#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_filter	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
NPHP4	261734	broad.mit.edu	37	1	5967195	5967195	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:5967195G>C	ENST00000378156.4	-	13	1856	c.1591C>G	c.(1591-1593)Cag>Gag	p.Q531E	NPHP4_ENST00000478423.2_Intron	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	531					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)	p.Q531E(1)		NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		GGGGAGGCCTGAGAGCCATGG	0.617																																						uc001alq.1																			1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(1591-1593)CAG>GAG		nephroretinin							18.0	24.0	22.0					1																	5967195		2011	4163	6174	SO:0001583	missense	261734				actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity	g.chr1:5967195G>C	AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.1591C>G	1.37:g.5967195G>C	ENSP00000367398:p.Gln531Glu					NPHP4_uc001als.1_RNA|NPHP4_uc009vlt.1_Intron|NPHP4_uc001alt.1_Intron|NPHP4_uc009vlu.1_5'Flank	p.Q531E	NM_015102	NP_055917	O75161	NPHP4_HUMAN		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)	13	1857	-	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)	531					Q8IWC0	Missense_Mutation	SNP	ENST00000378156.4	37	c.1591C>G	CCDS44052.1	.	.	.	.	.	.	.	.	.	.	G	1.476	-0.558397	0.03967	.	.	ENSG00000131697	ENST00000378156	D	0.86627	-2.15	4.92	2.01	0.26516	.	1.148440	0.06535	N	0.742203	T	0.74435	0.3716	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.57277	-0.7839	10	0.02654	T	1	.	7.0463	0.25048	0.0:0.2281:0.4927:0.2792	.	531	O75161	NPHP4_HUMAN	E	531	ENSP00000367398:Q531E	ENSP00000367398:Q531E	Q	-	1	0	NPHP4	5889782	0.001000	0.12720	0.000000	0.03702	0.013000	0.08279	0.991000	0.29654	0.137000	0.18759	0.491000	0.48974	CAG		PASS	0.617	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001715.2			6	7	6	7	---	---	---	---
CASZ1	54897	broad.mit.edu	37	1	10699644	10699644	+	Silent	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:10699644G>A	ENST00000377022.3	-	21	4952	c.4635C>T	c.(4633-4635)gcC>gcT	p.A1545A	RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1545					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A1545A(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		AGAAGCCCGCGGCGCTGATCA	0.662																																						uc001aro.2																			1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(4633-4635)GCC>GCT		castor homolog 1, zinc finger isoform a							32.0	42.0	39.0					1																	10699644		2130	4229	6359	SO:0001819	synonymous_variant	54897				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding	g.chr1:10699644G>A	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.4635C>T	1.37:g.10699644G>A							p.A1545A	NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)	21	4955	-	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	1545					Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Silent	SNP	ENST00000377022.3	37	c.4635C>T	CCDS41246.1																																																																																				PASS	0.662	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766		7	28	7	28	---	---	---	---
PLEKHM2	23207	broad.mit.edu	37	1	16053734	16053734	+	Silent	SNP	C	C	T	rs372659037		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:16053734C>T	ENST00000375799.3	+	9	1394	c.1167C>T	c.(1165-1167)tcC>tcT	p.S389S	RP11-288I21.1_ENST00000453804.1_RNA|PLEKHM2_ENST00000375793.2_Silent_p.S369S	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	389					Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)	p.S492S(1)|p.S389S(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		GCGAGCGCTCCGAGCCGGGCC	0.672																																						uc010obo.1																			2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(1165-1167)TCC>TCT		pleckstrin homology domain containing, family M		C		0,3994		0,0,1997	10.0	13.0	12.0		1167	-10.6	0.0	1		12	1,8293		0,1,4146	no	coding-synonymous	PLEKHM2	NM_015164.2		0,1,6143	TT,TC,CC		0.0121,0.0,0.0081		389/1020	16053734	1,12287	1997	4147	6144	SO:0001819	synonymous_variant	23207				Golgi organization	cytoplasm	kinesin binding	g.chr1:16053734C>T	AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.1167C>T	1.37:g.16053734C>T							p.S389S	NM_015164	NP_055979	Q8IWE5	PKHM2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)	9	1394	+		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)	389					O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Silent	SNP	ENST00000375799.3	37	c.1167C>T	CCDS44063.1																																																																																				PASS	0.672	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008463.1	NM_015164		3	5	3	5	---	---	---	---
PLA2G5	5322	broad.mit.edu	37	1	20412659	20412659	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:20412659G>A	ENST00000375108.3	+	3	392	c.124G>A	c.(124-126)Ggc>Agc	p.G42S	PLA2G5_ENST00000486277.1_3'UTR	NM_000929.2	NP_000920.1	P39877	PA2G5_HUMAN	phospholipase A2, group V	42					arachidonic acid secretion (GO:0050482)|glycerophospholipid biosynthetic process (GO:0046474)|leukotriene biosynthetic process (GO:0019370)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|heparin binding (GO:0008201)	p.G42S(1)		NS(1)|large_intestine(1)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000249)|Lung NSC(340;0.000287)|Breast(348;0.000812)|Ovarian(437;0.00328)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;8.15e-05)|Kidney(64;0.000184)|GBM - Glioblastoma multiforme(114;0.00089)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0652)		GACAAACTACGGCTTCTACGG	0.567																																						uc001bcy.2																			1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(124-126)GGC>AGC		phospholipase A2, group V precursor							105.0	93.0	97.0					1																	20412659		2203	4300	6503	SO:0001583	missense	5322				lipid catabolic process	extracellular region	calcium ion binding|calcium-dependent phospholipase A2 activity	g.chr1:20412659G>A	U03090	CCDS202.1	1p36-p34	2008-09-19			ENSG00000127472	ENSG00000127472	3.1.1.4		9038	protein-coding gene	gene with protein product		601192				8838795, 8300559	Standard	NM_000929		Approved		uc001bcy.3	P39877	OTTHUMG00000002698	ENST00000375108.3:c.124G>A	1.37:g.20412659G>A	ENSP00000364249:p.Gly42Ser					PLA2G5_uc001bcw.2_RNA|PLA2G5_uc001bcx.2_Missense_Mutation_p.G73S	p.G42S	NM_000929	NP_000920	P39877	PA2G5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;8.15e-05)|Kidney(64;0.000184)|GBM - Glioblastoma multiforme(114;0.00089)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0652)	3	392	+		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000249)|Lung NSC(340;0.000287)|Breast(348;0.000812)|Ovarian(437;0.00328)|Myeloproliferative disorder(586;0.0255)	42					Q8N435	Missense_Mutation	SNP	ENST00000375108.3	37	c.124G>A	CCDS202.1	.	.	.	.	.	.	.	.	.	.	G	9.325	1.058943	0.19987	.	.	ENSG00000127472	ENST00000375108	D	0.81996	-1.56	5.26	4.28	0.50868	Phospholipase A2 (3);	0.227203	0.31438	N	0.007651	T	0.78635	0.4314	L	0.29908	0.895	0.31796	N	0.629085	D;P	0.71674	0.998;0.762	P;B	0.58013	0.831;0.112	T	0.72587	-0.4248	10	0.02654	T	1	-30.9696	10.647	0.45626	0.0:0.0:0.8091:0.1909	.	42;15	P39877;B3KUQ4	PA2G5_HUMAN;.	S	42	ENSP00000364249:G42S	ENSP00000364249:G42S	G	+	1	0	PLA2G5	20285246	0.009000	0.17119	0.989000	0.46669	0.607000	0.37147	0.623000	0.24447	2.620000	0.88729	0.655000	0.94253	GGC		PASS	0.567	PLA2G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007668.1	NM_000929		17	72	17	72	---	---	---	---
PITHD1	57095	broad.mit.edu	37	1	24112837	24112837	+	Missense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:24112837C>T	ENST00000246151.4	+	5	569	c.458C>T	c.(457-459)tCa>tTa	p.S153L	PITHD1_ENST00000374524.1_Missense_Mutation_p.S40L	NM_020362.4	NP_065095.2	Q9GZP4	PITH1_HUMAN	PITH (C-terminal proteasome-interacting domain of thioredoxin-like) domain containing 1	153	PITH. {ECO:0000255|PROSITE- ProRule:PRU00864}.					nucleus (GO:0005634)		p.S153L(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)	6						TATCATCTCTCAATTCATATT	0.383																																						uc001bhq.2																			1	Substitution - Missense(1)		lung(1)		0						c.(457-459)TCA>TTA		chromosome 1 open reading frame 128							143.0	130.0	134.0					1																	24112837		2203	4300	6503	SO:0001583	missense	57095							g.chr1:24112837C>T		CCDS240.1	1p36.11	2011-02-21	2011-02-21	2011-02-21	ENSG00000057757	ENSG00000057757			25022	protein-coding gene	gene with protein product	"""TXNL1 C-terminal like"""		"""chromosome 1 open reading frame 128"""	C1orf128		12477932	Standard	NM_020362		Approved	HT014, TXNL1CL	uc001bhq.3	Q9GZP4	OTTHUMG00000002960	ENST00000246151.4:c.458C>T	1.37:g.24112837C>T	ENSP00000246151:p.Ser153Leu					C1orf128_uc010oeb.1_Missense_Mutation_p.S60L	p.S153L	NM_020362	NP_065095	Q9GZP4	PITH1_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;1.97e-24)|Colorectal(126;5.06e-08)|COAD - Colon adenocarcinoma(152;2.92e-06)|GBM - Glioblastoma multiforme(114;4.4e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|KIRC - Kidney renal clear cell carcinoma(1967;0.00322)|STAD - Stomach adenocarcinoma(196;0.0124)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0837)|LUSC - Lung squamous cell carcinoma(448;0.185)	5	588	+		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.0034)|all_lung(284;0.00519)|Breast(348;0.0222)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0561)	153			PITH.		B2R7J4|Q5QPN6|Q5QPN7|Q9NRI8	Missense_Mutation	SNP	ENST00000246151.4	37	c.458C>T	CCDS240.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.022357	0.93462	.	.	ENSG00000057757	ENST00000246151;ENST00000415372;ENST00000374524	.	.	.	6.08	5.17	0.71159	Proteasome-interacting thioredoxin-like domain, C-terminal (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.83700	0.5311	M	0.88842	2.985	0.80722	D	1	D	0.56035	0.974	D	0.67103	0.949	D	0.86994	0.2112	9	0.72032	D	0.01	-22.5113	15.0477	0.71841	0.0:0.9317:0.0:0.0683	.	153	Q9GZP4	PITH1_HUMAN	L	153;60;40	.	ENSP00000246151:S153L	S	+	2	0	PITHD1	23985424	1.000000	0.71417	0.969000	0.41365	0.893000	0.52053	7.646000	0.83445	1.595000	0.50050	-0.136000	0.14681	TCA		PASS	0.383	PITHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008243.1	NM_020362		14	88	14	88	---	---	---	---
CSMD2	114784	broad.mit.edu	37	1	34071503	34071503	+	Intron	SNP	G	G	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:34071503G>T	ENST00000373380.1	-	21	3183				CSMD2_ENST00000373377.1_Intron|CSMD2_ENST00000373388.2_Intron|CSMD2_ENST00000373381.4_Intron			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V2103V(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				AGGAAGCGGCGACGGGAGGAG	0.507																																						uc001bxn.1																			1	Substitution - coding silent(1)		lung(1)	ovary(6)|skin(5)|pancreas(1)	12						c.(6307-6309)GTC>GTA		CUB and Sushi multiple domains 2							65.0	62.0	63.0					1																	34071503		2203	4300	6503	SO:0001627	intron_variant	114784					integral to membrane|plasma membrane	protein binding	g.chr1:34071503G>T	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.2963-433C>A	1.37:g.34071503G>T						CSMD2_uc001bxm.1_Intron|CSMD2_uc001bxo.1_Intron	p.V2103V	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN			42	6338	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	2103			Extracellular (Potential).		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373380.1	37	c.6309C>A																																																																																					PASS	0.507	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896		6	55	6	55	---	---	---	---
DMRTB1	63948	broad.mit.edu	37	1	53925207	53925207	+	Silent	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:53925207G>A	ENST00000371445.3	+	1	136	c.81G>A	c.(79-81)gcG>gcA	p.A27A		NM_033067.1	NP_149056.1	Q96MA1	DMRTB_HUMAN	DMRT-like family B with proline-rich C-terminal, 1	27					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A27A(1)		large_intestine(3)|lung(5)|ovary(1)|skin(1)	10						AGGGACACGCGGGCAAATGCC	0.617																																						uc001cvq.1																			1	Substitution - coding silent(1)		lung(1)	ovary(1)|skin(1)	2						c.(79-81)GCG>GCA		DMRT-like family B with proline-rich C-terminal,							33.0	30.0	31.0					1																	53925207		2203	4300	6503	SO:0001819	synonymous_variant	63948				sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity	g.chr1:53925207G>A	AJ291671	CCDS581.1	1p32	2008-08-29			ENSG00000143006	ENSG00000143006			13913	protein-coding gene	gene with protein product		614805					Standard	NM_033067		Approved		uc001cvq.1	Q96MA1	OTTHUMG00000008080	ENST00000371445.3:c.81G>A	1.37:g.53925207G>A							p.A27A	NM_033067	NP_149056	Q96MA1	DMRTB_HUMAN			1	136	+			27			DM.		Q96SD2	Silent	SNP	ENST00000371445.3	37	c.81G>A	CCDS581.1																																																																																				PASS	0.617	DMRTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022110.1			11	30	11	30	---	---	---	---
GBP2	2634	broad.mit.edu	37	1	89586879	89586879	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:89586879G>A	ENST00000370466.3	-	3	533	c.265C>T	c.(265-267)Cca>Tca	p.P89S	GBP2_ENST00000463660.1_5'Flank	NM_004120.3	NP_004111.2	P32456	GBP2_HUMAN	guanylate binding protein 2, interferon-inducible	89	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.P89S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(1)	20		Lung NSC(277;0.0908)		all cancers(265;0.0151)|Epithelial(280;0.0284)		GTGTGTTCTGGCTTCTTGGGA	0.428																																						uc001dmz.1																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(265-267)CCA>TCA		guanylate binding protein 2,							122.0	121.0	122.0					1																	89586879		2203	4300	6503	SO:0001583	missense	2634				interferon-gamma-mediated signaling pathway|type I interferon-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity	g.chr1:89586879G>A	BC073163	CCDS719.1	1p22.2	2008-02-05			ENSG00000162645	ENSG00000162645			4183	protein-coding gene	gene with protein product		600412				1715024	Standard	NM_004120		Approved		uc001dmz.1	P32456	OTTHUMG00000010662	ENST00000370466.3:c.265C>T	1.37:g.89586879G>A	ENSP00000359497:p.Pro89Ser					GBP2_uc001dmy.1_RNA	p.P89S	NM_004120	NP_004111	P32456	GBP2_HUMAN		all cancers(265;0.0151)|Epithelial(280;0.0284)	3	536	-		Lung NSC(277;0.0908)	89					Q6GPH0|Q6IAU2|Q86TB0	Missense_Mutation	SNP	ENST00000370466.3	37	c.265C>T	CCDS719.1	.	.	.	.	.	.	.	.	.	.	G	10.66	1.411899	0.25465	.	.	ENSG00000162645	ENST00000370466	T	0.61274	0.12	3.26	-1.0	0.10196	Guanylate-binding protein, N-terminal (1);	0.823227	0.10244	U	0.697985	T	0.31451	0.0797	M	0.67625	2.065	0.09310	N	1	B	0.27192	0.171	B	0.29663	0.105	T	0.43097	-0.9412	10	0.62326	D	0.03	2.004	4.6101	0.12399	0.3312:0.1685:0.5003:0.0	.	89	P32456	GBP2_HUMAN	S	89	ENSP00000359497:P89S	ENSP00000359497:P89S	P	-	1	0	GBP2	89359467	0.000000	0.05858	0.001000	0.08648	0.263000	0.26337	0.112000	0.15479	-0.088000	0.12506	-0.251000	0.11542	CCA		PASS	0.428	GBP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029406.2	NM_004120		42	168	42	168	---	---	---	---
GBP2	2634	broad.mit.edu	37	1	89587622	89587622	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:89587622G>A	ENST00000370466.3	-	2	296	c.28C>T	c.(28-30)Cca>Tca	p.P10S	GBP2_ENST00000463660.1_5'Flank	NM_004120.3	NP_004111.2	P32456	GBP2_HUMAN	guanylate binding protein 2, interferon-inducible	10	GTPase domain (Globular). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.P10S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(1)	20		Lung NSC(277;0.0908)		all cancers(265;0.0151)|Epithelial(280;0.0284)		AGGCTCATTGGGCCCGGCAAG	0.488																																						uc001dmz.1																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(28-30)CCA>TCA		guanylate binding protein 2,							117.0	116.0	116.0					1																	89587622		2203	4300	6503	SO:0001583	missense	2634				interferon-gamma-mediated signaling pathway|type I interferon-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity	g.chr1:89587622G>A	BC073163	CCDS719.1	1p22.2	2008-02-05			ENSG00000162645	ENSG00000162645			4183	protein-coding gene	gene with protein product		600412				1715024	Standard	NM_004120		Approved		uc001dmz.1	P32456	OTTHUMG00000010662	ENST00000370466.3:c.28C>T	1.37:g.89587622G>A	ENSP00000359497:p.Pro10Ser					GBP2_uc001dmy.1_RNA	p.P10S	NM_004120	NP_004111	P32456	GBP2_HUMAN		all cancers(265;0.0151)|Epithelial(280;0.0284)	2	299	-		Lung NSC(277;0.0908)	10					Q6GPH0|Q6IAU2|Q86TB0	Missense_Mutation	SNP	ENST00000370466.3	37	c.28C>T	CCDS719.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212789	0.58452	.	.	ENSG00000162645	ENST00000370466	T	0.68025	-0.3	3.43	3.43	0.39272	.	0.000000	0.64402	U	0.000008	D	0.82641	0.5081	H	0.96015	3.755	0.27189	N	0.960471	D	0.89917	1.0	D	0.97110	1.0	T	0.76575	-0.2909	10	0.87932	D	0	-0.8809	12.7238	0.57159	0.0:0.0:1.0:0.0	.	10	P32456	GBP2_HUMAN	S	10	ENSP00000359497:P10S	ENSP00000359497:P10S	P	-	1	0	GBP2	89360210	1.000000	0.71417	0.061000	0.19648	0.009000	0.06853	6.213000	0.72194	1.892000	0.54788	0.491000	0.48974	CCA		PASS	0.488	GBP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029406.2	NM_004120		42	188	42	188	---	---	---	---
DENND2D	79961	broad.mit.edu	37	1	111738540	111738540	+	Missense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:111738540C>T	ENST00000357640.4	-	6	872	c.643G>A	c.(643-645)Gag>Aag	p.E215K	DENND2D_ENST00000369752.5_Missense_Mutation_p.E212K|DENND2D_ENST00000473682.1_5'UTR	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	215	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.E215K(2)		breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		TAACCCACCTCAGTGCCTGAG	0.552																																						uc001eak.1																			2	Substitution - Missense(2)		large_intestine(1)|lung(1)	ovary(1)	1						c.(643-645)GAG>AAG		DENN/MADD domain containing 2D							143.0	140.0	141.0					1																	111738540		2203	4300	6503	SO:0001583	missense	79961							g.chr1:111738540C>T		CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.643G>A	1.37:g.111738540C>T	ENSP00000350266:p.Glu215Lys					DENND2D_uc001eal.1_Missense_Mutation_p.E212K	p.E215K	NM_024901	NP_079177	Q9H6A0	DEN2D_HUMAN		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)	6	843	-		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)	215			DENN.		Q5T5V6|Q9BSU0	Missense_Mutation	SNP	ENST00000357640.4	37	c.643G>A	CCDS831.1	.	.	.	.	.	.	.	.	.	.	C	36	5.686917	0.96784	.	.	ENSG00000162777	ENST00000357640;ENST00000369752	T;T	0.12569	2.67;2.67	5.24	5.24	0.73138	DENN (3);	4.374290	0.01156	N	0.006533	T	0.24967	0.0606	L	0.46670	1.46	0.53688	D	0.999977	D;D	0.76494	0.998;0.999	D;D	0.68353	0.928;0.957	T	0.00817	-1.1554	10	0.36615	T	0.2	-23.2792	16.283	0.82707	0.0:1.0:0.0:0.0	.	212;215	Q9H6A0-2;Q9H6A0	.;DEN2D_HUMAN	K	215;212	ENSP00000350266:E215K;ENSP00000358767:E212K	ENSP00000350266:E215K	E	-	1	0	DENND2D	111540063	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.818000	0.86416	2.440000	0.82611	0.561000	0.74099	GAG		PASS	0.552	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000034456.1	NM_024901		37	197	37	197	---	---	---	---
HIST2H2AB	317772	broad.mit.edu	37	1	149859299	149859299	+	Silent	SNP	G	G	C	rs140091148	byFrequency	TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:149859299G>C	ENST00000331128.3	-	1	167	c.168C>G	c.(166-168)ctC>ctG	p.L56L	BOLA1_ENST00000369153.2_5'Flank|HIST2H2BE_ENST00000369155.2_5'Flank	NM_175065.2	NP_778235.1	Q8IUE6	H2A2B_HUMAN	histone cluster 2, H2ab	56						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.L56L(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			TCAGGTACTCGAGGACCGCCG	0.667																																						uc001ete.2																			1	Substitution - coding silent(1)		lung(1)	ovary(1)|breast(1)	2						c.(166-168)CTC>CTG		histone cluster 2, H2ab							43.0	48.0	47.0					1																	149859299		2203	4300	6503	SO:0001819	synonymous_variant	317772				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr1:149859299G>C	AY131972	CCDS938.1	1q21.2	2011-01-27	2006-10-11		ENSG00000184270	ENSG00000184270		"""Histones / Replication-dependent"""	20508	protein-coding gene	gene with protein product		615014	"""histone 2, H2ab"""			12408966	Standard	NM_175065		Approved		uc001ete.3	Q8IUE6	OTTHUMG00000012085	ENST00000331128.3:c.168C>G	1.37:g.149859299G>C						HIST2H2BE_uc001etc.2_5'Flank	p.L56L	NM_175065	NP_778235	Q8IUE6	H2A2B_HUMAN	STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)		1	168	-	Breast(34;0.0124)|all_hematologic(923;0.127)		56						Silent	SNP	ENST00000331128.3	37	c.168C>G	CCDS938.1																																																																																				PASS	0.667	HIST2H2AB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033440.1	NM_175065		17	97	17	97	---	---	---	---
HIST2H2AB	317772	broad.mit.edu	37	1	149859370	149859370	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:149859370G>C	ENST00000331128.3	-	1	96	c.97C>G	c.(97-99)Cgc>Ggc	p.R33G	BOLA1_ENST00000369153.2_5'Flank|HIST2H2BE_ENST00000369155.2_5'Flank	NM_175065.2	NP_778235.1	Q8IUE6	H2A2B_HUMAN	histone cluster 2, H2ab	33						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R33G(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			CGCAGCAAGCGGTGCACTCGC	0.682																																						uc001ete.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|breast(1)	2						c.(97-99)CGC>GGC		histone cluster 2, H2ab							47.0	54.0	51.0					1																	149859370		2202	4296	6498	SO:0001583	missense	317772				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr1:149859370G>C	AY131972	CCDS938.1	1q21.2	2011-01-27	2006-10-11		ENSG00000184270	ENSG00000184270		"""Histones / Replication-dependent"""	20508	protein-coding gene	gene with protein product		615014	"""histone 2, H2ab"""			12408966	Standard	NM_175065		Approved		uc001ete.3	Q8IUE6	OTTHUMG00000012085	ENST00000331128.3:c.97C>G	1.37:g.149859370G>C	ENSP00000332790:p.Arg33Gly					HIST2H2BE_uc001etc.2_5'Flank	p.R33G	NM_175065	NP_778235	Q8IUE6	H2A2B_HUMAN	STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)		1	97	-	Breast(34;0.0124)|all_hematologic(923;0.127)		33						Missense_Mutation	SNP	ENST00000331128.3	37	c.97C>G	CCDS938.1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.572665	0.28092	.	.	ENSG00000184270	ENST00000331128	T	0.77620	-1.11	5.27	5.27	0.74061	Histone-fold (2);Histone core (1);Histone H2A (2);	0.000000	0.85682	D	0.000000	D	0.85852	0.5793	H	0.97516	4.02	0.46298	D	0.998972	P	0.43431	0.807	P	0.44732	0.459	D	0.90481	0.4460	10	0.87932	D	0	.	16.7454	0.85470	0.0:0.0:1.0:0.0	.	33	Q8IUE6	H2A2B_HUMAN	G	33	ENSP00000332790:R33G	ENSP00000332790:R33G	R	-	1	0	HIST2H2AB	148125994	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.322000	0.52007	2.621000	0.88768	0.655000	0.94253	CGC		PASS	0.682	HIST2H2AB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033440.1	NM_175065		26	150	26	150	---	---	---	---
TARS2	80222	broad.mit.edu	37	1	150469036	150469036	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:150469036G>A	ENST00000369064.3	+	8	887	c.853G>A	c.(853-855)Gaa>Aaa	p.E285K	TARS2_ENST00000438568.2_3'UTR|TARS2_ENST00000463555.1_Intron|TARS2_ENST00000369054.2_Intron|TARS2_ENST00000606933.1_Intron	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	285					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)	p.E285K(1)		cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	CCCCACAACAGAATTGCTGAG	0.547																																						uc001euq.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(853-855)GAA>AAA		threonyl-tRNA synthetase 2, mitochondrial	L-Threonine(DB00156)						123.0	118.0	120.0					1																	150469036		2203	4300	6503	SO:0001583	missense	80222				threonyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|threonine-tRNA ligase activity	g.chr1:150469036G>A	BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.853G>A	1.37:g.150469036G>A	ENSP00000358060:p.Glu285Lys					TARS2_uc010pcd.1_RNA|TARS2_uc001eur.2_Intron|TARS2_uc009wlt.2_Intron|TARS2_uc009wls.2_Intron	p.E285K	NM_025150	NP_079426	Q9BW92	SYTM_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		8	860	+	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		285					Q53GW7|Q96I50|Q9H9V2	Missense_Mutation	SNP	ENST00000369064.3	37	c.853G>A	CCDS952.1	.	.	.	.	.	.	.	.	.	.	G	0.029	-1.344772	0.01277	.	.	ENSG00000143374	ENST00000369064	.	.	.	4.92	4.92	0.64577	Threonyl/alanyl tRNA synthetase, class II-like, putative editing domain (1);	0.272154	0.35378	N	0.003243	T	0.01870	0.0059	N	0.00419	-1.52	0.21386	N	0.999708	B	0.06786	0.001	B	0.06405	0.002	T	0.43310	-0.9399	9	0.02654	T	1	-11.8195	8.3741	0.32432	0.084:0.1579:0.758:0.0	.	285	Q9BW92	SYTM_HUMAN	K	285	.	ENSP00000358060:E285K	E	+	1	0	TARS2	148735660	0.084000	0.21492	0.127000	0.21898	0.119000	0.20118	2.044000	0.41241	2.548000	0.85928	0.655000	0.94253	GAA		PASS	0.547	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035847.1	NM_025150		38	185	38	185	---	---	---	---
THBS3	7059	broad.mit.edu	37	1	155171307	155171307	+	Silent	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:155171307C>T	ENST00000368378.3	-	11	1250	c.1230G>A	c.(1228-1230)caG>caA	p.Q410Q	RP11-263K19.4_ENST00000447623.1_RNA|THBS3_ENST00000541990.1_5'UTR|RP11-263K19.4_ENST00000453136.1_RNA|THBS3_ENST00000541576.1_5'UTR|THBS3_ENST00000457183.2_Silent_p.Q290Q|THBS3_ENST00000486260.1_5'UTR|RP11-263K19.4_ENST00000422665.1_RNA|RP11-263K19.4_ENST00000430312.1_RNA|RP11-263K19.4_ENST00000454348.1_RNA|RP11-263K19.4_ENST00000436772.1_RNA	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	410	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.Q410Q(1)		breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGAGGCAGCCCTGGCTCTGGT	0.627																																						uc001fix.2																			1	Substitution - coding silent(1)		lung(1)	breast(3)|ovary(2)	5						c.(1228-1230)CAG>CAA		thrombospondin 3 precursor							48.0	53.0	51.0					1																	155171307		2203	4300	6503	SO:0001819	synonymous_variant	7059				cell-matrix adhesion	extracellular region|perinuclear region of cytoplasm	calcium ion binding|heparin binding|structural molecule activity	g.chr1:155171307C>T	L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.1230G>A	1.37:g.155171307C>T						RAG1AP1_uc010pey.1_Intron|THBS3_uc009wqi.2_Silent_p.Q401Q|THBS3_uc001fiz.2_Silent_p.Q410Q|THBS3_uc001fiy.2_5'UTR|THBS3_uc010pfu.1_Silent_p.Q290Q|THBS3_uc010pfv.1_RNA|THBS3_uc001fja.2_RNA	p.Q410Q	NM_007112	NP_009043	P49746	TSP3_HUMAN	Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		11	1253	-	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		410			EGF-like 3; calcium-binding (Potential).		B1AVR8|B4DQ20|Q8WV34	Silent	SNP	ENST00000368378.3	37	c.1230G>A	CCDS1099.1																																																																																				PASS	0.627	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086856.1	NM_007112		12	65	12	65	---	---	---	---
C1orf61	10485	broad.mit.edu	37	1	156376974	156376974	+	Silent	SNP	A	A	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:156376974A>G	ENST00000368243.1	-	6	437	c.321T>C	c.(319-321)ctT>ctC	p.L107L	C1orf61_ENST00000488498.2_5'UTR	NM_006365.1	NP_006356.1	Q13536	CROC4_HUMAN	chromosome 1 open reading frame 61	107						nucleus (GO:0005634)		p.L107L(1)		large_intestine(2)|lung(2)|skin(1)	5	Hepatocellular(266;0.158)					aggaataagcaagatcatgga	0.438																																						uc001fou.1																			1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(319-321)CTT>CTC		transcriptional activator of the c-fos promoter							56.0	51.0	53.0					1																	156376974		2203	4300	6503	SO:0001819	synonymous_variant	10485					nucleus		g.chr1:156376974A>G		CCDS1142.1	1q22	2014-03-17			ENSG00000125462	ENSG00000125462			30780	protein-coding gene	gene with protein product	"""contingent replication of cDNA-4"", ""transcriptional activator of the c fos promoter"""					10995546, 23012322	Standard	XM_005244832		Approved	CROC4	uc001fou.1	Q13536	OTTHUMG00000031022	ENST00000368243.1:c.321T>C	1.37:g.156376974A>G						C1orf61_uc001fot.1_3'UTR|C1orf61_uc001fov.1_Intron|C1orf61_uc001fow.1_Intron|C1orf61_uc001fox.1_Intron	p.L107L	NM_006365	NP_006356	Q13536	CROC4_HUMAN			6	438	-	Hepatocellular(266;0.158)		107					B1ALL5|B1ALL8	Silent	SNP	ENST00000368243.1	37	c.321T>C	CCDS1142.1	.	.	.	.	.	.	.	.	.	.	A	11.67	1.708577	0.30322	.	.	ENSG00000125462	ENST00000368242	.	.	.	4.0	4.0	0.46444	.	.	.	.	.	T	0.53400	0.1794	.	.	.	0.35303	D	0.783161	.	.	.	.	.	.	T	0.61481	-0.7054	5	0.72032	D	0.01	-0.0058	9.4767	0.38875	1.0:0.0:0.0:0.0	.	.	.	.	S	139	.	ENSP00000357225:L139S	L	-	2	0	C1orf61	154643598	0.008000	0.16893	0.074000	0.20217	0.918000	0.54935	1.492000	0.35594	1.817000	0.53016	0.533000	0.62120	TTG		PASS	0.438	C1orf61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075988.1	NM_006365		5	25	5	25	---	---	---	---
LRRC71	149499	broad.mit.edu	37	1	156897312	156897312	+	Silent	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:156897312C>T	ENST00000337428.7	+	7	841	c.687C>T	c.(685-687)aaC>aaT	p.N229N	LRRC71_ENST00000490146.1_3'UTR	NM_144702.2	NP_653303.2	Q8N4P6	LRC71_HUMAN	leucine rich repeat containing 71	229								p.N229N(1)		endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|stomach(1)	12						CTCTGCGGAACAATAACATCG	0.627																																						uc001fqm.2																			1	Substitution - coding silent(1)		lung(1)		0						c.(685-687)AAC>AAT		hypothetical protein LOC149499							19.0	21.0	21.0					1																	156897312		2004	4162	6166	SO:0001819	synonymous_variant	149499							g.chr1:156897312C>T	BC033790	CCDS44249.1	1q23.1	2011-02-14	2011-02-14	2011-02-14	ENSG00000160838	ENSG00000160838			26556	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 92"""	C1orf92		14702039	Standard	NM_144702		Approved	FLJ32884	uc001fqm.2	Q8N4P6	OTTHUMG00000041298	ENST00000337428.7:c.687C>T	1.37:g.156897312C>T						C1orf92_uc001fql.2_Silent_p.N14N	p.N229N	NM_144702	NP_653303	Q8N4P6	LRC71_HUMAN			7	859	+	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)		229			LRR 3.		Q96M24	Silent	SNP	ENST00000337428.7	37	c.687C>T	CCDS44249.1																																																																																				PASS	0.627	LRRC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098961.1	NM_144702		9	21	9	21	---	---	---	---
FCRL2	79368	broad.mit.edu	37	1	157737189	157737189	+	Missense_Mutation	SNP	A	A	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:157737189A>G	ENST00000361516.3	-	6	1042	c.994T>C	c.(994-996)Tac>Cac	p.Y332H	FCRL2_ENST00000469986.1_Missense_Mutation_p.Y79H|FCRL2_ENST00000368181.4_Intron|FCRL2_ENST00000392274.3_Missense_Mutation_p.Y332H	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	332	Ig-like C2-type 4.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.Y332H(1)|p.Y79H(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TAAAATTGGTACAAGATTGGG	0.587																																						uc001fre.2																			2	Substitution - Missense(2)		lung(2)	ovary(1)|pancreas(1)	2						c.(994-996)TAC>CAC		Fc receptor-like 2 precursor							63.0	68.0	67.0					1																	157737189		2203	4300	6503	SO:0001583	missense	79368				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity	g.chr1:157737189A>G	AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.994T>C	1.37:g.157737189A>G	ENSP00000355157:p.Tyr332His					FCRL2_uc001frd.2_Missense_Mutation_p.Y79H|FCRL2_uc010phz.1_Missense_Mutation_p.Y332H|FCRL2_uc009wsp.2_Intron	p.Y332H	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.24)		6	1053	-	all_hematologic(112;0.0378)		332			Ig-like C2-type 4.|Extracellular (Potential).		A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	ENST00000361516.3	37	c.994T>C	CCDS1168.1	.	.	.	.	.	.	.	.	.	.	A	11.07	1.529297	0.27387	.	.	ENSG00000132704	ENST00000361516;ENST00000392274;ENST00000469986	T;T;T	0.03524	3.9;3.9;3.9	3.99	3.99	0.46301	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.056480	0.07546	N	0.914706	T	0.21550	0.0519	H	0.98754	4.32	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.29671	-1.0004	10	0.72032	D	0.01	.	9.4616	0.38787	1.0:0.0:0.0:0.0	.	332;332;79	B4DVJ9;Q96LA5;Q96LA5-2	.;FCRL2_HUMAN;.	H	332;332;79	ENSP00000355157:Y332H;ENSP00000376100:Y332H;ENSP00000417393:Y79H	ENSP00000355157:Y332H	Y	-	1	0	FCRL2	156003813	0.828000	0.29307	0.036000	0.18154	0.037000	0.13140	4.048000	0.57390	1.789000	0.52484	0.482000	0.46254	TAC		PASS	0.587	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051408.2	NM_030764		26	132	26	132	---	---	---	---
RGS4	5999	broad.mit.edu	37	1	163044272	163044272	+	Silent	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:163044272G>A	ENST00000367909.6	+	5	880	c.540G>A	c.(538-540)ccG>ccA	p.P180P	RGS4_ENST00000491263.1_3'UTR|RGS4_ENST00000367906.3_Silent_p.P162P|RGS4_ENST00000531057.1_Intron|RGS4_ENST00000367908.4_3'UTR|RGS4_ENST00000421743.2_Silent_p.P277P|RGS4_ENST00000527809.1_Silent_p.P162P	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	180					inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)	p.P180P(1)|p.P277P(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						TGGTCAACCCGTCCAGCTGTG	0.517																																					Ovarian(76;1257 1738 3039 6086)	uc009wuy.2																			2	Substitution - coding silent(2)		lung(2)	ovary(2)|central_nervous_system(1)	3						c.(538-540)CCG>CCA		regulator of G-protein signaling 4 isoform 2							171.0	185.0	180.0					1																	163044272		2203	4300	6503	SO:0001819	synonymous_variant	5999				inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity	g.chr1:163044272G>A	BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.540G>A	1.37:g.163044272G>A						RGS4_uc001gcl.3_Silent_p.P277P|RGS4_uc009wuz.2_3'UTR|RGS4_uc009wva.2_Silent_p.P162P	p.P180P	NM_005613	NP_005604	P49798	RGS4_HUMAN			5	1051	+			180					A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Silent	SNP	ENST00000367909.6	37	c.540G>A	CCDS1243.1																																																																																				PASS	0.517	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083197.2	NM_005613		8	349	8	349	---	---	---	---
ATP1B1	481	broad.mit.edu	37	1	169101419	169101419	+	3'UTR	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:169101419C>G	ENST00000367816.1	+	0	2067				ATP1B1_ENST00000499679.3_3'UTR			P05026	AT1B1_HUMAN	ATPase, Na+/K+ transporting, beta 1 polypeptide						blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of calcium:sodium antiporter activity (GO:1903281)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|protein transport into plasma membrane raft (GO:0044861)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression (GO:0010468)|relaxation of cardiac muscle (GO:0055119)|response to hypoxia (GO:0001666)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|MHC class II protein complex binding (GO:0023026)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	14	all_hematologic(923;0.208)					GGGAACTGCCCTTTAAATTTT	0.413																																						uc001gfs.1																			0				ovary(1)	1								Synthetic construct DNA, clone: pF1KB8186, Homo sapiens ATP1B1 gene for ATPase, Na+/K+ transporting, beta 1 polypeptide, without stop codon, in Flexi system.							46.0	45.0	45.0					1																	169101419		1849	4080	5929	SO:0001624	3_prime_UTR_variant	481				ATP biosynthetic process|blood coagulation|leukocyte migration	sodium:potassium-exchanging ATPase complex	protein binding|sodium:potassium-exchanging ATPase activity	g.chr1:169101419C>G	U16799	CCDS1276.1	1q24.2	2012-10-22			ENSG00000143153	ENSG00000143153		"""ATPases / P-type"""	804	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-1"", ""sodium pump subunit beta-1"", ""sodium-potassium ATPase subunit beta 1 (non-catalytic)"""	182330		ATP1B			Standard	NM_001677		Approved		uc001gfr.1	P05026	OTTHUMG00000034590	ENST00000367816.1:c.*626C>G	1.37:g.169101419C>G										P05026	AT1B1_HUMAN			6		+	all_hematologic(923;0.208)							Q5TGZ3	RNA	SNP	ENST00000367816.1	37	c.1663C>G	CCDS1276.1																																																																																				PASS	0.413	ATP1B1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083696.1			5	17	5	17	---	---	---	---
TEX35	84066	broad.mit.edu	37	1	178485756	178485756	+	Missense_Mutation	SNP	G	G	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:178485756G>T	ENST00000319416.2	+	5	335	c.223G>T	c.(223-225)Gat>Tat	p.D75Y	TEX35_ENST00000367643.3_Missense_Mutation_p.D75Y|TEX35_ENST00000367641.3_Missense_Mutation_p.D75Y|TEX35_ENST00000367642.3_Intron|TEX35_ENST00000367639.1_Missense_Mutation_p.D83Y|TEX35_ENST00000258298.2_5'UTR	NM_032126.4	NP_115502.2			testis expressed 35									p.D75Y(2)									TTAGATAAAGGATCTAATGGA	0.403																																						uc001glt.1																			2	Substitution - Missense(2)		lung(2)		0						c.(223-225)GAT>TAT		hypothetical protein LOC84066							126.0	107.0	113.0					1																	178485756		2203	4300	6503	SO:0001583	missense	84066					microtubule cytoskeleton		g.chr1:178485756G>T	AL136694	CCDS1323.1, CCDS53433.1, CCDS53434.1	1q25.2	2014-01-28	2012-06-29	2012-06-29	ENSG00000240021	ENSG00000240021			25366	protein-coding gene	gene with protein product	"""Testis-Specific Conserved gene 24kDa"""		"""chromosome 1 open reading frame 49"""	C1orf49		11230166, 17077512	Standard	NM_032126		Approved	DKFZP564J047, TSC24	uc001glt.2	Q5T0J7	OTTHUMG00000035023	ENST00000319416.2:c.223G>T	1.37:g.178485756G>T	ENSP00000323795:p.Asp75Tyr					C1orf49_uc001glu.1_Missense_Mutation_p.D75Y|C1orf49_uc001glv.1_RNA|C1orf49_uc001glw.1_Missense_Mutation_p.D83Y	p.D75Y	NM_032126	NP_115502	Q5T0J7	CA049_HUMAN			5	335	+			75			Potential.			Missense_Mutation	SNP	ENST00000319416.2	37	c.223G>T	CCDS1323.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.046929	0.36085	.	.	ENSG00000240021	ENST00000319416;ENST00000367643;ENST00000367641;ENST00000367639	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	5.12	0.724	0.18236	.	1.223500	0.05889	N	0.627832	T	0.30355	0.0762	L	0.46157	1.445	0.09310	N	0.999998	D;D;D	0.58620	0.983;0.983;0.983	P;P;P	0.58873	0.847;0.847;0.847	T	0.15954	-1.0419	10	0.72032	D	0.01	-0.678	2.0057	0.03477	0.1778:0.1556:0.5064:0.1601	.	83;75;75	Q5T0J7-2;Q5T0J7-3;Q5T0J7	.;.;CA049_HUMAN	Y	75;75;75;83	ENSP00000323795:D75Y;ENSP00000356615:D75Y;ENSP00000356613:D75Y;ENSP00000356611:D83Y	ENSP00000323795:D75Y	D	+	1	0	C1orf49	176752379	0.300000	0.24435	0.051000	0.19133	0.070000	0.16714	0.382000	0.20635	0.239000	0.21243	-0.140000	0.14226	GAT		PASS	0.403	TEX35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084917.1	NM_032126		7	58	7	58	---	---	---	---
IRF6	3664	broad.mit.edu	37	1	209964183	209964183	+	Missense_Mutation	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:209964183C>G	ENST00000367021.3	-	7	889	c.717G>C	c.(715-717)caG>caC	p.Q239H	IRF6_ENST00000542854.1_Missense_Mutation_p.Q144H	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	239					cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q239H(1)		cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		CGGTCATGGTCTGCCCGTACT	0.577										HNSCC(57;0.16)																												uc001hhq.1																			1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(715-717)CAG>CAC		interferon regulatory factor 6							94.0	85.0	88.0					1																	209964183		2203	4300	6503	SO:0001583	missense	3664				cell cycle arrest|interferon-gamma-mediated signaling pathway|mammary gland epithelial cell differentiation|negative regulation of cell proliferation|positive regulation of transcription, DNA-dependent|type I interferon-mediated signaling pathway	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr1:209964183C>G	AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.717G>C	1.37:g.209964183C>G	ENSP00000355988:p.Gln239His	HNSCC(57;0.16)				IRF6_uc010psm.1_Missense_Mutation_p.Q144H|IRF6_uc009xct.1_Missense_Mutation_p.Q239H	p.Q239H	NM_006147	NP_006138	O14896	IRF6_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.0351)	7	980	-			239					B4DLE2|D3DT90|F5GWX8|G0ZTL0	Missense_Mutation	SNP	ENST00000367021.3	37	c.717G>C	CCDS1492.1	.	.	.	.	.	.	.	.	.	.	C	15.55	2.867658	0.51588	.	.	ENSG00000117595	ENST00000367021;ENST00000542854;ENST00000456314	D;D;D	0.95377	-3.69;-3.69;-3.69	6.17	4.3	0.51218	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.293735	0.39544	N	0.001321	D	0.93514	0.7930	L	0.36672	1.1	0.43485	D	0.995714	P	0.43938	0.822	P	0.51487	0.671	D	0.90568	0.4520	9	.	.	.	.	7.6081	0.28113	0.0:0.6781:0.1203:0.2016	.	239	O14896	IRF6_HUMAN	H	239;144;239	ENSP00000355988:Q239H;ENSP00000440532:Q144H;ENSP00000403855:Q239H	.	Q	-	3	2	IRF6	208030806	0.970000	0.33590	1.000000	0.80357	0.971000	0.66376	0.096000	0.15147	0.919000	0.36945	0.655000	0.94253	CAG		PASS	0.577	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088827.1	NM_006147		38	165	38	165	---	---	---	---
OBSCN	84033	broad.mit.edu	37	1	228468045	228468045	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:228468045G>A	ENST00000422127.1	+	29	7873	c.7829G>A	c.(7828-7830)cGg>cAg	p.R2610Q	OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.R2610Q|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000570156.2_Missense_Mutation_p.R3039Q|OBSCN_ENST00000359599.6_Missense_Mutation_p.R1457Q	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2610	Ig-like 25.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.R2610Q(1)|p.R2794Q(1)|p.R2664Q(1)|p.R2893Q(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CACAAGGGCCGGCGCCACACG	0.622																																						uc009xez.1																			4	Substitution - Missense(4)		lung(4)	stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28						c.(7828-7830)CGG>CAG		obscurin, cytoskeletal calmodulin and							35.0	42.0	40.0					1																	228468045		2133	4227	6360	SO:0001583	missense	84033				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding	g.chr1:228468045G>A	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.7829G>A	1.37:g.228468045G>A	ENSP00000409493:p.Arg2610Gln					OBSCN_uc001hsn.2_Missense_Mutation_p.R2610Q|OBSCN_uc001hsp.1_Missense_Mutation_p.R309Q|OBSCN_uc001hsq.1_5'Flank	p.R2610Q	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN			29	7873	+		Prostate(94;0.0405)	2610			Ig-like 25.		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	c.7829G>A	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	g	10.11	1.260173	0.23051	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599;ENST00000366706;ENST00000366704	T;T;T	0.66280	-0.2;-0.2;-0.2	5.3	1.36	0.22044	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.790169	0.11535	N	0.554290	T	0.64886	0.2639	M	0.67700	2.07	0.09310	N	0.999998	D;B;D	0.63046	0.992;0.09;0.987	P;B;B	0.53861	0.736;0.006;0.275	T	0.54497	-0.8285	10	0.11182	T	0.66	.	8.5419	0.33397	0.545:0.0:0.455:0.0	.	2610;2610;2610	Q5VST9;Q5VST9-2;Q5VST9-3	OBSCN_HUMAN;.;.	Q	2610;2610;1457;309;16	ENSP00000284548:R2610Q;ENSP00000409493:R2610Q;ENSP00000352613:R1457Q	ENSP00000284548:R2610Q	R	+	2	0	OBSCN	226534668	0.000000	0.05858	0.006000	0.13384	0.037000	0.13140	-0.093000	0.11111	0.006000	0.14734	-0.273000	0.10243	CGG		PASS	0.622	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843		6	10	6	10	---	---	---	---
LYST	1130	broad.mit.edu	37	1	235866082	235866082	+	Missense_Mutation	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:235866082C>G	ENST00000389794.3	-	45	10513	c.10339G>C	c.(10339-10341)Gag>Cag	p.E3447Q	LYST_ENST00000389793.2_Missense_Mutation_p.E3447Q|LYST_ENST00000473037.1_5'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3447					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.E3447Q(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TCTCGGGTCTCCCTGAAAGCA	0.498																																						uc001hxj.2																			1	Substitution - Missense(1)		lung(1)	ovary(6)|breast(4)|central_nervous_system(2)	12						c.(10339-10341)GAG>CAG		lysosomal trafficking regulator							138.0	140.0	139.0					1																	235866082		2203	4300	6503	SO:0001583	missense	1130	Chediak-Higashi_syndrome			defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding	g.chr1:235866082C>G	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.10339G>C	1.37:g.235866082C>G	ENSP00000374444:p.Glu3447Gln					LYST_uc001hxi.2_Missense_Mutation_p.E671Q	p.E3447Q	NM_000081	NP_000072	Q99698	LYST_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.000674)		45	10514	-	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	3447					O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	c.10339G>C	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	C	19.90	3.912599	0.72983	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.62639	0.01;0.01	5.37	5.37	0.77165	.	0.094886	0.64402	D	0.000001	T	0.61739	0.2371	L	0.57536	1.79	0.80722	D	1	B	0.31318	0.319	B	0.29785	0.107	T	0.62282	-0.6887	10	0.48119	T	0.1	.	19.1032	0.93282	0.0:1.0:0.0:0.0	.	3447	Q99698	LYST_HUMAN	Q	3447	ENSP00000374444:E3447Q;ENSP00000374443:E3447Q	ENSP00000374443:E3447Q	E	-	1	0	LYST	233932705	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.487000	0.81328	2.531000	0.85337	0.491000	0.48974	GAG		PASS	0.498	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5			4	243	4	243	---	---	---	---
