	2|0|0	MGAT4B|MGAT4B|MGAT4B	179160200|179160200|179160200	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.991000|0.991000|0.991000	0.47740|0.47740|0.47740	0.632000|0.632000|0.632000	0.37999|0.37999|0.37999	2.373000|2.373000|2.373000	0.44266|0.44266|0.44266	0.070000|0.070000|0.070000	0.16634|0.16634|0.16634	-0.311000|-0.311000|-0.311000	0.09066|0.09066|0.09066	TTC|CCC|TCC		0.647	MGAT4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253503.3	NM_014275		4	29	1	0	1.23904e-05	0.000602	1.47252e-05	4	29				
CDYL	9425	broad.mit.edu	37	6	4892523	4892523	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:4892523G>T	ENST00000328908.5	+	4	894	c.763G>T	c.(763-765)Ggg>Tgg	p.G255W	CDYL_ENST00000449732.2_Missense_Mutation_p.G69W|CDYL_ENST00000397588.3_Missense_Mutation_p.G201W|CDYL_ENST00000343762.5_Missense_Mutation_p.G69W|CDYL_ENST00000472453.1_Intron			Q9Y232	CDYL1_HUMAN	chromodomain protein, Y-like	255	Interaction with EZH2.				regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(2)|large_intestine(9)|lung(13)|skin(1)|stomach(2)|urinary_tract(1)	30	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		GGCCAGGATGGGGAGCAGGCC	0.642																																							uc003mwi.2		NA																	0					0						c.(763-765)GGG>TGG		chromodomain protein, Y chromosome-like isoform							40.0	50.0	46.0					6																	4892523		2203	4300	6503	SO:0001583	missense	9425				regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity	g.chr6:4892523G>T	AF081258	CCDS4491.2, CCDS47364.1	6p25.1	2010-05-04	2003-09-12		ENSG00000153046	ENSG00000153046			1811	protein-coding gene	gene with protein product	"""CDY-like, autosomal"", ""testis-specific chromodomain Y-like protein"""	603778	"""chromodomain protein, Y chromosome-like"""			10192397	Standard	NM_001143970		Approved	DKFZP586C1622, CDYL1	uc003mwj.3	Q9Y232	OTTHUMG00000014170	ENST00000328908.5:c.763G>T	6.37:g.4892523G>T	ENSP00000330512:p.Gly255Trp					CDYL_uc003mwj.2_Missense_Mutation_p.G201W|CDYL_uc003mwk.2_Intron|CDYL_uc011dhx.1_Missense_Mutation_p.G69W|CDYL_uc011dhy.1_Missense_Mutation_p.G69W	p.G255W	NM_001143971	NP_001137443	Q9Y232	CDYL1_HUMAN		OV - Ovarian serous cystadenocarcinoma(45;0.182)	4	894	+	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)	255					A8K6D6|B4DLG4|Q0VDG7|Q32NC5|Q5VX99|Q6P7T5|Q9BWZ2|Q9Y424	Missense_Mutation	SNP	ENST00000328908.5	37	c.763G>T		.	.	.	.	.	.	.	.	.	.	G	28.7	4.944645	0.92593	.	.	ENSG00000153046	ENST00000328908;ENST00000397588;ENST00000449732;ENST00000343762	T;T;T;T	0.58652	0.69;0.32;0.4;0.4	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.69070	0.3070	M	0.62723	1.935	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.72338	0.977;0.949	T	0.65796	-0.6081	9	.	.	.	.	19.0316	0.92959	0.0:0.0:1.0:0.0	.	201;255	Q9Y232-2;Q9Y232	.;CDYL1_HUMAN	W	255;201;69;69	ENSP00000330512:G255W;ENSP00000380718:G201W;ENSP00000394076:G69W;ENSP00000340908:G69W	.	G	+	1	0	CDYL	4837522	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.526000	0.98042	2.731000	0.93534	0.650000	0.86243	GGG		0.642	CDYL-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000039736.1	NM_004824		13	56	1	0	5.50884e-06	0.013537	6.65869e-06	13	56				
Unknown	0	broad.mit.edu	37	6	29855800	29855800	+	IGR	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:29855800T>A								HLA-G (56898 upstream) : HLA-A (53236 downstream)																							CCGCTTCATCTCCGTCGGCTA	0.692																																							uc010jro.2		NA																	0					0						c.(37-39)TCC>ACC		SubName: Full=cDNA FLJ52667, highly similar to HLA class I histocompatibility antigen, alpha chain H;																																				SO:0001628	intergenic_variant	3136							g.chr6:29855800T>A																													6.37:g.29855800T>A						HLA-G_uc011dmb.1_Intron|HLA-H_uc003nod.2_RNA	p.S13T							2	89	+									Missense_Mutation	SNP		37	c.37T>A																																																																																				0	0.692									3	24	0	0	0	0.001984	0	3	24				
USP49	25862	broad.mit.edu	37	6	41773944	41773944	+	Missense_Mutation	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:41773944T>A	ENST00000394253.3	-	3	1107	c.778A>T	c.(778-780)Aac>Tac	p.N260Y	USP49_ENST00000373009.3_Missense_Mutation_p.N260Y|USP49_ENST00000373006.1_Missense_Mutation_p.N260Y|USP49_ENST00000373010.1_Missense_Mutation_p.N260Y|USP49_ENST00000297229.2_Missense_Mutation_p.N260Y			Q70CQ1	UBP49_HUMAN	ubiquitin specific peptidase 49	260	USP.				histone H2B conserved C-terminal lysine deubiquitination (GO:0035616)|mRNA splicing, via spliceosome (GO:0000398)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)|skin(2)	23	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TAGCAGGTGTTGCCCAGGTTG	0.622																																							uc003ori.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(778-780)AAC>TAC		ubiquitin thioesterase 49							52.0	53.0	53.0					6																	41773944		2203	4299	6502	SO:0001583	missense	25862				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding	g.chr6:41773944T>A	AJ586139	CCDS4861.1, CCDS69111.1	6p12.1	2008-02-05	2005-08-08		ENSG00000164663	ENSG00000164663		"""Ubiquitin-specific peptidases"""	20078	protein-coding gene	gene with protein product			"""ubiquitin specific protease 49"""			14715245	Standard	NM_018561		Approved	MGC20741	uc003ori.3	Q70CQ1	OTTHUMG00000014688	ENST00000394253.3:c.778A>T	6.37:g.41773944T>A	ENSP00000377797:p.Asn260Tyr						p.N260Y	NM_018561	NP_061031	Q70CQ1	UBP49_HUMAN	STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)		4	1000	-	Ovarian(28;0.0919)|Colorectal(47;0.121)		260					Q5T3D9|Q5T3E0|Q96CK4	Missense_Mutation	SNP	ENST00000394253.3	37	c.778A>T		.	.	.	.	.	.	.	.	.	.	T	20.1	3.936264	0.73442	.	.	ENSG00000164663	ENST00000394253;ENST00000373010;ENST00000373009;ENST00000373006;ENST00000297229	T;T;T;D;D	0.82526	3.45;3.45;3.45;-1.62;-1.62	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	D	0.93520	0.7932	H	0.97806	4.08	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95568	0.8635	10	0.87932	D	0	-18.5876	13.7681	0.63008	0.0:0.0:0.0:1.0	.	260	Q70CQ1-2	.	Y	260	ENSP00000377797:N260Y;ENSP00000362101:N260Y;ENSP00000362100:N260Y;ENSP00000362097:N260Y;ENSP00000297229:N260Y	ENSP00000297229:N260Y	N	-	1	0	USP49	41881922	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	5.838000	0.69388	1.921000	0.55644	0.533000	0.62120	AAC		0.622	USP49-007	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000316513.3	NM_018561		7	78	0	0	0	0.001984	0	7	78				
PRPH2	5961	broad.mit.edu	37	6	42672193	42672193	+	Nonsense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:42672193C>T	ENST00000230381.5	-	2	977	c.738G>A	c.(736-738)tgG>tgA	p.W246*		NM_000322.4	NP_000313.2	P23942	PRPH2_HUMAN	peripherin 2 (retinal degeneration, slow)	246					cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	18	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)			AGCCACGCACCCACAGGTTGA	0.587																																							uc003osk.2		NA																	0				ovary(4)|central_nervous_system(1)	5						c.(736-738)TGG>TGA		peripherin 2							129.0	88.0	102.0					6																	42672193		2203	4300	6503	SO:0001587	stop_gained	5961				cell adhesion|visual perception	integral to membrane		g.chr6:42672193C>T		CCDS4871.1	6p21.1	2013-09-20	2006-11-23	2006-11-23	ENSG00000112619	ENSG00000112619		"""Tetraspanins"""	9942	protein-coding gene	gene with protein product	retinal peripherin	179605	"""retinal degeneration, slow (retinitis pigmentosa 7)"", ""retinal degeneration, slow"""	RP7, RDS		1749427	Standard	NM_000322		Approved	TSPAN22, rd2, CACD2	uc003osk.3	P23942	OTTHUMG00000014701	ENST00000230381.5:c.738G>A	6.37:g.42672193C>T	ENSP00000230381:p.Trp246*						p.W246*	NM_000322	NP_000313	P23942	PRPH2_HUMAN	Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)		2	1024	-	Colorectal(47;0.196)		246			Lumenal (Potential).		Q5TFH5|Q6DK65	Nonsense_Mutation	SNP	ENST00000230381.5	37	c.738G>A	CCDS4871.1	.	.	.	.	.	.	.	.	.	.	C	39	7.546307	0.98352	.	.	ENSG00000112619	ENST00000230381	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.5136	0.90926	0.0:1.0:0.0:0.0	.	.	.	.	X	246	.	ENSP00000230381:W246X	W	-	3	0	PRPH2	42780171	1.000000	0.71417	0.988000	0.46212	0.995000	0.86356	7.764000	0.85297	2.383000	0.81215	0.655000	0.94253	TGG		0.587	PRPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040556.1	NM_000322		4	41	0	0	0	0.009096	0	4	41				
CUL7	9820	broad.mit.edu	37	6	43020329	43020329	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:43020329C>A	ENST00000265348.3	-	2	283	c.198G>T	c.(196-198)ctG>ctT	p.L66L	CUL7_ENST00000535468.1_Silent_p.L118L			Q14999	CUL7_HUMAN	cullin 7	66					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			ACATCCACAGCAGGATGTGCT	0.617																																							uc003otq.2		NA																	0				ovary(3)|kidney(1)	4						c.(196-198)CTG>CTT		cullin 7							96.0	91.0	93.0					6																	43020329		2203	4300	6503	SO:0001819	synonymous_variant	9820				interspecies interaction between organisms|ubiquitin-dependent protein catabolic process|vasculogenesis	anaphase-promoting complex|mitochondrion	ubiquitin protein ligase binding	g.chr6:43020329C>A	BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.198G>T	6.37:g.43020329C>A						CUL7_uc011dvb.1_Silent_p.L118L|CUL7_uc010jyh.2_Missense_Mutation_p.C35F|KLC4_uc003otr.1_Intron	p.L66L	NM_014780	NP_055595	Q14999	CUL7_HUMAN	all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)		2	501	-			66					B4DYZ0|F5H0L1|Q5T654	Silent	SNP	ENST00000265348.3	37	c.198G>T	CCDS4881.1																																																																																				0.617	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780		11	107	1	0	0.000978159	0.010729	0.00108552	11	107				
SPATS1	221409	broad.mit.edu	37	6	44310868	44310868	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:44310868G>A	ENST00000288390.2	+	1	383	c.36G>A	c.(34-36)cgG>cgA	p.R12R	SPATS1_ENST00000323108.8_Silent_p.R12R|RP11-444E17.6_ENST00000505802.1_Intron			Q496A3	SPAS1_HUMAN	spermatogenesis associated, serine-rich 1	12										NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(5)|skin(1)|urinary_tract(1)	14	all_lung(25;0.00469)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ACAGTCCACGGGGCTGCCGTC	0.517																																							uc003oxk.2		NA																	0				skin(1)	1						c.(34-36)CGG>CGA		spermatogenesis associated, serine-rich 1							65.0	61.0	63.0					6																	44310868		2203	4300	6503	SO:0001819	synonymous_variant	221409							g.chr6:44310868G>A	AK058171	CCDS4911.1	6p21.1	2003-08-08			ENSG00000249481	ENSG00000249481			22957	protein-coding gene	gene with protein product							Standard	NM_145026		Approved	SPATA8, FLJ25442, SRSP1	uc021yzz.1	Q496A3	OTTHUMG00000014764	ENST00000288390.2:c.36G>A	6.37:g.44310868G>A						SPATS1_uc003oxg.2_Intron|SPATS1_uc010jzb.2_5'UTR	p.R12R	NM_145026	NP_659463	Q496A3	SPAS1_HUMAN	Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		1	383	+	all_lung(25;0.00469)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		12					Q496A2|Q496A5|Q96LJ0	Silent	SNP	ENST00000288390.2	37	c.36G>A	CCDS4911.1	.	.	.	.	.	.	.	.	.	.	G	3.219	-0.160003	0.06502	.	.	ENSG00000249481	ENST00000515220	.	.	.	3.09	1.08	0.20341	.	.	.	.	.	T	0.10252	0.0251	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.32402	-0.9908	4	.	.	.	.	5.2387	0.15460	0.0:0.3423:0.4504:0.2073	.	.	.	.	E	46	.	.	G	+	2	0	SPATS1	44418846	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.635000	0.24629	0.250000	0.21479	-0.309000	0.09137	GGG		0.517	SPATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040738.2	NM_145026		9	44	0	0	0	0.006214	0	9	44				
RHAG	6005	broad.mit.edu	37	6	49580220	49580220	+	Nonsense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:49580220C>A	ENST00000371175.4	-	6	861	c.835G>T	c.(835-837)Gga>Tga	p.G279*	RHAG_ENST00000229810.7_Nonsense_Mutation_p.G279*	NM_000324.2	NP_000315.2	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	279			G -> E (in RHN; dbSNP:rs28933991). {ECO:0000269|PubMed:9454778, ECO:0000269|PubMed:9716608}.		ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|carbon dioxide transport (GO:0015670)|cellular ion homeostasis (GO:0006873)|erythrocyte development (GO:0048821)|multicellular organismal iron ion homeostasis (GO:0060586)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	39	Lung NSC(77;0.0255)					GCAACTCCTCCAGCAAGGGTG	0.468																																					Ovarian(176;476 2003 7720 43408 44749)	Ovarian(176;476 2003 7720 43408 44749)	uc003ozk.3		NA																	0				breast(1)|skin(1)	2						c.(835-837)GGA>TGA		Rh-associated glycoprotein							91.0	78.0	82.0					6																	49580220		2203	4300	6503	SO:0001587	stop_gained	6005				carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding	g.chr6:49580220C>A		CCDS4927.1	6p12.3	2014-07-19	2006-02-23		ENSG00000112077	ENSG00000112077		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	10006	protein-coding gene	gene with protein product		180297	"""Rhesus blood group-associated glycoprotein"""			9479501	Standard	NM_000324		Approved	RH50A, CD241, SLC42A1	uc003ozk.4	Q02094	OTTHUMG00000016377	ENST00000371175.4:c.835G>T	6.37:g.49580220C>A	ENSP00000360217:p.Gly279*					RHAG_uc010jzl.2_Nonsense_Mutation_p.G279*|RHAG_uc010jzm.2_Nonsense_Mutation_p.G279*	p.G279*	NM_000324	NP_000315	Q02094	RHAG_HUMAN			6	897	-	Lung NSC(77;0.0255)		279			Helical; (Potential).		B2R8T8|O43514|O43515|Q7L8L3|Q9H454	Nonsense_Mutation	SNP	ENST00000371175.4	37	c.835G>T	CCDS4927.1	.	.	.	.	.	.	.	.	.	.	C	37	6.314313	0.97467	.	.	ENSG00000112077	ENST00000371175;ENST00000229810;ENST00000418071;ENST00000539403	.	.	.	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-13.7804	18.4694	0.90767	0.0:1.0:0.0:0.0	.	.	.	.	X	279	.	ENSP00000229810:G279X	G	-	1	0	RHAG	49688179	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.783000	0.85696	2.600000	0.87896	0.655000	0.94253	GGA		0.468	RHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043806.1			10	37	1	0	1.08611e-07	0.010729	1.45347e-07	10	37				
GCLC	2729	broad.mit.edu	37	6	53385617	53385617	+	Silent	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:53385617T>C	ENST00000229416.6	-	3	888	c.405A>G	c.(403-405)ttA>ttG	p.L135L	GCLC_ENST00000514004.1_Silent_p.L135L	NM_001197115.1|NM_001498.3	NP_001184044.1|NP_001489.1	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit	135					apoptotic mitochondrial changes (GO:0008637)|cell redox homeostasis (GO:0045454)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to arsenic-containing substance (GO:0046685)|response to heat (GO:0009408)|response to hormone (GO:0009725)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|coenzyme binding (GO:0050662)|glutamate binding (GO:0016595)|glutamate-cysteine ligase activity (GO:0004357)|magnesium ion binding (GO:0000287)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|Vitamin E(DB00163)	GATTTTCTTCTAATATAGAAG	0.443																																							uc003pbw.1		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(403-405)TTA>TTG		glutamate-cysteine ligase, catalytic subunit	L-Cysteine(DB00151)|L-Glutamic Acid(DB00142)						181.0	194.0	190.0					6																	53385617		2203	4300	6503	SO:0001819	synonymous_variant	2729				anti-apoptosis|cell redox homeostasis|cysteine metabolic process|glutamate metabolic process|glutathione biosynthetic process|negative regulation of transcription, DNA-dependent|regulation of blood vessel size|response to heat|response to hormone stimulus|response to oxidative stress|xenobiotic metabolic process	cytosol	ADP binding|ATP binding|coenzyme binding|glutamate binding|glutamate-cysteine ligase activity|magnesium ion binding	g.chr6:53385617T>C	M90656	CCDS4952.1, CCDS75471.1	6p12	2008-02-05				ENSG00000001084	6.3.2.2		4311	protein-coding gene	gene with protein product		606857		GLCLC, GLCL		1350904	Standard	NM_001498		Approved	GCS	uc003pbw.2	P48506		ENST00000229416.6:c.405A>G	6.37:g.53385617T>C						GCLC_uc003pbx.2_Silent_p.L135L	p.L135L	NM_001498	NP_001489	P48506	GSH1_HUMAN			3	793	-	Lung NSC(77;0.0137)		135					Q14399	Silent	SNP	ENST00000229416.6	37	c.405A>G	CCDS4952.1	.	.	.	.	.	.	.	.	.	.	T	7.849	0.723547	0.15439	.	.	ENSG00000001084	ENST00000513939	.	.	.	5.32	-1.08	0.09936	.	.	.	.	.	.	.	.	.	.	.	0.50632	D	0.999887	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.7903	0.34845	0.0:0.5284:0.1265:0.3451	.	.	.	.	W	123	.	.	X	-	2	0	GCLC	53493576	0.950000	0.32346	0.019000	0.16419	0.906000	0.53458	0.389000	0.20751	-0.114000	0.11936	-0.250000	0.11733	TAG		0.443	GCLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359710.2			15	173	0	0	0	0.003163	0	15	173				
GFRAL	389400	broad.mit.edu	37	6	55198661	55198661	+	Missense_Mutation	SNP	C	C	G	rs207466987		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:55198661C>G	ENST00000340465.2	+	3	321	c.235C>G	c.(235-237)Caa>Gaa	p.Q79E		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	79					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			AAGCAATTTCCAATTTAAAGA	0.348																																							uc003pcm.1		NA																	0				ovary(1)|breast(1)	2						c.(235-237)CAA>GAA		GDNF family receptor alpha like precursor							132.0	132.0	132.0					6																	55198661		2203	4300	6503	SO:0001583	missense	389400					integral to membrane	receptor activity	g.chr6:55198661C>G	AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.235C>G	6.37:g.55198661C>G	ENSP00000343636:p.Gln79Glu						p.Q79E	NM_207410	NP_997293	Q6UXV0	GFRAL_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.23)		3	321	+	Lung NSC(77;0.0875)|Renal(3;0.122)		79			Extracellular (Potential).		Q5VTF6	Missense_Mutation	SNP	ENST00000340465.2	37	c.235C>G	CCDS4957.1	.	.	.	.	.	.	.	.	.	.	C	2.875	-0.233073	0.05983	.	.	ENSG00000187871	ENST00000340465	T	0.28454	1.61	5.12	3.22	0.36961	GDNF/GAS1 (1);	0.510654	0.18393	N	0.142587	T	0.06462	0.0166	L	0.39633	1.23	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37549	-0.9701	10	0.07030	T	0.85	-22.5413	6.2563	0.20876	0.0:0.7121:0.188:0.0999	.	79	Q6UXV0	GFRAL_HUMAN	E	79	ENSP00000343636:Q79E	ENSP00000343636:Q79E	Q	+	1	0	GFRAL	55306620	0.011000	0.17503	0.003000	0.11579	0.198000	0.23893	0.601000	0.24119	1.135000	0.42183	0.650000	0.86243	CAA		0.348	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	NM_207410		23	91	0	0	0	0.014323	0	23	91				
RIMS1	22999	broad.mit.edu	37	6	72960115	72960115	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:72960115G>A	ENST00000521978.1	+	13	2324	c.2324G>A	c.(2323-2325)gGa>gAa	p.G775E	RIMS1_ENST00000520567.1_Missense_Mutation_p.G775E|RIMS1_ENST00000517827.1_Missense_Mutation_p.G234E|RIMS1_ENST00000264839.7_Missense_Mutation_p.G775E|RIMS1_ENST00000538414.1_5'Flank|RIMS1_ENST00000517960.1_Missense_Mutation_p.G775E|RIMS1_ENST00000348717.5_Missense_Mutation_p.G775E|RIMS1_ENST00000518273.1_Missense_Mutation_p.G775E|RIMS1_ENST00000425662.2_Missense_Mutation_p.G168E|RIMS1_ENST00000491071.2_Missense_Mutation_p.G775E|RIMS1_ENST00000401910.3_Missense_Mutation_p.G249E|RIMS1_ENST00000522291.1_Missense_Mutation_p.G775E|RIMS1_ENST00000523963.1_Missense_Mutation_p.G249E	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	775	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				AGAGTAGATGGACGTCCTCGA	0.348																																							uc003pga.2		NA																	0				ovary(7)|pancreas(2)|breast(1)	10						c.(2323-2325)GGA>GAA		regulating synaptic membrane exocytosis 1							79.0	73.0	75.0					6																	72960115		1842	4088	5930	SO:0001583	missense	22999				calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr6:72960115G>A	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.2324G>A	6.37:g.72960115G>A	ENSP00000428417:p.Gly775Glu					RIMS1_uc011dyb.1_Missense_Mutation_p.G401E|RIMS1_uc003pgc.2_Missense_Mutation_p.G401E|RIMS1_uc010kaq.2_Missense_Mutation_p.G249E|RIMS1_uc011dyc.1_Missense_Mutation_p.G249E|RIMS1_uc010kar.2_Missense_Mutation_p.G168E|RIMS1_uc011dyd.1_Missense_Mutation_p.G234E|RIMS1_uc003pgf.2_5'UTR|RIMS1_uc003pgg.2_5'UTR|RIMS1_uc003pgi.2_5'UTR|RIMS1_uc003pgh.2_5'UTR|RIMS1_uc003pgd.2_5'UTR|RIMS1_uc003pge.2_5'UTR|RIMS1_uc011dye.1_5'Flank|RIMS1_uc003pgb.3_Missense_Mutation_p.G401E|RIMS1_uc010kas.1_Missense_Mutation_p.G234E	p.G775E	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN			13	2401	+		all_epithelial(107;0.179)|all_hematologic(105;0.212)	775			C2 1.		A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	c.2324G>A	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.6|20.6	4.021049|4.021049	0.75275|0.75275	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827|ENST00000517433	T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.69040|.	-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37|.	5.28|5.28	5.28|5.28	0.74379|0.74379	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|.	0.73674|.	0.3617|.	M|M	0.78223|0.78223	2.4|2.4	0.80722|0.80722	D|D	1|1	D;P;D;D;D;D;D|.	0.89917|.	0.996;0.765;1.0;1.0;0.999;1.0;1.0|.	D;P;D;D;D;D;D|.	0.97110|.	0.986;0.528;1.0;0.996;0.993;0.999;1.0|.	T|.	0.73471|.	-0.3972|.	10|.	0.87932|.	D|.	0|.	-13.9318|-13.9318	19.2624|19.2624	0.93973|0.93973	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	234;249;775;234;249;775;775|.	B7Z3S3;E9PHF5;E9PHR1;B7Z9Z3;E9PF48;C9JNW6;Q86UR5|.	.;.;.;.;.;.;RIMS1_HUMAN|.	E|X	775;775;775;775;775;775;775;775;775;775;775;775;249;249;168;168;234|348	ENSP00000430101:G775E;ENSP00000275037:G775E;ENSP00000264839:G775E;ENSP00000429959:G775E;ENSP00000430408:G775E;ENSP00000430502:G775E;ENSP00000430932:G775E;ENSP00000428417:G775E;ENSP00000385649:G249E;ENSP00000428328:G249E;ENSP00000411235:G168E;ENSP00000389503:G168E;ENSP00000428367:G234E|.	ENSP00000264839:G775E|.	G|W	+|+	2|3	0|0	RIMS1|RIMS1	73016836|73016836	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.718000|0.718000	0.41266|0.41266	7.640000|7.640000	0.83355|0.83355	2.611000|2.611000	0.88343|0.88343	0.585000|0.585000	0.79938|0.79938	GGA|TGG		0.348	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1			4	18	0	0	0	0.009096	0	4	18				
COL12A1	1303	broad.mit.edu	37	6	75840577	75840577	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:75840577C>A	ENST00000322507.8	-	36	6367	c.6058G>T	c.(6058-6060)Ggc>Tgc	p.G2020C	COL12A1_ENST00000345356.6_Missense_Mutation_p.G856C|COL12A1_ENST00000483888.2_Missense_Mutation_p.G2020C|COL12A1_ENST00000416123.2_Missense_Mutation_p.G2020C	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2020	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CGCGTTCGGCCCTGGGCAGGG	0.567																																							uc003phs.2		NA																	0				ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						c.(6058-6060)GGC>TGC		collagen, type XII, alpha 1 long isoform							75.0	76.0	76.0					6																	75840577		2014	4177	6191	SO:0001583	missense	1303				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength	g.chr6:75840577C>A	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.6058G>T	6.37:g.75840577C>A	ENSP00000325146:p.Gly2020Cys					COL12A1_uc003pht.2_Missense_Mutation_p.G856C	p.G2020C	NM_004370	NP_004361	Q99715	COCA1_HUMAN			36	6224	-			2020			Fibronectin type-III 15.		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	c.6058G>T	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.471043	0.84533	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	T;T;T;T	0.53857	0.6;0.6;0.6;0.6	5.6	4.73	0.59995	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.266713	0.36234	N	0.002709	T	0.71904	0.3395	M	0.90870	3.155	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.962	T	0.79907	-0.1605	10	0.66056	D	0.02	.	14.2334	0.65908	0.0:0.9287:0.0:0.0713	.	856;2020	Q99715-2;Q99715	.;COCA1_HUMAN	C	2020;2020;856;2020;2020	ENSP00000325146:G2020C;ENSP00000305147:G856C;ENSP00000412864:G2020C;ENSP00000421216:G2020C	ENSP00000325146:G2020C	G	-	1	0	COL12A1	75897297	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.321000	0.72881	1.362000	0.46000	0.655000	0.94253	GGC		0.567	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370		12	46	1	0	0.00010058	0.013537	0.00011441	12	46				
MRAP2	112609	broad.mit.edu	37	6	84799141	84799141	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:84799141C>A	ENST00000257776.4	+	4	694	c.559C>A	c.(559-561)Cca>Aca	p.P187T		NM_138409.2	NP_612418.2	Q96G30	MRAP2_HUMAN	melanocortin 2 receptor accessory protein 2	187					energy homeostasis (GO:0097009)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|positive regulation of cAMP biosynthetic process (GO:0030819)|protein localization to cell surface (GO:0034394)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	corticotropin hormone receptor binding (GO:0031780)|identical protein binding (GO:0042802)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)|type 5 melanocortin receptor binding (GO:0031783)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(4)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	19						GATTTCTGAACCACCTATTGT	0.463																																							uc003pkg.3		NA																	0				skin(2)	2						c.(559-561)CCA>ACA		melanocortin 2 receptor accessory protein 2							113.0	117.0	116.0					6																	84799141		2203	4300	6503	SO:0001583	missense	112609				positive regulation of cAMP biosynthetic process|protein localization at cell surface	endoplasmic reticulum|plasma membrane	corticotropin hormone receptor binding|type 1 melanocortin receptor binding|type 3 melanocortin receptor binding|type 4 melanocortin receptor binding|type 5 melanocortin receptor binding	g.chr6:84799141C>A	AK090775	CCDS5001.1	6q14.3	2009-10-06	2008-07-16	2008-07-16	ENSG00000135324	ENSG00000135324			21232	protein-coding gene	gene with protein product		615410	"""chromosome 6 open reading frame 117"""	C6orf117			Standard	NM_138409		Approved	bA51G5.2	uc003pkg.4	Q96G30	OTTHUMG00000015121	ENST00000257776.4:c.559C>A	6.37:g.84799141C>A	ENSP00000257776:p.Pro187Thr					MRAP2_uc010kbo.2_Missense_Mutation_p.P101T	p.P187T	NM_138409	NP_612418	Q96G30	MRAP2_HUMAN			4	749	+			187					A8K9M1|Q8IXM9|Q8N2D1	Missense_Mutation	SNP	ENST00000257776.4	37	c.559C>A	CCDS5001.1	.	.	.	.	.	.	.	.	.	.	C	9.062	0.994852	0.19043	.	.	ENSG00000135324	ENST00000257776	D	0.85702	-2.02	5.53	1.41	0.22369	.	0.239259	0.42821	N	0.000649	T	0.68439	0.3001	L	0.47716	1.5	0.41610	D	0.988903	B	0.09022	0.002	B	0.10450	0.005	T	0.65529	-0.6146	10	0.54805	T	0.06	0.1561	10.7163	0.46015	0.2445:0.5193:0.2362:0.0	.	187	Q96G30	MRAP2_HUMAN	T	187	ENSP00000257776:P187T	ENSP00000257776:P187T	P	+	1	0	MRAP2	84855860	1.000000	0.71417	0.530000	0.27963	0.245000	0.25701	1.263000	0.33004	0.367000	0.24454	0.650000	0.86243	CCA		0.463	MRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041367.1	NM_138409		9	53	1	0	3.86212e-05	0.008291	4.47304e-05	9	53				
TBX18	9096	broad.mit.edu	37	6	85447051	85447051	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:85447051G>A	ENST00000369663.5	-	8	1513	c.1176C>T	c.(1174-1176)ggC>ggT	p.G392G	TBX18_ENST00000606784.1_Intron	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	392					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		AGCAAGAGGAGCCAGACAAAA	0.552																																							uc003pkl.1		NA																	0				ovary(2)|pancreas(2)|lung(1)	5						c.(1174-1176)GGC>GGT		T-box 18							76.0	78.0	78.0					6																	85447051		2203	4300	6503	SO:0001819	synonymous_variant	9096				multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr6:85447051G>A	AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.1176C>T	6.37:g.85447051G>A						TBX18_uc010kbq.1_Intron	p.G392G	NM_001080508	NP_001073977	O95935	TBX18_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0267)	8	1176	-		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)	392					A2RU13|Q7Z6U4|Q9UJI6	Silent	SNP	ENST00000369663.5	37	c.1176C>T	CCDS34495.1																																																																																				0.552	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041378.2	NM_001080508		10	57	0	0	0	0.010729	0	10	57				
LAMA4	3910	broad.mit.edu	37	6	112457342	112457342	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:112457342C>G	ENST00000230538.7	-	25	3794	c.3397G>C	c.(3397-3399)Gat>Cat	p.D1133H	LAMA4_ENST00000389463.4_Missense_Mutation_p.D1126H|LAMA4_ENST00000424408.2_Missense_Mutation_p.D1126H|LAMA4_ENST00000522006.1_Missense_Mutation_p.D1126H	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	1133	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TATTTTGCATCATTAATTTGA	0.368																																							uc003pvu.2		NA																	0				ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9						c.(3397-3399)GAT>CAT		laminin, alpha 4 isoform 1 precursor							143.0	127.0	133.0					6																	112457342		2203	4300	6503	SO:0001583	missense	3910				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding	g.chr6:112457342C>G		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.3397G>C	6.37:g.112457342C>G	ENSP00000230538:p.Asp1133His					LAMA4_uc003pvv.2_Missense_Mutation_p.D1126H|LAMA4_uc003pvt.2_Missense_Mutation_p.D1126H	p.D1133H	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)	25	3706	-		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)	1133			Laminin G-like 2.		Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	ENST00000230538.7	37	c.3397G>C	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.682142	0.88542	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	D;D;D;D	0.85773	-2.03;-2.03;-2.03;-2.03	5.93	5.93	0.95920	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.045914	0.85682	D	0.000000	D	0.92215	0.7531	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.91914	0.5542	10	0.72032	D	0.01	.	20.3368	0.98748	0.0:1.0:0.0:0.0	.	1133;1126	Q16363;Q16363-2	LAMA4_HUMAN;.	H	1133;1126;1126;1126	ENSP00000230538:D1133H;ENSP00000429488:D1126H;ENSP00000374114:D1126H;ENSP00000416470:D1126H	ENSP00000230538:D1133H	D	-	1	0	LAMA4	112564035	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.047000	0.76599	2.805000	0.96524	0.655000	0.94253	GAT		0.368	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206		6	26	0	0	0	0.001984	0	6	26				
GPRC6A	222545	broad.mit.edu	37	6	117121757	117121757	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:117121757C>T	ENST00000310357.3	-	4	1559	c.1538G>A	c.(1537-1539)aGg>aAg	p.R513K	GPRC6A_ENST00000530250.1_Missense_Mutation_p.R338K|GPRC6A_ENST00000368549.3_Intron	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	513					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		CTTAAGATTCCTGAACTCATT	0.418																																							uc003pxj.1		NA																	0				ovary(4)|skin(2)	6						c.(1537-1539)AGG>AAG		G protein-coupled receptor, family C, group 6,							168.0	146.0	153.0					6																	117121757		2203	4300	6503	SO:0001583	missense	222545				response to amino acid stimulus		G-protein coupled receptor activity	g.chr6:117121757C>T	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.1538G>A	6.37:g.117121757C>T	ENSP00000309493:p.Arg513Lys					GPRC6A_uc003pxk.1_Missense_Mutation_p.R338K|GPRC6A_uc003pxl.1_Intron	p.R513K	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)	4	1560	-		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)	513			Extracellular (Potential).		Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	37	c.1538G>A	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	C	5.424	0.263449	0.10294	.	.	ENSG00000173612	ENST00000310357;ENST00000530250	D;D	0.90197	-2.43;-2.63	5.35	1.22	0.21188	.	0.679913	0.13501	N	0.383236	T	0.51568	0.1682	N	0.08118	0	0.23468	N	0.997616	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.51919	-0.8644	10	0.05959	T	0.93	.	4.0906	0.09968	0.2425:0.3825:0.0:0.375	.	338;513	Q5T6X5-2;Q5T6X5	.;GPC6A_HUMAN	K	513;338	ENSP00000309493:R513K;ENSP00000433465:R338K	ENSP00000309493:R513K	R	-	2	0	GPRC6A	117228450	0.044000	0.20184	0.991000	0.47740	0.233000	0.25261	-0.093000	0.11111	0.023000	0.15187	-0.966000	0.02617	AGG		0.418	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2			14	45	0	0	0	0.00245	0	14	45				
VNN2	8875	broad.mit.edu	37	6	133072284	133072284	+	Splice_Site	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:133072284C>A	ENST00000326499.6	-	5	1324	c.1200G>T	c.(1198-1200)caG>caT	p.Q400H	RP1-55C23.7_ENST00000430895.1_RNA|VNN2_ENST00000525270.1_Splice_Site_p.Q347H|VNN2_ENST00000526192.1_5'Flank|VNN2_ENST00000525289.1_Intron	NM_004665.2	NP_004656	O95498	VNN2_HUMAN	vanin 2	400					cellular component movement (GO:0006928)|pantothenate metabolic process (GO:0015939)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		CTGAAATTACCTGCCAGTACT	0.373																																							uc003qdt.2		NA																	0					0						c.(1198-1200)CAG>CAT		vanin 2 isoform 1 precursor							116.0	117.0	117.0					6																	133072284		2203	4300	6503	SO:0001630	splice_region_variant	8875				cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity	g.chr6:133072284C>A	AB026705	CCDS5161.1, CCDS5162.1, CCDS56451.1	6q23-q24	2013-02-13			ENSG00000112303	ENSG00000112303	3.5.1.92	"""Vanins"""	12706	protein-coding gene	gene with protein product	"""pantetheinase"""	603571				9790769, 11491533	Standard	NM_078488		Approved	FOAP-4, GPI-80	uc003qdt.3	O95498	OTTHUMG00000015588	ENST00000326499.6:c.1200+1G>T	6.37:g.133072284C>A						VNN2_uc003qds.2_Missense_Mutation_p.Q109H|VNN2_uc010kgb.2_Intron|VNN2_uc003qdv.2_Missense_Mutation_p.Q347H	p.Q400H	NM_004665	NP_004656	O95498	VNN2_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)	5	1211	-			400					A0AUZ3|A6NDY1|A8K4E3|A8K7W0|B2DFZ0|B2DFZ1|B2DFZ2|B2DFZ3|F6XL73|Q2XUN1|Q9UJF3|Q9UMW2	Missense_Mutation	SNP	ENST00000326499.6	37	c.1200G>T	CCDS5161.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.973513	0.74246	.	.	ENSG00000112303	ENST00000326499;ENST00000525270	D;D	0.89123	-2.47;-2.47	5.68	4.8	0.61643	.	0.089636	0.48286	D	0.000196	D	0.94857	0.8338	M	0.93720	3.45	0.80722	D	1	D	0.76494	0.999	D	0.67900	0.954	D	0.96169	0.9121	9	.	.	.	-5.4164	15.2763	0.73745	0.1413:0.8587:0.0:0.0	.	400	O95498	VNN2_HUMAN	H	400;347	ENSP00000322276:Q400H;ENSP00000436822:Q347H	.	Q	-	3	2	VNN2	133113977	1.000000	0.71417	0.997000	0.53966	0.964000	0.63967	4.856000	0.62932	1.487000	0.48415	0.650000	0.86243	CAG		0.373	VNN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042264.2		Missense_Mutation	14	74	1	0	1.49906e-05	0.00245	1.77162e-05	14	74				
KIAA1244	57221	broad.mit.edu	37	6	138628520	138628520	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:138628520G>T	ENST00000251691.4	+	23	4125	c.3959G>T	c.(3958-3960)gGt>gTt	p.G1320V		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		TACCTGGTTGGTGACTACTCC	0.433																																							uc003qhu.2		NA																	0				ovary(1)|skin(1)	2						c.(3958-3960)GGT>GTT		brefeldin A-inhibited guanine							180.0	179.0	179.0					6																	138628520		2203	4300	6503	SO:0001583	missense	57221				regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity	g.chr6:138628520G>T	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.3959G>T	6.37:g.138628520G>T	ENSP00000251691:p.Gly1320Val						p.G1320V	NM_020340	NP_065073	Q5TH69	BIG3_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)	23	3959	+	Breast(32;0.135)		1320						Missense_Mutation	SNP	ENST00000251691.4	37	c.3959G>T	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	G	27.9	4.876901	0.91664	.	.	ENSG00000112379	ENST00000251691	T	0.18338	2.22	6.11	6.11	0.99139	.	7739.210000	0.00166	N	0.000000	T	0.35998	0.0951	L	0.44542	1.39	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.23013	-1.0200	10	0.72032	D	0.01	-23.8667	20.7342	0.99715	0.0:0.0:1.0:0.0	.	1320	Q5TH69	BIG3_HUMAN	V	1320	ENSP00000251691:G1320V	ENSP00000251691:G1320V	G	+	2	0	KIAA1244	138670213	1.000000	0.71417	0.983000	0.44433	0.986000	0.74619	9.511000	0.98006	2.906000	0.99361	0.655000	0.94253	GGT		0.433	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340		13	93	1	0	4.36969e-10	0.001855	6.41358e-10	13	93				
FUCA2	2519	broad.mit.edu	37	6	143823540	143823540	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:143823540C>G	ENST00000002165.6	-	4	970	c.915G>C	c.(913-915)agG>agC	p.R305S	FUCA2_ENST00000438118.2_Intron|RP1-20N2.6_ENST00000590703.1_RNA|RP1-20N2.6_ENST00000593175.1_RNA|RP1-20N2.6_ENST00000591892.1_RNA|RP1-20N2.6_ENST00000589489.1_RNA|RP1-20N2.6_ENST00000589563.1_RNA|RP1-20N2.6_ENST00000610068.1_RNA|RP1-20N2.6_ENST00000415586.1_RNA|RP1-20N2.6_ENST00000591189.1_RNA|FUCA2_ENST00000367585.1_Intron|RP1-20N2.6_ENST00000593045.1_RNA	NM_032020.4	NP_114409.2	Q9BTY2	FUCO2_HUMAN	fucosidase, alpha-L- 2, plasma	305					fucose metabolic process (GO:0006004)|glycoside catabolic process (GO:0016139)|regulation of entry of bacterium into host cell (GO:2000535)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)		CAGCTTCCCTCCTATAGCCCC	0.408																																							uc003qjm.2		NA																	0				ovary(1)	1						c.(913-915)AGG>AGC		fucosidase, alpha-L- 2, plasma precursor							188.0	175.0	180.0					6																	143823540		2203	4300	6503	SO:0001583	missense	2519				fucose metabolic process	extracellular region	alpha-L-fucosidase activity|cation binding	g.chr6:143823540C>G	BC003060	CCDS5200.1	6q24	2012-10-02			ENSG00000001036	ENSG00000001036	3.2.1.51		4008	protein-coding gene	gene with protein product		136820				6590153	Standard	NM_032020		Approved	MGC1314, dJ20N2.5	uc003qjm.3	Q9BTY2	OTTHUMG00000015728	ENST00000002165.6:c.915G>C	6.37:g.143823540C>G	ENSP00000002165:p.Arg305Ser					FUCA2_uc003qjn.2_Missense_Mutation_p.R59S	p.R305S	NM_032020	NP_114409	Q9BTY2	FUCO2_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)	4	1007	-			305					E9PEB6|Q7Z6V1|Q7Z6Y2|Q8NBK4	Missense_Mutation	SNP	ENST00000002165.6	37	c.915G>C	CCDS5200.1	.	.	.	.	.	.	.	.	.	.	C	18.41	3.618560	0.66787	.	.	ENSG00000001036	ENST00000002165	T	0.57595	0.39	5.8	3.03	0.35002	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.52092	0.1713	M	0.80028	2.48	0.80722	D	1	D	0.60575	0.988	P	0.61722	0.893	T	0.54437	-0.8294	10	0.36615	T	0.2	-28.9919	4.2267	0.10584	0.1097:0.5913:0.1068:0.1921	.	305	Q9BTY2	FUCO2_HUMAN	S	305	ENSP00000002165:R305S	ENSP00000002165:R305S	R	-	3	2	FUCA2	143865233	0.851000	0.29673	0.652000	0.29579	0.904000	0.53231	-0.003000	0.12901	0.783000	0.33636	0.655000	0.94253	AGG		0.408	FUCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042521.2	NM_032020		8	190	0	0	0	0.006214	0	8	190				
STXBP5	134957	broad.mit.edu	37	6	147704039	147704039	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:147704039G>T	ENST00000321680.6	+	27	3319	c.3319G>T	c.(3319-3321)Gca>Tca	p.A1107S	STXBP5_ENST00000367481.3_Missense_Mutation_p.A1071S|STXBP5_ENST00000179882.6_Missense_Mutation_p.A762S|STXBP5_ENST00000367480.3_Missense_Mutation_p.A1054S	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	1107	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		AGCCAGGCTGGCACTAGATGA	0.498																																							uc003qlz.2		NA																	0					0						c.(3319-3321)GCA>TCA		syntaxin binding protein 5 (tomosyn) isoform b							123.0	119.0	121.0					6																	147704039		2203	4300	6503	SO:0001583	missense	134957				exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding	g.chr6:147704039G>T	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.3319G>T	6.37:g.147704039G>T	ENSP00000321826:p.Ala1107Ser					STXBP5_uc010khz.1_Missense_Mutation_p.A1071S|STXBP5_uc003qlx.2_RNA|STXBP5_uc003qly.2_Missense_Mutation_p.A762S	p.A1107S	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)	27	3480	+		Ovarian(120;0.0164)	1107			v-SNARE coiled-coil homology.		Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Missense_Mutation	SNP	ENST00000321680.6	37	c.3319G>T	CCDS47499.1	.	.	.	.	.	.	.	.	.	.	G	31	5.076104	0.94000	.	.	ENSG00000164506	ENST00000367481;ENST00000321680;ENST00000367480;ENST00000179882	T;T;T;T	0.15017	2.51;2.46;2.63;3.1	5.41	5.41	0.78517	Synaptobrevin (1);	0.000000	0.85682	D	0.000000	T	0.39410	0.1077	M	0.81497	2.545	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.80764	0.994;0.989;0.989	T	0.19418	-1.0306	10	0.51188	T	0.08	.	19.554	0.95333	0.0:0.0:1.0:0.0	.	1071;1107;762	Q5T5C0-2;Q5T5C0;B3KXX0	.;STXB5_HUMAN;.	S	1071;1107;1054;762	ENSP00000356451:A1071S;ENSP00000321826:A1107S;ENSP00000356450:A1054S;ENSP00000179882:A762S	ENSP00000179882:A762S	A	+	1	0	STXBP5	147745732	1.000000	0.71417	0.990000	0.47175	0.991000	0.79684	9.810000	0.99221	2.702000	0.92279	0.585000	0.79938	GCA		0.498	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1			18	123	1	0	9.16793e-09	0.00499	1.29777e-08	18	123				
UST	10090	broad.mit.edu	37	6	149340286	149340286	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:149340286G>T	ENST00000367463.4	+	6	796	c.693G>T	c.(691-693)gaG>gaT	p.E231D		NM_005715.2	NP_005706.1	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase	231					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(2)	12		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		ATATCAATGAGTGTATTCTTG	0.408																																							uc003qmg.2		NA																	0				ovary(2)	2						c.(691-693)GAG>GAT		uronyl-2-sulfotransferase							168.0	158.0	161.0					6																	149340286		2203	4300	6503	SO:0001583	missense	10090				protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity	g.chr6:149340286G>T	AB020316	CCDS5213.1	6q25.1	2008-02-05			ENSG00000111962	ENSG00000111962		"""Sulfotransferases, membrane-bound"""	17223	protein-coding gene	gene with protein product		610752				10187838	Standard	NM_005715		Approved	2OST	uc003qmg.3	Q9Y2C2	OTTHUMG00000016135	ENST00000367463.4:c.693G>T	6.37:g.149340286G>T	ENSP00000356433:p.Glu231Asp						p.E231D	NM_005715	NP_005706	Q9Y2C2	UST_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)	6	989	+		Ovarian(120;0.0907)	231			Lumenal (Potential).		B2RCX6	Missense_Mutation	SNP	ENST00000367463.4	37	c.693G>T	CCDS5213.1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.174408	0.38413	.	.	ENSG00000111962	ENST00000367463	T	0.47869	0.83	5.95	5.09	0.68999	.	0.111365	0.64402	D	0.000010	T	0.16769	0.0403	N	0.25144	0.715	0.41460	D	0.988035	B	0.16603	0.018	B	0.22753	0.041	T	0.08106	-1.0738	10	0.17369	T	0.5	-19.2367	11.6869	0.51492	0.1849:0.0:0.8151:0.0	.	231	Q9Y2C2	UST_HUMAN	D	231	ENSP00000356433:E231D	ENSP00000356433:E231D	E	+	3	2	UST	149381979	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.090000	0.50191	1.526000	0.49068	0.655000	0.94253	GAG		0.408	UST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043363.1	NM_005715		10	72	1	0	2.17888e-05	0.006214	2.55607e-05	10	72				
SYNE1	23345	broad.mit.edu	37	6	152737815	152737815	+	Silent	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:152737815T>C	ENST00000367255.5	-	41	6358	c.5757A>G	c.(5755-5757)ttA>ttG	p.L1919L	SYNE1_ENST00000341594.5_Silent_p.L1956L|SYNE1_ENST00000265368.4_Silent_p.L1919L|SYNE1_ENST00000448038.1_Silent_p.L1926L|SYNE1_ENST00000423061.1_Silent_p.L1926L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1919					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CAGCAGATTCTAATGCTTTAG	0.458										HNSCC(10;0.0054)																													uc010kiw.2		NA																	0				central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45						c.(5755-5757)TTA>TTG		spectrin repeat containing, nuclear envelope 1							105.0	102.0	103.0					6																	152737815		2203	4300	6503	SO:0001819	synonymous_variant	23345				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding	g.chr6:152737815T>C	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.5757A>G	6.37:g.152737815T>C		HNSCC(10;0.0054)				SYNE1_uc003qot.3_Silent_p.L1926L|SYNE1_uc003qou.3_Silent_p.L1919L|SYNE1_uc010kjb.1_Silent_p.L1902L	p.L1919L	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	41	6359	-		Ovarian(120;0.0955)	1919			Cytoplasmic (Potential).|Potential.		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	c.5757A>G	CCDS5236.2																																																																																				0.458	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961		13	76	0	0	0	0.013537	0	13	76				