VN1R5	317705	broad.mit.edu	37	1	247419665	247419665	+	IGR	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr1:247419665C>G								RP11-488L18.8 (14540 upstream) : Y_RNA (38471 downstream)																							GCTCTTCACCCAGGCAATATT	0.413																																						uc010pyu.1																			0					0						c.(292-294)CAG>GAG		vomeronasal 1 receptor 5							127.0	120.0	122.0					1																	247419665		1997	4179	6176	SO:0001628	intergenic_variant	317705				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity	g.chr1:247419665C>G																													1.37:g.247419665C>G							p.Q98E	NM_173858	NP_776257	Q7Z5H4	VN1R5_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00854)		2	292	+	all_cancers(71;5.7e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)	all_cancers(173;0.0314)	98			Helical; Name=3; (Potential).			Missense_Mutation	SNP		37	c.292C>G																																																																																				0	PASS	0.413									33	170	33	170	---	---	---	---
ITGB1BP1	9270	broad.mit.edu	37	2	9558757	9558757	+	Nonsense_Mutation	SNP	T	T	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr2:9558757T>A	ENST00000360635.3	-	3	966	c.70A>T	c.(70-72)Aag>Tag	p.K24*	ITGB1BP1_ENST00000488451.1_Nonsense_Mutation_p.K24*|ITGB1BP1_ENST00000456913.2_Nonsense_Mutation_p.K24*|ITGB1BP1_ENST00000238091.4_Nonsense_Mutation_p.K24*|ITGB1BP1_ENST00000359712.3_Nonsense_Mutation_p.K24*|ITGB1BP1_ENST00000490426.1_Intron|ITGB1BP1_ENST00000355346.4_Nonsense_Mutation_p.K24*			O14713	ITBP1_HUMAN	integrin beta 1 binding protein 1	24	Ser/Thr-rich.				activation of protein kinase B activity (GO:0032148)|biomineral tissue development (GO:0031214)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|myoblast migration (GO:0051451)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of protein binding (GO:0032091)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|Notch signaling pathway (GO:0007219)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein transport (GO:0015031)|receptor clustering (GO:0043113)|regulation of blood vessel size (GO:0050880)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of integrin-mediated signaling pathway (GO:2001044)|transcription, DNA-templated (GO:0006351)|tube formation (GO:0035148)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	GDP-dissociation inhibitor activity (GO:0005092)|integrin binding (GO:0005178)|protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)	p.K24*(1)		kidney(2)|large_intestine(2)|lung(2)|prostate(2)	8	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.23)		TTCCCTACCTTGCTCTTAGTA	0.428																																						uc002qzj.2																			1	Substitution - Nonsense(1)		lung(1)		0						c.(70-72)AAG>TAG		integrin cytoplasmic domain-associated protein 1							321.0	303.0	309.0					2																	9558757		2203	4300	6503	SO:0001587	stop_gained	9270				cell migration|cell-matrix adhesion|intracellular protein kinase cascade	cytosol|lamellipodium|membrane|ruffle	protein binding|protein binding	g.chr2:9558757T>A	AF012023	CCDS1662.1, CCDS1663.1	2p25.2	2008-02-05			ENSG00000119185	ENSG00000119185			23927	protein-coding gene	gene with protein product	"""integrin cytoplasmic domain-associated protein 1"", ""integrin cytoplasmic domain-associated protein 1-beta"", ""integrin cytoplasmic domain-associated protein 1-alpha"", ""bodenin"""	607153				11854171, 9281591	Standard	NM_004763		Approved	ICAP-1A, ICAP-1B, ICAP1, ICAP1A, ICAP1B, ICAP-1alpha	uc002qzj.3	O14713	OTTHUMG00000090414	ENST00000360635.3:c.70A>T	2.37:g.9558757T>A	ENSP00000353850:p.Lys24*					ITGB1BP1_uc002qzk.2_Nonsense_Mutation_p.K24*|ITGB1BP1_uc002qzl.2_RNA|ITGB1BP1_uc002qzm.2_RNA|ITGB1BP1_uc010yiy.1_Intron|ITGB1BP1_uc002qzn.1_Nonsense_Mutation_p.K24*	p.K24*	NM_004763	NP_004754	O14713	ITBP1_HUMAN		Epithelial(75;0.23)	2	247	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		24			Ser/Thr-rich.		D6W4Y9|O14714|Q53RS0	Nonsense_Mutation	SNP	ENST00000360635.3	37	c.70A>T	CCDS1662.1	.	.	.	.	.	.	.	.	.	.	T	38	6.900286	0.97920	.	.	ENSG00000119185	ENST00000360635;ENST00000238091;ENST00000355346;ENST00000359712;ENST00000488451;ENST00000456913;ENST00000492079;ENST00000494563;ENST00000467606;ENST00000484735;ENST00000460001;ENST00000497105	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.641	14.9189	0.70818	0.0:0.0:0.0:1.0	.	.	.	.	X	24	.	ENSP00000238091:K24X	K	-	1	0	ITGB1BP1	9476208	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.209000	0.77916	2.119000	0.64992	0.533000	0.62120	AAG		PASS	0.428	ITGB1BP1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314623.2	NM_004763, NM_022334		81	388	81	388	---	---	---	---
NCOA1	8648	broad.mit.edu	37	2	24964741	24964741	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr2:24964741G>C	ENST00000406961.1	+	19	4044	c.3392G>C	c.(3391-3393)aGa>aCa	p.R1131T	NCOA1_ENST00000288599.5_Missense_Mutation_p.R1131T|NCOA1_ENST00000348332.3_Missense_Mutation_p.R1131T|NCOA1_ENST00000407230.1_Missense_Mutation_p.R980T|NCOA1_ENST00000405141.1_Missense_Mutation_p.R1131T|NCOA1_ENST00000395856.3_Missense_Mutation_p.R1131T|NCOA1_ENST00000538539.1_Missense_Mutation_p.R1131T			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	1131	Gln-rich.				androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)	p.R1131T(2)	PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGCAGCAAAGAGCCATGCTT	0.537			T	PAX3	alveolar rhadomyosarcoma																																	uc002rfk.2				Dom	yes		2	2p23	8648	T	nuclear receptor coactivator 1			M	PAX3		alveolar rhadomyosarcoma	PAX3/NCOA1(8)	2	Substitution - Missense(2)		lung(2)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11						c.(3391-3393)AGA>ACA		nuclear receptor coactivator 1 isoform 1							111.0	95.0	101.0					2																	24964741		2203	4300	6503	SO:0001583	missense	8648							g.chr2:24964741G>C	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.3392G>C	2.37:g.24964741G>C	ENSP00000385216:p.Arg1131Thr					NCOA1_uc010eye.2_Missense_Mutation_p.R1131T|NCOA1_uc002rfi.2_Missense_Mutation_p.R980T|NCOA1_uc002rfj.2_Missense_Mutation_p.R1131T|NCOA1_uc002rfl.2_Missense_Mutation_p.R1131T|NCOA1_uc010eyf.2_Missense_Mutation_p.R24T	p.R1131T	NM_003743	NP_003734	Q15788	NCOA1_HUMAN			17	3650	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		1131			Gln-rich.		O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	ENST00000406961.1	37	c.3392G>C	CCDS1712.1	.	.	.	.	.	.	.	.	.	.	G	16.97	3.267880	0.59540	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.02709	4.27;4.27;4.19;4.27;4.27;4.27;4.27	5.74	5.74	0.90152	.	0.054143	0.64402	D	0.000001	T	0.13756	0.0333	M	0.62723	1.935	0.48511	D	0.999669	B;D;B;P;D	0.57899	0.421;0.981;0.063;0.557;0.967	B;D;B;B;P	0.66351	0.037;0.943;0.017;0.08;0.879	T	0.00054	-1.2184	10	0.52906	T	0.07	.	19.5268	0.95210	0.0:0.0:1.0:0.0	.	1131;1131;1131;1131;980	A8K1V4;Q15788-3;Q15788;Q15788-2;B5MCN7	.;.;NCOA1_HUMAN;.;.	T	1131;1131;980;1131;1131;1131;1131	ENSP00000385216:R1131T;ENSP00000385097:R1131T;ENSP00000385195:R980T;ENSP00000444039:R1131T;ENSP00000320940:R1131T;ENSP00000288599:R1131T;ENSP00000379197:R1131T	ENSP00000288599:R1131T	R	+	2	0	NCOA1	24818245	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	5.264000	0.65513	2.716000	0.92895	0.591000	0.81541	AGA		PASS	0.537	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223		6	52	6	52	---	---	---	---
CDC42EP3	10602	broad.mit.edu	37	2	37873428	37873428	+	Silent	SNP	C	C	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr2:37873428C>A	ENST00000295324.3	-	2	1303	c.303G>T	c.(301-303)ccG>ccT	p.P101P	AC006369.2_ENST00000419425.1_RNA	NM_001270436.1|NM_001270437.1|NM_001270438.1|NM_006449.4	NP_001257365.1|NP_001257366.1|NP_001257367.1|NP_006440.2	Q9UKI2	BORG2_HUMAN	CDC42 effector protein (Rho GTPase binding) 3	101					regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	cytoskeletal regulatory protein binding (GO:0005519)	p.P101P(1)		endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|prostate(1)	11		all_hematologic(82;0.172)				TTTTGAGCACCGGGGAGGGCG	0.532																																						uc002rqi.1																			1	Substitution - coding silent(1)		lung(1)		0						c.(301-303)CCG>CCT		Cdc42 effector protein 3							91.0	94.0	93.0					2																	37873428		2203	4300	6503	SO:0001819	synonymous_variant	10602				regulation of cell shape|signal transduction	actin cytoskeleton|cytoplasm|endomembrane system|membrane	cytoskeletal regulatory protein binding	g.chr2:37873428C>A	AF094521	CCDS1791.1	2p21	2008-05-21			ENSG00000163171	ENSG00000163171			16943	protein-coding gene	gene with protein product		606133				9535835, 11035016	Standard	NM_001270436		Approved	CEP3, UB1, BORG2	uc031rnz.1	Q9UKI2	OTTHUMG00000100971	ENST00000295324.3:c.303G>T	2.37:g.37873428C>A							p.P101P	NM_006449	NP_006440	Q9UKI2	BORG2_HUMAN			2	1296	-		all_hematologic(82;0.172)	101					B2R8S0|O95353|Q9UQJ0	Silent	SNP	ENST00000295324.3	37	c.303G>T	CCDS1791.1																																																																																				PASS	0.532	CDC42EP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218581.3	NM_006449		4	182	4	182	---	---	---	---
ATP6V1B1	525	broad.mit.edu	37	2	71185479	71185479	+	Nonsense_Mutation	SNP	C	C	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr2:71185479C>A	ENST00000234396.4	+	4	363	c.290C>A	c.(289-291)tCa>tAa	p.S97*	ATP6V1B1_ENST00000412314.1_Nonsense_Mutation_p.S97*|AC007040.11_ENST00000606025.1_Intron	NM_001692.3	NP_001683.2	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1	97					ATP hydrolysis coupled proton transport (GO:0015991)|ATP metabolic process (GO:0046034)|calcium ion homeostasis (GO:0055074)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|pH reduction (GO:0045851)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances (GO:0016820)	p.S97*(1)		endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(1)	19						GAAGGGACATCAGGGATCGAT	0.572																																						uc002shj.2																			1	Substitution - Nonsense(1)		lung(1)	skin(1)	1						c.(289-291)TCA>TAA		ATPase, H+ transporting, lysosomal 56/58kDa, V1							79.0	71.0	74.0					2																	71185479		2203	4300	6503	SO:0001587	stop_gained	525				ATP hydrolysis coupled proton transport|calcium ion homeostasis|cellular iron ion homeostasis|excretion|inner ear morphogenesis|insulin receptor signaling pathway|ossification|pH reduction|sensory perception of sound|transferrin transport	apical plasma membrane|basolateral plasma membrane|cytosol|endomembrane system|lateral plasma membrane|microvillus|proton-transporting V-type ATPase, V1 domain|vacuolar proton-transporting V-type ATPase complex	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism	g.chr2:71185479C>A	AF107466	CCDS1912.1	2p13	2010-04-21	2008-07-31	2002-05-10	ENSG00000116039	ENSG00000116039	3.6.3.14	"""ATPases / V-type"""	853	protein-coding gene	gene with protein product	"""Renal tubular acidosis with deafness"""	192132	"""vacuolar proton pump 3"""	VPP3, ATP6B1		9916796, 2527371	Standard	XM_005264368		Approved	VATB, RTA1B, Vma2	uc002shj.3	P15313	OTTHUMG00000129711	ENST00000234396.4:c.290C>A	2.37:g.71185479C>A	ENSP00000234396:p.Ser97*					ATP6V1B1_uc002shi.1_Nonsense_Mutation_p.S97*|ATP6V1B1_uc010fdv.2_Nonsense_Mutation_p.S97*|ATP6V1B1_uc010fdw.2_RNA|ATP6V1B1_uc010fdx.2_Nonsense_Mutation_p.S55*	p.S97*	NM_001692	NP_001683	P15313	VATB1_HUMAN			4	377	+			97					Q53FY0|Q6P4H6	Nonsense_Mutation	SNP	ENST00000234396.4	37	c.290C>A	CCDS1912.1	.	.	.	.	.	.	.	.	.	.	C	36	5.868715	0.97049	.	.	ENSG00000116039	ENST00000234396;ENST00000483246;ENST00000412314;ENST00000454446	.	.	.	4.58	4.58	0.56647	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.4986	15.2537	0.73568	0.0:1.0:0.0:0.0	.	.	.	.	X	97;72;97;114	.	ENSP00000234396:S97X	S	+	2	0	ATP6V1B1	71038987	1.000000	0.71417	0.981000	0.43875	0.732000	0.41865	7.581000	0.82535	2.539000	0.85634	0.650000	0.86243	TCA		PASS	0.572	ATP6V1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251920.2	NM_001692		23	75	23	75	---	---	---	---
LOXL3	84695	broad.mit.edu	37	2	74761715	74761715	+	Missense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr2:74761715C>T	ENST00000264094.3	-	10	1837	c.1766G>A	c.(1765-1767)cGa>cAa	p.R589Q	LOXL3_ENST00000409986.1_Missense_Mutation_p.R444Q|LOXL3_ENST00000409249.1_Intron|LOXL3_ENST00000393937.2_Missense_Mutation_p.R444Q|LOXL3_ENST00000409549.1_Missense_Mutation_p.R533Q	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	589	Lysyl-oxidase like.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)	p.R589Q(1)		endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						GAAGTCAGCTCGTCCCAGGTT	0.642																																						uc002smp.1																			1	Substitution - Missense(1)		lung(1)		0						c.(1765-1767)CGA>CAA		lysyl oxidase-like 3 precursor							43.0	43.0	43.0					2																	74761715		2203	4300	6503	SO:0001583	missense	84695					extracellular space|membrane	copper ion binding|protein-lysine 6-oxidase activity|scavenger receptor activity	g.chr2:74761715C>T	AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.1766G>A	2.37:g.74761715C>T	ENSP00000264094:p.Arg589Gln					LOXL3_uc002smo.1_Missense_Mutation_p.R228Q|LOXL3_uc010ffm.1_Missense_Mutation_p.R533Q|LOXL3_uc002smq.1_Missense_Mutation_p.R444Q|LOXL3_uc010ffn.1_Missense_Mutation_p.R444Q	p.R589Q	NM_032603	NP_115992	P58215	LOXL3_HUMAN			10	1838	-			589			Lysyl-oxidase like.		D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Missense_Mutation	SNP	ENST00000264094.3	37	c.1766G>A	CCDS1953.1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.137151	0.37728	.	.	ENSG00000115318	ENST00000264094;ENST00000393937;ENST00000409549;ENST00000409986	T;T;T;T	0.32988	1.43;1.43;1.43;1.43	4.98	4.98	0.66077	.	0.068292	0.64402	D	0.000011	T	0.22936	0.0554	N	0.08118	0	0.35592	D	0.807192	D;B;B;B	0.63880	0.993;0.175;0.448;0.293	P;B;B;B	0.56216	0.794;0.032;0.216;0.062	T	0.07947	-1.0746	10	0.11485	T	0.65	.	9.5442	0.39271	0.0:0.9061:0.0:0.0939	.	444;533;444;589	B9A025;E7END4;Q6IPL7;P58215	.;.;.;LOXL3_HUMAN	Q	589;444;533;444	ENSP00000264094:R589Q;ENSP00000377512:R444Q;ENSP00000386696:R533Q;ENSP00000386545:R444Q	ENSP00000264094:R589Q	R	-	2	0	LOXL3	74615223	0.981000	0.34729	0.993000	0.49108	0.998000	0.95712	2.563000	0.45922	2.764000	0.94973	0.558000	0.71614	CGA		PASS	0.642	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252215.1	NM_032603		14	51	14	51	---	---	---	---
PTCD3	55037	broad.mit.edu	37	2	86352933	86352933	+	Missense_Mutation	SNP	T	T	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr2:86352933T>G	ENST00000254630.7	+	12	947	c.881T>G	c.(880-882)tTt>tGt	p.F294C	PTCD3_ENST00000409277.3_3'UTR	NM_017952.5	NP_060422.4	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3	294					mitochondrial translation (GO:0032543)|regulation of translation (GO:0006417)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|rRNA binding (GO:0019843)	p.F294C(1)		NS(1)|breast(2)|endometrium(3)|kidney(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	22						GTATACACATTTAATGCATTG	0.313																																						uc002sqw.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(880-882)TTT>TGT		pentatricopeptide repeat domain 3 precursor							46.0	50.0	49.0					2																	86352933		2203	4300	6503	SO:0001583	missense	55037					mitochondrion	protein binding	g.chr2:86352933T>G		CCDS33235.1	2p11.2	2014-02-12	2012-02-24		ENSG00000132300	ENSG00000132300			24717	protein-coding gene	gene with protein product		614918				8889548	Standard	NM_017952		Approved	FLJ20758, DKFZp666K071	uc002sqw.2	Q96EY7	OTTHUMG00000153168	ENST00000254630.7:c.881T>G	2.37:g.86352933T>G	ENSP00000254630:p.Phe294Cys					PTCD3_uc010ytc.1_RNA|PTCD3_uc002sqx.1_Translation_Start_Site	p.F294C	NM_017952	NP_060422	Q96EY7	PTCD3_HUMAN			12	947	+			294			PPR 4.		A6NHD2|D6W5M1|Q597H0|Q658Y9|Q9BUZ8|Q9NWL0	Missense_Mutation	SNP	ENST00000254630.7	37	c.881T>G	CCDS33235.1	.	.	.	.	.	.	.	.	.	.	T	15.02	2.708205	0.48412	.	.	ENSG00000132300	ENST00000254630	T	0.38240	1.15	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.67785	0.2930	M	0.91196	3.185	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75317	-0.3360	10	0.72032	D	0.01	-20.5685	14.0679	0.64841	0.0:0.0:0.0:1.0	.	294	Q96EY7	PTCD3_HUMAN	C	294	ENSP00000254630:F294C	ENSP00000254630:F294C	F	+	2	0	PTCD3	86206444	1.000000	0.71417	0.999000	0.59377	0.068000	0.16541	5.531000	0.67148	2.311000	0.77944	0.533000	0.62120	TTT		PASS	0.313	PTCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329854.1	NM_017952		9	54	9	54	---	---	---	---
KDM3A	55818	broad.mit.edu	37	2	86693609	86693609	+	Silent	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr2:86693609G>A	ENST00000409556.1	+	11	1487	c.1122G>A	c.(1120-1122)caG>caA	p.Q374Q	KDM3A_ENST00000542128.1_Silent_p.Q322Q|KDM3A_ENST00000312912.5_Silent_p.Q374Q|KDM3A_ENST00000409064.1_Silent_p.Q374Q			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	374					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.Q374Q(2)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						AGTCCTCTCAGATTGGAACTG	0.433																																					NSCLC(96;1150 1523 6936 46253 49736)	uc002sri.3																			2	Substitution - coding silent(2)		lung(2)	breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						c.(1120-1122)CAG>CAA		jumonji domain containing 1A							109.0	117.0	114.0					2																	86693609		2203	4300	6503	SO:0001819	synonymous_variant	55818				androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr2:86693609G>A	AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.1122G>A	2.37:g.86693609G>A						KDM3A_uc010ytj.1_Silent_p.Q374Q|KDM3A_uc010ytk.1_Silent_p.Q322Q	p.Q374Q	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN			10	1449	+			374					D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Silent	SNP	ENST00000409556.1	37	c.1122G>A	CCDS1990.1																																																																																				PASS	0.433	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252522.2	NM_018433		56	274	56	274	---	---	---	---
ZEB2	9839	broad.mit.edu	37	2	145156292	145156292	+	Missense_Mutation	SNP	G	G	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr2:145156292G>T	ENST00000558170.2	-	8	3646	c.2462C>A	c.(2461-2463)cCa>cAa	p.P821Q	ZEB2_ENST00000539609.3_Missense_Mutation_p.P797Q|ZEB2_ENST00000303660.4_Missense_Mutation_p.P821Q|ZEB2_ENST00000409487.3_Missense_Mutation_p.P821Q	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	821					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)	p.P821Q(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CATTTGTTTTGGTAATGACAA	0.388																																					Melanoma(33;1235 1264 5755 16332)	uc002tvu.2																			1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9						c.(2461-2463)CCA>CAA		zinc finger homeobox 1b							138.0	136.0	137.0					2																	145156292		2203	4300	6503	SO:0001583	missense	9839					cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding	g.chr2:145156292G>T	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.2462C>A	2.37:g.145156292G>T	ENSP00000454157:p.Pro821Gln					ZEB2_uc002tvv.2_Missense_Mutation_p.P815Q|ZEB2_uc010zbm.1_Missense_Mutation_p.P792Q|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Missense_Mutation_p.P850Q	p.P821Q	NM_014795	NP_055610	O60315	ZEB2_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.112)	8	2942	-			821					A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	c.2462C>A	CCDS2186.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.242099	0.58995	.	.	ENSG00000169554	ENST00000539609;ENST00000303660;ENST00000409487	T;T;T	0.26373	1.78;1.74;1.74	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.54549	0.1865	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.996;0.996;0.996	T	0.56739	-0.7929	10	0.87932	D	0	-6.0336	19.5998	0.95557	0.0:0.0:1.0:0.0	.	797;686;820;821	F5H814;Q53TD9;A0JP08;O60315	.;.;.;ZEB2_HUMAN	Q	797;821;821	ENSP00000443792:P797Q;ENSP00000302501:P821Q;ENSP00000386854:P821Q	ENSP00000302501:P821Q	P	-	2	0	ZEB2	144872762	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.717000	0.92951	0.655000	0.94253	CCA		PASS	0.388	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795		5	248	5	248	---	---	---	---
NEB	4703	broad.mit.edu	37	2	152410492	152410492	+	Silent	SNP	G	G	A	rs113068669		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr2:152410492G>A	ENST00000172853.10	-	98	14520	c.14373C>T	c.(14371-14373)atC>atT	p.I4791I	NEB_ENST00000603639.1_Silent_p.I6492I|NEB_ENST00000427231.2_Silent_p.I6492I|NEB_ENST00000409198.1_Silent_p.I4791I|NEB_ENST00000397345.3_Silent_p.I6492I|NEB_ENST00000604864.1_Silent_p.I6492I			P20929	NEBU_HUMAN	nebulin	4791					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.I6492I(2)|p.I4791I(2)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGTCGGGCACGATGTGGATTT	0.458																																						uc010fnx.2																			4	Substitution - coding silent(4)		lung(4)	ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20						c.(14371-14373)ATC>ATT		nebulin isoform 3							186.0	177.0	180.0					2																	152410492		1932	4135	6067	SO:0001819	synonymous_variant	4703				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	g.chr2:152410492G>A	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.14373C>T	2.37:g.152410492G>A						NEB_uc002txr.2_Silent_p.I1214I	p.I4791I	NM_004543	NP_004534	P20929	NEBU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.219)	98	14564	-			4791			Nebulin 131.		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37	c.14373C>T																																																																																					PASS	0.458	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543		41	221	41	221	---	---	---	---
KIAA1715	80856	broad.mit.edu	37	2	176860294	176860294	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr2:176860294G>C	ENST00000272748.4	-	2	266	c.19C>G	c.(19-21)Cga>Gga	p.R7G	KIAA1715_ENST00000535310.1_5'UTR|KIAA1715_ENST00000544803.1_Missense_Mutation_p.R7G|KIAA1715_ENST00000466445.1_5'UTR	NM_030650.1	NP_085153.1	Q9C0E8	LNP_HUMAN	KIAA1715	7					blood coagulation (GO:0007596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|limb development (GO:0060173)|regulation of chondrocyte differentiation (GO:0032330)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)	p.R7G(1)		endometrium(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)	20			OV - Ovarian serous cystadenocarcinoma(117;0.0793)			ACCCTCCATCGAGAAAATAAT	0.333																																						uc002ukc.1																			1	Substitution - Missense(1)		lung(1)	ovary(2)|skin(1)	3						c.(19-21)CGA>GGA		Lunapark							92.0	86.0	88.0					2																	176860294		2203	4296	6499	SO:0001583	missense	80856					integral to membrane	protein binding	g.chr2:176860294G>C	AB051502	CCDS33332.1	2q31	2014-06-27			ENSG00000144320	ENSG00000144320			21610	protein-coding gene	gene with protein product	"""lunapark"", ""limb and neural patterns"""	610236				11214970, 22729086	Standard	NM_030650		Approved	ulnaless, Ul, LNP1, LNP	uc002ukc.1	Q9C0E8	OTTHUMG00000154112	ENST00000272748.4:c.19C>G	2.37:g.176860294G>C	ENSP00000272748:p.Arg7Gly					KIAA1715_uc010zer.1_Missense_Mutation_p.R7G|KIAA1715_uc010fqw.1_Missense_Mutation_p.S71W|KIAA1715_uc010zes.1_Missense_Mutation_p.S71W|KIAA1715_uc002ukd.1_5'UTR|KIAA1715_uc010zet.1_RNA	p.R7G	NM_030650	NP_085153	Q9C0E8	LNP_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0793)		2	212	-			7			Cytoplasmic (Potential).		B7ZLA8|Q2M2V8|Q2YD99|Q658W8|Q8N5V9|Q96MS5	Missense_Mutation	SNP	ENST00000272748.4	37	c.19C>G	CCDS33332.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.99|17.99	3.523091|3.523091	0.64747|0.64747	.|.	.|.	ENSG00000144320|ENSG00000144320	ENST00000272748;ENST00000544803;ENST00000445472|ENST00000536291	.|.	.|.	.|.	5.12|5.12	2.04|2.04	0.26737|0.26737	.|.	0.116139|.	0.53938|.	D|.	0.000041|.	T|T	0.47469|0.47469	0.1447|0.1447	M|M	0.66297|0.66297	2.02|2.02	0.80722|0.80722	D|D	1|1	D;D|P;P	0.61080|0.45827	0.989;0.989|0.867;0.791	P;P|B;B	0.60286|0.37780	0.872;0.872|0.258;0.132	T|T	0.52983|0.52983	-0.8502|-0.8502	9|8	0.87932|0.66056	D|D	0|0.02	-7.6989|-7.6989	11.2887|11.2887	0.49237|0.49237	0.0:0.0:0.408:0.592|0.0:0.0:0.408:0.592	.|.	7;7|71;66	B7ZLA8;Q9C0E8|F5H2Y7;B7ZLA9	.;LNP_HUMAN|.;.	G|W	7|71	.|.	ENSP00000272748:R7G|ENSP00000438299:S71W	R|S	-|-	1|2	2|0	KIAA1715|KIAA1715	176568540|176568540	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	0.893000|0.893000	0.28336|0.28336	0.502000|0.502000	0.28037|0.28037	0.491000|0.491000	0.48974|0.48974	CGA|TCG		PASS	0.333	KIAA1715-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333949.3	XM_042834		3	96	3	96	---	---	---	---
TTN	7273	broad.mit.edu	37	2	179476841	179476841	+	Missense_Mutation	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr2:179476841C>G	ENST00000591111.1	-	217	45598	c.45374G>C	c.(45373-45375)cGa>cCa	p.R15125P	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R7826P|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R7893P|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R16766P|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R14198P|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R7701P			Q8WZ42	TITIN_HUMAN	titin	15125	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R14198P(2)|p.R7701P(1)|p.R7893P(1)|p.R7826P(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCAACATGTCGTTTTGTCAC	0.398																																						uc010zfg.1																			5	Substitution - Missense(5)		lung(5)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(42592-42594)CGA>CCA		titin isoform N2-A							107.0	95.0	99.0					2																	179476841		1874	4098	5972	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179476841C>G	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.45374G>C	2.37:g.179476841C>G	ENSP00000465570:p.Arg15125Pro					uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R7893P|TTN_uc010zfi.1_Missense_Mutation_p.R7826P|TTN_uc010zfj.1_Missense_Mutation_p.R7701P	p.R14198P	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		216	42817	-			15125					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.42593G>C		.	.	.	.	.	.	.	.	.	.	C	11.87	1.769145	0.31320	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	6.17	6.17	0.99709	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.72622	0.3483	M	0.81614	2.55	0.44181	D	0.996992	D;D;D;D	0.59357	0.957;0.957;0.957;0.985	P;P;P;P	0.57009	0.811;0.811;0.811;0.737	T	0.74269	-0.3720	9	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	7701;7826;7893;15125	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	P	14198;7701;7893;7826;7701	ENSP00000343764:R14198P;ENSP00000434586:R7701P;ENSP00000340554:R7893P;ENSP00000352154:R7826P	ENSP00000340554:R7893P	R	-	2	0	TTN	179185086	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	4.500000	0.60387	2.941000	0.99782	0.655000	0.94253	CGA		PASS	0.398	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		6	44	6	44	---	---	---	---
TTN	7273	broad.mit.edu	37	2	179593707	179593707	+	Missense_Mutation	SNP	C	C	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr2:179593707C>A	ENST00000591111.1	-	63	18331	c.18107G>T	c.(18106-18108)aGt>aTt	p.S6036I	TTN_ENST00000359218.5_Intron|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.S6353I|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.S5109I|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12827	Ig-like 41.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.S5109I(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTATCCACACTTCTGATTTG	0.393																																						uc010zfg.1																			1	Substitution - Missense(1)		lung(1)	ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(15325-15327)AGT>ATT		titin isoform N2-A							66.0	61.0	62.0					2																	179593707		1895	4125	6020	SO:0001583	missense	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179593707C>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18107G>T	2.37:g.179593707C>A	ENSP00000465570:p.Ser6036Ile					TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.S1770I	p.S5109I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		62	15550	-			6036					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.15326G>T		.	.	.	.	.	.	.	.	.	.	C	1.491	-0.554505	0.03996	.	.	ENSG00000155657	ENST00000342992	T	0.46451	0.87	5.93	2.71	0.32032	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.47911	0.1471	M	0.90705	3.14	0.09310	N	1	B	0.18610	0.029	B	0.21360	0.034	T	0.52953	-0.8506	9	0.87932	D	0	.	4.9422	0.13971	0.1044:0.437:0.3457:0.1129	.	6036	Q8WZ42	TITIN_HUMAN	I	5109	ENSP00000343764:S5109I	ENSP00000343764:S5109I	S	-	2	0	TTN	179301952	0.009000	0.17119	0.973000	0.42090	0.332000	0.28634	0.308000	0.19314	0.857000	0.35407	0.655000	0.94253	AGT		PASS	0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378		10	36	10	36	---	---	---	---
CASP10	843	broad.mit.edu	37	2	202060607	202060607	+	Missense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr2:202060607C>T	ENST00000272879.5	+	5	804	c.620C>T	c.(619-621)tCg>tTg	p.S207L	CASP10_ENST00000492363.1_3'UTR|CASP10_ENST00000360132.3_Missense_Mutation_p.S207L|CASP10_ENST00000346817.5_Missense_Mutation_p.S207L|CASP10_ENST00000286186.6_Missense_Mutation_p.S207L|CASP10_ENST00000374650.3_Missense_Mutation_p.S207L|CASP10_ENST00000448480.1_Missense_Mutation_p.S207L|CASP10_ENST00000313728.7_Missense_Mutation_p.S207L	NM_032974.4	NP_116756.2	Q92851	CASPA_HUMAN	caspase 10, apoptosis-related cysteine peptidase	207					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|innate immune response (GO:0045087)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)	CD95 death-inducing signaling complex (GO:0031265)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|death effector domain binding (GO:0035877)|ubiquitin protein ligase binding (GO:0031625)	p.S207L(2)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27						GAAGCCGAGTCGTATCAAGGA	0.428																																						uc002uxl.1																			2	Substitution - Missense(2)		lung(2)	skin(3)|ovary(1)|pancreas(1)|breast(1)	6						c.(619-621)TCG>TTG		caspase 10 isoform b preproprotein							221.0	207.0	212.0					2																	202060607		2203	4300	6503	SO:0001583	missense	843				apoptosis|induction of apoptosis by extracellular signals|proteolysis	cytosol|plasma membrane	cysteine-type endopeptidase activity|identical protein binding|protein binding	g.chr2:202060607C>T	U60519	CCDS2338.1, CCDS2339.1, CCDS2340.1, CCDS56159.1, CCDS56160.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000003400	ENSG00000003400	3.4.22.63	"""Caspases"""	1500	protein-coding gene	gene with protein product		601762	"""caspase 10, apoptosis-related cysteine protease"""			8755496	Standard	NM_032974		Approved	MCH4	uc002uxj.1	Q92851	OTTHUMG00000132818	ENST00000272879.5:c.620C>T	2.37:g.202060607C>T	ENSP00000272879:p.Ser207Leu					CASP10_uc002uxi.1_Missense_Mutation_p.S207L|CASP10_uc010zhn.1_RNA|CASP10_uc002uxj.1_Missense_Mutation_p.S207L|CASP10_uc002uxk.1_Missense_Mutation_p.S207L|CASP10_uc010fta.1_Missense_Mutation_p.S207L|CASP10_uc002uxm.1_Missense_Mutation_p.S207L|CASP10_uc010ftb.1_RNA	p.S207L	NM_032974	NP_116756	Q92851	CASPA_HUMAN			5	1038	+			207					Q68HC0|Q6KF62|Q6KF63|Q8IUP5|Q8WYQ8|Q99845|Q9Y2U6|Q9Y2U7	Missense_Mutation	SNP	ENST00000272879.5	37	c.620C>T	CCDS2338.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.887318	0.52014	.	.	ENSG00000003400	ENST00000286186;ENST00000360132;ENST00000272879;ENST00000374650;ENST00000346817;ENST00000313728;ENST00000448480	T;T;T;T;T;T;T	0.56611	4.4;0.45;4.31;0.56;4.28;4.07;4.2	3.19	2.3	0.28687	.	3.867830	0.00424	N	0.000070	T	0.29158	0.0725	N	0.08118	0	0.09310	N	1	B;P;P;P;P;P	0.50528	0.025;0.774;0.87;0.89;0.936;0.921	B;B;B;B;B;B	0.35278	0.004;0.164;0.069;0.088;0.191;0.199	T	0.33979	-0.9847	10	0.27082	T	0.32	.	6.2897	0.21053	0.0:0.8631:0.0:0.1369	.	207;207;207;207;207;207	Q92851-6;Q92851-5;Q92851;Q92851-2;Q92851-4;Q68HC0	.;.;CASPA_HUMAN;.;.;.	L	207	ENSP00000286186:S207L;ENSP00000353250:S207L;ENSP00000272879:S207L;ENSP00000363781:S207L;ENSP00000237865:S207L;ENSP00000314599:S207L;ENSP00000396835:S207L	ENSP00000272879:S207L	S	+	2	0	CASP10	201768852	0.000000	0.05858	0.005000	0.12908	0.358000	0.29455	-0.029000	0.12329	0.918000	0.36919	0.655000	0.94253	TCG		PASS	0.428	CASP10-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256273.1	NM_032977		48	270	48	270	---	---	---	---
PAX3	5077	broad.mit.edu	37	2	223163256	223163256	+	Silent	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr2:223163256G>A	ENST00000350526.4	-	1	215	c.79C>T	c.(79-81)Ctg>Ttg	p.L27L	PAX3_ENST00000392070.2_Silent_p.L27L|PAX3_ENST00000409551.3_Silent_p.L27L|PAX3_ENST00000392069.2_Silent_p.L27L|PAX3_ENST00000409828.3_Silent_p.L27L|PAX3_ENST00000336840.6_Silent_p.L27L|PAX3_ENST00000258387.5_Silent_p.L27L|PAX3_ENST00000344493.4_Silent_p.L27L|CCDC140_ENST00000295226.1_Intron	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	27					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L27L(3)	PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTACCTTCCAGCGGGAACCCG	0.716			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																															uc010fwo.2				Dom	yes		2	2q35	5077	T	paired box gene 3	yes	Waardenburg syndrome; craniofacial-deafness-hand syndrome	M	FOXO1A|NCOA1		alveolar rhabdomyosarcoma	PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	3	Substitution - coding silent(3)		lung(3)	soft_tissue(761)|ovary(4)|skin(1)	766						c.(79-81)CTG>TTG		paired box 3 isoform PAX3							7.0	9.0	9.0					2																	223163256		2173	4251	6424	SO:0001819	synonymous_variant	5077				apoptosis|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr2:223163256G>A		CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.79C>T	2.37:g.223163256G>A						PAX3_uc002vmt.1_Silent_p.L27L|PAX3_uc002vmy.1_Silent_p.L27L|PAX3_uc002vmv.1_Silent_p.L27L|PAX3_uc002vmw.1_Silent_p.L27L|PAX3_uc002vmx.1_Silent_p.L27L|PAX3_uc002vmz.1_Silent_p.L27L|PAX3_uc002vna.1_Silent_p.L27L|CCDC140_uc002vnb.1_Intron	p.L27L	NM_181457	NP_852122	P23760	PAX3_HUMAN		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	1	445	-		Renal(207;0.0183)	27					G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Silent	SNP	ENST00000350526.4	37	c.79C>T	CCDS42826.1																																																																																				PASS	0.716	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1			4	16	4	16	---	---	---	---
MYH15	22989	broad.mit.edu	37	3	108159979	108159979	+	Silent	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr3:108159979C>T	ENST00000273353.3	-	24	2900	c.2844G>A	c.(2842-2844)ctG>ctA	p.L948L		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	948						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.L948L(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						CCCTGGCAGTCAGCTCAGAAT	0.483																																						uc003dxa.1																			1	Substitution - coding silent(1)		lung(1)	ovary(5)|central_nervous_system(2)	7						c.(2842-2844)CTG>CTA		myosin, heavy polypeptide 15							145.0	146.0	146.0					3																	108159979		1972	4160	6132	SO:0001819	synonymous_variant	22989					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity	g.chr3:108159979C>T	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.2844G>A	3.37:g.108159979C>T							p.L948L	NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN			24	2901	-			948			Potential.			Silent	SNP	ENST00000273353.3	37	c.2844G>A	CCDS43127.1																																																																																				PASS	0.483	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988		34	194	34	194	---	---	---	---
PHLDB2	90102	broad.mit.edu	37	3	111603564	111603564	+	Nonsense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr3:111603564C>T	ENST00000431670.2	+	2	1051	c.640C>T	c.(640-642)Cag>Tag	p.Q214*	PHLDB2_ENST00000393925.3_Nonsense_Mutation_p.Q214*|PHLDB2_ENST00000478922.1_Nonsense_Mutation_p.Q214*|PHLDB2_ENST00000393923.3_Nonsense_Mutation_p.Q241*|PHLDB2_ENST00000477695.1_Nonsense_Mutation_p.Q214*|PHLDB2_ENST00000481953.1_Nonsense_Mutation_p.Q214*|PHLDB2_ENST00000412622.1_Nonsense_Mutation_p.Q214*	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	214						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)		p.Q214*(2)|p.Q241*(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						AATGAGCATTCAGGACAGCCT	0.517																																						uc010hqa.2																			3	Substitution - Nonsense(3)		lung(3)	ovary(4)|skin(2)	6						c.(640-642)CAG>TAG		pleckstrin homology-like domain, family B,							63.0	63.0	63.0					3																	111603564		2203	4300	6503	SO:0001587	stop_gained	90102					cytoplasm|intermediate filament cytoskeleton|plasma membrane		g.chr3:111603564C>T		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.640C>T	3.37:g.111603564C>T	ENSP00000405405:p.Gln214*					PHLDB2_uc003dyc.2_Nonsense_Mutation_p.Q241*|PHLDB2_uc003dyd.2_Nonsense_Mutation_p.Q214*|PHLDB2_uc003dyg.2_Nonsense_Mutation_p.Q214*|PHLDB2_uc003dyh.2_Nonsense_Mutation_p.Q214*|PHLDB2_uc003dye.3_Nonsense_Mutation_p.Q214*|PHLDB2_uc003dyf.3_Nonsense_Mutation_p.Q214*	p.Q214*	NM_001134438	NP_001127910	Q86SQ0	PHLB2_HUMAN			2	1051	+			214					A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Nonsense_Mutation	SNP	ENST00000431670.2	37	c.640C>T	CCDS46886.1	.	.	.	.	.	.	.	.	.	.	C	36	5.957099	0.97145	.	.	ENSG00000144824	ENST00000359729;ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000478922;ENST00000477695;ENST00000393925;ENST00000481953	.	.	.	5.61	5.61	0.85477	.	0.335993	0.33419	N	0.004940	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	16.9138	0.86146	0.0:1.0:0.0:0.0	.	.	.	.	X	241;241;214;214;214;214;214;214;214	.	ENSP00000352764:Q241X	Q	+	1	0	PHLDB2	113086254	0.998000	0.40836	0.974000	0.42286	0.897000	0.52465	4.157000	0.58144	2.813000	0.96785	0.655000	0.94253	CAG		PASS	0.517	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753		17	101	17	101	---	---	---	---
RNF168	165918	broad.mit.edu	37	3	196198983	196198983	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr3:196198983G>C	ENST00000318037.3	-	6	2017	c.1423C>G	c.(1423-1425)Cac>Gac	p.H475D	CTD-2002J20.1_ENST00000610042.1_RNA	NM_152617.3	NP_689830.2	Q8IYW5	RN168_HUMAN	ring finger protein 168, E3 ubiquitin protein ligase	475					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K13 ubiquitination (GO:0036351)|histone H2A-K15 ubiquitination (GO:0036352)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.H475D(1)		NS(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)	20	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		GCGCGTAAGTGATACTCATCT	0.458																																						uc003fwq.2																			1	Substitution - Missense(1)		lung(1)		0						c.(1423-1425)CAC>GAC		ring finger protein 168							263.0	248.0	253.0					3																	196198983		2203	4300	6503	SO:0001583	missense	165918				double-strand break repair|histone H2A K63-linked ubiquitination|positive regulation of DNA repair|response to ionizing radiation	nucleus|ubiquitin ligase complex	chromatin binding|histone binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding	g.chr3:196198983G>C	AK054732	CCDS3317.1	3q29	2014-09-17	2012-02-23		ENSG00000163961	ENSG00000163961		"""RING-type (C3HC4) zinc fingers"""	26661	protein-coding gene	gene with protein product		612688	"""ring finger protein 168"""			12477932	Standard	NM_152617		Approved	FLJ35794	uc003fwq.3	Q8IYW5	OTTHUMG00000155582	ENST00000318037.3:c.1423C>G	3.37:g.196198983G>C	ENSP00000320898:p.His475Asp					RNF168_uc010iah.2_Missense_Mutation_p.H308D|uc010iag.1_5'Flank	p.H475D	NM_152617	NP_689830	Q8IYW5	RN168_HUMAN	Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)	6	1961	-	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		475					Q8NA67|Q96NS4	Missense_Mutation	SNP	ENST00000318037.3	37	c.1423C>G	CCDS3317.1	.	.	.	.	.	.	.	.	.	.	G	2.274	-0.366299	0.05069	.	.	ENSG00000163961	ENST00000318037	T	0.06449	3.3	6.08	4.27	0.50696	.	0.975048	0.08440	N	0.945641	T	0.04998	0.0134	N	0.08118	0	0.21220	N	0.99976	B	0.06786	0.001	B	0.04013	0.001	T	0.46414	-0.9193	10	0.17832	T	0.49	0.1142	16.693	0.85327	0.0:0.2448:0.7552:0.0	.	475	Q8IYW5	RN168_HUMAN	D	475	ENSP00000320898:H475D	ENSP00000320898:H475D	H	-	1	0	RNF168	197683380	0.984000	0.35163	0.194000	0.23346	0.001000	0.01503	3.791000	0.55469	0.889000	0.36185	-0.189000	0.12847	CAC		PASS	0.458	RNF168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340778.1	NM_152617		77	604	77	604	---	---	---	---
MRPL1	65008	broad.mit.edu	37	4	78870971	78870971	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr4:78870971G>C	ENST00000315567.8	+	8	1127	c.798G>C	c.(796-798)caG>caC	p.Q266H		NM_020236.3	NP_064621.3	Q9BYD6	RM01_HUMAN	mitochondrial ribosomal protein L1	266					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.Q266H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)	17						CAAGTGACCAGATAGCTGCCA	0.358																																						uc003hku.2																			1	Substitution - Missense(1)		lung(1)		0						c.(796-798)CAG>CAC		mitochondrial ribosomal protein L1 precursor							122.0	122.0	122.0					4																	78870971		2203	4300	6503	SO:0001583	missense	65008						RNA binding	g.chr4:78870971G>C	AB049474	CCDS3583.2	4q21.1	2012-09-13			ENSG00000169288	ENSG00000169288		"""Mitochondrial ribosomal proteins / large subunits"""	14275	protein-coding gene	gene with protein product		611821					Standard	NM_020236		Approved	BM022	uc003hku.2	Q9BYD6	OTTHUMG00000130200	ENST00000315567.8:c.798G>C	4.37:g.78870971G>C	ENSP00000315017:p.Gln266His					MRPL1_uc010iji.1_Intron	p.Q266H	NM_020236	NP_064621	Q9BYD6	RM01_HUMAN			8	996	+			266					A6NG03|Q4W5B8|Q6IAG4|Q96BW3|Q9H793|Q9NRL5	Missense_Mutation	SNP	ENST00000315567.8	37	c.798G>C	CCDS3583.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.77|15.77	2.930476|2.930476	0.52866|0.52866	.|.	.|.	ENSG00000169288|ENSG00000169288	ENST00000315567;ENST00000538314|ENST00000504901	T|.	0.46819|.	0.86|.	5.95|5.95	5.11|5.11	0.69529|0.69529	Ribosomal protein L1, 2-layer alpha/beta-sandwich (1);Ribosomal protein L1, superfamily (1);|.	0.242296|.	0.43919|.	D|.	0.000509|.	T|T	0.61223|0.61223	0.2330|0.2330	L|L	0.51853|0.51853	1.615|1.615	0.40001|0.40001	D|D	0.975165|0.975165	B|.	0.22211|.	0.066|.	B|.	0.21151|.	0.033|.	T|T	0.60737|0.60737	-0.7204|-0.7204	10|5	0.25751|.	T|.	0.34|.	-0.4527|-0.4527	12.3502|12.3502	0.55144|0.55144	0.0786:0.0:0.9214:0.0|0.0786:0.0:0.9214:0.0	.|.	266|.	Q9BYD6|.	RM01_HUMAN|.	H|T	266;244|60	ENSP00000315017:Q266H|.	ENSP00000315017:Q266H|.	Q|R	+|+	3|2	2|0	MRPL1|MRPL1	79089995|79089995	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.956000|0.956000	0.61745|0.61745	0.664000|0.664000	0.25068|0.25068	1.534000|1.534000	0.49203|0.49203	0.655000|0.655000	0.94253|0.94253	CAG|AGA		PASS	0.358	MRPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252518.3	NM_020236		3	136	3	136	---	---	---	---
PPP3CA	5530	broad.mit.edu	37	4	102019574	102019574	+	Missense_Mutation	SNP	C	C	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr4:102019574C>A	ENST00000394854.3	-	5	1275	c.592G>T	c.(592-594)Gtg>Ttg	p.V198L	PPP3CA_ENST00000512215.1_Intron|PPP3CA_ENST00000507176.1_Missense_Mutation_p.V100L|PPP3CA_ENST00000323055.6_Missense_Mutation_p.V198L|PPP3CA_ENST00000394853.4_Missense_Mutation_p.V198L|PPP3CA_ENST00000523694.2_Missense_Mutation_p.V131L|PPP3CA_ENST00000510292.1_5'UTR	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	198	Catalytic.				calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)	p.V198L(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		CCACCATGCACACACAGGAAC	0.393																																						uc011cen.1																			1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(592-594)GTG>TTG		protein phosphatase 3, catalytic subunit, alpha							147.0	136.0	139.0					4																	102019574		2203	4300	6503	SO:0001583	missense	5530				protein dephosphorylation	calcineurin complex|cytosol|nucleus	calcium ion binding|calmodulin binding	g.chr4:102019574C>A		CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.592G>T	4.37:g.102019574C>A	ENSP00000378323:p.Val198Leu					PPP3CA_uc003hvu.2_Missense_Mutation_p.V198L|PPP3CA_uc010ilj.2_Missense_Mutation_p.V198L|PPP3CA_uc003hvt.2_Missense_Mutation_p.V185L|PPP3CA_uc003hvs.2_Missense_Mutation_p.V131L|PPP3CA_uc010ilk.2_Intron	p.V198L	NM_000944	NP_000935	Q08209	PP2BA_HUMAN		OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)	5	1267	-			198			Catalytic.		A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Missense_Mutation	SNP	ENST00000394854.3	37	c.592G>T	CCDS34037.1	.	.	.	.	.	.	.	.	.	.	C	33	5.287649	0.95517	.	.	ENSG00000138814	ENST00000394854;ENST00000323055;ENST00000394853;ENST00000507176;ENST00000523694	T;T;T;T;T	0.11385	2.78;2.78;2.78;2.78;2.78	4.51	4.51	0.55191	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.141962	0.45867	D	0.000335	T	0.29158	0.0725	M	0.84433	2.695	0.80722	D	1	P;B;P;D;D	0.53151	0.789;0.277;0.692;0.958;0.958	P;B;B;P;P	0.51516	0.672;0.128;0.235;0.637;0.637	T	0.29579	-1.0007	10	0.66056	D	0.02	-12.4325	17.2151	0.86941	0.0:1.0:0.0:0.0	.	198;198;198;100;131	Q08209;A8W6Z7;Q08209-2;E7ETC2;A1A441	PP2BA_HUMAN;.;.;.;.	L	198;198;198;100;131	ENSP00000378323:V198L;ENSP00000320580:V198L;ENSP00000378322:V198L;ENSP00000422990:V100L;ENSP00000429350:V131L	ENSP00000320580:V198L	V	-	1	0	PPP3CA	102238597	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.496000	0.81526	2.225000	0.72522	0.467000	0.42956	GTG		PASS	0.393	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258379.2	NM_000944		24	92	24	92	---	---	---	---