MYCT1	80177	broad.mit.edu	37	6	153043182	153043182	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:153043182C>A	ENST00000367245.5	+	2	510	c.502C>A	c.(502-504)Cat>Aat	p.H168N	MYCT1_ENST00000529453.1_Intron	NM_025107.2	NP_079383.2	Q8N699	MYCT1_HUMAN	myc target 1	168						nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	20		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		TTCTACTTTCCATCCCTTTCT	0.493																																							uc003qpd.3		NA																	0				ovary(1)	1						c.(502-504)CAT>AAT		myc target 1							86.0	86.0	86.0					6																	153043182		2203	4300	6503	SO:0001583	missense	80177					nucleus		g.chr6:153043182C>A	AF527367	CCDS5239.1	6q25.1	2008-02-05			ENSG00000120279	ENSG00000120279			23172	protein-coding gene	gene with protein product						12477932	Standard	NM_025107		Approved	MTLC, FLJ21269	uc003qpc.4	Q8N699	OTTHUMG00000015850	ENST00000367245.5:c.502C>A	6.37:g.153043182C>A	ENSP00000356214:p.His168Asn					MYCT1_uc010kjc.1_Missense_Mutation_p.H120N|MYCT1_uc003qpc.3_Missense_Mutation_p.H168N	p.H168N	NM_025107	NP_079383	Q8N699	MYCT1_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)	2	510	+		Ovarian(120;0.0654)	168					Q8N396|Q8TBE8|Q9H763	Missense_Mutation	SNP	ENST00000367245.5	37	c.502C>A	CCDS5239.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.673498	0.88445	.	.	ENSG00000120279	ENST00000367245	T	0.34072	1.38	5.78	5.78	0.91487	.	0.047245	0.85682	D	0.000000	T	0.56381	0.1981	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.56786	-0.7921	10	0.62326	D	0.03	-23.5618	20.0096	0.97446	0.0:1.0:0.0:0.0	.	120;168	D6Q1S4;Q8N699	.;MYCT1_HUMAN	N	168	ENSP00000356214:H168N	ENSP00000356214:H168N	H	+	1	0	MYCT1	153084875	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.412000	0.73303	2.727000	0.93392	0.579000	0.79373	CAT		0.493	MYCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042750.2	NM_025107		15	82	1	0	2.61681e-11	0.00245	4.01665e-11	15	82				
ARID1B	57492	broad.mit.edu	37	6	157527447	157527447	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:157527447G>T	ENST00000350026.5	+	19	5134	c.5133G>T	c.(5131-5133)ttG>ttT	p.L1711F	ARID1B_ENST00000346085.5_Missense_Mutation_p.L1724F|ARID1B_ENST00000275248.4_Missense_Mutation_p.L1706F|ARID1B_ENST00000367148.1_Missense_Mutation_p.L1764F	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1711					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GCCAGTCCTTGGCAGACGATT	0.478																																							uc003qqn.2		NA																	0				ovary(1)|breast(1)	2						c.(5116-5118)TTG>TTT		AT rich interactive domain 1B (SWI1-like)							162.0	177.0	172.0					6																	157527447		2203	4296	6499	SO:0001583	missense	57492				chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity	g.chr6:157527447G>T	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.5133G>T	6.37:g.157527447G>T	ENSP00000055163:p.Leu1711Phe					ARID1B_uc003qqo.2_Missense_Mutation_p.L1666F|ARID1B_uc003qqp.2_Missense_Mutation_p.L1653F	p.L1706F	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)	20	5270	+		Breast(66;0.000162)|Ovarian(120;0.0265)	1711					Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	37	c.5118G>T	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	G	1.455	-0.563998	0.03939	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000414678	T;T;T;T;T	0.02177	4.73;4.73;4.73;4.73;4.41	5.16	-0.107	0.13592	Armadillo-like helical (1);	2.106410	0.01656	N	0.024831	T	0.00524	0.0017	L	0.40543	1.245	0.09310	N	1	B;B;B	0.30973	0.201;0.302;0.178	B;B;B	0.26969	0.034;0.075;0.075	T	0.47086	-0.9144	10	0.09338	T	0.73	.	0.8675	0.01206	0.2312:0.1288:0.3756:0.2643	.	1711;1724;1706	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	F	1724;1711;1764;1706;1233	ENSP00000344546:L1724F;ENSP00000055163:L1711F;ENSP00000356116:L1764F;ENSP00000275248:L1706F;ENSP00000412835:L1233F	ENSP00000275248:L1706F	L	+	3	2	ARID1B	157569139	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	0.073000	0.14640	-0.361000	0.08125	0.467000	0.42956	TTG		0.478	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732		42	273	1	0	2.13384e-23	0.01441	3.95132e-23	42	273				
ARID1B	57492	broad.mit.edu	37	6	157528318	157528318	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:157528318G>T	ENST00000350026.5	+	19	6005	c.6004G>T	c.(6004-6006)Gac>Tac	p.D2002Y	ARID1B_ENST00000346085.5_Missense_Mutation_p.D2015Y|ARID1B_ENST00000275248.4_Missense_Mutation_p.D1997Y|ARID1B_ENST00000367148.1_Missense_Mutation_p.D2055Y	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	2002					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GTGGTGGTGGGACTGCCTCGA	0.547																																							uc003qqn.2		NA																	0				ovary(1)|breast(1)	2						c.(5989-5991)GAC>TAC		AT rich interactive domain 1B (SWI1-like)							111.0	110.0	110.0					6																	157528318		2203	4296	6499	SO:0001583	missense	57492				chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity	g.chr6:157528318G>T	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.6004G>T	6.37:g.157528318G>T	ENSP00000055163:p.Asp2002Tyr					ARID1B_uc003qqo.2_Missense_Mutation_p.D1957Y|ARID1B_uc003qqp.2_Missense_Mutation_p.D1944Y	p.D1997Y	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)	20	6141	+		Breast(66;0.000162)|Ovarian(120;0.0265)	2002					Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	37	c.5989G>T	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	G	17.27	3.346505	0.61073	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000414678	T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25	5.28	5.28	0.74379	.	0.093260	0.64402	D	0.000001	T	0.57651	0.2068	M	0.77103	2.36	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.988;0.988	T	0.62483	-0.6845	10	0.87932	D	0	.	19.2766	0.94034	0.0:0.0:1.0:0.0	.	2002;2015;1997	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	Y	2015;2002;2055;1997;1524	ENSP00000344546:D2015Y;ENSP00000055163:D2002Y;ENSP00000356116:D2055Y;ENSP00000275248:D1997Y;ENSP00000412835:D1524Y	ENSP00000275248:D1997Y	D	+	1	0	ARID1B	157570010	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.618000	0.88619	0.563000	0.77884	GAC		0.547	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732		19	126	1	0	1.01871e-10	0.008871	1.53409e-10	19	126				
IGF2R	3482	broad.mit.edu	37	6	160468236	160468236	+	Silent	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:160468236A>G	ENST00000356956.1	+	16	2245	c.2097A>G	c.(2095-2097)tcA>tcG	p.S699S		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	699					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	CGAAGCTTTCATATTATGATG	0.458																																							uc003qta.2		NA																	0				ovary(3)	3						c.(2095-2097)TCA>TCG		insulin-like growth factor 2 receptor precursor							152.0	143.0	146.0					6																	160468236		2203	4300	6503	SO:0001819	synonymous_variant	3482				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity	g.chr6:160468236A>G	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.2097A>G	6.37:g.160468236A>G							p.S699S	NM_000876	NP_000867	P11717	MPRI_HUMAN		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	16	2245	+		Breast(66;0.000777)|Ovarian(120;0.0305)	699			5.|Lumenal (Potential).		Q7Z7G9|Q96PT5	Silent	SNP	ENST00000356956.1	37	c.2097A>G	CCDS5273.1																																																																																				0.458	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876		11	58	0	0	0	0.008291	0	11	58				
C6orf118	168090	broad.mit.edu	37	6	165715274	165715274	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:165715274C>A	ENST00000230301.8	-	2	557	c.537G>T	c.(535-537)ctG>ctT	p.L179L	C6orf118_ENST00000543069.1_Silent_p.L75L	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	179										breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		TCAAGTCGGGCAGCCGGAGTT	0.647																																							uc003qum.3		NA																	0					0						c.(535-537)CTG>CTT		hypothetical protein LOC168090							37.0	41.0	40.0					6																	165715274		2203	4300	6503	SO:0001819	synonymous_variant	168090							g.chr6:165715274C>A		CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.537G>T	6.37:g.165715274C>A						C6orf118_uc011egi.1_RNA	p.L179L	NM_144980	NP_659417	Q5T5N4	CF118_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)	2	573	-		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)	179					Q8TC11	Silent	SNP	ENST00000230301.8	37	c.537G>T	CCDS5288.1																																																																																				0.647	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043026.1	NM_144980		22	69	1	0	1.96292e-10	0.010504	2.92145e-10	22	69				
TCP10L2	401285	broad.mit.edu	37	6	167595301	167595301	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:167595301G>A	ENST00000366832.2	+	8	1090	c.959G>A	c.(958-960)cGa>cAa	p.R320Q		NM_001145121.1	NP_001138593.1	B9ZVM9	TCP2L_HUMAN	t-complex 10-like 2	320										endometrium(1)|kidney(2)|lung(3)	6						GAAGAAAAACGACATCCAAAT	0.527																																							uc010kkp.2		NA																	0					0						c.(958-960)CGA>CAA		t-complex 10-like 2							155.0	121.0	131.0					6																	167595301		692	1591	2283	SO:0001583	missense	401285							g.chr6:167595301G>A		CCDS47514.1	6q27	2012-09-20	2012-09-20		ENSG00000166984	ENSG00000166984			21254	protein-coding gene	gene with protein product			"""t-complex 10-like 2 (mouse)"""				Standard	NM_001145121		Approved	bA517H2.3	uc010kkp.3	B9ZVM9	OTTHUMG00000016014	ENST00000366832.2:c.959G>A	6.37:g.167595301G>A	ENSP00000355797:p.Arg320Gln						p.R320Q	NM_001145121	NP_001138593	B9ZVM9	B9ZVM9_HUMAN			8	1090	+			320						Missense_Mutation	SNP	ENST00000366832.2	37	c.959G>A	CCDS47514.1	.	.	.	.	.	.	.	.	.	.	g	2.522	-0.310539	0.05458	.	.	ENSG00000166984	ENST00000366832	T	0.25912	1.77	1.64	-3.28	0.05033	.	.	.	.	.	T	0.02767	0.0083	N	0.14661	0.345	0.09310	N	1	B	0.18968	0.032	B	0.06405	0.002	T	0.42464	-0.9450	9	0.16896	T	0.51	.	4.2702	0.10783	0.2994:0.2112:0.4893:0.0	.	320	B9ZVM9	TCP2L_HUMAN	Q	320	ENSP00000355797:R320Q	ENSP00000355797:R320Q	R	+	2	0	TCP10L2	167515291	0.000000	0.05858	0.000000	0.03702	0.181000	0.23173	-1.256000	0.02869	-1.382000	0.02109	0.162000	0.16502	CGA		0.527	TCP10L2-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043112.5	XR_040749		5	42	0	0	0	0.000602	0	5	42				
FRMD1	79981	broad.mit.edu	37	6	168479740	168479740	+	Missense_Mutation	SNP	G	G	T	rs147876520		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:168479740G>T	ENST00000283309.6	-	1	99	c.35C>A	c.(34-36)cCc>cAc	p.P12H		NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	12						cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		TGTCCGGGCGGGGTCTATGCC	0.662																																					GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)	GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)	uc003qwo.3		NA																	0				ovary(1)	1						c.(34-36)CCC>CAC		FERM domain containing 1 isoform 1							52.0	49.0	50.0					6																	168479740		2203	4300	6503	SO:0001583	missense	79981					cytoskeleton	binding	g.chr6:168479740G>T		CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.35C>A	6.37:g.168479740G>T	ENSP00000283309:p.Pro12His						p.P12H	NM_024919	NP_079195	Q8N878	FRMD1_HUMAN		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)	1	100	-		Breast(66;1.07e-05)|Ovarian(120;0.0728)	12					B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Missense_Mutation	SNP	ENST00000283309.6	37	c.35C>A	CCDS5306.1	.	.	.	.	.	.	.	.	.	.	G	8.128	0.782496	0.16189	.	.	ENSG00000153303	ENST00000283309	D	0.84070	-1.8	2.18	1.26	0.21427	.	.	.	.	.	T	0.51719	0.1691	N	0.08118	0	0.09310	N	0.999998	D	0.67145	0.996	P	0.46172	0.506	T	0.49670	-0.8915	9	0.56958	D	0.05	.	6.5827	0.22605	0.1714:0.0:0.8286:0.0	.	12	Q8N878	FRMD1_HUMAN	H	12	ENSP00000283309:P12H	ENSP00000283309:P12H	P	-	2	0	FRMD1	168222589	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.107000	0.03316	0.205000	0.20568	0.313000	0.20887	CCC		0.662	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362513.2	NM_024919		13	49	1	0	2.27111e-07	0.013537	2.99523e-07	13	49				
SUN1	23353	broad.mit.edu	37	7	909028	909028	+	Nonsense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:909028C>T	ENST00000405266.1	+	18	2158	c.2134C>T	c.(2134-2136)Cag>Tag	p.Q712*	SUN1_ENST00000456758.2_Nonsense_Mutation_p.Q864*|SUN1_ENST00000389574.3_Nonsense_Mutation_p.Q592*|SUN1_ENST00000452783.2_Nonsense_Mutation_p.Q572*|SUN1_ENST00000401592.1_Nonsense_Mutation_p.Q675*|SUN1_ENST00000413514.2_Nonsense_Mutation_p.Q473*|SUN1_ENST00000425407.2_Nonsense_Mutation_p.Q592*			O94901	SUN1_HUMAN	Sad1 and UNC84 domain containing 1	702	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				cytoskeletal anchoring at nuclear membrane (GO:0090286)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)	acrosomal membrane (GO:0002080)|integral component of nuclear inner membrane (GO:0005639)|nuclear envelope (GO:0005635)|SUN-KASH complex (GO:0034993)				NS(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TAAAGGCTCCCAGGGGTACCT	0.547																																							uc011jvp.1		NA																	0					0						c.(2023-2025)CAG>TAG		unc-84 homolog A isoform a							130.0	133.0	132.0					7																	909028		1956	4150	6106	SO:0001587	stop_gained	23353				cytoskeletal anchoring at nuclear membrane|nuclear matrix anchoring at nuclear membrane	integral to membrane|nuclear inner membrane|SUN-KASH complex	protein binding	g.chr7:909028C>T	AF202724	CCDS43533.1, CCDS47525.1, CCDS55078.1, CCDS55079.1, CCDS55080.1	7p22.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164828	ENSG00000164828			18587	protein-coding gene	gene with protein product	"""Sad1 unc-84 domain protein 1"""	607723	"""unc-84 homolog A (C. elegans)"""	UNC84A		11593002	Standard	NM_001130965		Approved	KIAA0810, FLJ12407	uc021zym.1	O94901	OTTHUMG00000151426	ENST00000405266.1:c.2134C>T	7.37:g.909028C>T	ENSP00000384116:p.Gln712*					GET4_uc003sjj.1_Intron|SUN1_uc003sjf.2_Nonsense_Mutation_p.Q592*|SUN1_uc011jvq.1_Nonsense_Mutation_p.Q572*|SUN1_uc003sjg.2_Nonsense_Mutation_p.Q580*|SUN1_uc011jvr.1_Nonsense_Mutation_p.Q473*|SUN1_uc003sji.2_Nonsense_Mutation_p.Q513*|SUN1_uc003sjk.2_Nonsense_Mutation_p.Q314*	p.Q675*	NM_001130965	NP_001124437	O94901	SUN1_HUMAN			18	2102	+			702			Perinuclear space.|SUN.		A5PL20|B3KMV7|B4DZF7|B7WNY4|B7WP53|E9PDU4|E9PF23|F8WD13|Q96CZ7|Q9HA14|Q9UH98	Nonsense_Mutation	SNP	ENST00000405266.1	37	c.2023C>T		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	40|40	8.036984|8.036984	0.98621|0.98621	.|.	.|.	ENSG00000164828|ENSG00000164828	ENST00000433212|ENST00000456758;ENST00000389574;ENST00000452783;ENST00000405266;ENST00000401592;ENST00000297445;ENST00000425407;ENST00000429178;ENST00000413514	.|.	.|.	.|.	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	.|0.107273	.|0.64402	.|D	.|0.000006	T|.	0.76234|.	0.3959|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.80204|.	-0.1479|.	3|.	.|0.66056	.|D	.|0.02	-32.3181|-32.3181	16.503|16.503	0.84262|0.84262	0.0:0.8693:0.1307:0.0|0.0:0.8693:0.1307:0.0	.|.	.|.	.|.	.|.	L|X	523|864;592;572;712;675;702;592;600;473	.|.	.|ENSP00000297445:Q702X	P|Q	+|+	2|1	0|0	SUN1|SUN1	875554|875554	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	5.844000|5.844000	0.69430|0.69430	2.590000|2.590000	0.87494|0.87494	0.655000|0.655000	0.94253|0.94253	CCA|CAG		0.547	SUN1-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000322566.1	NM_025154		33	155	0	0	0	0.013726	0	33	155				
DGKB	1607	broad.mit.edu	37	7	14724966	14724966	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:14724966G>T	ENST00000403951.2	-	10	1152	c.733C>A	c.(733-735)Cac>Aac	p.H245N	DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000258767.5_Missense_Mutation_p.H245N|DGKB_ENST00000402815.1_Missense_Mutation_p.H245N|DGKB_ENST00000407950.1_Missense_Mutation_p.H238N|DGKB_ENST00000399322.3_Missense_Mutation_p.H245N|DGKB_ENST00000406247.3_Missense_Mutation_p.H245N|DGKB_ENST00000444700.2_Missense_Mutation_p.H238N			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	245					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						CGCCACACGTGCTGTCCATCA	0.463																																							uc003ssz.2		NA																	0				lung(5)|ovary(4)|breast(2)|skin(1)	12						c.(733-735)CAC>AAC		diacylglycerol kinase, beta isoform 1	Phosphatidylserine(DB00144)						98.0	98.0	98.0					7																	14724966		2197	4295	6492	SO:0001583	missense	1607				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding	g.chr7:14724966G>T	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.733C>A	7.37:g.14724966G>T	ENSP00000385780:p.His245Asn					DGKB_uc011jxt.1_Missense_Mutation_p.H238N|DGKB_uc003sta.2_Missense_Mutation_p.H245N|DGKB_uc011jxu.1_Missense_Mutation_p.H245N|DGKB_uc011jxv.1_Missense_Mutation_p.H245N	p.H245N	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN			9	920	-			245			Phorbol-ester/DAG-type 1.		A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	ENST00000403951.2	37	c.733C>A	CCDS47547.1	.	.	.	.	.	.	.	.	.	.	G	33	5.205347	0.95033	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	D;D;D;D;D;D;D	0.99716	-6.51;-6.51;-6.51;-6.51;-6.51;-6.51;-6.51	6.16	6.16	0.99307	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.000000	0.85682	D	0.000000	D	0.99887	0.9946	H	0.99211	4.47	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	D	0.96595	0.9440	10	0.72032	D	0.01	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	245;238;245;245	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	N	245;245;245;245;238;238;245	ENSP00000385780:H245N;ENSP00000382260:H245N;ENSP00000258767:H245N;ENSP00000384909:H245N;ENSP00000385031:H238N;ENSP00000388451:H238N;ENSP00000386066:H245N	ENSP00000258767:H245N	H	-	1	0	DGKB	14691491	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	CAC		0.463	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080		11	63	1	0	2.80697e-09	0.010729	4.01807e-09	11	63				
HOXA13	3209	broad.mit.edu	37	7	27238029	27238029	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:27238029A>T	ENST00000222753.4	-	2	983	c.955T>A	c.(955-957)Tat>Aat	p.Y319N	HOTTIP_ENST00000605136.1_RNA|HOXA13_ENST00000518136.3_5'Flank|HOTTIP_ENST00000521028.2_RNA|HOTTIP_ENST00000472494.1_RNA|HOTTIP_ENST00000421733.1_RNA	NM_000522.4	NP_000513.2	P31271	HXA13_HUMAN	homeobox A13	319					artery morphogenesis (GO:0048844)|branching involved in prostate gland morphogenesis (GO:0060442)|embryonic forelimb morphogenesis (GO:0035115)|endothelial cell fate specification (GO:0060847)|endothelial cell morphogenesis (GO:0001886)|inner ear development (GO:0048839)|male genitalia development (GO:0030539)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of BMP signaling pathway (GO:0030510)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|ventricular septum development (GO:0003281)	intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	6						CCCCTCCTATAGGAGCTGGCA	0.517			T	NUP98	AML						OREG0003748	type=REGULATORY REGION|Gene=HOXA13|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																											uc003szb.1		NA		Dom	yes		7	7p15-p14.2	3209	T	homeo box A13			L	NUP98		AML		0				breast(1)	1						c.(955-957)TAT>AAT		homeobox A13							90.0	92.0	92.0					7																	27238029		2203	4300	6503	SO:0001583	missense	3209				skeletal system development	nucleus	sequence-specific DNA binding	g.chr7:27238029A>T		CCDS5412.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106031	ENSG00000106031		"""Homeoboxes / ANTP class : HOXL subclass"""	5102	protein-coding gene	gene with protein product		142959	"""homeo box A13"""	HOX1J, HOX1		1973146, 1358459	Standard	NM_000522		Approved		uc003szb.1	P31271	OTTHUMG00000023438	ENST00000222753.4:c.955T>A	7.37:g.27238029A>T	ENSP00000222753:p.Tyr319Asn		OREG0003748	type=REGULATORY REGION|Gene=HOXA13|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	792	uc003szc.1_5'Flank	p.Y319N	NM_000522	NP_000513	P31271	HXA13_HUMAN			2	984	-			319					A4D188|O43371	Missense_Mutation	SNP	ENST00000222753.4	37	c.955T>A	CCDS5412.1	.	.	.	.	.	.	.	.	.	.	A	32	5.119950	0.94385	.	.	ENSG00000106031	ENST00000222753	T	0.54071	0.59	5.71	5.71	0.89125	Homeodomain-related (1);Homeodomain-like (1);	0.313684	0.31392	N	0.007721	T	0.70237	0.3201	M	0.74467	2.265	0.48571	D	0.999678	D	0.60575	0.988	P	0.61201	0.885	T	0.74520	-0.3638	10	0.87932	D	0	.	15.6505	0.77088	1.0:0.0:0.0:0.0	.	319	P31271	HXA13_HUMAN	N	319	ENSP00000222753:Y319N	ENSP00000222753:Y319N	Y	-	1	0	HOXA13	27204554	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	8.962000	0.93254	2.178000	0.69098	0.460000	0.39030	TAT		0.517	HOXA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358752.3			19	101	0	0	0	0.006122	0	19	101				
AMPH	273	broad.mit.edu	37	7	38433709	38433709	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:38433709C>T	ENST00000356264.2	-	18	1719	c.1504G>A	c.(1504-1506)Ggg>Agg	p.G502R	AMPH_ENST00000325590.5_Missense_Mutation_p.G460R|AMPH_ENST00000471913.1_5'UTR|AMPH_ENST00000428293.2_Missense_Mutation_p.G460R	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	502					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						ACTCCTTCCCCGGCAGGGACA	0.582																																							uc003tgu.2		NA																	0				ovary(3)|liver(1)|skin(1)	5						c.(1504-1506)GGG>AGG		amphiphysin isoform 1							141.0	126.0	131.0					7																	38433709		2203	4300	6503	SO:0001583	missense	273				endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane		g.chr7:38433709C>T		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1504G>A	7.37:g.38433709C>T	ENSP00000348602:p.Gly502Arg					AMPH_uc003tgv.2_Missense_Mutation_p.G460R|AMPH_uc003tgt.2_Missense_Mutation_p.G387R|AMPH_uc003tgw.1_Missense_Mutation_p.G525R|AMPH_uc010kxl.1_RNA	p.G502R	NM_001635	NP_001626	P49418	AMPH_HUMAN			18	1573	-			502					A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	ENST00000356264.2	37	c.1504G>A	CCDS5456.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.77|10.77	1.444009|1.444009	0.25987|0.25987	.|.	.|.	ENSG00000078053|ENSG00000078053	ENST00000325590;ENST00000356264;ENST00000428293;ENST00000353242|ENST00000441628	T;T;T|.	0.60040|.	0.23;0.26;0.22|.	5.66|5.66	4.78|4.78	0.61160|0.61160	.|.	0.857885|.	0.10403|.	N|.	0.678875|.	T|T	0.35038|0.35038	0.0918|0.0918	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	0.999999|0.999999	D;P;P;D|.	0.67145|.	0.996;0.925;0.939;0.994|.	P;B;B;P|.	0.57057|.	0.812;0.227;0.166;0.567|.	T|T	0.15665|0.15665	-1.0429|-1.0429	10|5	0.28530|.	T|.	0.3|.	-6.7893|-6.7893	9.545|9.545	0.39275|0.39275	0.0:0.907:0.0:0.093|0.0:0.907:0.0:0.093	.|.	548;460;502;390|.	Q8NFL6;P49418-2;P49418;Q8NFL4|.	.;.;AMPH_HUMAN;.|.	R|Q	460;502;460;404|384	ENSP00000317441:G460R;ENSP00000348602:G502R;ENSP00000390734:G460R|.	ENSP00000317441:G460R|.	G|R	-|-	1|2	0|0	AMPH|AMPH	38400234|38400234	0.004000|0.004000	0.15560|0.15560	0.016000|0.016000	0.15963|0.15963	0.137000|0.137000	0.21094|0.21094	1.998000|1.998000	0.40796|0.40796	2.665000|2.665000	0.90641|0.90641	0.563000|0.563000	0.77884|0.77884	GGG|CGG		0.582	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635		27	147	0	0	0	0.007291	0	27	147				
URGCP	55665	broad.mit.edu	37	7	43916860	43916860	+	Silent	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:43916860T>C	ENST00000453200.1	-	6	2695	c.2202A>G	c.(2200-2202)acA>acG	p.T734T	URGCP_ENST00000447717.3_Silent_p.T691T|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000443736.1_Silent_p.T691T|URGCP_ENST00000402306.3_Silent_p.T725T|URGCP_ENST00000223341.7_Silent_p.T691T|URGCP_ENST00000336086.6_Silent_p.T691T|URGCP-MRPS24_ENST00000603700.1_Intron			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	734	VLIG-type G.				cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCTCAGCCACTGTGATGAGCT	0.612																																							uc003tiw.2		NA																	0				ovary(2)|liver(1)|skin(1)	4						c.(2200-2202)ACA>ACG		up-regulated gene 4 isoform 3							41.0	43.0	43.0					7																	43916860		2075	4219	6294	SO:0001819	synonymous_variant	55665				cell cycle	centrosome|nucleus	GTP binding	g.chr7:43916860T>C		CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.2202A>G	7.37:g.43916860T>C						URGCP_uc003tiu.2_Silent_p.T691T|URGCP_uc003tiv.2_Silent_p.T659T|URGCP_uc003tix.2_Silent_p.T725T|URGCP_uc003tiy.2_Silent_p.T691T|URGCP_uc003tiz.2_Silent_p.T691T|URGCP_uc011kbj.1_Silent_p.T691T	p.T734T	NM_001077663	NP_001071131	Q8TCY9	URGCP_HUMAN			6	2259	-			734					E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Silent	SNP	ENST00000453200.1	37	c.2202A>G	CCDS47578.1																																																																																				0.612	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664		19	60	0	0	0	0.007413	0	19	60				
URGCP	55665	broad.mit.edu	37	7	43917673	43917673	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:43917673G>T	ENST00000453200.1	-	6	1882	c.1389C>A	c.(1387-1389)gaC>gaA	p.D463E	URGCP_ENST00000447717.3_Missense_Mutation_p.D420E|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000443736.1_Missense_Mutation_p.D420E|URGCP_ENST00000402306.3_Missense_Mutation_p.D454E|URGCP_ENST00000223341.7_Missense_Mutation_p.D420E|URGCP_ENST00000336086.6_Missense_Mutation_p.D420E|URGCP-MRPS24_ENST00000603700.1_Intron			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	463					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CACAGTCCTCGTCGACCTTTA	0.592																																							uc003tiw.2		NA																	0				ovary(2)|liver(1)|skin(1)	4						c.(1387-1389)GAC>GAA		up-regulated gene 4 isoform 3							125.0	132.0	130.0					7																	43917673		2044	4188	6232	SO:0001583	missense	55665				cell cycle	centrosome|nucleus	GTP binding	g.chr7:43917673G>T		CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1389C>A	7.37:g.43917673G>T	ENSP00000396918:p.Asp463Glu					URGCP_uc003tiu.2_Missense_Mutation_p.D420E|URGCP_uc003tiv.2_Missense_Mutation_p.D388E|URGCP_uc003tix.2_Missense_Mutation_p.D454E|URGCP_uc003tiy.2_Missense_Mutation_p.D420E|URGCP_uc003tiz.2_Missense_Mutation_p.D420E|URGCP_uc011kbj.1_Missense_Mutation_p.D420E	p.D463E	NM_001077663	NP_001071131	Q8TCY9	URGCP_HUMAN			6	1446	-			463					E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	ENST00000453200.1	37	c.1389C>A	CCDS47578.1	.	.	.	.	.	.	.	.	.	.	G	14.05	2.418307	0.42918	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.37915	1.25;1.25;1.18;1.25;1.17;1.25	5.79	-6.69	0.01772	.	0.049282	0.85682	D	0.000000	T	0.53465	0.1798	M	0.85630	2.765	0.21445	N	0.999681	D;D	0.56968	0.978;0.978	P;P	0.60117	0.869;0.869	T	0.60475	-0.7256	10	0.87932	D	0	-30.0415	15.7261	0.77761	0.681:0.0:0.319:0.0	.	454;463	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	E	420;420;454;420;463;420	ENSP00000223341:D420E;ENSP00000336872:D420E;ENSP00000384955:D454E;ENSP00000392136:D420E;ENSP00000396918:D463E;ENSP00000402803:D420E	ENSP00000223341:D420E	D	-	3	2	URGCP	43884198	0.014000	0.17966	0.242000	0.24170	0.569000	0.35902	-0.913000	0.04042	-1.436000	0.01970	-0.302000	0.09304	GAC		0.592	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664		35	149	1	0	2.49991e-28	0.003271	4.69748e-28	35	149				
CDC14C	168448	broad.mit.edu	37	7	48964880	48964880	+	IGR	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:48964880C>A								AC004899.1 (73659 upstream) : AC010971.1 (304852 downstream)																							ATTCAAGAGCCAGACTTGAAA	0.353																																							uc010kyv.1		NA																	0					0						c.(610-612)GCC>GCA		SubName: Full=Putative uncharacterized protein MGC26484;																																				SO:0001628	intergenic_variant	168448							g.chr7:48964880C>A																													7.37:g.48964880C>A							p.A204A	NR_003595						1	724	+									Silent	SNP		37	c.612C>A																																																																																				0	0.353									10	30	1	0	3.07112e-06	0.010729	3.81345e-06	10	30				
GTF2IRD2P1	401375	broad.mit.edu	37	7	72658179	72658179	+	RNA	SNP	T	T	C	rs62464331		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:72658179T>C	ENST00000425256.1	-	0	1732									GTF2I repeat domain containing 2 pseudogene 1																		cagagtgatttcggatgaatt	0.507																																							uc003txs.1		NA																	0					0						c.(805-807)AAA>GAA		RecName: Full=General transcription factor II-I repeat domain-containing protein 2B; AltName: Full=GTF2I repeat domain-containing protein 2B; AltName: Full=Transcription factor GTF2IRD2-beta;																																						401375							g.chr7:72658179T>C	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72658179T>C						FKBP6_uc003twz.2_Intron	p.K269E	NR_002164						13	1733	-									Missense_Mutation	SNP	ENST00000425256.1	37	c.805A>G																																																																																					0.507	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000345921.1	NR_002164		5	62	0	0	0	0.00308	0	5	62				
YWHAG	7532	broad.mit.edu	37	7	75959153	75959153	+	Missense_Mutation	SNP	T	T	A	rs547605838		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:75959153T>A	ENST00000307630.3	-	2	707	c.485A>T	c.(484-486)aAa>aTa	p.K162I		NM_012479.3	NP_036611.2	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma	162					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of neuron differentiation (GO:0045664)|regulation of signal transduction (GO:0009966)|regulation of synaptic plasticity (GO:0048167)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	insulin-like growth factor receptor binding (GO:0005159)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)|protein kinase C inhibitor activity (GO:0008426)			endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8						CATGTGCTCTTTGCTGATCTC	0.587																																							uc011kgj.1		NA																	0				ovary(1)|lung(1)	2						c.(484-486)AAA>ATA		tyrosine 3-monooxygenase/tryptophan							170.0	172.0	171.0					7																	75959153		2203	4300	6503	SO:0001583	missense	7532				G2/M transition of mitotic cell cycle|regulation of neuron differentiation|regulation of signal transduction|regulation of synaptic plasticity	cytosol	insulin-like growth factor receptor binding|protein kinase C binding|protein kinase C inhibitor activity	g.chr7:75959153T>A	AF142498	CCDS5584.1	7q11.23	2014-06-13	2013-12-03		ENSG00000170027	ENSG00000170027			12852	protein-coding gene	gene with protein product	"""14-3-3 gamma"", ""protein phosphatase 1, regulatory subunit 170"""	605356	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide"""			10486217, 10433554	Standard	NM_012479		Approved	PPP1R170	uc011kgj.1	P61981	OTTHUMG00000022862	ENST00000307630.3:c.485A>T	7.37:g.75959153T>A	ENSP00000306330:p.Lys162Ile						p.K162I	NM_012479	NP_036611	P61981	1433G_HUMAN			2	702	-			162					O70457|P35214|Q6FH52|Q9UDP2|Q9UN99	Missense_Mutation	SNP	ENST00000307630.3	37	c.485A>T	CCDS5584.1	.	.	.	.	.	.	.	.	.	.	T	17.40	3.380534	0.61845	.	.	ENSG00000170027	ENST00000307630;ENST00000536755;ENST00000453207	T	0.47528	0.84	5.42	5.42	0.78866	14-3-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.67249	0.2873	M	0.77313	2.365	0.80722	D	1	P	0.40534	0.72	P	0.57679	0.825	T	0.68697	-0.5340	10	0.52906	T	0.07	-17.5027	14.8076	0.69968	0.0:0.0:0.0:1.0	.	162	P61981	1433G_HUMAN	I	162;140;122	ENSP00000306330:K162I	ENSP00000306330:K162I	K	-	2	0	YWHAG	75797089	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.832000	0.86757	2.280000	0.76307	0.455000	0.32223	AAA		0.587	YWHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253002.1	NM_012479		42	186	0	0	0	0.011902	0	42	186				
DTX2	113878	broad.mit.edu	37	7	76111844	76111844	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:76111844G>A	ENST00000324432.5	+	5	798	c.288G>A	c.(286-288)cgG>cgA	p.R96R	DTX2_ENST00000413936.2_Silent_p.R96R|DTX2_ENST00000430490.2_Silent_p.R96R|DTX2_ENST00000446820.2_Silent_p.R96R|DTX2_ENST00000472426.1_3'UTR|DTX2_ENST00000307569.8_Silent_p.R96R|DTX2_ENST00000446600.1_Silent_p.R5R	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	96	WWE 1. {ECO:0000255|PROSITE- ProRule:PRU00248}.				Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						GGGCTGTGCGGAGACACCTGT	0.552																																							uc003uff.3		NA																	0				ovary(1)|skin(1)	2						c.(286-288)CGG>CGA		deltex 2 isoform a							75.0	79.0	78.0					7																	76111844		2203	4300	6503	SO:0001819	synonymous_variant	113878				Notch signaling pathway	cytoplasm|nucleus	protein binding|zinc ion binding	g.chr7:76111844G>A		CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.288G>A	7.37:g.76111844G>A						DTX2_uc011kgk.1_Silent_p.R5R|DTX2_uc003ufg.3_Silent_p.R96R|DTX2_uc003ufh.3_Silent_p.R96R|DTX2_uc003ufj.3_Silent_p.R96R	p.R96R	NM_020892	NP_065943	Q86UW9	DTX2_HUMAN			5	844	+			96			WWE 1.		Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Silent	SNP	ENST00000324432.5	37	c.288G>A	CCDS5587.1																																																																																				0.552	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253104.2			20	90	0	0	0	0.008871	0	20	90				
PCLO	27445	broad.mit.edu	37	7	82545660	82545660	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:82545660G>C	ENST00000333891.9	-	7	11979	c.11642C>G	c.(11641-11643)cCg>cGg	p.P3881R	PCLO_ENST00000423517.2_Missense_Mutation_p.P3881R|PCLO_ENST00000437081.1_Missense_Mutation_p.P601R	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGGACTTGTCGGAGGAACTAG	0.463																																							uc003uhx.2		NA																	0				ovary(7)	7						c.(11641-11643)CCG>CGG		piccolo isoform 1							569.0	561.0	564.0					7																	82545660		2020	4180	6200	SO:0001583	missense	27445				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity	g.chr7:82545660G>C	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11642C>G	7.37:g.82545660G>C	ENSP00000334319:p.Pro3881Arg					PCLO_uc003uhv.2_Missense_Mutation_p.P3881R|PCLO_uc010lec.2_Missense_Mutation_p.P846R	p.P3881R	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN			7	11931	-			3812			Gln-rich.			Missense_Mutation	SNP	ENST00000333891.9	37	c.11642C>G	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	13.40	2.225772	0.39300	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.17528	2.27;2.27	5.71	5.71	0.89125	.	.	.	.	.	T	0.36608	0.0973	L	0.58101	1.795	0.37387	D	0.912308	P;D;D	0.64830	0.9;0.994;0.994	B;P;P	0.57548	0.339;0.823;0.823	T	0.18398	-1.0338	9	0.87932	D	0	.	19.8534	0.96748	0.0:0.0:1.0:0.0	.	3812;3881;3881	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	R	3881;3881;601	ENSP00000334319:P3881R;ENSP00000388393:P3881R	ENSP00000334319:P3881R	P	-	2	0	PCLO	82383596	1.000000	0.71417	0.987000	0.45799	0.979000	0.70002	4.447000	0.60020	2.711000	0.92665	0.563000	0.77884	CCG		0.463	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510		61	386	0	0	0	0.01441	0	61	386				
DMTF1	9988	broad.mit.edu	37	7	86824364	86824364	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:86824364C>A	ENST00000394703.5	+	20	2754	c.2191C>A	c.(2191-2193)Cat>Aat	p.H731N	TMEM243_ENST00000481425.1_5'Flank|DMTF1_ENST00000432937.2_Missense_Mutation_p.H643N|DMTF1_ENST00000413276.2_Missense_Mutation_p.H661N|DMTF1_ENST00000414194.2_Missense_Mutation_p.H465N|DMTF1_ENST00000331242.7_Missense_Mutation_p.H731N	NM_021145.3	NP_066968.3	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1	731	Interaction with CCND1, CCND2 and CCND3. {ECO:0000250}.|Required for transcriptional activation. {ECO:0000250}.				cell cycle (GO:0007049)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)	16	Esophageal squamous(14;0.0058)					ACTCCAACATCATCAGGAAGA	0.338																																							uc003uih.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(2191-2193)CAT>AAT		cyclin D binding myb-like transcription factor 1							125.0	126.0	126.0					7																	86824364		2203	4300	6503	SO:0001583	missense	9988				cell cycle	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr7:86824364C>A	AF084530	CCDS5601.1, CCDS47633.1	7q21	2014-06-25			ENSG00000135164	ENSG00000135164			14603	protein-coding gene	gene with protein product	"""cyclin D-binding Myb-like protein"""	608491				10095122, 24958102	Standard	NR_024549		Approved	DMP1, DMTF, hDMP1, MRUL	uc003uih.3	Q9Y222	OTTHUMG00000154135	ENST00000394703.5:c.2191C>A	7.37:g.86824364C>A	ENSP00000378193:p.His731Asn					DMTF1_uc003uii.2_Missense_Mutation_p.H465N|DMTF1_uc003uij.2_Missense_Mutation_p.H465N|DMTF1_uc011khb.1_Missense_Mutation_p.H643N|DMTF1_uc003uik.2_RNA|DMTF1_uc003uil.2_Missense_Mutation_p.H731N|DMTF1_uc003uin.2_Missense_Mutation_p.H465N	p.H731N	NM_001142327	NP_001135799	Q9Y222	DMTF1_HUMAN			18	2517	+	Esophageal squamous(14;0.0058)		731			Interaction with CCND1, CCND2 and CCND3 (By similarity).|Required for transcriptional activation (By similarity).		B2RBE1|B4DJS5|Q05C48|Q59G79|Q6IS13|Q969T2|Q9H2Z2|Q9H2Z3	Missense_Mutation	SNP	ENST00000394703.5	37	c.2191C>A	CCDS5601.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.52|19.52	3.842504|3.842504	0.71488|0.71488	.|.	.|.	ENSG00000135164|ENSG00000135164	ENST00000331242;ENST00000413276;ENST00000432937;ENST00000394703;ENST00000414194|ENST00000454008	T;T;T;T;T|.	0.51071|.	0.79;0.72;0.8;0.79;0.79|.	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	0.050524|.	0.85682|.	D|.	0.000000|.	T|.	0.56906|.	0.2017|.	L|L	0.27053|0.27053	0.805|0.805	0.46478|0.46478	D|D	0.999067|0.999067	P|.	0.45126|.	0.851|.	P|.	0.55391|.	0.775|.	T|.	0.48043|.	-0.9069|.	10|.	0.72032|.	D|.	0.01|.	-6.2935|-6.2935	18.0158|18.0158	0.89239|0.89239	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	731|.	Q9Y222|.	DMTF1_HUMAN|.	N|X	731;661;643;731;465|150	ENSP00000332171:H731N;ENSP00000402627:H661N;ENSP00000412532:H643N;ENSP00000378193:H731N;ENSP00000415910:H465N|.	ENSP00000332171:H731N|.	H|S	+|+	1|2	0|0	DMTF1|DMTF1	86662300|86662300	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.969000|4.969000	0.63735|0.63735	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	CAT|TCA		0.338	DMTF1-002	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334025.5	NM_021145		7	58	1	0	8.12818e-05	0.001984	9.31233e-05	7	58				
BUD31	8896	broad.mit.edu	37	7	99015095	99015095	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:99015095C>G	ENST00000403633.2	+	5	790	c.261C>G	c.(259-261)aaC>aaG	p.N87K	PTCD1_ENST00000292478.4_3'UTR|BUD31_ENST00000456893.1_Missense_Mutation_p.N46K|BUD31_ENST00000222969.5_Missense_Mutation_p.N87K|BUD31_ENST00000431419.1_Missense_Mutation_p.N58K			P41223	BUD31_HUMAN	BUD31 homolog (S. cerevisiae)	87					regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	4	all_cancers(62;1.76e-08)|all_epithelial(64;1.63e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			CAGACAAAAACCTGATTGCAA	0.463																																							uc003uqf.2		NA																	0				ovary(1)	1						c.(259-261)AAC>AAG		G10 protein							79.0	76.0	77.0					7																	99015095		2203	4300	6503	SO:0001583	missense	8896				regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity	g.chr7:99015095C>G	BC022821	CCDS5663.1	7q22.1	2012-06-07	2007-01-12	2006-03-16	ENSG00000106245	ENSG00000106245			29629	protein-coding gene	gene with protein product	"""G10 maternal transcript homolog (Xenopus laevis)"", ""functional spliceosome-associated protein 17"""	603477	"""BUD31 homolog (yeast)"""			7841202	Standard	NM_003910		Approved	YCR063W, EDG-2, EDG2, G10, fSAP17, Cwc14	uc003uqg.4	P41223	OTTHUMG00000154602	ENST00000403633.2:c.261C>G	7.37:g.99015095C>G	ENSP00000386023:p.Asn87Lys					BUD31_uc011kiu.1_Missense_Mutation_p.N87K|BUD31_uc011kiv.1_Missense_Mutation_p.N87K|BUD31_uc003uqg.3_Missense_Mutation_p.N87K	p.N87K	NM_003910	NP_003901	P41223	BUD31_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		5	462	+	all_cancers(62;1.76e-08)|all_epithelial(64;1.63e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		87					A4D274|B7Z4S9|D6W5S6|Q6IB53|Q9UDV1	Missense_Mutation	SNP	ENST00000403633.2	37	c.261C>G	CCDS5663.1	.	.	.	.	.	.	.	.	.	.	C	13.27	2.186184	0.38609	.	.	ENSG00000106245	ENST00000403633;ENST00000222969;ENST00000456893;ENST00000431419	.	.	.	5.26	3.43	0.39272	.	0.000000	0.85682	D	0.000000	T	0.58337	0.2115	M	0.65498	2.005	0.80722	D	1	B;B	0.24092	0.097;0.007	B;B	0.27887	0.084;0.021	T	0.55101	-0.8193	9	0.21014	T	0.42	-43.0848	12.4611	0.55733	0.0:0.8563:0.0:0.1437	.	87;87	B7Z4S9;P41223	.;BUD31_HUMAN	K	87;87;46;58	.	ENSP00000222969:N87K	N	+	3	2	BUD31	98853031	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.788000	0.26872	1.376000	0.46267	0.655000	0.94253	AAC		0.463	BUD31-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336275.1	NM_003910		6	36	0	0	0	0.001168	0	6	36				
PTCD1	26024	broad.mit.edu	37	7	99030992	99030992	+	Missense_Mutation	SNP	C	C	A	rs10258918	byFrequency	TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:99030992C>A	ENST00000292478.4	-	3	753	c.503G>T	c.(502-504)cGa>cTa	p.R168L	ATP5J2-PTCD1_ENST00000437572.1_5'Flank|PTCD1_ENST00000485746.1_5'UTR|ATP5J2-PTCD1_ENST00000413834.1_Missense_Mutation_p.R217L|PTCD1_ENST00000555673.1_Missense_Mutation_p.R217L	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	168					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GGGCTGCAATCGCTCCTCCTT	0.597																																							uc003uqh.2		NA																	0				ovary(1)	1						c.(502-504)CGA>CTA		pentatricopeptide repeat domain 1							128.0	116.0	120.0					7																	99030992		2203	4300	6503	SO:0001583	missense	26024							g.chr7:99030992C>A	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.503G>T	7.37:g.99030992C>A	ENSP00000292478:p.Arg168Leu					PTCD1_uc011kiw.1_Missense_Mutation_p.R217L	p.R168L	NM_015545	NP_056360	O75127	PTCD1_HUMAN	STAD - Stomach adenocarcinoma(171;0.215)		3	634	-	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		168			PPR 1.		Q3ZB78|Q66K60|Q9UDV2	Missense_Mutation	SNP	ENST00000292478.4	37	c.503G>T	CCDS34691.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240885	0.79912	.	.	ENSG00000106246;ENSG00000106246;ENSG00000248919	ENST00000292478;ENST00000555673;ENST00000413834	T;T;T	0.66815	-0.23;-0.23;-0.23	5.32	3.42	0.39159	.	0.060154	0.64402	D	0.000005	T	0.78432	0.4282	M	0.80847	2.515	0.58432	D	0.999998	D;D	0.69078	0.997;0.996	P;D	0.63033	0.89;0.91	T	0.76822	-0.2817	10	0.39692	T	0.17	-2.7019	11.2775	0.49176	0.0:0.8427:0.0:0.1573	.	217;168	G3V325;O75127	.;PTCD1_HUMAN	L	168;217;217	ENSP00000292478:R168L;ENSP00000450995:R217L;ENSP00000400168:R217L	ENSP00000400168:R217L	R	-	2	0	ATP5J2-PTCD1;PTCD1	98868928	0.995000	0.38212	0.799000	0.32177	0.722000	0.41435	3.327000	0.52045	0.543000	0.28864	-0.345000	0.07892	CGA		0.597	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545		28	143	1	0	2.12542e-12	0.00632	3.38472e-12	28	143				
TRIM56	81844	broad.mit.edu	37	7	100732499	100732499	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:100732499G>T	ENST00000306085.6	+	3	2203	c.1906G>T	c.(1906-1908)Gcg>Tcg	p.A636S		NM_030961.1	NP_112223.1	Q9BRZ2	TRI56_HUMAN	tripartite motif containing 56	636					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of type I interferon production (GO:0032481)|protein K63-linked ubiquitination (GO:0070534)|regulation of type I interferon production (GO:0032479)|response to type I interferon (GO:0034340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	Lung NSC(181;0.136)|all_lung(186;0.182)					GGGCCTGCGGGCGCTGGTGTT	0.647																																					Ovarian(89;1092 1379 22756 38989 39611)	Ovarian(89;1092 1379 22756 38989 39611)	uc003uxq.2		NA																	0				kidney(1)|central_nervous_system(1)|skin(1)	3						c.(1906-1908)GCG>TCG		tripartite motif-containing 56							60.0	69.0	66.0					7																	100732499		1913	4117	6030	SO:0001583	missense	81844				defense response to virus|interferon-beta production|protein K63-linked ubiquitination|response to type I interferon	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding	g.chr7:100732499G>T	BK000511	CCDS43625.1	7q11.2	2013-01-09	2011-01-25		ENSG00000169871	ENSG00000169871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19028	protein-coding gene	gene with protein product			"""tripartite motif-containing 56"""				Standard	NM_030961		Approved	RNF109	uc003uxq.3	Q9BRZ2	OTTHUMG00000157032	ENST00000306085.6:c.1906G>T	7.37:g.100732499G>T	ENSP00000305161:p.Ala636Ser					TRIM56_uc003uxr.2_Intron	p.A636S	NM_030961	NP_112223	Q9BRZ2	TRI56_HUMAN			3	2137	+	Lung NSC(181;0.136)|all_lung(186;0.182)		636					Q6PJS5|Q86VT6|Q8N2H8|Q8NAC0|Q9H031	Missense_Mutation	SNP	ENST00000306085.6	37	c.1906G>T	CCDS43625.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.704500	0.48412	.	.	ENSG00000169871	ENST00000306085	T	0.28069	1.63	4.14	4.14	0.48551	Six-bladed beta-propeller, TolB-like (1);	.	.	.	.	T	0.27798	0.0684	N	0.08118	0	0.32111	N	0.589256	D	0.63880	0.993	D	0.70227	0.968	T	0.01108	-1.1449	9	0.05351	T	0.99	.	12.2786	0.54751	0.0:0.0:1.0:0.0	.	636	Q9BRZ2	TRI56_HUMAN	S	636	ENSP00000305161:A636S	ENSP00000305161:A636S	A	+	1	0	TRIM56	100519219	1.000000	0.71417	0.998000	0.56505	0.705000	0.40729	4.495000	0.60353	2.614000	0.88457	0.650000	0.86243	GCG		0.647	TRIM56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347185.1	NM_030961		26	118	1	0	5.45024e-15	0.00333	9.20903e-15	26	118				
RELN	5649	broad.mit.edu	37	7	103151413	103151413	+	Missense_Mutation	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:103151413T>A	ENST00000428762.1	-	51	8318	c.8159A>T	c.(8158-8160)gAa>gTa	p.E2720V	CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Missense_Mutation_p.E2720V|RELN_ENST00000343529.5_Missense_Mutation_p.E2720V	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2720					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACAGAATCTTTCTACTGTACA	0.413																																					NSCLC(146;835 1944 15585 22231 52158)	NSCLC(146;835 1944 15585 22231 52158)	uc003vca.2		NA																	0				ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19						c.(8158-8160)GAA>GTA		reelin isoform a							123.0	101.0	109.0					7																	103151413		2203	4300	6503	SO:0001583	missense	5649				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	g.chr7:103151413T>A		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.8159A>T	7.37:g.103151413T>A	ENSP00000392423:p.Glu2720Val					RELN_uc010liz.2_Missense_Mutation_p.E2720V	p.E2720V	NM_005045	NP_005036	P78509	RELN_HUMAN		COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)	51	8319	-			2720					A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	c.8159A>T	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	T	17.34	3.366080	0.61513	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000424828;ENST00000448171	T;T;T	0.19532	2.14;2.14;2.14	5.65	5.65	0.86999	Neuraminidase (2);	0.051678	0.85682	D	0.000000	T	0.37376	0.1001	L	0.46157	1.445	0.51012	D	0.999905	D;D	0.60160	0.968;0.987	P;P	0.60609	0.81;0.877	T	0.07404	-1.0774	10	0.59425	D	0.04	.	15.8717	0.79127	0.0:0.0:0.0:1.0	.	2720;2720	P78509-2;P78509	.;RELN_HUMAN	V	2720;2720;2720;237;2720	ENSP00000392423:E2720V;ENSP00000345694:E2720V;ENSP00000388446:E2720V	ENSP00000345694:E2720V	E	-	2	0	RELN	102938649	1.000000	0.71417	0.449000	0.26957	0.081000	0.17604	7.671000	0.83941	2.148000	0.66965	0.523000	0.50628	GAA		0.413	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045		7	18	0	0	0	0.00308	0	7	18				
GPR85	54329	broad.mit.edu	37	7	112724029	112724029	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:112724029C>A	ENST00000297146.3	-	3	1351	c.748G>T	c.(748-750)Ggt>Tgt	p.G250C	GPR85_ENST00000424100.1_Missense_Mutation_p.G250C|GPR85_ENST00000487573.1_5'Flank|GPR85_ENST00000501255.2_Missense_Mutation_p.G250C|GPR85_ENST00000449591.1_Missense_Mutation_p.G250C	NM_001146266.1	NP_001139738.1	P60893	GPR85_HUMAN	G protein-coupled receptor 85	250					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	17						GGTGTGGGACCCCTTCCAAAT	0.522																																							uc010ljv.2		NA																	0				ovary(1)|central_nervous_system(1)	2						c.(748-750)GGT>TGT		G protein-coupled receptor 85							104.0	113.0	110.0					7																	112724029		2203	4300	6503	SO:0001583	missense	54329					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr7:112724029C>A	AF250237	CCDS5758.1	7q31	2012-08-21			ENSG00000164604	ENSG00000164604		"""GPCR / Class A : Orphans"""	4536	protein-coding gene	gene with protein product		605188				10978537, 10833454	Standard	NM_018970		Approved	SREB2	uc003vgp.1	P60893	OTTHUMG00000156933	ENST00000297146.3:c.748G>T	7.37:g.112724029C>A	ENSP00000297146:p.Gly250Cys					GPR85_uc003vgp.1_Missense_Mutation_p.G250C|GPR85_uc003vgq.2_Missense_Mutation_p.G250C|GPR85_uc010ljw.1_Missense_Mutation_p.G250C	p.G250C	NM_001146266	NP_001139738	P60893	GPR85_HUMAN			2	1265	-			250			Cytoplasmic (Potential).		Q9JHI6|Q9NPD1	Missense_Mutation	SNP	ENST00000297146.3	37	c.748G>T	CCDS5758.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.455859	0.63401	.	.	ENSG00000164604	ENST00000501255;ENST00000297146;ENST00000424100;ENST00000449591	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	5.52	5.52	0.82312	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.72724	0.3496	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72734	-0.4204	10	0.56958	D	0.05	.	19.8176	0.96576	0.0:1.0:0.0:0.0	.	250	P60893	GPR85_HUMAN	C	250	ENSP00000445808:G250C;ENSP00000297146:G250C;ENSP00000396763:G250C;ENSP00000401178:G250C	ENSP00000297146:G250C	G	-	1	0	GPR85	112511265	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.748000	0.85085	2.765000	0.95021	0.650000	0.86243	GGT		0.522	GPR85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346650.2			37	167	1	0	3.93418e-24	0.004289	7.30634e-24	37	167				
PPP1R3A	5506	broad.mit.edu	37	7	113558946	113558946	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:113558946C>A	ENST00000284601.3	-	1	174	c.106G>T	c.(106-108)Ggt>Tgt	p.G36C		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	36					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						GGGGAGAAACCAGGTTGGAAA	0.388																																							uc010ljy.1		NA																	0				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						c.(106-108)GGT>TGT		protein phosphatase 1, regulatory (inhibitor)							80.0	82.0	81.0					7																	113558946		2203	4300	6503	SO:0001583	missense	5506				glycogen metabolic process	integral to membrane		g.chr7:113558946C>A	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.106G>T	7.37:g.113558946C>A	ENSP00000284601:p.Gly36Cys						p.G36C	NM_002711	NP_002702	Q16821	PPR3A_HUMAN			1	137	-			36					A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	c.106G>T	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.535897	0.45176	.	.	ENSG00000154415	ENST00000284601	T	0.17213	2.29	6.17	2.12	0.27331	.	0.279369	0.37095	N	0.002242	T	0.33089	0.0851	L	0.60455	1.87	0.34391	D	0.694211	D	0.89917	1.0	D	0.71414	0.973	T	0.46345	-0.9198	10	0.42905	T	0.14	-0.0716	11.8939	0.52646	0.0:0.466:0.4605:0.0736	.	36	Q16821	PPR3A_HUMAN	C	36	ENSP00000284601:G36C	ENSP00000284601:G36C	G	-	1	0	PPP1R3A	113346182	1.000000	0.71417	0.999000	0.59377	0.915000	0.54546	1.909000	0.39917	0.959000	0.37980	-0.127000	0.14921	GGT		0.388	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711		13	86	1	0	3.27435e-08	0.00245	4.48551e-08	13	86				
KCND2	3751	broad.mit.edu	37	7	119915431	119915431	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:119915431G>T	ENST00000331113.4	+	1	1710	c.745G>T	c.(745-747)Gct>Tct	p.A249S		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	249					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	GCTTCGCCTGGCTGCAGCGCC	0.517																																							uc003vjj.1		NA																	0				ovary(2)|central_nervous_system(2)|skin(1)	5						c.(745-747)GCT>TCT		potassium voltage-gated channel, Shal-related							181.0	150.0	161.0					7																	119915431		2203	4300	6503	SO:0001583	missense	3751				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding	g.chr7:119915431G>T	AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.745G>T	7.37:g.119915431G>T	ENSP00000333496:p.Ala249Ser						p.A249S	NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN			1	1710	+	all_neural(327;0.117)		249			Cytoplasmic (Potential).		O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	ENST00000331113.4	37	c.745G>T	CCDS5776.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.290247	0.40494	.	.	ENSG00000184408	ENST00000331113	D	0.98455	-4.94	5.57	5.57	0.84162	Ion transport (1);	0.131595	0.52532	D	0.000080	D	0.95294	0.8473	L	0.28344	0.845	0.30362	N	0.783685	B	0.06786	0.001	B	0.12837	0.008	D	0.89918	0.4057	9	.	.	.	.	16.0928	0.81102	0.0:0.1428:0.8572:0.0	.	249	Q9NZV8	KCND2_HUMAN	S	249	ENSP00000333496:A249S	.	A	+	1	0	KCND2	119702667	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	2.607000	0.46300	2.636000	0.89361	0.557000	0.71058	GCT		0.517	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281		13	64	1	0	5.50884e-06	0.013537	6.65869e-06	13	64				
GRM8	2918	broad.mit.edu	37	7	126086184	126086184	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:126086184G>T	ENST00000339582.2	-	10	3481	c.2673C>A	c.(2671-2673)acC>acA	p.T891T	GRM8_ENST00000358373.3_Silent_p.T891T|GRM8_ENST00000444921.2_Silent_p.T891T			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	891					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				ACTTACTGTTGGTTTCAAGAC	0.453										HNSCC(24;0.065)																													uc003vlr.2		NA																	0				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23						c.(2671-2673)ACC>ACA		glutamate receptor, metabotropic 8 isoform a	L-Glutamic Acid(DB00142)						202.0	185.0	191.0					7																	126086184		2203	4300	6503	SO:0001819	synonymous_variant	2918				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane		g.chr7:126086184G>T		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.2673C>A	7.37:g.126086184G>T		HNSCC(24;0.065)				GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Silent_p.T891T|GRM8_uc010lkz.1_RNA	p.T891T	NM_000845	NP_000836	O00222	GRM8_HUMAN			9	2984	-		Prostate(267;0.186)	891			Cytoplasmic (Potential).		A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Silent	SNP	ENST00000339582.2	37	c.2673C>A	CCDS5794.1																																																																																				0.453	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4			30	151	1	0	5.90632e-09	0.012213	8.39805e-09	30	151				
PLXNA4	91584	broad.mit.edu	37	7	132192798	132192798	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:132192798G>T	ENST00000359827.3	-	2	1617	c.655C>A	c.(655-657)Cat>Aat	p.H219N	PLXNA4_ENST00000321063.4_Missense_Mutation_p.H219N|PLXNA4_ENST00000423507.2_Missense_Mutation_p.H219N|PLXNA4_ENST00000378539.5_Missense_Mutation_p.H219N			Q9HCM2	PLXA4_HUMAN	plexin A4	219	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						AACTCATCATGGAAGACGTAC	0.507																																							uc003vra.3		NA																	0				ovary(1)	1						c.(655-657)CAT>AAT		plexin A4 isoform 1							143.0	136.0	138.0					7																	132192798		2203	4300	6503	SO:0001583	missense	91584					integral to membrane|intracellular|plasma membrane		g.chr7:132192798G>T	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.655C>A	7.37:g.132192798G>T	ENSP00000352882:p.His219Asn					PLXNA4_uc003vrc.2_Missense_Mutation_p.H219N|PLXNA4_uc003vrb.2_Missense_Mutation_p.H219N	p.H219N	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN			2	884	-			219			Extracellular (Potential).|Sema.		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	c.655C>A	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.224000	0.39300	.	.	ENSG00000221866	ENST00000321063;ENST00000359827;ENST00000423507;ENST00000378539	T;T;T;T	0.11495	2.77;2.77;2.77;2.77	5.57	5.57	0.84162	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.64402	U	0.000003	T	0.28699	0.0711	M	0.76574	2.34	0.80722	D	1	B;P;B	0.49358	0.321;0.923;0.304	B;P;B	0.57468	0.445;0.821;0.331	T	0.03910	-1.0993	10	0.12430	T	0.62	.	19.5531	0.95330	0.0:0.0:1.0:0.0	.	219;219;219	Q9HCM2-2;A4D1N6;Q9HCM2	.;.;PLXA4_HUMAN	N	219	ENSP00000323194:H219N;ENSP00000352882:H219N;ENSP00000392772:H219N;ENSP00000367800:H219N	ENSP00000323194:H219N	H	-	1	0	PLXNA4	131843338	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	9.869000	0.99810	2.642000	0.89623	0.462000	0.41574	CAT		0.507	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		17	118	1	0	6.49762e-13	0.006122	1.0452e-12	17	118				
EPHB6	2051	broad.mit.edu	37	7	142561931	142561931	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:142561931C>A	ENST00000392957.2	+	7	1160	c.373C>A	c.(373-375)Cgg>Agg	p.R125R	EPHB6_ENST00000442129.1_Silent_p.R125R|EPHB6_ENST00000411471.2_Intron	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	125	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					CGGCACCTGCCGGGAGACCTT	0.637																																							uc011kst.1		NA																	0				lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19						c.(373-375)CGG>AGG		ephrin receptor EphB6 precursor							56.0	62.0	60.0					7																	142561931		2203	4300	6503	SO:0001819	synonymous_variant	2051					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity	g.chr7:142561931C>A	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.373C>A	7.37:g.142561931C>A						EPHB6_uc011ksu.1_Silent_p.R125R|EPHB6_uc003wbs.2_5'UTR|EPHB6_uc003wbt.2_5'UTR|EPHB6_uc003wbu.2_5'UTR	p.R125R	NM_004445	NP_004436	O15197	EPHB6_HUMAN			7	1160	+	Melanoma(164;0.059)		125			Extracellular (Potential).		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Silent	SNP	ENST00000392957.2	37	c.373C>A	CCDS5873.2																																																																																				0.637	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1			35	131	1	0	7.11191e-15	0.013726	1.19533e-14	35	131				
OR6V1	346517	broad.mit.edu	37	7	142750269	142750269	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:142750269G>A	ENST00000418316.1	+	1	853	c.832G>A	c.(832-834)Gtt>Att	p.V278I		NM_001001667.1	NP_001001667.1	Q8N148	OR6V1_HUMAN	olfactory receptor, family 6, subfamily V, member 1	278						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	20	Melanoma(164;0.059)					GGTGACTTCAGTTCTCACCCC	0.493																																							uc011ksv.1		NA																	0				ovary(1)	1						c.(832-834)GTT>ATT		olfactory receptor, family 6, subfamily V,							91.0	98.0	96.0					7																	142750269		2015	4173	6188	SO:0001583	missense	346517				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:142750269G>A		CCDS47728.1	7q34	2014-05-06			ENSG00000225781	ENSG00000225781		"""GPCR / Class A : Olfactory receptors"""	15090	protein-coding gene	gene with protein product						12732197	Standard	NM_001001667		Approved	GPR138	uc011ksv.2	Q8N148	OTTHUMG00000158385	ENST00000418316.1:c.832G>A	7.37:g.142750269G>A	ENSP00000396085:p.Val278Ile						p.V278I	NM_001001667	NP_001001667	Q8N148	OR6V1_HUMAN			1	832	+	Melanoma(164;0.059)		278			Helical; Name=7; (Potential).		A4D2I0|B9EH48|Q6IF70	Missense_Mutation	SNP	ENST00000418316.1	37	c.832G>A	CCDS47728.1	.	.	.	.	.	.	.	.	.	.	G	8.409	0.843685	0.16963	.	.	ENSG00000225781	ENST00000418316	T	0.00289	8.28	4.72	-2.81	0.05805	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00144	0.0004	L	0.33339	1.005	0.09310	N	1	B	0.10296	0.003	B	0.13407	0.009	T	0.05869	-1.0859	9	0.22706	T	0.39	.	4.2117	0.10514	0.4847:0.0:0.2485:0.2667	.	278	Q8N148	OR6V1_HUMAN	I	278	ENSP00000396085:V278I	ENSP00000396085:V278I	V	+	1	0	OR6V1	142460391	0.000000	0.05858	0.001000	0.08648	0.950000	0.60333	-3.103000	0.00603	-0.416000	0.07473	0.655000	0.94253	GTT		0.493	OR6V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350860.1			13	61	0	0	0	0.013537	0	13	61				
TAS2R60	338398	broad.mit.edu	37	7	143141079	143141079	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:143141079G>T	ENST00000332690.1	+	1	534	c.534G>T	c.(532-534)tgG>tgT	p.W178C	EPHA1-AS1_ENST00000429289.1_RNA	NM_177437.1	NP_803186.1	P59551	T2R60_HUMAN	taste receptor, type 2, member 60	178					sensory perception of bitter taste (GO:0050913)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|kidney(1)|large_intestine(2)|lung(17)|prostate(1)|skin(7)|urinary_tract(2)	31	Melanoma(164;0.172)					TACAACCTTGGAATGTCACTG	0.413																																							uc011ktg.1		NA																	0				skin(6)	6						c.(532-534)TGG>TGT		taste receptor, type 2, member 60							164.0	160.0	161.0					7																	143141079		2203	4300	6503	SO:0001583	missense	338398				sensory perception of bitter taste	integral to membrane	G-protein coupled receptor activity	g.chr7:143141079G>T	AY114094	CCDS5885.1	7q35	2014-07-10			ENSG00000185899	ENSG00000185899		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	20639	protein-coding gene	gene with protein product		613968				12584440	Standard	NM_177437		Approved	T2R60	uc011ktg.2	P59551	OTTHUMG00000154891	ENST00000332690.1:c.534G>T	7.37:g.143141079G>T	ENSP00000327724:p.Trp178Cys					uc003wda.2_Intron	p.W178C	NM_177437	NP_803186	P59551	T2R60_HUMAN			1	534	+	Melanoma(164;0.172)		178			Extracellular (Potential).		A4D2G8|Q645W8|Q7RTR7	Missense_Mutation	SNP	ENST00000332690.1	37	c.534G>T	CCDS5885.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.583403	0.46006	.	.	ENSG00000185899	ENST00000332690	T	0.38560	1.13	5.62	3.83	0.44106	.	1.020390	0.07884	U	0.969926	T	0.53786	0.1818	L	0.44542	1.39	0.47659	D	0.99948	D	0.69078	0.997	D	0.64237	0.923	T	0.26744	-1.0094	10	0.59425	D	0.04	.	8.3116	0.32075	0.1802:0.0:0.8198:0.0	.	178	P59551	T2R60_HUMAN	C	178	ENSP00000327724:W178C	ENSP00000327724:W178C	W	+	3	0	TAS2R60	142851201	0.994000	0.37717	0.450000	0.26969	0.096000	0.18686	2.446000	0.44908	0.731000	0.32448	0.591000	0.81541	TGG		0.413	TAS2R60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337541.1			27	158	1	0	5.61819e-17	0.005443	9.91353e-17	27	158				
OR6B1	135946	broad.mit.edu	37	7	143701858	143701858	+	Missense_Mutation	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:143701858T>C	ENST00000408922.2	+	1	837	c.769T>C	c.(769-771)Tat>Cat	p.Y257H		NM_001005281.1	NP_001005281.1	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B, member 1	257						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|large_intestine(3)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	27	Melanoma(164;0.0783)					TATTTTCATGTATGCTCGACC	0.423																																							uc003wdt.1		NA																	0				ovary(1)	1						c.(769-771)TAT>CAT		olfactory receptor, family 6, subfamily B,							160.0	150.0	153.0					7																	143701858		1983	4172	6155	SO:0001583	missense	135946				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143701858T>C		CCDS43667.1	7q33-q35	2012-08-09			ENSG00000221813	ENSG00000221813		"""GPCR / Class A : Olfactory receptors"""	8354	protein-coding gene	gene with protein product							Standard	NM_001005281		Approved	OR7-3	uc003wdt.1	O95007	OTTHUMG00000157765	ENST00000408922.2:c.769T>C	7.37:g.143701858T>C	ENSP00000386151:p.Tyr257His						p.Y257H	NM_001005281	NP_001005281	O95007	OR6B1_HUMAN			1	769	+	Melanoma(164;0.0783)		257			Extracellular (Potential).		A4D2G2|B9EH47|Q6IFP6|Q96R38	Missense_Mutation	SNP	ENST00000408922.2	37	c.769T>C	CCDS43667.1	.	.	.	.	.	.	.	.	.	.	T	19.06	3.754057	0.69648	.	.	ENSG00000221813	ENST00000408922	T	0.00291	8.27	5.26	5.26	0.73747	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33813	U	0.004537	T	0.00666	0.0022	M	0.78285	2.405	0.36558	D	0.872263	P	0.49090	0.919	D	0.69142	0.962	T	0.70981	-0.4724	10	0.87932	D	0	.	13.1892	0.59700	0.0:0.0:0.0:1.0	.	257	O95007	OR6B1_HUMAN	H	257	ENSP00000386151:Y257H	ENSP00000386151:Y257H	Y	+	1	0	OR6B1	143332791	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.507000	0.53371	2.212000	0.71576	0.533000	0.62120	TAT		0.423	OR6B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349566.1			13	123	0	0	0	0.013537	0	13	123				
ATG9B	285973	broad.mit.edu	37	7	150715032	150715032	+	Missense_Mutation	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:150715032T>C	ENST00000377974.2	-	8	2053	c.1978A>G	c.(1978-1980)Act>Gct	p.T660A	ATG9B_ENST00000494791.1_5'UTR|ATG9B_ENST00000605938.1_Missense_Mutation_p.T660A|ATG9B_ENST00000444312.1_Missense_Mutation_p.T146A			Q674R7	ATG9B_HUMAN	autophagy related 9B	660					autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ACATCCACAGTGAAGTGATGA	0.592											OREG0018444	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc011kvc.1		NA																	0				ovary(1)	1						c.(1978-1980)ACT>GCT		ATG9 autophagy related 9 homolog B							44.0	51.0	49.0					7																	150715032		2057	4194	6251	SO:0001583	missense	285973				autophagic vacuole assembly	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane		g.chr7:150715032T>C	AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.1978A>G	7.37:g.150715032T>C	ENSP00000475005:p.Thr660Ala		OREG0018444	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1734	ATG9B_uc003wig.3_RNA	p.T660A	NM_173681	NP_775952	Q674R7	ATG9B_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	8	2054	-	all_neural(206;0.219)		660			Cytoplasmic (By similarity).		A1A5D3|Q6JRW5|Q8N8I8	Missense_Mutation	SNP	ENST00000377974.2	37	c.1978A>G		.	.	.	.	.	.	.	.	.	.	T	17.66	3.444476	0.63178	.	.	ENSG00000248602	ENST00000377974;ENST00000444312;ENST00000397266	.	.	.	5.43	3.04	0.35103	.	0.057103	0.64402	D	0.000002	T	0.65080	0.2657	.	.	.	.	.	.	D	0.89917	1.0	D	0.75484	0.986	T	0.71056	-0.4703	7	0.87932	D	0	.	3.5016	0.07674	0.1645:0.1767:0.0:0.6589	.	660	Q674R7	ATG9B_HUMAN	A	660;146;660	.	ENSP00000444232:T660A	T	-	1	0	AC010973.1	150345965	1.000000	0.71417	0.999000	0.59377	0.908000	0.53690	2.584000	0.46102	0.871000	0.35750	0.460000	0.39030	ACT		0.592	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173681		4	14	0	0	0	0.009096	0	4	14				
GALNTL5	168391	broad.mit.edu	37	7	151716812	151716812	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:151716812C>A	ENST00000392800.2	+	9	1512	c.1258C>A	c.(1258-1260)Ctg>Atg	p.L420M	GALNTL5_ENST00000431418.2_Missense_Mutation_p.L420M	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	420					spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		AAGGAAACGACTGGGTTGCAA	0.398																																							uc003wkp.2		NA																	0				ovary(2)	2						c.(1258-1260)CTG>ATG		UDP-N-acetyl-alpha-D-galactosamine:polypeptide							124.0	116.0	119.0					7																	151716812		2203	4300	6503	SO:0001583	missense	168391					Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups	g.chr7:151716812C>A	AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.1258C>A	7.37:g.151716812C>A	ENSP00000376548:p.Leu420Met					GALNTL5_uc003wkq.2_Missense_Mutation_p.L171M|GALNTL5_uc003wkr.2_RNA|GALNTL5_uc003wks.2_RNA|GALNTL5_uc010lqf.2_Missense_Mutation_p.L309M	p.L420M	NM_145292	NP_660335	Q7Z4T8	GLTL5_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)	9	1481	+	all_neural(206;0.187)	all_hematologic(28;0.0749)	420			Lumenal (Potential).		Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Missense_Mutation	SNP	ENST00000392800.2	37	c.1258C>A	CCDS5929.1	.	.	.	.	.	.	.	.	.	.	C	15.77	2.931681	0.52866	.	.	ENSG00000106648	ENST00000431418;ENST00000392800	T;T	0.58652	0.32;0.32	5.01	-8.21	0.01041	.	0.000000	0.38217	N	0.001777	T	0.78013	0.4217	M	0.91663	3.23	0.23421	N	0.997714	D;D	0.89917	0.998;1.0	D;D	0.87578	0.947;0.998	T	0.78623	-0.2132	10	0.87932	D	0	.	22.0676	0.99966	0.0:0.8683:0.0:0.1317	.	171;420	A8MZD3;Q7Z4T8	.;GLTL5_HUMAN	M	420	ENSP00000392582:L420M;ENSP00000376548:L420M	ENSP00000376548:L420M	L	+	1	2	GALNTL5	151347745	0.000000	0.05858	0.004000	0.12327	0.910000	0.53928	-0.940000	0.03929	-1.880000	0.01125	-0.355000	0.07637	CTG		0.398	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348395.1	NM_145292		15	48	1	0	2.31682e-05	0.003163	2.70792e-05	15	48				
KMT2C	58508	broad.mit.edu	37	7	151970805	151970805	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:151970805G>T	ENST00000262189.6	-	7	1215	c.997C>A	c.(997-999)Caa>Aaa	p.Q333K	KMT2C_ENST00000355193.2_Missense_Mutation_p.Q333K	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	333					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TCAGGAGCTTGGTCAATGTGT	0.383																																						Colon(68;14 1149 1884 27689 34759)	uc003wla.2		NA								N							medulloblastoma		0				large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(997-999)CAA>AAA		myeloid/lymphoid or mixed-lineage leukemia 3							236.0	220.0	225.0					7																	151970805		2203	4300	6503	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151970805G>T	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.997C>A	7.37:g.151970805G>T	ENSP00000262189:p.Gln333Lys						p.Q333K	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	7	1216	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	333					Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.997C>A	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.040985	0.55003	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.84944	-1.91;-1.92	4.78	4.78	0.61160	Zinc finger, RING/FYVE/PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.41823	U	0.000812	T	0.75961	0.3921	L	0.36672	1.1	0.80722	D	1	P	0.35077	0.483	B	0.30943	0.122	T	0.74719	-0.3570	10	0.02654	T	1	.	18.1678	0.89734	0.0:0.0:1.0:0.0	.	333	Q8NEZ4	MLL3_HUMAN	K	333	ENSP00000262189:Q333K;ENSP00000347325:Q333K	ENSP00000262189:Q333K	Q	-	1	0	MLL3	151601738	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.587000	0.67510	2.375000	0.81037	0.585000	0.79938	CAA		0.383	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			8	202	1	0	0.00307968	0.00308	0.00334771	8	202				
RBM33	155435	broad.mit.edu	37	7	155538132	155538132	+	Nonsense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:155538132G>T	ENST00000401878.3	+	14	3013	c.2815G>T	c.(2815-2817)Gag>Tag	p.E939*	RBM33_ENST00000341148.3_5'Flank	NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	939							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		TGCAGATGTGGAGGAGCCAGC	0.552																																							uc010lqk.1		NA																	0				ovary(1)	1						c.(2815-2817)GAG>TAG		RNA binding motif protein 33							47.0	44.0	45.0					7																	155538132		2203	4300	6503	SO:0001587	stop_gained	155435						nucleotide binding|RNA binding	g.chr7:155538132G>T	AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.2815G>T	7.37:g.155538132G>T	ENSP00000384160:p.Glu939*					RBM33_uc011kvv.1_Nonsense_Mutation_p.E748*|RBM33_uc003wmg.2_5'Flank	p.E939*	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)	14	3183	+	all_neural(206;0.101)	all_hematologic(28;0.0592)	939					A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Nonsense_Mutation	SNP	ENST00000401878.3	37	c.2815G>T	CCDS5941.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.476025|6.476025	0.97598|0.97598	.|.	.|.	ENSG00000184863|ENSG00000184863	ENST00000401878|ENST00000392761	.|.	.|.	.|.	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	0.500545|.	0.19351|.	N|.	0.116398|.	.|T	.|0.72486	.|0.3466	.|.	.|.	.|.	0.49389|0.49389	D|D	0.999783|0.999783	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.70439	.|-0.4871	.|4	0.28530|.	T|.	0.3|.	.|.	16.4544|16.4544	0.84008|0.84008	0.0:0.1974:0.8026:0.0|0.0:0.1974:0.8026:0.0	.|.	.|.	.|.	.|.	X|C	939|710	.|.	ENSP00000384160:E939X|.	E|W	+|+	1|3	0|0	RBM33|RBM33	155230893|155230893	0.835000|0.835000	0.29415|0.29415	0.911000|0.911000	0.35937|0.35937	0.038000|0.038000	0.13279|0.13279	3.231000|3.231000	0.51294|0.51294	2.652000|2.652000	0.90054|0.90054	0.655000|0.655000	0.94253|0.94253	GAG|TGG		0.552	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317225.3	NM_001008408		7	28	1	0	2.0095e-06	0.001984	2.5099e-06	7	28				
RP1L1	94137	broad.mit.edu	37	8	10466663	10466663	+	Nonsense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr8:10466663C>A	ENST00000382483.3	-	4	5168	c.4945G>T	c.(4945-4947)Gag>Tag	p.E1649*		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1729					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TCCGCCTCCTCGCCCAGCTGG	0.682																																							uc003wtc.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(4945-4947)GAG>TAG		retinitis pigmentosa 1-like 1							31.0	35.0	34.0					8																	10466663		1996	4156	6152	SO:0001587	stop_gained	94137				intracellular signal transduction			g.chr8:10466663C>A	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4945G>T	8.37:g.10466663C>A	ENSP00000371923:p.Glu1649*						p.E1649*	NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN		COAD - Colon adenocarcinoma(149;0.0811)	4	5174	-			1649					Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Nonsense_Mutation	SNP	ENST00000382483.3	37	c.4945G>T	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	43	10.095001	0.99336	.	.	ENSG00000183638	ENST00000382483	.	.	.	4.07	0.108	0.14548	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-1.0E-4	4.2259	0.10580	0.154:0.4814:0.0:0.3646	.	.	.	.	X	1649	.	ENSP00000371923:E1649X	E	-	1	0	RP1L1	10504073	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.610000	0.24253	-0.190000	0.10465	-0.339000	0.08088	GAG		0.682	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1			9	30	1	0	3.09899e-07	0.004482	4.07021e-07	9	30				
SLC18A1	6570	broad.mit.edu	37	8	20022571	20022571	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr8:20022571G>T	ENST00000276373.5	-	9	1172	c.906C>A	c.(904-906)atC>atA	p.I302I	SLC18A1_ENST00000265808.7_Silent_p.I302I|SLC18A1_ENST00000437980.1_Silent_p.I302I|SLC18A1_ENST00000440926.1_Silent_p.I302I|SLC18A1_ENST00000519026.1_Silent_p.I302I|SLC18A1_ENST00000381608.4_Silent_p.I302I	NM_003053.3	NP_003044.1	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 1	302					monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29				Colorectal(74;0.0747)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	CAGCCACCAGGATGTAAGGGT	0.537																																							uc011kyq.1		NA																	0				ovary(2)	2						c.(904-906)ATC>ATA		solute carrier family 18 (vesicular monoamine),							102.0	94.0	96.0					8																	20022571		2203	4300	6503	SO:0001819	synonymous_variant	6570				neurotransmitter transport	clathrin sculpted monoamine transport vesicle membrane|integral to membrane|membrane fraction	drug transmembrane transporter activity|monoamine transmembrane transporter activity	g.chr8:20022571G>T		CCDS6013.1, CCDS47814.1, CCDS47815.1	8p21.3	2013-07-18	2013-07-18		ENSG00000036565	ENSG00000036565		"""Solute carriers"""	10934	protein-coding gene	gene with protein product		193002		VMAT1, VAT1			Standard	NM_003053		Approved	CGAT	uc003wzm.3	P54219	OTTHUMG00000097017	ENST00000276373.5:c.906C>A	8.37:g.20022571G>T						SLC18A1_uc003wzl.2_Silent_p.I89I|SLC18A1_uc003wzm.2_Silent_p.I302I|SLC18A1_uc011kyr.1_Silent_p.I302I|SLC18A1_uc003wzn.2_Silent_p.I302I|SLC18A1_uc010ltf.2_RNA|SLC18A1_uc003wzo.2_Silent_p.I302I	p.I302I	NM_001135691	NP_001129163	P54219	VMAT1_HUMAN		Colorectal(74;0.0747)	10	1377	-			302			Helical; (Potential).		E9PDJ5|Q9BRE4	Silent	SNP	ENST00000276373.5	37	c.906C>A	CCDS6013.1																																																																																				0.537	SLC18A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214106.1			19	68	1	0	3.99206e-14	0.007413	6.60504e-14	19	68				
KCNU1	157855	broad.mit.edu	37	8	36698038	36698038	+	Silent	SNP	C	C	T	rs199841533	byFrequency	TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr8:36698038C>T	ENST00000399881.3	+	15	1613	c.1576C>T	c.(1576-1578)Ctg>Ttg	p.L526L		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	526					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		AAACAAAATTCTGACCCAACG	0.413																																							uc010lvw.2		NA																	0				ovary(1)	1						c.(1576-1578)CTG>TTG		potassium channel, subfamily U, member 1							104.0	97.0	99.0					8																	36698038		1899	4112	6011	SO:0001819	synonymous_variant	157855					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity	g.chr8:36698038C>T	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.1576C>T	8.37:g.36698038C>T						KCNU1_uc003xjw.2_RNA	p.L526L	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN		KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)	15	1663	+			526			Cytoplasmic (Potential).			Silent	SNP	ENST00000399881.3	37	c.1576C>T	CCDS55220.1																																																																																				0.413	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836		5	18	0	0	0	0.000602	0	5	18				
NPBWR1	2831	broad.mit.edu	37	8	53853025	53853025	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr8:53853025C>A	ENST00000331251.3	+	1	2035	c.558C>A	c.(556-558)cgC>cgA	p.R186R		NM_005285.3	NP_005276.2	P48145	NPBW1_HUMAN	neuropeptides B/W receptor 1	186					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)|regulation of metabolic process (GO:0019222)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)	17		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				AGGGCCGGCGCCAGTGCGTGC	0.706																																							uc011ldu.1		NA																	0				ovary(2)|breast(1)	3						c.(556-558)CGC>CGA		G protein-coupled receptor 7							11.0	10.0	10.0					8																	53853025		2168	4244	6412	SO:0001819	synonymous_variant	2831				synaptic transmission	plasma membrane	opioid receptor activity|protein binding	g.chr8:53853025C>A	BC033145	CCDS6151.1	8p22-q21.13	2012-08-08	2006-02-15	2006-02-15		ENSG00000183729		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4522	protein-coding gene	gene with protein product		600730	"""G protein-coupled receptor 7"""	GPR7		7590751, 12401809	Standard	NM_005285		Approved		uc011ldu.2	P48145		ENST00000331251.3:c.558C>A	8.37:g.53853025C>A							p.R186R	NM_005285	NP_005276	P48145	NPBW1_HUMAN			1	558	+		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)	186			Extracellular (Potential).		Q6NTC7	Silent	SNP	ENST00000331251.3	37	c.558C>A	CCDS6151.1																																																																																				0.706	NPBWR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378047.1	NM_005285		4	14	1	0	0.00909568	0.009096	0.00960854	4	14				
NCOA2	10499	broad.mit.edu	37	8	71068967	71068967	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr8:71068967C>A	ENST00000452400.2	-	11	1814	c.1633G>T	c.(1633-1635)Ggg>Tgg	p.G545W	NCOA2_ENST00000524223.1_Intron	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	545					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)	p.G545R(1)	PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			AATGAGACCCCGTGCCCCTCG	0.512			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																		uc003xyn.1		NA		Dom	yes		8	8q13.1	10499	T	nuclear receptor coactivator 2 (TIF2)			L	RUNXBP2		AML	PAX3/NCOA2(4)	1	Substitution - Missense(1)		lung(1)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16						c.(1633-1635)GGG>TGG		nuclear receptor coactivator 2							89.0	87.0	88.0					8																	71068967		1889	4125	6014	SO:0001583	missense	10499				cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity	g.chr8:71068967C>A	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.1633G>T	8.37:g.71068967C>A	ENSP00000399968:p.Gly545Trp						p.G545W	NM_006540	NP_006531	Q15596	NCOA2_HUMAN	Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)		11	1795	-	Breast(64;0.201)		545					Q14CD2	Missense_Mutation	SNP	ENST00000452400.2	37	c.1633G>T	CCDS47872.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.985483	0.74589	.	.	ENSG00000140396	ENST00000452400	T	0.02323	4.34	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.16685	0.0401	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00007	-1.2502	10	0.87932	D	0	.	20.3368	0.98748	0.0:1.0:0.0:0.0	.	545	Q15596	NCOA2_HUMAN	W	545	ENSP00000399968:G545W	ENSP00000399968:G545W	G	-	1	0	NCOA2	71231521	0.999000	0.42202	0.997000	0.53966	0.989000	0.77384	4.545000	0.60698	2.805000	0.96524	0.655000	0.94253	GGG		0.512	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1			16	93	1	0	2.23348e-06	0.004007	2.77877e-06	16	93				
CALB1	793	broad.mit.edu	37	8	91075512	91075512	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr8:91075512G>C	ENST00000265431.3	-	8	724	c.543C>G	c.(541-543)ttC>ttG	p.F181L	CALB1_ENST00000518457.1_Missense_Mutation_p.F124L	NM_004929.2	NP_004920.1	P05937	CALB1_HUMAN	calbindin 1, 28kDa	181					cellular response to organic substance (GO:0071310)|cytosolic calcium ion homeostasis (GO:0051480)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|metanephric collecting duct development (GO:0072205)|metanephric connecting tubule development (GO:0072286)|metanephric distal convoluted tubule development (GO:0072221)|metanephric part of ureteric bud development (GO:0035502)|regulation of synaptic plasticity (GO:0048167)|retina layer formation (GO:0010842)|short-term memory (GO:0007614)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|vitamin D binding (GO:0005499)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(8)|pancreas(1)	11			BRCA - Breast invasive adenocarcinoma(11;0.00953)			TAAGTACCTGGAATTTAAGAA	0.284																																					Melanoma(46;573 1182 27367 39727 48386)	Melanoma(46;573 1182 27367 39727 48386)	uc003yel.1		NA																	0				pancreas(1)	1						c.(541-543)TTC>TTG		calbindin 1							30.0	30.0	30.0					8																	91075512		2177	4277	6454	SO:0001583	missense	793					nucleus	calcium ion binding|vitamin D binding	g.chr8:91075512G>C		CCDS6251.1	8q21.3	2013-01-10	2002-08-29		ENSG00000104327	ENSG00000104327		"""EF-hand domain containing"""	1434	protein-coding gene	gene with protein product		114050		CALB			Standard	NM_004929		Approved		uc003yel.1	P05937	OTTHUMG00000134314	ENST00000265431.3:c.543C>G	8.37:g.91075512G>C	ENSP00000265431:p.Phe181Leu					CALB1_uc011lge.1_Missense_Mutation_p.F124L	p.F181L	NM_004929	NP_004920	P05937	CALB1_HUMAN	BRCA - Breast invasive adenocarcinoma(11;0.00953)		8	725	-			181					B2R696|B7Z9J4	Missense_Mutation	SNP	ENST00000265431.3	37	c.543C>G	CCDS6251.1	.	.	.	.	.	.	.	.	.	.	G	19.07	3.755601	0.69648	.	.	ENSG00000104327	ENST00000265431;ENST00000518457	D;D	0.91351	-1.57;-2.83	5.9	3.57	0.40892	.	0.000000	0.85682	D	0.000000	D	0.93064	0.7792	M	0.66439	2.03	0.58432	D	0.999999	P	0.51933	0.949	D	0.69654	0.965	D	0.91025	0.4860	10	0.51188	T	0.08	-7.6843	7.814	0.29247	0.7671:0.0:0.2329:0.0	.	181	P05937	CALB1_HUMAN	L	181;124	ENSP00000265431:F181L;ENSP00000429602:F124L	ENSP00000265431:F181L	F	-	3	2	CALB1	91144688	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.743000	0.47442	0.525000	0.28522	-0.312000	0.09012	TTC		0.284	CALB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259338.2	NM_004929		5	19	0	0	0	0.000602	0	5	19				
CDH17	1015	broad.mit.edu	37	8	95178176	95178176	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr8:95178176A>T	ENST00000027335.3	-	10	1219	c.1095T>A	c.(1093-1095)caT>caA	p.H365Q	CDH17_ENST00000441892.2_Missense_Mutation_p.H151Q|CDH17_ENST00000450165.2_Missense_Mutation_p.H365Q	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	365	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			CATCCCTGTCATGTGCAGTAA	0.408																																							uc003ygh.2		NA																	0				ovary(5)|skin(1)	6						c.(1093-1095)CAT>CAA		cadherin 17 precursor							75.0	75.0	75.0					8																	95178176		2203	4300	6503	SO:0001583	missense	1015					integral to membrane	calcium ion binding	g.chr8:95178176A>T	X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1095T>A	8.37:g.95178176A>T	ENSP00000027335:p.His365Gln					CDH17_uc011lgo.1_Missense_Mutation_p.H151Q|CDH17_uc011lgp.1_Missense_Mutation_p.H365Q	p.H365Q	NM_004063	NP_004054	Q12864	CAD17_HUMAN	BRCA - Breast invasive adenocarcinoma(8;0.00691)		10	1220	-	Breast(36;4.65e-06)		365			Extracellular (Potential).|Cadherin 4.		Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	37	c.1095T>A	CCDS6260.1	.	.	.	.	.	.	.	.	.	.	A	11.91	1.779702	0.31502	.	.	ENSG00000079112	ENST00000027335;ENST00000441892;ENST00000450165	T;T;T	0.51071	0.72;4.71;0.72	5.89	-4.45	0.03546	Cadherin (4);Cadherin-like (1);	0.537282	0.16953	N	0.192836	T	0.29423	0.0733	L	0.42632	1.34	0.27635	N	0.947906	B;B	0.23490	0.01;0.086	B;B	0.25614	0.062;0.04	T	0.18587	-1.0332	10	0.22706	T	0.39	-3.1822	4.9182	0.13856	0.4359:0.0:0.3405:0.2236	.	151;365	E7EN24;Q12864	.;CAD17_HUMAN	Q	365;151;365	ENSP00000027335:H365Q;ENSP00000392811:H151Q;ENSP00000401468:H365Q	ENSP00000027335:H365Q	H	-	3	2	CDH17	95247352	0.006000	0.16342	0.008000	0.14137	0.011000	0.07611	-0.303000	0.08210	-0.780000	0.04553	0.459000	0.35465	CAT		0.408	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063		10	38	0	0	0	0.010729	0	10	38				
VPS13B	157680	broad.mit.edu	37	8	100844858	100844858	+	Missense_Mutation	SNP	C	C	T	rs149842139		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr8:100844858C>T	ENST00000358544.2	+	52	9778	c.9667C>T	c.(9667-9669)Cgg>Tgg	p.R3223W	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.R3198W	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3223					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CGGGAATTTCCGGGAAAATGG	0.468													C|||	1	0.000199681	0.0	0.0	5008	,	,		15825	0.0		0.001	False		,,,				2504	0.0				Colon(161;2205 2542 7338 31318)	Colon(161;2205 2542 7338 31318)	uc003yiv.2		NA																	0				ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20						c.(9667-9669)CGG>TGG		vacuolar protein sorting 13B isoform 5		C	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	50.0	54.0	53.0		9667,9592	1.8	0.2	8	dbSNP_134	53	39,8561	26.3+/-74.7	0,39,4261	yes	missense,missense	VPS13B	NM_017890.3,NM_152564.3	101,101	0,40,6463	TT,TC,CC		0.4535,0.0227,0.3076	possibly-damaging,possibly-damaging	3223/4023,3198/3998	100844858	40,12966	2203	4300	6503	SO:0001583	missense	157680				protein transport			g.chr8:100844858C>T	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.9667C>T	8.37:g.100844858C>T	ENSP00000351346:p.Arg3223Trp					VPS13B_uc003yiw.2_Missense_Mutation_p.R3198W	p.R3223W	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;0.00636)		52	9778	+	Breast(36;3.73e-07)		3223					C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	c.9667C>T	CCDS6280.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	9.638	1.138319	0.21123	2.27E-4	0.004535	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.69561	-0.41;-0.41	5.62	1.75	0.24633	.	0.391022	0.27744	N	0.018022	T	0.49762	0.1576	L	0.29908	0.895	0.09310	N	1	D;D	0.57257	0.979;0.964	B;B	0.43123	0.409;0.232	T	0.47736	-0.9094	10	0.66056	D	0.02	.	5.2663	0.15601	0.4668:0.2684:0.2648:0.0	.	3198;3223	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	W	3198;3223	ENSP00000349685:R3198W;ENSP00000351346:R3223W	ENSP00000349685:R3198W	R	+	1	2	VPS13B	100914034	0.000000	0.05858	0.168000	0.22838	0.351000	0.29236	0.228000	0.17814	0.061000	0.16311	-0.402000	0.06365	CGG		0.468	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042		18	64	0	0	0	0.00499	0	18	64				
RIMS2	9699	broad.mit.edu	37	8	105257206	105257206	+	Nonsense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr8:105257206G>T	ENST00000436393.2	+	24	3692	c.3451G>T	c.(3451-3453)Gaa>Taa	p.E1151*	RIMS2_ENST00000262231.10_Nonsense_Mutation_p.E972*|RIMS2_ENST00000507740.1_Nonsense_Mutation_p.E947*|RIMS2_ENST00000406091.3_Nonsense_Mutation_p.E1133*|RIMS2_ENST00000339750.2_Nonsense_Mutation_p.E69*			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1195					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CCTGGCCGTGGAAATGAGGAA	0.463										HNSCC(12;0.0054)																													uc003yls.2		NA																	0				ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15						c.(3451-3453)GAA>TAA		regulating synaptic membrane exocytosis 2							130.0	136.0	134.0					8																	105257206		2024	4188	6212	SO:0001587	stop_gained	9699				intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding	g.chr8:105257206G>T	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3451G>T	8.37:g.105257206G>T	ENSP00000390665:p.Glu1151*	HNSCC(12;0.0054)				RIMS2_uc003ylp.2_Nonsense_Mutation_p.E1133*|RIMS2_uc003ylw.2_Nonsense_Mutation_p.E1140*|RIMS2_uc003ylq.2_Nonsense_Mutation_p.E947*|RIMS2_uc003ylr.2_Nonsense_Mutation_p.E972*	p.E1151*	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)		24	3692	+			1195					B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Nonsense_Mutation	SNP	ENST00000436393.2	37	c.3451G>T		.	.	.	.	.	.	.	.	.	.	G	41	8.907749	0.98998	.	.	ENSG00000176406	ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393;ENST00000523362;ENST00000339750	.	.	.	5.05	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	18.5918	0.91215	0.0:0.0:1.0:0.0	.	.	.	.	X	1170;1133;1195;972;947;1140;1151;69;69	.	ENSP00000262231:E972X	E	+	1	0	RIMS2	105326382	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.860000	0.86993	2.623000	0.88846	0.650000	0.86243	GAA		0.463	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117		33	127	1	0	1.99505e-19	0.012213	3.65186e-19	33	127				
DCSTAMP	81501	broad.mit.edu	37	8	105361085	105361085	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr8:105361085G>T	ENST00000297581.2	+	2	354	c.305G>T	c.(304-306)gGc>gTc	p.G102V	DCSTAMP_ENST00000517991.1_Missense_Mutation_p.G102V|DPYS_ENST00000521601.1_Intron	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	102					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											ATTGCAGCTGGCACAGGGATC	0.448																																							uc003ylx.1		NA																	0				pancreas(2)|large_intestine(1)|ovary(1)	4						c.(304-306)GGC>GTC		dendritic cell-specific transmembrane protein							65.0	64.0	64.0					8																	105361085		2203	4300	6503	SO:0001583	missense	81501				osteoclast differentiation	cell surface|integral to membrane|plasma membrane		g.chr8:105361085G>T	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.305G>T	8.37:g.105361085G>T	ENSP00000297581:p.Gly102Val						p.G102V	NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)		2	354	+			102			Helical; (Potential).		B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	ENST00000297581.2	37	c.305G>T	CCDS6301.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.662390	0.88251	.	.	ENSG00000164935	ENST00000297581;ENST00000517991	T	0.30182	1.54	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.55784	0.1942	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.49735	-0.8908	9	.	.	.	-17.3213	18.3185	0.90229	0.0:0.0:1.0:0.0	.	102	Q9H295	TM7S4_HUMAN	V	102	ENSP00000297581:G102V	.	G	+	2	0	TM7SF4	105430261	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.090000	0.89526	2.779000	0.95612	0.655000	0.94253	GGC		0.448	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1	NM_030788		13	56	1	0	2.68362e-12	0.013537	4.2524e-12	13	56				