CCRN4L	25819	broad.mit.edu	37	4	139966110	139966110	+	Silent	SNP	T	T	C	rs140314273		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr4:139966110T>C	ENST00000280614.2	+	3	971	c.778T>C	c.(778-780)Ttg>Ctg	p.L260L	ELF2_ENST00000515489.1_Intron	NM_012118.2	NP_036250.2	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like (S. cerevisiae)	260					circadian regulation of gene expression (GO:0032922)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of gene expression (GO:0010629)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|regulation of circadian rhythm (GO:0042752)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|response to extracellular stimulus (GO:0009991)|response to lipopolysaccharide (GO:0032496)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A)-specific ribonuclease activity (GO:0004535)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L260L(1)		kidney(2)|large_intestine(3)|lung(3)|ovary(1)	9	all_hematologic(180;0.162)					AGCCATGACATTGAAAACCAA	0.478													T|||	1	0.000199681	0.0	0.0	5008	,	,		22543	0.001		0.0	False		,,,				2504	0.0				Ovarian(144;566 1842 19130 21379 22209)	uc003ihl.2																			1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(778-780)TTG>CTG		CCR4 carbon catabolite repression 4-like		T		0,4406		0,0,2203	88.0	84.0	85.0		778	-0.9	0.0	4	dbSNP_134	85	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CCRN4L	NM_012118.2		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		260/432	139966110	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	25819				rhythmic process|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity	g.chr4:139966110T>C	AF183961	CCDS3743.1	4q31.1	2014-06-18	2001-11-28		ENSG00000151014	ENSG00000151014			14254	protein-coding gene	gene with protein product		608468	"""CCR4-like (carbon catabolite repression 4, S.cerevisiae)"""			10521507	Standard	NM_012118		Approved	CCR4L, Ccr4c	uc003ihl.3	Q9UK39	OTTHUMG00000161271	ENST00000280614.2:c.778T>C	4.37:g.139966110T>C							p.L260L	NM_012118	NP_036250	Q9UK39	NOCT_HUMAN			3	971	+	all_hematologic(180;0.162)		260					D3DNY5|Q14D51|Q9HD93|Q9HD94|Q9HD95	Silent	SNP	ENST00000280614.2	37	c.778T>C	CCDS3743.1																																																																																				PASS	0.478	CCRN4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257231.3	NM_012118		18	65	18	65	---	---	---	---
FSTL5	56884	broad.mit.edu	37	4	162307103	162307103	+	Missense_Mutation	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr4:162307103C>G	ENST00000306100.5	-	16	2776	c.2340G>C	c.(2338-2340)aaG>aaC	p.K780N	FSTL5_ENST00000536695.1_Missense_Mutation_p.K779N|FSTL5_ENST00000379164.4_Missense_Mutation_p.K779N|RP11-234O6.2_ENST00000508189.1_RNA|FSTL5_ENST00000427802.2_Missense_Mutation_p.K770N	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	780						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.K780N(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		CCTTGAGACTCTTTATCATCT	0.458																																						uc003iqh.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8						c.(2338-2340)AAG>AAC		follistatin-like 5 isoform a							182.0	166.0	171.0					4																	162307103		2203	4300	6503	SO:0001583	missense	56884					extracellular region	calcium ion binding	g.chr4:162307103C>G	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.2340G>C	4.37:g.162307103C>G	ENSP00000305334:p.Lys780Asn					FSTL5_uc003iqi.2_Missense_Mutation_p.K779N|FSTL5_uc010iqv.2_Missense_Mutation_p.K770N|uc010iqu.1_RNA	p.K780N	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN		COAD - Colon adenocarcinoma(41;0.179)	16	2776	-	all_hematologic(180;0.24)		780					E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	37	c.2340G>C	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.216611	0.58452	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	5.55	1.79	0.24919	.	0.088300	0.85682	D	0.000000	T	0.48519	0.1504	M	0.78049	2.395	0.51482	D	0.999928	D;P;P	0.89917	1.0;0.735;0.616	D;B;B	0.87578	0.998;0.438;0.42	T	0.41538	-0.9503	10	0.72032	D	0.01	.	4.0721	0.09887	0.1552:0.5227:0.0:0.3221	.	770;779;780	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	N	780;779;770;779	ENSP00000305334:K780N;ENSP00000368462:K779N;ENSP00000389270:K770N;ENSP00000440409:K779N	ENSP00000305334:K780N	K	-	3	2	FSTL5	162526553	1.000000	0.71417	0.982000	0.44146	0.994000	0.84299	1.153000	0.31676	0.260000	0.21731	0.655000	0.94253	AAG		PASS	0.458	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116		42	169	42	169	---	---	---	---
SPATA4	132851	broad.mit.edu	37	4	177116539	177116539	+	Missense_Mutation	SNP	G	G	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr4:177116539G>T	ENST00000280191.2	-	1	283	c.175C>A	c.(175-177)Ctt>Att	p.L59I	SPATA4_ENST00000515234.1_5'Flank	NM_144644.2	NP_653245.2	Q8NEY3	SPAT4_HUMAN	spermatogenesis associated 4	59						cytoplasm (GO:0005737)		p.L59I(1)		NS(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)	22		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.9e-20)|Epithelial(43;1.99e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.58e-09)|GBM - Glioblastoma multiforme(59;0.000162)|STAD - Stomach adenocarcinoma(60;0.000543)|LUSC - Lung squamous cell carcinoma(193;0.096)		AGACCCTGAAGCCAACGCAGA	0.622																																						uc003iuo.1																			1	Substitution - Missense(1)		lung(1)		0						c.(175-177)CTT>ATT		spermatogenesis associated 4							110.0	109.0	109.0					4																	177116539		2203	4300	6503	SO:0001583	missense	132851				apoptosis|spermatogenesis			g.chr4:177116539G>T	AY040204	CCDS3826.1	4q34.2	2008-02-05			ENSG00000150628	ENSG00000150628			17333	protein-coding gene	gene with protein product		609879					Standard	NM_144644		Approved	TSARG2, SPEF1B	uc003iuo.1	Q8NEY3	OTTHUMG00000160788	ENST00000280191.2:c.175C>A	4.37:g.177116539G>T	ENSP00000280191:p.Leu59Ile						p.L59I	NM_144644	NP_653245	Q8NEY3	SPAT4_HUMAN		all cancers(43;2.9e-20)|Epithelial(43;1.99e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.58e-09)|GBM - Glioblastoma multiforme(59;0.000162)|STAD - Stomach adenocarcinoma(60;0.000543)|LUSC - Lung squamous cell carcinoma(193;0.096)	1	284	-		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)	59					Q8NCS5|Q8WW15	Missense_Mutation	SNP	ENST00000280191.2	37	c.175C>A	CCDS3826.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.263552	0.80358	.	.	ENSG00000150628	ENST00000280191	T	0.35236	1.32	4.32	4.32	0.51571	.	0.000000	0.64402	D	0.000009	T	0.46444	0.1393	L	0.33753	1.03	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.31110	-0.9955	10	0.39692	T	0.17	-12.3152	12.4713	0.55790	0.0:0.0:1.0:0.0	.	59	Q8NEY3	SPAT4_HUMAN	I	59	ENSP00000280191:L59I	ENSP00000280191:L59I	L	-	1	0	SPATA4	177353533	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	3.500000	0.53318	2.394000	0.81467	0.585000	0.79938	CTT		PASS	0.622	SPATA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362326.1	NM_144644		15	111	15	111	---	---	---	---
ADCY2	108	broad.mit.edu	37	5	7709351	7709351	+	Missense_Mutation	SNP	T	T	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr5:7709351T>C	ENST00000338316.4	+	10	1518	c.1429T>C	c.(1429-1431)Ttc>Ctc	p.F477L	ADCY2_ENST00000537121.1_Missense_Mutation_p.F297L|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	477					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.F477L(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CCAGCATCTCTTCAGACCTCG	0.592																																						uc003jdz.1																			1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(1)|skin(1)	7						c.(1429-1431)TTC>CTC		adenylate cyclase 2							70.0	65.0	67.0					5																	7709351		2203	4300	6503	SO:0001583	missense	108				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding	g.chr5:7709351T>C	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1429T>C	5.37:g.7709351T>C	ENSP00000342952:p.Phe477Leu					ADCY2_uc011cmo.1_Missense_Mutation_p.F297L	p.F477L	NM_020546	NP_065433	Q08462	ADCY2_HUMAN			10	1496	+			477			Cytoplasmic (Potential).		B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	c.1429T>C	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	t	11.73	1.725636	0.30593	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	T;T	0.80304	-0.87;-1.36	5.62	5.62	0.85841	.	0.379586	0.30159	N	0.010270	T	0.50633	0.1627	N	0.00801	-1.175	0.30554	N	0.765181	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.48906	-0.8993	10	0.10636	T	0.68	.	11.5987	0.50990	0.141:0.0:0.0:0.859	.	297;477	B7Z2C1;Q08462	.;ADCY2_HUMAN	L	477;328;297	ENSP00000342952:F477L;ENSP00000444803:F297L	ENSP00000342952:F477L	F	+	1	0	ADCY2	7762351	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.036000	0.49767	2.137000	0.66172	0.456000	0.33151	TTC		PASS	0.592	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546		19	108	19	108	---	---	---	---
ADCY2	108	broad.mit.edu	37	5	7709429	7709429	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr5:7709429G>A	ENST00000338316.4	+	10	1596	c.1507G>A	c.(1507-1509)Gca>Aca	p.A503T	ADCY2_ENST00000537121.1_Missense_Mutation_p.A323T|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	503					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.A503T(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						GTCCTGGGGGGCAGCCAAGCC	0.607																																						uc003jdz.1																			1	Substitution - Missense(1)		lung(1)	ovary(5)|pancreas(1)|skin(1)	7						c.(1507-1509)GCA>ACA		adenylate cyclase 2							88.0	68.0	75.0					5																	7709429		2203	4300	6503	SO:0001583	missense	108				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding	g.chr5:7709429G>A	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1507G>A	5.37:g.7709429G>A	ENSP00000342952:p.Ala503Thr					ADCY2_uc011cmo.1_Missense_Mutation_p.A323T	p.A503T	NM_020546	NP_065433	Q08462	ADCY2_HUMAN			10	1574	+			503			Cytoplasmic (Potential).		B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	c.1507G>A	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	g	36	5.693365	0.96793	.	.	ENSG00000078295	ENST00000338316;ENST00000537121	T;T	0.78003	-1.14;-1.14	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.86969	0.6061	M	0.76838	2.35	0.80722	D	1	P;P	0.46220	0.786;0.874	P;P	0.56088	0.791;0.734	D	0.87140	0.2202	10	0.56958	D	0.05	.	19.6604	0.95864	0.0:0.0:1.0:0.0	.	323;503	B7Z2C1;Q08462	.;ADCY2_HUMAN	T	503;323	ENSP00000342952:A503T;ENSP00000444803:A323T	ENSP00000342952:A503T	A	+	1	0	ADCY2	7762429	1.000000	0.71417	0.423000	0.26634	0.997000	0.91878	9.554000	0.98121	2.644000	0.89710	0.558000	0.71614	GCA		PASS	0.607	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546		10	75	10	75	---	---	---	---
SEMA5A	9037	broad.mit.edu	37	5	9063029	9063029	+	Missense_Mutation	SNP	A	A	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr5:9063029A>G	ENST00000382496.5	-	18	3153	c.2488T>C	c.(2488-2490)Tac>Cac	p.Y830H		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	830	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)	p.Y830H(1)		biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CATTCCTGGTATTCCAGAGAT	0.512																																						uc003jek.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(2488-2490)TAC>CAC		semaphorin 5A precursor							98.0	82.0	88.0					5																	9063029		2203	4300	6503	SO:0001583	missense	9037				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane		g.chr5:9063029A>G	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2488T>C	5.37:g.9063029A>G	ENSP00000371936:p.Tyr830His						p.Y830H	NM_003966	NP_003957	Q13591	SEM5A_HUMAN			18	3200	-			830			TSP type-1 5.|Extracellular (Potential).		D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	37	c.2488T>C	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	A	15.27	2.782883	0.49891	.	.	ENSG00000112902	ENST00000382496	T	0.52754	0.65	5.65	5.65	0.86999	.	0.122577	0.64402	D	0.000020	T	0.61098	0.2320	L	0.53249	1.67	0.45150	D	0.998163	P	0.45126	0.851	P	0.59948	0.866	T	0.59364	-0.7468	10	0.41790	T	0.15	.	13.8294	0.63370	1.0:0.0:0.0:0.0	.	830	Q13591	SEM5A_HUMAN	H	830	ENSP00000371936:Y830H	ENSP00000371936:Y830H	Y	-	1	0	SEMA5A	9116029	1.000000	0.71417	0.987000	0.45799	0.068000	0.16541	9.040000	0.93783	2.149000	0.67028	0.533000	0.62120	TAC		PASS	0.512	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2			4	134	4	134	---	---	---	---
CDH12	1010	broad.mit.edu	37	5	21802373	21802373	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr5:21802373G>C	ENST00000382254.1	-	10	2245	c.1159C>G	c.(1159-1161)Ccg>Gcg	p.P387A	CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000522262.1_Missense_Mutation_p.P347A|CDH12_ENST00000504376.2_Missense_Mutation_p.P387A	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	387	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P387A(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						GTGTAGAGCGGCTTGCTGAAA	0.552										HNSCC(59;0.17)																												uc010iuc.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1159-1161)CCG>GCG		cadherin 12, type 2 preproprotein							98.0	74.0	82.0					5																	21802373		2203	4300	6503	SO:0001583	missense	1010				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:21802373G>C	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1159C>G	5.37:g.21802373G>C	ENSP00000371689:p.Pro387Ala	HNSCC(59;0.17)				CDH12_uc011cno.1_Missense_Mutation_p.P347A|CDH12_uc003jgk.2_Missense_Mutation_p.P387A	p.P387A	NM_004061	NP_004052	P55289	CAD12_HUMAN			7	1617	-			387			Extracellular (Potential).|Cadherin 4.		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	c.1159C>G	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.857329	0.51376	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.60548	0.18;0.18;0.18	5.84	4.92	0.64577	Cadherin (2);Cadherin-like (1);	0.160386	0.56097	D	0.000024	T	0.47078	0.1426	N	0.25485	0.75	0.46131	D	0.998888	B;B	0.20368	0.0;0.044	B;B	0.21708	0.002;0.036	T	0.37478	-0.9704	10	0.40728	T	0.16	.	16.4304	0.83840	0.0:0.1312:0.8688:0.0	.	347;387	B7Z2U6;P55289	.;CAD12_HUMAN	A	387;387;347	ENSP00000423577:P387A;ENSP00000371689:P387A;ENSP00000428786:P347A	ENSP00000371689:P387A	P	-	1	0	CDH12	21838130	1.000000	0.71417	0.997000	0.53966	0.962000	0.63368	5.243000	0.65395	2.765000	0.95021	0.655000	0.94253	CCG		PASS	0.552	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061		40	41	40	41	---	---	---	---
GOLPH3	64083	broad.mit.edu	37	5	32143959	32143959	+	Missense_Mutation	SNP	T	T	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr5:32143959T>C	ENST00000265070.6	-	2	568	c.253A>G	c.(253-255)Ata>Gta	p.I85V	GOLPH3_ENST00000512668.1_Intron	NM_022130.3	NP_071413.1	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3 (coat-protein)	85					cell adhesion molecule production (GO:0060352)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|gene expression (GO:0010467)|glycoprotein biosynthetic process (GO:0009101)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|Golgi vesicle budding (GO:0048194)|lamellipodium assembly (GO:0030032)|leukocyte tethering or rolling (GO:0050901)|positive regulation of protein secretion (GO:0050714)|positive regulation of TOR signaling (GO:0032008)|protein retention in Golgi apparatus (GO:0045053)|protein secretion (GO:0009306)|regulation of mitochondrion organization (GO:0010821)	cytosol (GO:0005829)|endosome (GO:0005768)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|phosphatidylinositol-4-phosphate binding (GO:0070273)	p.I85V(1)		kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11						CCAGATGATATACAGTCATTC	0.308																																						uc003jhp.1																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(253-255)ATA>GTA		golgi phosphoprotein 3							102.0	103.0	102.0					5																	32143959		2203	4300	6503	SO:0001583	missense	64083				cell proliferation|positive regulation of TOR signaling cascade|regulation of mitochondrion organization	cytosol|endosome|Golgi cisterna membrane|mitochondrial intermembrane space|plasma membrane|trans-Golgi network	protein binding	g.chr5:32143959T>C	AK075156	CCDS3896.1	5p13.2	2008-07-18			ENSG00000113384	ENSG00000113384			15452	protein-coding gene	gene with protein product	"""golgi peripheral membrane protein 1, 34 kDa"", ""golgi protein"", ""coat-protein"", ""golgi-associated protein"""	612207				11042173, 16263763	Standard	NM_022130		Approved	GPP34, GOPP1, MIDAS	uc003jhp.1	Q9H4A6	OTTHUMG00000090679	ENST00000265070.6:c.253A>G	5.37:g.32143959T>C	ENSP00000265070:p.Ile85Val						p.I85V	NM_022130	NP_071413	Q9H4A6	GOLP3_HUMAN			2	538	-			85					Q9UIW5	Missense_Mutation	SNP	ENST00000265070.6	37	c.253A>G	CCDS3896.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.527632	0.85706	.	.	ENSG00000113384	ENST00000265070;ENST00000542582	.	.	.	5.19	5.19	0.71726	.	0.047564	0.85682	D	0.000000	T	0.76976	0.4063	M	0.86953	2.85	0.80722	D	1	P	0.48764	0.915	P	0.54140	0.743	T	0.80291	-0.1444	9	0.46703	T	0.11	.	15.1097	0.72346	0.0:0.0:0.0:1.0	.	85	Q9H4A6	GOLP3_HUMAN	V	85;68	.	ENSP00000265070:I85V	I	-	1	0	GOLPH3	32179716	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.924000	0.87555	1.971000	0.57363	0.524000	0.50904	ATA		PASS	0.308	GOLPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207363.2	NM_022130		60	114	60	114	---	---	---	---
PRR16	51334	broad.mit.edu	37	5	120021831	120021831	+	Silent	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr5:120021831C>G	ENST00000407149.2	+	2	551	c.342C>G	c.(340-342)ctC>ctG	p.L114L	PRR16_ENST00000379551.2_Silent_p.L91L|PRR16_ENST00000505123.1_Silent_p.L44L|PRR16_ENST00000446965.1_Silent_p.L44L			Q569H4	LARGN_HUMAN	proline rich 16	114	Pro-rich.				positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)			p.L91L(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		CTGCTATCCTCACGGTCCTGA	0.522																																						uc003ksq.2																			1	Substitution - coding silent(1)		lung(1)	pancreas(2)|ovary(1)	3						c.(340-342)CTC>CTG		proline rich 16							143.0	126.0	132.0					5																	120021831		2203	4300	6503	SO:0001819	synonymous_variant	51334							g.chr5:120021831C>G	AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.342C>G	5.37:g.120021831C>G						PRR16_uc003ksp.2_Silent_p.L91L|PRR16_uc003ksr.2_Silent_p.L44L	p.L114L	NM_016644	NP_057728	Q569H4	PRR16_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)	2	505	+		all_cancers(142;0.0464)|Prostate(80;0.00446)	114			Pro-rich.		D3DSZ0|Q8IXY1|Q9NYI5	Silent	SNP	ENST00000407149.2	37	c.342C>G																																																																																					PASS	0.522	PRR16-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000371059.1	NM_016644		28	112	28	112	---	---	---	---
PKD2L2	27039	broad.mit.edu	37	5	137271531	137271531	+	Nonsense_Mutation	SNP	G	G	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr5:137271531G>T	ENST00000508883.1	+	13	1743	c.1717G>T	c.(1717-1719)Gag>Tag	p.E573*	PKD2L2_ENST00000502810.1_Nonsense_Mutation_p.E551*|PKD2L2_ENST00000508638.1_Nonsense_Mutation_p.E472*|PKD2L2_ENST00000290431.5_Nonsense_Mutation_p.E573*|PKD2L2_ENST00000350250.4_Nonsense_Mutation_p.E539*			Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	573					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)	integral component of membrane (GO:0016021)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)	p.E573*(1)		breast(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	28			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AGAGAGGCTTGAGAAAAAGTA	0.383																																						uc003lby.2																			1	Substitution - Nonsense(1)		lung(1)		0						c.(1717-1719)GAG>TAG		polycystic kidney disease 2-like 2							85.0	83.0	83.0					5																	137271531		1835	4094	5929	SO:0001587	stop_gained	27039					integral to membrane	calcium ion binding|ion channel activity	g.chr5:137271531G>T	AF118125	CCDS43367.1, CCDS58971.1, CCDS58972.1	5q31	2011-12-16			ENSG00000078795	ENSG00000078795		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9012	protein-coding gene	gene with protein product		604669				10602361	Standard	NM_014386		Approved	TRPP5	uc003lbw.1	Q9NZM6	OTTHUMG00000163306	ENST00000508883.1:c.1717G>T	5.37:g.137271531G>T	ENSP00000424725:p.Glu573*					PKD2L2_uc003lbw.1_Nonsense_Mutation_p.E573*|PKD2L2_uc003lbx.2_Nonsense_Mutation_p.E472*|PKD2L2_uc011cyi.1_Nonsense_Mutation_p.E181*	p.E573*	NM_014386	NP_055201	Q9NZM6	PK2L2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)		13	1773	+			573			Cytoplasmic (Potential).|Potential.		A6NK98|B4DXD2|E9PC91|E9PDG4|Q86YB4|Q9UNJ0	Nonsense_Mutation	SNP	ENST00000508883.1	37	c.1717G>T		.	.	.	.	.	.	.	.	.	.	G	26.9	4.778755	0.90195	.	.	ENSG00000078795	ENST00000350250;ENST00000508638;ENST00000502810;ENST00000508883;ENST00000290431	.	.	.	5.63	3.71	0.42584	.	0.329685	0.27068	N	0.021081	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-5.5503	7.6506	0.28346	0.0838:0.3201:0.596:0.0	.	.	.	.	X	539;472;551;573;573	.	ENSP00000290431:E573X	E	+	1	0	PKD2L2	137299430	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.073000	0.30691	1.504000	0.48704	0.655000	0.94253	GAG		PASS	0.383	PKD2L2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372521.1	NM_014386		7	56	7	56	---	---	---	---
MATR3	9782	broad.mit.edu	37	5	138661310	138661310	+	Missense_Mutation	SNP	A	A	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr5:138661310A>G	ENST00000394805.3	+	13	2665	c.2330A>G	c.(2329-2331)gAt>gGt	p.D777G	MATR3_ENST00000394800.2_Missense_Mutation_p.D825G|MATR3_ENST00000504203.1_Missense_Mutation_p.D439G|MATR3_ENST00000502929.1_Missense_Mutation_p.D825G|MATR3_ENST00000510056.1_Missense_Mutation_p.D777G|MATR3_ENST00000509990.1_Missense_Mutation_p.D777G|MATR3_ENST00000361059.2_Missense_Mutation_p.D777G|MATR3_ENST00000503811.1_Missense_Mutation_p.D489G|MATR3_ENST00000502499.1_Missense_Mutation_p.D439G	NM_001194955.1|NM_018834.5	NP_001181884.1|NP_061322.2	P43243	MATR3_HUMAN	matrin 3	777					cell death (GO:0008219)	membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)	p.D213G(1)|p.D777G(1)		breast(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			ACAATCCCAGATGAGTATAGA	0.418																																						uc003ldu.2																			2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(2329-2331)GAT>GGT		matrin 3							137.0	122.0	127.0					5																	138661310		2203	4300	6503	SO:0001583	missense	9782					nuclear inner membrane|nuclear matrix	nucleotide binding|protein binding|RNA binding|structural molecule activity|zinc ion binding	g.chr5:138661310A>G	M63483	CCDS4210.1, CCDS54908.1, CCDS75316.1	5q31.3	2010-08-12			ENSG00000015479	ENSG00000015479			6912	protein-coding gene	gene with protein product		164015	"""myopathy, distal 2"""	MPD2		2033075, 19344878	Standard	NM_018834		Approved	KIAA0723, MGC9105, VCPDM	uc003ldx.3	P43243	OTTHUMG00000129229	ENST00000394805.3:c.2330A>G	5.37:g.138661310A>G	ENSP00000378284:p.Asp777Gly					MATR3_uc003ldt.2_Missense_Mutation_p.D439G|MATR3_uc003ldw.2_Missense_Mutation_p.D825G|MATR3_uc003ldx.2_Missense_Mutation_p.D777G|MATR3_uc010jfc.2_Missense_Mutation_p.D777G|MATR3_uc011czb.1_Missense_Mutation_p.D489G|MATR3_uc003ldz.2_Missense_Mutation_p.D777G|MATR3_uc003lea.2_Missense_Mutation_p.D777G|MATR3_uc003leb.2_Missense_Mutation_p.D439G|MATR3_uc003lec.2_Missense_Mutation_p.D454G	p.D777G	NM_199189	NP_954659	P43243	MATR3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		16	2757	+			777					B7ZAV5|D3DQC3|Q9UHW0|Q9UQ27	Missense_Mutation	SNP	ENST00000394805.3	37	c.2330A>G	CCDS4210.1	.	.	.	.	.	.	.	.	.	.	A	18.60	3.659851	0.67586	.	.	ENSG00000015479	ENST00000509990;ENST00000361059;ENST00000504203;ENST00000502929;ENST00000394800;ENST00000394805;ENST00000502499;ENST00000510056;ENST00000503811;ENST00000337359	T;T;T;T;T;T;T;T;T	0.79554	-1.02;-1.02;-1.02;-1.28;-1.28;-1.02;-1.02;-1.28;-1.28	4.29	4.29	0.51040	.	0.256407	0.45126	D	0.000394	T	0.75199	0.3817	N	0.19112	0.55	0.41713	D	0.989467	B;B;B;P;B	0.50943	0.213;0.198;0.213;0.94;0.198	B;B;B;P;B	0.50314	0.033;0.108;0.033;0.637;0.108	T	0.77653	-0.2507	10	0.45353	T	0.12	-13.8368	13.8853	0.63704	1.0:0.0:0.0:0.0	.	489;777;489;825;777	B7ZAV5;D6REM6;B4DRS1;A8MXP9;P43243	.;.;.;.;MATR3_HUMAN	G	777;777;439;825;825;777;439;777;489;213	ENSP00000423533:D777G;ENSP00000354346:D777G;ENSP00000421218:D439G;ENSP00000422319:D825G;ENSP00000378279:D825G;ENSP00000378284:D777G;ENSP00000426030:D439G;ENSP00000426743:D777G;ENSP00000423587:D489G	ENSP00000338208:D213G	D	+	2	0	MATR3	138689209	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.036000	0.70948	1.927000	0.55829	0.477000	0.44152	GAT		PASS	0.418	MATR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251324.2	NM_018834		20	47	20	47	---	---	---	---
PAIP2	51247	broad.mit.edu	37	5	138704469	138704469	+	Silent	SNP	G	G	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr5:138704469G>T	ENST00000394795.2	+	4	1357	c.366G>T	c.(364-366)gtG>gtT	p.V122V	PAIP2_ENST00000510080.1_Silent_p.V122V|SLC23A1_ENST00000353963.3_Intron|CTB-43P18.1_ENST00000503553.3_RNA|SLC23A1_ENST00000348729.3_Intron|PAIP2_ENST00000511381.1_3'UTR|PAIP2_ENST00000511706.1_Silent_p.V62V|PAIP2_ENST00000265192.4_Silent_p.V122V			Q9BPZ3	PAIP2_HUMAN	poly(A) binding protein interacting protein 2	122					memory (GO:0007613)|negative regulation of translational initiation (GO:0045947)|regulation of long-term synaptic potentiation (GO:1900271)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mRNA binding (GO:0003729)|translation repressor activity (GO:0030371)	p.V122V(1)		kidney(1)|large_intestine(2)|lung(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTCCTGGGGTGAAGTACGGAA	0.393																																						uc003led.2																			1	Substitution - coding silent(1)		lung(1)		0						c.(364-366)GTG>GTT		poly(A) binding protein interacting protein 2							146.0	143.0	144.0					5																	138704469		2203	4300	6503	SO:0001819	synonymous_variant	51247				negative regulation of translational initiation	cytoplasm	protein binding|translation repressor activity	g.chr5:138704469G>T	AF151052	CCDS4211.1	5q32	2008-02-05			ENSG00000120727	ENSG00000120727			17970	protein-coding gene	gene with protein product		605604				11172725, 16804161	Standard	NM_016480		Approved	PAIP2A	uc003led.3	Q9BPZ3	OTTHUMG00000129227	ENST00000394795.2:c.366G>T	5.37:g.138704469G>T						PAIP2_uc003lee.2_Silent_p.V122V|PAIP2_uc003lef.2_Silent_p.V122V|SLC23A1_uc003leh.2_Intron|SLC23A1_uc003leg.2_Intron	p.V122V	NM_016480	NP_057564	Q9BPZ3	PAIP2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		4	543	+			122					B2RBI1|D3DQC6|Q49A06|Q9H0Y5|Q9P0Q8	Silent	SNP	ENST00000394795.2	37	c.366G>T	CCDS4211.1																																																																																				PASS	0.393	PAIP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373002.1	NM_016480		18	113	18	113	---	---	---	---
PCDHB13	56123	broad.mit.edu	37	5	140594887	140594887	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr5:140594887G>A	ENST00000341948.4	+	1	1379	c.1192G>A	c.(1192-1194)Gaa>Aaa	p.E398K		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	398	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E398*(1)|p.E398K(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAAATCCGCGGAAAACTTTTA	0.453																																						uc003lja.1																			2	Substitution - Missense(1)|Substitution - Nonsense(1)		lung(1)|kidney(1)	skin(2)|ovary(1)	3						c.(1192-1194)GAA>AAA		protocadherin beta 13 precursor							89.0	88.0	88.0					5																	140594887		2203	4300	6503	SO:0001583	missense	56123				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	g.chr5:140594887G>A	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1192G>A	5.37:g.140594887G>A	ENSP00000345491:p.Glu398Lys						p.E398K	NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)		1	1379	+			398			Cadherin 4.|Extracellular (Potential).		A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	c.1192G>A	CCDS4255.1	.	.	.	.	.	.	.	.	.	.	N	4.843	0.156732	0.09236	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.03607	3.87	3.5	0.507	0.16967	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.02267	0.0070	N	0.11154	0.105	0.09310	N	1	B	0.06786	0.001	B	0.24974	0.057	T	0.50197	-0.8856	9	0.18276	T	0.48	.	7.9544	0.30033	0.4429:0.0:0.5571:0.0	.	398	Q9Y5F0	PCDBD_HUMAN	K	398	ENSP00000345491:E398K	ENSP00000345491:E398K	E	+	1	0	PCDHB13	140575071	0.000000	0.05858	0.001000	0.08648	0.249000	0.25844	-0.604000	0.05667	0.135000	0.18707	0.298000	0.19748	GAA		PASS	0.453	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933		22	89	22	89	---	---	---	---
HAVCR2	84868	broad.mit.edu	37	5	156514243	156514243	+	Missense_Mutation	SNP	C	C	A	rs138681649		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr5:156514243C>A	ENST00000307851.4	-	7	1506	c.776G>T	c.(775-777)cGc>cTc	p.R259L	HAVCR2_ENST00000522593.1_Missense_Mutation_p.R231L	NM_032782.4	NP_116171.3	Q8TDQ0	HAVR2_HUMAN	hepatitis A virus cellular receptor 2	259						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.R259L(1)		cervix(1)|large_intestine(4)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	22	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTCTTCTGAGCGAATTCCCTC	0.458																																						uc003lwk.1																			1	Substitution - Missense(1)		lung(1)		0						c.(775-777)CGC>CTC		T cell immunoglobulin mucin 3 precursor							110.0	97.0	101.0					5																	156514243		2203	4300	6503	SO:0001583	missense	84868					integral to membrane		g.chr5:156514243C>A	AK027334	CCDS4333.1	5q34	2014-01-14			ENSG00000135077	ENSG00000135077		"""Immunoglobulin superfamily / V-set domain containing"""	18437	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 3"""	606652				11823861	Standard	NM_032782		Approved	Tim-3, TIM3, FLJ14428, TIMD3	uc003lwk.2	Q8TDQ0	OTTHUMG00000130249	ENST00000307851.4:c.776G>T	5.37:g.156514243C>A	ENSP00000312002:p.Arg259Leu						p.R259L	NM_032782	NP_116171	Q8TDQ0	HAVR2_HUMAN	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		7	920	-	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	259			Cytoplasmic (Potential).		B2RAY2|Q8WW60|Q96K94	Missense_Mutation	SNP	ENST00000307851.4	37	c.776G>T	CCDS4333.1	.	.	.	.	.	.	.	.	.	.	C	19.85	3.903839	0.72754	.	.	ENSG00000135077	ENST00000307851;ENST00000522593	T;T	0.21191	2.02;2.29	4.77	-3.19	0.05171	.	0.660669	0.14197	N	0.334939	T	0.29716	0.0742	L	0.56769	1.78	0.09310	N	1	D	0.63880	0.993	P	0.55615	0.78	T	0.19712	-1.0297	10	0.62326	D	0.03	-1.9137	10.7114	0.45986	0.0:0.3386:0.0:0.6614	.	259	Q8TDQ0	HAVR2_HUMAN	L	259;231	ENSP00000312002:R259L;ENSP00000430873:R231L	ENSP00000312002:R259L	R	-	2	0	HAVCR2	156446821	0.001000	0.12720	0.000000	0.03702	0.491000	0.33493	-1.196000	0.03041	-0.556000	0.06134	0.561000	0.74099	CGC		PASS	0.458	HAVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252574.2			11	59	11	59	---	---	---	---
DTNBP1	84062	broad.mit.edu	37	6	15627683	15627683	+	Missense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr6:15627683C>T	ENST00000344537.5	-	5	418	c.246G>A	c.(244-246)atG>atA	p.M82I	DTNBP1_ENST00000338950.5_Missense_Mutation_p.M82I|DTNBP1_ENST00000355917.3_Missense_Mutation_p.M82I	NM_032122.4	NP_115498.2	Q96EV8	DTBP1_HUMAN	dystrobrevin binding protein 1	82					actin cytoskeleton reorganization (GO:0031532)|anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|blood coagulation (GO:0007596)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|neuron projection morphogenesis (GO:0048812)|platelet dense granule organization (GO:0060155)|positive regulation of gene expression (GO:0010628)|positive regulation of neurotransmitter secretion (GO:0001956)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of dopamine secretion (GO:0014059)	axon (GO:0030424)|BLOC-1 complex (GO:0031083)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|growth cone (GO:0030426)|neuron projection (GO:0043005)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)|synaptic vesicle membrane (GO:0030672)		p.M82I(2)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|skin(2)	14	Breast(50;0.0289)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.211)			GCGCAGAAAGCATGACCACCT	0.488									Hermansky-Pudlak syndrome																													uc003nbm.2																			2	Substitution - Missense(2)		lung(2)		0						c.(244-246)ATG>ATA		dystrobrevin binding protein 1 isoform a							51.0	50.0	50.0					6																	15627683		2203	4300	6503	SO:0001583	missense	84062	Hermansky-Pudlak_syndrome	Familial Cancer Database	HPS, HPS1-8	actin cytoskeleton reorganization|cellular membrane organization|neuron projection morphogenesis|post-Golgi vesicle-mediated transport|regulation of dopamine receptor signaling pathway	axon part|BLOC-1 complex|cell junction|dendritic spine|endoplasmic reticulum membrane|endosome membrane|growth cone|melanosome membrane|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|synaptic vesicle membrane|synaptosome	identical protein binding	g.chr6:15627683C>T	AF394226	CCDS4534.1, CCDS4535.1, CCDS75404.1, CCDS75405.1	6p22.3	2013-09-27			ENSG00000047579	ENSG00000047579		"""Biogenesis of lysosomal organelles complex-1 subunits"""	17328	protein-coding gene	gene with protein product	"""dysbindin-1"", ""biogenesis of lysosomal organelles complex-1, subunit 8"""	607145				11316798	Standard	NM_032122		Approved	Dysbindin, My031, HPS7, DBND, BLOC1S8	uc003nbm.3	Q96EV8	OTTHUMG00000014295	ENST00000344537.5:c.246G>A	6.37:g.15627683C>T	ENSP00000341680:p.Met82Ile					DTNBP1_uc003nbl.2_Missense_Mutation_p.M1I|DTNBP1_uc003nbn.2_RNA|DTNBP1_uc003nbo.2_RNA|DTNBP1_uc003nbp.2_Missense_Mutation_p.M82I|DTNBP1_uc010jph.2_Missense_Mutation_p.M69I	p.M82I	NM_032122	NP_115498	Q96EV8	DTBP1_HUMAN	Epithelial(50;0.211)		5	417	-	Breast(50;0.0289)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	82					A8K3V3|Q5THY3|Q5THY4|Q96NV2|Q9H0U2|Q9H3J5	Missense_Mutation	SNP	ENST00000344537.5	37	c.246G>A	CCDS4534.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.861363	0.51482	.	.	ENSG00000047579	ENST00000344537;ENST00000355917;ENST00000397306;ENST00000511762;ENST00000338950;ENST00000543749	T;T;T	0.32272	1.46;1.46;1.49	5.58	5.58	0.84498	.	0.084756	0.51477	D	0.000099	T	0.47764	0.1463	M	0.76838	2.35	0.58432	D	0.999997	D;D;D	0.63880	0.993;0.988;0.988	P;P;P	0.61940	0.851;0.896;0.709	T	0.40683	-0.9550	10	0.42905	T	0.14	.	18.3295	0.90263	0.0:1.0:0.0:0.0	.	82;82;82	F5GY46;Q96EV8-2;Q96EV8	.;.;DTBP1_HUMAN	I	82;82;1;47;82;82	ENSP00000341680:M82I;ENSP00000348183:M82I;ENSP00000344718:M82I	ENSP00000344718:M82I	M	-	3	0	DTNBP1	15735662	1.000000	0.71417	0.999000	0.59377	0.046000	0.14306	4.258000	0.58822	2.637000	0.89404	0.650000	0.86243	ATG		PASS	0.488	DTNBP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000039933.2	NM_032122		12	76	12	76	---	---	---	---
HIST1H2BH	8345	broad.mit.edu	37	6	26252107	26252107	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr6:26252107G>A	ENST00000356350.2	+	1	229	c.229G>A	c.(229-231)Gag>Aag	p.E77K	HIST1H3F_ENST00000446824.2_5'Flank	NM_003524.2	NP_003515.1	Q93079	H2B1H_HUMAN	histone cluster 1, H2bh	77					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E77K(1)		NS(3)|breast(2)|large_intestine(1)|lung(3)|ovary(3)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	17						CATCGCCGGCGAGGCTTCCCG	0.592																																						uc003nhh.2																			1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(229-231)GAG>AAG		histone cluster 1, H2bh							104.0	106.0	105.0					6																	26252107		2203	4300	6503	SO:0001583	missense	8345				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:26252107G>A	Z80781	CCDS4601.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000197459	ENSG00000275713		"""Histones / Replication-dependent"""	4755	protein-coding gene	gene with protein product		602806	"""H2B histone family, member J"", ""histone 1, H2bh"""	H2BFJ		9119399, 12408966	Standard	NM_003524		Approved	H2B/j	uc003nhh.3	Q93079	OTTHUMG00000014447	ENST00000356350.2:c.229G>A	6.37:g.26252107G>A	ENSP00000348706:p.Glu77Lys					HIST1H3F_uc003nhg.1_5'Flank	p.E77K	NM_003524	NP_003515	Q93079	H2B1H_HUMAN			1	229	+			77					B2R541|Q4VB74	Missense_Mutation	SNP	ENST00000356350.2	37	c.229G>A	CCDS4601.1	.	.	.	.	.	.	.	.	.	.	.	22.5	4.292564	0.80914	.	.	ENSG00000197459	ENST00000356350	T	0.34472	1.36	4.65	4.65	0.58169	Histone-fold (2);Histone core (1);	.	.	.	.	T	0.62319	0.2418	H	0.95780	3.72	0.42567	D	0.993161	D	0.67145	0.996	P	0.58970	0.849	T	0.74639	-0.3598	9	0.54805	T	0.06	.	17.3874	0.87420	0.0:0.0:1.0:0.0	.	77	Q93079	H2B1H_HUMAN	K	77	ENSP00000348706:E77K	ENSP00000348706:E77K	E	+	1	0	HIST1H2BH	26360086	1.000000	0.71417	0.997000	0.53966	0.004000	0.04260	7.667000	0.83888	2.513000	0.84729	0.591000	0.81541	GAG		PASS	0.592	HIST1H2BH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040110.1	NM_003524		8	197	8	197	---	---	---	---
HIST1H2BK	85236	broad.mit.edu	37	6	27114419	27114419	+	Silent	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr6:27114419G>A	ENST00000356950.1	-	1	158	c.159C>T	c.(157-159)acC>acT	p.T53T	MIR3143_ENST00000584253.1_RNA|HIST1H2BK_ENST00000396891.4_Silent_p.T53T|HIST1H2AH_ENST00000377459.1_5'Flank			O60814	H2B1K_HUMAN	histone cluster 1, H2bk	53					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.T53T(2)		breast(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						AGGAGATGCCGGTGTCGGGGT	0.577																																						uc003nix.1																			2	Substitution - coding silent(2)		lung(2)		0						c.(157-159)ACC>ACT		histone cluster 1, H2bk							106.0	95.0	99.0					6																	27114419		2203	4295	6498	SO:0001819	synonymous_variant	85236				defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:27114419G>A	AJ223352	CCDS4621.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000197903	ENSG00000197903		"""Histones / Replication-dependent"""	13954	protein-coding gene	gene with protein product		615045	"""H2B histone family, member T"", ""histone 1, H2bk"""	H2BFT		12408966	Standard	NM_080593		Approved	H2BFAiii	uc003nix.2	O60814	OTTHUMG00000014473	ENST00000356950.1:c.159C>T	6.37:g.27114419G>A						HIST1H2AH_uc003niz.2_5'Flank|hsa-mir-3143|MI0014167_5'Flank	p.T53T	NM_080593	NP_542160	O60814	H2B1K_HUMAN			1	201	-			53					A8K7P7|Q2VPI7	Silent	SNP	ENST00000356950.1	37	c.159C>T	CCDS4621.1																																																																																				PASS	0.577	HIST1H2BK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040141.1	NM_080593		47	282	47	282	---	---	---	---
ZNF184	7738	broad.mit.edu	37	6	27420015	27420015	+	Silent	SNP	A	A	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr6:27420015A>T	ENST00000211936.6	-	6	1607	c.1323T>A	c.(1321-1323)acT>acA	p.T441T	ZNF184_ENST00000377419.1_Silent_p.T441T	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	441					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.T441T(1)		breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						GTTTCTCCCCAGTATGAGTTT	0.403																																						uc003njj.2																			1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(1321-1323)ACT>ACA		zinc finger protein 184							85.0	86.0	85.0					6																	27420015		2203	4300	6503	SO:0001819	synonymous_variant	7738				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr6:27420015A>T	U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.1323T>A	6.37:g.27420015A>T						ZNF184_uc010jqv.2_Silent_p.T441T|ZNF184_uc003nji.2_Silent_p.T441T	p.T441T	NM_007149	NP_009080	Q99676	ZN184_HUMAN			5	2134	-			441					B2R715|O60792|Q8TBA9	Silent	SNP	ENST00000211936.6	37	c.1323T>A	CCDS4624.1																																																																																				PASS	0.403	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040146.1	NM_007149		37	194	37	194	---	---	---	---
MDC1	9656	broad.mit.edu	37	6	30671677	30671677	+	Silent	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr6:30671677C>T	ENST00000376406.3	-	10	5930	c.5283G>A	c.(5281-5283)gtG>gtA	p.V1761V	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000376405.2_Silent_p.V1497V	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1761	Required for nuclear localization (NLS2).				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)	p.V1761V(1)		breast(2)|kidney(1)|ovary(1)	4						CAGCTGCTCTCACTGCTCCCC	0.557								Other conserved DNA damage response genes																														uc003nrg.3																			1	Substitution - coding silent(1)		lung(1)	breast(2)|ovary(1)|kidney(1)	4						c.(5281-5283)GTG>GTA	Other_conserved_DNA_damage_response_genes	mediator of DNA-damage checkpoint 1							68.0	65.0	66.0					6																	30671677		2203	4300	6503	SO:0001819	synonymous_variant	9656				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding	g.chr6:30671677C>T	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.5283G>A	6.37:g.30671677C>T						MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Silent_p.V1368V	p.V1761V	NM_014641	NP_055456	Q14676	MDC1_HUMAN			10	5723	-			1761			Required for nuclear localization (NLS2).		A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Silent	SNP	ENST00000376406.3	37	c.5283G>A	CCDS34384.1																																																																																				PASS	0.557	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641		6	107	6	107	---	---	---	---
PBX2	5089	broad.mit.edu	37	6	32155509	32155509	+	Missense_Mutation	SNP	T	T	A	rs202223627		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr6:32155509T>A	ENST00000375050.4	-	5	1055	c.785A>T	c.(784-786)tAt>tTt	p.Y262F	XXbac-BPG300A18.13_ENST00000559458.1_RNA	NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	262					embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.Y262F(3)		endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						GGAGTAGAAATACTCATTTAG	0.517																																						uc003oav.1																			3	Substitution - Missense(3)		lung(3)	ovary(1)	1						c.(784-786)TAT>TTT		pre-B-cell leukemia homeobox 2																																				SO:0001583	missense	5089						transcription factor binding	g.chr6:32155509T>A		CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.785A>T	6.37:g.32155509T>A	ENSP00000364190:p.Tyr262Phe					PBX2_uc003oaw.2_Missense_Mutation_p.Y262F	p.Y262F	NM_002586	NP_002577	P40425	PBX2_HUMAN			5	1056	-			262			Homeobox; TALE-type.		A2BFJ2	Missense_Mutation	SNP	ENST00000375050.4	37	c.785A>T	CCDS4748.1	.	.	.	.	.	.	.	.	.	.	T	19.51	3.841111	0.71488	.	.	ENSG00000204304	ENST00000375050	D	0.83673	-1.75	4.63	4.63	0.57726	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.201957	0.34435	N	0.003969	T	0.61837	0.2379	N	0.10629	0.01	0.80722	D	1	P;P	0.42337	0.776;0.502	P;P	0.45232	0.474;0.458	T	0.71314	-0.4630	10	0.49607	T	0.09	-0.8351	12.0363	0.53427	0.0:0.0:0.0:1.0	.	262;262	Q7KZE5;P40425	.;PBX2_HUMAN	F	262	ENSP00000364190:Y262F	ENSP00000364190:Y262F	Y	-	2	0	PBX2	32263487	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.505000	0.81655	1.943000	0.56356	0.459000	0.35465	TAT		PASS	0.517	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076194.4			4	24	4	24	---	---	---	---
HLA-DRA	3122	broad.mit.edu	37	6	32410335	32410335	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr6:32410335G>A	ENST00000374982.5	+	2	266	c.193G>A	c.(193-195)Gag>Aag	p.E65K	HLA-DRA_ENST00000395388.2_Missense_Mutation_p.E65K			P01903	DRA_HUMAN	major histocompatibility complex, class II, DR alpha	65	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002504)|cognition (GO:0050890)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|polysaccharide assembly with MHC class II protein complex (GO:0002506)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)	p.E65K(1)		NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19						GGCAAAGAAGGAGACGGTCTG	0.468									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Kaposi Sarcoma, Familial Clustering of																													uc003obh.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(193-195)GAG>AAG		major histocompatibility complex, class II, DR							149.0	154.0	152.0					6																	32410335		1511	2709	4220	SO:0001583	missense	3122	T-cell_Lymphoma_(Cutaneous)__Familial_Clustering_of|Kaposi_Sarcoma_Familial_Clustering_of	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;	antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|Golgi apparatus|integral to plasma membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity	g.chr6:32410335G>A		CCDS4750.1	6p21.3	2013-01-11			ENSG00000204287	ENSG00000204287		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4947	protein-coding gene	gene with protein product		142860		HLA-DRA1			Standard	NM_019111		Approved		uc003obh.3	P01903	OTTHUMG00000031269	ENST00000374982.5:c.193G>A	6.37:g.32410335G>A	ENSP00000364121:p.Glu65Lys					HLA-DRA_uc003obi.2_Missense_Mutation_p.E65K	p.E65K	NM_019111	NP_061984	P01903	DRA_HUMAN			2	274	+			65			Extracellular (Potential).|Alpha-1.		A2BET4|Q30160|Q6IAZ1|Q861I2|Q9TP70	Missense_Mutation	SNP	ENST00000374982.5	37	c.193G>A		.	.	.	.	.	.	.	.	.	.	.	21.4	4.149271	0.78001	.	.	ENSG00000204287	ENST00000395388;ENST00000374982	T;T	0.03496	3.91;3.91	5.38	4.49	0.54785	MHC class II, alpha/beta chain, N-terminal (1);MHC classes I/II-like antigen recognition protein (1);MHC class II, alpha chain, N-terminal (2);	0.284016	0.35349	N	0.003266	T	0.10680	0.0261	M	0.87180	2.865	0.35135	D	0.768291	D;D	0.55385	0.971;0.966	P;P	0.62298	0.9;0.832	T	0.01617	-1.1311	10	0.72032	D	0.01	.	11.8526	0.52419	0.0:0.1756:0.8244:0.0	.	65;65	Q30118;P01903	.;DRA_HUMAN	K	65	ENSP00000378786:E65K;ENSP00000364121:E65K	ENSP00000364121:E65K	E	+	1	0	HLA-DRA	32518313	0.997000	0.39634	0.898000	0.35279	0.531000	0.34715	2.903000	0.48711	1.476000	0.48215	0.638000	0.83543	GAG		PASS	0.468	HLA-DRA-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000076587.3	NM_019111		32	146	32	146	---	---	---	---