CSMD3	114788	broad.mit.edu	37	8	113402960	113402960	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr8:113402960G>T	ENST00000297405.5	-	36	6111	c.5867C>A	c.(5866-5868)cCt>cAt	p.P1956H	CSMD3_ENST00000352409.3_Missense_Mutation_p.P1886H|CSMD3_ENST00000455883.2_Missense_Mutation_p.P1852H|CSMD3_ENST00000343508.3_Missense_Mutation_p.P1916H	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1956	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATAAGGCTCAGGGTATCCAGG	0.403										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(5866-5868)CCT>CAT		CUB and Sushi multiple domains 3 isoform 1							91.0	85.0	87.0					8																	113402960		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113402960G>T	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5867C>A	8.37:g.113402960G>T	ENSP00000297405:p.Pro1956His	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Missense_Mutation_p.P1158H|CSMD3_uc003ynt.2_Missense_Mutation_p.P1916H|CSMD3_uc011lhx.1_Missense_Mutation_p.P1852H	p.P1956H	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			36	6026	-			1956			Extracellular (Potential).|CUB 11.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.5867C>A	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.581456	0.86748	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59	5.14	5.14	0.70334	CUB (5);	0.000000	0.64402	D	0.000001	D	0.83931	0.5361	H	0.98577	4.27	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.89708	0.3910	10	0.59425	D	0.04	.	18.7912	0.91974	0.0:0.0:1.0:0.0	.	1852;1956;1916	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	H	1916;1956;1226;1852;1886	ENSP00000345799:P1916H;ENSP00000297405:P1956H;ENSP00000341558:P1226H;ENSP00000412263:P1852H;ENSP00000343124:P1886H	ENSP00000297405:P1956H	P	-	2	0	CSMD3	113472136	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	9.643000	0.98464	2.677000	0.91161	0.467000	0.42956	CCT		0.403	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		14	36	1	0	6.81908e-15	0.00245	1.14914e-14	14	36				
CSMD3	114788	broad.mit.edu	37	8	113697783	113697783	+	Missense_Mutation	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr8:113697783T>A	ENST00000297405.5	-	15	2578	c.2334A>T	c.(2332-2334)aaA>aaT	p.K778N	CSMD3_ENST00000352409.3_Missense_Mutation_p.K778N|CSMD3_ENST00000455883.2_Missense_Mutation_p.K674N|CSMD3_ENST00000343508.3_Missense_Mutation_p.K738N	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	778	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AGTCACCATCTTTAACAGCAA	0.433										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																													uc003ynu.2		NA																	0				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(2332-2334)AAA>AAT		CUB and Sushi multiple domains 3 isoform 1							100.0	103.0	102.0					8																	113697783		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113697783T>A	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2334A>T	8.37:g.113697783T>A	ENSP00000297405:p.Lys778Asn	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Missense_Mutation_p.K50N|CSMD3_uc003ynt.2_Missense_Mutation_p.K738N|CSMD3_uc011lhx.1_Missense_Mutation_p.K674N	p.K778N	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			15	2493	-			778			Extracellular (Potential).|CUB 4.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.2334A>T	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	16.56	3.158284	0.57368	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.59772	0.24;0.24;0.24;0.24;0.24	5.96	4.83	0.62350	CUB (5);	0.064573	0.64402	D	0.000013	T	0.66636	0.2809	L	0.49126	1.545	0.32081	N	0.593134	P;D;D	0.89917	0.712;0.979;1.0	P;D;D	0.97110	0.617;0.948;1.0	T	0.67612	-0.5626	10	0.23891	T	0.37	.	10.6529	0.45659	0.0:0.1005:0.0:0.8995	.	674;778;738	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	N	738;778;118;674;778	ENSP00000345799:K738N;ENSP00000297405:K778N;ENSP00000341558:K118N;ENSP00000412263:K674N;ENSP00000343124:K778N	ENSP00000297405:K778N	K	-	3	2	CSMD3	113766959	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.807000	0.27140	2.279000	0.76181	0.533000	0.62120	AAA		0.433	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		21	71	0	0	0	0.010504	0	21	71				
TG	7038	broad.mit.edu	37	8	133935738	133935738	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr8:133935738G>T	ENST00000220616.4	+	22	4724	c.4684G>T	c.(4684-4686)Gac>Tac	p.D1562Y	TG_ENST00000542445.1_5'UTR|TG_ENST00000377869.1_Intron	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1562	Thyroglobulin type-1 11. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CCCTCTTGAGGACTCACAGTG	0.582																																							uc003ytw.2		NA																	0				ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15						c.(4684-4686)GAC>TAC		thyroglobulin precursor							60.0	58.0	59.0					8																	133935738		2203	4300	6503	SO:0001583	missense	7038				hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity	g.chr8:133935738G>T	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4684G>T	8.37:g.133935738G>T	ENSP00000220616:p.Asp1562Tyr					TG_uc010mdw.2_Missense_Mutation_p.D321Y|TG_uc011ljb.1_5'UTR|TG_uc003ytx.1_Intron	p.D1562Y	NM_003235	NP_003226	P01266	THYG_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)	22	4725	+	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	1562			Thyroglobulin type-1 11.		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	c.4684G>T	CCDS34944.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.48|10.48	1.362746|1.362746	0.24684|0.24684	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000543313;ENST00000220616|ENST00000519178	T|.	0.68903|.	-0.36|.	4.84|4.84	3.74|3.74	0.42951|0.42951	Thyroglobulin type-1 (3);|.	0.444861|.	0.21139|.	N|.	0.079512|.	T|T	0.54351|0.54351	0.1853|0.1853	M|M	0.69823|0.69823	2.125|2.125	0.09310|0.09310	N|N	0.999992|0.999992	D|.	0.76494|.	0.999|.	P|.	0.60173|.	0.87|.	T|T	0.46638|0.46638	-0.9177|-0.9177	10|5	0.87932|.	D|.	0|.	.|.	8.9343|8.9343	0.35691|0.35691	0.1223:0.0:0.8777:0.0|0.1223:0.0:0.8777:0.0	.|.	1562|.	P01266|.	THYG_HUMAN|.	Y|V	368;1562|81	ENSP00000220616:D1562Y|.	ENSP00000220616:D1562Y|.	D|G	+|+	1|2	0|0	TG|TG	134004920|134004920	0.947000|0.947000	0.32204|0.32204	0.740000|0.740000	0.30986|0.30986	0.176000|0.176000	0.22953|0.22953	2.988000|2.988000	0.49386|0.49386	2.247000|2.247000	0.74100|0.74100	0.555000|0.555000	0.69702|0.69702	GAC|GGA		0.582	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235		13	42	1	0	4.36969e-10	0.001855	6.41358e-10	13	42				
FAM135B	51059	broad.mit.edu	37	8	139144923	139144923	+	Silent	SNP	G	G	A	rs371041013	byFrequency	TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr8:139144923G>A	ENST00000395297.1	-	20	4304	c.4134C>T	c.(4132-4134)atC>atT	p.I1378I		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1378										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CGGCTCGGCCGATCAGGGTGT	0.537										HNSCC(54;0.14)			G|||	4	0.000798722	0.003	0.0	5008	,	,		16467	0.0		0.0	False		,,,				2504	0.0						uc003yuy.2		NA																	0				ovary(7)|skin(2)	9						c.(4132-4134)ATC>ATT		hypothetical protein LOC51059		G		19,3915		0,19,1948	196.0	207.0	203.0		4134	-2.7	1.0	8		203	1,8303		0,1,4151	no	coding-synonymous	FAM135B	NM_015912.3		0,20,6099	AA,AG,GG		0.012,0.483,0.1634		1378/1407	139144923	20,12218	1967	4152	6119	SO:0001819	synonymous_variant	51059							g.chr8:139144923G>A	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.4134C>T	8.37:g.139144923G>A		HNSCC(54;0.14)				FAM135B_uc003yux.2_Silent_p.I1279I|FAM135B_uc003yuz.2_RNA	p.I1378I	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0805)		20	4305	-	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		1378					B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	ENST00000395297.1	37	c.4134C>T	CCDS6375.2																																																																																				0.537	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912		53	239	0	0	0	0.01441	0	53	239				
CYP11B2	1585	broad.mit.edu	37	8	143994787	143994787	+	Silent	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr8:143994787C>G	ENST00000323110.2	-	6	1037	c.1035G>C	c.(1033-1035)ctG>ctC	p.L345L		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	345					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	CTGCGGCGGCCAGGCTCTCCT	0.637									Familial Hyperaldosteronism type I																														uc003yxk.1		NA																	0					0						c.(1033-1035)CTG>CTC		cytochrome P450, family 11, subfamily B,	Candesartan(DB00796)|Metyrapone(DB01011)																																			SO:0001819	synonymous_variant	1585	Familial_Hyperaldosteronism_type_I	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity	g.chr8:143994787C>G	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.1035G>C	8.37:g.143994787C>G							p.L345L	NM_000498	NP_000489	P19099	C11B2_HUMAN			6	1038	-	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)		345					B0ZBE4|Q16726	Silent	SNP	ENST00000323110.2	37	c.1035G>C	CCDS6393.1																																																																																				0.637	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1			26	121	0	0	0	0.004656	0	26	121				
ZNF34	80778	broad.mit.edu	37	8	145999678	145999678	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr8:145999678G>A	ENST00000343459.4	-	6	721	c.656C>T	c.(655-657)tCa>tTa	p.S219L	ZNF34_ENST00000429371.2_Missense_Mutation_p.S198L			Q8IZ26	ZNF34_HUMAN	zinc finger protein 34	219					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.221)	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;5.18e-38)|all cancers(56;4.41e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.0179)		TGTTTTTTTTGACCTGTGTAC	0.358																																							uc003zdy.3		NA																	0					0						c.(655-657)TCA>TTA		zinc finger protein 34							54.0	53.0	53.0					8																	145999678		1882	4110	5992	SO:0001583	missense	80778				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr8:145999678G>A	BC028136	CCDS47945.1, CCDS69562.1	8q24	2013-01-08	2006-05-11					"""Zinc fingers, C2H2-type"", ""-"""	13098	protein-coding gene	gene with protein product		194526	"""zinc finger protein 34 (KOX 32)"""			8104631, 2014798	Standard	XM_005272349		Approved	KOX32	uc003zdy.4	Q8IZ26		ENST00000343459.4:c.656C>T	8.37:g.145999678G>A	ENSP00000341528:p.Ser219Leu					ZNF34_uc010mgb.2_Missense_Mutation_p.S116L|ZNF34_uc003zdx.3_Missense_Mutation_p.S198L	p.S219L	NM_030580	NP_085057	Q8IZ26	ZNF34_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;5.18e-38)|all cancers(56;4.41e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.0179)	6	758	-	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.221)	219					D3DWN1|Q9BSZ0	Missense_Mutation	SNP	ENST00000343459.4	37	c.656C>T	CCDS47945.1	.	.	.	.	.	.	.	.	.	.	G	7.964	0.747650	0.15710	.	.	ENSG00000196378	ENST00000449516;ENST00000527190;ENST00000343459;ENST00000429371;ENST00000534337	T;T;T	0.60672	0.17;0.17;0.17	3.77	-1.63	0.08345	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.43456	0.1248	L	0.36672	1.1	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.38972	-0.9636	9	0.87932	D	0	.	7.6651	0.28426	0.1859:0.5691:0.245:0.0	.	178;219	E7EN25;Q8IZ26	.;ZNF34_HUMAN	L	178;148;219;198;158	ENSP00000341528:S219L;ENSP00000396894:S198L;ENSP00000434049:S158L	ENSP00000341528:S219L	S	-	2	0	ZNF34	145970482	0.000000	0.05858	0.000000	0.03702	0.213000	0.24496	-1.144000	0.03197	-0.356000	0.08187	-0.192000	0.12808	TCA		0.358	ZNF34-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382936.1	NM_030580		8	30	0	0	0	0.00308	0	8	30				
RANBP6	26953	broad.mit.edu	37	9	6015050	6015050	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr9:6015050G>A	ENST00000259569.5	-	1	568	c.558C>T	c.(556-558)gaC>gaT	p.D186D	RANBP6_ENST00000485372.1_Intron	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	186					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		GAATACACTGGTCCAACAACC	0.428																																							uc003zjr.2		NA																	0				ovary(3)	3						c.(556-558)GAC>GAT		RAN binding protein 6							82.0	72.0	76.0					9																	6015050		2203	4300	6503	SO:0001819	synonymous_variant	26953				protein transport	cytoplasm|nucleus	binding	g.chr9:6015050G>A	AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.558C>T	9.37:g.6015050G>A						RANBP6_uc011lmf.1_Intron|RANBP6_uc003zjs.2_Intron	p.D186D	NM_012416	NP_036548	O60518	RNBP6_HUMAN		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)	1	569	-		Acute lymphoblastic leukemia(23;0.158)	186					Q5T7X4|Q7Z3V2|Q96E78	Silent	SNP	ENST00000259569.5	37	c.558C>T	CCDS6467.1																																																																																				0.428	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416		14	51	0	0	0	0.001855	0	14	51				
PTPRD	5789	broad.mit.edu	37	9	8492961	8492961	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr9:8492961G>T	ENST00000381196.4	-	24	2911	c.2368C>A	c.(2368-2370)Ctc>Atc	p.L790I	PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000360074.4_Missense_Mutation_p.L777I|PTPRD_ENST00000358503.5_Missense_Mutation_p.L768I|PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000486161.1_Intron|PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000356435.5_Missense_Mutation_p.L790I|PTPRD_ENST00000397617.3_Intron|PTPRD_ENST00000471274.1_5'UTR|PTPRD_ENST00000540109.1_Missense_Mutation_p.L790I|PTPRD_ENST00000397606.3_Intron	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	790	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TCAGGCTGGAGCCCAGAAATG	0.498										TSP Lung(15;0.13)																													uc003zkk.2		NA																	0				lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(2368-2370)CTC>ATC		protein tyrosine phosphatase, receptor type, D							196.0	167.0	177.0					9																	8492961		2203	4300	6503	SO:0001583	missense	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8492961G>T	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.2368C>A	9.37:g.8492961G>T	ENSP00000370593:p.Leu790Ile	TSP Lung(15;0.13)				PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Missense_Mutation_p.L781I|PTPRD_uc003zkm.2_Missense_Mutation_p.L777I|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	p.L790I	NM_002839	NP_002830	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	26	3079	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	790			Fibronectin type-III 5.|Extracellular (Potential).		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	c.2368C>A	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.977231	0.74360	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000540109	D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86	5.27	5.27	0.74061	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	D	0.95652	0.8586	H	0.98155	4.16	0.58432	D	0.999999	D;D;D	0.76494	0.997;0.999;0.999	D;D;D	0.80764	0.911;0.994;0.984	D	0.97395	0.9992	9	.	.	.	.	18.8589	0.92265	0.0:0.0:1.0:0.0	.	777;790;790	G3XAE2;Q2HXI4;P23468	.;.;PTPRD_HUMAN	I	790;790;777;768;790	ENSP00000370593:L790I;ENSP00000348812:L790I;ENSP00000353187:L777I;ENSP00000351293:L768I;ENSP00000438164:L790I	.	L	-	1	0	PTPRD	8482961	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.054000	0.71096	2.465000	0.83290	0.484000	0.47621	CTC		0.498	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			22	87	1	0	1.87028e-06	0.012319	2.35915e-06	22	87				
ELAVL2	1993	broad.mit.edu	37	9	23701398	23701398	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr9:23701398G>T	ENST00000397312.2	-	5	966	c.692C>A	c.(691-693)gCt>gAt	p.A231D	ELAVL2_ENST00000380110.4_Missense_Mutation_p.A260D|ELAVL2_ENST00000223951.6_Missense_Mutation_p.A231D|ELAVL2_ENST00000380117.1_Missense_Mutation_p.A231D|ELAVL2_ENST00000544538.1_Missense_Mutation_p.A231D	NM_004432.3	NP_004423.2	Q12926	ELAV2_HUMAN	ELAV like neuron-specific RNA binding protein 2	231					regulation of transcription, DNA-templated (GO:0006355)		mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		TGCCTGCTGAGCTAGCGGTCC	0.443																																							uc003zpu.2		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(691-693)GCT>GAT		ELAV (embryonic lethal, abnormal vision,							280.0	273.0	275.0					9																	23701398		2203	4300	6503	SO:0001583	missense	1993				regulation of transcription, DNA-dependent		mRNA 3'-UTR binding|nucleotide binding|protein binding	g.chr9:23701398G>T	BC030692	CCDS6515.1, CCDS55298.1	9p21	2013-10-03	2013-10-03		ENSG00000107105	ENSG00000107105		"""RNA binding motif (RRM) containing"""	3313	protein-coding gene	gene with protein product	"""Hu antigen B"""	601673	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)"""			8812435	Standard	NM_004432		Approved	HuB, HEL-N1	uc003zpu.3	Q12926	OTTHUMG00000019700	ENST00000397312.2:c.692C>A	9.37:g.23701398G>T	ENSP00000380479:p.Ala231Asp					ELAVL2_uc003zps.2_Missense_Mutation_p.A231D|ELAVL2_uc003zpt.2_Missense_Mutation_p.A231D|ELAVL2_uc003zpv.2_Missense_Mutation_p.A231D|ELAVL2_uc003zpw.2_Missense_Mutation_p.A231D	p.A231D	NM_004432	NP_004423	Q12926	ELAV2_HUMAN		GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)	5	967	-			231					D3DRK3|Q13235|Q59G15|Q8NEM4|Q9H1Q8	Missense_Mutation	SNP	ENST00000397312.2	37	c.692C>A	CCDS6515.1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.438926	0.63067	.	.	ENSG00000107105	ENST00000223951;ENST00000397312;ENST00000544538;ENST00000380110;ENST00000380117;ENST00000359598	T;T;T;T	0.15139	2.45;2.89;2.89;2.89	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.17916	0.0430	L	0.29908	0.895	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.12156	0.007;0.003	T	0.03157	-1.1066	10	0.87932	D	0	.	20.3241	0.98686	0.0:0.0:1.0:0.0	.	231;231	Q12926;Q12926-2	ELAV2_HUMAN;.	D	231;231;231;231;231;259	ENSP00000223951:A231D;ENSP00000380479:A231D;ENSP00000440998:A231D;ENSP00000369460:A231D	ENSP00000223951:A231D	A	-	2	0	ELAVL2	23691398	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.641000	0.54360	2.812000	0.96745	0.563000	0.77884	GCT		0.443	ELAVL2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051943.2	NM_004432		49	203	1	0	9.57592e-29	0.01441	1.81543e-28	49	203				
ROR2	4920	broad.mit.edu	37	9	94486708	94486708	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr9:94486708G>T	ENST00000375708.3	-	9	2266	c.2068C>A	c.(2068-2070)Ctg>Atg	p.L690M	ROR2_ENST00000550066.1_5'UTR|ROR2_ENST00000375715.1_Missense_Mutation_p.L550M	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	690	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						TAGGGCTGCAGGCCGTAGCTG	0.617																																							uc004arj.1		NA																	0				lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						c.(2068-2070)CTG>ATG		receptor tyrosine kinase-like orphan receptor 2							75.0	59.0	65.0					9																	94486708		2203	4300	6503	SO:0001583	missense	4920				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding	g.chr9:94486708G>T	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.2068C>A	9.37:g.94486708G>T	ENSP00000364860:p.Leu690Met					ROR2_uc004ari.1_Missense_Mutation_p.L550M	p.L690M	NM_004560	NP_004551	Q01974	ROR2_HUMAN			9	2267	-			690			Cytoplasmic (Potential).|Protein kinase.		Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	ENST00000375708.3	37	c.2068C>A	CCDS6691.1	.	.	.	.	.	.	.	.	.	.	G	13.07	2.127887	0.37533	.	.	ENSG00000169071	ENST00000375715;ENST00000375708	D;D	0.82619	-1.63;-1.63	4.65	3.73	0.42828	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.33290	N	0.005077	D	0.83995	0.5375	L	0.35414	1.06	0.58432	D	0.999998	D;P	0.76494	0.999;0.922	D;P	0.87578	0.998;0.754	T	0.83297	-0.0030	10	0.54805	T	0.06	.	8.3972	0.32564	0.232:0.0:0.768:0.0	.	690;550	Q01974;B1APY4	ROR2_HUMAN;.	M	550;690	ENSP00000364867:L550M;ENSP00000364860:L690M	ENSP00000364860:L690M	L	-	1	2	ROR2	93526529	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.701000	0.47094	2.415000	0.81967	0.561000	0.74099	CTG		0.617	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1			20	46	1	0	5.03518e-11	0.007413	7.67323e-11	20	46				
COL15A1	1306	broad.mit.edu	37	9	101810113	101810113	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr9:101810113G>T	ENST00000375001.3	+	27	3148	c.2725G>T	c.(2725-2727)Ggg>Tgg	p.G909W		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	909	Collagen-like 4.|Triple-helical region 5 (COL5).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				TGGCCTTCCCGGGCGACCTGT	0.542																																							uc004azb.1		NA																	0				ovary(6)	6						c.(2725-2727)GGG>TGG		alpha 1 type XV collagen precursor							134.0	134.0	134.0					9																	101810113		2203	4300	6503	SO:0001583	missense	1306				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding	g.chr9:101810113G>T	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.2725G>T	9.37:g.101810113G>T	ENSP00000364140:p.Gly909Trp						p.G909W	NM_001855	NP_001846	P39059	COFA1_HUMAN			27	2931	+		Acute lymphoblastic leukemia(62;0.0562)	909			Triple-helical region 5 (COL5).		Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	c.2725G>T	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	G	12.64	1.999292	0.35226	.	.	ENSG00000204291	ENST00000375001	D	0.99369	-5.78	5.74	5.74	0.90152	C-type lectin fold (1);	0.000000	0.85682	D	0.000000	D	0.99715	0.9890	H	0.99357	4.53	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.97256	0.9901	10	0.87932	D	0	-12.853	15.4078	0.74893	0.0:0.0:1.0:0.0	.	909	P39059	COFA1_HUMAN	W	909	ENSP00000364140:G909W	ENSP00000364140:G909W	G	+	1	0	COL15A1	100849934	1.000000	0.71417	0.961000	0.40146	0.284000	0.27059	6.953000	0.75995	2.714000	0.92807	0.585000	0.79938	GGG		0.542	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855		66	123	1	0	1.92745e-42	0.01441	3.70932e-42	66	123				
OR1J4	26219	broad.mit.edu	37	9	125281713	125281713	+	Silent	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr9:125281713A>G	ENST00000340750.1	+	1	294	c.294A>G	c.(292-294)gtA>gtG	p.V98V		NM_001004452.1	NP_001004452.1	Q8NGS1	OR1J4_HUMAN	olfactory receptor, family 1, subfamily J, member 4	98						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	20						CAGGGTGTGTAACTCAGATGT	0.423																																							uc011lyw.1		NA																	0					0						c.(292-294)GTA>GTG		olfactory receptor, family 1, subfamily J,							200.0	189.0	193.0					9																	125281713		2203	4300	6503	SO:0001819	synonymous_variant	26219				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:125281713A>G	X64979	CCDS35122.1	9q33.2	2013-09-20			ENSG00000239590	ENSG00000239590		"""GPCR / Class A : Olfactory receptors"""	8211	protein-coding gene	gene with protein product						1370859	Standard	NM_001004452		Approved	HTPCRX01, HSHTPCRX01	uc011lyw.2	Q8NGS1	OTTHUMG00000020606	ENST00000340750.1:c.294A>G	9.37:g.125281713A>G							p.V98V	NM_001004452	NP_001004452	Q8NGS1	OR1J4_HUMAN			1	294	+			98			Extracellular (Potential).		A3KFM0|Q6IEZ3|Q96R89	Silent	SNP	ENST00000340750.1	37	c.294A>G	CCDS35122.1																																																																																				0.423	OR1J4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053936.1			55	120	0	0	0	0.01441	0	55	120				
NR5A1	2516	broad.mit.edu	37	9	127255381	127255381	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr9:127255381C>T	ENST00000373588.4	-	5	1114	c.918G>A	c.(916-918)ctG>ctA	p.L306L		NM_004959.4	NP_004950.2	Q13285	STF1_HUMAN	nuclear receptor subfamily 5, group A, member 1	306	Important for dimerization.|Ligand-binding.				adrenal gland development (GO:0030325)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|hormone metabolic process (GO:0042445)|intracellular receptor signaling pathway (GO:0030522)|luteinization (GO:0001553)|maintenance of protein location in nucleus (GO:0051457)|male gonad development (GO:0008584)|multicellular organismal aging (GO:0010259)|negative regulation of female gonad development (GO:2000195)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|primary sex determination (GO:0007538)|regulation of steroid biosynthetic process (GO:0050810)|tissue development (GO:0009888)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(1)|upper_aerodigestive_tract(1)	2						GGTCGAACACCAGCAGCTCGC	0.692																																							uc004boo.1		NA																	0					0						c.(916-918)CTG>CTA		nuclear receptor subfamily 5, group A, member 1							40.0	34.0	36.0					9																	127255381		2202	4299	6501	SO:0001819	synonymous_variant	2516				cell-cell signaling|male gonad development|positive regulation of transcription from RNA polymerase II promoter|primary sex determination|regulation of steroid biosynthetic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|phospholipid binding|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding	g.chr9:127255381C>T	D88155	CCDS6856.1	9q33	2013-01-16			ENSG00000136931	ENSG00000136931		"""Nuclear hormone receptors"""	7983	protein-coding gene	gene with protein product		184757		FTZF1		7789992	Standard	NM_004959		Approved	FTZ1, SF-1, ELP, AD4BP	uc004boo.1	Q13285	OTTHUMG00000020655	ENST00000373588.4:c.918G>A	9.37:g.127255381C>T							p.L306L	NM_004959	NP_004950	Q13285	STF1_HUMAN			5	1105	-			306			Important for dimerization.|Ligand-binding.		O15196|Q5T6F5	Silent	SNP	ENST00000373588.4	37	c.918G>A	CCDS6856.1																																																																																				0.692	NR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054029.1	NM_004959		14	20	0	0	0	0.001855	0	14	20				
COL5A1	1289	broad.mit.edu	37	9	137676928	137676928	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr9:137676928C>T	ENST00000371817.3	+	30	2992	c.2578C>T	c.(2578-2580)Ccc>Tcc	p.P860S		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	860	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TCCTCTGGGACCCCCTGGGGA	0.657																																							uc004cfe.2		NA																	0				skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11						c.(2578-2580)CCC>TCC		alpha 1 type V collagen preproprotein							32.0	37.0	35.0					9																	137676928		2203	4300	6503	SO:0001583	missense	1289				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding	g.chr9:137676928C>T	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.2578C>T	9.37:g.137676928C>T	ENSP00000360882:p.Pro860Ser						p.P860S	NM_000093	NP_000084	P20908	CO5A1_HUMAN		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)	30	2960	+		Myeloproliferative disorder(178;0.0341)	860			Triple-helical region.		Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	c.2578C>T	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	c	4.915	0.169994	0.09339	.	.	ENSG00000130635	ENST00000371817	D	0.96802	-4.13	4.41	4.41	0.53225	.	0.154081	0.43416	U	0.000562	D	0.94703	0.8291	L	0.50919	1.6	0.45239	D	0.998247	B	0.33807	0.426	B	0.42653	0.394	D	0.92655	0.6136	10	0.07325	T	0.83	.	15.7722	0.78180	0.0:1.0:0.0:0.0	.	860	P20908	CO5A1_HUMAN	S	860	ENSP00000360882:P860S	ENSP00000360882:P860S	P	+	1	0	COL5A1	136816749	0.978000	0.34361	0.951000	0.38953	0.387000	0.30353	3.864000	0.56024	2.004000	0.58718	0.306000	0.20318	CCC		0.657	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093		4	44	0	0	0	0.009096	0	4	44				
CACNA1B	774	broad.mit.edu	37	9	140991002	140991002	+	Missense_Mutation	SNP	C	C	A	rs201483132		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr9:140991002C>A	ENST00000371372.1	+	37	5306	c.5161C>A	c.(5161-5163)Cta>Ata	p.L1721I	CACNA1B_ENST00000371365.2_Missense_Mutation_p.L85I|CACNA1B_ENST00000371363.1_Missense_Mutation_p.L1719I|CACNA1B_ENST00000277549.5_Missense_Mutation_p.L915I|CACNA1B_ENST00000371355.4_Missense_Mutation_p.L1722I|CACNA1B_ENST00000277551.2_Missense_Mutation_p.L1721I|CACNA1B_ENST00000371357.1_Missense_Mutation_p.L1720I	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1721					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CTCTTCCATCCTAGGTCCTCA	0.557																																							uc004cog.2		NA																	0				breast(3)|large_intestine(2)|ovary(1)	6						c.(5161-5163)CTA>ATA		calcium channel, voltage-dependent, N type,	Amlodipine(DB00381)|Gabapentin(DB00996)						128.0	129.0	128.0					9																	140991002		2142	4270	6412	SO:0001583	missense	774				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity	g.chr9:140991002C>A	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.5161C>A	9.37:g.140991002C>A	ENSP00000360423:p.Leu1721Ile					CACNA1B_uc004coi.2_Missense_Mutation_p.L933I|CACNA1B_uc004cok.1_RNA|CACNA1B_uc010ncp.1_Intron	p.L1721I	NM_000718	NP_000709	Q00975	CAC1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	36	5306	+	all_cancers(76;0.166)		1721			Cytoplasmic (Potential).		B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	37	c.5161C>A	CCDS59522.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.96|19.96	3.923007|3.923007	0.73213|0.73213	.|.	.|.	ENSG00000148408|ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355;ENST00000371365|ENST00000413253	D;D;D;D;D;D;D|.	0.98028|.	-4.42;-4.43;-4.67;-4.41;-4.4;-4.41;-4.43|.	4.44|4.44	2.49|2.49	0.30216|0.30216	.|.	0.000000|.	0.64402|.	D|.	0.000007|.	T|T	0.80681|0.80681	0.4669|0.4669	H|H	0.94462|0.94462	3.54|3.54	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.998;0.998|.	T|T	0.81812|0.81812	-0.0761|-0.0761	10|5	0.87932|.	D|.	0|.	.|.	9.6128|9.6128	0.39674|0.39674	0.0:0.8183:0.0:0.1817|0.0:0.8183:0.0:0.1817	.|.	1720;1719|.	B1AQK7;B1AQK6|.	.;.|.	I|H	1721;1721;915;1719;1720;1722;85|85	ENSP00000360423:L1721I;ENSP00000277551:L1721I;ENSP00000277549:L915I;ENSP00000360414:L1719I;ENSP00000360408:L1720I;ENSP00000360406:L1722I;ENSP00000360416:L85I|.	ENSP00000277549:L915I|.	L|P	+|+	1|2	2|0	CACNA1B|CACNA1B	140110823|140110823	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.635000|2.635000	0.46537|0.46537	0.376000|0.376000	0.24707|0.24707	0.557000|0.557000	0.71058|0.71058	CTA|CCT		0.557	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718		26	58	1	0	3.28513e-13	0.003954	5.33833e-13	26	58				
ARSF	416	broad.mit.edu	37	X	3002504	3002504	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:3002504C>A	ENST00000381127.1	+	6	848	c.627C>A	c.(625-627)agC>agA	p.S209R	ARSF_ENST00000537104.1_Missense_Mutation_p.S209R|ARSF_ENST00000359361.2_Missense_Mutation_p.S209R	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	209					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGAAGCTGAGCGGCTGGGTCT	0.517																																							uc004cre.1		NA																	0				ovary(2)	2						c.(625-627)AGC>AGA		arylsulfatase F precursor							130.0	106.0	114.0					X																	3002504		2203	4300	6503	SO:0001583	missense	416					extracellular region	arylsulfatase activity|metal ion binding	g.chrX:3002504C>A	X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.627C>A	X.37:g.3002504C>A	ENSP00000370519:p.Ser209Arg					ARSF_uc004crf.1_Missense_Mutation_p.S209R	p.S209R	NM_004042	NP_004033	P54793	ARSF_HUMAN			6	848	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	209					Q8TCC5	Missense_Mutation	SNP	ENST00000381127.1	37	c.627C>A	CCDS14123.1	.	.	.	.	.	.	.	.	.	.	c	5.239	0.229555	0.09916	.	.	ENSG00000062096	ENST00000381127;ENST00000537104;ENST00000359361	D;D;D	0.93076	-3.16;-3.16;-3.16	3.44	-6.89	0.01660	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.737822	0.12828	U	0.435898	T	0.76097	0.3940	N	0.03967	-0.31	0.09310	N	1	B	0.12630	0.006	B	0.21917	0.037	T	0.70850	-0.4760	10	0.10902	T	0.67	.	4.8105	0.13340	0.2107:0.5239:0.1139:0.1515	.	209	P54793	ARSF_HUMAN	R	209	ENSP00000370519:S209R;ENSP00000445594:S209R;ENSP00000352319:S209R	ENSP00000352319:S209R	S	+	3	2	ARSF	3012504	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.843000	0.00179	-1.859000	0.01156	-1.361000	0.01213	AGC		0.517	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055652.1			13	101	1	0	9.31168e-06	0.001855	1.11705e-05	13	101				
MXRA5	25878	broad.mit.edu	37	X	3229391	3229391	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:3229391C>A	ENST00000217939.6	-	7	7007	c.6853G>T	c.(6853-6855)Gtg>Ttg	p.V2285L		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2285	Ig-like C2-type 7.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				AAGGAGTTCACCAGACTCCCG	0.567																																							uc004crg.3		NA																	0				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(6853-6855)GTG>TTG		adlican precursor							90.0	74.0	79.0					X																	3229391		2203	4300	6503	SO:0001583	missense	25878					extracellular region		g.chrX:3229391C>A	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.6853G>T	X.37:g.3229391C>A	ENSP00000217939:p.Val2285Leu						p.V2285L	NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN			7	7010	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	2285			Ig-like C2-type 7.		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	c.6853G>T	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	C	9.206	1.029756	0.19512	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.62105	0.05	4.28	4.28	0.50868	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.34435	U	0.003967	T	0.38558	0.1045	N	0.11724	0.165	0.36354	D	0.860258	B	0.24618	0.107	B	0.27262	0.078	T	0.37820	-0.9689	10	0.23891	T	0.37	.	5.3603	0.16083	0.0:0.6964:0.0:0.3036	.	2285	Q9NR99	MXRA5_HUMAN	L	2285	ENSP00000217939:V2285L	ENSP00000217939:V2285L	V	-	1	0	MXRA5	3239391	1.000000	0.71417	0.905000	0.35620	0.177000	0.22998	2.194000	0.42668	1.760000	0.52011	0.509000	0.49947	GTG		0.567	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		21	112	1	0	1.01871e-10	0.008871	1.53409e-10	21	112				
MXRA5	25878	broad.mit.edu	37	X	3239278	3239278	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:3239278G>T	ENST00000217939.6	-	5	4602	c.4448C>A	c.(4447-4449)cCt>cAt	p.P1483H		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1483						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GGCAGCAGTAGGGGTGTGATT	0.512																																							uc004crg.3		NA																	0				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8						c.(4447-4449)CCT>CAT		adlican precursor							103.0	89.0	94.0					X																	3239278		2203	4300	6503	SO:0001583	missense	25878					extracellular region		g.chrX:3239278G>T	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.4448C>A	X.37:g.3239278G>T	ENSP00000217939:p.Pro1483His						p.P1483H	NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN			5	4605	-		all_lung(23;0.00031)|Lung NSC(23;0.000946)	1483					Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	c.4448C>A	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	g	8.787	0.929586	0.18131	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.62364	0.03	3.09	1.18	0.20946	.	1.606800	0.04467	U	0.375412	T	0.46151	0.1378	N	0.14661	0.345	0.09310	N	1	P	0.52463	0.953	B	0.43783	0.431	T	0.39272	-0.9622	10	0.35671	T	0.21	.	5.6996	0.17875	0.3176:0.0:0.6824:0.0	.	1483	Q9NR99	MXRA5_HUMAN	H	1483	ENSP00000217939:P1483H	ENSP00000217939:P1483H	P	-	2	0	MXRA5	3249278	0.001000	0.12720	0.000000	0.03702	0.038000	0.13279	0.978000	0.29488	0.322000	0.23283	0.423000	0.28283	CCT		0.512	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419		17	66	1	0	1.15088e-07	0.004007	1.5337e-07	17	66				
NLGN4X	57502	broad.mit.edu	37	X	6069174	6069174	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:6069174G>C	ENST00000381095.3	-	2	961	c.334C>G	c.(334-336)Cag>Gag	p.Q112E	NLGN4X_ENST00000381092.1_Missense_Mutation_p.Q112E|NLGN4X_ENST00000469740.1_5'UTR|NLGN4X_ENST00000275857.6_Missense_Mutation_p.Q112E|NLGN4X_ENST00000538097.1_Missense_Mutation_p.Q112E|NLGN4X_ENST00000381093.2_Missense_Mutation_p.Q112E	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	112					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						TCCAGGTGCTGGGGGCACACA	0.527																																							uc010ndh.2		NA																	0				skin(2)|large_intestine(1)|ovary(1)	4						c.(334-336)CAG>GAG		X-linked neuroligin 4 precursor							122.0	104.0	110.0					X																	6069174		2203	4300	6503	SO:0001583	missense	57502				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity	g.chrX:6069174G>C	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.334C>G	X.37:g.6069174G>C	ENSP00000370485:p.Gln112Glu					NLGN4X_uc004crp.2_Missense_Mutation_p.Q112E|NLGN4X_uc004crq.2_Missense_Mutation_p.Q112E|NLGN4X_uc010ndi.2_Missense_Mutation_p.Q112E|NLGN4X_uc004crr.2_Missense_Mutation_p.Q112E|NLGN4X_uc010ndj.2_Missense_Mutation_p.Q112E	p.Q112E	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN			2	835	-			112			Extracellular (Potential).		Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	37	c.334C>G	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.680182	0.47886	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87;-0.87	4.09	4.09	0.47781	Carboxylesterase, type B (1);	.	.	.	.	D	0.91583	0.7341	H	0.98701	4.305	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.94904	0.8059	9	0.87932	D	0	.	14.8007	0.69913	0.0:0.0:1.0:0.0	.	112;112;112	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	E	112	ENSP00000370485:Q112E;ENSP00000370483:Q112E;ENSP00000275857:Q112E;ENSP00000370482:Q112E;ENSP00000439203:Q112E	ENSP00000275857:Q112E	Q	-	1	0	NLGN4X	6079174	1.000000	0.71417	0.911000	0.35937	0.177000	0.22998	8.047000	0.89440	1.660000	0.50760	0.600000	0.82982	CAG		0.527	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742		25	106	0	0	0	0.003954	0	25	106				
WWC3	55841	broad.mit.edu	37	X	10035347	10035347	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:10035347C>T	ENST00000380861.4	+	3	428	c.37C>T	c.(37-39)Cca>Tca	p.P13S	WWC3_ENST00000454666.1_Missense_Mutation_p.P13S	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	13					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						GATTGAGGATCCAAGAGAACA	0.388																																							uc004csx.3		NA																	0				ovary(4)	4						c.(37-39)CCA>TCA		WWC family member 3							47.0	40.0	42.0					X																	10035347		2203	4300	6503	SO:0001583	missense	55841							g.chrX:10035347C>T	AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.37C>T	X.37:g.10035347C>T	ENSP00000370242:p.Pro13Ser					WWC3_uc010nds.2_5'UTR	p.P13S	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN			3	235	+			13					A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	ENST00000380861.4	37	c.37C>T	CCDS14136.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.408189	0.83340	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000398613	T;T	0.43294	0.95;0.95	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.68072	0.2961	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72663	-0.4225	10	0.62326	D	0.03	-23.891	18.105	0.89517	0.0:1.0:0.0:0.0	.	13	Q9ULE0	WWC3_HUMAN	S	13	ENSP00000370242:P13S;ENSP00000399584:P13S	ENSP00000370242:P13S	P	+	1	0	WWC3	9995347	1.000000	0.71417	0.898000	0.35279	0.802000	0.45316	7.605000	0.82844	2.211000	0.71520	0.506000	0.49869	CCA		0.388	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691		4	20	0	0	0	0.009096	0	4	20				
WWC3	55841	broad.mit.edu	37	X	10096748	10096748	+	Splice_Site	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:10096748G>T	ENST00000380861.4	+	17	2823	c.2432G>T	c.(2431-2433)cGg>cTg	p.R811L	WWC3_ENST00000454666.1_Splice_Site_p.R811L	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	811					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						ATATCCGAGCGGTAAGGGCTA	0.647																																							uc004csx.3		NA																	0				ovary(4)	4						c.(2431-2433)CGG>CTG		WWC family member 3							65.0	52.0	57.0					X																	10096748		2202	4299	6501	SO:0001630	splice_region_variant	55841							g.chrX:10096748G>T	AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.2432+1G>T	X.37:g.10096748G>T						WWC3_uc010nds.2_Missense_Mutation_p.R475L|WWC3_uc010ndt.2_RNA	p.R811L	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN			17	2630	+			811			Potential.		A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	ENST00000380861.4	37	c.2432G>T	CCDS14136.1	.	.	.	.	.	.	.	.	.	.	g	15.32	2.799053	0.50208	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000543412	T;T	0.05717	3.4;3.4	4.51	4.51	0.55191	.	0.579350	0.17631	N	0.167364	T	0.10508	0.0257	L	0.56769	1.78	0.80722	D	1	P	0.45044	0.849	B	0.41666	0.363	T	0.18713	-1.0328	9	.	.	.	-12.0793	16.8501	0.85991	0.0:0.0:1.0:0.0	.	811	Q9ULE0	WWC3_HUMAN	L	811;811;306	ENSP00000370242:R811L;ENSP00000399584:R811L	.	R	+	2	0	WWC3	10056748	1.000000	0.71417	0.442000	0.26870	0.035000	0.12851	6.837000	0.75354	1.983000	0.57843	0.525000	0.51046	CGG		0.647	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691	Missense_Mutation	10	23	1	0	1.58986e-06	0.008291	2.01341e-06	10	23				
FANCB	2187	broad.mit.edu	37	X	14861873	14861873	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:14861873G>A	ENST00000324138.3	-	9	2549	c.2396C>T	c.(2395-2397)gCg>gTg	p.A799V	FANCB_ENST00000398334.1_Missense_Mutation_p.A799V	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	799					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					TAAAGCAGCCGCGACGACACT	0.408								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														uc004cwg.1		NA																	0				lung(1)	1						c.(2395-2397)GCG>GTG	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia complementation group B							141.0	124.0	130.0					X																	14861873		2203	4300	6503	SO:0001583	missense	2187	FanconAnemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	nucleoplasm		g.chrX:14861873G>A	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.2396C>T	X.37:g.14861873G>A	ENSP00000326819:p.Ala799Val					FANCB_uc004cwh.1_Missense_Mutation_p.A799V	p.A799V	NM_001018113	NP_001018123	Q8NB91	FANCB_HUMAN			10	2664	-	Hepatocellular(33;0.183)		799					B2RMZ4|Q7Z2U2|Q86XG1	Missense_Mutation	SNP	ENST00000324138.3	37	c.2396C>T	CCDS14161.1	.	.	.	.	.	.	.	.	.	.	G	0.035	-1.313189	0.01331	.	.	ENSG00000181544	ENST00000324138;ENST00000398334;ENST00000452869	.	.	.	4.26	-1.31	0.09230	.	1.659050	0.03598	N	0.232874	T	0.07279	0.0184	N	0.00246	-1.78	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18903	-1.0322	9	0.12766	T	0.61	.	4.7854	0.13222	0.5889:0.1494:0.2617:0.0	.	799	Q8NB91	FANCB_HUMAN	V	799	.	ENSP00000326819:A799V	A	-	2	0	FANCB	14771794	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.263000	0.18478	-0.691000	0.05135	-0.573000	0.04149	GCG		0.408	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055835.1	NM_152633		26	85	0	0	0	0.00632	0	26	85				
ASB11	140456	broad.mit.edu	37	X	15306042	15306042	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:15306042G>T	ENST00000480796.1	-	6	858	c.808C>A	c.(808-810)Cca>Aca	p.P270T	ASB11_ENST00000537676.1_Missense_Mutation_p.P249T|ASB11_ENST00000344384.4_Missense_Mutation_p.P249T|ASB11_ENST00000380470.3_Missense_Mutation_p.P253T			Q8WXH4	ASB11_HUMAN	ankyrin repeat and SOCS box containing 11, E3 ubiquitin protein ligase	270					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|skin(1)	16	Hepatocellular(33;0.183)					CTGCTTTTTGGAGCCGCCAGA	0.537																																							uc004cwp.1		NA																	0				breast(2)|skin(1)	3						c.(808-810)CCA>ACA		ankyrin repeat and SOCS box-containing protein							107.0	84.0	92.0					X																	15306042		2203	4300	6503	SO:0001583	missense	140456				intracellular signal transduction			g.chrX:15306042G>T	AF425642	CCDS14164.1, CCDS35209.1, CCDS56596.1	Xp22.31	2014-02-10	2014-02-10		ENSG00000165192	ENSG00000165192		"""Ankyrin repeat domain containing"""	17186	protein-coding gene	gene with protein product		300626	"""ankyrin repeat and SOCS box-containing 11"", ""ankyrin repeat and SOCS box containing 11"""			24337577	Standard	NM_080873		Approved	DKFZp779E2460	uc004cwp.2	Q8WXH4	OTTHUMG00000021173	ENST00000480796.1:c.808C>A	X.37:g.15306042G>T	ENSP00000417914:p.Pro270Thr					ASB11_uc004cwo.1_Missense_Mutation_p.P249T|ASB11_uc010nes.1_RNA|ASB11_uc010net.1_Missense_Mutation_p.P253T	p.P270T	NM_080873	NP_543149	Q8WXH4	ASB11_HUMAN			6	808	-	Hepatocellular(33;0.183)		270					E9PEN1|Q3SYC4|Q7Z667	Missense_Mutation	SNP	ENST00000480796.1	37	c.808C>A	CCDS14164.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.281268	0.59758	.	.	ENSG00000165192	ENST00000537676;ENST00000380470;ENST00000344384;ENST00000480796	T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03	5.44	5.44	0.79542	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000002	T	0.61974	0.2390	N	0.11651	0.15	0.58432	D	0.999996	D;D;D	0.76494	0.986;0.999;0.999	D;D;D	0.83275	0.909;0.996;0.996	T	0.59883	-0.7370	10	0.13853	T	0.58	-16.6722	17.2286	0.86978	0.0:0.0:1.0:0.0	.	253;270;249	Q7Z667;Q8WXH4;E9PEN1	.;ASB11_HUMAN;.	T	249;253;249;270	ENSP00000445465:P249T;ENSP00000369837:P253T;ENSP00000343408:P249T;ENSP00000417914:P270T	ENSP00000343408:P249T	P	-	1	0	ASB11	15215963	1.000000	0.71417	0.068000	0.19968	0.926000	0.56050	8.393000	0.90182	2.279000	0.76181	0.523000	0.50628	CCA		0.537	ASB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055852.2			15	76	1	0	6.72482e-11	0.003163	1.01751e-10	15	76				
ACE2	59272	broad.mit.edu	37	X	15618935	15618935	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:15618935G>T	ENST00000252519.3	-	1	202	c.100C>A	c.(100-102)Cac>Aac	p.H34N	ACE2_ENST00000427411.1_Missense_Mutation_p.H34N|GS1-594A7.3_ENST00000421585.1_RNA			Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2	34	Interaction with SARS-CoV spike glycoprotein.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|angiotensin-mediated drinking behavior (GO:0003051)|cellular protein metabolic process (GO:0044267)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|receptor biosynthetic process (GO:0032800)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell proliferation (GO:0042127)|regulation of cytokine production (GO:0001817)|regulation of inflammatory response (GO:0050727)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|response to virus (GO:0009615)|viral entry into host cell (GO:0046718)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|endopeptidase activity (GO:0004175)|glycoprotein binding (GO:0001948)|peptide hormone binding (GO:0017046)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	32	Hepatocellular(33;0.183)				Lisinopril(DB00722)|Moexipril(DB00691)	TCGGCTTCGTGGTTAAACTTG	0.438																																							uc004cxa.1		NA																	0				ovary(3)	3						c.(100-102)CAC>AAC		angiotensin I converting enzyme 2 precursor	Moexipril(DB00691)						166.0	137.0	147.0					X																	15618935		2203	4300	6503	SO:0001583	missense	59272				angiotensin-mediated drinking behavior|proteolysis|receptor biosynthetic process|regulation of cell proliferation|virion attachment, binding of host cell surface receptor	cell surface|extracellular space|integral to membrane|membrane raft|plasma membrane	carboxypeptidase activity|glycoprotein binding|metallopeptidase activity|peptidyl-dipeptidase activity|viral receptor activity|zinc ion binding	g.chrX:15618935G>T	AF291820	CCDS14169.1	Xp22	2013-06-12	2013-06-12		ENSG00000130234	ENSG00000130234	3.4.17.23		13557	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	300335	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 2"""			10969042	Standard	NM_021804		Approved		uc004cxb.2	Q9BYF1	OTTHUMG00000021177	ENST00000252519.3:c.100C>A	X.37:g.15618935G>T	ENSP00000252519:p.His34Asn					ACE2_uc004cxb.2_Missense_Mutation_p.H34N	p.H34N	NM_021804	NP_068576	Q9BYF1	ACE2_HUMAN			1	268	-	Hepatocellular(33;0.183)		34			Extracellular (Potential).|Interaction with SARS-CoV spike glycoprotein.		C7ECU1|Q6UWP0|Q86WT0|Q9NRA7|Q9UFZ6	Missense_Mutation	SNP	ENST00000252519.3	37	c.100C>A	CCDS14169.1	.	.	.	.	.	.	.	.	.	.	G	0.406	-0.915752	0.02415	.	.	ENSG00000130234	ENST00000252519;ENST00000427411	T;T	0.32023	1.47;1.47	5.81	-9.75	0.00506	.	2.742440	0.00909	N	0.002441	T	0.13884	0.0336	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08806	-1.0704	10	0.22706	T	0.39	11.5464	5.7105	0.17933	0.0784:0.115:0.2419:0.5646	.	34	Q9BYF1	ACE2_HUMAN	N	34	ENSP00000252519:H34N;ENSP00000389326:H34N	ENSP00000252519:H34N	H	-	1	0	ACE2	15528856	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-1.562000	0.02156	-1.717000	0.01385	-0.229000	0.12294	CAC		0.438	ACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055867.1			15	92	1	0	1.05317e-09	0.00245	1.53167e-09	15	92				
GRPR	2925	broad.mit.edu	37	X	16168473	16168473	+	Silent	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:16168473C>A	ENST00000380289.2	+	2	857	c.459C>A	c.(457-459)gcC>gcA	p.A153A	RP11-431J24.2_ENST00000435789.1_RNA|RP11-431J24.2_ENST00000454712.2_RNA|RP11-431J24.2_ENST00000422438.1_RNA	NM_005314.2	NP_005305.1	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor	153					cell proliferation (GO:0008283)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)|G-protein coupled peptide receptor activity (GO:0008528)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(3)|stomach(1)|upper_aerodigestive_tract(3)	25	Hepatocellular(33;0.183)					CCTCTCATGCCCTGATGAAGA	0.498																																							uc004cxj.2		NA																	0				ovary(3)|lung(1)	4						c.(457-459)GCC>GCA		gastrin-releasing peptide receptor							99.0	96.0	97.0					X																	16168473		2203	4300	6503	SO:0001819	synonymous_variant	2925				cell proliferation	integral to plasma membrane	bombesin receptor activity	g.chrX:16168473C>A		CCDS14174.1	Xp22.2	2014-02-21			ENSG00000126010	ENSG00000126010		"""GPCR / Class A : Bombesin receptors"""	4609	protein-coding gene	gene with protein product	"""bombesin receptor 2"""	305670					Standard	NM_005314		Approved	BB2	uc004cxj.3	P30550	OTTHUMG00000021189	ENST00000380289.2:c.459C>A	X.37:g.16168473C>A							p.A153A	NM_005314	NP_005305	P30550	GRPR_HUMAN			2	1112	+	Hepatocellular(33;0.183)		153			Helical; Name=4; (Potential).		B2R910	Silent	SNP	ENST00000380289.2	37	c.459C>A	CCDS14174.1																																																																																				0.498	GRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055901.1	NM_005314		21	99	1	0	2.27731e-05	0.012319	2.66662e-05	21	99				
REPS2	9185	broad.mit.edu	37	X	17047678	17047678	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:17047678C>A	ENST00000357277.3	+	5	874	c.703C>A	c.(703-705)Cag>Aag	p.Q235K	REPS2_ENST00000303843.7_Missense_Mutation_p.Q234K|REPS2_ENST00000380064.4_Missense_Mutation_p.Q95K	NM_001080975.1|NM_004726.2	NP_001074444.1|NP_004717.2	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2	235					epidermal growth factor receptor signaling pathway (GO:0007173)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(3)|urinary_tract(1)	17	Hepatocellular(33;0.183)					GCCCCTTGTCCAGCCCGAGGG	0.498																																							uc004cxv.1		NA																	0				skin(2)|central_nervous_system(1)	3						c.(703-705)CAG>AAG		RALBP1 associated Eps domain containing 2							82.0	75.0	77.0					X																	17047678		2203	4300	6503	SO:0001583	missense	9185				epidermal growth factor receptor signaling pathway|protein complex assembly	cytoplasm	calcium ion binding|protein binding	g.chrX:17047678C>A	AF010233	CCDS14180.2, CCDS43919.1	Xp22.2	2013-01-10			ENSG00000169891	ENSG00000169891		"""EF-hand domain containing"""	9963	protein-coding gene	gene with protein product		300317				9422736, 9928989	Standard	NM_001080975		Approved	POB1	uc004cxv.1	Q8NFH8	OTTHUMG00000021199	ENST00000357277.3:c.703C>A	X.37:g.17047678C>A	ENSP00000349824:p.Gln235Lys					REPS2_uc004cxw.1_Missense_Mutation_p.Q234K|REPS2_uc011miw.1_Missense_Mutation_p.Q94K	p.Q235K	NM_004726	NP_004717	Q8NFH8	REPS2_HUMAN			5	874	+	Hepatocellular(33;0.183)		235					A6PWZ6|O43428|Q5JNZ8|Q8NFI5	Missense_Mutation	SNP	ENST00000357277.3	37	c.703C>A	CCDS14180.2	.	.	.	.	.	.	.	.	.	.	C	11.14	1.551321	0.27739	.	.	ENSG00000169891	ENST00000357277;ENST00000380063;ENST00000303843;ENST00000380064	T;T;T	0.34275	1.37;1.37;1.37	5.5	5.5	0.81552	.	0.428272	0.20652	N	0.088181	T	0.22859	0.0552	L	0.27053	0.805	0.21064	N	0.999798	B;P;P	0.43094	0.049;0.799;0.651	B;B;B	0.36092	0.031;0.217;0.118	T	0.22138	-1.0225	10	0.06494	T	0.89	-4.9904	16.2278	0.82311	0.0:1.0:0.0:0.0	.	95;234;235	B4DQQ8;Q8NFH8-4;Q8NFH8	.;.;REPS2_HUMAN	K	235;235;234;95	ENSP00000349824:Q235K;ENSP00000306033:Q234K;ENSP00000369404:Q95K	ENSP00000306033:Q234K	Q	+	1	0	REPS2	16957599	0.996000	0.38824	0.106000	0.21319	0.150000	0.21749	4.331000	0.59273	2.300000	0.77407	0.544000	0.68410	CAG		0.498	REPS2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316778.1	NM_004726		13	82	1	0	7.93312e-07	0.00245	1.01678e-06	13	82				
CXorf23	256643	broad.mit.edu	37	X	19984254	19984254	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:19984254G>T	ENST00000379682.4	-	2	588	c.555C>A	c.(553-555)tcC>tcA	p.S185S	CXorf23_ENST00000356980.3_Silent_p.S185S|CXorf23_ENST00000379687.3_Silent_p.S185S			A2AJT9	CX023_HUMAN	chromosome X open reading frame 23	185						mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(6)|skin(1)|urinary_tract(1)	11						TAGTTGACTGGGAGTATTTTT	0.408																																							uc004czp.2		NA																	0				lung(1)|skin(1)	2						c.(553-555)TCC>TCA		hypothetical protein LOC256643							153.0	135.0	141.0					X																	19984254		1853	4098	5951	SO:0001819	synonymous_variant	256643					mitochondrion		g.chrX:19984254G>T	AL833278	CCDS14194.2	Xp22.13	2012-11-27			ENSG00000173681	ENSG00000173681			27413	protein-coding gene	gene with protein product						14702039	Standard	NM_198279		Approved		uc004czp.3	A2AJT9	OTTHUMG00000021226	ENST00000379682.4:c.555C>A	X.37:g.19984254G>T						CXorf23_uc010nfn.2_5'Flank|CXorf23_uc011mjg.1_5'Flank|CXorf23_uc004czo.2_Silent_p.S135S	p.S185S	NM_198279	NP_938020	A2AJT9	CX023_HUMAN			2	555	-			185					A1A4E8|Q5VSM7|Q5VSN1|Q6ZS60|Q8N1W7	Silent	SNP	ENST00000379682.4	37	c.555C>A																																																																																					0.408	CXorf23-006	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000055991.2	NM_198279		29	98	1	0	1.08312e-15	0.009535	1.86472e-15	29	98				
YY2	404281	broad.mit.edu	37	X	21875099	21875099	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:21875099C>A	ENST00000429584.2	+	1	995	c.497C>A	c.(496-498)aCg>aAg	p.T166K	MBTPS2_ENST00000465888.1_3'UTR|MBTPS2_ENST00000379484.5_Intron|MBTPS2_ENST00000365779.2_Intron	NM_206923.3	NP_996806.2	O15391	TYY2_HUMAN	YY2 transcription factor	166					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(2)	19						AGCCTGGGCACGAGGAAGTGG	0.582																																							uc011mjp.1		NA																	0				breast(1)|skin(1)	2						c.(496-498)ACG>AAG		YY2 transcription factor							74.0	74.0	74.0					X																	21875099		2203	4300	6503	SO:0001583	missense	404281				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|plasma membrane	DNA binding|zinc ion binding	g.chrX:21875099C>A	AK091850	CCDS14202.1	Xp22.2-p22.1	2011-02-11			ENSG00000230797	ENSG00000230797		"""Zinc fingers, C2H2-type"""	31684	protein-coding gene	gene with protein product	"""transcription factor yin yang 2"""	300570				14702039	Standard	NM_206923		Approved	ZNF631	uc011mjp.2	O15391	OTTHUMG00000021236	ENST00000429584.2:c.497C>A	X.37:g.21875099C>A	ENSP00000389381:p.Thr166Lys					MBTPS2_uc004dae.2_Intron|MBTPS2_uc010nfr.2_Intron|YY2_uc010nfq.2_Missense_Mutation_p.T384K|MBTPS2_uc004dab.2_Intron	p.T166K	NM_206923	NP_996806	O15391	TYY2_HUMAN			1	497	+			166					B2RP10|Q6Q1S4	Missense_Mutation	SNP	ENST00000429584.2	37	c.497C>A	CCDS14202.1	.	.	.	.	.	.	.	.	.	.	C	7.858	0.725390	0.15439	.	.	ENSG00000230797	ENST00000429584	T	0.09255	3.0	3.29	-6.58	0.01836	.	44.809600	0.01776	U	0.031471	T	0.05686	0.0149	N	0.19112	0.55	0.09310	N	1	B	0.15141	0.012	B	0.10450	0.005	T	0.32107	-0.9919	10	0.14656	T	0.56	.	3.8399	0.08909	0.2865:0.4751:0.1283:0.1101	.	166	O15391	TYY2_HUMAN	K	166	ENSP00000389381:T166K	ENSP00000389381:T166K	T	+	2	0	YY2	21785020	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.221000	0.09202	-2.525000	0.00495	-0.185000	0.12909	ACG		0.582	YY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056025.1	NM_206923		32	119	1	0	2.08457e-15	0.010818	3.57916e-15	32	119				
PDK3	5165	broad.mit.edu	37	X	24552145	24552145	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:24552145A>T	ENST00000379162.4	+	11	1412	c.1177A>T	c.(1177-1179)Agc>Tgc	p.S393C	PDK3_ENST00000441463.2_Missense_Mutation_p.S393C	NM_005391.4	NP_005382.1	Q15120	PDK3_HUMAN	pyruvate dehydrogenase kinase, isozyme 3	393					cell death (GO:0008219)|cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to glucose stimulus (GO:0071333)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|peptidyl-serine phosphorylation (GO:0018105)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|regulation of reactive oxygen species metabolic process (GO:2000377)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			NS(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						GAGCAATCCCAGCAGTGAACC	0.428																																							uc004dbg.2		NA																	0				lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6						c.(1177-1179)AGC>TGC		pyruvate dehydrogenase kinase 3 isoform 2							76.0	65.0	69.0					X																	24552145		2202	4300	6502	SO:0001583	missense	5165				glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	ATP binding|protein binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity	g.chrX:24552145A>T	L42452	CCDS14212.1, CCDS48088.1	Xp22.12	2008-02-05	2005-11-16		ENSG00000067992	ENSG00000067992			8811	protein-coding gene	gene with protein product		300906	"""pyruvate dehydrogenase kinase, isoenzyme 3"""			7499431	Standard	NM_001142386		Approved		uc004dbh.3	Q15120	OTTHUMG00000021269	ENST00000379162.4:c.1177A>T	X.37:g.24552145A>T	ENSP00000368460:p.Ser393Cys					PDK3_uc004dbh.2_Missense_Mutation_p.S393C	p.S393C	NM_005391	NP_005382	Q15120	PDK3_HUMAN			11	1406	+			393					B4DXG6	Missense_Mutation	SNP	ENST00000379162.4	37	c.1177A>T	CCDS14212.1	.	.	.	.	.	.	.	.	.	.	A	19.84	3.902490	0.72754	.	.	ENSG00000067992	ENST00000379162;ENST00000441463	T;T	0.48522	0.81;0.82	5.53	5.53	0.82687	.	0.037246	0.85682	D	0.000000	T	0.47507	0.1449	M	0.66939	2.045	0.80722	D	1	P;P	0.35774	0.519;0.519	B;B	0.32583	0.103;0.148	T	0.53816	-0.8385	10	0.72032	D	0.01	-11.8414	14.683	0.69031	1.0:0.0:0.0:0.0	.	393;393	B4DXG6;Q15120	.;PDK3_HUMAN	C	393	ENSP00000368460:S393C;ENSP00000387536:S393C	ENSP00000368460:S393C	S	+	1	0	PDK3	24462066	1.000000	0.71417	0.997000	0.53966	0.957000	0.61999	6.953000	0.75995	2.044000	0.60594	0.486000	0.48141	AGC		0.428	PDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056097.1	NM_005391		3	33	0	0	0	0.009096	0	3	33				
MAGEB6	158809	broad.mit.edu	37	X	26212836	26212836	+	Silent	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:26212836C>T	ENST00000379034.1	+	2	1022	c.873C>T	c.(871-873)ctC>ctT	p.L291L		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	291	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						TGATGTCGCTCCTGGTTGTGA	0.542																																							uc004dbr.2		NA																	0				ovary(3)	3						c.(871-873)CTC>CTT		melanoma antigen family B, 6							164.0	153.0	157.0					X																	26212836		2202	4300	6502	SO:0001819	synonymous_variant	158809							g.chrX:26212836C>T	AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.873C>T	X.37:g.26212836C>T						MAGEB6_uc010ngc.1_Silent_p.L71L	p.L291L	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN			2	1022	+			291			MAGE.		Q6GS19|Q9H219	Silent	SNP	ENST00000379034.1	37	c.873C>T	CCDS14217.1																																																																																				0.542	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056123.1	NM_173523		19	267	0	0	0	0.008871	0	19	267				
NR0B1	190	broad.mit.edu	37	X	30326724	30326724	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:30326724C>A	ENST00000378970.4	-	1	991	c.757G>T	c.(757-759)Gtg>Ttg	p.V253L	NR0B1_ENST00000453287.1_Missense_Mutation_p.V253L|NR0B1_ENST00000378963.1_5'Flank	NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	253	4 X 67 AA tandem repeats.				adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	TCGCAGACCACCTGTGGACTC	0.677											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											uc004dcf.3		NA																	0				ovary(1)|lung(1)	2						c.(757-759)GTG>TTG		nuclear receptor subfamily 0, group B, member 1	Dexamethasone(DB01234)|Tretinoin(DB00755)						15.0	12.0	13.0					X																	30326724		2161	4213	6374	SO:0001583	missense	190				adrenal gland development|hypothalamus development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of steroid hormone receptor signaling pathway|pituitary gland development|protein localization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid biosynthetic process	cytoplasm|membrane fraction|nucleoplasm|nucleus|polysomal ribosome	AF-2 domain binding|DNA hairpin binding|ligand-regulated transcription factor activity|protein domain specific binding|protein homodimerization activity|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|steroid hormone receptor binding|transcription corepressor activity|transcription factor binding	g.chrX:30326724C>A	S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.757G>T	X.37:g.30326724C>A	ENSP00000368253:p.Val253Leu		OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	816		p.V253L	NM_000475	NP_000466	P51843	NR0B1_HUMAN			1	772	-			253			4; truncated.|4 X 67 AA tandem repeats.		Q96F69	Missense_Mutation	SNP	ENST00000378970.4	37	c.757G>T	CCDS14223.1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.349019	0.41599	.	.	ENSG00000169297	ENST00000378970;ENST00000453287	D;D	0.98567	-5.0;-5.0	4.8	3.9	0.45041	Nuclear hormone receptor, ligand-binding (2);	0.123243	0.56097	D	0.000036	D	0.95859	0.8652	L	0.43152	1.355	0.50632	D	0.999885	B	0.24258	0.1	B	0.26094	0.066	D	0.93255	0.6638	10	0.20519	T	0.43	-16.9868	13.6963	0.62582	0.1633:0.8367:0.0:0.0	.	253	P51843	NR0B1_HUMAN	L	253	ENSP00000368253:V253L;ENSP00000396403:V253L	ENSP00000368253:V253L	V	-	1	0	NR0B1	30236645	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	0.830000	0.27462	0.934000	0.37316	0.513000	0.50165	GTG		0.677	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056161.1	NM_000475		7	26	1	0	0.00198382	0.001984	0.00216386	7	26				
NR0B1	190	broad.mit.edu	37	X	30327329	30327329	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:30327329C>T	ENST00000378970.4	-	1	386	c.152G>A	c.(151-153)aGa>aAa	p.R51K	NR0B1_ENST00000453287.1_Missense_Mutation_p.R51K|NR0B1_ENST00000378963.1_5'Flank	NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	51	4 X 67 AA tandem repeats.				adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	CAGCCCCTCTCTGCCCACCCC	0.672																																							uc004dcf.3		NA																	0				ovary(1)|lung(1)	2						c.(151-153)AGA>AAA		nuclear receptor subfamily 0, group B, member 1	Dexamethasone(DB01234)|Tretinoin(DB00755)						15.0	14.0	14.0					X																	30327329		2183	4276	6459	SO:0001583	missense	190				adrenal gland development|hypothalamus development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of steroid hormone receptor signaling pathway|pituitary gland development|protein localization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid biosynthetic process	cytoplasm|membrane fraction|nucleoplasm|nucleus|polysomal ribosome	AF-2 domain binding|DNA hairpin binding|ligand-regulated transcription factor activity|protein domain specific binding|protein homodimerization activity|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|steroid hormone receptor binding|transcription corepressor activity|transcription factor binding	g.chrX:30327329C>T	S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.152G>A	X.37:g.30327329C>T	ENSP00000368253:p.Arg51Lys						p.R51K	NM_000475	NP_000466	P51843	NR0B1_HUMAN			1	167	-			51			4 X 67 AA tandem repeats.|1.		Q96F69	Missense_Mutation	SNP	ENST00000378970.4	37	c.152G>A	CCDS14223.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.051687	0.36181	.	.	ENSG00000169297	ENST00000378970;ENST00000453287	D;D	0.96774	-3.2;-4.12	4.42	4.42	0.53409	.	0.323970	0.22373	N	0.060907	D	0.94072	0.8100	M	0.64404	1.975	0.18873	N	0.999986	P	0.40970	0.734	B	0.37198	0.243	D	0.89885	0.4033	10	0.52906	T	0.07	-9.2908	11.4042	0.49887	0.0:1.0:0.0:0.0	.	51	P51843	NR0B1_HUMAN	K	51	ENSP00000368253:R51K;ENSP00000396403:R51K	ENSP00000368253:R51K	R	-	2	0	NR0B1	30237250	0.004000	0.15560	0.516000	0.27786	0.958000	0.62258	1.223000	0.32527	2.167000	0.68274	0.513000	0.50165	AGA		0.672	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056161.1	NM_000475		7	43	0	0	0	0.004482	0	7	43				
DMD	1756	broad.mit.edu	37	X	32466669	32466669	+	Silent	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:32466669A>G	ENST00000357033.4	-	27	3896	c.3690T>C	c.(3688-3690)ccT>ccC	p.P1230P	DMD_ENST00000378677.2_Silent_p.P1226P	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1230					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTTGTGCTACAGGTGGAGCTT	0.423																																							uc004dda.1		NA																	0				ovary(3)|pancreas(2)|large_intestine(1)	6						c.(3688-3690)CCT>CCC		dystrophin Dp427m isoform							183.0	149.0	160.0					X																	32466669		2202	4300	6502	SO:0001819	synonymous_variant	1756				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding	g.chrX:32466669A>G	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3690T>C	X.37:g.32466669A>G						DMD_uc004dcz.2_Silent_p.P1107P|DMD_uc004dcy.1_Silent_p.P1226P|DMD_uc004ddb.1_Silent_p.P1222P|DMD_uc010ngo.1_Intron	p.P1230P	NM_004006	NP_003997	P11532	DMD_HUMAN			27	3934	-		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)	1230			Spectrin 8.		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	c.3690T>C	CCDS14233.1																																																																																				0.423	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006		4	65	0	0	0	0.009096	0	4	65				
MAGEB16	139604	broad.mit.edu	37	X	35820687	35820687	+	Missense_Mutation	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:35820687T>A	ENST00000399989.1	+	2	653	c.374T>A	c.(373-375)cTg>cAg	p.L125Q	MAGEB16_ENST00000399987.1_Missense_Mutation_p.L125Q|MAGEB16_ENST00000399985.1_Missense_Mutation_p.L125Q|MAGEB16_ENST00000399988.1_Missense_Mutation_p.L125Q|MAGEB16_ENST00000399992.1_Missense_Mutation_p.L157Q	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	125	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						AATTTCATGCTGCACAAGTGT	0.453																																							uc010ngt.1		NA																	0				lung(3)|ovary(2)|breast(1)|skin(1)	7						c.(373-375)CTG>CAG		melanoma antigen family B, 16							58.0	54.0	55.0					X																	35820687		1952	4152	6104	SO:0001583	missense	139604							g.chrX:35820687T>A		CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.374T>A	X.37:g.35820687T>A	ENSP00000382871:p.Leu125Gln						p.L125Q	NM_001099921	NP_001093391	A2A368	MAGBG_HUMAN			2	653	+			125			MAGE.		A8MU30	Missense_Mutation	SNP	ENST00000399989.1	37	c.374T>A	CCDS43927.1	.	.	.	.	.	.	.	.	.	.	T	12.80	2.045755	0.36085	.	.	ENSG00000189023	ENST00000399988;ENST00000399992;ENST00000399987;ENST00000399989;ENST00000399985	T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0	3.13	1.9	0.25705	.	0.000000	0.64402	D	0.000001	T	0.45975	0.1369	M	0.90369	3.11	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.28996	-1.0026	10	0.62326	D	0.03	.	4.8795	0.13672	0.2759:0.0:0.0:0.7241	.	125	A2A368	MAGBG_HUMAN	Q	125;157;125;125;125	ENSP00000382870:L125Q;ENSP00000382874:L157Q;ENSP00000382869:L125Q;ENSP00000382871:L125Q;ENSP00000382867:L125Q	ENSP00000382867:L125Q	L	+	2	0	MAGEB16	35730608	0.030000	0.19436	0.007000	0.13788	0.020000	0.10135	1.638000	0.37165	0.432000	0.26286	0.423000	0.28283	CTG		0.453	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251034.1			11	47	0	0	0	0.010729	0	11	47				
USP11	8237	broad.mit.edu	37	X	47107328	47107328	+	Nonstop_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:47107328G>C	ENST00000218348.3	+	21	2891	c.2891G>C	c.(2890-2892)tGa>tCa	p.*964S	USP11_ENST00000377107.2_Nonstop_Mutation_p.*921S	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	0					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						GATGTTAATTGAGAGCCCTGG	0.597																																							uc004dhp.2		NA																	0				ovary(1)|lung(1)|central_nervous_system(1)	3						c.(2890-2892)TGA>TCA		ubiquitin specific peptidase 11							8.0	8.0	8.0					X																	47107328		2181	4258	6439	SO:0001578	stop_lost	8237				protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	g.chrX:47107328G>C	U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.2891G>C	X.37:g.47107328G>C	ENSP00000218348:p.*964Serext*40					USP11_uc004dhq.2_Nonstop_Mutation_p.*690S	p.*964S	NM_004651	NP_004642	P51784	UBP11_HUMAN			21	2891	+			964					B2RTX1|Q8IUG6|Q9BWE1	Nonstop_Mutation	SNP	ENST00000218348.3	37	c.2891G>C	CCDS14277.1	.	.	.	.	.	.	.	.	.	.	g	12.89	2.074231	0.36566	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	.	.	.	4.89	1.13	0.20643	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.3579	0.21412	0.4551:0.0:0.5449:0.0	.	.	.	.	S	921;964	.	.	X	+	2	2	USP11	46992272	0.735000	0.28153	0.357000	0.25798	0.850000	0.48378	0.184000	0.16939	-0.095000	0.12351	0.431000	0.28591	TGA		0.597	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_004651		4	19	0	0	0	0.009096	0	4	19				
GRIPAP1	56850	broad.mit.edu	37	X	48831665	48831665	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:48831665C>A	ENST00000376441.1	-	25	2369	c.2335G>T	c.(2335-2337)Gac>Tac	p.D779Y	GRIPAP1_ENST00000473581.1_5'Flank|GRIPAP1_ENST00000376444.3_Missense_Mutation_p.D734Y|GRIPAP1_ENST00000376425.3_Missense_Mutation_p.D748Y	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	779						blood microparticle (GO:0072562)|endosome (GO:0005768)				breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						TTCACTAGGTCTCTCAGGACG	0.597																																							uc004dly.1		NA																	0				breast(2)|kidney(1)	3						c.(2335-2337)GAC>TAC		GRIP1 associated protein 1 isoform 1							57.0	45.0	49.0					X																	48831665		2203	4300	6503	SO:0001583	missense	56850					early endosome		g.chrX:48831665C>A	AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.2335G>T	X.37:g.48831665C>A	ENSP00000365624:p.Asp779Tyr						p.D779Y	NM_020137	NP_064522	Q4V328	GRAP1_HUMAN			25	2370	-			779					A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Missense_Mutation	SNP	ENST00000376441.1	37	c.2335G>T	CCDS35248.1	.	.	.	.	.	.	.	.	.	.	c	20.3	3.966174	0.74131	.	.	ENSG00000068400	ENST00000376425;ENST00000376444;ENST00000376441;ENST00000537291	.	.	.	3.66	3.66	0.41972	.	0.000000	0.64402	U	0.000001	T	0.65365	0.2684	L	0.39397	1.21	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.65220	-0.6221	9	0.45353	T	0.12	-15.8974	11.6458	0.51261	0.0:1.0:0.0:0.0	.	779	Q4V328	GRAP1_HUMAN	Y	748;734;779;748	.	ENSP00000365608:D748Y	D	-	1	0	GRIPAP1	48716609	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.929000	0.75852	1.674000	0.50907	0.488000	0.48403	GAC		0.597	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080970.2	NM_207672		6	44	1	0	0.00198382	0.001984	0.00216386	6	44				
CCNB3	85417	broad.mit.edu	37	X	50053979	50053979	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:50053979C>T	ENST00000376042.1	+	6	3108	c.2810C>T	c.(2809-2811)cCc>cTc	p.P937L	CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000276014.7_Missense_Mutation_p.P937L|CCNB3_ENST00000376038.1_Intron			Q8WWL7	CCNB3_HUMAN	cyclin B3	937					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					AATGAGAAACCCACCACTGGG	0.453																																							uc004dox.3		NA																	0				ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9						c.(2809-2811)CCC>CTC		cyclin B3 isoform 3							84.0	79.0	81.0					X																	50053979		2203	4300	6503	SO:0001583	missense	85417				cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding	g.chrX:50053979C>T	AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.2810C>T	X.37:g.50053979C>T	ENSP00000365210:p.Pro937Leu					CCNB3_uc004doy.2_Missense_Mutation_p.P937L|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	p.P937L	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN			6	3108	+	Ovarian(276;0.236)		937					B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	ENST00000376042.1	37	c.2810C>T	CCDS14331.1	.	.	.	.	.	.	.	.	.	.	C	6.733	0.503947	0.12822	.	.	ENSG00000147082	ENST00000376042;ENST00000276014	T;T	0.24908	1.83;1.83	3.69	0.941	0.19519	.	352.489000	0.00166	N	0.000000	T	0.17704	0.0425	N	0.25890	0.77	0.09310	N	1	B	0.12630	0.006	B	0.10450	0.005	T	0.12682	-1.0538	9	.	.	.	.	2.8717	0.05618	0.2189:0.5317:0.0:0.2494	.	937	Q8WWL7	CCNB3_HUMAN	L	937	ENSP00000365210:P937L;ENSP00000276014:P937L	.	P	+	2	0	CCNB3	50070719	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.982000	0.01489	0.071000	0.16664	-0.240000	0.12126	CCC		0.453	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056558.1			14	92	0	0	0	0.003163	0	14	92				
DGKK	139189	broad.mit.edu	37	X	50163469	50163469	+	RNA	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:50163469G>T	ENST00000376025.2	-	0	933							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					TTCCGGTTGGGTGCAGCCAGA	0.393																																							uc010njr.1		NA																	0				ovary(1)|kidney(1)	2						c.(874-876)CCC>ACC		diacylglycerol kinase kappa							245.0	215.0	225.0					X																	50163469		1857	4089	5946			139189				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding	g.chrX:50163469G>T	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50163469G>T							p.P292T	NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN			4	934	-	Ovarian(276;0.236)		292			PH.		B2RP91	Missense_Mutation	SNP	ENST00000376025.2	37	c.874C>A																																																																																					0.393	DGKK-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000368187.1	NM_001013742		19	106	1	0	1.00905e-13	0.008871	1.65235e-13	19	106				
SHROOM4	57477	broad.mit.edu	37	X	50377606	50377606	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:50377606G>T	ENST00000289292.7	-	4	1750	c.1467C>A	c.(1465-1467)caC>caA	p.H489Q	SHROOM4_ENST00000376020.2_Missense_Mutation_p.H489Q|SHROOM4_ENST00000460112.3_Missense_Mutation_p.H373Q			Q9ULL8	SHRM4_HUMAN	shroom family member 4	489					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					TTTGGCTCTGGTGTCCCAAAA	0.517																																							uc004dpe.2		NA																	0				upper_aerodigestive_tract(1)	1						c.(1465-1467)CAC>CAA		shroom family member 4							115.0	97.0	104.0					X																	50377606		2203	4300	6503	SO:0001583	missense	57477				actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding	g.chrX:50377606G>T	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.1467C>A	X.37:g.50377606G>T	ENSP00000289292:p.His489Gln					SHROOM4_uc004dpd.3_RNA|SHROOM4_uc004dpf.1_Missense_Mutation_p.H373Q	p.H489Q	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN			4	1493	-	Ovarian(276;0.236)		489					A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	ENST00000289292.7	37	c.1467C>A	CCDS35277.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.770530	0.00645	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	T;T;T	0.13538	3.0;3.0;2.58	5.43	1.39	0.22231	.	0.972451	0.08466	N	0.941624	T	0.10035	0.0246	L	0.51422	1.61	0.09310	N	1	B	0.18863	0.031	B	0.14578	0.011	T	0.45101	-0.9284	10	0.11794	T	0.64	.	0.7769	0.01034	0.3091:0.1587:0.3668:0.1655	.	489	Q9ULL8	SHRM4_HUMAN	Q	489;489;373	ENSP00000289292:H489Q;ENSP00000365188:H489Q;ENSP00000421450:H373Q	ENSP00000289292:H489Q	H	-	3	2	SHROOM4	50394346	0.009000	0.17119	0.114000	0.21550	0.104000	0.19210	-0.012000	0.12699	-0.047000	0.13423	0.600000	0.82982	CAC		0.517	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717		17	120	1	0	9.16793e-09	0.00499	1.29777e-08	17	120				
WNK3	65267	broad.mit.edu	37	X	54275959	54275959	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:54275959A>T	ENST00000375159.2	-	16	2821	c.2822T>A	c.(2821-2823)gTg>gAg	p.V941E	WNK3_ENST00000375169.3_Missense_Mutation_p.V941E|WNK3_ENST00000354646.2_Missense_Mutation_p.V941E			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	941					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						ACCATCAACCACATCCTTGTG	0.403																																							uc004dtd.1		NA																	0				lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						c.(2821-2823)GTG>GAG		WNK lysine deficient protein kinase 3 isoform 2							113.0	107.0	109.0					X																	54275959		2203	4300	6503	SO:0001583	missense	65267				intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity	g.chrX:54275959A>T	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.2822T>A	X.37:g.54275959A>T	ENSP00000364301:p.Val941Glu					WNK3_uc004dtc.1_Missense_Mutation_p.V941E	p.V941E	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN			17	3261	-			941					B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	ENST00000375159.2	37	c.2822T>A	CCDS14357.1	.	.	.	.	.	.	.	.	.	.	A	9.738	1.164142	0.21538	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.70749	-0.49;-0.51;-0.51	5.02	5.02	0.67125	.	0.660669	0.13130	N	0.411519	T	0.53594	0.1806	N	0.24115	0.695	0.27557	N	0.950316	B;P	0.43169	0.017;0.8	B;B	0.34722	0.009;0.188	T	0.49670	-0.8915	10	0.48119	T	0.1	-0.0374	10.1303	0.42674	1.0:0.0:0.0:0.0	.	941;941	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	E	941	ENSP00000364312:V941E;ENSP00000346667:V941E;ENSP00000364301:V941E	ENSP00000346667:V941E	V	-	2	0	WNK3	54292684	1.000000	0.71417	0.674000	0.29902	0.395000	0.30598	2.597000	0.46214	1.656000	0.50722	0.441000	0.28932	GTG		0.403	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922		29	118	0	0	0	0.00632	0	29	118				
ITIH6	347365	broad.mit.edu	37	X	54783638	54783638	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:54783638G>T	ENST00000218436.6	-	8	2898	c.2869C>A	c.(2869-2871)Ctg>Atg	p.L957M		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	957	Pro-rich.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										GATGGTCCCAGAACTTGCCTG	0.587																																							uc004dtj.2		NA																	0				lung(2)|skin(2)|ovary(1)|breast(1)	6						c.(2869-2871)CTG>ATG		inter-alpha (globulin) inhibitor H5-like							81.0	75.0	77.0					X																	54783638		2203	4300	6503	SO:0001583	missense	347365				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity	g.chrX:54783638G>T	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.2869C>A	X.37:g.54783638G>T	ENSP00000218436:p.Leu957Met						p.L957M	NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN			8	2899	-			957			Pro-rich.		A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	c.2869C>A	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	G	6.707	0.499211	0.12762	.	.	ENSG00000102313	ENST00000218436	T	0.02682	4.2	4.01	2.16	0.27623	.	4.580930	0.01431	U	0.014754	T	0.06371	0.0164	N	0.19112	0.55	0.09310	N	1	D	0.69078	0.997	P	0.60789	0.879	T	0.32534	-0.9903	10	0.54805	T	0.06	.	5.3451	0.16004	0.2786:0.0:0.7214:0.0	.	957	Q6UXX5	ITH5L_HUMAN	M	957	ENSP00000218436:L957M	ENSP00000218436:L957M	L	-	1	2	ITIH5L	54800363	0.419000	0.25449	0.057000	0.19452	0.006000	0.05464	1.321000	0.33678	0.632000	0.30432	0.594000	0.82650	CTG		0.587	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510		19	64	1	0	6.94344e-10	0.006122	1.01212e-09	19	64				
ZXDA	7789	broad.mit.edu	37	X	57936015	57936015	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:57936015C>A	ENST00000358697.4	-	1	1052	c.840G>T	c.(838-840)aaG>aaT	p.K280N		NM_007156.4	NP_009087.1	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	280	Required for interaction with ZXDC.				positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|prostate(2)|skin(1)	37						GCTGGTGCTTCTTGGCGAAGG	0.692																																							uc004dve.2		NA																	0				ovary(1)	1						c.(838-840)AAG>AAT		zinc finger, X-linked, duplicated A							16.0	16.0	16.0					X																	57936015		2199	4297	6496	SO:0001583	missense	7789				positive regulation of transcription, DNA-dependent	nucleus	C2H2 zinc finger domain binding|identical protein binding|nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chrX:57936015C>A	L14787	CCDS14376.1	Xp11.21	2013-01-08			ENSG00000198205	ENSG00000198205		"""Zinc fingers, C2H2-type"""	13198	protein-coding gene	gene with protein product	"""zinc finger protein 896"""	300235				8268913	Standard	NM_007156		Approved	ZNF896	uc004dve.3	P98168	OTTHUMG00000021688	ENST00000358697.4:c.840G>T	X.37:g.57936015C>A	ENSP00000351530:p.Lys280Asn						p.K280N	NM_007156	NP_009087	P98168	ZXDA_HUMAN			1	1053	-			280			C2H2-type 1.|Required for interaction with ZXDC.		Q9UJP7	Missense_Mutation	SNP	ENST00000358697.4	37	c.840G>T	CCDS14376.1	.	.	.	.	.	.	.	.	.	.	.	14.98	2.696000	0.48202	.	.	ENSG00000198205	ENST00000358697	T	0.36878	1.23	3.35	3.35	0.38373	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.124268	0.52532	D	0.000064	T	0.40398	0.1115	L	0.29908	0.895	0.31648	N	0.647197	D	0.56521	0.976	P	0.60286	0.872	T	0.40365	-0.9567	9	.	.	.	.	11.8259	0.52267	0.0:1.0:0.0:0.0	.	280	P98168	ZXDA_HUMAN	N	280	ENSP00000351530:K280N	.	K	-	3	2	ZXDA	57952740	0.036000	0.19791	1.000000	0.80357	0.974000	0.67602	0.750000	0.26334	1.931000	0.55961	0.415000	0.27848	AAG		0.692	ZXDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056925.1	NM_007156		5	24	1	0	0.000602214	0.000602	0.000674184	5	24				
AMER1	139285	broad.mit.edu	37	X	63411755	63411755	+	Missense_Mutation	SNP	T	T	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:63411755T>C	ENST00000330258.3	-	2	1684	c.1412A>G	c.(1411-1413)tAt>tGt	p.Y471C	AMER1_ENST00000403336.1_Missense_Mutation_p.Y471C|AMER1_ENST00000374869.3_Missense_Mutation_p.Y471C	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	471					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									GGAGTCATAATAACCTTCATC	0.542																																							uc004dvo.2		NA																	67	Whole gene deletion(67)	p.0?(40)	kidney(65)|ovary(1)|large_intestine(1)	kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						c.(1411-1413)TAT>TGT		family with sequence similarity 123B							80.0	62.0	68.0					X																	63411755		2203	4300	6503	SO:0001583	missense	139285				Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		g.chrX:63411755T>C	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1412A>G	X.37:g.63411755T>C	ENSP00000329117:p.Tyr471Cys						p.Y471C	NM_152424	NP_689637	Q5JTC6	F123B_HUMAN			2	1685	-			471					A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	37	c.1412A>G	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	T	16.48	3.134662	0.56828	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	T;T;T	0.52754	0.65;0.65;0.65	5.32	5.32	0.75619	.	0.076814	0.52532	D	0.000063	T	0.68632	0.3022	M	0.79475	2.455	0.46437	D	0.999042	D	0.89917	1.0	D	0.85130	0.997	T	0.73196	-0.4059	10	0.87932	D	0	-10.903	13.2881	0.60255	0.0:0.0:0.0:1.0	.	471	Q5JTC6	F123B_HUMAN	C	471	ENSP00000364003:Y471C;ENSP00000329117:Y471C;ENSP00000384722:Y471C	ENSP00000329117:Y471C	Y	-	2	0	FAM123B	63328480	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.525000	0.81892	2.088000	0.63022	0.486000	0.48141	TAT		0.542	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424		12	57	0	0	0	0.010729	0	12	57				
STARD8	9754	broad.mit.edu	37	X	67943859	67943859	+	Silent	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:67943859G>A	ENST00000252336.6	+	13	3222	c.2850G>A	c.(2848-2850)gtG>gtA	p.V950V	STARD8_ENST00000374597.3_Silent_p.V950V|STARD8_ENST00000374599.3_Silent_p.V1030V	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	950	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						AACAACCTGTGCCAGAGTCGG	0.627																																							uc004dxa.2		NA																	0				breast(3)|ovary(2)|pancreas(1)	6						c.(2848-2850)GTG>GTA		StAR-related lipid transfer (START) domain							126.0	83.0	97.0					X																	67943859		2203	4300	6503	SO:0001819	synonymous_variant	9754				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity	g.chrX:67943859G>A	D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.2850G>A	X.37:g.67943859G>A						STARD8_uc004dxb.2_Silent_p.V1030V|STARD8_uc004dxc.3_Silent_p.V950V	p.V950V	NM_014725	NP_055540	Q92502	STAR8_HUMAN			13	3222	+			950			START.		A8K6T2|D3DVT9|Q5JST0|Q68DG7	Silent	SNP	ENST00000252336.6	37	c.2850G>A	CCDS14390.1																																																																																				0.627	STARD8-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057026.2	NM_014725		11	66	0	0	0	0.010729	0	11	66				
FAM155B	27112	broad.mit.edu	37	X	68749663	68749663	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:68749663C>T	ENST00000252338.4	+	3	1325	c.1283C>T	c.(1282-1284)cCt>cTt	p.P428L		NM_015686.2	NP_056501.2	O75949	F155B_HUMAN	family with sequence similarity 155, member B	429						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)	16						CGCCTCAGCCCTAGCAGGATC	0.632																																							uc004dxk.2		NA																	0				ovary(1)|breast(1)	2						c.(1282-1284)CCT>CTT		transmembrane protein 28							100.0	78.0	85.0					X																	68749663		2203	4300	6503	SO:0001583	missense	27112					integral to membrane		g.chrX:68749663C>T	AF087142	CCDS35317.1	Xq13.1	2008-04-15	2008-04-15	2008-04-15	ENSG00000130054	ENSG00000130054			30701	protein-coding gene	gene with protein product			"""transmembrane protein 28"", ""chromosome X open reading frame 63"""	TMEM28, CXorf63			Standard	NM_015686		Approved	TED	uc004dxk.3	O75949	OTTHUMG00000021756	ENST00000252338.4:c.1283C>T	X.37:g.68749663C>T	ENSP00000252338:p.Pro428Leu						p.P428L	NM_015686	NP_056501	O75949	F155B_HUMAN			3	1331	+			429					B1ALV6|B9EGK1|D3DVU1	Missense_Mutation	SNP	ENST00000252338.4	37	c.1283C>T	CCDS35317.1	.	.	.	.	.	.	.	.	.	.	C	11.31	1.601697	0.28534	.	.	ENSG00000130054	ENST00000252338	T	0.45276	0.9	4.32	4.32	0.51571	.	0.940439	0.08915	N	0.875203	T	0.30823	0.0777	N	0.24115	0.695	0.39770	D	0.972157	B	0.06786	0.001	B	0.08055	0.003	T	0.15954	-1.0419	10	0.54805	T	0.06	-4.4152	8.7036	0.34340	0.2263:0.7737:0.0:0.0	.	428	O75949-2	.	L	428	ENSP00000252338:P428L	ENSP00000252338:P428L	P	+	2	0	FAM155B	68666388	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	3.251000	0.51453	2.005000	0.58758	0.476000	0.43555	CCT		0.632	FAM155B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057037.1	NM_015686		18	65	0	0	0	0.006122	0	18	65				
SLC7A3	84889	broad.mit.edu	37	X	70145939	70145939	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:70145939A>T	ENST00000374299.3	-	11	1854	c.1710T>A	c.(1708-1710)ttT>ttA	p.F570L	SLC7A3_ENST00000298085.4_Missense_Mutation_p.F570L			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	570					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	TCCAGACCCCAAATCGGGCCC	0.488																																							uc004dyn.2		NA																	0				ovary(1)|kidney(1)	2						c.(1708-1710)TTT>TTA		solute carrier family 7 (cationic amino acid	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)						61.0	54.0	56.0					X																	70145939		2203	4300	6503	SO:0001583	missense	84889				cellular nitrogen compound metabolic process	integral to membrane|plasma membrane		g.chrX:70145939A>T	AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.1710T>A	X.37:g.70145939A>T	ENSP00000363417:p.Phe570Leu					SLC7A3_uc004dyo.2_Missense_Mutation_p.F570L	p.F570L	NM_032803	NP_116192	Q8WY07	CTR3_HUMAN			11	1868	-	Renal(35;0.156)		570			Helical; Name=14; (Potential).		D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	ENST00000374299.3	37	c.1710T>A	CCDS14404.1	.	.	.	.	.	.	.	.	.	.	A	15.12	2.739307	0.49045	.	.	ENSG00000165349	ENST00000374299;ENST00000298085	D;D	0.89939	-2.59;-2.59	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	D	0.90817	0.7116	L	0.52905	1.665	0.52501	D	0.999952	P	0.37708	0.606	P	0.55011	0.766	D	0.90619	0.4558	10	0.66056	D	0.02	.	7.7867	0.29095	0.9059:0.0:0.0941:0.0	.	570	Q8WY07	CTR3_HUMAN	L	570	ENSP00000363417:F570L;ENSP00000298085:F570L	ENSP00000298085:F570L	F	-	3	2	SLC7A3	70062664	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	2.933000	0.48948	1.919000	0.55581	0.356000	0.21956	TTT		0.488	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057080.1	NM_032803		12	43	0	0	0	0.010729	0	12	43				
RGAG4	340526	broad.mit.edu	37	X	71351284	71351284	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:71351284A>T	ENST00000545866.1	-	1	474	c.107T>A	c.(106-108)cTc>cAc	p.L36H	NHSL2_ENST00000510661.1_5'Flank|NHSL2_ENST00000535692.1_5'Flank|NHSL2_ENST00000373677.1_5'Flank|RGAG4_ENST00000609883.1_Missense_Mutation_p.L36H|NHSL2_ENST00000540800.1_Intron	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	36										cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					GGCTCTCCCGAGCTGGAGGCC	0.592																																							uc010nlh.1		NA																	0				ovary(2)|skin(1)	3						c.(106-108)CTC>CAC		retrotransposon gag domain containing 4							41.0	43.0	42.0					X																	71351284		1885	4091	5976	SO:0001583	missense	340526							g.chrX:71351284A>T	AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.107T>A	X.37:g.71351284A>T	ENSP00000441366:p.Leu36His					NHSL2_uc011mqa.1_Intron|RGAG4_uc004eaj.1_RNA|NHSL2_uc004eak.1_5'Flank|NHSL2_uc010nli.2_5'Flank	p.L36H	NM_001024455	NP_001019626	Q5HYW3	RGAG4_HUMAN			1	468	-	Renal(35;0.156)		36					A7E2W7|Q8NCM4|Q9NPX1	Missense_Mutation	SNP	ENST00000545866.1	37	c.107T>A	CCDS55446.1	.	.	.	.	.	.	.	.	.	.	a	17.16	3.319339	0.60524	.	.	ENSG00000242732	ENST00000545866;ENST00000479991	T;T	0.27720	1.65;1.65	4.24	4.24	0.50183	.	.	.	.	.	T	0.36386	0.0965	N	0.19112	0.55	0.29494	N	0.855391	D	0.89917	1.0	D	0.83275	0.996	T	0.11494	-1.0585	8	.	.	.	.	8.7436	0.34571	1.0:0.0:0.0:0.0	.	36	Q5HYW3	RGAG4_HUMAN	H	36	ENSP00000441366:L36H;ENSP00000418667:L36H	.	L	-	2	0	RGAG4	71268009	1.000000	0.71417	0.989000	0.46669	0.954000	0.61252	2.085000	0.41634	1.884000	0.54569	0.448000	0.29417	CTC		0.592	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057171.1	NM_001024455		14	94	0	0	0	0.001855	0	14	94				