SYNGAP1	8831	broad.mit.edu	37	6	33405597	33405597	+	Silent	SNP	C	C	A	rs370654601		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr6:33405597C>A	ENST00000418600.2	+	8	1016	c.915C>A	c.(913-915)acC>acA	p.T305T	MIR5004_ENST00000579078.1_RNA|SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000293748.5_Silent_p.T305T|SYNGAP1_ENST00000428982.2_Silent_p.T246T	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	305	C2.				dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)	p.T290T(1)|p.T305T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						CTGGGGACACCGTCTTCTGGG	0.602																																						uc011dri.1																			2	Substitution - coding silent(2)		lung(2)	ovary(4)	4						c.(913-915)ACC>ACA		synaptic Ras GTPase activating protein 1							76.0	72.0	73.0					6																	33405597		2203	4300	6503	SO:0001819	synonymous_variant	8831				negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding	g.chr6:33405597C>A	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.915C>A	6.37:g.33405597C>A						SYNGAP1_uc003oeo.1_Silent_p.T290T|SYNGAP1_uc010juy.2_Silent_p.T290T|SYNGAP1_uc010juz.2_Silent_p.T17T	p.T305T	NM_006772	NP_006763	Q96PV0	SYGP1_HUMAN			8	1110	+			305			C2.		A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Silent	SNP	ENST00000418600.2	37	c.915C>A	CCDS34434.2																																																																																				PASS	0.602	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407		3	95	3	95	---	---	---	---
KCNK17	89822	broad.mit.edu	37	6	39271753	39271753	+	Missense_Mutation	SNP	C	C	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr6:39271753C>A	ENST00000373231.4	-	4	900	c.668G>T	c.(667-669)gGc>gTc	p.G223V	KCNK17_ENST00000453413.2_Missense_Mutation_p.G223V	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	223					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.G223V(2)		endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						GTCGCCGAAGCCCACGGTGCT	0.617																																						uc003ooo.2																			2	Substitution - Missense(2)		lung(2)	skin(2)	2						c.(667-669)GGC>GTC		potassium channel, subfamily K, member 17							100.0	95.0	96.0					6																	39271753		2203	4300	6503	SO:0001583	missense	89822					integral to membrane	potassium channel activity|voltage-gated ion channel activity	g.chr6:39271753C>A	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.668G>T	6.37:g.39271753C>A	ENSP00000362328:p.Gly223Val					KCNK17_uc003oop.2_Missense_Mutation_p.G223V	p.G223V	NM_031460	NP_113648	Q96T54	KCNKH_HUMAN			4	808	-			223					E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	c.668G>T	CCDS4842.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.514506	0.85389	.	.	ENSG00000124780	ENST00000373231;ENST00000453413	D;D	0.93076	-2.66;-3.16	4.31	4.31	0.51392	Ion transport 2 (1);	0.000000	0.56097	D	0.000023	D	0.97826	0.9286	H	0.97587	4.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99211	1.0876	10	0.87932	D	0	.	15.7119	0.77635	0.0:1.0:0.0:0.0	.	223;223	E9PB46;Q96T54	.;KCNKH_HUMAN	V	223	ENSP00000362328:G223V;ENSP00000401271:G223V	ENSP00000362328:G223V	G	-	2	0	KCNK17	39379731	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	6.818000	0.75257	2.223000	0.72356	0.561000	0.74099	GGC		PASS	0.617	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460		18	128	18	128	---	---	---	---
MOCS1	4337	broad.mit.edu	37	6	39874531	39874531	+	Missense_Mutation	SNP	C	C	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr6:39874531C>A	ENST00000340692.5	-	11	1516	c.1513G>T	c.(1513-1515)Gtg>Ttg	p.V505L	MOCS1_ENST00000308559.7_Missense_Mutation_p.V489L|MOCS1_ENST00000373188.2_3'UTR|MOCS1_ENST00000373186.4_3'UTR|MOCS1_ENST00000425303.2_Missense_Mutation_p.V505L|MOCS1_ENST00000373175.4_3'UTR|MOCS1_ENST00000373195.3_Missense_Mutation_p.V402L			Q9NZB8	MOCS1_HUMAN	molybdenum cofactor synthesis 1	505	Molybdenum cofactor biosynthesis protein C.				Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|molybdopterin synthase complex (GO:0019008)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|cyclic pyranopterin monophosphate synthase activity (GO:0061597)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.V505L(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	21	Ovarian(28;0.0355)|Colorectal(47;0.196)					GCCACAGCCACCCGCTCTGTG	0.592																																					NSCLC(84;861 1413 23785 24908 42279)|Melanoma(182;611 2047 9114 11847 26639)	uc003opb.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|liver(1)|central_nervous_system(1)	3						c.(1513-1515)GTG>TTG		molybdenum cofactor synthesis-step 1 protein							68.0	59.0	62.0					6																	39874531		2203	4300	6503	SO:0001583	missense	4337				Mo-molybdopterin cofactor biosynthetic process|Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol|molybdopterin synthase complex|nucleus	4 iron, 4 sulfur cluster binding|4 iron, 4 sulfur cluster binding|catalytic activity|GTP binding|metal ion binding	g.chr6:39874531C>A	AJ224328	CCDS4846.1, CCDS43460.1	6p21.2	2012-05-08			ENSG00000124615	ENSG00000124615			7190	protein-coding gene	gene with protein product		603707				9731530, 10053004	Standard	NM_001075098		Approved	MOCOD	uc003opb.3	Q9NZB8	OTTHUMG00000014656	ENST00000340692.5:c.1513G>T	6.37:g.39874531C>A	ENSP00000344794:p.Val505Leu					MOCS1_uc003opa.2_3'UTR|MOCS1_uc003opc.2_Missense_Mutation_p.V489L|MOCS1_uc003opd.2_3'UTR|MOCS1_uc003ope.2_Missense_Mutation_p.V402L	p.V505L	NM_005942	NP_005933	Q9NZB8	MOCS1_HUMAN			10	1651	-	Ovarian(28;0.0355)|Colorectal(47;0.196)		505			Molybdenum cofactor biosynthesis protein C.		B3KPT7|B4DTP1|O14940|O14941|O75710|Q5J7W0|Q5TCE1|Q5TCE2|Q5TCE6|Q5TCE9|Q5TCF0|Q5TCF1|Q8N418|Q9NZB7|Q9UEM1	Missense_Mutation	SNP	ENST00000340692.5	37	c.1513G>T		.	.	.	.	.	.	.	.	.	.	C	14.75	2.628306	0.46944	.	.	ENSG00000124615	ENST00000308559;ENST00000373195;ENST00000340692;ENST00000425303	T;T;T;T	0.31247	1.5;1.51;1.5;1.5	5.33	4.45	0.53987	Molybdopterin cofactor biosynthesis C (MoaC) domain (3);	0.419151	0.24447	N	0.038457	T	0.06508	0.0167	.	.	.	0.80722	D	1	B;B;B	0.28055	0.199;0.125;0.019	B;B;B	0.31390	0.117;0.129;0.034	T	0.18681	-1.0329	9	0.10111	T	0.7	-13.8948	5.3938	0.16259	0.0:0.717:0.0:0.283	.	489;505;505	Q9NZB8-2;Q9NZB8;Q9NZB8-8	.;MOCS1_HUMAN;.	L	489;402;505;505	ENSP00000309843:V489L;ENSP00000362291:V402L;ENSP00000344794:V505L;ENSP00000416478:V505L	ENSP00000309843:V489L	V	-	1	0	MOCS1	39982509	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.826000	0.55738	2.481000	0.83766	0.563000	0.77884	GTG		PASS	0.592	MOCS1-005	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000040476.2	NM_005943		3	78	3	78	---	---	---	---
COL9A1	1297	broad.mit.edu	37	6	70942343	70942343	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr6:70942343G>C	ENST00000357250.6	-	36	2604	c.2446C>G	c.(2446-2448)Cgt>Ggt	p.R816G	COL9A1_ENST00000489611.1_5'UTR|COL9A1_ENST00000370499.4_Missense_Mutation_p.R573G|COL9A1_ENST00000320755.7_Missense_Mutation_p.R573G|RP1-149L1.1_ENST00000522264.1_RNA	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	816	Collagen-like 9.|Triple-helical region (COL1).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)	p.R573G(1)|p.R816G(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						GGAAGGCCACGAATTCCCATC	0.592																																						uc003pfg.3																			2	Substitution - Missense(2)		lung(2)	ovary(4)	4						c.(2446-2448)CGT>GGT		alpha 1 type IX collagen isoform 1 precursor							82.0	89.0	87.0					6																	70942343		2203	4300	6503	SO:0001583	missense	1297				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding	g.chr6:70942343G>C		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.2446C>G	6.37:g.70942343G>C	ENSP00000349790:p.Arg816Gly					COL9A1_uc003pfe.3_Missense_Mutation_p.R365G|COL9A1_uc003pff.3_Missense_Mutation_p.R573G	p.R816G	NM_001851	NP_001842	P20849	CO9A1_HUMAN			36	2605	-			816			Triple-helical region (COL1).		Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	c.2446C>G	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	G	13.48	2.249440	0.39797	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	D;D;D	0.93547	-3.24;-3.24;-3.24	5.91	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.95271	0.8466	M	0.73217	2.22	0.54753	D	0.999986	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.974	D	0.95681	0.8732	10	0.62326	D	0.03	.	13.9705	0.64237	0.0:0.0:0.724:0.276	.	816;573;365	P20849;P20849-2;B3KWS8	CO9A1_HUMAN;.;.	G	816;573;573	ENSP00000349790:R816G;ENSP00000315252:R573G;ENSP00000359530:R573G	ENSP00000315252:R573G	R	-	1	0	COL9A1	70999064	1.000000	0.71417	0.978000	0.43139	0.769000	0.43574	4.968000	0.63728	1.457000	0.47850	0.655000	0.94253	CGT		PASS	0.592	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2			33	209	33	209	---	---	---	---
SESN1	27244	broad.mit.edu	37	6	109322510	109322510	+	Missense_Mutation	SNP	C	C	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr6:109322510C>A	ENST00000356644.7	-	3	444	c.350G>T	c.(349-351)cGt>cTt	p.R117L	RP11-787I22.3_ENST00000605885.1_RNA|SESN1_ENST00000302071.2_Missense_Mutation_p.R51L|SESN1_ENST00000436639.2_Missense_Mutation_p.R176L	NM_001199933.1	NP_001186862.1	Q9Y6P5	SESN1_HUMAN	sestrin 1	117					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of cell proliferation (GO:0008285)|regulation of protein kinase B signaling (GO:0051896)|regulation of response to reactive oxygen species (GO:1901031)	nucleus (GO:0005634)		p.R176L(1)		cervix(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	10		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)		AATGTAGTGACGATAATGTAG	0.333																																						uc003pst.3																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(349-351)CGT>CTT		sestrin 1							73.0	71.0	72.0					6																	109322510		2203	4300	6503	SO:0001583	missense	27244				cell cycle arrest|negative regulation of cell proliferation|response to DNA damage stimulus	nucleus		g.chr6:109322510C>A	AF033120	CCDS5070.1, CCDS56444.1, CCDS56445.1	6q21	2008-10-23			ENSG00000080546	ENSG00000080546			21595	protein-coding gene	gene with protein product		606103				9926927, 7938006	Standard	NM_014454		Approved	SEST1, PA26	uc003psu.3	Q9Y6P5	OTTHUMG00000015338	ENST00000356644.7:c.350G>T	6.37:g.109322510C>A	ENSP00000349061:p.Arg117Leu					SESN1_uc003psu.2_Missense_Mutation_p.R176L	p.R117L	NM_014454	NP_055269	Q9Y6P5	SESN1_HUMAN		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)	3	442	-		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)	117					Q2M2B7|Q5T316|Q9NV00|Q9UPD5|Q9Y6P6	Missense_Mutation	SNP	ENST00000356644.7	37	c.350G>T	CCDS56445.1	.	.	.	.	.	.	.	.	.	.	C	18.67	3.674718	0.67928	.	.	ENSG00000080546	ENST00000436639;ENST00000302071;ENST00000356644	T;T;T	0.52057	0.68;0.68;0.68	5.41	5.41	0.78517	.	0.054046	0.64402	D	0.000001	T	0.50803	0.1637	M	0.91196	3.185	0.80722	D	1	P;P	0.46064	0.872;0.8	B;B	0.44108	0.441;0.392	T	0.63721	-0.6573	10	0.56958	D	0.05	-13.2758	12.5222	0.56067	0.0:0.9239:0.0:0.0761	.	176;117	Q9Y6P5-2;Q9Y6P5	.;SESN1_HUMAN	L	176;51;117	ENSP00000393762:R176L;ENSP00000306734:R51L;ENSP00000349061:R117L	ENSP00000306734:R51L	R	-	2	0	SESN1	109429203	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	5.782000	0.68973	2.539000	0.85634	0.650000	0.86243	CGT		PASS	0.333	SESN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041738.4	NM_014454		18	117	18	117	---	---	---	---
PDE10A	10846	broad.mit.edu	37	6	165808737	165808737	+	Missense_Mutation	SNP	C	C	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr6:165808737C>A	ENST00000366882.1	-	16	1562	c.1408G>T	c.(1408-1410)Ggt>Tgt	p.G470C	PDE10A_ENST00000539869.2_Missense_Mutation_p.G480C|PDE10A_ENST00000354448.4_Missense_Mutation_p.G470C			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	470					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)	p.G470C(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	TCAAAAGGACCAATGTCAAAG	0.333																																					Esophageal Squamous(22;308 615 5753 12038 40624)	uc003qun.2																			1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)	5						c.(1408-1410)GGT>TGT		phosphodiesterase 10A isoform 2	Dipyridamole(DB00975)						71.0	69.0	70.0					6																	165808737		2203	4300	6503	SO:0001583	missense	10846				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding	g.chr6:165808737C>A	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1408G>T	6.37:g.165808737C>A	ENSP00000355847:p.Gly470Cys					PDE10A_uc011egj.1_RNA|PDE10A_uc011egk.1_Missense_Mutation_p.G400C|PDE10A_uc003quo.2_Missense_Mutation_p.G480C	p.G470C	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	16	1649	-		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)	470					Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37	c.1408G>T		.	.	.	.	.	.	.	.	.	.	C	13.67	2.307017	0.40795	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.77489	-1.1;-1.1	5.57	4.59	0.56863	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.625761	0.17922	N	0.157444	T	0.47266	0.1436	N	0.22421	0.69	0.37586	D	0.919988	P;B	0.51653	0.947;0.063	B;B	0.41646	0.362;0.049	T	0.58031	-0.7708	10	0.46703	T	0.11	.	3.1601	0.06517	0.0:0.5137:0.2989:0.1874	.	480;470	Q9ULW9;Q9Y233	.;PDE10_HUMAN	C	470;498;480;470;469	ENSP00000355847:G470C;ENSP00000346435:G470C	ENSP00000341187:G480C	G	-	1	0	PDE10A	165728727	0.976000	0.34144	0.889000	0.34880	0.996000	0.88848	1.898000	0.39809	2.619000	0.88677	0.650000	0.86243	GGT		PASS	0.333	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1			7	56	7	56	---	---	---	---
EIF3B	8662	broad.mit.edu	37	7	2402315	2402315	+	Missense_Mutation	SNP	C	C	A	rs150739455		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr7:2402315C>A	ENST00000360876.4	+	3	784	c.728C>A	c.(727-729)gCt>gAt	p.A243D	EIF3B_ENST00000397011.2_Missense_Mutation_p.A243D	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B									p.A243D(1)		breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		CCTGCCCACgctgtggatgct	0.547																																						uc003slx.2																			1	Substitution - Missense(1)		lung(1)		0						c.(727-729)GCT>GAT		eukaryotic translation initiation factor 3,							120.0	98.0	106.0					7																	2402315		2203	4300	6503	SO:0001583	missense	8662				regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity	g.chr7:2402315C>A	U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.728C>A	7.37:g.2402315C>A	ENSP00000354125:p.Ala243Asp					EIF3B_uc003sly.2_Missense_Mutation_p.A243D|EIF3B_uc003slz.1_Missense_Mutation_p.A204D|EIF3B_uc003sma.2_Translation_Start_Site	p.A243D	NM_003751	NP_003742	P55884	EIF3B_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)	3	811	+		Ovarian(82;0.0253)	243			Sufficient for interaction with EIF3E.|RRM.|Sufficient for interaction with EIF3J.			Missense_Mutation	SNP	ENST00000360876.4	37	c.728C>A	CCDS5332.1	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646392	0.67358	.	.	ENSG00000106263	ENST00000314800;ENST00000360876;ENST00000413917;ENST00000397011;ENST00000489558	T;T;T	0.62232	0.04;0.04;0.04	5.47	5.47	0.80525	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.88511	0.6456	H	0.98965	4.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.93046	0.6461	10	0.87932	D	0	-29.1637	19.3204	0.94236	0.0:1.0:0.0:0.0	.	204;243	A4D210;P55884	.;EIF3B_HUMAN	D	243;243;204;243;167	ENSP00000354125:A243D;ENSP00000407785:A204D;ENSP00000380206:A243D	ENSP00000316638:A243D	A	+	2	0	EIF3B	2368841	1.000000	0.71417	0.314000	0.25224	0.091000	0.18340	7.566000	0.82347	2.577000	0.86979	0.655000	0.94253	GCT		PASS	0.547	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207006.1			4	76	4	76	---	---	---	---
TTYH3	80727	broad.mit.edu	37	7	2701348	2701348	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr7:2701348G>A	ENST00000258796.7	+	14	1752	c.1547G>A	c.(1546-1548)cGc>cAc	p.R516H	TTYH3_ENST00000407643.1_Missense_Mutation_p.R484H|TTYH3_ENST00000403167.1_Missense_Mutation_p.R345H	NM_025250.2	NP_079526.1	Q9C0H2	TTYH3_HUMAN	tweety family member 3	516					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|intracellular calcium activated chloride channel activity (GO:0005229)	p.R516H(1)		kidney(1)|large_intestine(3)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	17		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		AGCCAGCCTCGCCCTGACTCC	0.692																																						uc003smp.2																			1	Substitution - Missense(1)		lung(1)		0						c.(1546-1548)CGC>CAC		tweety 3							31.0	21.0	25.0					7																	2701348		2189	4285	6474	SO:0001583	missense	80727					chloride channel complex|plasma membrane	chloride channel activity	g.chr7:2701348G>A		CCDS34588.1	7p22	2013-09-02	2013-09-02		ENSG00000136295	ENSG00000136295			22222	protein-coding gene	gene with protein product		608919	"""tweety homolog 3 (Drosophila)"""				Standard	NM_025250		Approved	KIAA1691	uc003smp.3	Q9C0H2	OTTHUMG00000152050	ENST00000258796.7:c.1547G>A	7.37:g.2701348G>A	ENSP00000258796:p.Arg516His					TTYH3_uc010ksn.2_Missense_Mutation_p.R236H|TTYH3_uc003smq.2_Missense_Mutation_p.R345H	p.R516H	NM_025250	NP_079526	Q9C0H2	TTYH3_HUMAN		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)	14	1734	+		Ovarian(82;0.0112)	516			Cytoplasmic (Potential).		A4D201|B7WP98|Q6L749|Q6ZVG3|Q8TEG6	Missense_Mutation	SNP	ENST00000258796.7	37	c.1547G>A	CCDS34588.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.441420	0.83993	.	.	ENSG00000136295	ENST00000258796;ENST00000407643;ENST00000403167	T;T;T	0.15834	2.82;2.84;2.39	4.53	4.53	0.55603	.	0.350162	0.26959	U	0.021634	T	0.11281	0.0275	N	0.11427	0.14	0.34497	D	0.705639	D;D	0.63046	0.992;0.987	P;P	0.51582	0.674;0.474	T	0.03795	-1.1003	10	0.02654	T	1	.	10.8742	0.46902	0.0874:0.0:0.9126:0.0	.	345;516	Q9C0H2-3;Q9C0H2	.;TTYH3_HUMAN	H	516;484;345	ENSP00000258796:R516H;ENSP00000385316:R484H;ENSP00000385015:R345H	ENSP00000258796:R516H	R	+	2	0	TTYH3	2667874	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.333000	0.79214	2.063000	0.61619	0.561000	0.74099	CGC		PASS	0.692	TTYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325082.2	XM_166523		3	13	3	13	---	---	---	---
SAMD9	54809	broad.mit.edu	37	7	92731019	92731019	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr7:92731019G>C	ENST00000379958.2	-	3	4661	c.4392C>G	c.(4390-4392)ttC>ttG	p.F1464L		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1464						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.F1464L(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			ATTGCCCCTTGAAAGAATTTT	0.343																																						uc003umf.2																			1	Substitution - Missense(1)		lung(1)	ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7						c.(4390-4392)TTC>TTG		sterile alpha motif domain containing 9							105.0	104.0	104.0					7																	92731019		2203	4300	6503	SO:0001583	missense	54809					cytoplasm		g.chr7:92731019G>C	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.4392C>G	7.37:g.92731019G>C	ENSP00000369292:p.Phe1464Leu					SAMD9_uc003umg.2_Missense_Mutation_p.F1464L	p.F1464L	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	STAD - Stomach adenocarcinoma(171;0.000302)		3	4648	-	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		1464					A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	37	c.4392C>G	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	G	16.93	3.258943	0.59321	.	.	ENSG00000205413	ENST00000379958	T	0.22945	1.93	4.35	1.09	0.20402	.	0.078048	0.51477	U	0.000097	T	0.37100	0.0991	L	0.54323	1.7	0.33806	D	0.627213	D	0.67145	0.996	P	0.62813	0.907	T	0.48692	-0.9013	10	0.66056	D	0.02	.	8.0366	0.30496	0.3051:0.0:0.6949:0.0	.	1464	Q5K651	SAMD9_HUMAN	L	1464	ENSP00000369292:F1464L	ENSP00000369292:F1464L	F	-	3	2	SAMD9	92568955	0.126000	0.22350	0.038000	0.18304	0.957000	0.61999	0.391000	0.20784	0.084000	0.17077	0.603000	0.83216	TTC		PASS	0.343	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654		35	200	35	200	---	---	---	---
LAMB1	3912	broad.mit.edu	37	7	107599767	107599767	+	Missense_Mutation	SNP	C	C	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr7:107599767C>A	ENST00000222399.6	-	20	2847	c.2617G>T	c.(2617-2619)Gcc>Tcc	p.A873S	LAMB1_ENST00000393561.1_Missense_Mutation_p.A897S	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	873	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.A873S(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CAGTCATCGGCGTGGCCATTG	0.557																																						uc003vew.2																			1	Substitution - Missense(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8						c.(2617-2619)GCC>TCC		laminin, beta 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						129.0	118.0	122.0					7																	107599767		2203	4300	6503	SO:0001583	missense	3912				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent	g.chr7:107599767C>A	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.2617G>T	7.37:g.107599767C>A	ENSP00000222399:p.Ala873Ser					LAMB1_uc003vev.2_Missense_Mutation_p.A897S	p.A873S	NM_002291	NP_002282	P07942	LAMB1_HUMAN			20	2952	-			873			Laminin EGF-like 8.		Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	c.2617G>T	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	C	16.92	3.254597	0.59212	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	T;T	0.61742	0.08;0.08	5.55	5.55	0.83447	EGF-like, laminin (3);	.	.	.	.	T	0.50973	0.1647	N	0.10685	0.025	0.80722	D	1	P;P	0.52061	0.95;0.695	P;B	0.51415	0.669;0.226	T	0.54899	-0.8224	9	0.39692	T	0.17	.	19.6941	0.96016	0.0:1.0:0.0:0.0	.	873;897	P07942;G3XAI2	LAMB1_HUMAN;.	S	897;873	ENSP00000377191:A897S;ENSP00000222399:A873S	ENSP00000222399:A873S	A	-	1	0	LAMB1	107387003	0.877000	0.30153	0.815000	0.32552	0.459000	0.32528	1.734000	0.38166	2.885000	0.99019	0.655000	0.94253	GCC		PASS	0.557	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		41	203	41	203	---	---	---	---
LAMB1	3912	broad.mit.edu	37	7	107615434	107615434	+	Silent	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr7:107615434G>A	ENST00000222399.6	-	12	1709	c.1479C>T	c.(1477-1479)tgC>tgT	p.C493C	LAMB1_ENST00000393560.1_Silent_p.C493C|LAMB1_ENST00000393561.1_Silent_p.C517C	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	493	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.C493C(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						TACTTACCAGGCACTGGTCAC	0.498																																						uc003vew.2																			1	Substitution - coding silent(1)		lung(1)	ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8						c.(1477-1479)TGC>TGT		laminin, beta 1 precursor	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)						117.0	103.0	108.0					7																	107615434		2203	4300	6503	SO:0001819	synonymous_variant	3912				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent	g.chr7:107615434G>A	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.1479C>T	7.37:g.107615434G>A						LAMB1_uc003vev.2_Silent_p.C517C|LAMB1_uc003vex.2_Silent_p.C493C|LAMB1_uc010ljn.1_Silent_p.C579C	p.C493C	NM_002291	NP_002282	P07942	LAMB1_HUMAN			12	1814	-			493			Laminin EGF-like 4.		Q14D91	Silent	SNP	ENST00000222399.6	37	c.1479C>T	CCDS5750.1																																																																																				PASS	0.498	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291		27	114	27	114	---	---	---	---
LMOD2	442721	broad.mit.edu	37	7	123302662	123302662	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr7:123302662G>C	ENST00000458573.2	+	2	1179	c.1022G>C	c.(1021-1023)aGa>aCa	p.R341T	LMOD2_ENST00000456238.2_Intron	NM_207163.1	NP_997046.1	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	341						cytoskeleton (GO:0005856)		p.R341T(1)									CCAGGACCAAGAATGAGCATG	0.483																																						uc003vky.2																			1	Substitution - Missense(1)		lung(1)		0						c.(1021-1023)AGA>ACA		leiomodin 2 (cardiac)							115.0	108.0	110.0					7																	123302662		2036	4198	6234	SO:0001583	missense	442721					cytoskeleton	actin binding|tropomyosin binding	g.chr7:123302662G>C	AC006333	CCDS47693.1	7q31.32	2008-08-08			ENSG00000170807	ENSG00000170807			6648	protein-coding gene	gene with protein product		608006					Standard	NM_207163		Approved		uc003vky.2	Q6P5Q4	OTTHUMG00000157149	ENST00000458573.2:c.1022G>C	7.37:g.123302662G>C	ENSP00000411932:p.Arg341Thr						p.R341T	NM_207163	NP_997046	Q6P5Q4	LMOD2_HUMAN			2	1179	+			341					A4D0W9|A4D0Y2|Q8WVJ8	Missense_Mutation	SNP	ENST00000458573.2	37	c.1022G>C	CCDS47693.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.361637	0.82353	.	.	ENSG00000170807	ENST00000458573;ENST00000444702;ENST00000332074	D	0.94931	-3.56	5.27	5.27	0.74061	.	.	.	.	.	D	0.97158	0.9071	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.97578	1.0109	9	0.87932	D	0	.	19.2535	0.93935	0.0:0.0:1.0:0.0	.	341	Q6P5Q4	LMOD2_HUMAN	T	341;301;312	ENSP00000411932:R341T	ENSP00000405123:R312T	R	+	2	0	LMOD2	123089898	1.000000	0.71417	0.541000	0.28102	0.841000	0.47740	9.768000	0.98965	2.624000	0.88883	0.491000	0.48974	AGA		PASS	0.483	LMOD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348525.1			5	183	5	183	---	---	---	---
PLXNA4	91584	broad.mit.edu	37	7	131853158	131853158	+	Missense_Mutation	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr7:131853158C>G	ENST00000359827.3	-	22	5153	c.4191G>C	c.(4189-4191)aaG>aaC	p.K1397N	PLXNA4_ENST00000321063.4_Missense_Mutation_p.K1397N			Q9HCM2	PLXA4_HUMAN	plexin A4	1397					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.K1397N(2)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CGTACTCCAGCTTGCTCTGCA	0.587																																						uc003vra.3																			2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(4189-4191)AAG>AAC		plexin A4 isoform 1							89.0	88.0	89.0					7																	131853158		2203	4300	6503	SO:0001583	missense	91584					integral to membrane|intracellular|plasma membrane		g.chr7:131853158C>G	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4191G>C	7.37:g.131853158C>G	ENSP00000352882:p.Lys1397Asn						p.K1397N	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN			22	4420	-			1397			Cytoplasmic (Potential).		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	c.4191G>C	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	19.61	3.859161	0.71834	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.14391	2.51;2.51	5.49	4.61	0.57282	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.20659	0.0497	L	0.52126	1.63	0.80722	D	1	P	0.49862	0.929	P	0.51297	0.665	T	0.00790	-1.1565	10	0.45353	T	0.12	.	10.5219	0.44924	0.0:0.8516:0.0:0.1484	.	1397	Q9HCM2	PLXA4_HUMAN	N	1397	ENSP00000323194:K1397N;ENSP00000352882:K1397N	ENSP00000323194:K1397N	K	-	3	2	PLXNA4	131503698	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	0.948000	0.29096	1.324000	0.45282	0.462000	0.41574	AAG		PASS	0.587	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775		13	43	13	43	---	---	---	---
MKRN1	23608	broad.mit.edu	37	7	140154376	140154376	+	Missense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr7:140154376C>T	ENST00000255977.2	-	8	1614	c.1390G>A	c.(1390-1392)Gaa>Aaa	p.E464K	MKRN1_ENST00000474576.1_Missense_Mutation_p.E400K|MKRN1_ENST00000437223.2_Missense_Mutation_p.E198K	NM_013446.3	NP_038474.2	Q9UHC7	MKRN1_HUMAN	makorin ring finger protein 1	464					protein polyubiquitination (GO:0000209)		chromatin binding (GO:0003682)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E464K(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	16	Melanoma(164;0.00956)					CACTCATCTTCAGAGTCTGTT	0.488																																						uc003vvt.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1390-1392)GAA>AAA		makorin ring finger protein 1 isoform 1							95.0	77.0	83.0					7																	140154376		2203	4300	6503	SO:0001583	missense	23608						ligase activity|nucleic acid binding|protein binding|zinc ion binding	g.chr7:140154376C>T	AF192784	CCDS5860.1, CCDS47725.1	7q34	2013-01-09	2008-08-13		ENSG00000133606	ENSG00000133606		"""RING-type (C3HC4) zinc fingers"""	7112	protein-coding gene	gene with protein product		607754				10843807	Standard	NM_013446		Approved	RNF61	uc003vvt.2	Q9UHC7	OTTHUMG00000157412	ENST00000255977.2:c.1390G>A	7.37:g.140154376C>T	ENSP00000255977:p.Glu464Lys					MKRN1_uc003vvs.2_Missense_Mutation_p.E400K|MKRN1_uc011krd.1_Missense_Mutation_p.E198K	p.E464K	NM_013446	NP_038474	Q9UHC7	MKRN1_HUMAN			8	1615	-	Melanoma(164;0.00956)		464					A4D1T7|B3KXB4|Q256Y7|Q59G11|Q6GSF1|Q9H0G0|Q9UEZ7|Q9UHW2	Missense_Mutation	SNP	ENST00000255977.2	37	c.1390G>A	CCDS5860.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.004617	0.93287	.	.	ENSG00000133606	ENST00000255977;ENST00000539898;ENST00000437223;ENST00000474576	T;T;T	0.36699	2.54;1.24;1.92	5.26	5.26	0.73747	.	0.066596	0.56097	D	0.000027	T	0.58104	0.2099	L	0.58101	1.795	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	T	0.59123	-0.7513	10	0.72032	D	0.01	.	19.0564	0.93067	0.0:1.0:0.0:0.0	.	464	Q9UHC7	MKRN1_HUMAN	K	464;400;198;400	ENSP00000255977:E464K;ENSP00000439823:E198K;ENSP00000417863:E400K	ENSP00000255977:E464K	E	-	1	0	MKRN1	139800845	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.266000	0.78452	2.735000	0.93741	0.650000	0.86243	GAA		PASS	0.488	MKRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348752.1	NM_013446		12	65	12	65	---	---	---	---
KMT2C	58508	broad.mit.edu	37	7	151960110	151960110	+	Missense_Mutation	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr7:151960110C>G	ENST00000262189.6	-	9	1508	c.1290G>C	c.(1288-1290)tgG>tgC	p.W430C	KMT2C_ENST00000355193.2_Missense_Mutation_p.W430C	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	430					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.W430C(2)									CTTTGCATTTCCAGCCATTGG	0.348																																						uc003wla.2										N							medulloblastoma		2	Substitution - Missense(2)		lung(2)	large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63						c.(1288-1290)TGG>TGC		myeloid/lymphoid or mixed-lineage leukemia 3							78.0	71.0	74.0					7																	151960110		2203	4299	6502	SO:0001583	missense	58508				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding	g.chr7:151960110C>G	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1290G>C	7.37:g.151960110C>G	ENSP00000262189:p.Trp430Cys						p.W430C	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)	9	1509	-	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	430			PHD-type 2.		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	c.1290G>C	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	15.31	2.794674	0.50102	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.94280	-3.39;-3.39	4.65	4.65	0.58169	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.42682	D	0.000662	D	0.98340	0.9449	H	0.99273	4.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99873	1.1099	10	0.87932	D	0	.	17.923	0.88973	0.0:1.0:0.0:0.0	.	430	Q8NEZ4	MLL3_HUMAN	C	430	ENSP00000262189:W430C;ENSP00000347325:W430C	ENSP00000262189:W430C	W	-	3	0	MLL3	151591043	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.670000	0.83925	2.300000	0.77407	0.557000	0.71058	TGG		PASS	0.348	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			37	159	37	159	---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	2796131	2796131	+	Silent	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr8:2796131C>T	ENST00000520002.1	-	71	11229	c.10674G>A	c.(10672-10674)ctG>ctA	p.L3558L	CSMD1_ENST00000537824.1_Silent_p.L3557L|CSMD1_ENST00000602723.1_Silent_p.L3381L|CSMD1_ENST00000400186.3_Silent_p.L3381L|CSMD1_ENST00000602557.1_Silent_p.L3558L|CSMD1_ENST00000542608.1_Silent_p.L3380L			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3558						integral component of membrane (GO:0016021)		p.L3286L(1)|p.L3557L(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AGACTGTGTTCAGAGTTGTGT	0.458																																						uc011kwk.1																			2	Substitution - coding silent(2)		lung(2)	breast(20)|large_intestine(5)	25						c.(10672-10674)CTG>CTA		CUB and Sushi multiple domains 1 precursor							203.0	190.0	194.0					8																	2796131		1978	4156	6134	SO:0001819	synonymous_variant	64478					integral to membrane		g.chr8:2796131C>T			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.10674G>A	8.37:g.2796131C>T						CSMD1_uc011kwj.1_Silent_p.L2872L|CSMD1_uc010lrg.2_Silent_p.L1449L	p.L3558L	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	70	11064	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	3558			Cytoplasmic (Potential).		Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37	c.10674G>A		.	.	.	.	.	.	.	.	.	.	C	8.926	0.962261	0.18583	.	.	ENSG00000183117	ENST00000335551	.	.	.	6.07	4.28	0.50868	.	.	.	.	.	T	0.59197	0.2176	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57100	-0.7869	4	.	.	.	.	8.702	0.34332	0.0:0.7284:0.0:0.2716	.	.	.	.	K	2960	.	.	E	-	1	0	CSMD1	2783538	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.087000	0.30865	1.584000	0.49913	-0.137000	0.14449	GAA		PASS	0.458	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		5	40	5	40	---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	2830790	2830790	+	Silent	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr8:2830790C>G	ENST00000520002.1	-	58	9330	c.8775G>C	c.(8773-8775)ggG>ggC	p.G2925G	CSMD1_ENST00000537824.1_Silent_p.G2924G|CSMD1_ENST00000602723.1_Silent_p.G2867G|CSMD1_ENST00000400186.3_Silent_p.G2867G|CSMD1_ENST00000602557.1_Silent_p.G2925G|CSMD1_ENST00000542608.1_Silent_p.G2866G			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2925	Sushi 22. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.G2924G(1)|p.G2653G(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GTGCTGGGGTCCCCGGATCAC	0.483																																						uc011kwk.1																			2	Substitution - coding silent(2)		lung(2)	breast(20)|large_intestine(5)	25						c.(8773-8775)GGG>GGC		CUB and Sushi multiple domains 1 precursor							162.0	162.0	162.0					8																	2830790		1872	4124	5996	SO:0001819	synonymous_variant	64478					integral to membrane		g.chr8:2830790C>G			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8775G>C	8.37:g.2830790C>G						CSMD1_uc011kwj.1_Silent_p.G2254G|CSMD1_uc010lrg.2_Silent_p.G935G	p.G2925G	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)	57	9165	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	2925			Extracellular (Potential).|Sushi 22.		Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37	c.8775G>C		.	.	.	.	.	.	.	.	.	.	C	0.129	-1.116448	0.01799	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.21	-3.3	0.05003	.	.	.	.	.	T	0.37785	0.1016	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33548	-0.9864	4	.	.	.	.	1.062	0.01603	0.2267:0.2468:0.1129:0.4137	.	.	.	.	H	2342	.	.	D	-	1	0	CSMD1	2818197	0.233000	0.23772	0.446000	0.26920	0.030000	0.12068	-0.591000	0.05753	-0.576000	0.05974	-0.797000	0.03246	GAC		PASS	0.483	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225		48	279	48	279	---	---	---	---
XKR5	389610	broad.mit.edu	37	8	6690416	6690416	+	RNA	SNP	T	T	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr8:6690416T>A	ENST00000518724.1	-	0	215				GS1-24F4.2_ENST00000500823.2_lincRNA			Q6UX68	XKR5_HUMAN	XK, Kell blood group complex subunit-related family, member 5							integral component of membrane (GO:0016021)		p.Y22F(1)		endometrium(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		AGCCACGGTGTAAAGGCCTGG	0.552																																						uc003wqp.2																			1	Substitution - Missense(1)		lung(1)		0						c.(64-66)TAC>TTC		XK-related protein 5a							33.0	42.0	39.0					8																	6690416		2036	4186	6222			389610					integral to membrane		g.chr8:6690416T>A	AY358489		8p23.1	2006-01-12	2006-01-12		ENSG00000186530	ENSG00000275591			20782	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 5"""				Standard	NM_207411		Approved		uc022aqv.1	Q6UX68	OTTHUMG00000153652		8.37:g.6690416T>A						XKR5_uc003wqq.2_5'UTR|XKR5_uc003wqr.1_RNA	p.Y22F	NM_207411	NP_997294	Q6UX68	XKR5_HUMAN	STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)	2	87	-			22					Q5GH74	Missense_Mutation	SNP	ENST00000518724.1	37	c.65A>T																																																																																					PASS	0.552	XKR5-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000331969.2	NM_207411		12	15	12	15	---	---	---	---
GPR124	25960	broad.mit.edu	37	8	37686463	37686463	+	Silent	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr8:37686463G>A	ENST00000412232.2	+	3	409	c.396G>A	c.(394-396)ggG>ggA	p.G132G	GPR124_ENST00000315215.7_Silent_p.G132G	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	132					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G125G(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TGGGCCTGGGGGAGCTGAAGC	0.667																																						uc003xkj.2																			1	Substitution - coding silent(1)		lung(1)	large_intestine(2)|ovary(2)|skin(1)	5						c.(394-396)GGG>GGA		G protein-coupled receptor 124 precursor							60.0	57.0	58.0					8																	37686463		2203	4300	6503	SO:0001819	synonymous_variant	25960				central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr8:37686463G>A	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.396G>A	8.37:g.37686463G>A						GPR124_uc003xki.2_Silent_p.G132G|GPR124_uc010lvy.2_Silent_p.G132G	p.G132G	NM_032777	NP_116166	Q96PE1	GP124_HUMAN	BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)		3	759	+			132			Extracellular (Potential).		A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Silent	SNP	ENST00000412232.2	37	c.396G>A	CCDS6097.2																																																																																				PASS	0.667	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2			6	66	6	66	---	---	---	---
STAR	6770	broad.mit.edu	37	8	38005810	38005810	+	Missense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr8:38005810C>T	ENST00000276449.4	-	3	660	c.214G>A	c.(214-216)Gag>Aag	p.E72K	RP11-90P5.2_ENST00000520598.1_RNA	NM_000349.2	NP_000340.2	P49675	STAR_HUMAN	steroidogenic acute regulatory protein	72	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				bile acid biosynthetic process (GO:0006699)|biphenyl metabolic process (GO:0018879)|brain development (GO:0007420)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth hormone stimulus (GO:0071378)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-alpha (GO:0035457)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to luteinizing hormone stimulus (GO:0071373)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cholesterol metabolic process (GO:0008203)|circadian sleep/wake cycle, REM sleep (GO:0042747)|dibenzo-p-dioxin metabolic process (GO:0018894)|diterpenoid metabolic process (GO:0016101)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|glucocorticoid metabolic process (GO:0008211)|insecticide metabolic process (GO:0017143)|intracellular cholesterol transport (GO:0032367)|male gonad development (GO:0008584)|negative regulation of neuron apoptotic process (GO:0043524)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|positive regulation of gene expression (GO:0010628)|positive regulation of neurogenesis (GO:0050769)|progesterone biosynthetic process (GO:0006701)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of steroid biosynthetic process (GO:0050810)|response to activity (GO:0014823)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to herbicide (GO:0009635)|response to hydrogen peroxide (GO:0042542)|response to ionizing radiation (GO:0010212)|response to lead ion (GO:0010288)|response to leptin (GO:0044321)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytosol (GO:0005829)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	cholesterol binding (GO:0015485)	p.E72K(1)		breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11	Colorectal(12;0.000442)	all_lung(54;0.0151)|Lung NSC(58;0.0295)		READ - Rectum adenocarcinoma(644;0.188)		TAGGCCAGCTCCTGGTCACTG	0.572																																						uc003xkv.1																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(214-216)GAG>AAG		steroidogenic acute regulatory protein isoform							69.0	55.0	60.0					8																	38005810		2203	4300	6503	SO:0001583	missense	6770				C21-steroid hormone biosynthetic process	mitochondrial intermembrane space	cholesterol transporter activity	g.chr8:38005810C>T	BC010550	CCDS6102.1	8p11.2	2011-09-13	2007-05-15		ENSG00000147465	ENSG00000147465		"""StAR-related lipid transfer (START) domain containing"""	11359	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 1"""	600617	"""steroidogenic acute regulator"""			7761400	Standard	NM_000349		Approved	StAR, STARD1	uc003xkv.1	P49675	OTTHUMG00000164058	ENST00000276449.4:c.214G>A	8.37:g.38005810C>T	ENSP00000276449:p.Glu72Lys					STAR_uc010lwc.1_Missense_Mutation_p.E34K	p.E72K	NM_001007243	NP_001007244	P49675	STAR_HUMAN		READ - Rectum adenocarcinoma(644;0.188)	3	478	-	Colorectal(12;0.000442)	all_lung(54;0.0151)|Lung NSC(58;0.0295)	72			START.		Q16396	Missense_Mutation	SNP	ENST00000276449.4	37	c.214G>A	CCDS6102.1	.	.	.	.	.	.	.	.	.	.	C	36	5.905477	0.97087	.	.	ENSG00000147465	ENST00000276449;ENST00000522753	D	0.87334	-2.24	5.43	5.43	0.79202	Lipid-binding START (1);START-like domain (1);	0.093639	0.64402	D	0.000001	D	0.91637	0.7357	M	0.88704	2.975	0.80722	D	1	P;P	0.38729	0.459;0.644	B;B	0.43251	0.225;0.413	D	0.92711	0.6183	10	0.87932	D	0	-39.3886	19.589	0.95499	0.0:1.0:0.0:0.0	.	34;72	E7ETA9;P49675	.;STAR_HUMAN	K	72;34	ENSP00000276449:E72K	ENSP00000276449:E72K	E	-	1	0	STAR	38124967	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.256000	0.78350	2.709000	0.92574	0.491000	0.48974	GAG		PASS	0.572	STAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376990.2	NM_000349		9	26	9	26	---	---	---	---
ZFHX4	79776	broad.mit.edu	37	8	77765105	77765105	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr8:77765105G>A	ENST00000521891.2	+	10	6396	c.5948G>A	c.(5947-5949)cGt>cAt	p.R1983H	ZFHX4_ENST00000455469.2_Missense_Mutation_p.R1938H|ZFHX4_ENST00000518282.1_Missense_Mutation_p.R1957H|ZFHX4_ENST00000050961.6_Missense_Mutation_p.R1938H	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1938	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.R1983H(2)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAATTTGCTCGTCAATACAGG	0.458										HNSCC(33;0.089)																												uc003yav.2																			2	Substitution - Missense(2)		lung(1)|pancreas(1)	ovary(8)|large_intestine(4)|breast(2)|lung(1)	15						c.(5812-5814)CGT>CAT		zinc finger homeodomain 4							53.0	53.0	53.0					8																	77765105		1889	4117	6006	SO:0001583	missense	79776					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr8:77765105G>A		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.5948G>A	8.37:g.77765105G>A	ENSP00000430497:p.Arg1983His	HNSCC(33;0.089)				ZFHX4_uc003yau.1_Missense_Mutation_p.R1983H|ZFHX4_uc003yaw.1_Missense_Mutation_p.R1938H	p.R1938H	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	BRCA - Breast invasive adenocarcinoma(89;0.0895)		10	6200	+			1938					G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	c.5813G>A	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	14.06	2.423068	0.43020	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.50813	0.73;0.78;0.74;0.74	4.2	4.2	0.49525	.	0.000000	0.44483	U	0.000460	T	0.49966	0.1588	M	0.62723	1.935	0.43271	D	0.995226	P;P;P	0.46020	0.796;0.871;0.871	B;B;B	0.42361	0.215;0.385;0.385	T	0.60747	-0.7202	10	0.66056	D	0.02	.	17.142	0.86756	0.0:0.0:1.0:0.0	.	1938;1938;1983	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	H	1983;1983;1938;1938;1957	ENSP00000430497:R1983H;ENSP00000399605:R1938H;ENSP00000050961:R1938H;ENSP00000430848:R1957H	ENSP00000050961:R1938H	R	+	2	0	ZFHX4	77927660	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	5.860000	0.69546	2.365000	0.80145	0.539000	0.68188	CGT		PASS	0.458	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721		21	41	21	41	---	---	---	---