ZDHHC15	158866	broad.mit.edu	37	X	74670759	74670759	+	Splice_Site	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:74670759T>A	ENST00000373367.3	-	4	489		c.e4-2		ZDHHC15_ENST00000541184.1_Splice_Site|ZDHHC15_ENST00000373361.3_Splice_Site	NM_144969.2	NP_659406.1	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15						establishment of protein localization (GO:0045184)|protein palmitoylation (GO:0018345)|synaptic vesicle maturation (GO:0016188)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(1)|lung(11)|ovary(2)|skin(2)	26						CAAGTGGAACTGGAAGCAGGA	0.368																																							uc004ecg.2		NA																	0				ovary(2)	2						c.e4-1		zinc finger, DHHC-type containing 15 isoform 1							62.0	51.0	54.0					X																	74670759		2203	4300	6503	SO:0001630	splice_region_variant	158866					integral to membrane	zinc ion binding	g.chrX:74670759T>A	AK056374	CCDS14430.1, CCDS55454.1	Xq13.3	2008-05-02			ENSG00000102383	ENSG00000102383		"""Zinc fingers, DHHC-type"""	20342	protein-coding gene	gene with protein product		300576					Standard	NM_144969		Approved	FLJ31812, MRX91	uc004ecg.3	Q96MV8	OTTHUMG00000021866	ENST00000373367.3:c.259-2A>T	X.37:g.74670759T>A						ZDHHC15_uc004ech.2_Splice_Site_p.F78_splice|ZDHHC15_uc011mqo.1_Splice_Site|ZDHHC15_uc004eci.2_Intron	p.F87_splice	NM_144969	NP_659406	Q96MV8	ZDH15_HUMAN			4	737	-								B3KVG7|Q3SY30|Q6UWH3	Splice_Site	SNP	ENST00000373367.3	37	c.259_splice	CCDS14430.1	.	.	.	.	.	.	.	.	.	.	T	17.52	3.410174	0.62399	.	.	ENSG00000102383	ENST00000373367;ENST00000541184;ENST00000373361	.	.	.	4.86	4.86	0.63082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5523	0.50726	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZDHHC15	74587484	1.000000	0.71417	0.998000	0.56505	0.799000	0.45148	6.460000	0.73518	1.698000	0.51180	0.441000	0.28932	.		0.368	ZDHHC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057283.1	NM_144969	Intron	12	36	0	0	0	0.013537	0	12	36				
MAGEE2	139599	broad.mit.edu	37	X	75004218	75004218	+	Silent	SNP	C	C	T	rs367730676		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:75004218C>T	ENST00000373359.2	-	1	861	c.669G>A	c.(667-669)agG>agA	p.R223R		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	223	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.									autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TGAGGAGGTTCCTTGTGTTCC	0.493																																							uc004ecj.1		NA																	0				ovary(1)|skin(1)	2						c.(667-669)AGG>AGA		melanoma antigen family E, 2		C		0,3835		0,0,1632,571	85.0	72.0	76.0		669	-0.8	0.0	X		76	1,6727		0,1,2427,1872	no	coding-synonymous	MAGEE2	NM_138703.4		0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095		223/524	75004218	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	139599							g.chrX:75004218C>T	AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.669G>A	X.37:g.75004218C>T							p.R223R	NM_138703	NP_619648	Q8TD90	MAGE2_HUMAN			1	854	-			223			MAGE 1.		Q5JSI5	Silent	SNP	ENST00000373359.2	37	c.669G>A	CCDS14431.1																																																																																				0.493	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057288.1	NM_138703		24	51	0	0	0	0.00333	0	24	51				
PBDC1	51260	broad.mit.edu	37	X	75395337	75395337	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:75395337G>T	ENST00000373358.3	+	4	389	c.186G>T	c.(184-186)ctG>ctT	p.L62L	PBDC1_ENST00000373357.3_Silent_p.L62L	NM_016500.3	NP_057584.2	Q9BVG4	PBDC1_HUMAN	polysaccharide biosynthesis domain containing 1	62																	CACAGTTCCTGAAACTCACCA	0.408																																							uc004ecl.1		NA																	0					0						c.(184-186)CTG>CTT		hypothetical protein LOC51260							89.0	78.0	82.0					X																	75395337		2203	4300	6503	SO:0001819	synonymous_variant	51260							g.chrX:75395337G>T	BC001220	CCDS14432.1, CCDS75995.1	Xq13.2	2012-11-28	2012-11-28	2012-11-28	ENSG00000102390	ENSG00000102390			28790	protein-coding gene	gene with protein product			"""chromosome X open reading frame 26"""	CXorf26		11042152	Standard	NM_016500		Approved	MGC874	uc004ecl.1	Q9BVG4	OTTHUMG00000021876	ENST00000373358.3:c.186G>T	X.37:g.75395337G>T							p.L62L	NM_016500	NP_057584	Q9BVG4	CX026_HUMAN			4	389	+			62						Silent	SNP	ENST00000373358.3	37	c.186G>T	CCDS14432.1																																																																																				0.408	PBDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057294.1	NM_016500		4	36	1	0	0.00909568	0.009096	0.00960854	4	36				
ATRX	546	broad.mit.edu	37	X	76890137	76890137	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:76890137G>T	ENST00000373344.5	-	17	4971	c.4757C>A	c.(4756-4758)cCa>cAa	p.P1586Q	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.P1548Q	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1586	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TCCTGAACCTGGAGATTTCTT	0.373			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																uc004ecp.3		NA		Rec	yes		X	Xq21.1	546	Mis|F|N	alpha thalassemia/mental retardation syndrome X-linked	yes	ATR-X (alpha thalassemia/mental retardation) syndrome	E			Pancreatic neuroendocrine tumors		1	Unknown(1)		bone(1)	haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30						c.(4756-4758)CCA>CAA		transcriptional regulator ATRX isoform 1	Phosphatidylserine(DB00144)						177.0	172.0	174.0					X																	76890137		2203	4296	6499	SO:0001583	missense	546				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding	g.chrX:76890137G>T	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.4757C>A	X.37:g.76890137G>T	ENSP00000362441:p.Pro1586Gln					ATRX_uc004ecq.3_Missense_Mutation_p.P1548Q|ATRX_uc004eco.3_Missense_Mutation_p.P1371Q	p.P1586Q	NM_000489	NP_000480	P46100	ATRX_HUMAN			17	4989	-			1586			Helicase ATP-binding.		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	c.4757C>A	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012859	0.75161	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	T;T	0.27557	1.66;1.66	5.77	5.77	0.91146	DEAD-like helicase (2);SNF2-related (1);	0.361517	0.25922	N	0.027437	T	0.31765	0.0807	N	0.05158	-0.105	0.80722	D	1	D;P	0.57571	0.98;0.91	P;P	0.56700	0.804;0.658	T	0.39961	-0.9588	10	0.52906	T	0.07	-5.754	18.913	0.92493	0.0:0.0:1.0:0.0	.	1548;1586	P46100-4;P46100	.;ATRX_HUMAN	Q	1586;1548	ENSP00000362441:P1586Q;ENSP00000378967:P1548Q	ENSP00000362441:P1586Q	P	-	2	0	ATRX	76776793	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.489000	0.81451	2.414000	0.81942	0.600000	0.82982	CCA		0.373	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489		15	163	1	0	4.75885e-15	0.00499	8.10531e-15	15	163				
MAGT1	84061	broad.mit.edu	37	X	77112936	77112936	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:77112936C>A	ENST00000358075.6	-	4	631	c.545G>T	c.(544-546)cGg>cTg	p.R182L		NM_032121.5	NP_115497.4	Q9H0U3	MAGT1_HUMAN	magnesium transporter 1	150					cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)	p.R150L(1)		cervix(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	17						TGTATCACCCCGTTTGGGTTT	0.423																																							uc004fof.2		NA																	1	Substitution - Missense(1)		lung(1)	upper_aerodigestive_tract(1)	1						c.(544-546)CGG>CTG		magnesium transporter 1							146.0	136.0	139.0					X																	77112936		2203	4296	6499	SO:0001583	missense	84061				protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex		g.chrX:77112936C>A		CCDS14436.2	Xq21.1	2014-09-17			ENSG00000102158	ENSG00000102158			28880	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog B (S. cerevisiae)"""	300715				15804357	Standard	NM_032121		Approved	DKFZp564K142, IAP, OST3B, MRX95	uc004fof.3	Q9H0U3	OTTHUMG00000021882	ENST00000358075.6:c.545G>T	X.37:g.77112936C>A	ENSP00000354649:p.Arg182Leu					MAGT1_uc004fog.3_RNA	p.R182L	NM_032121	NP_115497	Q9H0U3	MAGT1_HUMAN			4	607	-			150					B2RAR4|D3DTE3|Q53G00|Q6P577|Q8NBN6	Missense_Mutation	SNP	ENST00000358075.6	37	c.545G>T	CCDS14436.2	.	.	.	.	.	.	.	.	.	.	C	17.15	3.316416	0.60524	.	.	ENSG00000102158	ENST00000358075;ENST00000453109	T	0.46063	0.88	4.85	3.77	0.43336	Thioredoxin-like fold (2);	0.348665	0.25030	U	0.033683	T	0.38506	0.1043	M	0.61703	1.905	0.09310	N	0.999997	P	0.39940	0.696	B	0.39935	0.314	T	0.22382	-1.0218	10	0.26408	T	0.33	-7.9344	9.8331	0.40954	0.0:0.8052:0.0:0.1948	.	150	Q9H0U3	MAGT1_HUMAN	L	182;33	ENSP00000354649:R182L	ENSP00000354649:R182L	R	-	2	0	MAGT1	76999592	0.012000	0.17670	0.957000	0.39632	0.971000	0.66376	1.799000	0.38824	1.981000	0.57761	0.513000	0.50165	CGG		0.423	MAGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057301.2	NM_032121		22	195	1	0	1.10513e-12	0.014323	1.76877e-12	22	195				
PGK1	5230	broad.mit.edu	37	X	77380449	77380449	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:77380449C>A	ENST00000373316.4	+	9	1182	c.1015C>A	c.(1015-1017)Cct>Act	p.P339T	PGK1_ENST00000476531.1_3'UTR|PGK1_ENST00000537456.1_Missense_Mutation_p.P311T|PGK1_ENST00000442431.1_Missense_Mutation_p.P203T	NM_000291.3	NP_000282.1	P00558	PGK1_HUMAN	phosphoglycerate kinase 1	339					carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	24					Lamivudine(DB00709)	GTGGAATGGTCCTGTGGGGGT	0.532																																							uc004ecz.3		NA																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1015-1017)CCT>ACT		phosphoglycerate kinase 1							132.0	123.0	126.0					X																	77380449		2203	4296	6499	SO:0001583	missense	5230				gluconeogenesis|glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity	g.chrX:77380449C>A	L00159	CCDS14438.1	Xq13.3	2011-03-17			ENSG00000102144	ENSG00000102144	2.7.2.3		8896	protein-coding gene	gene with protein product		311800				6188151, 6099325	Standard	NM_000291		Approved		uc004ecz.4	P00558	OTTHUMG00000021888	ENST00000373316.4:c.1015C>A	X.37:g.77380449C>A	ENSP00000362413:p.Pro339Thr					PGK1_uc010nlz.2_RNA|PGK1_uc011mqq.1_Missense_Mutation_p.P311T	p.P339T	NM_000291	NP_000282	P00558	PGK1_HUMAN			9	1187	+			339					A8K4W6|B7Z7A9|Q5J7W1|Q6IBT6|Q8NI87	Missense_Mutation	SNP	ENST00000373316.4	37	c.1015C>A	CCDS14438.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.084781	0.76642	.	.	ENSG00000102144	ENST00000373316;ENST00000442431;ENST00000450919;ENST00000537456	D;D;D	0.97665	-4.48;-3.66;-4.48	5.0	5.0	0.66597	Phosphoglycerate kinase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99140	0.9703	H	0.98466	4.24	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	D	0.98979	1.0804	10	0.87932	D	0	-32.7328	16.5703	0.84609	0.0:1.0:0.0:0.0	.	339	P00558	PGK1_HUMAN	T	339;203;164;311	ENSP00000362413:P339T;ENSP00000405452:P203T;ENSP00000444708:P311T	ENSP00000362413:P339T	P	+	1	0	PGK1	77267105	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.468000	0.80943	2.201000	0.70794	0.513000	0.50165	CCT		0.532	PGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057310.1			13	157	1	0	0.00010058	0.013537	0.00011441	13	157				
ZCCHC5	203430	broad.mit.edu	37	X	77913593	77913593	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:77913593G>T	ENST00000321110.1	-	2	620	c.325C>A	c.(325-327)Cca>Aca	p.P109T		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	109	Pro-rich.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						GGGGCTGCTGGGGCCTCCTGG	0.642																																							uc004edc.1		NA																	0				ovary(1)	1						c.(325-327)CCA>ACA		zinc finger, CCHC domain containing 5							20.0	23.0	22.0					X																	77913593		2201	4291	6492	SO:0001583	missense	203430						nucleic acid binding|zinc ion binding	g.chrX:77913593G>T	AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.325C>A	X.37:g.77913593G>T	ENSP00000316794:p.Pro109Thr						p.P109T	NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN			2	621	-			109			Pro-rich.		B2RMZ0|Q5JQE9	Missense_Mutation	SNP	ENST00000321110.1	37	c.325C>A	CCDS14440.1	.	.	.	.	.	.	.	.	.	.	G	4.279	0.050944	0.08243	.	.	ENSG00000179300	ENST00000321110	T	0.18657	2.2	3.11	0.374	0.16183	.	.	.	.	.	T	0.09024	0.0223	N	0.08118	0	0.09310	N	1	B	0.34103	0.437	B	0.29862	0.108	T	0.27773	-1.0064	9	0.38643	T	0.18	.	6.8587	0.24054	0.3637:0.0:0.6363:0.0	.	109	Q8N8U3	ZCHC5_HUMAN	T	109	ENSP00000316794:P109T	ENSP00000316794:P109T	P	-	1	0	ZCCHC5	77800249	0.002000	0.14202	0.000000	0.03702	0.063000	0.16089	0.066000	0.14489	-0.048000	0.13401	-0.508000	0.04489	CCA		0.642	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694		6	26	1	0	0.00116845	0.001168	0.00128549	6	26				
P2RY10	27334	broad.mit.edu	37	X	78216850	78216850	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:78216850C>T	ENST00000171757.2	+	4	1113	c.833C>T	c.(832-834)cCc>cTc	p.P278L	P2RY10_ENST00000544091.1_Missense_Mutation_p.P278L	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	278						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						AGCAGTTGTCCCGTTGTCCGA	0.418																																							uc004ede.2		NA																	0				ovary(2)|lung(2)|breast(1)	5						c.(832-834)CCC>CTC		G-protein coupled purinergic receptor P2Y10							232.0	213.0	219.0					X																	78216850		2203	4300	6503	SO:0001583	missense	27334					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	g.chrX:78216850C>T	AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.833C>T	X.37:g.78216850C>T	ENSP00000171757:p.Pro278Leu					P2RY10_uc004edf.2_Missense_Mutation_p.P278L	p.P278L	NM_014499	NP_055314	O00398	P2Y10_HUMAN			4	1202	+			278			Extracellular (Potential).		D3DTE5|Q4VBN7|Q86V16	Missense_Mutation	SNP	ENST00000171757.2	37	c.833C>T	CCDS14442.1	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.423289	0.00186	.	.	ENSG00000078589	ENST00000544091;ENST00000171757	T;T	0.42900	0.96;0.96	4.99	3.15	0.36227	GPCR, rhodopsin-like superfamily (1);	1.292910	0.05032	N	0.474769	T	0.32941	0.0846	L	0.40543	1.245	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.21759	-1.0236	10	0.25106	T	0.35	.	3.6216	0.08097	0.0:0.4777:0.1856:0.3367	.	278	O00398	P2Y10_HUMAN	L	278	ENSP00000443138:P278L;ENSP00000171757:P278L	ENSP00000171757:P278L	P	+	2	0	P2RY10	78103506	0.000000	0.05858	0.130000	0.21974	0.091000	0.18340	0.424000	0.21330	0.462000	0.27095	-0.195000	0.12781	CCC		0.418	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057323.1			22	251	0	0	0	0.014323	0	22	251				
APOOL	139322	broad.mit.edu	37	X	84342616	84342616	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:84342616G>T	ENST00000373173.2	+	9	826	c.739G>T	c.(739-741)Gac>Tac	p.D247Y		NM_198450.5	NP_940852.3	Q6UXV4	MIC27_HUMAN	apolipoprotein O-like	247						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8						GTTTATGCCTGACCCCAAGCT	0.403																																							uc004eem.2		NA																	0					0						c.(739-741)GAC>TAC		apolipoprotein O-like precursor							43.0	37.0	39.0					X																	84342616		1858	4090	5948	SO:0001583	missense	139322					extracellular region		g.chrX:84342616G>T	AK130506	CCDS48138.1	Xq21.1	2007-01-17	2007-01-17	2007-01-17	ENSG00000155008	ENSG00000155008			24009	protein-coding gene	gene with protein product			"""chromosome X open reading frame 33"", ""family with sequence similarity 121A"""	CXorf33, FAM121A		12975309	Standard	NM_198450		Approved	UNQ8193, AAIR8193	uc004eem.3	Q6UXV4	OTTHUMG00000021930	ENST00000373173.2:c.739G>T	X.37:g.84342616G>T	ENSP00000362268:p.Asp247Tyr					APOOL_uc010nmp.2_RNA	p.D247Y	NM_198450	NP_940852	Q6UXV4	APOOL_HUMAN			9	753	+			247					Q3KNU7|Q5H9D1	Missense_Mutation	SNP	ENST00000373173.2	37	c.739G>T	CCDS48138.1	.	.	.	.	.	.	.	.	.	.	G	18.67	3.673198	0.67928	.	.	ENSG00000155008	ENST00000373173;ENST00000373169	.	.	.	5.7	4.84	0.62591	.	0.042655	0.85682	D	0.000000	T	0.77644	0.4161	M	0.81942	2.565	0.45464	D	0.998433	D	0.89917	1.0	D	0.91635	0.999	T	0.79629	-0.1724	9	0.62326	D	0.03	-32.7748	10.2137	0.43156	0.0945:0.0:0.9055:0.0	.	247	Q6UXV4	APOOL_HUMAN	Y	247;246	.	ENSP00000362264:D246Y	D	+	1	0	APOOL	84229272	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.698000	0.54771	2.393000	0.81446	0.529000	0.55759	GAC		0.403	APOOL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057385.2	NM_198450		3	8	1	0	0.004672	0.004672	0.00501021	3	8				
TGIF2LX	90316	broad.mit.edu	37	X	89177650	89177650	+	Missense_Mutation	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:89177650C>G	ENST00000561129.2	+	1	696	c.566C>G	c.(565-567)cCg>cGg	p.P189R	TGIF2LX_ENST00000283891.5_Missense_Mutation_p.P189R			Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	189					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(29)|ovary(1)|skin(3)|urinary_tract(1)	40						ATAGCCCAGCCGAAGAAAAAG	0.572																																							uc004efe.2		NA																	0				ovary(1)|skin(1)	2						c.(565-567)CCG>CGG		TGFB-induced factor homeobox 2-like, X-linked							70.0	75.0	74.0					X																	89177650		2203	4300	6503	SO:0001583	missense	90316					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:89177650C>G	AF497480	CCDS14459.1	Xq21.31	2014-05-14	2007-02-07		ENSG00000153779	ENSG00000153779		"""Homeoboxes / TALE class"""	18570	protein-coding gene	gene with protein product		300411	"""TGFB-induced factor 2-like, X-linked"""				Standard	NM_138960		Approved		uc004efe.3	Q8IUE1	OTTHUMG00000021954	ENST00000561129.2:c.566C>G	X.37:g.89177650C>G	ENSP00000453704:p.Pro189Arg						p.P189R	NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN			2	615	+			189					Q5JRM9|Q8TD48	Missense_Mutation	SNP	ENST00000561129.2	37	c.566C>G	CCDS14459.1	.	.	.	.	.	.	.	.	.	.	C	9.958	1.222139	0.22457	.	.	ENSG00000153779	ENST00000283891	T	0.63096	-0.02	2.95	0.0758	0.14400	.	.	.	.	.	T	0.68979	0.3060	M	0.76574	2.34	0.09310	N	1	D	0.64830	0.994	P	0.60886	0.88	T	0.57201	-0.7852	8	.	.	.	-5.0317	2.3044	0.04170	0.244:0.457:0.0:0.2989	.	189	Q8IUE1	TF2LX_HUMAN	R	189	ENSP00000355119:P189R	.	P	+	2	0	TGIF2LX	89064306	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.009000	0.12765	-0.101000	0.12219	0.506000	0.49869	CCG		0.572	TGIF2LX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417911.2	NM_138960		12	75	0	0	0	0.010729	0	12	75				
DIAPH2	1730	broad.mit.edu	37	X	96369926	96369926	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:96369926G>T	ENST00000324765.8	+	21	2898	c.2551G>T	c.(2551-2553)Gcc>Tcc	p.A851S	DIAPH2_ENST00000373054.4_Missense_Mutation_p.A847S|DIAPH2_ENST00000373061.3_Missense_Mutation_p.A851S|DIAPH2_ENST00000355827.4_Missense_Mutation_p.A851S|DIAPH2_ENST00000373049.4_Missense_Mutation_p.A851S			O60879	DIAP2_HUMAN	diaphanous-related formin 2	851	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						CTCAAGAAATGCCCAGTCTTT	0.338																																							uc004efu.3		NA																	0				ovary(3)|lung(1)	4						c.(2551-2553)GCC>TCC		diaphanous 2 isoform 156							71.0	70.0	70.0					X																	96369926		2203	4300	6503	SO:0001583	missense	1730				cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding	g.chrX:96369926G>T	Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.2551G>T	X.37:g.96369926G>T	ENSP00000321348:p.Ala851Ser					DIAPH2_uc004eft.3_Missense_Mutation_p.A851S	p.A851S	NM_006729	NP_006720	O60879	DIAP2_HUMAN			21	2947	+			851			FH2.		A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	ENST00000324765.8	37	c.2551G>T	CCDS14467.1	.	.	.	.	.	.	.	.	.	.	G	32	5.144228	0.94603	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	5.66	5.66	0.87406	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.076456	0.49305	D	0.000151	T	0.66489	0.2794	M	0.83692	2.655	0.49798	D	0.999827	D;D	0.54397	0.966;0.958	P;P	0.60117	0.869;0.793	T	0.71307	-0.4632	10	0.66056	D	0.02	.	18.7455	0.91791	0.0:0.0:1.0:0.0	.	851;851	O60879;O60879-2	DIAP2_HUMAN;.	S	851;847;851;851;851;858	ENSP00000362152:A851S;ENSP00000362145:A847S;ENSP00000348082:A851S;ENSP00000362140:A851S;ENSP00000321348:A851S	ENSP00000321348:A851S	A	+	1	0	DIAPH2	96256582	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.715000	0.98748	2.372000	0.80975	0.600000	0.82982	GCC		0.338	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058871.2	NM_006729, NM_007309		3	38	1	0	0.004672	0.004672	0.00501021	3	38				
GPRASP2	114928	broad.mit.edu	37	X	101970569	101970569	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:101970569C>A	ENST00000535209.1	+	4	1603	c.772C>A	c.(772-774)Cac>Aac	p.H258N	GPRASP2_ENST00000543253.1_Missense_Mutation_p.H258N|GPRASP2_ENST00000332262.5_Missense_Mutation_p.H258N			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	258						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						CAGGTCCAGGCACAGGGCTAA	0.532																																							uc004ejk.2		NA																	0				ovary(1)	1						c.(772-774)CAC>AAC		G protein-coupled receptor associated sorting							96.0	98.0	97.0					X																	101970569		2203	4300	6503	SO:0001583	missense	114928					cytoplasm	protein binding	g.chrX:101970569C>A	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.772C>A	X.37:g.101970569C>A	ENSP00000437394:p.His258Asn					GPRASP2_uc004ejl.2_Missense_Mutation_p.H258N|GPRASP2_uc004ejm.2_Missense_Mutation_p.H258N|GPRASP2_uc011mrp.1_5'Flank	p.H258N	NM_138437	NP_612446	Q96D09	GASP2_HUMAN			4	2106	+			258					D3DXA0|Q8NAB4	Missense_Mutation	SNP	ENST00000535209.1	37	c.772C>A	CCDS14501.1	.	.	.	.	.	.	.	.	.	.	C	0.866	-0.733655	0.03111	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.08008	3.14;3.14;3.14	4.86	3.99	0.46301	.	0.000000	0.49305	D	0.000159	T	0.13756	0.0333	L	0.58101	1.795	0.29450	N	0.858554	D	0.61697	0.99	P	0.51657	0.676	T	0.05007	-1.0912	10	0.18276	T	0.48	.	10.6371	0.45571	0.0:0.901:0.0:0.099	.	258	Q96D09	GASP2_HUMAN	N	258	ENSP00000437872:H258N;ENSP00000437394:H258N;ENSP00000339057:H258N	ENSP00000339057:H258N	H	+	1	0	GPRASP2	101857225	0.126000	0.22350	1.000000	0.80357	0.013000	0.08279	0.556000	0.23438	1.133000	0.42147	-0.191000	0.12829	CAC		0.532	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437		34	155	1	0	1.04352e-10	0.003755	1.56774e-10	34	155				
GPRASP2	114928	broad.mit.edu	37	X	101971085	101971085	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:101971085A>T	ENST00000535209.1	+	4	2119	c.1288A>T	c.(1288-1290)Agt>Tgt	p.S430C	GPRASP2_ENST00000543253.1_Missense_Mutation_p.S430C|GPRASP2_ENST00000332262.5_Missense_Mutation_p.S430C			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	430						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						GGAAAAGTCCAGTTTGGGGGC	0.577																																							uc004ejk.2		NA																	0				ovary(1)	1						c.(1288-1290)AGT>TGT		G protein-coupled receptor associated sorting							77.0	77.0	77.0					X																	101971085		2203	4300	6503	SO:0001583	missense	114928					cytoplasm	protein binding	g.chrX:101971085A>T	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.1288A>T	X.37:g.101971085A>T	ENSP00000437394:p.Ser430Cys					GPRASP2_uc004ejl.2_Missense_Mutation_p.S430C|GPRASP2_uc004ejm.2_Missense_Mutation_p.S430C|GPRASP2_uc011mrp.1_5'Flank	p.S430C	NM_138437	NP_612446	Q96D09	GASP2_HUMAN			4	2622	+			430					D3DXA0|Q8NAB4	Missense_Mutation	SNP	ENST00000535209.1	37	c.1288A>T	CCDS14501.1	.	.	.	.	.	.	.	.	.	.	A	11.75	1.730896	0.30684	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.07908	3.15;3.15;3.15	4.44	0.603	0.17541	.	0.728704	0.12388	N	0.473316	T	0.09379	0.0231	L	0.50333	1.59	0.09310	N	1	P	0.52463	0.953	B	0.43754	0.43	T	0.22243	-1.0222	10	0.56958	D	0.05	.	7.3052	0.26443	0.7043:0.0:0.2957:0.0	.	430	Q96D09	GASP2_HUMAN	C	430	ENSP00000437872:S430C;ENSP00000437394:S430C;ENSP00000339057:S430C	ENSP00000339057:S430C	S	+	1	0	GPRASP2	101857741	0.002000	0.14202	0.010000	0.14722	0.985000	0.73830	1.201000	0.32259	0.001000	0.14605	0.486000	0.48141	AGT		0.577	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437		18	107	0	0	0	0.00499	0	18	107				
IL1RAPL2	26280	broad.mit.edu	37	X	104993096	104993096	+	Splice_Site	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:104993096G>T	ENST00000372582.1	+	9	1948	c.1192G>T	c.(1192-1194)Gac>Tac	p.D398Y	IL1RAPL2_ENST00000344799.4_Splice_Site_p.D398Y|IL1RAPL2_ENST00000485671.1_3'UTR	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	398					central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AACTAATGATGGTAAGCTGTC	0.363																																							uc004elz.1		NA																	0				breast(2)|ovary(1)	3						c.(1192-1194)GAC>TAC		interleukin 1 receptor accessory protein-like 2							96.0	78.0	84.0					X																	104993096		2203	4300	6503	SO:0001630	splice_region_variant	26280				central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity	g.chrX:104993096G>T	AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1192+1G>T	X.37:g.104993096G>T							p.D398Y	NM_017416	NP_059112	Q9NP60	IRPL2_HUMAN			9	1948	+			398			Cytoplasmic (Potential).		Q2M3U3|Q9NZN0	Missense_Mutation	SNP	ENST00000372582.1	37	c.1192G>T	CCDS14517.1	.	.	.	.	.	.	.	.	.	.	G	17.60	3.429895	0.62844	.	.	ENSG00000189108	ENST00000372582;ENST00000344799	T;T	0.02787	4.16;4.16	5.62	5.62	0.85841	Toll/interleukin-1 receptor homology (TIR) domain (1);	0.000000	0.64402	D	0.000002	T	0.17959	0.0431	M	0.87682	2.9	0.80722	D	1	D	0.76494	0.999	D	0.64042	0.921	T	0.00514	-1.1695	10	0.87932	D	0	.	17.5543	0.87886	0.0:0.0:1.0:0.0	.	398	Q9NP60	IRPL2_HUMAN	Y	398	ENSP00000361663:D398Y;ENSP00000344976:D398Y	ENSP00000344976:D398Y	D	+	1	0	IL1RAPL2	104879752	1.000000	0.71417	1.000000	0.80357	0.408000	0.30992	9.448000	0.97600	2.361000	0.80049	0.538000	0.68166	GAC		0.363	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	Missense_Mutation	13	52	1	0	5.50884e-06	0.013537	6.65869e-06	13	52				
SERPINA7	6906	broad.mit.edu	37	X	105277592	105277592	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:105277592G>T	ENST00000327674.4	-	4	1482	c.1147C>A	c.(1147-1149)Cct>Act	p.P383T	SERPINA7_ENST00000372563.1_Missense_Mutation_p.P383T|SERPINA7_ENST00000487487.1_5'Flank			P05543	THBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7	383			P -> L (in TBG deficiency; Kumamoto). {ECO:0000269|PubMed:1294376}.		aging (GO:0007568)|negative regulation of endopeptidase activity (GO:0010951)|post-embryonic development (GO:0009791)|regulation of proteolysis (GO:0030162)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to peptide hormone (GO:0043434)|response to prostaglandin E (GO:0034695)|response to vitamin A (GO:0033189)|thyroid hormone transport (GO:0070327)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hormone binding (GO:0042562)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|skin(3)	24					Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	TGGATAATAGGGTGTAGGAAA	0.438																																							uc004eme.1		NA																	0					0						c.(1147-1149)CCT>ACT		serine (or cysteine) proteinase inhibitor, clade	Levothyroxine(DB00451)|Liothyronine(DB00279)						225.0	224.0	224.0					X																	105277592		2203	4300	6503	SO:0001583	missense	6906				regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity	g.chrX:105277592G>T	M14091	CCDS14518.1	Xq21-q22	2014-02-18	2005-08-18		ENSG00000123561	ENSG00000123561		"""Serine (or cysteine) peptidase inhibitors"""	11583	protein-coding gene	gene with protein product	"""thyroxin-binding globulin"", ""thyroxine-binding globulin"", ""alpha-1 antiproteinase, antitrypsin"""	314200	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7"""	TBG		24172014	Standard	NM_000354		Approved		uc004eme.2	P05543	OTTHUMG00000022144	ENST00000327674.4:c.1147C>A	X.37:g.105277592G>T	ENSP00000329374:p.Pro383Thr					SERPINA7_uc010npd.2_Missense_Mutation_p.P383T	p.P383T	NM_000354	NP_000345	P05543	THBG_HUMAN			4	1163	-			383		P -> L (in TBG deficiency; Kumamoto).			D3DUX1	Missense_Mutation	SNP	ENST00000327674.4	37	c.1147C>A	CCDS14518.1	.	.	.	.	.	.	.	.	.	.	G	4.548	0.101842	0.08731	.	.	ENSG00000123561	ENST00000327674;ENST00000372563	D;D	0.84223	-1.82;-1.82	4.9	-3.02	0.05446	Serpin domain (3);	0.262727	0.32444	N	0.006089	T	0.71091	0.3299	L	0.46885	1.475	0.09310	N	1	B	0.32160	0.358	B	0.30782	0.12	T	0.61362	-0.7078	10	0.11182	T	0.66	.	5.562	0.17150	0.3419:0.3906:0.2675:0.0	.	383	P05543	THBG_HUMAN	T	383	ENSP00000329374:P383T;ENSP00000361644:P383T	ENSP00000329374:P383T	P	-	1	0	SERPINA7	105164248	0.910000	0.30920	0.000000	0.03702	0.039000	0.13416	3.651000	0.54431	-0.590000	0.05866	0.594000	0.82650	CCT		0.438	SERPINA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057790.1	NM_000354		54	340	1	0	1.0442e-30	0.01441	1.98553e-30	54	340				
MORC4	79710	broad.mit.edu	37	X	106186365	106186365	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:106186365G>C	ENST00000355610.4	-	15	2030	c.1756C>G	c.(1756-1758)Cct>Gct	p.P586A	MORC4_ENST00000535534.1_Missense_Mutation_p.P334A|MORC4_ENST00000255495.7_Missense_Mutation_p.P586A	NM_001085354.2|NM_024657.4	NP_001078823.1|NP_078933.3	Q8TE76	MORC4_HUMAN	MORC family CW-type zinc finger 4	586						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	28						TCTAGAGAAGGTGTTGTCATC	0.453																																							uc004emu.3		NA																	0				ovary(1)	1						c.(1756-1758)CCT>GCT		zinc finger, CW type with coiled-coil domain 2							132.0	131.0	131.0					X																	106186365		2203	4300	6503	SO:0001583	missense	79710						ATP binding|zinc ion binding	g.chrX:106186365G>C	AK021627	CCDS14525.2, CCDS48146.1	Xq22.3	2008-02-05	2005-06-15	2005-06-15	ENSG00000133131	ENSG00000133131			23485	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 2"", ""zinc finger, CW type with coiled-coil domain 2"""	ZCWCC2		14607086	Standard	NM_024657		Approved	ZCW4, FLJ11565	uc004emp.4	Q8TE76	OTTHUMG00000022155	ENST00000355610.4:c.1756C>G	X.37:g.106186365G>C	ENSP00000347821:p.Pro586Ala					MORC4_uc004emp.3_Intron|MORC4_uc004emv.3_Missense_Mutation_p.P586A|MORC4_uc004emw.3_Missense_Mutation_p.P334A	p.P586A	NM_024657	NP_078933	Q8TE76	MORC4_HUMAN			15	1999	-			586					A1YR23|A1YR24|H7BXF1|Q5JUK7|Q96MZ2|Q9HAI7	Missense_Mutation	SNP	ENST00000355610.4	37	c.1756C>G	CCDS14525.2	.	.	.	.	.	.	.	.	.	.	G	3.354	-0.131824	0.06753	.	.	ENSG00000133131	ENST00000355610;ENST00000535534;ENST00000255495	T;T;T	0.32753	2.71;1.44;2.69	5.16	2.86	0.33363	.	0.313970	0.23411	N	0.048471	T	0.21761	0.0524	L	0.47716	1.5	0.21950	N	0.999453	B;B;B	0.23316	0.083;0.083;0.048	B;B;B	0.19148	0.024;0.024;0.009	T	0.13926	-1.0491	10	0.34782	T	0.22	0.6172	4.2005	0.10464	0.5291:0.0:0.4708:0.0	.	334;586;586	A1YR24;A1YR23;Q8TE76	.;.;MORC4_HUMAN	A	586;334;586	ENSP00000347821:P586A;ENSP00000440359:P334A;ENSP00000255495:P586A	ENSP00000255495:P586A	P	-	1	0	MORC4	106073021	0.950000	0.32346	0.659000	0.29680	0.052000	0.14988	0.795000	0.26972	0.826000	0.34661	0.544000	0.68410	CCT		0.453	MORC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057816.3	NM_024657		30	169	0	0	0	0.008361	0	30	169				
RBM41	55285	broad.mit.edu	37	X	106310791	106310791	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:106310791G>T	ENST00000372479.3	-	7	1238	c.1208C>A	c.(1207-1209)gCt>gAt	p.A403D	RBM41_ENST00000372487.1_Missense_Mutation_p.A403D	NM_018301.3	NP_060771.3	Q96IZ5	RBM41_HUMAN	RNA binding motif protein 41	403							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	13						GCTACCTGTAGCACATGATAT	0.368																																							uc004emz.2		NA																	0				ovary(1)	1						c.(1207-1209)GCT>GAT		RNA binding motif protein 41							214.0	206.0	209.0					X																	106310791		2203	4300	6503	SO:0001583	missense	55285						nucleotide binding|RNA binding	g.chrX:106310791G>T	BC006986	CCDS14526.1, CCDS55472.1	Xq22.3	2013-02-12			ENSG00000089682	ENSG00000089682		"""RNA binding motif (RRM) containing"""	25617	protein-coding gene	gene with protein product						12477932	Standard	NM_001171080		Approved	FLJ11016	uc004emz.3	Q96IZ5	OTTHUMG00000022156	ENST00000372479.3:c.1208C>A	X.37:g.106310791G>T	ENSP00000361557:p.Ala403Asp					RBM41_uc004emy.1_Missense_Mutation_p.A403D	p.A403D	NM_018301	NP_060771	Q96IZ5	RBM41_HUMAN			7	1239	-			403					Q5JSN7|Q5JSN8|Q9H8F7|Q9NV04	Missense_Mutation	SNP	ENST00000372479.3	37	c.1208C>A	CCDS14526.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.046762	0.36085	.	.	ENSG00000089682	ENST00000372487;ENST00000372479	T;T	0.25579	1.79;1.85	5.72	3.95	0.45737	.	0.451949	0.21239	N	0.077843	T	0.16041	0.0386	L	0.27053	0.805	0.09310	N	0.999996	B	0.29085	0.232	B	0.21360	0.034	T	0.16100	-1.0414	10	0.56958	D	0.05	.	7.7208	0.28731	0.1954:0.0:0.8046:0.0	.	403	Q96IZ5	RBM41_HUMAN	D	403	ENSP00000361565:A403D;ENSP00000361557:A403D	ENSP00000361557:A403D	A	-	2	0	RBM41	106197447	0.762000	0.28451	0.221000	0.23827	0.896000	0.52359	2.725000	0.47294	0.580000	0.29522	0.513000	0.50165	GCT		0.368	RBM41-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057819.1	NM_018301		35	230	1	0	2.09667e-21	0.003755	3.86005e-21	35	230				
IRS4	8471	broad.mit.edu	37	X	107975899	107975899	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:107975899G>T	ENST00000372129.2	-	1	3752	c.3676C>A	c.(3676-3678)Ccg>Acg	p.P1226T	RP6-24A23.6_ENST00000563887.1_Missense_Mutation_p.P7T	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	1226					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						TCTCTCTCCGGGGGTCTTGGC	0.572																																							uc004eoc.2		NA																	0				ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(3676-3678)CCG>ACG		insulin receptor substrate 4							105.0	106.0	105.0					X																	107975899		2203	4300	6503	SO:0001583	missense	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107975899G>T	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.3676C>A	X.37:g.107975899G>T	ENSP00000361202:p.Pro1226Thr						p.P1226T	NM_003604	NP_003595	O14654	IRS4_HUMAN			1	3709	-			1226						Missense_Mutation	SNP	ENST00000372129.2	37	c.3676C>A	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	G	15.27	2.782829	0.49891	.	.	ENSG00000133124	ENST00000372129	T	0.42900	0.96	4.39	3.53	0.40419	.	0.768746	0.11742	N	0.533909	T	0.24236	0.0587	N	0.24115	0.695	0.20638	N	0.999879	P	0.37781	0.608	B	0.30029	0.11	T	0.07102	-1.0790	10	0.37606	T	0.19	0.0119	7.1375	0.25537	0.1213:0.0:0.8787:0.0	.	1226	O14654	IRS4_HUMAN	T	1226	ENSP00000361202:P1226T	ENSP00000361202:P1226T	P	-	1	0	IRS4	107862555	0.912000	0.30974	0.752000	0.31206	0.523000	0.34469	2.345000	0.44018	1.199000	0.43173	0.600000	0.82982	CCG		0.572	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604		68	256	1	0	1.62914e-18	0.01441	2.93984e-18	68	256				
AMMECR1	9949	broad.mit.edu	37	X	109560903	109560903	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:109560903A>T	ENST00000262844.5	-	1	564	c.397T>A	c.(397-399)Ttt>Att	p.F133I	AMMECR1_ENST00000496695.1_5'UTR|AMMECR1_ENST00000372059.2_Missense_Mutation_p.F133I|AMMECR1_ENST00000372057.1_Missense_Mutation_p.F10I	NM_015365.2	NP_056180.1	Q9Y4X0	AMMR1_HUMAN	Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1	133	AMMECR1. {ECO:0000255|PROSITE- ProRule:PRU00467}.									large_intestine(1)|lung(4)|ovary(1)|stomach(1)	7						TCGAAGCAAAAGCAGCACATC	0.647																																							uc004eoo.2		NA																	0					0						c.(397-399)TTT>ATT		AMMECR1 protein isoform 1							47.0	38.0	41.0					X																	109560903		2202	4300	6502	SO:0001583	missense	9949							g.chrX:109560903A>T	AJ007014	CCDS14551.1, CCDS35368.1, CCDS55476.1	Xq22.3	2014-06-17	2008-09-12		ENSG00000101935	ENSG00000101935			467	protein-coding gene	gene with protein product		300195				10049589, 9480748	Standard	NM_001171689		Approved		uc004eoo.3	Q9Y4X0	OTTHUMG00000022197	ENST00000262844.5:c.397T>A	X.37:g.109560903A>T	ENSP00000262844:p.Phe133Ile					AMMECR1_uc004eop.2_Missense_Mutation_p.F133I|AMMECR1_uc004eoq.2_Missense_Mutation_p.F10I	p.F133I	NM_015365	NP_056180	Q9Y4X0	AMER1_HUMAN			1	478	-			133			AMMECR1.		Q5JYV9|Q6P9D8|Q8WX22|Q9UIQ8	Missense_Mutation	SNP	ENST00000262844.5	37	c.397T>A	CCDS14551.1	.	.	.	.	.	.	.	.	.	.	a	26.3	4.727929	0.89390	.	.	ENSG00000101935	ENST00000262844;ENST00000372059;ENST00000372057	.	.	.	4.99	4.99	0.66335	AMMECR1 domain (2);	0.097074	0.64402	D	0.000001	T	0.78298	0.4261	M	0.80982	2.52	0.80722	D	1	D;D	0.67145	0.996;0.987	D;P	0.69142	0.962;0.901	T	0.80473	-0.1367	8	.	.	.	-11.9258	13.57	0.61841	1.0:0.0:0.0:0.0	.	133;133	Q9Y4X0-3;Q9Y4X0	.;AMER1_HUMAN	I	133;133;10	.	.	F	-	1	0	AMMECR1	109447559	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.662000	0.91130	1.658000	0.50742	0.237000	0.17872	TTT		0.647	AMMECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057907.1			7	26	0	0	0	0.001984	0	7	26				
LUZP4	51213	broad.mit.edu	37	X	114540908	114540908	+	Nonsense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:114540908C>T	ENST00000371920.3	+	4	488	c.481C>T	c.(481-483)Cga>Tga	p.R161*	LUZP4_ENST00000451986.2_Nonsense_Mutation_p.R79*	NM_016383.3	NP_057467.1	Q9P127	LUZP4_HUMAN	leucine zipper protein 4	161						nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	14						TCATTCTGAGCGATCCCGAAA	0.463																																							uc004eqa.2		NA																	0				ovary(2)	2						c.(481-483)CGA>TGA		leucine zipper protein 4							104.0	97.0	99.0					X																	114540908		2203	4300	6503	SO:0001587	stop_gained	51213					nucleus		g.chrX:114540908C>T	AF124430	CCDS14567.1	Xq24	2009-03-25			ENSG00000102021	ENSG00000102021			24971	protein-coding gene	gene with protein product	"""cancer/testis antigen 28"""	300616				12032826, 11051238	Standard	XM_005268343		Approved	HOM-TES-85, CT-8, CT28	uc004eqa.3	Q9P127	OTTHUMG00000022234	ENST00000371920.3:c.481C>T	X.37:g.114540908C>T	ENSP00000360988:p.Arg161*					LUZP4_uc004eqb.2_Nonsense_Mutation_p.R79*	p.R161*	NM_016383	NP_057467	Q9P127	LUZP4_HUMAN			4	515	+			161					B3KSD6	Nonsense_Mutation	SNP	ENST00000371920.3	37	c.481C>T	CCDS14567.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.464796	0.63513	.	.	ENSG00000102021	ENST00000451986;ENST00000371920	.	.	.	2.35	-0.143	0.13444	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.8733	0.05624	0.4083:0.2639:0.3278:0.0	.	.	.	.	X	79;161	.	ENSP00000360988:R161X	R	+	1	2	LUZP4	114447164	0.000000	0.05858	0.001000	0.08648	0.475000	0.33008	-2.818000	0.00751	-0.114000	0.11936	0.179000	0.17066	CGA		0.463	LUZP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057972.1	NM_016383		21	74	0	0	0	0.012319	0	21	74				
ZCCHC12	170261	broad.mit.edu	37	X	117960036	117960036	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:117960036G>A	ENST00000310164.2	+	4	1336	c.829G>A	c.(829-831)Gtg>Atg	p.V277M		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	277					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						CGATGAGGATGTGATCCTGGT	0.567																																							uc004equ.2		NA																	0				ovary(1)	1						c.(829-831)GTG>ATG		zinc finger, CCHC domain containing 12							92.0	79.0	84.0					X																	117960036		2203	4300	6503	SO:0001583	missense	170261				regulation of transcription, DNA-dependent|transcription, DNA-dependent		nucleic acid binding|zinc ion binding	g.chrX:117960036G>A	AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.829G>A	X.37:g.117960036G>A	ENSP00000308921:p.Val277Met						p.V277M	NM_173798	NP_776159	Q6PEW1	ZCH12_HUMAN			4	1302	+			277					B3KV48|Q6PID5|Q8N1C1	Missense_Mutation	SNP	ENST00000310164.2	37	c.829G>A	CCDS14574.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.891629	0.52014	.	.	ENSG00000174460	ENST00000310164	T	0.46063	0.88	3.1	3.1	0.35709	.	.	.	.	.	T	0.61689	0.2367	M	0.78223	2.4	0.28923	N	0.892048	D	0.76494	0.999	D	0.87578	0.998	T	0.53816	-0.8385	9	0.56958	D	0.05	-20.9499	8.8131	0.34978	0.0:0.0:1.0:0.0	.	277	Q6PEW1	ZCH12_HUMAN	M	277	ENSP00000308921:V277M	ENSP00000308921:V277M	V	+	1	0	ZCCHC12	117844064	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	3.765000	0.55272	1.807000	0.52817	0.600000	0.82982	GTG		0.567	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058014.1	NM_173798		18	104	0	0	0	0.007413	0	18	104				
CXorf56	63932	broad.mit.edu	37	X	118699205	118699205	+	Silent	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:118699205G>T	ENST00000371594.4	-	1	192	c.114C>A	c.(112-114)gtC>gtA	p.V38V	CXorf56_ENST00000536133.1_Silent_p.V38V|CXorf56_ENST00000320339.4_5'UTR	NM_022101.3	NP_071384.1	Q9H5V9	CX056_HUMAN	chromosome X open reading frame 56	38										cervix(1)|endometrium(2)|lung(7)	10						CCAGCACTAGGACCATCTGGC	0.582													g|||	1	0.000264901	0.0	0.0	3775	,	,		11754	0.0		0.0	False		,,,				2504	0.001						uc004erk.1		NA																	0					0						c.(112-114)GTC>GTA		hypothetical protein LOC63932							75.0	73.0	73.0					X																	118699205		2203	4300	6503	SO:0001819	synonymous_variant	63932						protein binding	g.chrX:118699205G>T	AK026618	CCDS55484.1, CCDS55485.1	Xq24	2008-02-05			ENSG00000018610	ENSG00000018610			26239	protein-coding gene	gene with protein product						12477932	Standard	NM_022101		Approved	FLJ22965	uc004erk.2	Q9H5V9	OTTHUMG00000022276	ENST00000371594.4:c.114C>A	X.37:g.118699205G>T						CXorf56_uc004erj.1_5'UTR|CXorf56_uc011mtu.1_Silent_p.V38V	p.V38V	NM_022101	NP_071384	Q9H5V9	CX056_HUMAN			1	160	-			38					A8MPX7|B4DQN2|D3DWH9|F5GWL7|O43351	Silent	SNP	ENST00000371594.4	37	c.114C>A	CCDS14579.1																																																																																				0.582	CXorf56-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_022101		21	151	1	0	8.04996e-18	0.012319	1.43636e-17	21	151				
GLUD2	2747	broad.mit.edu	37	X	120182641	120182641	+	Missense_Mutation	SNP	A	A	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:120182641A>T	ENST00000328078.1	+	1	1180	c.1103A>T	c.(1102-1104)gAa>gTa	p.E368V		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	368					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						AAGCCCTATGAAGGAAGCATC	0.488																																							uc004eto.2		NA																	0				pancreas(1)	1						c.(1102-1104)GAA>GTA		glutamate dehydrogenase 2 precursor	L-Glutamic Acid(DB00142)|NADH(DB00157)						183.0	166.0	171.0					X																	120182641		2203	4300	6503	SO:0001583	missense	2747				glutamate biosynthetic process|glutamate catabolic process	mitochondrial matrix	ADP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|leucine binding	g.chrX:120182641A>T	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.1103A>T	X.37:g.120182641A>T	ENSP00000327589:p.Glu368Val						p.E368V	NM_012084	NP_036216	P49448	DHE4_HUMAN			1	1180	+			368					B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	c.1103A>T	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	A	12.84	2.057199	0.36277	.	.	ENSG00000182890	ENST00000328078	D	0.95518	-3.73	1.61	1.61	0.23674	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (2);NAD(P)-binding domain (1);	0.190786	0.56097	D	0.000037	D	0.94324	0.8176	M	0.86864	2.845	0.80722	D	1	B	0.22346	0.068	B	0.25614	0.062	D	0.91843	0.5485	10	0.59425	D	0.04	-20.5648	6.8544	0.24032	1.0:0.0:0.0:0.0	.	368	P49448	DHE4_HUMAN	V	368	ENSP00000327589:E368V	ENSP00000327589:E368V	E	+	2	0	GLUD2	120010322	1.000000	0.71417	0.926000	0.36857	0.935000	0.57460	6.284000	0.72652	0.919000	0.36945	0.384000	0.25694	GAA		0.488	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084		34	225	0	0	0	0.012213	0	34	225				
STAG2	10735	broad.mit.edu	37	X	123191729	123191729	+	Missense_Mutation	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:123191729A>G	ENST00000371160.1	+	15	1608	c.1318A>G	c.(1318-1320)Aga>Gga	p.R440G	STAG2_ENST00000371145.3_Missense_Mutation_p.R440G|STAG2_ENST00000354548.5_Missense_Mutation_p.R371G|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Missense_Mutation_p.R440G|STAG2_ENST00000371157.3_Missense_Mutation_p.R440G|STAG2_ENST00000371144.3_Missense_Mutation_p.R440G	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	440					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						CTTCAGTCGTAGAGATCCAGA	0.313																																							uc004etz.3		NA																	0				ovary(4)|skin(1)	5						c.(1318-1320)AGA>GGA		stromal antigen 2 isoform b							126.0	114.0	118.0					X																	123191729		2203	4300	6503	SO:0001583	missense	10735				cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding	g.chrX:123191729A>G	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.1318A>G	X.37:g.123191729A>G	ENSP00000360202:p.Arg440Gly					STAG2_uc004eua.2_Missense_Mutation_p.R440G|STAG2_uc004eub.2_Missense_Mutation_p.R440G|STAG2_uc004euc.2_Missense_Mutation_p.R440G|STAG2_uc004eud.2_Missense_Mutation_p.R440G|STAG2_uc004eue.2_Missense_Mutation_p.R440G	p.R440G	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN			14	1657	+			440					B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	37	c.1318A>G	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	A	11.48	1.651592	0.29336	.	.	ENSG00000101972	ENST00000218089;ENST00000455404;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56;1.56	5.74	3.39	0.38822	Armadillo-type fold (1);	0.054817	0.64402	D	0.000001	T	0.22627	0.0546	L	0.38531	1.155	0.54753	D	0.999989	B;B	0.33512	0.356;0.415	B;B	0.36922	0.236;0.179	T	0.04537	-1.0944	10	0.22109	T	0.4	-15.319	6.9425	0.24500	0.6264:0.2985:0.0751:0.0	.	440;440	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	G	440;440;371;440;440;440;440	ENSP00000218089:R440G;ENSP00000397265:R440G;ENSP00000346555:R371G;ENSP00000360202:R440G;ENSP00000360199:R440G;ENSP00000360187:R440G;ENSP00000360186:R440G	ENSP00000218089:R440G	R	+	1	2	STAG2	123019410	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	3.672000	0.54583	0.311000	0.23014	0.486000	0.48141	AGA		0.313	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603		4	36	0	0	0	0.000602	0	4	36				
TENM1	10178	broad.mit.edu	37	X	123779114	123779114	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:123779114C>A	ENST00000371130.3	-	10	1818	c.1755G>T	c.(1753-1755)aaG>aaT	p.K585N	TENM1_ENST00000422452.2_Missense_Mutation_p.K585N	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	585	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ACTCTGGCCCCTTCCAGCCAT	0.522																																							uc004euj.2		NA																	0				ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						c.(1753-1755)AAG>AAT		odz, odd Oz/ten-m homolog 1 isoform 3							233.0	204.0	214.0					X																	123779114		2203	4300	6503	SO:0001583	missense	10178				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	g.chrX:123779114C>A	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.1755G>T	X.37:g.123779114C>A	ENSP00000360171:p.Lys585Asn					ODZ1_uc011muj.1_Missense_Mutation_p.K584N|ODZ1_uc010nqy.2_Missense_Mutation_p.K585N	p.K585N	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN			10	1819	-			585			EGF-like 2.|Extracellular (Potential).		B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	c.1755G>T	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.523994	0.64747	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.08282	3.11;3.11	5.32	1.4	0.22301	EGF-like region, conserved site (2);	0.000000	0.85682	D	0.000000	T	0.23451	0.0567	M	0.86028	2.79	0.58432	D	0.999999	D;D;D	0.71674	0.998;0.998;0.979	P;P;P	0.60682	0.813;0.878;0.756	T	0.01033	-1.1474	10	0.87932	D	0	.	7.3248	0.26549	0.0:0.2333:0.0:0.7667	.	584;585;585	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	N	585	ENSP00000360171:K585N;ENSP00000403954:K585N	ENSP00000360171:K585N	K	-	3	2	ODZ1	123606795	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.415000	0.44635	0.250000	0.21479	0.600000	0.82982	AAG		0.522	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253		68	272	1	0	2.18329e-32	0.01441	4.16393e-32	68	272				
BCORL1	63035	broad.mit.edu	37	X	129147583	129147583	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:129147583G>T	ENST00000218147.7	+	4	1032	c.835G>T	c.(835-837)Gcc>Tcc	p.A279S	BCORL1_ENST00000540052.1_Missense_Mutation_p.A279S|BCORL1_ENST00000303743.5_Missense_Mutation_p.A279S|BCORL1_ENST00000359304.2_Missense_Mutation_p.A279S			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	279	Pro-rich.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						TTCTGTTTCGGCCTCAGTCTT	0.637																																							uc004evb.1		NA																	0				ovary(4)|breast(2)|lung(1)	7						c.(835-837)GCC>TCC		BCL6 co-repressor-like 1							98.0	87.0	91.0					X																	129147583		2203	4300	6503	SO:0001583	missense	63035				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus		g.chrX:129147583G>T	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.835G>T	X.37:g.129147583G>T	ENSP00000218147:p.Ala279Ser					BCORL1_uc010nrd.1_Missense_Mutation_p.A181S	p.A279S	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN			4	949	+			279			Pro-rich.		B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	ENST00000218147.7	37	c.835G>T	CCDS14616.1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.380195	0.24944	.	.	ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052	T;T;T;T	0.45276	0.92;1.14;0.9;0.92	4.3	4.3	0.51218	.	0.000000	0.33364	N	0.004990	T	0.30293	0.0760	N	0.08118	0	0.09310	N	0.999992	D;P	0.54964	0.969;0.895	P;B	0.50192	0.634;0.431	T	0.12142	-1.0559	9	.	.	.	-14.626	12.6001	0.56492	0.0:0.1644:0.8356:0.0	.	279;279	Q5H9F3-2;Q5H9F3	.;BCORL_HUMAN	S	279	ENSP00000218147:A279S;ENSP00000307541:A279S;ENSP00000352253:A279S;ENSP00000437775:A279S	.	A	+	1	0	BCORL1	128975264	0.010000	0.17322	0.524000	0.27887	0.325000	0.28411	1.104000	0.31074	1.963000	0.57068	0.436000	0.28706	GCC		0.637	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946		25	126	1	0	3.65163e-15	0.00632	6.23616e-15	25	126				
BCORL1	63035	broad.mit.edu	37	X	129149725	129149725	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:129149725C>T	ENST00000218147.7	+	4	3174	c.2977C>T	c.(2977-2979)Cat>Tat	p.H993Y	BCORL1_ENST00000540052.1_Missense_Mutation_p.H993Y|BCORL1_ENST00000303743.5_Missense_Mutation_p.H993Y|BCORL1_ENST00000359304.2_Missense_Mutation_p.H993Y			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	993					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						CTACATGTCCCATGAGCTGGT	0.582																																							uc004evb.1		NA																	0				ovary(4)|breast(2)|lung(1)	7						c.(2977-2979)CAT>TAT		BCL6 co-repressor-like 1							80.0	81.0	81.0					X																	129149725		2203	4300	6503	SO:0001583	missense	63035				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus		g.chrX:129149725C>T	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.2977C>T	X.37:g.129149725C>T	ENSP00000218147:p.His993Tyr					BCORL1_uc010nrd.1_Missense_Mutation_p.H895Y	p.H993Y	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN			4	3091	+			993					B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	ENST00000218147.7	37	c.2977C>T	CCDS14616.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.42|16.42	3.117681|3.117681	0.56505|0.56505	.|.	.|.	ENSG00000085185|ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822|ENST00000441294	T;T;T;T;T|.	0.54866|.	0.59;1.0;0.55;0.59;1.08|.	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	0.000000|.	0.37809|.	N|.	0.001923|.	T|T	0.56077|0.56077	0.1961|0.1961	L|L	0.27053|0.27053	0.805|0.805	0.41295|0.41295	D|D	0.987004|0.987004	D;D|.	0.71674|.	0.991;0.998|.	P;P|.	0.59357|.	0.856;0.813|.	T|T	0.53493|0.53493	-0.8431|-0.8431	10|5	0.62326|.	D|.	0.03|.	-11.8541|-11.8541	17.8442|17.8442	0.88724|0.88724	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	993;993|.	Q5H9F3-2;Q5H9F3|.	.;BCORL_HUMAN|.	Y|L	993;993;993;993;593|428	ENSP00000218147:H993Y;ENSP00000307541:H993Y;ENSP00000352253:H993Y;ENSP00000437775:H993Y;ENSP00000399483:H593Y|.	ENSP00000218147:H993Y|.	H|P	+|+	1|2	0|0	BCORL1|BCORL1	128977406|128977406	0.991000|0.991000	0.36638|0.36638	0.997000|0.997000	0.53966|0.53966	0.993000|0.993000	0.82548|0.82548	5.080000|5.080000	0.64437|0.64437	2.147000|2.147000	0.66899|0.66899	0.529000|0.529000	0.55759|0.55759	CAT|CCA		0.582	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946		28	116	0	0	0	0.00632	0	28	116				
FRMD7	90167	broad.mit.edu	37	X	131212489	131212489	+	Missense_Mutation	SNP	G	G	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:131212489G>C	ENST00000298542.4	-	12	1731	c.1556C>G	c.(1555-1557)cCa>cGa	p.P519R	FRMD7_ENST00000370879.1_Missense_Mutation_p.P399R|FRMD7_ENST00000464296.1_Missense_Mutation_p.P504R	NM_194277.2	NP_919253.1	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	519					regulation of neuron projection development (GO:0010975)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Acute lymphoblastic leukemia(192;0.000127)					ATAGCTATGTGGACTTGTCCT	0.488																																							uc004ewn.2		NA																	0				skin(1)	1						c.(1555-1557)CCA>CGA		FERM domain containing 7							163.0	159.0	160.0					X																	131212489		2203	4300	6503	SO:0001583	missense	90167				regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding	g.chrX:131212489G>C	AL161984	CCDS35397.1	Xq26.2	2014-09-17	2006-09-01	2006-09-01	ENSG00000165694	ENSG00000165694			8079	protein-coding gene	gene with protein product		300628	"""nystagmus 1, congenital"""	NYS, NYS1		2063919, 17013395	Standard	NM_194277		Approved	FLJ43346	uc004ewn.3	Q6ZUT3	OTTHUMG00000022421	ENST00000298542.4:c.1556C>G	X.37:g.131212489G>C	ENSP00000298542:p.Pro519Arg					FRMD7_uc011muy.1_Missense_Mutation_p.P504R	p.P519R	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN			12	1734	-	Acute lymphoblastic leukemia(192;0.000127)		519					C0LLJ3|Q5JX99	Missense_Mutation	SNP	ENST00000298542.4	37	c.1556C>G	CCDS35397.1	.	.	.	.	.	.	.	.	.	.	G	1.618	-0.522173	0.04171	.	.	ENSG00000165694	ENST00000370879;ENST00000298542;ENST00000464296	D;D;D	0.86366	-2.11;-1.77;-1.88	4.55	1.67	0.24075	.	0.634071	0.15201	N	0.275005	T	0.75155	0.3811	L	0.34521	1.04	0.09310	N	1	B;P	0.40970	0.376;0.734	B;B	0.33042	0.109;0.157	T	0.65780	-0.6085	10	0.59425	D	0.04	.	5.0942	0.14725	0.1602:0.0:0.5461:0.2937	.	504;519	Q6ZUT3-2;Q6ZUT3	.;FRMD7_HUMAN	R	399;519;504	ENSP00000359916:P399R;ENSP00000298542:P519R;ENSP00000417996:P504R	ENSP00000298542:P519R	P	-	2	0	FRMD7	131040170	0.398000	0.25279	0.259000	0.24435	0.009000	0.06853	0.332000	0.19751	0.086000	0.17137	0.600000	0.82982	CCA		0.488	FRMD7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355031.1	NM_194277		37	203	0	0	0	0.006999	0	37	203				
GPR112	139378	broad.mit.edu	37	X	135427714	135427714	+	Nonsense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:135427714G>T	ENST00000394143.1	+	6	2140	c.1849G>T	c.(1849-1851)Gga>Tga	p.G617*	GPR112_ENST00000370652.1_Nonsense_Mutation_p.G617*|GPR112_ENST00000412101.1_Nonsense_Mutation_p.G412*|GPR112_ENST00000287534.4_Nonsense_Mutation_p.G554*|GPR112_ENST00000394141.1_Nonsense_Mutation_p.G412*	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	617					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TACAGCTGATGGACACTTGCT	0.473																																							uc004ezu.1		NA																	0				ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(1849-1851)GGA>TGA		G-protein coupled receptor 112							131.0	99.0	110.0					X																	135427714		2203	4300	6503	SO:0001587	stop_gained	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135427714G>T	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.1849G>T	X.37:g.135427714G>T	ENSP00000377699:p.Gly617*					GPR112_uc010nsb.1_Nonsense_Mutation_p.G412*|GPR112_uc010nsc.1_Nonsense_Mutation_p.G384*	p.G617*	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN			6	2140	+	Acute lymphoblastic leukemia(192;0.000127)		617			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Nonsense_Mutation	SNP	ENST00000394143.1	37	c.1849G>T	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	g	38	6.890945	0.97912	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	.	.	.	3.04	2.15	0.27550	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	4.5297	0.11999	0.1871:0.0:0.8129:0.0	.	.	.	.	X	617;617;412;554;412	.	ENSP00000287534:G554X	G	+	1	0	GPR112	135255380	0.023000	0.18921	0.007000	0.13788	0.008000	0.06430	0.438000	0.21559	1.483000	0.48342	0.411000	0.27672	GGA		0.473	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			15	82	1	0	1.49906e-05	0.00245	1.77162e-05	15	82				
GPR112	139378	broad.mit.edu	37	X	135429187	135429187	+	Nonsense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:135429187G>T	ENST00000394143.1	+	6	3613	c.3322G>T	c.(3322-3324)Gaa>Taa	p.E1108*	GPR112_ENST00000370652.1_Nonsense_Mutation_p.E1108*|GPR112_ENST00000412101.1_Nonsense_Mutation_p.E903*|GPR112_ENST00000287534.4_Nonsense_Mutation_p.E1045*|GPR112_ENST00000394141.1_Nonsense_Mutation_p.E903*	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1108					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TTCTCTGACAGAAACACCATT	0.473																																							uc004ezu.1		NA																	0				ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12						c.(3322-3324)GAA>TAA		G-protein coupled receptor 112							156.0	127.0	137.0					X																	135429187		2203	4300	6503	SO:0001587	stop_gained	139378				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:135429187G>T	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.3322G>T	X.37:g.135429187G>T	ENSP00000377699:p.Glu1108*					GPR112_uc010nsb.1_Nonsense_Mutation_p.E903*|GPR112_uc010nsc.1_Nonsense_Mutation_p.E875*	p.E1108*	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN			6	3613	+	Acute lymphoblastic leukemia(192;0.000127)		1108			Extracellular (Potential).		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Nonsense_Mutation	SNP	ENST00000394143.1	37	c.3322G>T	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	G	42	9.327338	0.99138	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	.	.	.	2.82	2.82	0.32997	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	9.0848	0.36574	0.0:0.0:1.0:0.0	.	.	.	.	X	1108;1108;903;1045;903	.	ENSP00000287534:E1045X	E	+	1	0	GPR112	135256853	0.742000	0.28228	0.030000	0.17652	0.080000	0.17528	1.741000	0.38238	1.363000	0.46019	0.436000	0.28706	GAA		0.473	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1			44	197	1	0	1.7489e-18	0.011902	3.14704e-18	44	197				
CD40LG	959	broad.mit.edu	37	X	135741549	135741549	+	Missense_Mutation	SNP	C	C	A	rs193922136		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:135741549C>A	ENST00000370629.2	+	5	817	c.761C>A	c.(760-762)aCg>aAg	p.T254K	CD40LG_ENST00000370628.2_Missense_Mutation_p.T233K	NM_000074.2	NP_000065.1	P29965	CD40L_HUMAN	CD40 ligand	254			T -> M (in HIGM1). {ECO:0000269|PubMed:9150729, ECO:0000269|PubMed:9746782}.		B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|immunoglobulin secretion (GO:0048305)|inflammatory response (GO:0006954)|isotype switching (GO:0045190)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of apoptotic process (GO:0043066)|platelet activation (GO:0030168)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of interleukin-12 production (GO:0032735)|regulation of immune response (GO:0050776)|regulation of immunoglobulin secretion (GO:0051023)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	CD40 receptor binding (GO:0005174)			endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|skin(1)|stomach(1)	26	Acute lymphoblastic leukemia(192;0.000127)					ACTGGCTTCACGTCCTTTGGC	0.507									Immune Deficiency with Hyper-IgM																														uc004faa.2		NA																	0				skin(1)	1	GRCh37	CM960264	CD40LG	M		c.(760-762)ACG>AAG		CD40 ligand	Atorvastatin(DB01076)						112.0	95.0	100.0					X																	135741549		2203	4300	6503	SO:0001583	missense	959	Immune_Deficiency_with_Hyper-IgM	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	anti-apoptosis|B cell proliferation|inflammatory response|isotype switching|leukocyte cell-cell adhesion|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of interleukin-12 production	extracellular space|integral to plasma membrane|soluble fraction	CD40 receptor binding|cytokine activity|tumor necrosis factor receptor binding	g.chrX:135741549C>A	X67878	CCDS14659.1	Xq26	2014-09-17	2008-08-01	2005-01-14	ENSG00000102245	ENSG00000102245		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"", ""Endogenous ligands"""	11935	protein-coding gene	gene with protein product	"""CD40 antigen ligand"", ""tumor necrosis factor (ligand) superfamily member 5"", ""T-B cell-activating molecule"", ""TNF-related activation protein"", ""hyper-IgM syndrome"""	300386	"""tumor necrosis factor (ligand) superfamily, member 5 (hyper-IgM syndrome)"""	HIGM1, IMD3, TNFSF5		1427881, 7678782	Standard	NM_000074		Approved	CD40L, TRAP, gp39, hCD40L, CD154	uc004faa.3	P29965	OTTHUMG00000022512	ENST00000370629.2:c.761C>A	X.37:g.135741549C>A	ENSP00000359663:p.Thr254Lys					CD40LG_uc010nsd.2_Missense_Mutation_p.T233K	p.T254K	NM_000074	NP_000065	P29965	CD40L_HUMAN			5	833	+	Acute lymphoblastic leukemia(192;0.000127)		254		T -> M (in HIGM1).	Extracellular (Potential).			Missense_Mutation	SNP	ENST00000370629.2	37	c.761C>A	CCDS14659.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.239547	0.79800	.	.	ENSG00000102245	ENST00000370629;ENST00000370628	D;D	0.99150	-5.49;-5.49	5.46	5.46	0.80206	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.055142	0.64402	D	0.000001	D	0.99180	0.9716	M	0.72353	2.195	0.38931	D	0.957951	D;D	0.89917	1.0;1.0	D;D	0.87578	0.989;0.998	D	0.99936	1.1362	10	0.87932	D	0	-12.444	17.9229	0.88973	0.0:1.0:0.0:0.0	.	233;254	Q3L8U2;P29965	.;CD40L_HUMAN	K	254;233	ENSP00000359663:T254K;ENSP00000359662:T233K	ENSP00000359662:T233K	T	+	2	0	CD40LG	135569215	0.996000	0.38824	0.913000	0.36048	0.904000	0.53231	3.754000	0.55189	2.273000	0.75805	0.594000	0.82650	ACG		0.507	CD40LG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058501.1	NM_000074		19	107	1	0	8.28177e-16	0.007413	1.43356e-15	19	107				
GPR101	83550	broad.mit.edu	37	X	136112640	136112640	+	Silent	SNP	A	A	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:136112640A>G	ENST00000298110.1	-	1	1193	c.1194T>C	c.(1192-1194)gcT>gcC	p.A398A		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	398						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					AGATCACTTTAGCAGCTTTGC	0.547																																							uc011mwh.1		NA																	0				ovary(3)|lung(1)|skin(1)	5						c.(1192-1194)GCT>GCC		G protein-coupled receptor 101							129.0	117.0	121.0					X																	136112640		2203	4300	6503	SO:0001819	synonymous_variant	83550					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chrX:136112640A>G	AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.1194T>C	X.37:g.136112640A>G							p.A398A	NM_054021	NP_473362	Q96P66	GP101_HUMAN			1	1194	-	Acute lymphoblastic leukemia(192;0.000127)		398			Cytoplasmic (Potential).		Q5JSM8|Q8NG93	Silent	SNP	ENST00000298110.1	37	c.1194T>C	CCDS14662.1																																																																																				0.547	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1			16	76	0	0	0	0.003163	0	16	76				
SOX3	6658	broad.mit.edu	37	X	139586844	139586844	+	Missense_Mutation	SNP	T	T	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:139586844T>A	ENST00000370536.2	-	1	381	c.382A>T	c.(382-384)Agc>Tgc	p.S128C		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	128					central nervous system development (GO:0007417)|face development (GO:0060324)|hypothalamus development (GO:0021854)|negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|sensory organ development (GO:0007423)|Sertoli cell development (GO:0060009)|sex determination (GO:0007530)|spermatid differentiation (GO:0048515)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)					CCACCTCCGCTCGCACCACCG	0.721																																							uc004fbd.1		NA																	0				pancreas(1)	1						c.(382-384)AGC>TGC		SRY (sex determining region Y)-box 3							15.0	17.0	17.0					X																	139586844		2199	4296	6495	SO:0001583	missense	6658				face development|hypothalamus development|negative regulation of neuron differentiation|pituitary gland development|regulation of transcription, DNA-dependent|sensory organ development|sex determination|transcription, DNA-dependent	nucleus	DNA binding	g.chrX:139586844T>A		CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595		"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP		15800844	Standard	NM_005634		Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.382A>T	X.37:g.139586844T>A	ENSP00000359567:p.Ser128Cys						p.S128C	NM_005634	NP_005625	P41225	SOX3_HUMAN			1	382	-	Acute lymphoblastic leukemia(192;7.65e-05)		128					P35714|Q5JWI3|Q9NP49	Missense_Mutation	SNP	ENST00000370536.2	37	c.382A>T	CCDS14669.1	.	.	.	.	.	.	.	.	.	.	t	7.996	0.754445	0.15778	.	.	ENSG00000134595	ENST00000370536	D	0.82711	-1.64	4.39	2.04	0.26737	High mobility group, superfamily (1);	0.622203	0.14818	U	0.296636	T	0.59404	0.2191	N	0.08118	0	0.09310	N	1	P	0.41643	0.758	B	0.36186	0.219	T	0.51560	-0.8690	9	.	.	.	.	4.5302	0.12001	0.0:0.3268:0.0:0.6732	.	128	P41225	SOX3_HUMAN	C	128	ENSP00000359567:S128C	.	S	-	1	0	SOX3	139414510	0.994000	0.37717	0.004000	0.12327	0.124000	0.20399	0.882000	0.28186	1.433000	0.47394	0.427000	0.28365	AGC		0.721	SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058577.1			7	42	0	0	0	0.00308	0	7	42				
MAGEC3	139081	broad.mit.edu	37	X	140984797	140984797	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:140984797C>T	ENST00000298296.1	+	7	1253	c.1253C>T	c.(1252-1254)tCc>tTc	p.S418F	MAGEC3_ENST00000536088.1_Missense_Mutation_p.S120F|MAGEC3_ENST00000483584.1_3'UTR|MAGEC3_ENST00000544766.1_Missense_Mutation_p.S120F|MAGEC3_ENST00000409007.1_Missense_Mutation_p.S120F|MAGEC3_ENST00000443323.2_Missense_Mutation_p.S40F	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	418										NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					cctcTAGACTCCTGCTCATCC	0.572																																							uc011mwp.1		NA																	0				skin(2)|central_nervous_system(1)	3						c.(1252-1254)TCC>TTC		melanoma antigen family C, 3 isoform 1							28.0	26.0	26.0					X																	140984797		2203	4300	6503	SO:0001583	missense	139081							g.chrX:140984797C>T	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1253C>T	X.37:g.140984797C>T	ENSP00000298296:p.Ser418Phe					MAGEC3_uc004fbs.2_Missense_Mutation_p.S120F|MAGEC3_uc010nsj.2_Missense_Mutation_p.S120F	p.S418F	NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN			7	1253	+	Acute lymphoblastic leukemia(192;6.56e-05)		418					Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	ENST00000298296.1	37	c.1253C>T	CCDS14676.1	.	.	.	.	.	.	.	.	.	.	c	10.02	1.235866	0.22626	.	.	ENSG00000165509	ENST00000298296;ENST00000536088;ENST00000443323;ENST00000544766;ENST00000409007	T;T;T;T;T	0.03717	4.07;3.83;3.87;3.83;3.83	1.18	-1.25	0.09405	.	.	.	.	.	T	0.02649	0.0080	N	0.24115	0.695	0.09310	N	1	P;B	0.46020	0.871;0.039	P;B	0.45195	0.473;0.009	T	0.38200	-0.9672	9	0.20519	T	0.43	.	2.3205	0.04209	0.0:0.3981:0.3318:0.2701	.	418;120	Q8TD91;Q3SYA7	MAGC3_HUMAN;.	F	418;120;40;120;120	ENSP00000298296:S418F;ENSP00000441107:S120F;ENSP00000438254:S40F;ENSP00000440444:S120F;ENSP00000386566:S120F	ENSP00000298296:S418F	S	+	2	0	MAGEC3	140812463	0.000000	0.05858	0.001000	0.08648	0.136000	0.21042	-0.344000	0.07780	-0.535000	0.06307	0.179000	0.17066	TCC		0.572	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702		3	20	0	0	0	0.004672	0	3	20				
MAGEA8	4107	broad.mit.edu	37	X	149013098	149013098	+	Missense_Mutation	SNP	G	G	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:149013098G>A	ENST00000542674.1	+	3	573	c.52G>A	c.(52-54)Gcc>Acc	p.A18T	MAGEA8_ENST00000286482.1_Missense_Mutation_p.A18T|MAGEA8_ENST00000493910.1_3'UTR|MAGEA8_ENST00000535454.1_Missense_Mutation_p.A18T	NM_001166401.1	NP_001159873.1	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	18										NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(12)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)					AGGCCTTCAGGCCCAAGGAGA	0.577																																							uc004fdw.1		NA																	0					0						c.(52-54)GCC>ACC		melanoma antigen family A, 8							46.0	37.0	40.0					X																	149013098		2203	4298	6501	SO:0001583	missense	4107							g.chrX:149013098G>A		CCDS14692.1	Xq28	2009-03-13			ENSG00000156009	ENSG00000156009			6806	protein-coding gene	gene with protein product	"""MAGE-8 antigen"", ""cancer/testis antigen family 1, member 8"""	300341		MAGE8		8575766	Standard	NM_005364		Approved	MGC2182, CT1.8	uc004fdw.2	P43361	OTTHUMG00000022635	ENST00000542674.1:c.52G>A	X.37:g.149013098G>A	ENSP00000443776:p.Ala18Thr						p.A18T	NM_005364	NP_005355	P43361	MAGA8_HUMAN			3	267	+	Acute lymphoblastic leukemia(192;6.56e-05)		18					Q9BUN9	Missense_Mutation	SNP	ENST00000542674.1	37	c.52G>A	CCDS14692.1	.	.	.	.	.	.	.	.	.	.	.	12.41	1.930477	0.34096	.	.	ENSG00000156009	ENST00000535454;ENST00000542674;ENST00000286482	T;T;T	0.08896	3.04;3.04;3.04	0.994	0.0199	0.14123	Melanoma associated antigen, MAGE, N-terminal (1);	1.979020	0.03442	N	0.209429	T	0.23572	0.0570	M	0.72118	2.19	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.13388	-1.0511	10	0.29301	T	0.29	.	3.055	0.06181	0.3582:0.0:0.6418:0.0	.	18	P43361	MAGA8_HUMAN	T	18	ENSP00000438293:A18T;ENSP00000443776:A18T;ENSP00000286482:A18T	ENSP00000286482:A18T	A	+	1	0	MAGEA8	148773756	0.018000	0.18449	0.015000	0.15790	0.076000	0.17211	0.049000	0.14099	-0.063000	0.13065	0.179000	0.17066	GCC		0.577	MAGEA8-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058728.1	NM_005364		8	26	0	0	0	0.00308	0	8	26				
MAGEA10	4109	broad.mit.edu	37	X	151303513	151303513	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:151303513C>A	ENST00000370323.4	-	4	896	c.580G>T	c.(580-582)Gtg>Ttg	p.V194L	RP11-1007I13.4_ENST00000509345.2_RNA|MAGEA10_ENST00000244096.3_Missense_Mutation_p.V194L	NM_001251828.1|NM_021048.4	NP_001238757.1|NP_066386	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	194	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					GTGGGATCCACTTCCTTTACA	0.498																																							uc004ffk.2		NA																	0					0						c.(580-582)GTG>TTG		melanoma antigen family A, 10							80.0	76.0	77.0					X																	151303513		2203	4300	6503	SO:0001583	missense	4109							g.chrX:151303513C>A		CCDS14705.1	Xq28	2009-03-13			ENSG00000124260	ENSG00000124260			6797	protein-coding gene	gene with protein product	"""MAGE-10 antigen"", ""melanoma-associated antigen 10"", ""cancer/testis antigen family 1, member 10"""	300343		MAGE10		8575766	Standard	NM_001011543		Approved	MGC10599, CT1.10	uc004ffl.3	P43363	OTTHUMG00000024180	ENST00000370323.4:c.580G>T	X.37:g.151303513C>A	ENSP00000359347:p.Val194Leu					MAGEA10_uc004ffl.2_Missense_Mutation_p.V194L	p.V194L	NM_001011543	NP_001011543	P43363	MAGAA_HUMAN			5	988	-	Acute lymphoblastic leukemia(192;6.56e-05)		194			MAGE.			Missense_Mutation	SNP	ENST00000370323.4	37	c.580G>T	CCDS14705.1	.	.	.	.	.	.	.	.	.	.	C	6.908	0.537035	0.13188	.	.	ENSG00000124260	ENST00000370323;ENST00000244096	T;T	0.04706	3.57;3.57	2.6	-0.453	0.12201	.	0.275863	0.32970	N	0.005438	T	0.05914	0.0154	M	0.73372	2.23	0.09310	N	1	B	0.18863	0.031	B	0.19666	0.026	T	0.28776	-1.0033	10	0.56958	D	0.05	.	4.3571	0.11183	0.1775:0.5689:0.0:0.2535	.	194	P43363	MAGAA_HUMAN	L	194	ENSP00000359347:V194L;ENSP00000244096:V194L	ENSP00000244096:V194L	V	-	1	0	MAGEA10	151054169	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.608000	0.05641	-0.641000	0.05487	-2.407000	0.00222	GTG		0.498	MAGEA10-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060916.3	NM_021048		19	104	1	0	5.35267e-07	0.007413	6.9727e-07	19	104				
MAGEA6	4105	broad.mit.edu	37	X	151869560	151869560	+	Missense_Mutation	SNP	T	T	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:151869560T>G	ENST00000329342.5	+	3	475	c.250T>G	c.(250-252)Tat>Gat	p.Y84D		NM_005363.2	NP_005354.1	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	84										breast(1)|endometrium(3)|large_intestine(3)|lung(16)|prostate(3)|skin(1)|urinary_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					GAGCCAATCCTATGAGGACTC	0.597																																							uc004ffq.1		NA																	0					0						c.(250-252)TAT>GAT		melanoma antigen family A, 6							33.0	34.0	34.0					X																	151869560		2199	4289	6488	SO:0001583	missense	4105						protein binding	g.chrX:151869560T>G		CCDS76050.1	Xq28	2009-03-13			ENSG00000197172	ENSG00000197172			6804	protein-coding gene	gene with protein product	"""MAGE-6 antigen"", ""melanoma-associated antigen 6"", ""melanoma antigen family A 6"", ""cancer/testis antigen family 1, member 6"""	300176		MAGE6		8575766	Standard	NM_005363		Approved	CT1.6	uc004ffq.1	P43360	OTTHUMG00000022642	ENST00000329342.5:c.250T>G	X.37:g.151869560T>G	ENSP00000329199:p.Tyr84Asp					MAGEA6_uc004ffr.1_Missense_Mutation_p.Y84D|MAGEA2_uc010nto.2_Intron	p.Y84D	NM_005363	NP_005354	P43360	MAGA6_HUMAN			3	444	+	Acute lymphoblastic leukemia(192;6.56e-05)		84					A8IF93|Q6NW44	Missense_Mutation	SNP	ENST00000329342.5	37	c.250T>G	CCDS14708.1	.	.	.	.	.	.	.	.	.	.	t	0.001	-3.542431	0.00009	.	.	ENSG00000197172	ENST00000329342;ENST00000412733;ENST00000457643	T;T;T	0.03181	4.02;4.02;4.02	0.596	-1.19	0.09585	Melanoma associated antigen, MAGE, N-terminal (1);	3.002980	0.00807	N	0.001461	T	0.00608	0.0020	N	0.00019	-2.8	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47649	-0.9101	9	0.02654	T	1	.	.	.	.	.	84	P43360	MAGA6_HUMAN	D	84	ENSP00000329199:Y84D;ENSP00000403303:Y84D;ENSP00000401806:Y84D	ENSP00000329199:Y84D	Y	+	1	0	MAGEA6	151620216	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.573000	0.02134	-1.434000	0.01975	-1.462000	0.01023	TAT		0.597	MAGEA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058747.2	NM_005363		21	86	0	0	0	0.003954	0	21	86				
CETN2	1069	broad.mit.edu	37	X	151996441	151996441	+	Missense_Mutation	SNP	C	C	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:151996441C>T	ENST00000370277.3	-	5	529	c.463G>A	c.(463-465)Gga>Aga	p.G155R	CETN2_ENST00000493482.1_5'UTR	NM_004344.1	NP_004335.1	P41208	CETN2_HUMAN	centrin, EF-hand protein, 2	155	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)|regulation of cytokinesis (GO:0032465)|spermatogenesis (GO:0007283)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|intracellular (GO:0005622)|photoreceptor connecting cilium (GO:0032391)|XPC complex (GO:0071942)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|calcium ion binding (GO:0005509)|nucleic acid binding (GO:0003676)			breast(1)|lung(4)|prostate(1)|skin(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)					CTGACCTCTCCATCTCCATCT	0.373								Direct reversal of damage;Nucleotide excision repair (NER)																															uc004fgq.2		NA																	0					0						c.(463-465)GGA>AGA	Direct_reversal_of_damage|NER	caltractin							193.0	164.0	174.0					X																	151996441		2203	4300	6503	SO:0001583	missense	1069				cell division|centriole replication|G2/M transition of mitotic cell cycle|mitosis|nucleotide-excision repair|regulation of cytokinesis	centriole|cytosol|XPC complex	ATP binding|ATP-dependent helicase activity|calcium ion binding|nucleic acid binding	g.chrX:151996441C>T	X72964	CCDS14716.1	Xq28	2013-01-10			ENSG00000147400	ENSG00000147400		"""EF-hand domain containing"""	1867	protein-coding gene	gene with protein product		300006		CALT		7713520, 8597638	Standard	NM_004344		Approved	CEN2	uc004fgq.3	P41208	OTTHUMG00000024246	ENST00000370277.3:c.463G>A	X.37:g.151996441C>T	ENSP00000359300:p.Gly155Arg					CETN2_uc004fgr.2_Missense_Mutation_p.G84R	p.G155R	NM_004344	NP_004335	P41208	CETN2_HUMAN			5	510	-	Acute lymphoblastic leukemia(192;6.56e-05)		155			2.|EF-hand 4.		B2R4T4|Q53XW1	Missense_Mutation	SNP	ENST00000370277.3	37	c.463G>A	CCDS14716.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.613415	0.87359	.	.	ENSG00000147400	ENST00000370277	D	0.94497	-3.44	6.17	5.31	0.75309	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.97807	0.9280	H	0.95224	3.64	0.80722	D	1	D	0.63880	0.993	D	0.67900	0.954	D	0.98196	1.0465	10	0.87932	D	0	.	11.9876	0.53157	0.0:0.9156:0.0:0.0844	.	155	P41208	CETN2_HUMAN	R	155	ENSP00000359300:G155R	ENSP00000359300:G155R	G	-	1	0	CETN2	151747097	1.000000	0.71417	0.908000	0.35775	0.894000	0.52154	7.675000	0.84002	1.348000	0.45733	0.600000	0.82982	GGA		0.373	CETN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061197.1	NM_004344		20	110	0	0	0	0.010504	0	20	110				
PNMA5	114824	broad.mit.edu	37	X	152159318	152159318	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:152159318G>T	ENST00000439251.1	-	2	1263	c.825C>A	c.(823-825)caC>caA	p.H275Q	PNMA5_ENST00000361887.5_Missense_Mutation_p.H275Q|PNMA5_ENST00000452693.1_Missense_Mutation_p.H275Q|PNMA5_ENST00000535214.1_Missense_Mutation_p.H275Q	NM_001103150.1	NP_001096620.1	Q96PV4	PNMA5_HUMAN	paraneoplastic Ma antigen family member 5	275					positive regulation of apoptotic process (GO:0043065)					breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					AGGGGCTCTTGTGCACGGCTT	0.567																																							uc010ntw.2		NA																	0				ovary(1)|skin(1)	2						c.(823-825)CAC>CAA		paraneoplastic antigen like 5							55.0	55.0	55.0					X																	152159318		2203	4300	6503	SO:0001583	missense	114824				apoptosis			g.chrX:152159318G>T	AB067521	CCDS14718.1	Xq28	2012-02-09	2012-02-09		ENSG00000198883	ENSG00000198883		"""Paraneoplastic Ma antigens"""	18743	protein-coding gene	gene with protein product	"""paraneoplastic antigen family 5"""	300916	"""paraneoplastic antigen like 5"""			16214224	Standard	NM_052926		Approved	KIAA1934	uc004fgy.4	Q96PV4	OTTHUMG00000024184	ENST00000439251.1:c.825C>A	X.37:g.152159318G>T	ENSP00000388850:p.His275Gln					PNMA5_uc004fha.3_Missense_Mutation_p.H275Q|PNMA5_uc010ntx.2_Missense_Mutation_p.H275Q|PNMA5_uc004fgy.3_Missense_Mutation_p.H275Q	p.H275Q	NM_001103151	NP_001096621	Q96PV4	PNMA5_HUMAN			3	1164	-	Acute lymphoblastic leukemia(192;6.56e-05)		275					B4DI72|B7Z9Y9|Q495L5|Q8NET3	Missense_Mutation	SNP	ENST00000439251.1	37	c.825C>A	CCDS14718.1	.	.	.	.	.	.	.	.	.	.	g	1.367	-0.587263	0.03799	.	.	ENSG00000198883	ENST00000361887;ENST00000535214;ENST00000439251;ENST00000452693	T;T;T;T	0.08282	3.11;3.11;3.11;3.11	3.07	0.15	0.14883	.	.	.	.	.	T	0.01454	0.0047	N	0.00182	-1.905	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45498	-0.9257	9	0.16896	T	0.51	-4.9951	1.5475	0.02568	0.212:0.449:0.2074:0.1316	.	275	Q96PV4	PNMA5_HUMAN	Q	275	ENSP00000354834:H275Q;ENSP00000445775:H275Q;ENSP00000388850:H275Q;ENSP00000392342:H275Q	ENSP00000354834:H275Q	H	-	3	2	PNMA5	151909974	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.487000	0.06505	-0.057000	0.13199	-2.409000	0.00222	CAC		0.567	PNMA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060925.1	NM_052926		26	96	1	0	2.27525e-19	0.003954	4.15283e-19	26	96				
PNMA3	29944	broad.mit.edu	37	X	152226044	152226044	+	Missense_Mutation	SNP	G	G	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:152226044G>T	ENST00000370264.4	+	1	658	c.632G>T	c.(631-633)gGc>gTc	p.G211V	PNMA3_ENST00000447306.1_Missense_Mutation_p.G211V|PNMA3_ENST00000370265.4_Missense_Mutation_p.G211V			Q9UL41	PNMA3_HUMAN	paraneoplastic Ma antigen 3	211					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.G211V(2)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	16	Acute lymphoblastic leukemia(192;6.56e-05)					tgcttacggggccctgctctc	0.612																																							uc004fhc.2		NA																	2	Substitution - Missense(2)		lung(2)	skin(2)|large_intestine(1)	3						c.(631-633)GGC>GTC		paraneoplastic cancer-testis-brain antigen							70.0	69.0	70.0					X																	152226044		2203	4300	6503	SO:0001583	missense	29944				apoptosis	nucleolus	nucleic acid binding|zinc ion binding	g.chrX:152226044G>T	AF083116	CCDS35435.2, CCDS65344.1	Xq28	2012-02-09	2012-02-09		ENSG00000183837	ENSG00000183837		"""Paraneoplastic Ma antigens"""	18742	protein-coding gene	gene with protein product	"""paraneoplastic cancer-testis-brain antigen"""	300675	"""paraneoplastic antigen MA3"""			11558790	Standard	NM_013364		Approved	MA5, MA3, MGC132756, MGC132758	uc004fhc.2	Q9UL41	OTTHUMG00000024195	ENST00000370264.4:c.632G>T	X.37:g.152226044G>T	ENSP00000359286:p.Gly211Val					PNMA5_uc004fha.3_5'Flank|PNMA3_uc004fhd.2_5'Flank	p.G211V	NM_013364	NP_037496	Q9UL41	PNMA3_HUMAN			2	968	+	Acute lymphoblastic leukemia(192;6.56e-05)		211					D3DWT7|Q9H0A4	Missense_Mutation	SNP	ENST00000370264.4	37	c.632G>T	CCDS35435.2	.	.	.	.	.	.	.	.	.	.	g	12.53	1.965242	0.34659	.	.	ENSG00000183837	ENST00000370265;ENST00000447306;ENST00000370264	T;T;T	0.41065	1.01;1.01;1.01	1.98	1.98	0.26296	.	.	.	.	.	T	0.60534	0.2276	M	0.77616	2.38	0.20563	N	0.999888	D	0.89917	1.0	D	0.91635	0.999	T	0.43015	-0.9417	9	0.87932	D	0	.	6.8643	0.24084	0.0:0.0:1.0:0.0	.	211	Q9UL41	PNMA3_HUMAN	V	211	ENSP00000359288:G211V;ENSP00000407642:G211V;ENSP00000359286:G211V	ENSP00000359286:G211V	G	+	2	0	PNMA3	151976700	0.138000	0.22547	0.011000	0.14972	0.014000	0.08584	2.435000	0.44811	1.297000	0.44761	0.464000	0.42555	GGC		0.612	PNMA3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060946.2	NM_013364		20	135	1	0	9.7654e-05	0.007413	0.00011148	20	135				
MECP2	4204	broad.mit.edu	37	X	153295921	153295921	+	Missense_Mutation	SNP	C	C	A	rs267608625|rs61753980		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:153295921C>A	ENST00000303391.6	-	4	1607	c.1358G>T	c.(1357-1359)cGa>cTa	p.R453L	MECP2_ENST00000460227.1_5'Flank|MECP2_ENST00000453960.2_Missense_Mutation_p.R465L	NM_004992.3	NP_004983.1	P51608	MECP2_HUMAN	methyl CpG binding protein 2	453			R -> Q (in MRXS13). {ECO:0000269|PubMed:11309367}.		adult locomotory behavior (GO:0008344)|behavioral fear response (GO:0001662)|cardiolipin metabolic process (GO:0032048)|catecholamine secretion (GO:0050432)|cerebellum development (GO:0021549)|chromatin silencing (GO:0006342)|dendrite development (GO:0016358)|glucocorticoid metabolic process (GO:0008211)|glutamine metabolic process (GO:0006541)|histone acetylation (GO:0016573)|histone methylation (GO:0016571)|inositol metabolic process (GO:0006020)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone methylation (GO:0031061)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron maturation (GO:0042551)|pathogenesis (GO:0009405)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|proprioception (GO:0019230)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|startle response (GO:0001964)|synapse assembly (GO:0007416)|transcription, DNA-templated (GO:0006351)|ventricular system development (GO:0021591)|visual learning (GO:0008542)	cytosol (GO:0005829)|extracellular space (GO:0005615)|heterochromatin (GO:0000792)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded methylated DNA binding (GO:0010385)|methyl-CpG binding (GO:0008327)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|siRNA binding (GO:0035197)|transcription corepressor activity (GO:0003714)			breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(8)|prostate(2)|urinary_tract(1)	23	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCCCTCCCCTCGGTGTTTGTA	0.622																																							uc004fjv.2		NA																	0					0	GRCh37	CM011406	MECP2	M	rs61753980	c.(1357-1359)CGA>CTA		methyl CpG binding protein 2 isoform 1							249.0	221.0	231.0					X																	153295921		2203	4300	6503	SO:0001583	missense	4204				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	heterochromatin|nucleus	double-stranded methylated DNA binding|protein domain specific binding|protein N-terminus binding|transcription corepressor activity	g.chrX:153295921C>A	AF158180	CCDS14741.1, CCDS48193.1	Xq28	2014-09-17	2014-06-18		ENSG00000169057	ENSG00000169057			6990	protein-coding gene	gene with protein product		300005	"""mental retardation, X-linked 16"", ""mental retardation, X-linked 79"", ""Rett syndrome"", ""methyl CpG binding protein 2 (Rett syndrome)"""	RTT, MRX16, MRX79		1606614, 10508514	Standard	NM_004992		Approved		uc004fjw.2	P51608	OTTHUMG00000024229	ENST00000303391.6:c.1358G>T	X.37:g.153295921C>A	ENSP00000301948:p.Arg453Leu					MECP2_uc004fjw.2_Missense_Mutation_p.R465L	p.R453L	NM_004992	NP_004983	P51608	MECP2_HUMAN			4	1584	-	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		453		R -> Q (in MRXS13).			O15233|Q6QHH9|Q7Z384	Missense_Mutation	SNP	ENST00000303391.6	37	c.1358G>T	CCDS14741.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.291681	0.59976	.	.	ENSG00000169057	ENST00000303391;ENST00000453960	D;D	0.90620	-2.7;-2.69	5.67	5.67	0.87782	.	0.192792	0.43747	D	0.000532	D	0.91307	0.7259	N	0.24115	0.695	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.76575	0.988;0.972	D	0.90399	0.4401	10	0.30854	T	0.27	-4.0964	15.98	0.80102	0.0:1.0:0.0:0.0	.	465;453	P51608-2;P51608	.;MECP2_HUMAN	L	453;465	ENSP00000301948:R453L;ENSP00000395535:R465L	ENSP00000301948:R453L	R	-	2	0	MECP2	152949115	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.235000	0.51328	2.374000	0.81015	0.513000	0.50165	CGA		0.622	MECP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061144.1	NM_004992		79	450	1	0	7.83748e-43	0.01441	1.51287e-42	79	450				
SLC10A3	8273	broad.mit.edu	37	X	153716657	153716657	+	Missense_Mutation	SNP	C	C	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:153716657C>A	ENST00000393587.4	-	3	886	c.623G>T	c.(622-624)gGg>gTg	p.G208V	SLC10A3_ENST00000393586.1_Missense_Mutation_p.G263V|SLC10A3_ENST00000369649.4_Missense_Mutation_p.G179V|SLC10A3_ENST00000263512.4_Missense_Mutation_p.G208V|UBL4A_ENST00000369653.4_5'Flank|UBL4A_ENST00000369660.4_5'Flank|UBL4A_ENST00000477777.1_5'Flank	NM_001142391.1|NM_001142392.1	NP_001135863.1|NP_001135864.1	P09131	P3_HUMAN	solute carrier family 10, member 3	208					response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CACTTTGCACCCAAACGAACA	0.587																																							uc004flq.2		NA																	0				ovary(1)|skin(1)	2						c.(622-624)GGG>GTG		solute carrier family 10, member 3 isoform 1							72.0	75.0	74.0					X																	153716657		2203	4299	6502	SO:0001583	missense	8273				organic anion transport	integral to membrane	bile acid:sodium symporter activity	g.chrX:153716657C>A	X12458	CCDS14755.1, CCDS48195.1	Xq28	2013-07-18	2013-07-18		ENSG00000126903	ENSG00000126903		"""Solute carriers"""	22979	protein-coding gene	gene with protein product		312090				8733135	Standard	NM_019848		Approved	P3, DXS253E	uc004flq.3	P09131	OTTHUMG00000013369	ENST00000393587.4:c.623G>T	X.37:g.153716657C>A	ENSP00000377212:p.Gly208Val					UBL4A_uc004flo.2_5'Flank|SLC10A3_uc004flr.2_Missense_Mutation_p.G179V|SLC10A3_uc004flp.2_Missense_Mutation_p.G208V	p.G208V	NM_001142392	NP_001135864	P09131	P3_HUMAN			3	887	-	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		208					Q5HY79|Q9BSL2	Missense_Mutation	SNP	ENST00000393587.4	37	c.623G>T	CCDS14755.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.492465	0.84962	.	.	ENSG00000126903	ENST00000369649;ENST00000393586;ENST00000263512;ENST00000393587;ENST00000453912	T;T;T;T	0.14516	2.5;2.5;2.5;2.5	5.36	5.36	0.76844	.	0.000000	0.85682	U	0.000000	T	0.47673	0.1458	M	0.91818	3.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.60146	-0.7320	10	0.87932	D	0	-12.4706	16.8028	0.85618	0.0:1.0:0.0:0.0	.	179;208	Q9BSL2;P09131	.;P3_HUMAN	V	179;263;208;208;208	ENSP00000358663:G179V;ENSP00000377211:G263V;ENSP00000263512:G208V;ENSP00000377212:G208V	ENSP00000263512:G208V	G	-	2	0	SLC10A3	153369851	1.000000	0.71417	0.981000	0.43875	0.971000	0.66376	6.880000	0.75578	2.229000	0.72834	0.600000	0.82982	GGG		0.587	SLC10A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037235.3	NM_019848		24	156	1	0	1.9806e-07	0.014323	2.63391e-07	24	156				
WASH6P	653440	broad.mit.edu	37	X	155254735	155254735	+	RNA	SNP	C	C	G			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:155254735C>G	ENST00000461007.1	+	0	3651				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.L425V(1)									GATGTCGGATCTCTTCAACAA	0.587																																							uc004fnx.3		NA																	1	Substitution - Missense(1)		kidney(1)		NA						c.(631-633)CTC>GTC		WAS protein family homolog 1																																						0							g.chrX:155254735C>G	AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155254735C>G							p.L211V	NM_182905	NP_878908					8	1085	+								A6NGF1|Q8N305	Missense_Mutation	SNP	ENST00000461007.1	37	c.631C>G		.	.	.	.	.	.	.	.	.	.	c	15.33	2.802731	0.50315	.	.	ENSG00000182484	ENST00000359512;ENST00000285718	.	.	.	0.379	0.379	0.16213	.	0.186044	0.48286	D	0.000191	T	0.39200	0.1069	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.29822	-0.9999	6	0.72032	D	0.01	-24.1796	6.473	0.22020	0.0:0.9998:0.0:2.0E-4	.	.	.	.	V	425;394	.	ENSP00000285718:L394V	L	+	1	0	WASH6P	154907929	1.000000	0.71417	0.841000	0.33234	0.284000	0.27059	4.956000	0.63645	0.418000	0.25898	0.171000	0.16805	CTC		0.587	WASH6P-016	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000058840.1	NG_008380		3	8	0	0	0	0.004672	0	3	8				
GJA8	2703	broad.mit.edu	37	1	147380436	147380436	+	Frame_Shift_Del	DEL	G	G	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr1:147380436delG	ENST00000369235.1	+	1	354	c.354delG	c.(352-354)gcgfs	p.A118fs	GJA8_ENST00000240986.4_Frame_Shift_Del_p.A118fs			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	118					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					GCCAGCAGGCGGGGACTAACG	0.662																																					Melanoma(76;1255 1795 8195 52096)	Melanoma(76;1255 1795 8195 52096)	uc001epu.1		NA																	0				ovary(2)|large_intestine(2)|breast(1)|skin(1)	6						c.(352-354)GCGfs		connexin 50							46.0	52.0	50.0					1																	147380436		2203	4300	6503	SO:0001589	frameshift_variant	2703				cell communication|visual perception	connexon complex|integral to plasma membrane	channel activity	g.chr1:147380436delG	U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.354delG	1.37:g.147380436delG	ENSP00000358238:p.Ala118fs						p.A118fs	NM_005267	NP_005258	P48165	CXA8_HUMAN			2	417	+	all_hematologic(923;0.0276)		118			Cytoplasmic (Potential).		A7L5M5|Q5VVN9|Q9NP25	Frame_Shift_Del	DEL	ENST00000369235.1	37	c.354delG	CCDS30834.1																																																																																				0.662	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060647.1	NM_005267		42	96	NA	NA	NA	NA	NA	42	96	---	---	---	---