RNF19A	25897	broad.mit.edu	37	8	101287334	101287334	+	Missense_Mutation	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr8:101287334C>G	ENST00000519449.1	-	4	1046	c.730G>C	c.(730-732)Gag>Cag	p.E244Q	RNF19A_ENST00000341084.2_Missense_Mutation_p.E244Q	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	244					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E244Q(1)		breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			CCACAGCCCTCTCGCCCACAA	0.433																																						uc003yjj.1																			1	Substitution - Missense(1)		lung(1)	ovary(2)|central_nervous_system(1)|skin(1)	4						c.(730-732)GAG>CAG		ring finger protein 19							98.0	93.0	95.0					8																	101287334		2203	4300	6503	SO:0001583	missense	25897				microtubule cytoskeleton organization|protein modification process	centrosome|integral to membrane	ligase activity|transcription factor binding|zinc ion binding	g.chr8:101287334C>G	AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.730G>C	8.37:g.101287334C>G	ENSP00000428968:p.Glu244Gln					RNF19A_uc003yjk.1_Missense_Mutation_p.E244Q	p.E244Q	NM_015435	NP_056250	Q9NV58	RN19A_HUMAN	Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)		4	1047	-	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		244			IBR-type.		A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Missense_Mutation	SNP	ENST00000519449.1	37	c.730G>C	CCDS6286.1	.	.	.	.	.	.	.	.	.	.	C	19.07	3.755068	0.69648	.	.	ENSG00000034677	ENST00000519449;ENST00000341084	T;T	0.62788	0.0;0.0	5.3	5.3	0.74995	Zinc finger, C6HC-type (2);	0.127702	0.64402	D	0.000013	T	0.60287	0.2257	L	0.52364	1.645	0.58432	D	0.999997	P	0.39717	0.684	B	0.40901	0.343	T	0.55579	-0.8119	10	0.20519	T	0.43	.	18.7569	0.91836	0.0:1.0:0.0:0.0	.	244	Q9NV58	RN19A_HUMAN	Q	244	ENSP00000428968:E244Q;ENSP00000342667:E244Q	ENSP00000342667:E244Q	E	-	1	0	RNF19A	101356510	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.651000	0.83577	2.765000	0.95021	0.650000	0.86243	GAG		PASS	0.433	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380004.1	NM_015435		22	141	22	141	---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113697923	113697923	+	Missense_Mutation	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr8:113697923C>G	ENST00000297405.5	-	15	2438	c.2194G>C	c.(2194-2196)Gtt>Ctt	p.V732L	CSMD3_ENST00000455883.2_Missense_Mutation_p.V628L|CSMD3_ENST00000352409.3_Missense_Mutation_p.V732L|CSMD3_ENST00000343508.3_Missense_Mutation_p.V692L	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	732	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V692L(1)|p.V732L(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GGAGAAAGAACTGTTCCCATT	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												uc003ynu.2																			2	Substitution - Missense(2)		lung(2)	ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						c.(2194-2196)GTT>CTT		CUB and Sushi multiple domains 3 isoform 1							76.0	84.0	81.0					8																	113697923		2203	4300	6503	SO:0001583	missense	114788					integral to membrane|plasma membrane		g.chr8:113697923C>G	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2194G>C	8.37:g.113697923C>G	ENSP00000297405:p.Val732Leu	HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)				CSMD3_uc003yns.2_Missense_Mutation_p.V4L|CSMD3_uc003ynt.2_Missense_Mutation_p.V692L|CSMD3_uc011lhx.1_Missense_Mutation_p.V628L	p.V732L	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN			15	2353	-			732			Extracellular (Potential).|CUB 4.		Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	c.2194G>C	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	17.63	3.436695	0.62955	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4	5.96	5.96	0.96718	CUB (5);	0.000000	0.64402	D	0.000004	T	0.59004	0.2162	N	0.16098	0.37	0.46458	D	0.999059	D;D;P	0.67145	0.971;0.996;0.918	D;D;P	0.85130	0.977;0.997;0.835	T	0.56938	-0.7896	10	0.28530	T	0.3	.	20.4008	0.98991	0.0:1.0:0.0:0.0	.	628;732;692	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	L	692;732;72;628;732	ENSP00000345799:V692L;ENSP00000297405:V732L;ENSP00000341558:V72L;ENSP00000412263:V628L;ENSP00000343124:V732L	ENSP00000297405:V732L	V	-	1	0	CSMD3	113767099	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.977000	0.63792	2.826000	0.97356	0.655000	0.94253	GTT		PASS	0.353	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900		68	147	68	147	---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8485848	8485848	+	Missense_Mutation	SNP	T	T	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr9:8485848T>A	ENST00000381196.4	-	25	3512	c.2969A>T	c.(2968-2970)tAc>tTc	p.Y990F	PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000360074.4_Missense_Mutation_p.Y977F|PTPRD_ENST00000358503.5_Missense_Mutation_p.Y968F|PTPRD_ENST00000486161.1_Intron|PTPRD_ENST00000397617.3_Intron|PTPRD_ENST00000540109.1_Missense_Mutation_p.Y990F|PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000471274.1_5'UTR|PTPRD_ENST00000356435.5_Missense_Mutation_p.Y990F|PTPRD_ENST00000397606.3_Intron	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	990	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.Y990F(1)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TTTTACATCGTATGTGGTATC	0.488										TSP Lung(15;0.13)																												uc003zkk.2																			1	Substitution - Missense(1)		lung(1)	lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22						c.(2968-2970)TAC>TTC		protein tyrosine phosphatase, receptor type, D							135.0	118.0	123.0					9																	8485848		2203	4300	6503	SO:0001583	missense	5789				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity	g.chr9:8485848T>A	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.2969A>T	9.37:g.8485848T>A	ENSP00000370593:p.Tyr990Phe	TSP Lung(15;0.13)				PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Missense_Mutation_p.Y981F|PTPRD_uc003zkm.2_Missense_Mutation_p.Y977F|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	p.Y990F	NM_002839	NP_002830	P23468	PTPRD_HUMAN		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	27	3680	-		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)	990			Fibronectin type-III 7.|Extracellular (Potential).		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	c.2969A>T	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.321316	0.81580	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000540109	D;D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41;-2.41	5.38	5.38	0.77491	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.96880	0.8981	H	0.98918	4.37	0.80722	D	1	D;D;B	0.89917	1.0;0.998;0.087	D;D;B	0.74348	0.983;0.949;0.334	D	0.98614	1.0664	9	.	.	.	.	15.6864	0.77415	0.0:0.0:0.0:1.0	.	977;990;990	G3XAE2;Q2HXI4;P23468	.;.;PTPRD_HUMAN	F	990;990;977;968;990	ENSP00000370593:Y990F;ENSP00000348812:Y990F;ENSP00000353187:Y977F;ENSP00000351293:Y968F;ENSP00000438164:Y990F	.	Y	-	2	0	PTPRD	8475848	1.000000	0.71417	0.986000	0.45419	0.997000	0.91878	7.997000	0.88414	2.175000	0.68902	0.533000	0.62120	TAC		PASS	0.488	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3			12	71	12	71	---	---	---	---
SPINK4	27290	broad.mit.edu	37	9	33246680	33246680	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr9:33246680G>C	ENST00000379721.3	+	3	214	c.169G>C	c.(169-171)Gat>Cat	p.D57H	SPINK4_ENST00000379725.1_Missense_Mutation_p.D80H|SPINK4_ENST00000379723.1_Missense_Mutation_p.D80H	NM_014471.1	NP_055286.1	O60575	ISK4_HUMAN	serine peptidase inhibitor, Kazal type 4	57	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				response to drug (GO:0042493)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.D57H(1)		lung(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)			CTGCGGCACTGATGGGCTCAC	0.572																																						uc003zsh.2																			1	Substitution - Missense(1)		lung(1)		0						c.(169-171)GAT>CAT		serine peptidase inhibitor, Kazal type 4							182.0	154.0	164.0					9																	33246680		2203	4300	6503	SO:0001583	missense	27290					extracellular region	serine-type endopeptidase inhibitor activity	g.chr9:33246680G>C	AF048700	CCDS6536.1	9p13.3	2011-08-31	2005-08-17		ENSG00000122711	ENSG00000122711		"""Serine peptidase inhibitors, Kazal type"""	16646	protein-coding gene	gene with protein product		613929	"""serine protease inhibitor, Kazal type 4"""			1400298, 17333166	Standard	NM_014471		Approved	PEC-60, MGC133107	uc003zsh.3	O60575	OTTHUMG00000019762	ENST00000379721.3:c.169G>C	9.37:g.33246680G>C	ENSP00000369045:p.Asp57His					SUGT1P1_uc010mjq.1_Intron	p.D57H	NM_014471	NP_055286	O60575	ISK4_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.00506)		3	180	+			57			Kazal-like.		Q2YDT7	Missense_Mutation	SNP	ENST00000379721.3	37	c.169G>C	CCDS6536.1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.606829	0.28623	.	.	ENSG00000122711	ENST00000379725;ENST00000379723;ENST00000379721	D;D;D	0.89196	-2.48;-2.48;-2.48	4.7	0.823	0.18812	Proteinase inhibitor I1, Kazal (3);	0.218004	0.35585	N	0.003114	D	0.91529	0.7325	.	.	.	0.21290	N	0.999734	D	0.71674	0.998	D	0.67382	0.951	T	0.83056	-0.0150	9	0.87932	D	0	-17.4273	6.1838	0.20486	0.4234:0.0:0.5766:0.0	.	57	O60575	ISK4_HUMAN	H	80;80;57	ENSP00000369048:D80H;ENSP00000369046:D80H;ENSP00000369045:D57H	ENSP00000369045:D57H	D	+	1	0	SPINK4	33236680	0.015000	0.18098	0.422000	0.26621	0.165000	0.22458	0.172000	0.16704	0.316000	0.23135	0.462000	0.41574	GAT		PASS	0.572	SPINK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052035.1	NM_014471		33	262	33	262	---	---	---	---
FRMPD1	22844	broad.mit.edu	37	9	37746211	37746211	+	Silent	SNP	G	G	A	rs201150264		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr9:37746211G>A	ENST00000539465.1	+	16	4775	c.4182G>A	c.(4180-4182)tcG>tcA	p.S1394S	RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Silent_p.S1394S			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1394						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.S1394S(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		CACCCCTGTCGAGGAAAAGCC	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		15973	0.001		0.0	False		,,,				2504	0.0					uc004aag.1																			1	Substitution - coding silent(1)		lung(1)	ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9						c.(4180-4182)TCG>TCA		FERM and PDZ domain containing 1							26.0	32.0	30.0					9																	37746211		2201	4296	6497	SO:0001819	synonymous_variant	22844					cytoskeleton|cytosol|plasma membrane		g.chr9:37746211G>A	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.4182G>A	9.37:g.37746211G>A						FRMPD1_uc004aah.1_Silent_p.S1394S	p.S1394S	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN		GBM - Glioblastoma multiforme(29;0.00655)	16	4226	+			1394					B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Silent	SNP	ENST00000539465.1	37	c.4182G>A	CCDS6612.1																																																																																				PASS	0.657	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907		6	70	6	70	---	---	---	---
SPATA31B1P	404770	broad.mit.edu	37	9	84675878	84675878	+	IGR	SNP	A	A	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr9:84675878A>T								SPATA31D1 (65707 upstream) : RP11-15B24.5 (211792 downstream)														p.*183R(1)									TGGAGTTATCAGAGTGGAGTC	0.562																																						uc010mpu.1																			1	Nonstop extension(1)		lung(1)								c.(547-549)TGA>AGA		hypothetical protein LOC404770							192.0	194.0	193.0					9																	84675878		2043	4177	6220	SO:0001628	intergenic_variant	0							g.chr9:84675878A>T																													9.37:g.84675878A>T							p.*183R	NM_001164339	NP_001157811					3	550	-									Nonstop_Mutation	SNP		37	c.547T>A		.	.	.	.	.	.	.	.	.	.	A	0.319	-0.963369	0.02249	.	.	ENSG00000204561	ENST00000376458	.	.	.	1.03	1.03	0.20045	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.4053	0.11406	1.0:0.0:0.0:0.0	.	.	.	.	R	183	.	.	X	-	1	0	FAM75B	83865698	0.032000	0.19561	0.003000	0.11579	0.111000	0.19643	0.029000	0.13666	0.757000	0.33036	0.102000	0.15555	TGA	0	PASS	0.562									69	284	69	284	---	---	---	---
OR2K2	26248	broad.mit.edu	37	9	114089856	114089856	+	Silent	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr9:114089856G>A	ENST00000374428.1	-	1	944	c.945C>T	c.(943-945)ccC>ccT	p.P315P	OR2K2_ENST00000302681.1_Silent_p.P286P			Q8NGT1	OR2K2_HUMAN	olfactory receptor, family 2, subfamily K, member 2	315						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P286P(1)|p.P315P(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)	20						TGTAAATTATGGGGTTCAACA	0.388																																						uc011lwp.1																			2	Substitution - coding silent(2)		lung(2)	ovary(1)	1						c.(856-858)CCC>CCT		olfactory receptor, family 2, subfamily K,							120.0	111.0	114.0					9																	114089856		2203	4300	6503	SO:0001819	synonymous_variant	26248				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr9:114089856G>A	X64977	CCDS6778.1	9q31.3	2012-08-09			ENSG00000171133	ENSG00000171133		"""GPCR / Class A : Olfactory receptors"""	8264	protein-coding gene	gene with protein product				OR2AR1P		1370859, 17010214	Standard	NM_205859		Approved	HTPCRH06, HSHTPCRH06	uc011lwp.2	Q8NGT1	OTTHUMG00000020488	ENST00000374428.1:c.945C>T	9.37:g.114089856G>A							p.P286P	NM_205859	NP_995581	Q8NGT1	OR2K2_HUMAN			1	858	-			315			Helical; Name=7; (Potential).		Q2TA61|Q5VYK4|Q6IFI5	Silent	SNP	ENST00000374428.1	37	c.858C>T																																																																																					PASS	0.388	OR2K2-201	KNOWN	basic	protein_coding	protein_coding		NM_205859		34	129	34	129	---	---	---	---
FAM208B	54906	broad.mit.edu	37	10	5772786	5772786	+	Missense_Mutation	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr10:5772786C>G	ENST00000328090.5	+	11	1449	c.824C>G	c.(823-825)tCt>tGt	p.S275C	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	275								p.S275C(1)									TTGGAAGTGTCTACTGCTTTG	0.423																																						uc001iij.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(823-825)TCT>TGT		hypothetical protein LOC54906							199.0	186.0	190.0					10																	5772786		1875	4107	5982	SO:0001583	missense	54906							g.chr10:5772786C>G	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.824C>G	10.37:g.5772786C>G	ENSP00000328426:p.Ser275Cys					C10orf18_uc001iik.2_5'UTR	p.S275C	NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN			11	1449	+			275					Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	37	c.824C>G	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.266717	0.59540	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.07114	3.22	5.98	5.06	0.68205	.	0.327566	0.26700	N	0.022953	T	0.10337	0.0253	M	0.72894	2.215	0.09310	N	1	P	0.39883	0.693	B	0.26614	0.071	T	0.16541	-1.0399	10	0.39692	T	0.17	.	15.0354	0.71741	0.0:0.8581:0.1419:0.0	.	275	Q5VWN6	F208B_HUMAN	C	275	ENSP00000328426:S275C	ENSP00000328426:S275C	S	+	2	0	C10orf18	5812792	0.032000	0.19561	0.053000	0.19242	0.986000	0.74619	1.652000	0.37313	1.504000	0.48704	0.591000	0.81541	TCT		PASS	0.423	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782		26	587	26	587	---	---	---	---
DHTKD1	55526	broad.mit.edu	37	10	12142178	12142178	+	Splice_Site	SNP	C	C	G	rs373710565		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr10:12142178C>G	ENST00000263035.4	+	9	1735	c.1673C>G	c.(1672-1674)tCc>tGc	p.S558C		NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	558					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.S558C(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			ATTTTACAGTCCAGAATGGAG	0.418																																						uc001ild.3																			1	Substitution - Missense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1672-1674)TCC>TGC		dehydrogenase E1 and transketolase domain		C	CYS/SER	1,4405	2.1+/-5.4	0,1,2202	120.0	131.0	127.0		1673	5.4	1.0	10		127	0,8600		0,0,4300	no	missense-near-splice	DHTKD1	NM_018706.5	112	0,1,6502	GG,GC,CC		0.0,0.0227,0.0077	possibly-damaging	558/920	12142178	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	55526				glycolysis	mitochondrion	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding	g.chr10:12142178C>G	BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.1672-1C>G	10.37:g.12142178C>G							p.S558C	NM_018706	NP_061176	Q96HY7	DHTK1_HUMAN	BRCA - Breast invasive adenocarcinoma(52;0.188)		9	1772	+		Renal(717;0.228)	558					Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	ENST00000263035.4	37	c.1673C>G	CCDS7087.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.789535	0.70337	2.27E-4	0.0	ENSG00000181192	ENST00000263035	D	0.91792	-2.91	5.39	5.39	0.77823	.	0.105878	0.64402	D	0.000003	D	0.94355	0.8185	M	0.72894	2.215	0.58432	D	0.999998	P	0.48764	0.915	P	0.51999	0.687	D	0.94845	0.8008	10	0.87932	D	0	-9.4496	19.1825	0.93629	0.0:1.0:0.0:0.0	.	558	Q96HY7	DHTK1_HUMAN	C	558	ENSP00000263035:S558C	ENSP00000263035:S558C	S	+	2	0	DHTKD1	12182184	1.000000	0.71417	1.000000	0.80357	0.454000	0.32378	5.234000	0.65343	2.531000	0.85337	0.484000	0.47621	TCC		PASS	0.418	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1	NM_018706	Missense_Mutation	44	319	44	319	---	---	---	---
PHYH	5264	broad.mit.edu	37	10	13330464	13330464	+	Missense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr10:13330464C>T	ENST00000263038.4	-	6	632	c.574G>A	c.(574-576)Gcc>Acc	p.A192T	PHYH_ENST00000396913.2_Missense_Mutation_p.A92T|PHYH_ENST00000396920.3_Missense_Mutation_p.A175T	NM_006214.3	NP_006205.1	O14832	PAHX_HUMAN	phytanoyl-CoA 2-hydroxylase	192			A -> AA (in RD). {ECO:0000269|PubMed:10767344}.		cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|isoprenoid metabolic process (GO:0006720)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|electron carrier activity (GO:0009055)|L-ascorbic acid binding (GO:0031418)|metal ion binding (GO:0046872)|phytanoyl-CoA dioxygenase activity (GO:0048244)	p.A192T(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	25		Ovarian(717;0.0448)			Antihemophilic Factor(DB00025)|Vitamin C(DB00126)	GCCGTCCAGGCGCAAACGATG	0.582																																						uc001imf.2																			1	Substitution - Missense(1)		lung(1)		0						c.(574-576)GCC>ACC		phytanoyl-CoA 2-hydroxylase isoform a precursor	Antihemophilic Factor(DB00025)|Vitamin C(DB00126)						78.0	75.0	76.0					10																	13330464		2203	4300	6503	SO:0001583	missense	5264				fatty acid alpha-oxidation|nervous system development	peroxisomal matrix	electron carrier activity|L-ascorbic acid binding|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|phytanoyl-CoA dioxygenase activity|protein binding	g.chr10:13330464C>T		CCDS7097.1, CCDS41489.1	10p13	2010-04-27	2006-01-09		ENSG00000107537	ENSG00000107537	1.14.11.18		8940	protein-coding gene	gene with protein product	"""Refsum disease"", ""phytanoyl-CoA dioxygenase"""	602026	"""phytanoyl-CoA hydroxylase (Refsum disease)"", ""phytanoyl-CoA hydroxylase"""			9326939	Standard	XM_005252469		Approved	PAHX, RD, PHYH1	uc001imf.3	O14832	OTTHUMG00000017693	ENST00000263038.4:c.574G>A	10.37:g.13330464C>T	ENSP00000263038:p.Ala192Thr					PHYH_uc001ime.2_Missense_Mutation_p.A92T|PHYH_uc001img.2_Missense_Mutation_p.A175T	p.A192T	NM_006214	NP_006205	O14832	PAHX_HUMAN			6	662	-		Ovarian(717;0.0448)	192		A -> AA (in RD).			A8MTS8|B1ALH5	Missense_Mutation	SNP	ENST00000263038.4	37	c.574G>A	CCDS7097.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.694378	0.48202	.	.	ENSG00000107537	ENST00000396913;ENST00000263038;ENST00000396920;ENST00000453759;ENST00000479604	D;D;D;D;D	0.90444	-2.67;-2.67;-2.67;-2.67;-2.67	5.8	4.89	0.63831	.	0.211534	0.49305	D	0.000159	D	0.93979	0.8072	M	0.89904	3.07	0.58432	D	0.999995	D;D	0.54397	0.966;0.966	P;P	0.49953	0.627;0.627	D	0.94410	0.7631	10	0.54805	T	0.06	-22.5423	15.0315	0.71710	0.3332:0.6668:0.0:0.0	.	175;192	B1ALH6;O14832	.;PAHX_HUMAN	T	92;192;175;92;194	ENSP00000380121:A92T;ENSP00000263038:A192T;ENSP00000380126:A175T;ENSP00000412525:A92T;ENSP00000420117:A194T	ENSP00000263038:A192T	A	-	1	0	PHYH	13370470	0.971000	0.33674	0.153000	0.22517	0.020000	0.10135	1.046000	0.30354	1.440000	0.47531	-0.182000	0.12963	GCC		PASS	0.582	PHYH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046845.2			31	125	31	125	---	---	---	---
WAC	51322	broad.mit.edu	37	10	28900789	28900789	+	Missense_Mutation	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr10:28900789C>G	ENST00000354911.4	+	10	1536	c.1375C>G	c.(1375-1377)Caa>Gaa	p.Q459E	WAC_ENST00000375646.1_Missense_Mutation_p.Q307E|WAC_ENST00000347934.4_Missense_Mutation_p.Q356E|WAC_ENST00000375664.4_Missense_Mutation_p.Q414E	NM_016628.4	NP_057712.2	Q9BTA9	WAC_HUMAN	WW domain containing adaptor with coiled-coil	459					cellular response to DNA damage stimulus (GO:0006974)|G1 DNA damage checkpoint (GO:0044783)|histone H2B conserved C-terminal lysine ubiquitination (GO:0071894)|histone monoubiquitination (GO:0010390)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	chromatin binding (GO:0003682)|RNA polymerase II core binding (GO:0000993)	p.Q459*(1)|p.Q459E(1)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|urinary_tract(1)	32						AAGCACACCTCAAACTAACAC	0.433																																						uc001iuf.2																			2	Substitution - Nonsense(1)|Substitution - Missense(1)		lung(2)	large_intestine(1)|ovary(1)	2						c.(1375-1377)CAA>GAA		WW domain-containing adapter with a coiled-coil							169.0	141.0	150.0					10																	28900789		2203	4300	6503	SO:0001583	missense	51322				cell cycle checkpoint|histone H2B conserved C-terminal lysine ubiquitination|histone monoubiquitination|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nuclear speck	chromatin binding|RNA polymerase II core binding	g.chr10:28900789C>G	AK055852	CCDS7159.1, CCDS7160.1, CCDS7161.1	10p12.1	2007-05-17	2003-03-19		ENSG00000095787	ENSG00000095787			17327	protein-coding gene	gene with protein product		615049	"""WW domain-containing adaptor with coiled coil"""			11827461	Standard	NR_024557		Approved	Wwp4, FLJ31290, PRO1741, BM-016, MGC10753	uc001iuf.3	Q9BTA9	OTTHUMG00000017872	ENST00000354911.4:c.1375C>G	10.37:g.28900789C>G	ENSP00000346986:p.Gln459Glu					WAC_uc001iud.2_Missense_Mutation_p.Q414E|WAC_uc001iue.2_Missense_Mutation_p.Q149E|WAC_uc001iug.2_Missense_Mutation_p.Q356E|WAC_uc001iuh.2_Missense_Mutation_p.Q411E	p.Q459E	NM_016628	NP_057712	Q9BTA9	WAC_HUMAN			10	1460	+			459					A8K2A9|C9JBT9|D3DRW5|D3DRW6|D3DRW7|Q53EN9|Q5JU75|Q5JU77|Q5VXK0|Q5VXK2|Q8TCK1|Q96DP3|Q96FW6|Q96JI3	Missense_Mutation	SNP	ENST00000354911.4	37	c.1375C>G	CCDS7159.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.036812	0.93630	.	.	ENSG00000095787	ENST00000375664;ENST00000375646;ENST00000347934;ENST00000354911;ENST00000338396	T;T;T;T	0.28895	1.75;1.84;1.59;1.74	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.47875	0.1469	L	0.32530	0.975	0.80722	D	1	P;D;P	0.58268	0.954;0.982;0.924	D;D;P	0.70227	0.954;0.968;0.9	T	0.43196	-0.9406	10	0.87932	D	0	-9.8677	20.0769	0.97748	0.0:1.0:0.0:0.0	.	414;356;459	Q9BTA9-2;Q9BTA9-5;Q9BTA9	.;.;WAC_HUMAN	E	414;307;356;459;22	ENSP00000364816:Q414E;ENSP00000364797:Q307E;ENSP00000311106:Q356E;ENSP00000346986:Q459E	ENSP00000341462:Q22E	Q	+	1	0	WAC	28940795	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	7.776000	0.85560	2.820000	0.97059	0.650000	0.86243	CAA		PASS	0.433	WAC-017	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000047371.1	NM_100264		20	282	20	282	---	---	---	---
RGR	5995	broad.mit.edu	37	10	86017684	86017684	+	Silent	SNP	C	C	A	rs575867273		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr10:86017684C>A	ENST00000359452.4	+	6	716	c.678C>A	c.(676-678)ctC>ctA	p.L226L	RGR_ENST00000358110.5_Intron|RGR_ENST00000479725.1_3'UTR	NM_001012720.1|NM_002921.3	NP_001012738.1|NP_002912.2	P47804	RGR_HUMAN	retinal G protein coupled receptor	222					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.L226L(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	17						CGCTGCTGCTCGGCTGGGGCC	0.547																																					NSCLC(15;204 545 5889 6385 32445)	uc001kdc.1																			1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(664-666)CTC>CTA		retinal G-protein coupled receptor isoform 2							82.0	75.0	77.0					10																	86017684		2203	4300	6503	SO:0001819	synonymous_variant	5995				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity|protein binding	g.chr10:86017684C>A	BC011349	CCDS7374.1, CCDS41543.1	10q23	2013-02-14			ENSG00000148604	ENSG00000148604		"""GPCR / Class A : Opsin receptors"""	9990	protein-coding gene	gene with protein product	"""RGR-opsin"""	600342				8641686	Standard	NM_002921		Approved	RP44	uc001kdd.1	P47804	OTTHUMG00000018636	ENST00000359452.4:c.678C>A	10.37:g.86017684C>A						RGR_uc001kdd.1_Silent_p.L226L|RGR_uc001kde.1_Intron	p.L222L	NM_001012720	NP_001012738	P47804	RGR_HUMAN			6	704	+			222			Helical; Name=6; (Potential).		A6NKK7|Q96FC5	Silent	SNP	ENST00000359452.4	37	c.666C>A	CCDS7374.1																																																																																				PASS	0.547	RGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049116.1	NM_002921		30	80	30	80	---	---	---	---
CFAP43	80217	broad.mit.edu	37	10	105906076	105906076	+	Missense_Mutation	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr10:105906076C>G	ENST00000357060.3	-	30	3915	c.3800G>C	c.(3799-3801)aGa>aCa	p.R1267T	WDR96_ENST00000428666.1_Intron	NM_025145.5	NP_079421.5												p.R1267T(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CAGGTCTTCTCTAGATTTCCG	0.413																																						uc001kxw.2																			1	Substitution - Missense(1)		lung(1)		0						c.(3799-3801)AGA>ACA		hypothetical protein LOC80217							139.0	125.0	130.0					10																	105906076		2203	4300	6503	SO:0001583	missense	80217							g.chr10:105906076C>G																												ENST00000357060.3:c.3800G>C	10.37:g.105906076C>G	ENSP00000349568:p.Arg1267Thr					C10orf79_uc009xxq.2_Intron	p.R1267T	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)	30	3916	-		Colorectal(252;0.178)	1267						Missense_Mutation	SNP	ENST00000357060.3	37	c.3800G>C	CCDS31281.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.020|7.020	0.558593|0.558593	0.13436|0.13436	.|.	.|.	ENSG00000197748|ENSG00000197748	ENST00000457071|ENST00000357060	.|T	.|0.13901	.|2.55	6.07|6.07	-1.47|-1.47	0.08772|0.08772	.|.	.|0.466125	.|0.21837	.|N	.|0.068397	T|T	0.15132|0.15132	0.0365|0.0365	M|M	0.63428|0.63428	1.95|1.95	0.09310|0.09310	N|N	0.999991|0.999991	.|P	.|0.43094	.|0.799	.|B	.|0.41764	.|0.366	T|T	0.12915|0.12915	-1.0529|-1.0529	5|10	.|0.44086	.|T	.|0.13	.|.	12.0837|12.0837	0.53686|0.53686	0.0:0.2778:0.0:0.7222|0.0:0.2778:0.0:0.7222	.|.	.|1267	.|Q8NDM7	.|WDR96_HUMAN	Q|T	116|1267	.|ENSP00000349568:R1267T	.|ENSP00000349568:R1267T	E|R	-|-	1|2	0|0	WDR96|WDR96	105896066|105896066	0.000000|0.000000	0.05858|0.05858	0.043000|0.043000	0.18650|0.18650	0.021000|0.021000	0.10359|0.10359	-0.915000|-0.915000	0.04033|0.04033	-0.306000|-0.306000	0.08818|0.08818	-0.140000|-0.140000	0.14226|0.14226	GAG|AGA		PASS	0.413	WDR96-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				10	184	10	184	---	---	---	---
TPH1	7166	broad.mit.edu	37	11	18062260	18062260	+	Missense_Mutation	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr11:18062260C>G	ENST00000250018.2	-	1	612	c.50G>C	c.(49-51)aGa>aCa	p.R17T	TPH1_ENST00000341556.2_Missense_Mutation_p.R17T	NM_004179.2	NP_004170.1	P17752	TPH1_HUMAN	tryptophan hydroxylase 1	17					aromatic amino acid family metabolic process (GO:0009072)|bone remodeling (GO:0046849)|cellular nitrogen compound metabolic process (GO:0034641)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|mammary gland alveolus development (GO:0060749)|negative regulation of ossification (GO:0030279)|response to immobilization stress (GO:0035902)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)	p.R17T(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(14)|prostate(1)|stomach(1)	25					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	GAGACTTGCTCTTCCCCTTTC	0.333																																						uc001mnp.2																			1	Substitution - Missense(1)		lung(1)		0						c.(49-51)AGA>ACA		tryptophan hydroxylase 1	L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)						63.0	58.0	60.0					11																	18062260		2200	4290	6490	SO:0001583	missense	7166				aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity	g.chr11:18062260C>G	X52836	CCDS7829.1	11p15.3-p14	2012-10-02	2008-07-31	2003-04-04	ENSG00000129167	ENSG00000129167	1.14.16.4		12008	protein-coding gene	gene with protein product	"""tryptophan 5-monooxygenase"""	191060	"""tryptophan hydroxylase (tryptophan 5-monooxygenase)"""	TPRH, TPH		1463016	Standard	NM_004179		Approved		uc001mnp.2	P17752	OTTHUMG00000166421	ENST00000250018.2:c.50G>C	11.37:g.18062260C>G	ENSP00000250018:p.Arg17Thr					TPH1_uc009yhe.2_RNA	p.R17T	NM_004179	NP_004170	P17752	TPH1_HUMAN			1	76	-			17					D3DQX6|O95188|O95189|Q16736|Q3KPG8	Missense_Mutation	SNP	ENST00000250018.2	37	c.50G>C	CCDS7829.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.828572	0.50845	.	.	ENSG00000129167	ENST00000250018;ENST00000341556;ENST00000528338	D;D;D	0.98381	-4.9;-4.9;-4.9	5.28	4.37	0.52481	.	0.090748	0.64402	D	0.000001	D	0.95245	0.8458	L	0.31578	0.945	0.50313	D	0.999863	B	0.29955	0.263	B	0.32677	0.15	D	0.93198	0.6589	10	0.41790	T	0.15	-12.1445	10.111	0.42563	0.0:0.8464:0.0:0.1536	.	17	P17752	TPH1_HUMAN	T	17;17;27	ENSP00000250018:R17T;ENSP00000343550:R17T;ENSP00000436081:R27T	ENSP00000250018:R17T	R	-	2	0	TPH1	18018836	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.297000	0.51810	1.237000	0.43756	0.491000	0.48974	AGA		PASS	0.333	TPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389696.1	NM_004179		22	70	22	70	---	---	---	---
NELL1	4745	broad.mit.edu	37	11	20869208	20869208	+	Missense_Mutation	SNP	G	G	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr11:20869208G>T	ENST00000357134.5	+	4	567	c.415G>T	c.(415-417)Gca>Tca	p.A139S	NELL1_ENST00000532434.1_Missense_Mutation_p.A139S|NELL1_ENST00000298925.5_Missense_Mutation_p.A167S|NELL1_ENST00000325319.5_Intron	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	139	Laminin G-like.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)	p.A139S(1)		NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						AAGGACAGAGGCACTTCCTTA	0.478																																						uc001mqe.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)|large_intestine(1)	3						c.(415-417)GCA>TCA		nel-like 1 isoform 1 precursor							257.0	176.0	204.0					11																	20869208		2203	4300	6503	SO:0001583	missense	4745				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity	g.chr11:20869208G>T	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.415G>T	11.37:g.20869208G>T	ENSP00000349654:p.Ala139Ser					NELL1_uc001mqf.2_Missense_Mutation_p.A139S|NELL1_uc009yid.2_Missense_Mutation_p.A167S|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron	p.A139S	NM_006157	NP_006148	Q92832	NELL1_HUMAN			4	568	+			139			TSP N-terminal.		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	c.415G>T	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	G	19.07	3.754943	0.69648	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000532434	T;T;T	0.01998	4.51;4.51;4.51	5.62	5.62	0.85841	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);Laminin G, subdomain 2 (1);	0.187586	0.46442	D	0.000300	T	0.02848	0.0085	N	0.20986	0.625	0.80722	D	1	B;B;B	0.18461	0.028;0.02;0.016	B;B;B	0.24848	0.056;0.034;0.023	T	0.61451	-0.7060	10	0.21540	T	0.41	-9.0348	20.0377	0.97569	0.0:0.0:1.0:0.0	.	167;139;139	B3KXR2;Q92832-2;Q92832	.;.;NELL1_HUMAN	S	167;139;139	ENSP00000298925:A167S;ENSP00000349654:A139S;ENSP00000437170:A139S	ENSP00000298925:A167S	A	+	1	0	NELL1	20825784	1.000000	0.71417	0.973000	0.42090	0.798000	0.45092	4.123000	0.57917	2.822000	0.97130	0.650000	0.86243	GCA		PASS	0.478	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157		10	51	10	51	---	---	---	---
ZNF408	79797	broad.mit.edu	37	11	46726988	46726988	+	Missense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr11:46726988C>T	ENST00000311764.2	+	5	1968	c.1738C>T	c.(1738-1740)Ccc>Tcc	p.P580S		NM_001184751.1|NM_024741.2	NP_001171680.1|NP_079017.1	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	580					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.P580S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GAGGCCCTTTCCCTGTCCCCA	0.672																																					Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)	uc001nde.1																			1	Substitution - Missense(1)		lung(1)		0						c.(1738-1740)CCC>TCC		zinc finger protein 408							23.0	24.0	24.0					11																	46726988		2201	4296	6497	SO:0001583	missense	79797				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|identical protein binding|zinc ion binding	g.chr11:46726988C>T	AF346626	CCDS7923.1	11p11.2	2008-02-05			ENSG00000175213	ENSG00000175213		"""Zinc fingers, C2H2-type"""	20041	protein-coding gene	gene with protein product						15231747	Standard	NM_024741		Approved	FLJ12827	uc010rgw.2	Q9H9D4	OTTHUMG00000166568	ENST00000311764.2:c.1738C>T	11.37:g.46726988C>T	ENSP00000309606:p.Pro580Ser					ZNF408_uc010rgw.1_Missense_Mutation_p.P572S	p.P580S	NM_024741	NP_079017	Q9H9D4	ZN408_HUMAN			5	1968	+			580			C2H2-type 9.			Missense_Mutation	SNP	ENST00000311764.2	37	c.1738C>T	CCDS7923.1	.	.	.	.	.	.	.	.	.	.	C	10.41	1.341657	0.24339	.	.	ENSG00000175213	ENST00000311764	T	0.19105	2.17	5.23	3.22	0.36961	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.367432	0.19898	N	0.103570	T	0.07413	0.0187	N	0.02708	-0.52	0.19775	N	0.999957	P;P	0.43231	0.801;0.801	B;B	0.37780	0.258;0.258	T	0.22243	-1.0222	10	0.15952	T	0.53	-5.6456	9.2848	0.37751	0.2746:0.5764:0.149:0.0	.	572;580	B4DXY4;Q9H9D4	.;ZN408_HUMAN	S	580	ENSP00000309606:P580S	ENSP00000309606:P580S	P	+	1	0	ZNF408	46683564	0.009000	0.17119	0.796000	0.32109	0.741000	0.42261	0.566000	0.23593	1.181000	0.42912	0.462000	0.41574	CCC		PASS	0.672	ZNF408-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390485.2	NM_024741		11	54	11	54	---	---	---	---
CKAP5	9793	broad.mit.edu	37	11	46832582	46832582	+	Missense_Mutation	SNP	G	G	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr11:46832582G>T	ENST00000529230.1	-	5	651	c.605C>A	c.(604-606)cCa>cAa	p.P202Q	CKAP5_ENST00000354558.3_Missense_Mutation_p.P202Q|CKAP5_ENST00000312055.5_Missense_Mutation_p.P202Q|CKAP5_ENST00000415402.1_Missense_Mutation_p.P202Q			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	202					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)		p.P202Q(1)		breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						ATTTTGTAATGGGGGTCTCAG	0.388																																					Ovarian(4;85 273 2202 4844 13323)	uc001ndi.1																			1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(604-606)CCA>CAA		colonic and hepatic tumor over-expressed protein							74.0	76.0	75.0					11																	46832582		2201	4299	6500	SO:0001583	missense	9793				cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding	g.chr11:46832582G>T		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.605C>A	11.37:g.46832582G>T	ENSP00000432768:p.Pro202Gln					CKAP5_uc009ylg.1_Missense_Mutation_p.P88Q|CKAP5_uc001ndj.1_Missense_Mutation_p.P202Q	p.P202Q	NM_001008938	NP_001008938	Q14008	CKAP5_HUMAN			5	715	-			202					Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	37	c.605C>A	CCDS31477.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.668846	0.47677	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000378629;ENST00000354558	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	5.85	5.85	0.93711	Armadillo-like helical (1);Armadillo-type fold (1);	0.152011	0.64402	D	0.000011	T	0.43919	0.1269	N	0.05050	-0.12	0.54753	D	0.999989	D;D;B	0.67145	0.996;0.996;0.021	D;P;B	0.65010	0.931;0.885;0.01	T	0.48269	-0.9050	10	0.29301	T	0.29	-9.4783	20.1601	0.98131	0.0:0.0:1.0:0.0	.	202;202;202	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	Q	202	ENSP00000432768:P202Q;ENSP00000395302:P202Q;ENSP00000310227:P202Q;ENSP00000346566:P202Q	ENSP00000310227:P202Q	P	-	2	0	CKAP5	46789158	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	9.735000	0.98825	2.765000	0.95021	0.563000	0.77884	CCA		PASS	0.388	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756		33	149	33	149	---	---	---	---
OR5AR1	219493	broad.mit.edu	37	11	56431560	56431560	+	Missense_Mutation	SNP	C	C	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr11:56431560C>A	ENST00000302969.2	+	1	423	c.399C>A	c.(397-399)agC>agA	p.S133R		NM_001004730.1	NP_001004730.1	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR, member 1 (gene/pseudogene)	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S133R(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(12)|prostate(1)|skin(3)|stomach(1)	26						TCCACTATAGCACCTTCATGT	0.512																																						uc010rjm.1																			1	Substitution - Missense(1)		lung(1)		0						c.(397-399)AGC>AGA		olfactory receptor, family 5, subfamily AR,							197.0	181.0	187.0					11																	56431560		2201	4296	6497	SO:0001583	missense	219493				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:56431560C>A	AB065740	CCDS31535.1	11q11	2013-10-10	2013-10-10		ENSG00000172459	ENSG00000172459		"""GPCR / Class A : Olfactory receptors"""	15260	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AR, member 1"""				Standard	NM_001004730		Approved		uc010rjm.2	Q8NGP9	OTTHUMG00000154213	ENST00000302969.2:c.399C>A	11.37:g.56431560C>A	ENSP00000302639:p.Ser133Arg						p.S133R	NM_001004730	NP_001004730	Q8NGP9	O5AR1_HUMAN			1	399	+			133			Cytoplasmic (Potential).		Q6IF61	Missense_Mutation	SNP	ENST00000302969.2	37	c.399C>A	CCDS31535.1	.	.	.	.	.	.	.	.	.	.	C	8.681	0.905131	0.17760	.	.	ENSG00000172459	ENST00000302969	T	0.01034	5.42	4.94	2.02	0.26589	GPCR, rhodopsin-like superfamily (1);	0.344773	0.25154	N	0.032732	T	0.01421	0.0046	M	0.79343	2.45	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46555	-0.9183	10	0.66056	D	0.02	.	2.2715	0.04092	0.1363:0.5008:0.1323:0.2307	.	133	Q8NGP9	O5AR1_HUMAN	R	133	ENSP00000302639:S133R	ENSP00000302639:S133R	S	+	3	2	OR5AR1	56188136	0.000000	0.05858	0.418000	0.26571	0.523000	0.34469	-1.260000	0.02858	0.267000	0.21916	0.573000	0.79308	AGC		PASS	0.512	OR5AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334434.1	NM_001004730		59	338	59	338	---	---	---	---
ZDHHC5	25921	broad.mit.edu	37	11	57464264	57464264	+	Silent	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr11:57464264G>A	ENST00000287169.3	+	10	2403	c.1041G>A	c.(1039-1041)ccG>ccA	p.P347P	ZDHHC5_ENST00000527985.1_Silent_p.P294P	NM_015457.2	NP_056272.2	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC-type containing 5	347					protein palmitoylation (GO:0018345)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.P347P(1)		endometrium(6)|kidney(3)|large_intestine(3)|lung(5)|skin(1)	18						ACAGCCCCCCGACACCTACCA	0.512																																						uc001nkx.1																			1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(1039-1041)CCG>CCA		zinc finger, DHHC domain containing 5							96.0	87.0	90.0					11																	57464264		2201	4296	6497	SO:0001819	synonymous_variant	25921					integral to membrane	acyltransferase activity|zinc ion binding	g.chr11:57464264G>A	AB051535	CCDS7965.1	11q13.1	2008-05-02			ENSG00000156599	ENSG00000156599		"""Zinc fingers, DHHC-type"""	18472	protein-coding gene	gene with protein product		614586				11214970	Standard	NM_015457		Approved	KIAA1748, ZNF375	uc001nkx.1	Q9C0B5	OTTHUMG00000167198	ENST00000287169.3:c.1041G>A	11.37:g.57464264G>A						ZDHHC5_uc001nky.1_Silent_p.P294P|ZDHHC5_uc001nkz.1_Silent_p.P161P	p.P347P	NM_015457	NP_056272	Q9C0B5	ZDHC5_HUMAN			10	2297	+			347					Q2TGF0|Q6ZMF0|Q8TAK8|Q9H923|Q9UFI7	Silent	SNP	ENST00000287169.3	37	c.1041G>A	CCDS7965.1																																																																																				PASS	0.512	ZDHHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393694.1	NM_015457		15	69	15	69	---	---	---	---
OR5B12	390191	broad.mit.edu	37	11	58206915	58206915	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr11:58206915G>C	ENST00000302572.2	-	1	731	c.710C>G	c.(709-711)tCt>tGt	p.S237C		NM_001004733.2	NP_001004733.1	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B, member 12	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S237C(1)		large_intestine(6)|liver(1)|lung(28)|ovary(1)|prostate(3)|skin(1)	40	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				AGCACAAGTAGAAAAGGCCTT	0.418																																						uc010rkh.1																			1	Substitution - Missense(1)		lung(1)		0						c.(709-711)TCT>TGT		olfactory receptor, family 5, subfamily B,							78.0	75.0	76.0					11																	58206915		2201	4295	6496	SO:0001583	missense	390191				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	g.chr11:58206915G>C	AB065851	CCDS31551.1	11q12.1	2012-08-09		2004-03-10	ENSG00000172362	ENSG00000172362		"""GPCR / Class A : Olfactory receptors"""	15432	protein-coding gene	gene with protein product				OR5B12P, OR5B16		12213199	Standard	NM_001004733		Approved	OST743	uc010rkh.2	Q96R08	OTTHUMG00000167543	ENST00000302572.2:c.710C>G	11.37:g.58206915G>C	ENSP00000306657:p.Ser237Cys						p.S237C	NM_001004733	NP_001004733	Q96R08	OR5BC_HUMAN			1	710	-	Esophageal squamous(5;0.0027)	Breast(21;0.0778)	237			Helical; Name=6; (Potential).		B2RNL2|Q6IEV5	Missense_Mutation	SNP	ENST00000302572.2	37	c.710C>G	CCDS31551.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.691177	0.48097	.	.	ENSG00000172362	ENST00000302572	T	0.00314	8.14	4.3	4.3	0.51218	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000203	T	0.01189	0.0039	H	0.97103	3.94	0.31995	N	0.604102	D	0.89917	1.0	D	0.80764	0.994	T	0.02505	-1.1149	10	0.87932	D	0	-14.9003	16.2624	0.82553	0.0:0.0:1.0:0.0	.	237	Q96R08	OR5BC_HUMAN	C	237	ENSP00000306657:S237C	ENSP00000306657:S237C	S	-	2	0	OR5B12	57963491	0.763000	0.28462	1.000000	0.80357	0.501000	0.33797	2.412000	0.44609	2.383000	0.81215	0.462000	0.41574	TCT		PASS	0.418	OR5B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394987.1	NM_001004733		5	120	5	120	---	---	---	---
SLC22A10	387775	broad.mit.edu	37	11	63058004	63058004	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr11:63058004G>A	ENST00000332793.6	+	1	369	c.367G>A	c.(367-369)Gat>Aat	p.D123N	SLC22A10_ENST00000544661.1_5'UTR|SLC22A10_ENST00000526800.1_Missense_Mutation_p.D71N|SLC22A10_ENST00000525620.1_Intron|SLC22A10_ENST00000535888.1_Intron	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	123						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)	p.D123N(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	CTGGGTATATGATCAAAGCTA	0.468																																						uc009yor.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(367-369)GAT>AAT		solute carrier family 22, member 10							97.0	104.0	102.0					11																	63058004		2201	4298	6499	SO:0001583	missense	387775					integral to membrane	transmembrane transporter activity	g.chr11:63058004G>A	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.367G>A	11.37:g.63058004G>A	ENSP00000327569:p.Asp123Asn					SLC22A10_uc010rmo.1_Intron|SLC22A10_uc001nwu.3_RNA|SLC22A10_uc010rmp.1_Missense_Mutation_p.D71N	p.D123N	NM_001039752	NP_001034841	Q63ZE4	S22AA_HUMAN			1	575	+			123			Extracellular (Potential).		Q68CJ0	Missense_Mutation	SNP	ENST00000332793.6	37	c.367G>A	CCDS41661.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980963	0.53827	.	.	ENSG00000184999	ENST00000332793;ENST00000526800	T;T	0.76968	-1.06;-1.06	2.68	2.68	0.31781	Major facilitator superfamily domain (1);	0.187322	0.44688	U	0.000433	D	0.86331	0.5907	M	0.82132	2.575	0.80722	D	1	P;D	0.89917	0.828;1.0	B;D	0.97110	0.422;1.0	D	0.86473	0.1786	10	0.48119	T	0.1	.	11.2649	0.49104	0.0:0.0:1.0:0.0	.	71;123	E9PJB1;Q63ZE4	.;S22AA_HUMAN	N	123;71	ENSP00000327569:D123N;ENSP00000433908:D71N	ENSP00000327569:D123N	D	+	1	0	SLC22A10	62814580	1.000000	0.71417	0.890000	0.34922	0.443000	0.32047	3.090000	0.50191	1.546000	0.49388	0.579000	0.79373	GAT		PASS	0.468	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382622.3	NM_001039752		5	130	5	130	---	---	---	---
FAM86C1	55199	broad.mit.edu	37	11	71500881	71500881	+	Missense_Mutation	SNP	T	T	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr11:71500881T>C	ENST00000359244.4	+	2	172	c.149T>C	c.(148-150)aTt>aCt	p.I50T	FAM86C1_ENST00000426628.2_Missense_Mutation_p.I50T|FAM86C1_ENST00000346333.6_Missense_Mutation_p.I50T	NM_018172.2	NP_060642.2	Q9NVL1	FA86C_HUMAN	family with sequence similarity 86, member C1	50								p.I50T(2)		lung(1)	1						CTGCGGGATATTTTGCAGAAG	0.493																																						uc001oqv.3																			2	Substitution - Missense(2)		lung(2)		0						c.(148-150)ATT>ACT		hypothetical protein LOC55199 isoform 1							45.0	57.0	53.0					11																	71500881		1491	2660	4151	SO:0001583	missense	55199							g.chr11:71500881T>C	AK130709	CCDS8202.1, CCDS41686.1, CCDS44664.1	11q13.4	2011-07-07	2011-07-07	2011-07-07	ENSG00000158483	ENSG00000158483			25561	protein-coding gene	gene with protein product			"""family with sequence similarity 86, member C"""	FAM86C		12477932	Standard	NM_152563		Approved	FLJ10661, FLJ27199	uc001oqv.4	Q9NVL1	OTTHUMG00000160552	ENST00000359244.4:c.149T>C	11.37:g.71500881T>C	ENSP00000352182:p.Ile50Thr					FAM86C_uc009ysr.2_Missense_Mutation_p.I50T|FAM86C_uc001oqw.3_Missense_Mutation_p.I50T|FAM86C_uc009yss.2_RNA|FAM86C_uc010rqq.1_RNA	p.I50T	NM_018172	NP_060642	Q9NVL1	FA86C_HUMAN			2	175	+			50					Q8N5D3	Missense_Mutation	SNP	ENST00000359244.4	37	c.149T>C	CCDS41686.1	.	.	.	.	.	.	.	.	.	.	.	13.32	2.202986	0.38905	.	.	ENSG00000158483	ENST00000346333;ENST00000359244;ENST00000426628;ENST00000528685	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	2.05	2.05	0.26809	.	.	.	.	.	T	0.45736	0.1357	M	0.79926	2.475	0.42758	D	0.993799	D;P;D	0.76494	0.999;0.89;0.997	D;D;D	0.71656	0.974;0.923;0.958	T	0.43909	-0.9362	9	0.72032	D	0.01	.	6.0007	0.19519	0.0:0.0:0.0:1.0	.	50;50;50	G3V0F7;Q9NVL1-2;Q9NVL1	.;.;FA86C_HUMAN	T	50	ENSP00000325662:I50T;ENSP00000352182:I50T;ENSP00000391329:I50T;ENSP00000436598:I50T	ENSP00000325662:I50T	I	+	2	0	FAM86C1	71178529	1.000000	0.71417	0.940000	0.37924	0.111000	0.19643	3.386000	0.52492	0.937000	0.37394	0.155000	0.16302	ATT		PASS	0.493	FAM86C1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361120.1	NM_152563		16	114	16	114	---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92533601	92533601	+	Silent	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr11:92533601G>A	ENST00000298047.6	+	9	7439	c.7422G>A	c.(7420-7422)ggG>ggA	p.G2474G	FAT3_ENST00000525166.1_Silent_p.G2324G|FAT3_ENST00000409404.2_Silent_p.G2474G			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2474	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G2474G(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCTCTGATGGGTTGTTCACCA	0.498										TCGA Ovarian(4;0.039)																												uc001pdj.3																			2	Substitution - coding silent(2)		lung(2)	ovary(4)|pancreas(1)	5						c.(7420-7422)GGG>GGA		FAT tumor suppressor homolog 3							124.0	119.0	121.0					11																	92533601		2041	4201	6242	SO:0001819	synonymous_variant	120114				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr11:92533601G>A	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7422G>A	11.37:g.92533601G>A		TCGA Ovarian(4;0.039)					p.G2474G	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN			9	7439	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	2474			Cadherin 22.|Extracellular (Potential).		B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37	c.7422G>A																																																																																					PASS	0.498	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781		30	97	30	97	---	---	---	---