OR52N4	390072	broad.mit.edu	37	11	5776795	5776795	+	Frame_Shift_Del	DEL	C	C	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:5776795delC	ENST00000317254.3	+	1	873	c.825delC	c.(823-825)tgcfs	p.C275fs	TRIM5_ENST00000380027.1_Intron	NM_001005175.2	NP_001005175.3	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N, member 4 (gene/pseudogene)	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		CCCCTTCTTGCCACATCATTG	0.458																																							uc001mbu.2		NA																	0				ovary(1)|skin(1)	2						c.(823-825)TGCfs		olfactory receptor, family 52, subfamily N,							152.0	143.0	146.0					11																	5776795		1926	4157	6083	SO:0001589	frameshift_variant	390072				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:5776795delC	AB065813	CCDS44528.1	11p15.4	2013-10-10	2013-10-10		ENSG00000181074	ENSG00000181074		"""GPCR / Class A : Olfactory receptors"""	15230	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily N, member 4"""				Standard	NM_001005175		Approved		uc001mbu.3	Q8NGI2	OTTHUMG00000066887	ENST00000317254.3:c.825delC	11.37:g.5776795delC	ENSP00000323224:p.Cys275fs					TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	p.C275fs	NM_001005175	NP_001005175	Q8NGI2	O52N4_HUMAN		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)	1	873	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)	275			Extracellular (Potential).		B2RNP8|Q6IF77	Frame_Shift_Del	DEL	ENST00000317254.3	37	c.825delC	CCDS44528.1																																																																																				0.458	OR52N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143350.1	NM_001005175		13	161	NA	NA	NA	NA	NA	13	161	---	---	---	---
KRTAP5-10	387273	broad.mit.edu	37	11	71276873	71276874	+	Frame_Shift_Ins	INS	-	-	A			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:71276873_71276874insA	ENST00000398531.1	+	1	265_266	c.240_241insA	c.(241-243)aaafs	p.K81fs	KRTAP5-10_ENST00000376536.4_Intron	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	81	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						GTGGGGGCTCCAAAGGGGGCTG	0.683																																							uc001oqt.1		NA																	0				skin(1)	1						c.(238-243)TCCAAAfs		keratin associated protein 5-10																																				SO:0001589	frameshift_variant	387273					keratin filament		g.chr11:71276873_71276874insA	AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.243dupA	11.37:g.71276876_71276876dupA	ENSP00000381542:p.Lys81fs						p.S80fs	NM_001012710	NP_001012728	Q6L8G5	KR510_HUMAN			1	265_266	+			80_81			7 X 4 AA repeats of C-C-X-P.		B9EHA4	Frame_Shift_Ins	INS	ENST00000398531.1	37	c.240_241insA	CCDS41684.1																																																																																				0.683	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000127968.2			34	266	NA	NA	NA	NA	NA	34	266	---	---	---	---
SCN2B	6327	broad.mit.edu	37	11	118037787	118037787	+	Frame_Shift_Del	DEL	C	C	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr11:118037787delC	ENST00000278947.5	-	4	704	c.463delG	c.(463-465)gacfs	p.D155fs		NM_004588.4	NP_004579.1	O60939	SCN2B_HUMAN	sodium channel, voltage-gated, type II, beta subunit	155					cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|nervous system development (GO:0007399)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	voltage-gated sodium channel complex (GO:0001518)	sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)	7	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)	Valproic Acid(DB00313)|Zonisamide(DB00909)	ACCGTGGAGTCCCGCTCAGGG	0.617																																							uc001psf.2		NA																	0					0						c.(463-465)GACfs		sodium channel, voltage-gated, type II, beta							64.0	65.0	65.0					11																	118037787		2200	4296	6496	SO:0001589	frameshift_variant	6327				synaptic transmission	voltage-gated sodium channel complex	voltage-gated sodium channel activity	g.chr11:118037787delC	AY358945	CCDS8390.1	11q23.3	2013-09-19	2012-02-28		ENSG00000149575	ENSG00000149575		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10589	protein-coding gene	gene with protein product		601327	"""sodium channel, voltage-gated, type II, beta polypeptide"", ""sodium channel, voltage-gated, type II, beta"""			10198179	Standard	NM_004588		Approved		uc001psf.2	O60939	OTTHUMG00000048248	ENST00000278947.5:c.463delG	11.37:g.118037787delC	ENSP00000278947:p.Asp155fs						p.D155fs	NM_004588	NP_004579	O60939	SCN2B_HUMAN		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)	4	654	-	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)	155			Extracellular (Potential).		O75302|Q9UNN3	Frame_Shift_Del	DEL	ENST00000278947.5	37	c.463delG	CCDS8390.1																																																																																				0.617	SCN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109748.2	NM_004588		10	51	NA	NA	NA	NA	NA	10	51	---	---	---	---
PRB4	5545	broad.mit.edu	37	12	11461410	11461410	+	Frame_Shift_Del	DEL	T	T	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:11461410delT	ENST00000535904.1	-	3	540	c.507delA	c.(505-507)gaafs	p.E169fs	PRB4_ENST00000445719.2_Intron|PRB4_ENST00000279575.1_Frame_Shift_Del_p.E169fs			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	190	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.		Missing (in allele S).	GGN -> QGG (in Ref. 5; AA sequence). {ECO:0000305}.|Missing (in Ref. 7; CAA30542). {ECO:0000305}.		extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						ACTTGTTTCCTTCCTGTGGGG	0.587										HNSCC(22;0.051)																													uc001qzf.1		NA																	0				ovary(1)	1						c.(505-507)GAAfs		proline-rich protein BstNI subfamily 4							188.0	206.0	200.0					12																	11461410		2203	4300	6503	SO:0001589	frameshift_variant	5545					extracellular region		g.chr12:11461410delT		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.507delA	12.37:g.11461410delT	ENSP00000442834:p.Glu169fs	HNSCC(22;0.051)				PRB4_uc001qzt.2_Frame_Shift_Del_p.E169fs	p.E169fs	NM_002723	NP_002714	P10163	PRB4_HUMAN			3	541	-			232			9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.|10; truncated.		A1L439|O00600|P02813|P10161|P10162|P81489	Frame_Shift_Del	DEL	ENST00000535904.1	37	c.507delA	CCDS8641.1																																																																																				0.587	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723		74	405	NA	NA	NA	NA	NA	74	405	---	---	---	---
ZCRB1	85437	broad.mit.edu	37	12	42717844	42717844	+	Frame_Shift_Del	DEL	G	G	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:42717844delG	ENST00000266529.3	-	2	244	c.61delC	c.(61-63)ctgfs	p.L21fs	PPHLN1_ENST00000449194.2_5'Flank|PPHLN1_ENST00000337898.6_5'Flank|PPHLN1_ENST00000432191.2_5'Flank|PPHLN1_ENST00000395568.2_5'Flank|ZCRB1_ENST00000551102.1_5'Flank|PPHLN1_ENST00000552761.1_5'Flank|PPHLN1_ENST00000549190.1_Intron|PPHLN1_ENST00000395580.3_5'Flank|ZCRB1_ENST00000552673.1_Intron|PPHLN1_ENST00000317560.9_5'Flank|PPHLN1_ENST00000256678.8_5'Flank|PPHLN1_ENST00000358314.7_5'Flank	NM_033114.3	NP_149105.3	Q8TBF4	ZCRB1_HUMAN	zinc finger CCHC-type and RNA binding motif 1	21	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|skin(2)	8	all_cancers(12;0.000348)|Breast(8;0.221)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0689)		TTGTTTGTCAGGGAAAAAGGC	0.378																																							uc001rmz.2		NA																	0				skin(1)	1						c.(61-63)CTGfs		zinc finger CCHC-type and RNA binding motif 1							135.0	130.0	132.0					12																	42717844		2203	4300	6503	SO:0001589	frameshift_variant	85437				mRNA processing	nucleoplasm|U12-type spliceosomal complex	nucleotide binding|RNA binding|zinc ion binding	g.chr12:42717844delG	BC022543	CCDS8740.1	12q12	2013-02-12				ENSG00000139168		"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	29620	protein-coding gene	gene with protein product	"""U11/U12 snRNP 31K"""	610750				15146077, 16959469	Standard	NM_033114		Approved	MADP-1, MADP1, RBM36, ZCCHC19, SNRNP31	uc001rmz.3	Q8TBF4	OTTHUMG00000169382	ENST00000266529.3:c.61delC	12.37:g.42717844delG	ENSP00000266529:p.Leu21fs					PPHLN1_uc001rmy.2_Intron|PPHLN1_uc001rna.2_5'Flank|PPHLN1_uc001rne.2_5'Flank|PPHLN1_uc001rnb.2_5'Flank|PPHLN1_uc001rnd.2_5'Flank|PPHLN1_uc001rnc.2_5'Flank|PPHLN1_uc001rnf.2_5'Flank|PPHLN1_uc010skq.1_5'Flank|PPHLN1_uc010skr.1_5'Flank|PPHLN1_uc001rng.1_5'Flank|PPHLN1_uc010sks.1_5'Flank|PPHLN1_uc010skt.1_5'Flank|PPHLN1_uc001rni.1_5'Flank|PPHLN1_uc001rnh.1_5'Flank|PPHLN1_uc010sku.1_5'Flank	p.L21fs	NM_033114	NP_149105	Q8TBF4	ZCRB1_HUMAN		GBM - Glioblastoma multiforme(48;0.0689)	2	270	-	all_cancers(12;0.000348)|Breast(8;0.221)	Lung NSC(34;0.123)	21			RRM.		Q6PJX0|Q96TA6	Frame_Shift_Del	DEL	ENST00000266529.3	37	c.61delC	CCDS8740.1																																																																																				0.378	ZCRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403813.1	NM_033114		21	71	NA	NA	NA	NA	NA	21	71	---	---	---	---
TMEM132B	114795	broad.mit.edu	37	12	126138827	126138827	+	Frame_Shift_Del	DEL	G	G	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr12:126138827delG	ENST00000299308.3	+	9	2816	c.2808delG	c.(2806-2808)cagfs	p.Q936fs	TMEM132B_ENST00000535886.1_Frame_Shift_Del_p.Q448fs	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	936						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		TGAGTGAGCAGGGCAACATCC	0.512																																							uc001uhe.1		NA																	0				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19						c.(2806-2808)CAGfs		transmembrane protein 132B							103.0	103.0	103.0					12																	126138827		2028	4192	6220	SO:0001589	frameshift_variant	114795					integral to membrane		g.chr12:126138827delG	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.2808delG	12.37:g.126138827delG	ENSP00000299308:p.Gln936fs					TMEM132B_uc001uhf.1_Frame_Shift_Del_p.Q448fs	p.Q936fs	NM_052907	NP_443139	Q14DG7	T132B_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)	9	2816	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		936			Cytoplasmic (Potential).		A2RRG8|Q8NA73|Q96JN9|Q96PY1	Frame_Shift_Del	DEL	ENST00000299308.3	37	c.2808delG	CCDS41859.1																																																																																				0.512	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907		9	95	NA	NA	NA	NA	NA	9	95	---	---	---	---
SMOC1	64093	broad.mit.edu	37	14	70477560	70477561	+	Frame_Shift_Ins	INS	-	-	C			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr14:70477560_70477561insC	ENST00000381280.4	+	8	1007_1008	c.754_755insC	c.(754-756)gccfs	p.A252fs	SMOC1_ENST00000361956.3_Frame_Shift_Ins_p.A252fs	NM_001034852.2|NM_022137.5	NP_001030024.1|NP_071420.1	Q9H4F8	SMOC1_HUMAN	SPARC related modular calcium binding 1	252	Thyroglobulin type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|eye development (GO:0001654)|limb development (GO:0060173)|positive regulation of cell-substrate adhesion (GO:0010811)|regulation of osteoblast differentiation (GO:0045667)|signal transduction (GO:0007165)	basement membrane (GO:0005604)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	21				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		CCCTGAATGTGCCCCTGGGGGA	0.589																																							uc001xls.1		NA																	0				upper_aerodigestive_tract(1)|pancreas(1)	2						c.(754-756)GCCfs		secreted modular calcium-binding protein 1																																				SO:0001589	frameshift_variant	64093				cell differentiation|eye development|limb development|regulation of osteoblast differentiation|signal transduction	basement membrane	calcium ion binding	g.chr14:70477560_70477561insC	AJ249900	CCDS9798.1, CCDS32110.1	14q24.1	2010-08-05			ENSG00000198732	ENSG00000198732			20318	protein-coding gene	gene with protein product		608488				12130637	Standard	NM_001034852		Approved		uc001xlt.2	Q9H4F8		ENST00000381280.4:c.758dupC	14.37:g.70477564_70477564dupC	ENSP00000370680:p.Ala252fs					SMOC1_uc001xlt.1_Frame_Shift_Ins_p.A252fs	p.A252fs	NM_022137	NP_071420	Q9H4F8	SMOC1_HUMAN		all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)	8	1007_1008	+			252			Thyroglobulin type-1 2.		A8K1S3|B2R7P5|Q96F78	Frame_Shift_Ins	INS	ENST00000381280.4	37	c.754_755insC	CCDS9798.1																																																																																				0.589	SMOC1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000412467.1			34	119	NA	NA	NA	NA	NA	34	119	---	---	---	---
KIFC3	3801	broad.mit.edu	37	16	57803530	57803530	+	Frame_Shift_Del	DEL	C	C	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr16:57803530delC	ENST00000379655.4	-	9	1452	c.1195delG	c.(1195-1197)gccfs	p.A399fs	KIFC3_ENST00000541240.1_Frame_Shift_Del_p.A421fs|KIFC3_ENST00000566975.1_5'Flank|KIFC3_ENST00000539578.1_Frame_Shift_Del_p.A341fs|KIFC3_ENST00000445690.2_Frame_Shift_Del_p.A399fs|KIFC3_ENST00000421376.2_Frame_Shift_Del_p.A260fs|KIFC3_ENST00000540079.2_Frame_Shift_Del_p.A297fs|KIFC3_ENST00000562903.1_Frame_Shift_Del_p.A260fs|KIFC3_ENST00000543930.1_Frame_Shift_Del_p.A260fs|KIFC3_ENST00000465878.2_Frame_Shift_Del_p.A260fs	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3	399					ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				CTCCTGAGGGCCTCCTGCAGC	0.657																																							uc002emp.2		NA																	0				central_nervous_system(2)|ovary(1)	3						c.(1195-1197)GCCfs		kinesin family member C3 isoform 1							36.0	38.0	37.0					16																	57803530		2198	4300	6498	SO:0001589	frameshift_variant	3801				epithelial cell-cell adhesion|microtubule-based movement|visual perception|zonula adherens maintenance	centrosome|cytoplasmic vesicle membrane|kinesin complex|microtubule|zonula adherens	ATP binding|microtubule motor activity	g.chr16:57803530delC	BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455	ENST00000379655.4:c.1195delG	16.37:g.57803530delC	ENSP00000368976:p.Ala399fs					KIFC3_uc010vhw.1_Frame_Shift_Del_p.A297fs|KIFC3_uc002emn.2_RNA|KIFC3_uc002emm.2_Frame_Shift_Del_p.A260fs|KIFC3_uc010vhx.1_Frame_Shift_Del_p.A260fs|KIFC3_uc010cdf.2_Frame_Shift_Del_p.A260fs|KIFC3_uc002emo.3_Frame_Shift_Del_p.A260fs|KIFC3_uc010vhy.1_Frame_Shift_Del_p.A341fs|KIFC3_uc002emq.2_Frame_Shift_Del_p.A399fs|KIFC3_uc010vhz.1_Frame_Shift_Del_p.A421fs|KIFC3_uc002emr.1_Frame_Shift_Del_p.A176fs	p.A399fs	NM_005550	NP_005541	Q9BVG8	KIFC3_HUMAN			9	1392	-		all_neural(199;0.224)	399			Potential.		A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Frame_Shift_Del	DEL	ENST00000379655.4	37	c.1195delG	CCDS10789.2																																																																																				0.657	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257329.2	NM_005550		27	72	NA	NA	NA	NA	NA	27	72	---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11554601	11554601	+	Frame_Shift_Del	DEL	C	C	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr17:11554601delC	ENST00000262442.4	+	13	2381	c.2313delC	c.(2311-2313)cgcfs	p.R771fs	DNAH9_ENST00000454412.2_Frame_Shift_Del_p.R771fs	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	771	Stem. {ECO:0000250}.		R -> L (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TTGATCTCCGCCTCAGAGCAG	0.418																																							uc002gne.2		NA																	0		p.R771L(1)		skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20						c.(2311-2313)CGCfs		dynein, axonemal, heavy chain 9 isoform 2							59.0	64.0	62.0					17																	11554601		2203	4300	6503	SO:0001589	frameshift_variant	1770				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr17:11554601delC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.2313delC	17.37:g.11554601delC	ENSP00000262442:p.Arg771fs					DNAH9_uc010coo.2_Frame_Shift_Del_p.R65fs	p.R771fs	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)	13	2381	+		Breast(5;0.0122)|all_epithelial(5;0.131)	771		R -> L (in a breast cancer sample; somatic mutation).	Stem (By similarity).|Potential.		A2VCQ8|O15064|O95494|Q9NQ28	Frame_Shift_Del	DEL	ENST00000262442.4	37	c.2313delC	CCDS11160.1																																																																																				0.418	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372		21	59	NA	NA	NA	NA	NA	21	59	---	---	---	---
CTAGE1	64693	broad.mit.edu	37	18	19995559	19995559	+	5'Flank	DEL	A	A	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:19995559delA	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Frame_Shift_Del_p.F739fs			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					GGCTGGGGGGAAAAATGCAGG	0.502																																							uc002ktv.1		NA																	0				ovary(1)	1						c.(2215-2217)TTCfs		cutaneous T-cell lymphoma-associated antigen 1							25.0	28.0	27.0					18																	19995559		2093	4247	6340	SO:0001631	upstream_gene_variant	64693					integral to membrane		g.chr18:19995559delA	AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19995559delA	Exception_encountered						p.F739fs	NM_172241	NP_758441	Q96RT6	CTGE2_HUMAN			1	2320	-	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)		739			Pro-rich.		B0YIZ3	Frame_Shift_Del	DEL	ENST00000525417.1	37	c.2216delT																																																																																					0.502	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000386767.1	NM_022663, NM_172241		18	48	NA	NA	NA	NA	NA	18	48	---	---	---	---
ADNP2	22850	broad.mit.edu	37	18	77895005	77895006	+	Frame_Shift_Ins	INS	-	-	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr18:77895005_77895006insT	ENST00000262198.4	+	4	2164_2165	c.1709_1710insT	c.(1708-1713)actgtgfs	p.V571fs		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	571					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		CTCAACCAGACTGTGGGCACCA	0.55																																							uc002lnw.2		NA																	0				ovary(4)|breast(3)|central_nervous_system(1)	8						c.(1708-1710)ACTfs		ADNP homeobox 2																																				SO:0001589	frameshift_variant	22850				cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:77895005_77895006insT	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.1710dupT	18.37:g.77895006_77895006dupT	ENSP00000262198:p.Val571fs						p.T570fs	NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)	4	2164_2165	+		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)	570					A8K951|O94943|Q9H9P3	Frame_Shift_Ins	INS	ENST00000262198.4	37	c.1709_1710insT	CCDS32853.1																																																																																				0.550	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913		22	88	NA	NA	NA	NA	NA	22	88	---	---	---	---
NUMBL	9253	broad.mit.edu	37	19	41173866	41173868	+	In_Frame_Del	DEL	TGC	TGC	-	rs201081747	byFrequency	TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	TGC	TGC	-	-	TGC	TGC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr19:41173866_41173868delTGC	ENST00000252891.4	-	10	1502_1504	c.1335_1337delGCA	c.(1333-1338)cagcaa>caa	p.445_446QQ>Q	NUMBL_ENST00000598779.1_In_Frame_Del_p.404_405QQ>Q|NUMBL_ENST00000540131.1_In_Frame_Del_p.404_405QQ>Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	445	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			TGAGgctgcttgctgctgttgct	0.67														104	0.0207668	0.0144	0.0331	5008	,	,		15968	0.0		0.0507	False		,,,				2504	0.0112						uc002oon.2		NA																	0				lung(3)|ovary(1)|breast(1)	5						c.(1333-1338)CAGCAA>CAA		numb homolog (Drosophila)-like				86,4074		5,76,1999						-4.0	0.1			9	263,7789		20,223,3783	no	coding	NUMBL	NM_004756.3		25,299,5782	A1A1,A1R,RR		3.2663,2.0673,2.8578				349,11863				SO:0001651	inframe_deletion	9253				cytokine-mediated signaling pathway|lateral ventricle development|neuroblast division in subventricular zone|protein metabolic process	cytoplasm	protein binding	g.chr19:41173866_41173868delTGC	AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1335_1337delGCA	19.37:g.41173869_41173871delTGC	ENSP00000252891:p.Gln446del					NUMBL_uc010xvq.1_In_Frame_Del_p.404_405QQ>Q|NUMBL_uc002ooo.2_In_Frame_Del_p.444_445QQ>Q|NUMBL_uc010xvr.1_In_Frame_Del_p.404_405QQ>Q	p.445_446QQ>Q	NM_004756	NP_004747	Q9Y6R0	NUMBL_HUMAN	Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)		10	1503_1505	-			445_446			Poly-Gln.		Q7Z4J9	In_Frame_Del	DEL	ENST00000252891.4	37	c.1335_1337delGCA	CCDS12561.1																																																																																				0.670	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462749.2	NM_004756		3	5	NA	NA	NA	NA	NA	3	5	---	---	---	---
CCDC142	84865	broad.mit.edu	37	2	74709220	74709220	+	Frame_Shift_Del	DEL	T	T	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr2:74709220delT	ENST00000393965.3	-	1	1141	c.745delA	c.(745-747)agtfs	p.S249fs	TTC31_ENST00000233623.5_5'Flank|TTC31_ENST00000442235.2_5'Flank|TTC31_ENST00000410003.1_5'Flank|CCDC142_ENST00000290418.4_Frame_Shift_Del_p.S249fs|CCDC142_ENST00000471713.1_5'UTR	NM_032779.3	NP_116168.3	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	249										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	16						TCCAGCCGACTTGCCACCTGG	0.677																																							uc002slr.2		NA																	0				central_nervous_system(1)	1						c.(745-747)AGTfs		coiled-coil domain containing 142							21.0	26.0	24.0					2																	74709220		2202	4297	6499	SO:0001589	frameshift_variant	84865							g.chr2:74709220delT	AK075543	CCDS1945.1	2p13.1	2008-02-05			ENSG00000135637	ENSG00000135637			25889	protein-coding gene	gene with protein product							Standard	NM_032779		Approved	FLJ14397	uc002slq.3	Q17RM4	OTTHUMG00000129962	ENST00000393965.3:c.745delA	2.37:g.74709220delT	ENSP00000377537:p.Ser249fs					TTC31_uc002sls.2_5'Flank|TTC31_uc010yrv.1_5'Flank|TTC31_uc002slt.2_5'Flank|TTC31_uc002slu.2_5'Flank|CCDC142_uc002slo.2_RNA|CCDC142_uc002slq.2_Frame_Shift_Del_p.S249fs|CCDC142_uc002slp.2_Frame_Shift_Del_p.S249fs	p.S249fs	NM_032779	NP_116168	Q17RM4	CC142_HUMAN			1	1138	-			249					B7ZKV5|Q8NBJ3|Q8NBV2|Q96KA7	Frame_Shift_Del	DEL	ENST00000393965.3	37	c.745delA																																																																																					0.677	CCDC142-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000328391.1	NM_032779		18	52	NA	NA	NA	NA	NA	18	52	---	---	---	---
ADAMTS1	9510	broad.mit.edu	37	21	28212020	28212020	+	Frame_Shift_Del	DEL	C	C	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr21:28212020delC	ENST00000284984.3	-	7	2368	c.1914delG	c.(1912-1914)gggfs	p.G638fs		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	638	Cys-rich.				heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		CAGGCCCACTCCCAAAGGAAG	0.458																																							uc002ymf.2		NA																	0				lung(3)|large_intestine(2)|central_nervous_system(1)	6						c.(1912-1914)GGGfs		ADAM metallopeptidase with thrombospondin type 1							94.0	96.0	96.0					21																	28212020		2203	4300	6503	SO:0001589	frameshift_variant	9510				integrin-mediated signaling pathway|negative regulation of cell proliferation|proteolysis		heparin binding|zinc ion binding	g.chr21:28212020delC	AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.1914delG	21.37:g.28212020delC	ENSP00000284984:p.Gly638fs						p.G638fs	NM_006988	NP_008919	Q9UHI8	ATS1_HUMAN		Lung(58;0.215)	7	2369	-		Breast(209;0.000962)	638			Cys-rich.		D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Frame_Shift_Del	DEL	ENST00000284984.3	37	c.1914delG	CCDS33524.1																																																																																				0.458	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2			25	99	NA	NA	NA	NA	NA	25	99	---	---	---	---
PFKL	5211	broad.mit.edu	37	21	45730904	45730904	+	Frame_Shift_Del	DEL	G	G	-	rs150271960		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr21:45730904delG	ENST00000349048.4	+	3	230	c.175delG	c.(175-177)gtgfs	p.V59fs	PFKL_ENST00000496824.1_3'UTR|PFKL_ENST00000403390.1_Frame_Shift_Del_p.V106fs	NM_002626.4	NP_002617.3	P17858	PFKAL_HUMAN	phosphofructokinase, liver	59	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of insulin secretion (GO:0046676)|protein homotetramerization (GO:0051289)|protein oligomerization (GO:0051259)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|fructose-6-phosphate binding (GO:0070095)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	23				Colorectal(79;0.0811)		TGAGGGCCTCGTGGAGGGAGG	0.597																																							uc002zel.2		NA																	0					0						c.(175-177)GTGfs		liver phosphofructokinase							132.0	101.0	112.0					21																	45730904		2203	4299	6502	SO:0001589	frameshift_variant	5211				fructose 6-phosphate metabolic process|glycolysis|protein oligomerization	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|fructose-6-phosphate binding|identical protein binding|kinase binding|metal ion binding	g.chr21:45730904delG		CCDS33582.1	21q22.3	1992-12-17			ENSG00000141959	ENSG00000141959	2.7.1.11		8876	protein-coding gene	gene with protein product		171860					Standard	NR_024108		Approved		uc002zel.3	P17858	OTTHUMG00000086910	ENST00000349048.4:c.175delG	21.37:g.45730904delG	ENSP00000269848:p.Val59fs					PFKL_uc002zek.2_Frame_Shift_Del_p.V106fs|PFKL_uc011afd.1_Frame_Shift_Del_p.V106fs	p.V59fs	NM_002626	NP_002617	P17858	K6PL_HUMAN		Colorectal(79;0.0811)	3	234	+			59					Q96A64|Q96IH4|Q9BR91	Frame_Shift_Del	DEL	ENST00000349048.4	37	c.175delG	CCDS33582.1																																																																																				0.597	PFKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195805.1			12	35	NA	NA	NA	NA	NA	12	35	---	---	---	---
TRH	7200	broad.mit.edu	37	3	129695643	129695643	+	Frame_Shift_Del	DEL	G	G	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:129695643delG	ENST00000302649.3	+	3	840	c.313delG	c.(313-315)gggfs	p.G106fs	TRH_ENST00000507066.1_Frame_Shift_Del_p.G102fs	NM_007117.3	NP_009048.1	P20396	TRH_HUMAN	thyrotropin-releasing hormone	106					adult walking behavior (GO:0007628)|cell-cell signaling (GO:0007267)|eating behavior (GO:0042755)|histamine metabolic process (GO:0001692)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of feeding behavior (GO:2000252)|negative regulation of glutamate secretion (GO:0014050)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of insulin secretion (GO:0032024)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	thyrotropin-releasing hormone activity (GO:0008437)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	14						agaggaagaagggggggCTGT	0.567																																					Esophageal Squamous(60;321 1330 17401 41911)	Esophageal Squamous(60;321 1330 17401 41911)	uc003enc.2		NA																	0				ovary(1)	1						c.(313-315)GGGfs		thyrotropin-releasing hormone							52.0	49.0	50.0					3																	129695643		2203	4300	6503	SO:0001589	frameshift_variant	7200				cell-cell signaling|hormone-mediated signaling pathway	extracellular region|soluble fraction	neuropeptide hormone activity|thyrotropin-releasing hormone activity	g.chr3:129695643delG		CCDS3066.1	3q13.3-q21	2013-02-28				ENSG00000170893		"""Endogenous ligands"""	12298	protein-coding gene	gene with protein product	"""prothyroliberin"""	613879				2126343, 1900134	Standard	NM_007117		Approved		uc003enc.4	P20396		ENST00000302649.3:c.313delG	3.37:g.129695643delG	ENSP00000303452:p.Gly106fs						p.G105fs	NM_007117	NP_009048	P20396	TRH_HUMAN			3	874	+			105					B2R8R1|Q2TB83	Frame_Shift_Del	DEL	ENST00000302649.3	37	c.313delG	CCDS3066.1																																																																																				0.567	TRH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356592.1	NM_007117		7	63	NA	NA	NA	NA	NA	7	63	---	---	---	---
SAMD7	344658	broad.mit.edu	37	3	169644460	169644467	+	Frame_Shift_Del	DEL	CTGCCTAC	CTGCCTAC	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	CTGCCTAC	CTGCCTAC	-	-	CTGCCTAC	CTGCCTAC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr3:169644460_169644467delCTGCCTAC	ENST00000428432.2	+	6	799_806	c.410_417delCTGCCTAC	c.(409-417)gctgcctacfs	p.AAY137fs	SAMD7_ENST00000335556.3_Frame_Shift_Del_p.AAY137fs	NM_182610.2	NP_872416.1	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	137										NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			GCTGCCCCCGCTGCCTACCATGGCAGGA	0.548																																							uc003fgd.2		NA																	0				skin(1)	1						c.(409-417)GCTGCCTACfs		sterile alpha motif domain containing 7																																				SO:0001589	frameshift_variant	344658							g.chr3:169644460_169644467delCTGCCTAC	BX537903	CCDS3209.1	3q26.31	2013-01-10			ENSG00000187033	ENSG00000187033		"""Sterile alpha motif (SAM) domain containing"""	25394	protein-coding gene	gene with protein product							Standard	NM_182610		Approved	DKFZp686E1583	uc003fgd.3	Q7Z3H4	OTTHUMG00000158730	ENST00000428432.2:c.410_417delCTGCCTAC	3.37:g.169644460_169644467delCTGCCTAC	ENSP00000391299:p.Ala137fs					SAMD7_uc003fge.2_Frame_Shift_Del_p.A137fs|SAMD7_uc011bpo.1_Frame_Shift_Del_p.A38fs	p.A137fs	NM_182610	NP_872416	Q7Z3H4	SAMD7_HUMAN	Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)		6	677_684	+	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		137_139						Frame_Shift_Del	DEL	ENST00000428432.2	37	c.410_417delCTGCCTAC	CCDS3209.1																																																																																				0.548	SAMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351959.1	NM_182610		8	76	NA	NA	NA	NA	NA	8	76	---	---	---	---
UNC5C	8633	broad.mit.edu	37	4	96171725	96171725	+	Frame_Shift_Del	DEL	G	G	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:96171725delG	ENST00000453304.1	-	5	1036	c.688delC	c.(688-690)cgafs	p.R230fs	UNC5C_ENST00000504962.1_Frame_Shift_Del_p.R230fs|UNC5C_ENST00000506749.1_Frame_Shift_Del_p.R230fs	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	230	Ig-like C2-type.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		TCAGAGAGTCGGGCCTGCTTT	0.398																																							uc003htp.1		NA																	0				ovary(3)|pancreas(1)	4						c.(688-690)CGAfs		unc5C precursor							188.0	184.0	185.0					4																	96171725		2203	4300	6503	SO:0001589	frameshift_variant	8633				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity	g.chr4:96171725delG	AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.688delC	4.37:g.96171725delG	ENSP00000406022:p.Arg230fs					UNC5C_uc010ilc.1_Frame_Shift_Del_p.R230fs|UNC5C_uc003htq.2_Frame_Shift_Del_p.R230fs	p.R230fs	NM_003728	NP_003719	O95185	UNC5C_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)	5	842	-		Hepatocellular(203;0.114)	230			Extracellular (Potential).|Ig-like C2-type.		Q8IUT0	Frame_Shift_Del	DEL	ENST00000453304.1	37	c.688delC	CCDS3643.1																																																																																				0.398	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728		34	157	NA	NA	NA	NA	NA	34	157	---	---	---	---
PCDH10	57575	broad.mit.edu	37	4	134073021	134073039	+	Frame_Shift_Del	DEL	GCGCCTCTACCAGGGCGCA	GCGCCTCTACCAGGGCGCA	-	rs376228322		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	GCGCCTCTACCAGGGCGCA	GCGCCTCTACCAGGGCGCA	-	-	GCGCCTCTACCAGGGCGCA	GCGCCTCTACCAGGGCGCA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:134073021_134073039delGCGCCTCTACCAGGGCGCA	ENST00000264360.5	+	1	2552_2570	c.1726_1744delGCGCCTCTACCAGGGCGCA	c.(1726-1746)gcgcctctaccagggcgcaacfs	p.APLPGRN576fs	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	576					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TGCCATCGTGGCGCCTCTACCAGGGCGCAACGGGACTCC	0.694																																							uc003iha.2		NA																	0				ovary(2)	2						c.(1726-1746)GCGCCTCTACCAGGGCGCAACfs		protocadherin 10 isoform 1 precursor																																				SO:0001589	frameshift_variant	57575				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr4:134073021_134073039delGCGCCTCTACCAGGGCGCA	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1726_1744delGCGCCTCTACCAGGGCGCA	4.37:g.134073021_134073039delGCGCCTCTACCAGGGCGCA	ENSP00000264360:p.Ala576fs					uc003igy.2_5'Flank|PCDH10_uc003igz.2_Frame_Shift_Del_p.A576fs	p.A576fs	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN		LUSC - Lung squamous cell carcinoma(193;0.227)	1	2552_2570	+			576_582			Cadherin 6.|Extracellular (Potential).		Q4W5F6|Q96SF0	Frame_Shift_Del	DEL	ENST00000264360.5	37	c.1726_1744delGCGCCTCTACCAGGGCGCA	CCDS34063.1																																																																																				0.694	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961		7	86	NA	NA	NA	NA	NA	7	86	---	---	---	---
TLL1	7092	broad.mit.edu	37	4	166964494	166964494	+	Frame_Shift_Del	DEL	C	C	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr4:166964494delC	ENST00000061240.2	+	12	2094	c.1447delC	c.(1447-1449)cgcfs	p.R483fs	TLL1_ENST00000507499.1_Frame_Shift_Del_p.R483fs	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	483	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TGATGACTATCGCCCGATGAA	0.413																																							uc003irh.1		NA																	0				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7						c.(1447-1449)CGCfs		tolloid-like 1 precursor							183.0	168.0	173.0					4																	166964494		2203	4300	6503	SO:0001589	frameshift_variant	7092				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding	g.chr4:166964494delC	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.1447delC	4.37:g.166964494delC	ENSP00000061240:p.Arg483fs					TLL1_uc011cjn.1_Frame_Shift_Del_p.R483fs|TLL1_uc011cjo.1_Frame_Shift_Del_p.R307fs	p.R483fs	NM_012464	NP_036596	O43897	TLL1_HUMAN		GBM - Glioblastoma multiforme(119;0.103)	12	2094	+	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)	483			CUB 2.		B2RMU2|Q96AN3|Q9NQS4	Frame_Shift_Del	DEL	ENST00000061240.2	37	c.1447delC	CCDS3811.1																																																																																				0.413	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1			17	95	NA	NA	NA	NA	NA	17	95	---	---	---	---
TTK	7272	broad.mit.edu	37	6	80745022	80745023	+	Frame_Shift_Ins	INS	-	-	G	rs55918562	byFrequency	TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:80745022_80745023insG	ENST00000369798.2	+	16	1923_1924	c.1812_1813insG	c.(1813-1815)ggafs	p.G605fs	TTK_ENST00000230510.3_Frame_Shift_Ins_p.G604fs|TTK_ENST00000509894.1_Frame_Shift_Ins_p.G604fs	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	605	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		TAATGGAGTGTGGAAATATTGA	0.327																																							uc003pjc.2		NA																	0				ovary(4)|stomach(2)|lung(2)|large_intestine(2)|pancreas(1)	11						c.(1810-1815)TGTGGAfs		TTK protein kinase																																				SO:0001589	frameshift_variant	7272				mitotic cell cycle spindle assembly checkpoint|mitotic spindle organization|positive regulation of cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation	spindle	ATP binding|identical protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr6:80745022_80745023insG		CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.1814dupG	6.37:g.80745024_80745024dupG	ENSP00000358813:p.Gly605fs					TTK_uc003pjb.3_Frame_Shift_Ins_p.C603fs	p.C604fs	NM_003318	NP_003309	P33981	TTK_HUMAN		BRCA - Breast invasive adenocarcinoma(397;0.0321)	16	1886_1887	+		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)	604_605			Protein kinase.		A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Frame_Shift_Ins	INS	ENST00000369798.2	37	c.1812_1813insG	CCDS4993.1																																																																																				0.327	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041316.2			15	48	NA	NA	NA	NA	NA	15	48	---	---	---	---
TAAR6	319100	broad.mit.edu	37	6	132891761	132891761	+	Frame_Shift_Del	DEL	G	G	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr6:132891761delG	ENST00000275198.1	+	1	301	c.301delG	c.(301-303)gggfs	p.G101fs		NM_175067.1	NP_778237.1	Q96RI8	TAAR6_HUMAN	trace amine associated receptor 6	101					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(19)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.006)|GBM - Glioblastoma multiforme(226;0.00792)		CTGGTATTTTGGGAGGAGTTT	0.493																																							uc011eck.1		NA																	0				ovary(2)|skin(1)	3						c.(301-303)GGGfs		trace amine associated receptor 6							187.0	173.0	177.0					6																	132891761		2203	4300	6503	SO:0001589	frameshift_variant	319100					plasma membrane	G-protein coupled receptor activity	g.chr6:132891761delG	AF380192	CCDS5155.1	6q23.1	2012-08-08	2005-02-23	2005-02-24	ENSG00000146383	ENSG00000146383		"""GPCR / Class A : Trace amine associated receptors"""	20978	protein-coding gene	gene with protein product		608923	"""trace amine receptor 4"""	TRAR4		11459929, 15718104	Standard	NM_175067		Approved	TA4	uc011eck.2	Q96RI8	OTTHUMG00000015579	ENST00000275198.1:c.301delG	6.37:g.132891761delG	ENSP00000275198:p.Gly101fs						p.G101fs	NM_175067	NP_778237	Q96RI8	TAAR6_HUMAN		OV - Ovarian serous cystadenocarcinoma(155;0.006)|GBM - Glioblastoma multiforme(226;0.00792)	1	301	+	Breast(56;0.112)		101			Extracellular (Potential).		Q5VUQ4	Frame_Shift_Del	DEL	ENST00000275198.1	37	c.301delG	CCDS5155.1																																																																																				0.493	TAAR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042255.1	NM_175067		37	119	NA	NA	NA	NA	NA	37	119	---	---	---	---
ELMO1	9844	broad.mit.edu	37	7	37354511	37354512	+	Frame_Shift_Ins	INS	-	-	T			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:37354511_37354512insT	ENST00000310758.4	-	4	781_782	c.134_135insA	c.(133-135)aacfs	p.N45fs	ELMO1_ENST00000448602.1_Frame_Shift_Ins_p.N45fs|ELMO1_ENST00000442504.1_Frame_Shift_Ins_p.N45fs	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	45					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						AATATTCATGGTTGGCAAGAGA	0.332																																							uc003tfk.1		NA																	0				ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						c.(133-135)AACfs		engulfment and cell motility 1 isoform 1																																				SO:0001589	frameshift_variant	9844				actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding	g.chr7:37354511_37354512insT	AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.135dupA	7.37:g.37354513_37354513dupT	ENSP00000312185:p.Asn45fs					ELMO1_uc010kxg.1_Frame_Shift_Ins_p.N45fs	p.N45fs	NM_014800	NP_055615	Q92556	ELMO1_HUMAN			4	441_442	-			45					A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Frame_Shift_Ins	INS	ENST00000310758.4	37	c.134_135insA	CCDS5449.1																																																																																				0.332	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442		8	33	NA	NA	NA	NA	NA	8	33	---	---	---	---
OR2A12	346525	broad.mit.edu	37	7	143792483	143792483	+	Frame_Shift_Del	DEL	C	C	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr7:143792483delC	ENST00000408949.2	+	1	343	c.283delC	c.(283-285)cctfs	p.P95fs		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					CTCCTTTGCTCCTTGCATACT	0.443																																							uc011kty.1		NA																	0				ovary(2)|central_nervous_system(1)	3						c.(283-285)CCTfs		olfactory receptor, family 2, subfamily A,							129.0	117.0	121.0					7																	143792483		2013	4193	6206	SO:0001589	frameshift_variant	346525				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr7:143792483delC		CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.283delC	7.37:g.143792483delC	ENSP00000386174:p.Pro95fs						p.P95fs	NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN			1	283	+	Melanoma(164;0.0783)		95			Extracellular (Potential).		Q6IF43	Frame_Shift_Del	DEL	ENST00000408949.2	37	c.283delC	CCDS43670.1																																																																																				0.443	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349969.1			21	77	NA	NA	NA	NA	NA	21	77	---	---	---	---
C9orf131	138724	broad.mit.edu	37	9	35043876	35043887	+	In_Frame_Del	DEL	GAGAAAACTCAG	GAGAAAACTCAG	-	rs575093956		TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	GAGAAAACTCAG	GAGAAAACTCAG	-	-	GAGAAAACTCAG	GAGAAAACTCAG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr9:35043876_35043887delGAGAAAACTCAG	ENST00000312292.5	+	2	1297_1308	c.1250_1261delGAGAAAACTCAG	c.(1249-1263)agagaaaactcagga>aga	p.ENSG418del	C9orf131_ENST00000354479.5_In_Frame_Del_p.ENSG345del|FLJ00273_ENST00000595331.1_5'Flank|C9orf131_ENST00000421362.2_In_Frame_Del_p.ENSG370del	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	418										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			TGGGAATGCAGAGAAAACTCAGGAAACCTCTG	0.538																																							uc003zvw.2		NA																	0					0						c.(1249-1263)AGAGAAAACTCAGGA>AGA		hypothetical protein LOC138724 isoform A																																				SO:0001651	inframe_deletion	138724							g.chr9:35043876_35043887delGAGAAAACTCAG	BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.1250_1261delGAGAAAACTCAG	9.37:g.35043876_35043887delGAGAAAACTCAG	ENSP00000308279:p.Glu418_Gly421del					C9orf131_uc003zvu.2_In_Frame_Del_p.ENSG370del|C9orf131_uc003zvv.2_In_Frame_Del_p.ENSG345del|C9orf131_uc003zvx.2_In_Frame_Del_p.ENSG383del	p.ENSG418del	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)		2	1279_1290	+	all_epithelial(49;0.22)		418_421					A6NLE6|E9PB26|Q86XC6|Q9UF74	In_Frame_Del	DEL	ENST00000312292.5	37	c.1250_1261delGAGAAAACTCAG	CCDS6572.2																																																																																				0.538	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052283.5	NM_203299		10	101	NA	NA	NA	NA	NA	10	101	---	---	---	---
FUBP3	8939	broad.mit.edu	37	9	133485348	133485348	+	Frame_Shift_Del	DEL	C	C	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chr9:133485348delC	ENST00000319725.9	+	3	273	c.198delC	c.(196-198)aacfs	p.N66fs		NM_003934.1	NP_003925.1	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3	66					positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|urinary_tract(2)	21				OV - Ovarian serous cystadenocarcinoma(145;0.000279)		CAGTAGGTAACCAGTTAGGGG	0.378																																							uc004bzr.1		NA																	0				ovary(1)	1						c.(196-198)AACfs		far upstream element (FUSE) binding protein 3							172.0	167.0	169.0					9																	133485348		1838	4089	5927	SO:0001589	frameshift_variant	8939				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|RNA binding	g.chr9:133485348delC	U69127	CCDS43893.1	9q34.11	2008-02-05			ENSG00000107164	ENSG00000107164			4005	protein-coding gene	gene with protein product		603536		FBP3		8940189	Standard	NM_003934		Approved		uc004bzr.1	Q96I24	OTTHUMG00000020809	ENST00000319725.9:c.198delC	9.37:g.133485348delC	ENSP00000318177:p.Asn66fs					FUBP3_uc010mzd.1_Frame_Shift_Del_p.N6fs|FUBP3_uc004bzs.1_5'UTR	p.N66fs	NM_003934	NP_003925	Q96I24	FUBP3_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;0.000279)	3	306	+			66					A3KFK8|A3KFL0|Q92946|Q9BVB6	Frame_Shift_Del	DEL	ENST00000319725.9	37	c.198delC	CCDS43893.1																																																																																				0.378	FUBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054666.1			25	49	NA	NA	NA	NA	NA	25	49	---	---	---	---
AMER1	139285	broad.mit.edu	37	X	63411772	63411772	+	Frame_Shift_Del	DEL	G	G	-			TCGA-99-7458-01A-11D-2036-08	TCGA-99-7458-10A-01D-2036-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	6135f346-7be7-4beb-bc56-50a94e439776	d8bf0172-63f7-42c6-834d-dd3a53ee3f85	g.chrX:63411772delG	ENST00000330258.3	-	2	1667	c.1395delC	c.(1393-1395)cccfs	p.P465fs	AMER1_ENST00000403336.1_Frame_Shift_Del_p.P465fs|AMER1_ENST00000374869.3_Frame_Shift_Del_p.P465fs	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	465					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									CATCACTATTGGGGGCGGATT	0.547																																							uc004dvo.2		NA																	67	Whole gene deletion(67)	p.0?(40)	kidney(65)|ovary(1)|large_intestine(1)	kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						c.(1393-1395)CCCfs		family with sequence similarity 123B							82.0	63.0	69.0					X																	63411772		2203	4300	6503	SO:0001589	frameshift_variant	139285				Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		g.chrX:63411772delG	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1395delC	X.37:g.63411772delG	ENSP00000329117:p.Pro465fs						p.P465fs	NM_152424	NP_689637	Q5JTC6	F123B_HUMAN			2	1668	-			465					A2IB86|Q8N885	Frame_Shift_Del	DEL	ENST00000330258.3	37	c.1395delC	CCDS14377.2																																																																																				0.547	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424		11	68	NA	NA	NA	NA	NA	11	68	---	---	---	---