BCO2	83875	broad.mit.edu	37	11	112065424	112065424	+	Missense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr11:112065424C>T	ENST00000357685.5	+	5	817	c.682C>T	c.(682-684)Cat>Tat	p.H228Y	BCO2_ENST00000531169.1_Missense_Mutation_p.H194Y|BCO2_ENST00000526088.1_Missense_Mutation_p.H194Y|BCO2_ENST00000393032.2_Missense_Mutation_p.H194Y|BCO2_ENST00000532593.1_Missense_Mutation_p.H123Y|AP002884.3_ENST00000532612.1_Intron|BCO2_ENST00000361053.4_Intron|BCO2_ENST00000438022.1_Missense_Mutation_p.H194Y			Q9BYV7	BCDO2_HUMAN	beta-carotene oxygenase 2	228					carotene catabolic process (GO:0016121)|carotene metabolic process (GO:0016119)|carotenoid metabolic process (GO:0016116)|oxidation-reduction process (GO:0055114)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)	p.H228Y(1)		NS(1)|breast(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)	16						TGCACATCCTCATTATGACCT	0.398																																					GBM(177;1916 2099 21049 29541 39946)	uc001pnf.2																			1	Substitution - Missense(1)		lung(1)		0						c.(682-684)CAT>TAT		beta-carotene dioxygenase 2 isoform a							169.0	158.0	162.0					11																	112065424		2201	4297	6498	SO:0001583	missense	83875				carotene metabolic process|retinal metabolic process|retinoic acid metabolic process		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	g.chr11:112065424C>T	AJ290393	CCDS8358.2, CCDS41716.1, CCDS58181.1, CCDS58182.1, CCDS58183.1	11q23.1	2014-05-12	2008-04-15	2008-04-15	ENSG00000197580	ENSG00000197580	1.13.11.71		18503	protein-coding gene	gene with protein product	"""beta-carotene 9',10' oxygenase"", ""carotenoid-9',10'-cleaving dioxygenase"""	611740	"""beta-carotene dioxygenase 2"""	BCDO2		11278918, 15983114, 15949678	Standard	NM_031938		Approved	FLJ34464, B-DIOX-II	uc001pnf.3	Q9BYV7	OTTHUMG00000167155	ENST00000357685.5:c.682C>T	11.37:g.112065424C>T	ENSP00000350314:p.His228Tyr					BCO2_uc001pne.1_Missense_Mutation_p.H55Y|BCO2_uc001png.2_Intron|BCO2_uc001pnh.2_Missense_Mutation_p.H194Y|BCO2_uc010rwt.1_Missense_Mutation_p.H123Y|BCO2_uc009yyn.2_Missense_Mutation_p.H194Y|BCO2_uc001pni.2_Missense_Mutation_p.H194Y	p.H228Y	NM_031938	NP_114144	Q9BYV7	BCDO2_HUMAN			5	799	+			228					B0YIX5|B4DNC3|E9PBI8|E9PJJ1|Q8IUS0|Q96JC8|Q96JY5	Missense_Mutation	SNP	ENST00000357685.5	37	c.682C>T	CCDS8358.2	.	.	.	.	.	.	.	.	.	.	C	24.5	4.537110	0.85812	.	.	ENSG00000197580	ENST00000357685;ENST00000393032;ENST00000438022;ENST00000526088;ENST00000532593;ENST00000531169	D;D;D;D;D;D	0.95137	-3.62;-3.62;-3.62;-3.62;-3.62;-3.62	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	D	0.97804	0.9279	M	0.89840	3.065	0.80722	D	1	D;D;D	0.89917	0.996;0.999;1.0	D;D;D	0.85130	0.97;0.97;0.997	D	0.98498	1.0613	10	0.87932	D	0	-18.2665	18.743	0.91780	0.0:1.0:0.0:0.0	.	205;228;55	C9JEZ9;Q9BYV7;Q8NAZ7	.;BCDO2_HUMAN;.	Y	228;194;194;194;123;194	ENSP00000350314:H228Y;ENSP00000376752:H194Y;ENSP00000414843:H194Y;ENSP00000436615:H194Y;ENSP00000431802:H123Y;ENSP00000437053:H194Y	ENSP00000350314:H228Y	H	+	1	0	BCO2	111570634	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	5.279000	0.65597	2.676000	0.91093	0.557000	0.71058	CAT		PASS	0.398	BCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256570.3	NM_001037290		39	160	39	160	---	---	---	---
NFRKB	4798	broad.mit.edu	37	11	129758544	129758544	+	Missense_Mutation	SNP	A	A	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr11:129758544A>C	ENST00000446488.3	-	3	385	c.282T>G	c.(280-282)agT>agG	p.S94R	NFRKB_ENST00000524794.1_Missense_Mutation_p.S107R|NFRKB_ENST00000526940.1_Missense_Mutation_p.S94R|NFRKB_ENST00000304521.5_Missense_Mutation_p.S94R|NFRKB_ENST00000524746.1_Missense_Mutation_p.S94R	NM_001143835.1	NP_001137307.1	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	94					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protease binding (GO:0002020)	p.S107R(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(13)|ovary(4)|skin(3)|urinary_tract(1)	32	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		AGTTCTCCCCACTGAACAAGG	0.498																																						uc001qfi.2																			1	Substitution - Missense(1)		lung(1)	ovary(3)	3						c.(280-282)AGT>AGG		nuclear factor related to kappaB binding protein							119.0	109.0	112.0					11																	129758544		2201	4297	6498	SO:0001583	missense	4798				DNA recombination|DNA repair|inflammatory response|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Ino80 complex	DNA binding|protease binding	g.chr11:129758544A>C		CCDS8483.1, CCDS44770.1	11q24-q25	2011-07-06			ENSG00000170322	ENSG00000170322		"""INO80 complex subunits"""	7802	protein-coding gene	gene with protein product	"""nuclear factor related to kappa B binding protein"", ""DNA-binding protein R kappa B"", ""INO80 complex subunit G"""	164013				1427843	Standard	NM_006165		Approved	DKFZp547B2013, INO80G	uc001qfg.3	Q6P4R8	OTTHUMG00000165761	ENST00000446488.3:c.282T>G	11.37:g.129758544A>C	ENSP00000400476:p.Ser94Arg					NFRKB_uc001qfg.2_Missense_Mutation_p.S107R|NFRKB_uc001qfh.2_Missense_Mutation_p.S117R|NFRKB_uc010sbw.1_Missense_Mutation_p.S94R	p.S94R	NM_001143835	NP_001137307	Q6P4R8	NFRKB_HUMAN		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)	4	483	-	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)	94					Q12869|Q15312|Q9H048	Missense_Mutation	SNP	ENST00000446488.3	37	c.282T>G	CCDS44770.1	.	.	.	.	.	.	.	.	.	.	A	15.22	2.768971	0.49680	.	.	ENSG00000170322	ENST00000304521;ENST00000446488;ENST00000524794;ENST00000524746;ENST00000531755;ENST00000532225;ENST00000529319;ENST00000526940	.	.	.	5.71	-0.959	0.10343	.	0.274240	0.46442	N	0.000285	T	0.19644	0.0472	N	0.19112	0.55	0.30991	N	0.721431	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.001	T	0.03374	-1.1043	9	0.45353	T	0.12	7.0E-4	1.2979	0.02073	0.4178:0.2513:0.2099:0.1211	.	94;94;94;107	B4DSL1;Q6P4R8;Q6P4R8-3;Q6P4R8-2	.;NFRKB_HUMAN;.;.	R	94;94;107;94;94;94;94;94	.	ENSP00000303800:S94R	S	-	3	2	NFRKB	129263754	0.023000	0.18921	0.990000	0.47175	0.980000	0.70556	-0.772000	0.04694	-0.425000	0.07371	0.529000	0.55759	AGT		PASS	0.498	NFRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386063.2	NM_006165		28	159	28	159	---	---	---	---
OPCML	4978	broad.mit.edu	37	11	132307140	132307140	+	Silent	SNP	G	G	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr11:132307140G>T	ENST00000331898.7	-	4	1218	c.640C>A	c.(640-642)Cgg>Agg	p.R214R	OPCML_ENST00000541867.1_Silent_p.R214R|OPCML_ENST00000524381.1_Silent_p.R207R|OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000374778.4_Silent_p.R173R	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	214	Ig-like C2-type 2.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)	p.R207R(1)|p.R214R(1)		endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		TTTACTTTCCGCACATCGGGC	0.537																																						uc001qgs.2																			2	Substitution - coding silent(2)		lung(2)	ovary(2)|skin(1)	3						c.(640-642)CGG>AGG		opioid binding protein/cell adhesion							131.0	118.0	122.0					11																	132307140		2201	4297	6498	SO:0001819	synonymous_variant	4978				cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity	g.chr11:132307140G>T	BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.640C>A	11.37:g.132307140G>T						OPCML_uc001qgu.2_Silent_p.R207R|OPCML_uc010sck.1_Silent_p.R214R|OPCML_uc001qgt.2_Silent_p.R213R|OPCML_uc010scl.1_Silent_p.R173R	p.R214R	NM_002545	NP_002536	Q14982	OPCM_HUMAN		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)	4	690	-	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)	214			Ig-like C2-type 2.		B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Silent	SNP	ENST00000331898.7	37	c.640C>A	CCDS8492.1																																																																																				PASS	0.537	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374689.3	NM_001012393		22	188	22	188	---	---	---	---
KDM5A	5927	broad.mit.edu	37	12	475139	475139	+	Silent	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr12:475139G>C	ENST00000399788.2	-	4	860	c.498C>G	c.(496-498)ctC>ctG	p.L166L	KDM5A_ENST00000382815.4_Silent_p.L166L	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	166	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.L166L(4)		NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						CATATGGGTAGAGAATTCTTT	0.393			T	NUP98	AML																																	uc001qif.1				Dom	yes		12	12p11	5927	T 	"""lysine (K)-specific demethylase 5A, JARID1A"""			L	NUP98		AML		4	Substitution - coding silent(4)		lung(2)|endometrium(2)	skin(2)|ovary(1)	3						c.(496-498)CTC>CTG		retinoblastoma binding protein 2 isoform 1							177.0	176.0	177.0					12																	475139		1831	4093	5924	SO:0001819	synonymous_variant	5927				chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr12:475139G>C		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.498C>G	12.37:g.475139G>C						KDM5A_uc001qie.1_Silent_p.L166L|KDM5A_uc010sdn.1_Silent_p.L125L|KDM5A_uc010sdo.1_Intron	p.L166L	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN			4	861	-			166			ARID.		A8MV76|Q4LE72|Q86XZ1	Silent	SNP	ENST00000399788.2	37	c.498C>G	CCDS41736.1																																																																																				PASS	0.393	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1	NM_005056		80	395	80	395	---	---	---	---
KDM5A	5927	broad.mit.edu	37	12	475168	475168	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr12:475168G>C	ENST00000399788.2	-	4	831	c.469C>G	c.(469-471)Ctt>Gtt	p.L157V	KDM5A_ENST00000382815.4_Missense_Mutation_p.L157V	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	157	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.L157V(2)		NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						GACTTCAAAAGAGACCCAGTT	0.408			T	NUP98	AML																																	uc001qif.1				Dom	yes		12	12p11	5927	T 	"""lysine (K)-specific demethylase 5A, JARID1A"""			L	NUP98		AML		2	Substitution - Missense(2)		lung(2)	skin(2)|ovary(1)	3						c.(469-471)CTT>GTT		retinoblastoma binding protein 2 isoform 1							231.0	229.0	230.0					12																	475168		1826	4091	5917	SO:0001583	missense	5927				chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr12:475168G>C		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.469C>G	12.37:g.475168G>C	ENSP00000382688:p.Leu157Val					KDM5A_uc001qie.1_Missense_Mutation_p.L157V|KDM5A_uc010sdn.1_Missense_Mutation_p.L116V|KDM5A_uc010sdo.1_Intron	p.L157V	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN			4	832	-			157			ARID.		A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	ENST00000399788.2	37	c.469C>G	CCDS41736.1	.	.	.	.	.	.	.	.	.	.	G	10.99	1.507654	0.27036	.	.	ENSG00000073614	ENST00000399787;ENST00000399788;ENST00000382815;ENST00000535014	T;T;T	0.63417	-0.04;-0.04;-0.04	5.52	5.52	0.82312	ARID/BRIGHT DNA-binding domain (5);	0.000000	0.85682	D	0.000000	T	0.58949	0.2158	N	0.13352	0.335	0.53688	D	0.999972	B;B;D	0.63046	0.003;0.073;0.992	B;B;D	0.79784	0.023;0.177;0.993	T	0.53809	-0.8386	10	0.02654	T	1	-13.7193	13.5357	0.61646	0.0809:0.0:0.9191:0.0	.	157;157;157	F5H1F7;P29375;P29375-2	.;KDM5A_HUMAN;.	V	116;157;157;116	ENSP00000382688:L157V;ENSP00000372265:L157V;ENSP00000443854:L116V	ENSP00000372265:L157V	L	-	1	0	KDM5A	345429	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.770000	0.62309	2.745000	0.94114	0.655000	0.94253	CTT		PASS	0.408	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1	NM_005056		99	515	99	515	---	---	---	---
PLCZ1	89869	broad.mit.edu	37	12	18841147	18841147	+	Silent	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr12:18841147G>A	ENST00000538330.1	-	9	1194	c.813C>T	c.(811-813)atC>atT	p.I271I	PLCZ1_ENST00000534932.1_5'UTR|PLCZ1_ENST00000435379.1_Silent_p.I294I|PLCZ1_ENST00000541695.1_Silent_p.I352I|PLCZ1_ENST00000447925.2_Silent_p.I487I|PLCZ1_ENST00000266505.7_Silent_p.I489I|PLCZ1_ENST00000539875.1_Silent_p.I296I					phospholipase C, zeta 1									p.I489I(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					GGATACCACTGATGAGCTGCA	0.294																																						uc010sid.1																			1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)|skin(1)	3						c.(1465-1467)ATC>ATT		phospholipase C, zeta 1							80.0	90.0	87.0					12																	18841147		2203	4298	6501	SO:0001819	synonymous_variant	89869				intracellular signal transduction|lipid catabolic process|multicellular organismal development	nucleus|perinuclear region of cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity	g.chr12:18841147G>A	AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.813C>T	12.37:g.18841147G>A						PLCZ1_uc001rdv.3_Silent_p.I385I|PLCZ1_uc001rdw.3_Silent_p.I230I|PLCZ1_uc001rdu.1_Silent_p.I271I|PLCZ1_uc009zil.1_RNA	p.I489I	NM_033123	NP_149114	Q86YW0	PLCZ1_HUMAN			13	1658	-	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)		489	I -> T (in Ref. 2; AAK61372).		C2.			Silent	SNP	ENST00000538330.1	37	c.1467C>T		.	.	.	.	.	.	.	.	.	.	G	7.103	0.574387	0.13623	.	.	ENSG00000139151	ENST00000536023	.	.	.	5.67	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4146	0.67139	0.0:0.0:0.8426:0.1574	.	.	.	.	X	59	.	.	Q	-	1	0	PLCZ1	18732414	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	0.876000	0.28092	2.681000	0.91329	0.313000	0.20887	CAG		PASS	0.294	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000401666.3	NM_033123		42	209	42	209	---	---	---	---
H1FNT	341567	broad.mit.edu	37	12	48723703	48723703	+	Missense_Mutation	SNP	C	C	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr12:48723703C>A	ENST00000335017.1	+	1	941	c.629C>A	c.(628-630)gCg>gAg	p.A210E		NM_181788.1	NP_861453.1	Q75WM6	H1FNT_HUMAN	H1 histone family, member N, testis-specific	210					chromosome condensation (GO:0030261)|multicellular organismal development (GO:0007275)|sperm chromatin condensation (GO:0035092)|spermatid nucleus elongation (GO:0007290)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)	p.A210E(1)		endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	13						GAAGCGGGAGCGACAGCGGCA	0.662																																						uc001rrm.2																			1	Substitution - Missense(1)		lung(1)	pancreas(1)	1						c.(628-630)GCG>GAG		H1 histone family, member N, testis-specific							55.0	56.0	56.0					12																	48723703		2182	4294	6476	SO:0001583	missense	341567				chromosome condensation|multicellular organismal development|sperm chromatin condensation|spermatid nucleus elongation	nuclear chromatin	ATP binding|DNA binding	g.chr12:48723703C>A	AY302593	CCDS8762.1	12q13.11	2011-01-27				ENSG00000187166		"""Histones / Replication-independent"""	24893	protein-coding gene	gene with protein product						15710904	Standard	NM_181788		Approved	HANP1, H1T2	uc001rrm.3	Q75WM6		ENST00000335017.1:c.629C>A	12.37:g.48723703C>A	ENSP00000334805:p.Ala210Glu						p.A210E	NM_181788	NP_861453	Q75WM6	H1FNT_HUMAN			1	941	+			210					Q147U8|Q5GKZ5|Q7Z694	Missense_Mutation	SNP	ENST00000335017.1	37	c.629C>A	CCDS8762.1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.376762	0.61735	.	.	ENSG00000187166	ENST00000335017	T	0.18810	2.19	4.67	1.59	0.23543	.	.	.	.	.	T	0.14141	0.0342	L	0.38175	1.15	0.09310	N	1	P	0.42556	0.783	B	0.37144	0.242	T	0.15838	-1.0423	9	0.72032	D	0.01	-0.6058	5.1313	0.14911	0.1471:0.6221:0.1434:0.0874	.	210	Q75WM6	H1FNT_HUMAN	E	210	ENSP00000334805:A210E	ENSP00000334805:A210E	A	+	2	0	H1FNT	47009970	0.000000	0.05858	0.019000	0.16419	0.012000	0.07955	-0.428000	0.06991	0.510000	0.28216	0.655000	0.94253	GCG		PASS	0.662	H1FNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406516.1	NM_181788		7	9	7	9	---	---	---	---
FREM2	341640	broad.mit.edu	37	13	39266156	39266156	+	Missense_Mutation	SNP	G	G	A	rs267603820		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr13:39266156G>A	ENST00000280481.7	+	1	4891	c.4675G>A	c.(4675-4677)Gaa>Aaa	p.E1559K		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1559					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E1559K(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GCTCACTGTCGAAGACAGAGA	0.443																																						uc001uwv.2																			1	Substitution - Missense(1)		lung(1)	ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11						c.(4675-4677)GAA>AAA		FRAS1-related extracellular matrix protein 2							111.0	107.0	108.0					13																	39266156		2203	4300	6503	SO:0001583	missense	341640				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding	g.chr13:39266156G>A	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.4675G>A	13.37:g.39266156G>A	ENSP00000280481:p.Glu1559Lys						p.E1559K	NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)	1	4984	+		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)	1559			Extracellular (Potential).|CSPG 11.		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	c.4675G>A	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.609628	0.87258	.	.	ENSG00000150893	ENST00000280481	T	0.62498	0.02	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.82426	0.5034	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.78471	-0.2191	10	0.21540	T	0.41	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	1559	Q5SZK8	FREM2_HUMAN	K	1559	ENSP00000280481:E1559K	ENSP00000280481:E1559K	E	+	1	0	FREM2	38164156	1.000000	0.71417	0.979000	0.43373	0.966000	0.64601	9.864000	0.99589	2.890000	0.99128	0.650000	0.86243	GAA		PASS	0.443	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361		39	122	39	122	---	---	---	---
MYCBP2	23077	broad.mit.edu	37	13	77657221	77657221	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr13:77657221G>A	ENST00000544440.2	-	63	10885	c.10868C>T	c.(10867-10869)tCa>tTa	p.S3623L	MYCBP2-AS1_ENST00000422231.2_RNA|MYCBP2_ENST00000407578.2_Missense_Mutation_p.S3661L|MYCBP2_ENST00000357337.6_Missense_Mutation_p.S3623L|MYCBP2-AS1_ENST00000448470.2_RNA|MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2-AS1_ENST00000450627.2_RNA|MYCBP2-AS2_ENST00000428716.2_RNA					MYC binding protein 2, E3 ubiquitin protein ligase									p.S3661L(1)|p.S3623L(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CATAAGGTCTGAGATGGTCTG	0.473																																						uc001vkf.2																			2	Substitution - Missense(2)		lung(2)	ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14						c.(10867-10869)TCA>TTA		MYC binding protein 2							189.0	172.0	178.0					13																	77657221		2203	4300	6503	SO:0001583	missense	23077				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding	g.chr13:77657221G>A	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.10868C>T	13.37:g.77657221G>A	ENSP00000444596:p.Ser3623Leu					MYCBP2_uc010aev.2_Missense_Mutation_p.S3027L|MYCBP2_uc001vke.2_Missense_Mutation_p.S243L	p.S3623L	NM_015057	NP_055872	O75592	MYCB2_HUMAN		GBM - Glioblastoma multiforme(99;0.109)	64	10959	-		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)	3623						Missense_Mutation	SNP	ENST00000544440.2	37	c.10868C>T		.	.	.	.	.	.	.	.	.	.	G	18.84	3.708569	0.68615	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.61274	0.12;0.12;0.12	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.66509	0.2796	L	0.29908	0.895	0.80722	D	1	D	0.54601	0.967	D	0.63597	0.916	T	0.70055	-0.4977	10	0.87932	D	0	.	19.165	0.93553	0.0:0.0:1.0:0.0	.	3623	O75592	MYCB2_HUMAN	L	3623;3661;3623	ENSP00000349892:S3623L;ENSP00000384288:S3661L;ENSP00000444596:S3623L	ENSP00000349892:S3623L	S	-	2	0	MYCBP2	76555222	1.000000	0.71417	0.876000	0.34364	0.935000	0.57460	9.869000	0.99810	2.504000	0.84457	0.650000	0.86243	TCA		PASS	0.473	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057		43	116	43	116	---	---	---	---
RNF219	79596	broad.mit.edu	37	13	79213126	79213126	+	Silent	SNP	A	A	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr13:79213126A>G	ENST00000282003.6	-	4	439	c.381T>C	c.(379-381)atT>atC	p.I127I		NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219	127							zinc ion binding (GO:0008270)	p.I127I(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		AAGGATCCAGAATAGTTTTGA	0.373																																						uc001vkw.1																			1	Substitution - coding silent(1)		lung(1)	large_intestine(2)	2						c.(379-381)ATT>ATC		ring finger protein 219							142.0	136.0	138.0					13																	79213126		2203	4300	6503	SO:0001819	synonymous_variant	79596						zinc ion binding	g.chr13:79213126A>G	BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.381T>C	13.37:g.79213126A>G						RNF219_uc010afb.1_5'UTR|RNF219_uc010afc.2_Silent_p.I127I	p.I127I	NM_024546	NP_078822	Q5W0B1	RN219_HUMAN		GBM - Glioblastoma multiforme(99;0.0414)	4	440	-		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)	127			Potential.		B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Silent	SNP	ENST00000282003.6	37	c.381T>C	CCDS31997.1																																																																																				PASS	0.373	RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045363.1	NM_024546		61	188	61	188	---	---	---	---
KLHL28	54813	broad.mit.edu	37	14	45400541	45400541	+	Missense_Mutation	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr14:45400541C>G	ENST00000396128.4	-	4	1666	c.1547G>C	c.(1546-1548)aGa>aCa	p.R516T	KLHL28_ENST00000355081.2_Missense_Mutation_p.R530T	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	516								p.R516T(1)		breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						ATTACCTGTTCTAGGTTCTTT	0.358																																						uc001wvq.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1546-1548)AGA>ACA		BTB (POZ) domain containing 5							65.0	61.0	62.0					14																	45400541		2203	4300	6503	SO:0001583	missense	54813							g.chr14:45400541C>G	AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.1547G>C	14.37:g.45400541C>G	ENSP00000379434:p.Arg516Thr					KLHL28_uc001wvr.2_Missense_Mutation_p.R516T	p.R516T	NM_017658	NP_060128	Q9NXS3	KLH28_HUMAN			4	1793	-			516			Kelch 5.		Q0VAL5	Missense_Mutation	SNP	ENST00000396128.4	37	c.1547G>C	CCDS9680.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.396239	0.83011	.	.	ENSG00000179454	ENST00000396128;ENST00000355081	D;D	0.85339	-1.97;-1.97	4.82	4.82	0.62117	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	D	0.93877	0.8041	H	0.96111	3.77	0.80722	D	1	D	0.64830	0.994	P	0.57204	0.815	D	0.95933	0.8940	10	0.87932	D	0	.	17.8685	0.88803	0.0:1.0:0.0:0.0	.	516	Q9NXS3	KLH28_HUMAN	T	516;530	ENSP00000379434:R516T;ENSP00000347193:R530T	ENSP00000347193:R530T	R	-	2	0	KLHL28	44470291	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.411000	0.80078	2.397000	0.81536	0.557000	0.71058	AGA		PASS	0.358	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276790.3			13	61	13	61	---	---	---	---
FANCM	57697	broad.mit.edu	37	14	45645812	45645812	+	Silent	SNP	T	T	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr14:45645812T>C	ENST00000267430.5	+	14	3940	c.3855T>C	c.(3853-3855)caT>caC	p.H1285H	FANCM_ENST00000542564.2_Silent_p.H1259H	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1285					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)	p.H1285H(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						CAAGAGATCATAGTAAAAATT	0.328								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													uc001wwd.3																			1	Substitution - coding silent(1)		lung(1)	ovary(3)|lung(2)|breast(2)	7						c.(3853-3855)CAT>CAC	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia, complementation group M							72.0	73.0	73.0					14																	45645812		2203	4298	6501	SO:0001819	synonymous_variant	57697	Fanconi_Anemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding	g.chr14:45645812T>C	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.3855T>C	14.37:g.45645812T>C						FANCM_uc010anf.2_Silent_p.H1259H|FANCM_uc001wwe.3_Silent_p.H821H|FANCM_uc010ang.2_Silent_p.H499H	p.H1285H	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN			14	3954	+			1285					B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Silent	SNP	ENST00000267430.5	37	c.3855T>C	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.836974	0.00579	.	.	ENSG00000187790	ENST00000554809	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.54753	D	0.99998	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2687	0.54693	0.0:0.0:0.0:1.0	.	.	.	.	Q	218	.	.	X	+	1	0	FANCM	44715562	0.007000	0.16637	0.019000	0.16419	0.015000	0.08874	1.206000	0.32321	2.156000	0.67533	0.533000	0.62120	TAG		PASS	0.328	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128		25	107	25	107	---	---	---	---
KLHDC2	23588	broad.mit.edu	37	14	50247037	50247037	+	Silent	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr14:50247037C>T	ENST00000298307.5	+	9	1741	c.880C>T	c.(880-882)Cta>Tta	p.L294L	KLHDC2_ENST00000554589.1_Silent_p.L294L|KLHDC2_ENST00000557247.1_Silent_p.L294L	NM_014315.2	NP_055130.1	Q9Y2U9	KLDC2_HUMAN	kelch domain containing 2	294						nucleus (GO:0005634)		p.L294L(1)		endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	all_epithelial(31;0.000959)|Breast(41;0.0117)					TAAACAGCCACTAAGTAAGTC	0.368																																						uc001wwx.2																			1	Substitution - coding silent(1)		lung(1)	ovary(1)	1						c.(880-882)CTA>TTA		kelch domain containing 2							85.0	88.0	87.0					14																	50247037		2203	4300	6503	SO:0001819	synonymous_variant	23588					nucleus	protein binding	g.chr14:50247037C>T	AK001771	CCDS9693.1	14q21.3	2003-01-15			ENSG00000165516	ENSG00000165516			20231	protein-coding gene	gene with protein product		611280				11384994	Standard	NM_014315		Approved	HCLP-1, LCP	uc001wwx.3	Q9Y2U9	OTTHUMG00000140288	ENST00000298307.5:c.880C>T	14.37:g.50247037C>T						SDCCAG1_uc010anj.1_Intron|KLHDC2_uc001wwy.2_Silent_p.L294L|KLHDC2_uc010anp.2_Silent_p.L294L	p.L294L	NM_014315	NP_055130	Q9Y2U9	KLDC2_HUMAN			9	1280	+	all_epithelial(31;0.000959)|Breast(41;0.0117)		294			Kelch 5.		B3KPF9|Q6IAF0|Q86TY9	Silent	SNP	ENST00000298307.5	37	c.880C>T	CCDS9693.1																																																																																				PASS	0.368	KLHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276869.1			29	92	29	92	---	---	---	---
DCAF5	8816	broad.mit.edu	37	14	69521476	69521476	+	Nonsense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr14:69521476G>A	ENST00000341516.5	-	9	2074	c.1927C>T	c.(1927-1929)Caa>Taa	p.Q643*	DCAF5_ENST00000553293.1_5'Flank|DCAF5_ENST00000554215.1_Nonsense_Mutation_p.Q561*|DCAF5_ENST00000556847.1_Nonsense_Mutation_p.Q561*|DCAF5_ENST00000557386.1_Nonsense_Mutation_p.Q642*	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	643					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)		p.Q643*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						CGGCTTGGTTGAATCTCTAGC	0.473																																						uc001xkp.2																			1	Substitution - Nonsense(1)		lung(1)	ovary(1)|central_nervous_system(1)	2						c.(1927-1929)CAA>TAA		WD repeat domain 22							73.0	76.0	75.0					14																	69521476		2203	4300	6503	SO:0001587	stop_gained	8816					CUL4 RING ubiquitin ligase complex		g.chr14:69521476G>A	AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.1927C>T	14.37:g.69521476G>A	ENSP00000341351:p.Gln643*					DCAF5_uc001xkq.2_Nonsense_Mutation_p.Q642*	p.Q643*	NM_003861	NP_003852	Q96JK2	DCAF5_HUMAN			9	2146	-			643					B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Nonsense_Mutation	SNP	ENST00000341516.5	37	c.1927C>T	CCDS32106.1	.	.	.	.	.	.	.	.	.	.	G	34	5.399341	0.96030	.	.	ENSG00000139990	ENST00000341516;ENST00000554215;ENST00000556847;ENST00000557386	.	.	.	5.32	5.32	0.75619	.	0.323197	0.26840	N	0.022239	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	-12.6097	17.1784	0.86848	0.0:0.0:1.0:0.0	.	.	.	.	X	643;561;561;642	.	ENSP00000341351:Q643X	Q	-	1	0	DCAF5	68591229	1.000000	0.71417	0.994000	0.49952	0.690000	0.40134	3.692000	0.54727	2.477000	0.83638	0.561000	0.74099	CAA		PASS	0.473	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414806.2	NM_003861		10	135	10	135	---	---	---	---
SPATA7	55812	broad.mit.edu	37	14	88883116	88883116	+	Missense_Mutation	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr14:88883116C>G	ENST00000393545.4	+	5	589	c.300C>G	c.(298-300)ttC>ttG	p.F100L	SPATA7_ENST00000356583.5_Missense_Mutation_p.F68L|SPATA7_ENST00000556553.1_Missense_Mutation_p.F68L|SPATA7_ENST00000045347.7_Missense_Mutation_p.F100L	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	100					response to stimulus (GO:0050896)|visual perception (GO:0007601)			p.F100L(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						AAAAAGAGTTCAAATTAACTA	0.279																																						uc001xwq.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(298-300)TTC>TTG		spermatogenesis-associated protein 7 isoform a							58.0	64.0	62.0					14																	88883116		2203	4296	6499	SO:0001583	missense	55812				response to stimulus|visual perception			g.chr14:88883116C>G	AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.300C>G	14.37:g.88883116C>G	ENSP00000377176:p.Phe100Leu					SPATA7_uc001xwr.2_Missense_Mutation_p.F68L|SPATA7_uc001xws.2_Missense_Mutation_p.F36L|SPATA7_uc001xwt.2_5'UTR	p.F100L	NM_018418	NP_060888	Q9P0W8	SPAT7_HUMAN			5	451	+			100					Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Missense_Mutation	SNP	ENST00000393545.4	37	c.300C>G	CCDS9883.1	.	.	.	.	.	.	.	.	.	.	C	4.400	0.073905	0.08485	.	.	ENSG00000042317	ENST00000556553;ENST00000393545;ENST00000356583;ENST00000555401;ENST00000553885;ENST00000045347	T;T;T;T;T;T	0.15017	2.46;2.46;2.46;2.46;2.46;2.46	5.14	-2.63	0.06133	.	0.536026	0.16691	N	0.203550	T	0.03136	0.0092	N	0.01668	-0.77	0.23550	N	0.997433	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.002;0.002;0.002	T	0.36261	-0.9755	10	0.06625	T	0.88	-1.376	0.9002	0.01272	0.1839:0.276:0.284:0.2561	.	68;68;100	A8K3L6;Q9P0W8-2;Q9P0W8	.;.;SPAT7_HUMAN	L	68;100;68;43;86;100	ENSP00000451128:F68L;ENSP00000377176:F100L;ENSP00000348991:F68L;ENSP00000452435:F43L;ENSP00000450606:F86L;ENSP00000045347:F100L	ENSP00000045347:F100L	F	+	3	2	SPATA7	87952869	0.770000	0.28543	0.270000	0.24601	0.908000	0.53690	0.272000	0.18644	-0.115000	0.11915	-0.136000	0.14681	TTC		PASS	0.279	SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410172.1			5	92	5	92	---	---	---	---
CATSPERB	79820	broad.mit.edu	37	14	92091277	92091277	+	Missense_Mutation	SNP	G	G	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr14:92091277G>T	ENST00000256343.3	-	18	1973	c.1817C>A	c.(1816-1818)gCa>gAa	p.A606E		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	606					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)		p.A606E(1)		NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				TTTCATTTCTGCAATAACTGA	0.343																																						uc001xzs.1																			1	Substitution - Missense(1)		lung(1)	breast(2)|skin(2)|ovary(1)	5						c.(1816-1818)GCA>GAA		cation channel, sperm-associated, beta							86.0	87.0	87.0					14																	92091277		2202	4299	6501	SO:0001583	missense	79820				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane		g.chr14:92091277G>T	AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.1817C>A	14.37:g.92091277G>T	ENSP00000256343:p.Ala606Glu					CATSPERB_uc010aub.1_Missense_Mutation_p.A128E	p.A606E	NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN			18	1957	-		all_cancers(154;0.0663)|all_epithelial(191;0.236)	606					A0AV51	Missense_Mutation	SNP	ENST00000256343.3	37	c.1817C>A	CCDS32142.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.214023	0.58452	.	.	ENSG00000133962	ENST00000256343	T	0.51817	0.69	4.88	3.97	0.46021	.	0.392842	0.21455	N	0.074268	T	0.48537	0.1505	L	0.55481	1.735	0.20638	N	0.999877	P	0.44429	0.835	P	0.47645	0.553	T	0.43877	-0.9364	10	0.56958	D	0.05	-8.9266	9.662	0.39960	0.1033:0.0:0.8967:0.0	.	606	Q9H7T0	CTSRB_HUMAN	E	606	ENSP00000256343:A606E	ENSP00000256343:A606E	A	-	2	0	CATSPERB	91161030	0.237000	0.23815	0.922000	0.36590	0.745000	0.42441	1.151000	0.31651	2.419000	0.82065	0.305000	0.20034	GCA		PASS	0.343	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411769.1	NM_024764		19	113	19	113	---	---	---	---
SERPINA11	256394	broad.mit.edu	37	14	94914713	94914713	+	Silent	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr14:94914713G>C	ENST00000334708.3	-	2	463	c.399C>G	c.(397-399)ctC>ctG	p.L133L	RP11-349I1.2_ENST00000536735.1_RNA	NM_001080451.1	NP_001073920.1	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11	133					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.L315L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(14)|skin(1)|upper_aerodigestive_tract(1)	24				COAD - Colon adenocarcinoma(157;0.211)		CTTTTAGTTCGAGTTTGGGGC	0.537																																						uc001ydd.1																			1	Substitution - coding silent(1)		lung(1)	kidney(1)	1						c.(397-399)CTC>CTG		serpin peptidase inhibitor, clade A (alpha-1							130.0	138.0	135.0					14																	94914713		2203	4300	6503	SO:0001819	synonymous_variant	256394				regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity	g.chr14:94914713G>C	BX248259	CCDS32149.1	14q32.13	2014-02-18	2005-08-18		ENSG00000186910	ENSG00000186910		"""Serine (or cysteine) peptidase inhibitors"""	19193	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11"""			15014966, 24172014	Standard	NM_001080451		Approved		uc001ydd.1	Q86U17	OTTHUMG00000171348	ENST00000334708.3:c.399C>G	14.37:g.94914713G>C							p.L133L	NM_001080451	NP_001073920	Q86U17	SPA11_HUMAN		COAD - Colon adenocarcinoma(157;0.211)	2	459	-			133					B2RV07	Silent	SNP	ENST00000334708.3	37	c.399C>G	CCDS32149.1																																																																																				PASS	0.537	SERPINA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413091.1	NM_001080451		52	264	52	264	---	---	---	---
ATP10A	57194	broad.mit.edu	37	15	25947152	25947152	+	Missense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr15:25947152C>T	ENST00000356865.6	-	13	2782	c.2671G>A	c.(2671-2673)Gac>Aac	p.D891N		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	891					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.D891N(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TCTTGTTTGTCACCAGTGAGA	0.532																																						uc010ayu.2																			1	Substitution - Missense(1)		lung(1)	pancreas(2)|ovary(1)|breast(1)|liver(1)	5						c.(2671-2673)GAC>AAC		ATPase, class V, type 10A							178.0	161.0	166.0					15																	25947152		2203	4300	6503	SO:0001583	missense	57194				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity	g.chr15:25947152C>T	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.2671G>A	15.37:g.25947152C>T	ENSP00000349325:p.Asp891Asn						p.D891N	NM_024490	NP_077816	O60312	AT10A_HUMAN		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)	13	2777	-		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)	891			Cytoplasmic (Potential).		Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	37	c.2671G>A	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.747787	0.89663	.	.	ENSG00000206190	ENST00000356865	D	0.94576	-3.46	5.51	5.51	0.81932	HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.98469	0.9490	H	0.97240	3.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99509	1.0955	10	0.87932	D	0	-46.8724	19.4252	0.94739	0.0:1.0:0.0:0.0	.	891	O60312	AT10A_HUMAN	N	891	ENSP00000349325:D891N	ENSP00000349325:D891N	D	-	1	0	ATP10A	23498245	1.000000	0.71417	0.921000	0.36526	0.399000	0.30720	7.561000	0.82288	2.589000	0.87451	0.655000	0.94253	GAC		PASS	0.532	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490		6	236	6	236	---	---	---	---
RYR3	6263	broad.mit.edu	37	15	34034598	34034598	+	Missense_Mutation	SNP	G	G	A	rs369629619		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr15:34034598G>A	ENST00000389232.4	+	52	7922	c.7852G>A	c.(7852-7854)Gtc>Atc	p.V2618I	RYR3_ENST00000415757.3_Missense_Mutation_p.V2618I	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2618	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.V2618I(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGAATACATCGTCACCAAGTA	0.413																																						uc001zhi.2																			1	Substitution - Missense(1)		lung(1)	ovary(5)|central_nervous_system(4)|lung(1)	10						c.(7852-7854)GTC>ATC		ryanodine receptor 3		G	ILE/VAL	2,3778		0,2,1888	84.0	80.0	82.0		7852	5.5	1.0	15		82	0,8238		0,0,4119	no	missense	RYR3	NM_001036.3	29	0,2,6007	AA,AG,GG		0.0,0.0529,0.0166	benign	2618/4871	34034598	2,12016	1890	4119	6009	SO:0001583	missense	6263				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	g.chr15:34034598G>A		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.7852G>A	15.37:g.34034598G>A	ENSP00000373884:p.Val2618Ile					RYR3_uc010bar.2_Missense_Mutation_p.V2618I	p.V2618I	NM_001036	NP_001027	Q15413	RYR3_HUMAN		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)	52	7922	+		all_lung(180;7.18e-09)	2618			3.|Cytoplasmic (By similarity).|4 X approximate repeats.		O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	c.7852G>A	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	6.534	0.466848	0.12402	5.29E-4	0.0	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.92299	-3.01;-3.01	5.48	5.48	0.80851	Ryanodine receptor Ryr (1);	0.136022	0.49305	D	0.000152	T	0.79741	0.4498	N	0.05177	-0.1	0.37175	D	0.903245	B;B	0.27192	0.171;0.112	B;B	0.25884	0.03;0.064	T	0.76708	-0.2860	10	0.02654	T	1	.	12.8101	0.57635	0.0739:0.0:0.9261:0.0	.	2618;2618	Q15413-2;Q15413	.;RYR3_HUMAN	I	2618	ENSP00000373884:V2618I;ENSP00000399610:V2618I	ENSP00000354735:V2618I	V	+	1	0	RYR3	31821890	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	3.359000	0.52292	2.852000	0.98041	0.643000	0.83706	GTC		PASS	0.413	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			11	67	11	67	---	---	---	---
SLC12A6	9990	broad.mit.edu	37	15	34551037	34551037	+	Missense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr15:34551037C>T	ENST00000354181.3	-	5	1012	c.520G>A	c.(520-522)Gaa>Aaa	p.E174K	SLC12A6_ENST00000560164.1_Missense_Mutation_p.E35K|SLC12A6_ENST00000451844.2_Missense_Mutation_p.E35K|RP11-1084A12.2_ENST00000559867.1_RNA|SLC12A6_ENST00000558667.1_Missense_Mutation_p.E174K|SLC12A6_ENST00000560611.1_Missense_Mutation_p.E174K|SLC12A6_ENST00000558589.1_Missense_Mutation_p.E165K|SLC12A6_ENST00000290209.5_Missense_Mutation_p.E123K|SLC12A6_ENST00000397707.2_Missense_Mutation_p.E159K|SLC12A6_ENST00000397702.2_Missense_Mutation_p.E115K|SLC12A6_ENST00000458406.2_Missense_Mutation_p.E115K			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	174					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)	p.E165K(1)|p.E123K(1)		central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	TTTTTCCCTTCAGTGATGTTT	0.453																																						uc001zhw.2																			2	Substitution - Missense(2)		lung(2)	central_nervous_system(5)|ovary(1)|skin(1)	7						c.(520-522)GAA>AAA		solute carrier family 12, member 6 isoform a	Potassium Chloride(DB00761)						281.0	264.0	270.0					15																	34551037		2201	4298	6499	SO:0001583	missense	9990				angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity	g.chr15:34551037C>T	AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.520G>A	15.37:g.34551037C>T	ENSP00000346112:p.Glu174Lys					SLC12A6_uc001zhv.2_Missense_Mutation_p.E123K|SLC12A6_uc001zhx.2_Missense_Mutation_p.E159K|SLC12A6_uc001zhy.2_RNA|SLC12A6_uc001zhz.2_RNA|SLC12A6_uc001zia.2_Missense_Mutation_p.E115K|SLC12A6_uc001zib.2_Missense_Mutation_p.E165K|SLC12A6_uc001zic.2_Missense_Mutation_p.E174K|SLC12A6_uc010bau.2_Missense_Mutation_p.E174K|SLC12A6_uc001zid.2_Missense_Mutation_p.E115K|SLC12A6_uc001zhu.2_Missense_Mutation_p.E35K	p.E174K	NM_133647	NP_598408	Q9UHW9	S12A6_HUMAN		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	4	684	-		all_lung(180;2.78e-08)	174			Cytoplasmic (Potential).		A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	ENST00000354181.3	37	c.520G>A	CCDS58352.1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.557422	0.45590	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406;ENST00000451844	D;D;D;D;D;T	0.84516	-1.76;-1.79;-1.86;-1.76;-1.76;-1.31	4.82	4.82	0.62117	.	0.072884	0.56097	D	0.000027	T	0.70753	0.3260	N	0.08118	0	0.42521	D	0.993001	B;B;B;B	0.10296	0.003;0.002;0.0;0.0	B;B;B;B	0.22386	0.039;0.002;0.004;0.001	T	0.65627	-0.6122	10	0.18710	T	0.47	.	13.2027	0.59778	0.0:0.8386:0.1614:0.0	.	159;174;123;35	Q9UHW9-3;Q9UHW9;A0AV76;B3KXX3	.;S12A6_HUMAN;.;.	K	123;159;165;115;115;35	ENSP00000290209:E123K;ENSP00000380819:E159K;ENSP00000346112:E165K;ENSP00000380814:E115K;ENSP00000387725:E115K;ENSP00000390199:E35K	ENSP00000290209:E123K	E	-	1	0	SLC12A6	32338329	0.744000	0.28250	1.000000	0.80357	0.975000	0.68041	4.411000	0.59781	2.508000	0.84585	0.655000	0.94253	GAA		PASS	0.453	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000417991.1	NM_005135		65	375	65	375	---	---	---	---
C15orf52	388115	broad.mit.edu	37	15	40627419	40627419	+	Silent	SNP	C	C	G	rs144372797		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr15:40627419C>G	ENST00000559313.1	-	11	1560	c.1545G>C	c.(1543-1545)tcG>tcC	p.S515S	C15orf52_ENST00000397536.2_Silent_p.S305S	NM_207380.2	NP_997263.2	Q6ZUT6	CO052_HUMAN	chromosome 15 open reading frame 52	515							poly(A) RNA binding (GO:0044822)	p.S515S(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	19		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		CTGTGCCTCTCGACCTTTGGC	0.692																																						uc001zlh.3																			1	Substitution - coding silent(1)		lung(1)	large_intestine(1)	1						c.(1543-1545)TCG>TCC		hypothetical protein LOC388115							91.0	106.0	101.0					15																	40627419		2203	4300	6503	SO:0001819	synonymous_variant	388115							g.chr15:40627419C>G	AK124643	CCDS10055.2	15q15.1	2007-06-14			ENSG00000188549	ENSG00000188549			33488	protein-coding gene	gene with protein product							Standard	NM_207380		Approved	FLJ43339	uc001zlh.4	Q6ZUT6	OTTHUMG00000129981	ENST00000559313.1:c.1545G>C	15.37:g.40627419C>G						C15orf52_uc010ucn.1_Silent_p.S305S	p.S515S	NM_207380	NP_997263	Q6ZUT6	CO052_HUMAN		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)	11	1561	-		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)	515					B9EIQ8|Q68DG9|Q6ZTM3|Q6ZU22	Silent	SNP	ENST00000559313.1	37	c.1545G>C	CCDS10055.2																																																																																				PASS	0.692	C15orf52-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319567.2	NM_207380		76	343	76	343	---	---	---	---
GATM	2628	broad.mit.edu	37	15	45658353	45658353	+	Missense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr15:45658353C>T	ENST00000396659.3	-	6	1208	c.869G>A	c.(868-870)aGa>aAa	p.R290K	GATM_ENST00000558336.1_Missense_Mutation_p.R290K	NM_001482.2	NP_001473.1	P50440	GATM_HUMAN	glycine amidinotransferase (L-arginine:glycine amidinotransferase)	290					cellular nitrogen compound metabolic process (GO:0034641)|creatine biosynthetic process (GO:0006601)|creatine metabolic process (GO:0006600)|embryo development (GO:0009790)|response to mercury ion (GO:0046689)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)	glycine amidinotransferase activity (GO:0015068)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amidines (GO:0016813)	p.R290K(1)		biliary_tract(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	15		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Glycine(DB00145)|L-Ornithine(DB00129)	GATATGCACTCTGTAGTCTGG	0.413																																						uc001zvc.2																			1	Substitution - Missense(1)		lung(1)		0						c.(868-870)AGA>AAA		L-arginine:glycine amidinotransferase precursor	Creatine(DB00148)|Glycine(DB00145)|L-Ornithine(DB00129)						167.0	146.0	153.0					15																	45658353		2198	4298	6496	SO:0001583	missense	2628				creatine biosynthetic process	mitochondrial inner membrane|mitochondrial intermembrane space	glycine amidinotransferase activity|protein binding	g.chr15:45658353C>T	S68805	CCDS10122.1	15q15.1	2007-12-06			ENSG00000171766	ENSG00000171766	2.1.4.1		4175	protein-coding gene	gene with protein product		602360				8313955	Standard	NM_001482		Approved	AGAT	uc001zvc.3	P50440	OTTHUMG00000131427	ENST00000396659.3:c.869G>A	15.37:g.45658353C>T	ENSP00000379895:p.Arg290Lys					GATM_uc001zvb.2_Missense_Mutation_p.R161K|GATM_uc010uev.1_Missense_Mutation_p.R343K	p.R290K	NM_001482	NP_001473	P50440	GATM_HUMAN		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	6	1198	-		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)	290					B4DH99|B4DPI3|Q53EQ4	Missense_Mutation	SNP	ENST00000396659.3	37	c.869G>A	CCDS10122.1	.	.	.	.	.	.	.	.	.	.	C	13.06	2.123976	0.37533	.	.	ENSG00000171766	ENST00000396659	T	0.71341	-0.56	4.95	3.07	0.35406	.	0.241003	0.49916	N	0.000139	T	0.49236	0.1545	N	0.17379	0.485	0.38430	D	0.946404	B;B	0.02656	0.0;0.0	B;B	0.08055	0.001;0.003	T	0.37549	-0.9701	10	0.27785	T	0.31	-7.7649	7.0742	0.25195	0.0:0.7274:0.0:0.2726	.	290;290	P50440-3;P50440	.;GATM_HUMAN	K	290	ENSP00000379895:R290K	ENSP00000379895:R290K	R	-	2	0	GATM	43445645	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	2.600000	0.46240	0.795000	0.33922	0.655000	0.94253	AGA		PASS	0.413	GATM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254220.2	NM_001482		21	92	21	92	---	---	---	---
AP4E1	23431	broad.mit.edu	37	15	51242119	51242119	+	Silent	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr15:51242119G>C	ENST00000261842.5	+	12	1519	c.1413G>C	c.(1411-1413)ctG>ctC	p.L471L	AP4E1_ENST00000560508.1_Silent_p.L396L	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	471					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)		p.L471L(1)		breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		ATAACTTTCTGAGACTACTAG	0.333																																						uc001zyx.1																			1	Substitution - coding silent(1)		lung(1)		0						c.(1411-1413)CTG>CTC		adaptor-related protein complex 4, epsilon 1							167.0	155.0	159.0					15																	51242119		2196	4294	6490	SO:0001819	synonymous_variant	23431				intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity	g.chr15:51242119G>C	AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.1413G>C	15.37:g.51242119G>C							p.L471L	NM_007347	NP_031373	Q9UPM8	AP4E1_HUMAN		all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)	12	1443	+			471					A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Silent	SNP	ENST00000261842.5	37	c.1413G>C	CCDS32240.1																																																																																				PASS	0.333	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418656.1			7	215	7	215	---	---	---	---
HOMER2	9455	broad.mit.edu	37	15	83561500	83561500	+	Silent	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr15:83561500G>A	ENST00000304231.8	-	2	291	c.99C>T	c.(97-99)acC>acT	p.T33T	HOMER2_ENST00000399166.2_Silent_p.T33T|HOMER2_ENST00000426485.1_Silent_p.T33T|HOMER2_ENST00000450735.2_Silent_p.T33T	NM_199330.2	NP_955362.1	Q9NSB8	HOME2_HUMAN	homer homolog 2 (Drosophila)	33	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				behavioral response to cocaine (GO:0048148)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|chemical homeostasis within a tissue (GO:0048875)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.T33T(1)|p.T96T(1)		cervix(1)|endometrium(2)|lung(6)	9						AGTAGGAAACGGTGACCGCCT	0.522																																						uc002bjg.2																			2	Substitution - coding silent(2)		lung(2)		0						c.(97-99)ACC>ACT		homer 2 isoform 2							179.0	181.0	180.0					15																	83561500		2011	4178	6189	SO:0001819	synonymous_variant	9455				metabotropic glutamate receptor signaling pathway	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane		g.chr15:83561500G>A	AF093264	CCDS45334.1, CCDS45336.1	15q24.3	2008-02-05				ENSG00000103942			17513	protein-coding gene	gene with protein product		604799				9808459, 9808458	Standard	NM_199330		Approved	CPD, Cupidin, Vesl-2, HOMER-2B, HOMER-2, HOMER-2A	uc002bjg.3	Q9NSB8		ENST00000304231.8:c.99C>T	15.37:g.83561500G>A						HOMER2_uc002bjh.2_Silent_p.T33T|HOMER2_uc002bjj.2_Silent_p.T33T|HOMER2_uc002bji.2_Silent_p.T33T	p.T33T	NM_199330	NP_955362	Q9NSB8	HOME2_HUMAN			2	285	-			33			WH1.		O95269|O95349|Q9NSB6|Q9NSB7|Q9UNT7	Silent	SNP	ENST00000304231.8	37	c.99C>T	CCDS45334.1																																																																																				PASS	0.522	HOMER2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418689.1			50	237	50	237	---	---	---	---
SV2B	9899	broad.mit.edu	37	15	91795168	91795168	+	Missense_Mutation	SNP	C	C	G	rs547706465		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr15:91795168C>G	ENST00000394232.1	+	3	1041	c.571C>G	c.(571-573)Ctc>Gtc	p.L191V	SV2B_ENST00000545111.2_Missense_Mutation_p.L40V|SV2B_ENST00000330276.4_Missense_Mutation_p.L191V	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	191					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)	p.L191V(1)		NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			CTTCGCCTCCCTCTCTTCCTT	0.587																																						uc002bqv.2																			1	Substitution - Missense(1)		lung(1)	ovary(3)|central_nervous_system(2)|skin(2)|upper_aerodigestive_tract(1)	8						c.(571-573)CTC>GTC		synaptic vesicle protein 2B homolog							146.0	116.0	126.0					15																	91795168		2198	4298	6496	SO:0001583	missense	9899				neurotransmitter transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity	g.chr15:91795168C>G	AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.571C>G	15.37:g.91795168C>G	ENSP00000377779:p.Leu191Val					SV2B_uc002bqt.2_Missense_Mutation_p.L191V|SV2B_uc010uqv.1_Missense_Mutation_p.L40V|SV2B_uc002bqu.3_RNA	p.L191V	NM_014848	NP_055663	Q7L1I2	SV2B_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0895)		2	962	+	Lung NSC(78;0.0987)|all_lung(78;0.172)		191			Helical; (Potential).		B4DH30|C6G489|O94840|Q6IAR8	Missense_Mutation	SNP	ENST00000394232.1	37	c.571C>G	CCDS10370.1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.241733	0.39598	.	.	ENSG00000185518	ENST00000545111;ENST00000394232;ENST00000330276	T;T;T	0.79033	-1.23;-1.23;-1.23	5.38	4.45	0.53987	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.182790	0.49305	D	0.000144	T	0.72993	0.3530	L	0.56280	1.765	0.43588	D	0.995937	B	0.17268	0.021	B	0.30029	0.11	T	0.67094	-0.5757	10	0.28530	T	0.3	-28.5306	10.2698	0.43477	0.153:0.6996:0.1474:0.0	.	191	Q7L1I2	SV2B_HUMAN	V	40;191;191	ENSP00000443243:L40V;ENSP00000377779:L191V;ENSP00000332818:L191V	ENSP00000332818:L191V	L	+	1	0	SV2B	89596172	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.595000	0.36708	1.369000	0.46134	0.563000	0.77884	CTC		PASS	0.587	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313494.3	NM_014848		5	147	5	147	---	---	---	---
NME4	4833	broad.mit.edu	37	16	450284	450284	+	Missense_Mutation	SNP	G	G	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr16:450284G>T	ENST00000219479.2	+	5	520	c.506G>T	c.(505-507)aGc>aTc	p.S169I	DECR2_ENST00000424398.2_5'Flank|NME4_ENST00000382940.4_Missense_Mutation_p.S177I|NME4_ENST00000450036.1_Missense_Mutation_p.S99I|DECR2_ENST00000219481.5_5'Flank|DECR2_ENST00000397710.1_5'Flank|NME4_ENST00000397722.1_Missense_Mutation_p.S99I	NM_005009.2	NP_005000.1	O00746	NDKM_HUMAN	NME/NM23 nucleoside diphosphate kinase 4	169					CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|small molecule metabolic process (GO:0044281)|UTP biosynthetic process (GO:0006228)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)	p.S169I(1)		NS(1)|lung(1)|stomach(1)|urinary_tract(1)	4		Hepatocellular(16;0.00015)				TGGTTCCAGAGCAGTGAGCTG	0.652																																						uc002cgz.2																			1	Substitution - Missense(1)		lung(1)		0						c.(505-507)AGC>ATC		nucleoside diphosphate kinase 4 precursor							50.0	55.0	53.0					16																	450284		2202	4297	6499	SO:0001583	missense	4833				CTP biosynthetic process|GTP biosynthetic process|nucleobase, nucleoside and nucleotide interconversion|UTP biosynthetic process	mitochondrial inner membrane|mitochondrial intermembrane space	ATP binding|metal ion binding|nucleoside diphosphate kinase activity	g.chr16:450284G>T	Y07604	CCDS10408.1, CCDS66886.1, CCDS73797.1	16p13.3	2013-04-29	2012-05-18		ENSG00000103202	ENSG00000103202			7852	protein-coding gene	gene with protein product		601818	"""non-metastatic cells 4, protein expressed in"""			9099850, 19852809	Standard	NM_005009		Approved	nm23-H4, NM23H4, NDPKD	uc002cgz.3	O00746	OTTHUMG00000047995	ENST00000219479.2:c.506G>T	16.37:g.450284G>T	ENSP00000219479:p.Ser169Ile					NME4_uc002cgy.2_Missense_Mutation_p.S99I|NME4_uc002cha.2_RNA|DECR2_uc002chb.2_5'Flank|DECR2_uc002chc.2_5'Flank|DECR2_uc010bqv.2_5'Flank|DECR2_uc002chd.2_5'Flank	p.S169I	NM_005009	NP_005000	O00746	NDKM_HUMAN			5	537	+		Hepatocellular(16;0.00015)	169					A2IDD0|Q5U0M9	Missense_Mutation	SNP	ENST00000219479.2	37	c.506G>T	CCDS10408.1	.	.	.	.	.	.	.	.	.	.	G	17.72	3.459518	0.63401	.	.	ENSG00000103202	ENST00000397722;ENST00000219479;ENST00000382940;ENST00000450036	T;T;T;T	0.77489	0.48;-1.1;-1.1;0.48	4.98	-0.601	0.11638	.	0.828672	0.11111	N	0.598567	T	0.80401	0.4616	M	0.66297	2.02	0.09310	N	1	P	0.47302	0.893	P	0.57679	0.825	T	0.68428	-0.5411	10	0.87932	D	0	-9.6258	3.0038	0.06021	0.1494:0.2598:0.4569:0.1339	.	169	O00746	NDKM_HUMAN	I	99;169;177;99	ENSP00000380834:S99I;ENSP00000219479:S169I;ENSP00000372398:S177I;ENSP00000389048:S99I	ENSP00000219479:S169I	S	+	2	0	NME4	390285	0.005000	0.15991	0.000000	0.03702	0.998000	0.95712	1.063000	0.30567	-0.217000	0.10033	0.561000	0.74099	AGC		PASS	0.652	NME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109256.2	NM_005009		13	103	13	103	---	---	---	---
CHD9	80205	broad.mit.edu	37	16	53358634	53358634	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr16:53358634G>C	ENST00000398510.3	+	38	8608	c.8521G>C	c.(8521-8523)Gaa>Caa	p.E2841Q	CHD9_ENST00000447540.1_Missense_Mutation_p.E2826Q|CHD9_ENST00000564845.1_Missense_Mutation_p.E2825Q|CHD9_ENST00000566029.1_Missense_Mutation_p.E2825Q			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2841					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.E2842Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				TAAGTCTGTAGAAGTAAAAGA	0.393																																						uc002ehb.2																			1	Substitution - Missense(1)		lung(1)	lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7						c.(8521-8523)GAA>CAA		chromodomain helicase DNA binding protein 9							53.0	48.0	49.0					16																	53358634		1838	4077	5915	SO:0001583	missense	80205				cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding	g.chr16:53358634G>C	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.8521G>C	16.37:g.53358634G>C	ENSP00000381522:p.Glu2841Gln					CHD9_uc002egy.2_Missense_Mutation_p.E2825Q|CHD9_uc002ehc.2_Missense_Mutation_p.E2826Q|CHD9_uc002ehf.2_Missense_Mutation_p.E1939Q|CHD9_uc010cbw.2_Missense_Mutation_p.E907Q	p.E2841Q	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN			38	8685	+		all_cancers(37;0.0212)	2841					B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	ENST00000398510.3	37	c.8521G>C		.	.	.	.	.	.	.	.	.	.	G	12.55	1.971615	0.34754	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000450543	D	0.86097	-2.07	5.25	5.25	0.73442	.	0.000000	0.53938	D	0.000046	D	0.86522	0.5953	N	0.24115	0.695	0.39088	D	0.961049	D;P;D;P	0.59357	0.971;0.718;0.985;0.718	P;B;P;B	0.61533	0.572;0.275;0.89;0.275	D	0.87077	0.2163	10	0.40728	T	0.16	-20.8402	19.2109	0.93755	0.0:0.0:1.0:0.0	.	907;2826;2841;2825	C9JR69;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	Q	2826;2825;907	ENSP00000396345:E2826Q	ENSP00000381522:E2825Q	E	+	1	0	CHD9	51916135	1.000000	0.71417	0.995000	0.50966	0.984000	0.73092	4.760000	0.62235	2.611000	0.88343	0.655000	0.94253	GAA		PASS	0.393	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134		5	29	5	29	---	---	---	---
NUP93	9688	broad.mit.edu	37	16	56878437	56878437	+	Silent	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr16:56878437G>A	ENST00000308159.5	+	22	2497	c.2376G>A	c.(2374-2376)ctG>ctA	p.L792L	NUP93_ENST00000569842.1_Missense_Mutation_p.D832N|NUP93_ENST00000542526.1_Silent_p.L669L|NUP93_ENST00000564887.1_Silent_p.L669L	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	792					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.L792L(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						CCCGCACTCTGATTACCTTTG	0.498																																					Colon(33;610 796 1305 1705 38917)	uc002eka.2																			1	Substitution - coding silent(1)		lung(1)	ovary(1)|lung(1)	2						c.(2374-2376)CTG>CTA		nucleoporin 93kDa							119.0	96.0	104.0					16																	56878437		2198	4300	6498	SO:0001819	synonymous_variant	9688				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding	g.chr16:56878437G>A	D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.2376G>A	16.37:g.56878437G>A						NUP93_uc002ekb.2_Silent_p.L669L|NUP93_uc010vhi.1_Silent_p.L669L	p.L792L	NM_014669	NP_055484	Q8N1F7	NUP93_HUMAN			22	2497	+			792					B3KPQ8|Q14705	Silent	SNP	ENST00000308159.5	37	c.2376G>A	CCDS10769.1																																																																																				PASS	0.498	NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257058.4	NM_014669		10	53	10	53	---	---	---	---
PRMT7	54496	broad.mit.edu	37	16	68349904	68349904	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr16:68349904G>A	ENST00000339507.5	+	3	852	c.22G>A	c.(22-24)Gcc>Acc	p.A8T	RP11-96D1.3_ENST00000563203.1_RNA|snoU13_ENST00000458872.1_RNA|PRMT7_ENST00000449359.3_Missense_Mutation_p.A8T|PRMT7_ENST00000348497.4_Missense_Mutation_p.A8T|PRMT7_ENST00000441236.1_Missense_Mutation_p.A8T|PRMT7_ENST00000564441.1_Intron			Q9NVM4	ANM7_HUMAN	protein arginine methyltransferase 7	8					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	[myelin basic protein]-arginine N-methyltransferase activity (GO:0016277)|histone binding (GO:0042393)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.A8T(1)		endometrium(3)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|urinary_tract(1)	20		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)		CTGCAGTCGGGCCAATCCGAC	0.532																																						uc002evy.1																			1	Substitution - Missense(1)		lung(1)		0						c.(22-24)GCC>ACC		protein arginine methyltransferase 7							112.0	101.0	105.0					16																	68349904		2198	4300	6498	SO:0001583	missense	54496				cell differentiation|DNA methylation involved in gamete generation|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|spliceosomal snRNP assembly|transcription, DNA-dependent	cytosol|nucleus	[myelin basic protein]-arginine N-methyltransferase activity|histone methyltransferase activity (H4-R3 specific)|protein-arginine omega-N monomethyltransferase activity|protein-arginine omega-N symmetric methyltransferase activity|ribonucleoprotein binding	g.chr16:68349904G>A	AK001502	CCDS10866.1, CCDS54033.1	16q22.1	2008-02-05			ENSG00000132600	ENSG00000132600		"""Protein arginine methyltransferases"""	25557	protein-coding gene	gene with protein product		610087				15044439	Standard	NM_001184824		Approved	FLJ10640, KIAA1933	uc002evy.2	Q9NVM4	OTTHUMG00000137556	ENST00000339507.5:c.22G>A	16.37:g.68349904G>A	ENSP00000343103:p.Ala8Thr					PRMT7_uc002evx.1_Missense_Mutation_p.A8T|PRMT7_uc010vlg.1_Missense_Mutation_p.A8T	p.A8T	NM_019023	NP_061896	Q9NVM4	ANM7_HUMAN		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)	3	298	+		Ovarian(137;0.192)	8					B3KPR0|B3KUG9|B4E379|Q96PV5|Q9H9L0	Missense_Mutation	SNP	ENST00000339507.5	37	c.22G>A	CCDS10866.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.230675	0.39399	.	.	ENSG00000132600	ENST00000449359;ENST00000441236;ENST00000348497;ENST00000339507	T;T	0.76709	-1.04;0.94	5.82	5.82	0.92795	.	0.198085	0.53938	D	0.000054	T	0.71476	0.3344	L	0.36672	1.1	0.24807	N	0.992666	B;B;B	0.24618	0.078;0.003;0.107	B;B;B	0.29176	0.099;0.006;0.098	T	0.57613	-0.7781	10	0.22109	T	0.4	-28.6181	17.5868	0.87983	0.0:0.0:1.0:0.0	.	8;8;8	Q9NVM4-3;Q9NVM4;Q9NVM4-4	.;ANM7_HUMAN;.	T	8	ENSP00000345775:A8T;ENSP00000343103:A8T	ENSP00000343103:A8T	A	+	1	0	PRMT7	66907405	1.000000	0.71417	0.999000	0.59377	0.523000	0.34469	4.450000	0.60041	2.756000	0.94617	0.561000	0.74099	GCC		PASS	0.532	PRMT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268892.3	NM_019023		3	44	3	44	---	---	---	---
ZC3H18	124245	broad.mit.edu	37	16	88697587	88697587	+	Silent	SNP	C	C	A	rs556891447	byFrequency	TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr16:88697587C>A	ENST00000301011.5	+	18	2942	c.2742C>A	c.(2740-2742)gcC>gcA	p.A914A	ZC3H18_ENST00000452588.2_Silent_p.A938A	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	914						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.A914A(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		ATCCCGGCGCCGCCAGCACCA	0.652																																					Ovarian(121;375 2276 20373 38669)	uc002fky.2																			1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(2740-2742)GCC>GCA		zinc finger CCCH-type containing 18							44.0	44.0	44.0					16																	88697587		2198	4300	6498	SO:0001819	synonymous_variant	124245					nucleus	nucleic acid binding|zinc ion binding	g.chr16:88697587C>A	BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.2742C>A	16.37:g.88697587C>A						ZC3H18_uc010voz.1_Silent_p.A938A|ZC3H18_uc010chw.2_RNA|ZC3H18_uc002fkz.2_Silent_p.A184A	p.A914A	NM_144604	NP_653205	Q86VM9	ZCH18_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0542)	18	2942	+			914					Q96DG4|Q96MP7	Silent	SNP	ENST00000301011.5	37	c.2742C>A	CCDS10967.1	.	.	.	.	.	.	.	.	.	.	C	0.228	-1.023112	0.02061	.	.	ENSG00000158545	ENST00000289509	.	.	.	5.07	-5.98	0.02220	.	.	.	.	.	T	0.23532	0.0569	.	.	.	0.20873	N	0.999834	.	.	.	.	.	.	T	0.40850	-0.9541	5	0.87932	D	0	-1.6535	0.1392	0.00081	0.2842:0.2171:0.1693:0.3294	.	.	.	.	Q	740	.	ENSP00000289509:P740Q	P	+	2	0	ZC3H18	87225088	0.000000	0.05858	0.002000	0.10522	0.076000	0.17211	-5.635000	0.00108	-0.676000	0.05238	-1.010000	0.02471	CCG		PASS	0.652	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269168.1	NM_144604		3	63	3	63	---	---	---	---
MVD	4597	broad.mit.edu	37	16	88722562	88722562	+	Missense_Mutation	SNP	T	T	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr16:88722562T>C	ENST00000301012.3	-	5	583	c.554A>G	c.(553-555)cAa>cGa	p.Q185R	MVD_ENST00000568709.1_5'UTR	NM_002461.1	NP_002452.1	P53602	MVD1_HUMAN	mevalonate (diphospho) decarboxylase	185					cellular protein metabolic process (GO:0044267)|cholesterol biosynthetic process (GO:0006695)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|isopentenyl diphosphate biosynthetic process, mevalonate pathway (GO:0019287)|isoprenoid biosynthetic process (GO:0008299)|positive regulation of cell proliferation (GO:0008284)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|diphosphomevalonate decarboxylase activity (GO:0004163)|Hsp70 protein binding (GO:0030544)|protein homodimerization activity (GO:0042803)	p.Q185R(1)		endometrium(3)|large_intestine(1)|lung(7)|ovary(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGGGGCCACTTGCCGAGCGAT	0.687																																						uc002flg.1																			1	Substitution - Missense(1)		lung(1)		0						c.(553-555)CAA>CGA		diphosphomevalonate decarboxylase							78.0	70.0	72.0					16																	88722562		2198	4300	6498	SO:0001583	missense	4597				cholesterol biosynthetic process|positive regulation of cell proliferation	cytosol	ATP binding|diphosphomevalonate decarboxylase activity|Hsp70 protein binding|kinase activity|protein homodimerization activity	g.chr16:88722562T>C	U49260	CCDS10968.1	16q24.3	2010-04-29			ENSG00000167508	ENSG00000167508	4.1.1.33		7529	protein-coding gene	gene with protein product	"""mevalonate pyrophosphate decarboxylase"""	603236				8626466	Standard	NM_002461		Approved	MPD	uc002flg.1	P53602	OTTHUMG00000137865	ENST00000301012.3:c.554A>G	16.37:g.88722562T>C	ENSP00000301012:p.Gln185Arg					MVD_uc002flf.1_Missense_Mutation_p.Q54R	p.Q185R	NM_002461	NP_002452	P53602	MVD1_HUMAN		BRCA - Breast invasive adenocarcinoma(80;0.0478)	5	561	-			185					Q53Y65	Missense_Mutation	SNP	ENST00000301012.3	37	c.554A>G	CCDS10968.1	.	.	.	.	.	.	.	.	.	.	T	13.76	2.334573	0.41297	.	.	ENSG00000167508	ENST00000301012;ENST00000378400	T	0.48836	0.8	4.43	3.28	0.37604	Ribosomal protein S5 domain 2-type fold (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.061969	0.64402	D	0.000002	T	0.66396	0.2785	M	0.85197	2.74	0.58432	D	0.999996	P;D	0.69078	0.594;0.997	B;P	0.62435	0.129;0.902	T	0.69595	-0.5103	10	0.72032	D	0.01	-0.0431	10.6752	0.45781	0.0:0.0:0.1612:0.8388	.	185;200	P53602;Q59G80	MVD1_HUMAN;.	R	185;14	ENSP00000301012:Q185R	ENSP00000301012:Q185R	Q	-	2	0	MVD	87250063	1.000000	0.71417	1.000000	0.80357	0.346000	0.29079	5.451000	0.66632	0.625000	0.30304	0.402000	0.26972	CAA		PASS	0.687	MVD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269547.2	NM_002461		21	82	21	82	---	---	---	---
GP1BA	2811	broad.mit.edu	37	17	4836835	4836835	+	Silent	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr17:4836835C>T	ENST00000329125.5	+	2	1011	c.936C>T	c.(934-936)gtC>gtT	p.V312V		NM_000173.5	NP_000164.5	P07359	GP1BA_HUMAN	glycoprotein Ib (platelet), alpha polypeptide	312					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|fibrinolysis (GO:0042730)|platelet activation (GO:0030168)|regulation of blood coagulation (GO:0030193)|thrombin receptor signaling pathway (GO:0070493)	anchored component of external side of plasma membrane (GO:0031362)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)	p.V312V(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(5)|stomach(1)|urinary_tract(1)	20						GGACTGTGGTCAAGTTCCCCA	0.537																																						uc010vsq.1																			1	Substitution - coding silent(1)		lung(1)		0						c.(934-936)GTC>GTT		platelet glycoprotein Ib alpha polypeptide							120.0	112.0	115.0					17																	4836835		1992	4164	6156	SO:0001819	synonymous_variant	2811							g.chr17:4836835C>T		CCDS54068.1	17p13.2	2014-09-17			ENSG00000185245	ENSG00000185245		"""CD molecules"""	4439	protein-coding gene	gene with protein product		606672		GP1B		3353370	Standard	NM_000173		Approved	CD42b	uc021tnz.1	P07359	OTTHUMG00000177946	ENST00000329125.5:c.936C>T	17.37:g.4836835C>T						uc002fzn.1_RNA	p.V312V	NM_000173	NP_000164	P07359	GP1BA_HUMAN			2	1011	+			312					E7ES66|Q14441|Q16469|Q8N1F3|Q8NG39|Q9HDC7|Q9UEK1|Q9UQS4	Silent	SNP	ENST00000329125.5	37	c.936C>T	CCDS54068.1																																																																																				PASS	0.537	GP1BA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439889.1			23	129	23	129	---	---	---	---
DHRS7C	201140	broad.mit.edu	37	17	9680518	9680518	+	Missense_Mutation	SNP	C	C	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr17:9680518C>A	ENST00000330255.5	-	4	578	c.566G>T	c.(565-567)cGt>cTt	p.R189L	DHRS7C_ENST00000571134.1_Missense_Mutation_p.R188L	NM_001105571.2|NM_001220493.1	NP_001099041.1|NP_001207422.1	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C	189					regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	extracellular region (GO:0005576)|longitudinal sarcoplasmic reticulum (GO:0014801)|sarcoplasmic reticulum membrane (GO:0033017)	retinol dehydrogenase activity (GO:0004745)	p.R189L(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)	15						ACAAGTCGTACGGAACGGGAT	0.423																																						uc010vvb.1																			1	Substitution - Missense(1)		lung(1)		0						c.(565-567)CGT>CTT		dehydrogenase/reductase (SDR family) member 7C							113.0	105.0	108.0					17																	9680518		1899	4119	6018	SO:0001583	missense	201140					extracellular region	binding|oxidoreductase activity	g.chr17:9680518C>A		CCDS56020.1, CCDS58517.1	17p13.1	2011-09-20				ENSG00000184544		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	32423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 32C, member 2"""					19027726	Standard	NM_001105571		Approved	SDR32C2	uc010vvb.2	A6NNS2		ENST00000330255.5:c.566G>T	17.37:g.9680518C>A	ENSP00000327975:p.Arg189Leu					DHRS7C_uc010cof.2_Missense_Mutation_p.R188L	p.R189L	NM_001105571	NP_001099041	A6NNS2	DRS7C_HUMAN			4	566	-			189					B7ZW74|B9EJH3	Missense_Mutation	SNP	ENST00000330255.5	37	c.566G>T	CCDS56020.1	.	.	.	.	.	.	.	.	.	.	C	11.02	1.515416	0.27123	.	.	ENSG00000184544	ENST00000330255	D	0.86865	-2.18	5.05	5.05	0.67936	Short-chain dehydrogenase/reductase, conserved site (1);NAD(P)-binding domain (1);	0.109027	0.64402	D	0.000008	D	0.91236	0.7238	L	0.49126	1.545	0.80722	D	1	D;P	0.67145	0.996;0.58	D;B	0.67548	0.952;0.287	D	0.92023	0.5627	10	0.87932	D	0	.	17.3376	0.87286	0.0:1.0:0.0:0.0	.	189;185	A6NNS2;B9EJH3	DRS7C_HUMAN;.	L	189	ENSP00000327975:R189L	ENSP00000327975:R189L	R	-	2	0	DHRS7C	9621243	1.000000	0.71417	0.942000	0.38095	0.115000	0.19883	5.461000	0.66699	2.620000	0.88729	0.563000	0.77884	CGT		PASS	0.423	DHRS7C-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439863.1	XM_113912		15	51	15	51	---	---	---	---
KLHL10	317719	broad.mit.edu	37	17	39998268	39998268	+	Missense_Mutation	SNP	G	G	A	rs201335504		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr17:39998268G>A	ENST00000293303.4	+	2	541	c.388G>A	c.(388-390)Gag>Aag	p.E130K	KLHL10_ENST00000485613.1_3'UTR	NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	130					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)		p.E130K(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				GGGTTGCTGCGAGTTCCTCAA	0.507													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19905	0.0		0.0	False		,,,				2504	0.0					uc010cxr.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4						c.(388-390)GAG>AAG		kelch-like 10							122.0	113.0	116.0					17																	39998268		1992	4175	6167	SO:0001583	missense	317719					cytoplasm		g.chr17:39998268G>A	AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.388G>A	17.37:g.39998268G>A	ENSP00000293303:p.Glu130Lys					KLHL10_uc010wfv.1_Missense_Mutation_p.E124K|KLHL10_uc010wfw.1_Missense_Mutation_p.E42K	p.E130K	NM_152467	NP_689680	Q6JEL2	KLH10_HUMAN			2	530	+		Breast(137;0.000162)	130					Q6NW28|Q96MC0	Missense_Mutation	SNP	ENST00000293303.4	37	c.388G>A	CCDS42340.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	12.02	1.811765	0.32053	.	.	ENSG00000161594	ENST00000293303;ENST00000438813	T;T	0.71222	-0.55;-0.55	5.73	5.73	0.89815	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.260739	0.45126	D	0.000395	T	0.57651	0.2068	N	0.20401	0.57	0.41254	D	0.986731	B;B	0.18968	0.018;0.032	B;B	0.16289	0.01;0.015	T	0.52457	-0.8573	9	.	.	.	.	18.4703	0.90771	0.0:0.0:1.0:0.0	.	124;130	B4DXV2;Q6JEL2	.;KLH10_HUMAN	K	130;124	ENSP00000293303:E130K;ENSP00000416221:E124K	.	E	+	1	0	KLHL10	37251794	0.994000	0.37717	0.994000	0.49952	0.996000	0.88848	2.461000	0.45040	2.696000	0.92011	0.655000	0.94253	GAG		PASS	0.507	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326535.1	NM_152467		5	145	5	145	---	---	---	---
KLHL10	317719	broad.mit.edu	37	17	39998457	39998457	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr17:39998457G>C	ENST00000293303.4	+	2	730	c.577G>C	c.(577-579)Gat>Cat	p.D193H		NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	193					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)		p.D193H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				CATTGAGAAAGATGAGCTCAA	0.403																																						uc010cxr.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4						c.(577-579)GAT>CAT		kelch-like 10							92.0	82.0	85.0					17																	39998457		1877	4123	6000	SO:0001583	missense	317719					cytoplasm		g.chr17:39998457G>C	AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.577G>C	17.37:g.39998457G>C	ENSP00000293303:p.Asp193His					KLHL10_uc010wfv.1_Missense_Mutation_p.D187H|KLHL10_uc010wfw.1_Missense_Mutation_p.D105H	p.D193H	NM_152467	NP_689680	Q6JEL2	KLH10_HUMAN			2	719	+		Breast(137;0.000162)	193					Q6NW28|Q96MC0	Missense_Mutation	SNP	ENST00000293303.4	37	c.577G>C	CCDS42340.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.147496	0.77888	.	.	ENSG00000161594	ENST00000293303	T	0.75367	-0.93	5.73	5.73	0.89815	BTB/Kelch-associated (2);	0.085572	0.85682	D	0.000000	D	0.90065	0.6897	M	0.93939	3.475	0.58432	D	0.999996	D;D	0.89917	1.0;0.998	D;D	0.81914	0.995;0.946	D	0.92114	0.5698	9	.	.	.	.	18.4703	0.90771	0.0:0.0:1.0:0.0	.	187;193	B4DXV2;Q6JEL2	.;KLH10_HUMAN	H	193	ENSP00000293303:D193H	.	D	+	1	0	KLHL10	37251983	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.364000	0.79526	2.696000	0.92011	0.655000	0.94253	GAT		PASS	0.403	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326535.1	NM_152467		4	163	4	163	---	---	---	---
KLHL10	317719	broad.mit.edu	37	17	40004407	40004407	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr17:40004407G>C	ENST00000293303.4	+	5	1828	c.1675G>C	c.(1675-1677)Gac>Cac	p.D559H	RP11-156E6.1_ENST00000560400.1_RNA	NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	559				D -> G (in Ref. 2; BAB71387). {ECO:0000305}.	cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)		p.G559R(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				TGATGCTCATGACATGAGTAT	0.473																																						uc010cxr.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4						c.(1675-1677)GAC>CAC		kelch-like 10							135.0	131.0	133.0					17																	40004407		2007	4183	6190	SO:0001583	missense	317719					cytoplasm		g.chr17:40004407G>C	AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.1675G>C	17.37:g.40004407G>C	ENSP00000293303:p.Asp559His					KLHL10_uc010wfw.1_Missense_Mutation_p.D471H	p.D559H	NM_152467	NP_689680	Q6JEL2	KLH10_HUMAN			5	1817	+		Breast(137;0.000162)	559	D -> G (in Ref. 2; BAB71387).		Kelch 6.		Q6NW28|Q96MC0	Missense_Mutation	SNP	ENST00000293303.4	37	c.1675G>C	CCDS42340.1	.	.	.	.	.	.	.	.	.	.	G	17.98	3.521487	0.64747	.	.	ENSG00000161594	ENST00000293303	T	0.67345	-0.26	5.98	5.98	0.97165	Galactose oxidase, beta-propeller (1);	0.255835	0.45361	D	0.000366	T	0.82190	0.4983	M	0.75264	2.295	0.47698	D	0.999494	D	0.89917	1.0	D	0.77004	0.989	T	0.80901	-0.1175	9	.	.	.	.	19.0158	0.92894	0.0:0.0:1.0:0.0	.	559	Q6JEL2	KLH10_HUMAN	H	559	ENSP00000293303:D559H	.	D	+	1	0	KLHL10	37257933	1.000000	0.71417	0.999000	0.59377	0.918000	0.54935	5.240000	0.65378	2.838000	0.97847	0.591000	0.81541	GAC		PASS	0.473	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326535.1	NM_152467		6	155	6	155	---	---	---	---
TTC25	83538	broad.mit.edu	37	17	40087031	40087031	+	RNA	SNP	G	G	A	rs201321025	byFrequency	TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr17:40087031G>A	ENST00000591658.1	+	0	123							Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25							cytoplasm (GO:0005737)		p.E19K(2)		endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)				TTATATGGCCGAAGGCGAGCG	0.542													G|||	6	0.00119808	0.0045	0.0	5008	,	,		12913	0.0		0.0	False		,,,				2504	0.0					uc002hyj.3																			2	Substitution - Missense(2)		lung(2)	ovary(1)	1						c.(55-57)GAA>AAA		tetratricopeptide repeat domain 25		G	LYS/GLU	4,3702		0,4,1849	35.0	36.0	36.0		55	5.7	1.0	17		36	0,8196		0,0,4098	yes	missense	TTC25	NM_031421.2	56	0,4,5947	AA,AG,GG		0.0,0.1079,0.0336	probably-damaging	19/607	40087031	4,11898	1853	4098	5951			83538					cytoplasm	protein binding	g.chr17:40087031G>A	AK055498	CCDS74063.1	17q21.2	2014-08-12			ENSG00000204815	ENSG00000204815		"""Tetratricopeptide (TTC) repeat domain containing"""	25280	protein-coding gene	gene with protein product							Standard	XM_006722129		Approved	DKFZP434H0115	uc002hyj.4	Q96NG3	OTTHUMG00000175837		17.37:g.40087031G>A						TTC25_uc010cxt.2_RNA|TTC25_uc010cxs.1_Missense_Mutation_p.E19K	p.E19K	NM_031421	NP_113609	Q96NG3	TTC25_HUMAN			1	144	+		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)	19			TPR 1.		Q6NX40|Q6PJ04|Q9H0K5	Missense_Mutation	SNP	ENST00000591658.1	37	c.55G>A		.	.	.	.	.	.	.	.	.	.	G	37	6.206129	0.97376	0.001079	0.0	ENSG00000204815	ENST00000377540	.	.	.	5.65	5.65	0.86999	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.168708	0.53938	D	0.000052	T	0.77896	0.4199	M	0.72894	2.215	0.35543	D	0.803259	D;D	0.89917	0.974;1.0	P;D	0.79784	0.742;0.993	T	0.73528	-0.3954	8	0.31617	T	0.26	-52.8386	17.6706	0.88216	0.0:0.0:1.0:0.0	.	19;19	C9JGW6;Q96NG3	.;TTC25_HUMAN	K	19	.	ENSP00000366763:E19K	E	+	1	0	AC091172.1	37340557	1.000000	0.71417	0.982000	0.44146	0.950000	0.60333	6.975000	0.76128	2.941000	0.99782	0.655000	0.94253	GAA		PASS	0.542	TTC25-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000449237.1	NM_031421		5	17	5	17	---	---	---	---
SMG8	55181	broad.mit.edu	37	17	57289136	57289136	+	Missense_Mutation	SNP	A	A	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr17:57289136A>G	ENST00000543872.2	+	2	1988	c.1724A>G	c.(1723-1725)cAc>cGc	p.H575R	SMG8_ENST00000300917.5_Missense_Mutation_p.H575R|SMG8_ENST00000580498.1_Intron|SMG8_ENST00000578922.1_Missense_Mutation_p.H575R|CTD-2510F5.6_ENST00000577660.1_Intron			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	575					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)		p.H575R(1)		NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						ACTGATCAACACTGTGTGCAC	0.373																																						uc002ixi.2																			1	Substitution - Missense(1)		lung(1)		0						c.(1723-1725)CAC>CGC		SMG8 protein							103.0	92.0	96.0					17																	57289136		2203	4300	6503	SO:0001583	missense	55181				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of protein kinase activity		protein binding	g.chr17:57289136A>G	AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.1724A>G	17.37:g.57289136A>G	ENSP00000438748:p.His575Arg						p.H575R	NM_018149	NP_060619	Q8ND04	SMG8_HUMAN			1	1766	+	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)		575					Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	ENST00000543872.2	37	c.1724A>G	CCDS11615.1	.	.	.	.	.	.	.	.	.	.	A	11.69	1.714414	0.30413	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.42131	0.98;0.98	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.53997	0.1831	L	0.58101	1.795	0.58432	D	0.999997	D	0.58268	0.982	P	0.62435	0.902	T	0.50338	-0.8840	10	0.07644	T	0.81	-15.6563	15.2412	0.73471	1.0:0.0:0.0:0.0	.	575	Q8ND04	SMG8_HUMAN	R	575	ENSP00000300917:H575R;ENSP00000438748:H575R	ENSP00000300917:H575R	H	+	2	0	SMG8	54643918	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.335000	0.96500	2.184000	0.69523	0.533000	0.62120	CAC		PASS	0.373	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149		13	92	13	92	---	---	---	---
CEP131	22994	broad.mit.edu	37	17	79176050	79176050	+	Missense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr17:79176050C>T	ENST00000269392.4	-	7	1025	c.778G>A	c.(778-780)Gag>Aag	p.E260K	AZI1_ENST00000374782.3_Missense_Mutation_p.E260K|AZI1_ENST00000570482.2_5'UTR|AZI1_ENST00000450824.2_Missense_Mutation_p.E260K|AZI1_ENST00000575907.1_Missense_Mutation_p.E260K|RP11-455O6.2_ENST00000571085.1_RNA	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		260					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)	p.E260K(2)		breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CTCTCAGCCTCCTCCTCCGTC	0.662																																						uc002jzp.1																			2	Substitution - Missense(2)		lung(2)	central_nervous_system(2)|large_intestine(1)|ovary(1)	4						c.(778-780)GAG>AAG		5-azacytidine induced 1 isoform a							65.0	57.0	60.0					17																	79176050		2203	4300	6503	SO:0001583	missense	22994				cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle		g.chr17:79176050C>T																												ENST00000269392.4:c.778G>A	17.37:g.79176050C>T	ENSP00000269392:p.Glu260Lys					AZI1_uc002jzn.1_Missense_Mutation_p.E260K|AZI1_uc002jzo.1_Missense_Mutation_p.E260K|AZI1_uc010wum.1_Missense_Mutation_p.E260K	p.E260K	NM_014984	NP_055799	Q9UPN4	AZI1_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)		7	978	-	all_neural(118;0.0804)|Melanoma(429;0.242)		260					A6NHI8|B2RN11|Q96F50	Missense_Mutation	SNP	ENST00000269392.4	37	c.778G>A		.	.	.	.	.	.	.	.	.	.	C	17.97	3.517553	0.64634	.	.	ENSG00000141577	ENST00000450824;ENST00000374782;ENST00000269392	T;T;T	0.35605	1.3;1.3;1.3	5.04	4.08	0.47627	.	0.000000	0.85682	D	0.000000	T	0.57169	0.2035	M	0.68952	2.095	0.45318	D	0.998311	D;D;D;D	0.89917	1.0;1.0;1.0;0.995	D;D;D;D	0.91635	0.997;0.997;0.999;0.953	T	0.61705	-0.7008	10	0.72032	D	0.01	-31.6247	13.5103	0.61508	0.0:0.9236:0.0:0.0764	.	260;260;260;260	B2RN10;Q9UPN4;Q9UPN4-3;Q9UPN4-2	.;AZI1_HUMAN;.;.	K	260	ENSP00000393583:E260K;ENSP00000363914:E260K;ENSP00000269392:E260K	ENSP00000269392:E260K	E	-	1	0	AZI1	76790645	1.000000	0.71417	1.000000	0.80357	0.317000	0.28152	3.413000	0.52686	1.352000	0.45808	-0.126000	0.14955	GAG		PASS	0.662	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000256070.1			4	88	4	88	---	---	---	---
L3MBTL4	91133	broad.mit.edu	37	18	6241381	6241381	+	Missense_Mutation	SNP	C	C	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr18:6241381C>A	ENST00000284898.6	-	8	728	c.528G>T	c.(526-528)aaG>aaT	p.K176N	L3MBTL4_ENST00000400105.2_Missense_Mutation_p.K176N|L3MBTL4_ENST00000535782.1_5'UTR|L3MBTL4_ENST00000400104.3_Missense_Mutation_p.K176N|L3MBTL4_ENST00000317931.7_Missense_Mutation_p.K176N	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	176					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.K176N(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				TGAATAATTTCTTTGGAGCAT	0.303																																					Esophageal Squamous(41;748 902 17366 28959 43175)	uc002kmz.3																			1	Substitution - Missense(1)		lung(1)	skin(2)|pancreas(1)	3						c.(526-528)AAG>AAT		l(3)mbt-like 4							89.0	103.0	99.0					18																	6241381		2202	4296	6498	SO:0001583	missense	91133				chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr18:6241381C>A	BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.528G>T	18.37:g.6241381C>A	ENSP00000284898:p.Lys176Asn					L3MBTL4_uc010dkt.2_Missense_Mutation_p.K176N|L3MBTL4_uc002kmy.3_Missense_Mutation_p.K14N	p.K176N	NM_173464	NP_775735	Q8NA19	LMBL4_HUMAN			8	688	-		Colorectal(10;0.0249)	176			MBT 2.		A8MTL8|Q8IXS3	Missense_Mutation	SNP	ENST00000284898.6	37	c.528G>T	CCDS11839.2	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315616	0.60524	.	.	ENSG00000154655	ENST00000400105;ENST00000317931;ENST00000284898;ENST00000400104	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.37	5.37	0.77165	.	0.284257	0.29328	N	0.012466	T	0.59307	0.2184	M	0.71206	2.165	0.80722	D	1	D;D	0.76494	0.992;0.999	P;D	0.75020	0.75;0.985	T	0.57148	-0.7861	10	0.34782	T	0.22	.	10.1641	0.42868	0.0:0.9093:0.0:0.0907	.	176;176	Q8NA19;F8W9S8	LMBL4_HUMAN;.	N	176	ENSP00000382976:K176N;ENSP00000318543:K176N;ENSP00000284898:K176N;ENSP00000382975:K176N	ENSP00000284898:K176N	K	-	3	2	L3MBTL4	6231381	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	1.993000	0.40747	2.538000	0.85594	0.454000	0.30748	AAG		PASS	0.303	L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254448.2	NM_173464		40	229	40	229	---	---	---	---
ALPK2	115701	broad.mit.edu	37	18	56278980	56278980	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr18:56278980G>A	ENST00000361673.3	-	2	263	c.50C>T	c.(49-51)aCa>aTa	p.T17I		NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	17	Ig-like 1.					nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T17I(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						GGAAAGCAATGTAGATAAAAA	0.463																																						uc002lhj.3																			1	Substitution - Missense(1)		lung(1)	ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						c.(49-51)ACA>ATA		heart alpha-kinase							100.0	101.0	101.0					18																	56278980		1824	4089	5913	SO:0001583	missense	115701						ATP binding|protein serine/threonine kinase activity	g.chr18:56278980G>A	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.50C>T	18.37:g.56278980G>A	ENSP00000354991:p.Thr17Ile						p.T17I	NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN			2	264	-			17			Ig-like 1.		Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	37	c.50C>T	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	G	12.97	2.098505	0.37048	.	.	ENSG00000198796	ENST00000361673	T	0.66099	-0.19	5.68	5.68	0.88126	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.78046	0.4222	M	0.77616	2.38	0.09310	N	0.999999	D	0.71674	0.998	D	0.79784	0.993	T	0.70436	-0.4872	9	0.72032	D	0.01	-2.6528	10.7418	0.46158	0.0863:0.0:0.9137:0.0	.	17	Q86TB3	ALPK2_HUMAN	I	17	ENSP00000354991:T17I	ENSP00000354991:T17I	T	-	2	0	ALPK2	54429960	0.714000	0.27936	0.049000	0.19019	0.109000	0.19521	2.391000	0.44424	2.687000	0.91594	0.655000	0.94253	ACA		PASS	0.463	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947		36	157	36	157	---	---	---	---
TLE2	7089	broad.mit.edu	37	19	3028720	3028720	+	Nonsense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr19:3028720G>A	ENST00000262953.6	-	2	368	c.106C>T	c.(106-108)Cag>Tag	p.Q36*	TLE2_ENST00000590536.1_Nonsense_Mutation_p.Q36*|TLE2_ENST00000455444.2_5'UTR|TLE2_ENST00000426948.2_Nonsense_Mutation_p.Q49*|TLE2_ENST00000586422.1_5'Flank|TLE2_ENST00000443826.3_5'UTR|TLE2_ENST00000591529.1_Nonsense_Mutation_p.Q49*	NM_003260.4	NP_003251.2	Q04725	TLE2_HUMAN	transducin-like enhancer of split 2	36	Gln-rich.				negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)	p.Q36*(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TATTGAGCCTGAAGAAACTGG	0.672																																						uc002lww.2																			1	Substitution - Nonsense(1)		lung(1)		0						c.(106-108)CAG>TAG		transducin-like enhancer protein 2 isoform 1							47.0	54.0	52.0					19																	3028720		1798	4068	5866	SO:0001587	stop_gained	7089				negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity	g.chr19:3028720G>A	M99436	CCDS45911.1, CCDS45912.1, CCDS45913.1, CCDS74255.1	19p13.3	2014-03-07	2014-03-07					"""WD repeat domain containing"""	11838	protein-coding gene	gene with protein product	"""enhancer of split groucho 2"""	601041	"""transducin-like enhancer of split 2, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)"""			8808280	Standard	NM_003260		Approved	ESG2, GRG2, ESG, FLJ41188	uc002lww.3	Q04725		ENST00000262953.6:c.106C>T	19.37:g.3028720G>A	ENSP00000262953:p.Gln36*					TLE2_uc010dth.2_Nonsense_Mutation_p.Q36*|TLE2_uc010xhc.1_5'UTR|TLE2_uc010dti.2_Nonsense_Mutation_p.Q49*|TLE2_uc010xhd.1_Nonsense_Mutation_p.Q36*	p.Q36*	NM_003260	NP_003251	Q04725	TLE2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	2	369	-			36			Gln-rich.		B4DE03|E9PEV7|F8WCH2|Q8WVY0|Q9Y6S0	Nonsense_Mutation	SNP	ENST00000262953.6	37	c.106C>T	CCDS45911.1	.	.	.	.	.	.	.	.	.	.	G	39	7.788448	0.98489	.	.	ENSG00000065717	ENST00000262953;ENST00000450017;ENST00000426948;ENST00000439015	.	.	.	3.1	3.1	0.35709	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.7028	12.0058	0.53259	0.0:0.0:1.0:0.0	.	.	.	.	X	36;29;49;36	.	ENSP00000262953:Q36X	Q	-	1	0	TLE2	2979720	1.000000	0.71417	0.992000	0.48379	0.863000	0.49368	9.170000	0.94795	1.452000	0.47756	0.305000	0.20034	CAG		PASS	0.672	TLE2-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452194.2	NM_003260		19	101	19	101	---	---	---	---
MATK	4145	broad.mit.edu	37	19	3783854	3783854	+	Silent	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr19:3783854G>A	ENST00000310132.6	-	6	938	c.540C>T	c.(538-540)atC>atT	p.I180I	MATK_ENST00000395045.2_Silent_p.I181I|MATK_ENST00000395040.2_Silent_p.I139I|MATK_ENST00000585778.1_Silent_p.I180I	NM_139355.2	NP_647612.1	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase	180	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell proliferation (GO:0008283)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.I181I(1)|p.I180I(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	26		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGCCTCATCGATTGTGAGGT	0.682																																						uc002lyt.2																			2	Substitution - coding silent(2)		lung(2)	stomach(2)|ovary(1)|lung(1)|large_intestine(1)	5						c.(538-540)ATC>ATT		megakaryocyte-associated tyrosine kinase isoform							57.0	49.0	52.0					19																	3783854		2203	4300	6503	SO:0001819	synonymous_variant	4145				cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity	g.chr19:3783854G>A	L18974	CCDS12113.1, CCDS12114.1, CCDS42468.1	19p13.3	2013-02-14						"""SH2 domain containing"""	6906	protein-coding gene	gene with protein product	"""Csk-homologous kinase"", ""tyrosine-protein kinase CTK"", ""protein kinase HYL"", ""hematopoietic consensus tyrosine-lacking kinase"", ""tyrosylprotein kinase"", ""hydroxyaryl-protein kinase"", ""Csk-type protein tyrosine kinase"", ""HYL tyrosine kinase"", ""tyrosine kinase MATK"", ""leukocyte carboxyl-terminal src kinase related"""	600038				8288563, 7530249	Standard	NM_139355		Approved	HYLTK, CTK, HYL, Lsk, CHK, HHYLTK, DKFZp434N1212, MGC1708, MGC2101	uc002lyt.3	P42679		ENST00000310132.6:c.540C>T	19.37:g.3783854G>A						MATK_uc002lyv.2_Silent_p.I181I|MATK_uc002lyu.2_Silent_p.I139I|MATK_uc010dtq.2_Silent_p.I180I	p.I180I	NM_139355	NP_647612	P42679	MATK_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)	6	940	-		Hepatocellular(1079;0.137)	180			SH2.		B3KNZ9|Q9NST8	Silent	SNP	ENST00000310132.6	37	c.540C>T	CCDS12114.1																																																																																				PASS	0.682	MATK-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453639.1	NM_139355		13	54	13	54	---	---	---	---
MPND	84954	broad.mit.edu	37	19	4355107	4355107	+	Silent	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr19:4355107C>G	ENST00000262966.8	+	8	1000	c.933C>G	c.(931-933)ctC>ctG	p.L311L	AC007292.4_ENST00000594776.1_RNA|MPND_ENST00000599840.1_Silent_p.L311L|MPND_ENST00000359935.4_Intron|AC007292.3_ENST00000593524.1_RNA	NM_032868.4	NP_116257.2	Q8N594	MPND_HUMAN	MPN domain containing	311	MPN.						peptidase activity (GO:0008233)	p.L311L(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)	8				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		TGACGGTGCTCAGAGCCTTCC	0.677																																						uc002mae.2																			1	Substitution - coding silent(1)		lung(1)	breast(1)	1						c.(931-933)CTC>CTG		MPN domain containing isoform 1							32.0	41.0	38.0					19																	4355107		2067	4205	6272	SO:0001819	synonymous_variant	84954						peptidase activity	g.chr19:4355107C>G		CCDS42470.1, CCDS54200.1, CCDS74261.1	19p13.3	2014-08-12			ENSG00000008382				25934	protein-coding gene	gene with protein product							Standard	XM_005259663		Approved	FLJ14981	uc002mae.3	Q8N594	OTTHUMG00000181914	ENST00000262966.8:c.933C>G	19.37:g.4355107C>G						MPND_uc010dtx.2_RNA|MPND_uc002mag.2_Intron|MPND_uc002maf.2_Silent_p.L311L|MPND_uc002mah.2_Silent_p.L199L|MPND_uc002mai.2_Silent_p.L199L	p.L311L	NM_032868	NP_116257	Q8N594	MPND_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)	8	1000	+			311			MPN.		Q96SJ0|Q9Y2P1|Q9Y2P2	Silent	SNP	ENST00000262966.8	37	c.933C>G	CCDS42470.1																																																																																				PASS	0.677	MPND-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458292.1	NM_032868		9	72	9	72	---	---	---	---
FBN3	84467	broad.mit.edu	37	19	8175749	8175749	+	Missense_Mutation	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr19:8175749C>G	ENST00000600128.1	-	34	4727	c.4313G>C	c.(4312-4314)cGa>cCa	p.R1438P	FBN3_ENST00000270509.2_Missense_Mutation_p.R1438P|FBN3_ENST00000601739.1_Missense_Mutation_p.R1438P			Q75N90	FBN3_HUMAN	fibrillin 3	1438	EGF-like 22; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.R1438P(1)		NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GCCACCCCCTCGGTCCAGTTC	0.607																																						uc002mjf.2																			1	Substitution - Missense(1)		lung(1)	ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						c.(4312-4314)CGA>CCA		fibrillin 3 precursor							178.0	146.0	157.0					19																	8175749		2203	4300	6503	SO:0001583	missense	84467					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent	g.chr19:8175749C>G		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.4313G>C	19.37:g.8175749C>G	ENSP00000470498:p.Arg1438Pro						p.R1438P	NM_032447	NP_115823	Q75N90	FBN3_HUMAN			33	4334	-			1438			EGF-like 22; calcium-binding.		Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	c.4313G>C	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	C	10.21	1.287211	0.23478	.	.	ENSG00000142449	ENST00000270509	D	0.92099	-2.97	3.05	1.98	0.26296	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	T	0.76673	0.4020	N	0.01446	-0.86	0.45747	D	0.998649	B	0.13145	0.007	B	0.18871	0.023	T	0.66168	-0.5991	10	0.40728	T	0.16	.	8.6651	0.34116	0.0:0.7962:0.0:0.2038	.	1438	Q75N90	FBN3_HUMAN	P	1438	ENSP00000270509:R1438P	ENSP00000270509:R1438P	R	-	2	0	FBN3	8081749	0.818000	0.29161	0.475000	0.27278	0.486000	0.33341	1.555000	0.36277	0.385000	0.24970	0.462000	0.41574	CGA		PASS	0.607	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447		27	161	27	161	---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9009681	9009681	+	Silent	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr19:9009681G>C	ENST00000397910.4	-	39	39248	c.39045C>G	c.(39043-39045)ctC>ctG	p.L13015L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13017	SEA 7. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.L13015L(1)|p.L167L(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGTAAAGTTGAGGGTGAACG	0.498																																						uc002mkp.2																			2	Substitution - coding silent(2)		lung(2)	lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(39043-39045)CTC>CTG		mucin 16							177.0	143.0	154.0					19																	9009681		1971	4152	6123	SO:0001819	synonymous_variant	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9009681G>C	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39045C>G	19.37:g.9009681G>C						MUC16_uc010dwi.2_5'Flank|MUC16_uc010dwj.2_5'Flank|MUC16_uc010xki.1_Intron	p.L13015L	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			39	39249	-			13017			Extracellular (Potential).|SEA 7.		Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	c.39045C>G	CCDS54212.1																																																																																				PASS	0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690		4	168	4	168	---	---	---	---
QTRT1	81890	broad.mit.edu	37	19	10812667	10812667	+	Silent	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr19:10812667C>T	ENST00000250237.5	+	2	295	c.285C>T	c.(283-285)ttC>ttT	p.F95F	QTRT1_ENST00000585885.1_3'UTR	NM_031209.2	NP_112486.1	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	95					queuosine biosynthetic process (GO:0008616)|tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|queuine tRNA-ribosyltransferase activity (GO:0008479)	p.F95F(1)		large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			TCCACGGCTTCATGAATTGGC	0.582																																						uc002mpr.2																			1	Substitution - coding silent(1)		lung(1)	skin(1)	1						c.(283-285)TTC>TTT		queuine tRNA-ribosyltransferase 1							101.0	101.0	101.0					19																	10812667		2203	4300	6503	SO:0001819	synonymous_variant	81890				queuosine biosynthetic process	mitochondrion|nucleus|ribosome	metal ion binding|queuine tRNA-ribosyltransferase activity	g.chr19:10812667C>T	AF302783	CCDS12248.1	19p13.3	2014-06-11	2008-07-31		ENSG00000213339	ENSG00000213339	2.4.2.29		23797	protein-coding gene	gene with protein product	"""tRNA-guanine transglycosylase"""	609615				20354154	Standard	NM_031209		Approved	TGT	uc002mpr.3	Q9BXR0		ENST00000250237.5:c.285C>T	19.37:g.10812667C>T							p.F95F	NM_031209	NP_112486	Q9BXR0	TGT_HUMAN	Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)		2	310	+			95					B4DFM7|Q96BQ4|Q9BXQ9	Silent	SNP	ENST00000250237.5	37	c.285C>T	CCDS12248.1																																																																																				PASS	0.582	QTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452086.1	NM_031209		37	142	37	142	---	---	---	---
CCDC105	126402	broad.mit.edu	37	19	15132721	15132721	+	Missense_Mutation	SNP	G	G	A	rs144636554	byFrequency	TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr19:15132721G>A	ENST00000292574.3	+	6	1323	c.1241G>A	c.(1240-1242)cGc>cAc	p.R414H		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	414						extracellular vesicular exosome (GO:0070062)		p.R414H(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						GAGGCTGCGCGCCTCGCACAG	0.622													G|||	5	0.000998403	0.0	0.0	5008	,	,		12634	0.0		0.0	False		,,,				2504	0.0051					uc002nae.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(1240-1242)CGC>CAC		coiled-coil domain containing 105		G	HIS/ARG	0,4406		0,0,2203	46.0	51.0	50.0		1241	2.7	0.9	19	dbSNP_134	50	1,8599	1.2+/-3.3	0,1,4299	no	missense	CCDC105	NM_173482.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	414/500	15132721	1,13005	2203	4300	6503	SO:0001583	missense	126402				microtubule cytoskeleton organization	microtubule		g.chr19:15132721G>A	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1241G>A	19.37:g.15132721G>A	ENSP00000292574:p.Arg414His						p.R414H	NM_173482	NP_775753	Q8IYK2	CC105_HUMAN			6	1340	+			414					Q8N7T5|Q8NDL5	Missense_Mutation	SNP	ENST00000292574.3	37	c.1241G>A	CCDS12322.1	.	.	.	.	.	.	.	.	.	.	G	2.285	-0.363698	0.05103	0.0	1.16E-4	ENSG00000160994	ENST00000292574	T	0.02369	4.32	3.78	2.7	0.31948	.	0.243987	0.27388	N	0.019599	T	0.03220	0.0094	L	0.50919	1.6	0.24930	N	0.99192	B	0.24882	0.113	B	0.22880	0.042	T	0.31861	-0.9928	10	0.38643	T	0.18	-22.3411	7.3363	0.26611	0.1259:0.0:0.8741:0.0	.	414	Q8IYK2	CC105_HUMAN	H	414	ENSP00000292574:R414H	ENSP00000292574:R414H	R	+	2	0	CCDC105	14993721	0.028000	0.19301	0.886000	0.34754	0.307000	0.27823	0.035000	0.13797	1.973000	0.57446	0.549000	0.68633	CGC		PASS	0.622	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466293.1	NM_173482		11	68	11	68	---	---	---	---
PRX	57716	broad.mit.edu	37	19	40902362	40902362	+	Missense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr19:40902362C>T	ENST00000324001.7	-	7	2167	c.1897G>A	c.(1897-1899)Gag>Aag	p.E633K	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	633	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E633K(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGTTTCATCTCAGGGAGCTTC	0.587																																						uc002onr.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1897-1899)GAG>AAG		periaxin isoform 2							92.0	104.0	100.0					19																	40902362		2202	4300	6502	SO:0001583	missense	57716				axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding	g.chr19:40902362C>T	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.1897G>A	19.37:g.40902362C>T	ENSP00000326018:p.Glu633Lys					PRX_uc002onq.2_Missense_Mutation_p.E494K|PRX_uc002ons.2_3'UTR	p.E633K	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)		7	2166	-			633			32.|55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].		Q9BXL9|Q9HCF2	Missense_Mutation	SNP	ENST00000324001.7	37	c.1897G>A	CCDS33028.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.459567	0.43736	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.01947	4.54	2.6	1.54	0.23209	.	.	.	.	.	T	0.03178	0.0093	L	0.60455	1.87	0.18873	N	0.999983	B	0.02656	0.0	B	0.04013	0.001	T	0.37596	-0.9699	9	0.33940	T	0.23	.	8.9455	0.35756	0.0:0.8775:0.0:0.1225	.	633	Q9BXM0	PRAX_HUMAN	K	633	ENSP00000326018:E633K	ENSP00000326018:E633K	E	-	1	0	PRX	45594202	0.030000	0.19436	0.320000	0.25306	0.952000	0.60782	0.356000	0.20181	0.264000	0.21851	-0.201000	0.12746	GAG		PASS	0.587	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	NM_020956		54	285	54	285	---	---	---	---
PRX	57716	broad.mit.edu	37	19	40902675	40902675	+	Missense_Mutation	SNP	C	C	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr19:40902675C>A	ENST00000324001.7	-	7	1854	c.1584G>T	c.(1582-1584)atG>atT	p.M528I	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	528	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.M528I(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TTGGGAGTTTCATCTCCGACA	0.567																																						uc002onr.2																			1	Substitution - Missense(1)		lung(1)	ovary(2)	2						c.(1582-1584)ATG>ATT		periaxin isoform 2							82.0	94.0	90.0					19																	40902675		2202	4299	6501	SO:0001583	missense	57716				axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding	g.chr19:40902675C>A	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.1584G>T	19.37:g.40902675C>A	ENSP00000326018:p.Met528Ile					PRX_uc002onq.2_Missense_Mutation_p.M389I|PRX_uc002ons.2_3'UTR	p.M528I	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)		7	1853	-			528			15.|55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].		Q9BXL9|Q9HCF2	Missense_Mutation	SNP	ENST00000324001.7	37	c.1584G>T	CCDS33028.1	.	.	.	.	.	.	.	.	.	.	C	12.31	1.898377	0.33535	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.01854	4.6	3.72	2.68	0.31781	.	0.000000	0.49916	D	0.000121	T	0.05135	0.0137	L	0.51422	1.61	0.80722	D	1	P	0.47253	0.892	P	0.58391	0.838	T	0.54984	-0.8211	10	0.19590	T	0.45	-13.003	6.4173	0.21723	0.0:0.7095:0.1853:0.1053	.	528	Q9BXM0	PRAX_HUMAN	I	528	ENSP00000326018:M528I	ENSP00000326018:M528I	M	-	3	0	PRX	45594515	0.000000	0.05858	0.995000	0.50966	0.603000	0.37013	-0.379000	0.07437	0.783000	0.33636	0.491000	0.48974	ATG		PASS	0.567	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	NM_020956		35	186	35	186	---	---	---	---
TMEM145	284339	broad.mit.edu	37	19	42818842	42818842	+	Silent	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr19:42818842C>T	ENST00000301204.3	+	4	392	c.351C>T	c.(349-351)tcC>tcT	p.S117S	TMEM145_ENST00000598766.1_Silent_p.S127S|TMEM145_ENST00000601020.1_3'UTR	NM_173633.2	NP_775904.2	Q8NBT3	TM145_HUMAN	transmembrane protein 145	117					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)		p.S117S(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	27		Prostate(69;0.00682)				ATGCCTGGTCCGGCTGTCAGG	0.622																																						uc002otk.1																			1	Substitution - coding silent(1)		lung(1)		0						c.(349-351)TCC>TCT		transmembrane protein 145							85.0	85.0	85.0					19																	42818842		2203	4300	6503	SO:0001819	synonymous_variant	284339					integral to membrane		g.chr19:42818842C>T	AK075286	CCDS12603.1	19q13.2	2008-02-05				ENSG00000167619			26912	protein-coding gene	gene with protein product							Standard	NM_173633		Approved	FLJ90805	uc002otk.1	Q8NBT3		ENST00000301204.3:c.351C>T	19.37:g.42818842C>T							p.S117S	NM_173633	NP_775904	Q8NBT3	TM145_HUMAN			4	403	+		Prostate(69;0.00682)	117						Silent	SNP	ENST00000301204.3	37	c.351C>T	CCDS12603.1																																																																																				PASS	0.622	TMEM145-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463737.1	NM_173633		37	166	37	166	---	---	---	---
PPP1R13L	10848	broad.mit.edu	37	19	45895149	45895149	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr19:45895149G>C	ENST00000418234.2	-	8	1882	c.1804C>G	c.(1804-1806)Ccg>Gcg	p.P602A	PPP1R13L_ENST00000360957.5_Missense_Mutation_p.P602A	NM_001142502.1	NP_001135974.1	Q8WUF5	IASPP_HUMAN	protein phosphatase 1, regulatory subunit 13 like	602	Pro-rich.				apoptotic process (GO:0006915)|cardiac muscle contraction (GO:0060048)|cardiac right ventricle morphogenesis (GO:0003215)|embryonic camera-type eye development (GO:0031076)|hair cycle (GO:0042633)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|ventricular cardiac muscle tissue development (GO:0003229)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.P602A(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0182)		ATGCTCTGCGGCTGCTCTGGT	0.597																																					Pancreas(61;1447 1663 31419 50578)	uc002pbn.2																			1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(1804-1806)CCG>GCG		protein phosphatase 1, regulatory subunit 13							28.0	32.0	31.0					19																	45895149		2203	4298	6501	SO:0001583	missense	10848				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	transcription corepressor activity|transcription factor binding	g.chr19:45895149G>C	AF078036	CCDS33050.1	19q13.32	2013-01-10	2011-10-04		ENSG00000104881	ENSG00000104881		"""Ankyrin repeat domain containing"""	18838	protein-coding gene	gene with protein product		607463	"""protein phosphatase 1, regulatory (inhibitor) subunit 13 like"""			10336463	Standard	NM_006663		Approved	RAI, IASPP	uc002pbo.3	Q8WUF5		ENST00000418234.2:c.1804C>G	19.37:g.45895149G>C	ENSP00000403902:p.Pro602Ala					PPP1R13L_uc002pbm.2_Missense_Mutation_p.P181A|PPP1R13L_uc002pbo.2_Missense_Mutation_p.P602A	p.P602A	NM_006663	NP_006654	Q8WUF5	IASPP_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0182)	8	1881	-		all_neural(266;0.224)|Ovarian(192;0.231)	602			Pro-rich.		Q2PNZ9|Q5DU71|Q5I1X4|Q6P1R7|Q6PKF8|Q9Y290	Missense_Mutation	SNP	ENST00000418234.2	37	c.1804C>G	CCDS33050.1	.	.	.	.	.	.	.	.	.	.	G	9.877	1.200420	0.22121	.	.	ENSG00000104881	ENST00000418234;ENST00000360957;ENST00000221478	T;T	0.58060	0.36;0.36	4.97	4.97	0.65823	Src homology-3 domain (1);	1.178130	0.06119	N	0.668527	T	0.36663	0.0975	N	0.08118	0	0.27815	N	0.941981	B;B	0.26635	0.155;0.155	B;B	0.21360	0.034;0.021	T	0.10337	-1.0634	10	0.30078	T	0.28	.	13.7534	0.62921	0.0:0.0:1.0:0.0	.	602;181	Q8WUF5;A7YME7	IASPP_HUMAN;.	A	602;602;176	ENSP00000403902:P602A;ENSP00000354218:P602A	ENSP00000221478:P176A	P	-	1	0	PPP1R13L	50586989	1.000000	0.71417	0.956000	0.39512	0.053000	0.15095	5.088000	0.64486	2.622000	0.88805	0.449000	0.29647	CCG		PASS	0.597	PPP1R13L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457586.1	NM_006663		19	61	19	61	---	---	---	---
BBC3	27113	broad.mit.edu	37	19	47725147	47725147	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr19:47725147G>A	ENST00000439096.2	-	4	774	c.494C>T	c.(493-495)cCc>cTc	p.P165L	BBC3_ENST00000341983.4_Missense_Mutation_p.P103L|BBC3_ENST00000300880.7_Silent_p.P39P|BBC3_ENST00000449228.1_Silent_p.P199P	NM_014417.4	NP_055232.1	Q9BXH1	BBC3_HUMAN	BCL2 binding component 3	165					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|determination of adult lifespan (GO:0008340)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of growth (GO:0045926)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|release of cytochrome c from mitochondria (GO:0001836)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)		p.P199P(1)|p.P165L(1)		endometrium(1)|lung(2)|skin(1)	4		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.000179)|OV - Ovarian serous cystadenocarcinoma(262;0.00029)|Epithelial(262;0.0103)|GBM - Glioblastoma multiforme(486;0.0234)		CCAGGGTGAGGGGCGGTGCCG	0.612																																						uc002pgf.3																			2	Substitution - Missense(1)|Substitution - coding silent(1)		lung(2)		0						c.(493-495)CCC>CTC		BCL2 binding component 3 isoform 4							50.0	50.0	50.0					19																	47725147		2202	4300	6502	SO:0001583	missense	27113				activation of caspase activity|activation of pro-apoptotic gene products|cellular response to hypoxia|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|negative regulation of growth|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria|positive regulation of thymocyte apoptosis|protein insertion into mitochondrial membrane involved in induction of apoptosis|reduction of endoplasmic reticulum calcium ion concentration|release of cytochrome c from mitochondria|release of sequestered calcium ion into cytosol	cytosol|mitochondrial outer membrane	protein binding|protein binding	g.chr19:47725147G>A	AF332558	CCDS12697.1, CCDS46128.1, CCDS46129.1, CCDS46130.1	19q13.3-q13.4	2014-03-07							17868	protein-coding gene	gene with protein product		605854				11463392, 11572983	Standard	NM_001127240		Approved	JFY1, PUMA	uc002pgf.4	Q96PG8		ENST00000439096.2:c.494C>T	19.37:g.47725147G>A	ENSP00000395862:p.Pro165Leu					BBC3_uc010xyl.1_Silent_p.P199P|BBC3_uc010eky.2_Missense_Mutation_p.P103L|BBC3_uc010ekz.2_Silent_p.P39P	p.P165L	NM_014417	NP_055232	Q9BXH1	BBC3_HUMAN		all cancers(93;0.000179)|OV - Ovarian serous cystadenocarcinoma(262;0.00029)|Epithelial(262;0.0103)|GBM - Glioblastoma multiforme(486;0.0234)	4	775	-		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)	165					B9EGI3|O00171|Q96PG9	Missense_Mutation	SNP	ENST00000439096.2	37	c.494C>T	CCDS12697.1	.	.	.	.	.	.	.	.	.	.	g	13.33	2.204812	0.38905	.	.	ENSG00000105327	ENST00000439096;ENST00000341983	.	.	.	4.68	3.59	0.41128	.	0.188141	0.26163	N	0.025962	T	0.17066	0.0410	.	.	.	0.27891	N	0.939345	B;B	0.27229	0.172;0.005	B;B	0.23716	0.048;0.005	T	0.11616	-1.0580	8	0.15066	T	0.55	.	6.9424	0.24500	0.1279:0.0:0.8721:0.0	.	103;165	Q9BXH1-2;Q9BXH1	.;BBC3_HUMAN	L	165;103	.	ENSP00000341155:P103L	P	-	2	0	BBC3	52416987	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	2.787000	0.47798	2.427000	0.82271	0.655000	0.94253	CCC		PASS	0.612	BBC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466874.1	NM_014417		16	52	16	52	---	---	---	---
SIGLECL1	284369	broad.mit.edu	37	19	51770708	51770708	+	Silent	SNP	A	A	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr19:51770708A>G	ENST00000316401.7	+	5	873	c.492A>G	c.(490-492)caA>caG	p.Q164Q	CTD-3187F8.2_ENST00000597569.1_RNA|SIGLECL1_ENST00000597824.1_Silent_p.Q70Q|SIGLECL1_ENST00000593968.1_3'UTR	NM_173635.1	NP_775906.1	Q96PQ1	SIG12_HUMAN	SIGLEC family like 1	0	Ig-like V-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.Q164Q(1)									GAGCAAGCCAAGAACTTGAGA	0.453																																						uc002pwb.1																			1	Substitution - coding silent(1)		lung(1)	ovary(1)|pancreas(1)	2						c.(490-492)CAA>CAG		hypothetical protein LOC284369							116.0	115.0	116.0					19																	51770708		2203	4300	6503	SO:0001819	synonymous_variant	284369					integral to membrane		g.chr19:51770708A>G	AK097554	CCDS12827.1	19q13.33	2013-03-20	2012-07-20	2012-07-20	ENSG00000179213	ENSG00000179213			26856	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 75"", ""sialic acid binding Ig-like lectin 23, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 7"""	C19orf75, SIGLEC23P, SIGLECP7			Standard	NM_173635		Approved	FLJ40235	uc002pwb.1	Q8N7X8	OTTHUMG00000182881	ENST00000316401.7:c.492A>G	19.37:g.51770708A>G						C19orf75_uc010eov.1_RNA|C19orf75_uc010ycw.1_Silent_p.Q70Q	p.Q164Q	NM_173635	NP_775906	Q8N7X8	CS075_HUMAN			5	873	+			164					Q8IYH7	Silent	SNP	ENST00000316401.7	37	c.492A>G	CCDS12827.1																																																																																				PASS	0.453	SIGLECL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464161.2	NM_173635		42	197	42	197	---	---	---	---
PPP2R1A	5518	broad.mit.edu	37	19	52723032	52723032	+	Missense_Mutation	SNP	C	C	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr19:52723032C>G	ENST00000322088.6	+	10	1275	c.1217C>G	c.(1216-1218)cCt>cGt	p.P406R	PPP2R1A_ENST00000462990.1_Missense_Mutation_p.P227R|PPP2R1A_ENST00000444322.2_Missense_Mutation_p.P351R|CTD-2525I3.3_ENST00000593857.1_RNA	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	406	PP2A subunit C binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)	p.P406R(1)		NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		TCCCTGCTCCCTGCCATTGTG	0.612			Mis		clear cell ovarian carcinoma																																	uc002pyp.2				Dom?	yes		19	19q13.41	5518	Mis	"""protein phosphatase 2, regulatory subunit A, alpha"""			E			clear cell ovarian carcinoma		1	Substitution - Missense(1)		lung(1)	endometrium(31)|ovary(28)|lung(2)|breast(2)|skin(1)|kidney(1)|pancreas(1)	66						c.(1216-1218)CCT>CGT		alpha isoform of regulatory subunit A, protein							73.0	66.0	69.0					19																	52723032		2203	4300	6503	SO:0001583	missense	5518				ceramide metabolic process|chromosome segregation|G2/M transition of mitotic cell cycle|inactivation of MAPK activity|induction of apoptosis|negative regulation of cell growth|negative regulation of tyrosine phosphorylation of Stat3 protein|protein complex assembly|protein dephosphorylation|regulation of cell adhesion|regulation of cell differentiation|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|membrane|microtubule cytoskeleton|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction	antigen binding|protein heterodimerization activity|protein phosphatase type 2A regulator activity	g.chr19:52723032C>G		CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.1217C>G	19.37:g.52723032C>G	ENSP00000324804:p.Pro406Arg					PPP2R1A_uc010ydk.1_Missense_Mutation_p.P351R|PPP2R1A_uc002pyq.2_Missense_Mutation_p.P227R	p.P406R	NM_014225	NP_055040	P30153	2AAA_HUMAN		GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)	10	1376	+			406			HEAT 11.|PP2A subunit C binding.		Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	37	c.1217C>G	CCDS12849.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.583537	0.86748	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000444322	T;T	0.22134	1.97;1.97	4.68	4.68	0.58851	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000010	T	0.58466	0.2124	H	0.95712	3.71	0.80722	D	1	D;D	0.89917	1.0;0.995	D;P	0.72625	0.978;0.787	T	0.71998	-0.4423	10	0.87932	D	0	-21.2533	15.5205	0.75862	0.0:1.0:0.0:0.0	.	351;406	F5H3X9;P30153	.;2AAA_HUMAN	R	396;326;406;351	ENSP00000324804:P406R;ENSP00000415067:P351R	ENSP00000324804:P406R	P	+	2	0	PPP2R1A	57414844	1.000000	0.71417	0.953000	0.39169	0.998000	0.95712	6.907000	0.75724	2.605000	0.88082	0.655000	0.94253	CCT		PASS	0.612	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	NM_014225		21	67	21	67	---	---	---	---
PYGB	5834	broad.mit.edu	37	20	25239951	25239951	+	Missense_Mutation	SNP	G	G	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr20:25239951G>T	ENST00000216962.4	+	2	432	c.322G>T	c.(322-324)Gcc>Tcc	p.A108S		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	108					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)	p.A108S(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						CCTTCAGAATGCCTGCGATGA	0.522																																						uc002wup.2																			1	Substitution - Missense(1)		lung(1)	central_nervous_system(1)|skin(1)	2						c.(322-324)GCC>TCC		brain glycogen phosphorylase	Pyridoxal Phosphate(DB00114)						108.0	105.0	106.0					20																	25239951		2203	4300	6503	SO:0001583	missense	5834				glucose metabolic process|glycogen catabolic process	cytoplasm	glycogen phosphorylase activity|pyridoxal phosphate binding	g.chr20:25239951G>T		CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.322G>T	20.37:g.25239951G>T	ENSP00000216962:p.Ala108Ser						p.A108S	NM_002862	NP_002853	P11216	PYGB_HUMAN			2	431	+			108					Q96AK1|Q9NPX8	Missense_Mutation	SNP	ENST00000216962.4	37	c.322G>T	CCDS13171.1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.940253	0.34283	.	.	ENSG00000100994	ENST00000216962	D	0.86030	-2.06	4.38	4.38	0.52667	.	0.114208	0.64402	D	0.000014	T	0.78805	0.4341	L	0.41906	1.305	0.48696	D	0.999691	B	0.06786	0.001	B	0.15052	0.012	T	0.72795	-0.4185	10	0.13470	T	0.59	-15.1187	16.214	0.82191	0.0:0.0:1.0:0.0	.	108	P11216	PYGB_HUMAN	S	108	ENSP00000216962:A108S	ENSP00000216962:A108S	A	+	1	0	PYGB	25187951	1.000000	0.71417	0.836000	0.33094	0.924000	0.55760	6.040000	0.70980	2.431000	0.82371	0.655000	0.94253	GCC		PASS	0.522	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078415.2	NM_002862		8	101	8	101	---	---	---	---
BLCAP	10904	broad.mit.edu	37	20	36147493	36147493	+	Missense_Mutation	SNP	G	G	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr20:36147493G>T	ENST00000373537.2	-	2	398	c.84C>A	c.(82-84)ttC>ttA	p.F28L	BLCAP_ENST00000397131.1_Missense_Mutation_p.F28L|BLCAP_ENST00000397135.1_Missense_Mutation_p.F28L|BLCAP_ENST00000397137.1_Missense_Mutation_p.F28L|BLCAP_ENST00000414542.2_Missense_Mutation_p.F28L|NNAT_ENST00000062104.2_5'Flank|BLCAP_ENST00000397134.1_Missense_Mutation_p.F28L|NNAT_ENST00000346199.2_5'Flank	NM_001167823.1|NM_006698.3	NP_001161295.1|NP_006689.1	P62952	BLCAP_HUMAN	bladder cancer associated protein	28					apoptotic nuclear changes (GO:0030262)|cell cycle (GO:0007049)	integral component of membrane (GO:0016021)		p.F28L(1)		breast(1)|large_intestine(1)|lung(2)|stomach(1)	5		Myeloproliferative disorder(115;0.00878)				AGAAGCCCATGAACATGGAGT	0.577																																						uc002xha.2																			1	Substitution - Missense(1)		lung(1)		0						c.(82-84)TTC>TTA		bladder cancer associated protein							44.0	44.0	44.0					20																	36147493		2203	4300	6503	SO:0001583	missense	10904				apoptosis|cell cycle	integral to membrane		g.chr20:36147493G>T	AF053470	CCDS13295.1	20q11.23	2006-01-29			ENSG00000166619	ENSG00000166619			1055	protein-coding gene	gene with protein product		613110				10197429	Standard	NM_006698		Approved	BC10	uc021wdf.1	P62952	OTTHUMG00000032419	ENST00000373537.2:c.84C>A	20.37:g.36147493G>T	ENSP00000362637:p.Phe28Leu					BLCAP_uc002xhb.2_Missense_Mutation_p.F28L|BLCAP_uc002xhc.2_Missense_Mutation_p.F28L|NNAT_uc002xhd.2_5'Flank|NNAT_uc002xhe.2_5'Flank	p.F28L	NM_006698	NP_006689	P62952	BLCAP_HUMAN			2	287	-		Myeloproliferative disorder(115;0.00878)	28			Helical; (Potential).		A2A2K7|O60629|Q9D3B5	Missense_Mutation	SNP	ENST00000373537.2	37	c.84C>A	CCDS13295.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.861624	0.71949	.	.	ENSG00000166619	ENST00000373537;ENST00000397137;ENST00000414542;ENST00000397135;ENST00000397134;ENST00000397131;ENST00000432507;ENST00000445723;ENST00000414080	.	.	.	5.16	3.18	0.36537	.	0.000000	0.85682	D	0.000000	T	0.76054	0.3934	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.78314	-0.2252	8	0.87932	D	0	-8.8641	9.8799	0.41227	0.1718:0.0:0.8282:0.0	.	28	P62952	BLCAP_HUMAN	L	28	.	ENSP00000362637:F28L	F	-	3	2	BLCAP	35580907	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.549000	0.73900	1.406000	0.46857	0.585000	0.79938	TTC		PASS	0.577	BLCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079113.2	NM_006698		8	31	8	31	---	---	---	---
RTFDC1	51507	broad.mit.edu	37	20	55048360	55048360	+	Missense_Mutation	SNP	G	G	A	rs530872363		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr20:55048360G>A	ENST00000023939.4	+	2	180	c.73G>A	c.(73-75)Gac>Aac	p.D25N	RTFDC1_ENST00000484084.1_3'UTR|snoU13_ENST00000459416.1_RNA|RTFDC1_ENST00000357348.5_Missense_Mutation_p.D55N|RTFDC1_ENST00000395881.3_Missense_Mutation_p.D25N	NM_001283035.1|NM_001283036.1|NM_016407.3	NP_001269964.1|NP_001269965.1|NP_057491.2	Q9BY42	RTF2_HUMAN	replication termination factor 2 domain containing 1	25								p.D25N(1)									TTATTAGGTCGACAAAGATGC	0.338													G|||	1	0.000199681	0.0	0.0	5008	,	,		18333	0.0		0.0	False		,,,				2504	0.001					uc002xxt.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)	1						c.(73-75)GAC>AAC		hypothetical protein LOC51507							84.0	85.0	84.0					20																	55048360		2203	4300	6503	SO:0001583	missense	51507							g.chr20:55048360G>A	AF161513	CCDS13453.1, CCDS63316.1, CCDS63317.1	20q13	2012-10-29	2012-10-29	2012-10-29	ENSG00000022277	ENSG00000022277			15890	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 43"""	C20orf43			Standard	NM_001283035		Approved	HSPC164, CDAO5	uc002xxt.2	Q9BY42	OTTHUMG00000032801	ENST00000023939.4:c.73G>A	20.37:g.55048360G>A	ENSP00000023939:p.Asp25Asn					C20orf43_uc010zzf.1_Missense_Mutation_p.D55N|C20orf43_uc002xxu.2_Missense_Mutation_p.D25N|C20orf43_uc002xxv.2_Missense_Mutation_p.D25N	p.D25N	NM_016407	NP_057491	Q9BY42	CT043_HUMAN	Colorectal(105;0.202)		2	180	+			25					E1P5Z9|Q9BYL7|Q9HCV9|Q9NX29|Q9NZZ8|Q9P002|Q9UHW3	Missense_Mutation	SNP	ENST00000023939.4	37	c.73G>A	CCDS13453.1	.	.	.	.	.	.	.	.	.	.	G	35	5.487774	0.96323	.	.	ENSG00000022277	ENST00000023939;ENST00000395881;ENST00000357348;ENST00000449062	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.68220	0.2977	M	0.64260	1.97	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.994;0.994;0.997	T	0.64997	-0.6275	10	0.45353	T	0.12	-37.6505	19.8055	0.96531	0.0:0.0:1.0:0.0	.	55;25;25;25	A8MSH5;A2A2L6;B2RB99;Q9BY42	.;.;.;CT043_HUMAN	N	25;25;55;55	ENSP00000023939:D25N;ENSP00000379220:D25N;ENSP00000349906:D55N;ENSP00000400322:D55N	ENSP00000023939:D25N	D	+	1	0	C20orf43	54481767	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	8.754000	0.91642	2.780000	0.95670	0.585000	0.79938	GAC		PASS	0.338	RTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079817.2	NM_016407		16	103	16	103	---	---	---	---
RBM38	55544	broad.mit.edu	37	20	55967737	55967737	+	Missense_Mutation	SNP	G	G	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr20:55967737G>A	ENST00000356208.5	+	2	440	c.265G>A	c.(265-267)Gag>Aag	p.E89K	RP4-800J21.3_ENST00000417346.1_RNA|RBM38_ENST00000371219.2_Missense_Mutation_p.E8K|RBM38_ENST00000440234.2_Missense_Mutation_p.E89K	NM_017495.5	NP_059965.2	Q9H0Z9	RBM38_HUMAN	RNA binding motif protein 38	89	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell cycle (GO:0007049)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|regulation of myotube differentiation (GO:0010830)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E89K(1)		large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	Lung NSC(12;0.00242)|all_lung(29;0.00767)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.55e-12)|Epithelial(14;9.49e-09)|all cancers(14;5.01e-08)			GGCGGCAGCTGAGAGGGCTTG	0.677																																						uc010zzj.1																			1	Substitution - Missense(1)		lung(1)		0						c.(265-267)GAG>AAG		RNA-binding region containing protein 1 isoform							27.0	33.0	31.0					20																	55967737		1951	4161	6112	SO:0001583	missense	55544				3'-UTR-mediated mRNA stabilization|cell cycle|cell cycle arrest|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mRNA processing|negative regulation of cell proliferation|regulation of RNA splicing|RNA splicing	cytosol|cytosol|nucleus|nucleus	mRNA 3'-UTR binding|mRNA binding|nucleotide binding|RNA binding	g.chr20:55967737G>A	X75314	CCDS46617.1, CCDS46618.1	20q13.31	2013-02-12	2006-07-11	2006-07-11	ENSG00000132819	ENSG00000132819		"""RNA binding motif (RRM) containing"""	15818	protein-coding gene	gene with protein product		612428	"""RNA-binding region (RNP1, RRM) containing 1"""	RNPC1			Standard	NM_017495		Approved	HSRNASEB, SEB4D, seb4B, dJ800J21.2	uc010zzj.2	Q9H0Z9	OTTHUMG00000032820	ENST00000356208.5:c.265G>A	20.37:g.55967737G>A	ENSP00000348538:p.Glu89Lys					RBM38_uc010zzk.1_Missense_Mutation_p.E89K	p.E89K	NM_017495	NP_059965	Q9H0Z9	RBM38_HUMAN	BRCA - Breast invasive adenocarcinoma(4;1.55e-12)|Epithelial(14;9.49e-09)|all cancers(14;5.01e-08)		2	440	+	Lung NSC(12;0.00242)|all_lung(29;0.00767)|Melanoma(10;0.242)		89			RRM.		A6NDK1|A6NMU6|Q15350|Q15351|Q9BYK3|Q9BYK4	Missense_Mutation	SNP	ENST00000356208.5	37	c.265G>A	CCDS46617.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630712	0.67015	.	.	ENSG00000132819	ENST00000356208;ENST00000440234;ENST00000371219	D;D;T	0.86097	-2.07;-2.07;2.01	4.92	4.92	0.64577	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.104372	0.64402	D	0.000005	T	0.74191	0.3684	N	0.04162	-0.26	0.80722	D	1	B	0.18310	0.027	B	0.32724	0.151	T	0.68834	-0.5304	10	0.22706	T	0.39	0.0059	17.6948	0.88278	0.0:0.0:1.0:0.0	.	89	Q9H0Z9	RBM38_HUMAN	K	89;89;8	ENSP00000348538:E89K;ENSP00000407848:E89K;ENSP00000360263:E8K	ENSP00000345248:E66K	E	+	1	0	RBM38	55401143	1.000000	0.71417	0.976000	0.42696	0.951000	0.60555	7.321000	0.79088	2.258000	0.74832	0.563000	0.77884	GAG		PASS	0.677	RBM38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079843.4	NM_183425		15	48	15	48	---	---	---	---
TAF4	6874	broad.mit.edu	37	20	60578311	60578311	+	Silent	SNP	G	G	A	rs561993913		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr20:60578311G>A	ENST00000252996.4	-	9	2390	c.2391C>T	c.(2389-2391)gcC>gcT	p.A797A		NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	797					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.A797A(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CAGGTAACACGGCGGGTTTCA	0.488													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18314	0.0		0.0	False		,,,				2504	0.0					uc002ybs.2																			1	Substitution - coding silent(1)		lung(1)	ovary(2)|pancreas(1)	3						c.(2389-2391)GCC>GCT		TBP-associated factor 4							99.0	91.0	94.0					20																	60578311		2203	4300	6503	SO:0001819	synonymous_variant	6874				interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chr20:60578311G>A	Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.2391C>T	20.37:g.60578311G>A							p.A797A	NM_003185	NP_003176	O00268	TAF4_HUMAN	BRCA - Breast invasive adenocarcinoma(19;3.1e-07)		9	2391	-	Breast(26;1e-08)		797					A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Silent	SNP	ENST00000252996.4	37	c.2391C>T	CCDS33500.1																																																																																				PASS	0.488	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	NM_003185		16	94	16	94	---	---	---	---
DNMT3L	29947	broad.mit.edu	37	21	45674549	45674549	+	Missense_Mutation	SNP	G	G	C	rs532994427		TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr21:45674549G>C	ENST00000418993.1	-	8	1127	c.644C>G	c.(643-645)cCg>cGg	p.P215R	DNMT3L_ENST00000270172.3_Missense_Mutation_p.P215R	NM_175867.2	NP_787063.1	Q9UJW3	DNM3L_HUMAN	DNA (cytosine-5-)-methyltransferase 3-like	215					chorionic trophoblast cell differentiation (GO:0060718)|DNA methylation (GO:0006306)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|placenta development (GO:0001890)|positive regulation of catalytic activity (GO:0043085)|regulation of gene expression by genetic imprinting (GO:0006349)|spermatogenesis (GO:0007283)	condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)	p.P215R(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	11				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)		CAGTTGTCCCGGGTCAGAACC	0.572																																						uc002zeg.1																			1	Substitution - Missense(1)		lung(1)	skin(2)	2						c.(643-645)CCG>CGG		cytosine-5-methyltransferase 3-like protein							143.0	113.0	123.0					21																	45674549		2203	4300	6503	SO:0001583	missense	29947				DNA methylation|negative regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|metal ion binding	g.chr21:45674549G>C	AF194032	CCDS13705.1	21q22.3	2008-07-31			ENSG00000142182	ENSG00000142182			2980	protein-coding gene	gene with protein product	"""cytosine-5-methyltransferase 3-like protein"", ""human cytosine-5-methyltransferase 3-like protein"""	606588				10857753	Standard	NM_013369		Approved	MGC1090	uc002zeh.2	Q9UJW3	OTTHUMG00000086914	ENST00000418993.1:c.644C>G	21.37:g.45674549G>C	ENSP00000412862:p.Pro215Arg					DNMT3L_uc002zeh.1_Missense_Mutation_p.P215R	p.P215R	NM_175867	NP_787063	Q9UJW3	DNM3L_HUMAN		Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)	8	1128	-			215					E9PB42|Q9BUJ4	Missense_Mutation	SNP	ENST00000418993.1	37	c.644C>G	CCDS46650.1	.	.	.	.	.	.	.	.	.	.	G	2.997	-0.206900	0.06180	.	.	ENSG00000142182	ENST00000270172;ENST00000418993;ENST00000431166	T;T;T	0.76448	-1.02;-1.02;-1.02	3.92	0.527	0.17084	.	0.702090	0.13679	N	0.370310	T	0.62073	0.2398	L	0.38175	1.15	0.09310	N	1	B;B	0.22146	0.065;0.065	B;B	0.20577	0.03;0.03	T	0.44314	-0.9336	10	0.23891	T	0.37	-6.0428	4.7831	0.13211	0.1166:0.0:0.3488:0.5346	.	215;215	Q9UJW3-2;Q9UJW3	.;DNM3L_HUMAN	R	215;215;200	ENSP00000270172:P215R;ENSP00000412862:P215R;ENSP00000400242:P200R	ENSP00000270172:P215R	P	-	2	0	DNMT3L	44498977	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.238000	0.18004	0.068000	0.16574	-0.268000	0.10319	CCG		PASS	0.572	DNMT3L-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000195820.1	NM_013369		3	98	3	98	---	---	---	---
SF3A1	10291	broad.mit.edu	37	22	30735139	30735139	+	Missense_Mutation	SNP	T	T	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr22:30735139T>A	ENST00000215793.8	-	10	1631	c.1477A>T	c.(1477-1479)Atc>Ttc	p.I493F	SF3A1_ENST00000439242.1_Missense_Mutation_p.I428F	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	493					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.I493F(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						GGCTTCTGGATCTCCTCCTCA	0.512																																						uc003ahl.2																			1	Substitution - Missense(1)		lung(1)	ovary(3)|large_intestine(1)|pancreas(1)	5						c.(1477-1479)ATC>TTC		splicing factor 3a, subunit 1, 120kDa isoform 1							274.0	211.0	233.0					22																	30735139		2203	4300	6503	SO:0001583	missense	10291				nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|U2-type spliceosomal complex	protein binding|RNA binding	g.chr22:30735139T>A	X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.1477A>T	22.37:g.30735139T>A	ENSP00000215793:p.Ile493Phe						p.I493F	NM_005877	NP_005868	Q15459	SF3A1_HUMAN			10	1609	-			493					E9PAW1	Missense_Mutation	SNP	ENST00000215793.8	37	c.1477A>T	CCDS13875.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.980397	0.74474	.	.	ENSG00000099995	ENST00000439242;ENST00000215793;ENST00000536049	T;T	0.31247	1.5;1.5	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.48314	0.1493	L	0.55481	1.735	0.80722	D	1	P	0.50156	0.932	P	0.58520	0.84	T	0.41910	-0.9482	10	0.56958	D	0.05	-23.7187	16.3662	0.83325	0.0:0.0:0.0:1.0	.	493	Q15459	SF3A1_HUMAN	F	428;493;390	ENSP00000390336:I428F;ENSP00000215793:I493F	ENSP00000215793:I493F	I	-	1	0	SF3A1	29065139	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.817000	0.86213	2.274000	0.75844	0.533000	0.62120	ATC		PASS	0.512	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320916.2	NM_005877		6	291	6	291	---	---	---	---
LGALS1	3956	broad.mit.edu	37	22	38075647	38075647	+	Missense_Mutation	SNP	A	A	G			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chr22:38075647A>G	ENST00000215909.5	+	4	394	c.299A>G	c.(298-300)aAg>aGg	p.K100R	LGALS1_ENST00000489315.1_3'UTR	NM_002305.3	NP_002296.1	P09382	LEG1_HUMAN	lectin, galactoside-binding, soluble, 1	100	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)|cellular response to glucose stimulus (GO:0071333)|cellular response to organic cyclic compound (GO:0071407)|multicellular organismal response to stress (GO:0033555)|myoblast differentiation (GO:0045445)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of neuron projection development (GO:0010977)|plasma cell differentiation (GO:0002317)|positive regulation of erythrocyte aggregation (GO:0034120)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	galactoside binding (GO:0016936)|lactose binding (GO:0030395)|poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)	p.K100R(1)		endometrium(1)|large_intestine(1)|lung(1)	3	Melanoma(58;0.0574)					CTGACCGTCAAGCTGCCAGAT	0.582																																					Pancreas(23;406 890 14304 26016)	uc003atn.2																			1	Substitution - Missense(1)		lung(1)		0						c.(298-300)AAG>AGG		galectin-1							121.0	87.0	98.0					22																	38075647		2203	4300	6503	SO:0001583	missense	3956				apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of apoptosis	cytoplasm|extracellular space|proteinaceous extracellular matrix	galactoside binding|signal transducer activity	g.chr22:38075647A>G		CCDS13954.1	22q13.1	2014-01-30	2008-07-25		ENSG00000100097	ENSG00000100097		"""Lectins, galactoside-binding"", ""Endogenous ligands"""	6561	protein-coding gene	gene with protein product	"""galectin 1"""	150570				1988031, 12271131	Standard	NM_002305		Approved	GBP	uc003atn.3	P09382	OTTHUMG00000150661	ENST00000215909.5:c.299A>G	22.37:g.38075647A>G	ENSP00000215909:p.Lys100Arg						p.K100R	NM_002305	NP_002296	P09382	LEG1_HUMAN			4	396	+	Melanoma(58;0.0574)		100			Galectin.		B2R5E8|Q9UDK5	Missense_Mutation	SNP	ENST00000215909.5	37	c.299A>G	CCDS13954.1	.	.	.	.	.	.	.	.	.	.	A	11.01	1.512519	0.27123	.	.	ENSG00000100097	ENST00000215909	T	0.05649	3.41	6.08	-4.27	0.03744	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.365679	0.33477	N	0.004879	T	0.06416	0.0165	L	0.53671	1.685	0.50313	D	0.999869	B	0.02656	0.0	B	0.11329	0.006	T	0.20009	-1.0288	10	0.30854	T	0.27	-8.3052	13.3486	0.60589	0.3837:0.5542:0.0622:0.0	.	100	P09382	LEG1_HUMAN	R	100	ENSP00000215909:K100R	ENSP00000215909:K100R	K	+	2	0	LGALS1	36405593	1.000000	0.71417	0.939000	0.37840	0.147000	0.21601	1.042000	0.30303	-0.751000	0.04734	-1.236000	0.01555	AAG		PASS	0.582	LGALS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319482.1	NM_002305		16	54	16	54	---	---	---	---
ASMTL	8623	broad.mit.edu	37	X	1546948	1546948	+	Missense_Mutation	SNP	G	G	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chrX:1546948G>C	ENST00000381317.3	-	7	608	c.576C>G	c.(574-576)gaC>gaG	p.D192E	ASMTL_ENST00000416733.2_Missense_Mutation_p.D116E|ASMTL_ENST00000381333.4_Missense_Mutation_p.D176E|ASMTL_ENST00000534940.1_Missense_Mutation_p.D134E|ASMTL_ENST00000463763.1_5'UTR	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	192	MAF-like.					cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)	p.D192E(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CGTTCAGAAAGTCCCCGTGTA	0.637																																						uc004cpx.1																			1	Substitution - Missense(1)		lung(1)		0						c.(574-576)GAC>GAG		acetylserotonin O-methyltransferase-like							57.0	64.0	62.0					X																	1546948		1981	4127	6108	SO:0001583	missense	8623				melatonin biosynthetic process	cytoplasm	acetylserotonin O-methyltransferase activity	g.chrX:1546948G>C	Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.576C>G	X.37:g.1546948G>C	ENSP00000370718:p.Asp192Glu					ASMTL_uc011mhe.1_Missense_Mutation_p.D116E|ASMTL_uc004cpy.1_Missense_Mutation_p.D176E|ASMTL_uc011mhf.1_Missense_Mutation_p.D134E	p.D192E	NM_004192	NP_004183	O95671	ASML_HUMAN			7	687	-		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	192			MAF-like.		B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	Missense_Mutation	SNP	ENST00000381317.3	37	c.576C>G	CCDS43917.1	.	.	.	.	.	.	.	.	.	.	g	10.64	1.407309	0.25378	.	.	ENSG00000169093	ENST00000416733;ENST00000534940;ENST00000381333;ENST00000381317	T;T;T;T	0.03124	4.11;4.04;4.16;4.12	2.44	0.421	0.16451	.	0.000000	0.85682	U	0.000000	T	0.18425	0.0442	M	0.92833	3.35	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.02789	-1.1110	10	0.87932	D	0	.	6.2366	0.20766	0.5097:0.0:0.4903:0.0	.	116;176;192	E7ER97;O95671-2;O95671	.;.;ASML_HUMAN	E	116;134;176;192	ENSP00000410578:D116E;ENSP00000446410:D134E;ENSP00000370734:D176E;ENSP00000370718:D192E	ENSP00000370718:D192E	D	-	3	2	ASMTL	1506948	1.000000	0.71417	0.013000	0.15412	0.020000	0.10135	1.811000	0.38942	0.091000	0.17302	0.279000	0.19357	GAC		PASS	0.637	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055595.1	NM_004192		10	44	10	44	---	---	---	---
FAM47C	442444	broad.mit.edu	37	X	37026697	37026697	+	Missense_Mutation	SNP	C	C	T			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chrX:37026697C>T	ENST00000358047.3	+	1	266	c.214C>T	c.(214-216)Cgc>Tgc	p.R72C		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	72								p.R72C(2)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GCTTGTTTGTCGCCGTGACGA	0.532																																						uc004ddl.1																			2	Substitution - Missense(2)		lung(2)	ovary(3)	3						c.(214-216)CGC>TGC		hypothetical protein LOC442444							80.0	71.0	74.0					X																	37026697		2202	4300	6502	SO:0001583	missense	442444							g.chrX:37026697C>T	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.214C>T	X.37:g.37026697C>T	ENSP00000367913:p.Arg72Cys						p.R72C	NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN			1	228	+			72					Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	c.214C>T	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	C	6.581	0.475461	0.12521	.	.	ENSG00000198173	ENST00000358047	T	0.21543	2.0	0.502	-1.0	0.10196	.	.	.	.	.	T	0.14013	0.0339	L	0.60455	1.87	0.09310	N	1	P	0.34934	0.476	B	0.26864	0.074	T	0.14896	-1.0456	8	0.37606	T	0.19	.	.	.	.	.	72	Q5HY64	FA47C_HUMAN	C	72	ENSP00000367913:R72C	ENSP00000367913:R72C	R	+	1	0	FAM47C	36936618	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.750000	0.04808	-1.473000	0.01881	-0.708000	0.03648	CGC		PASS	0.532	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736		22	99	22	99	---	---	---	---
KIAA2022	340533	broad.mit.edu	37	X	73960686	73960686	+	Missense_Mutation	SNP	T	T	C			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chrX:73960686T>C	ENST00000055682.6	-	3	4317	c.3706A>G	c.(3706-3708)Aaa>Gaa	p.K1236E		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1236					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.K1236E(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						ATTTGCATTTTCTCTCCATTG	0.493																																						uc004eby.2																			1	Substitution - Missense(1)		lung(1)	ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						c.(3706-3708)AAA>GAA		hypothetical protein LOC340533							108.0	77.0	87.0					X																	73960686		2203	4300	6503	SO:0001583	missense	340533				base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity	g.chrX:73960686T>C		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.3706A>G	X.37:g.73960686T>C	ENSP00000055682:p.Lys1236Glu						p.K1236E	NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN			3	4323	-			1236					A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	c.3706A>G	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	T	16.88	3.244378	0.59103	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.28666	1.6;1.6	4.94	4.94	0.65067	.	0.344244	0.35838	N	0.002946	T	0.43634	0.1256	L	0.32530	0.975	0.49582	D	0.999803	D	0.89917	1.0	D	0.85130	0.997	T	0.41378	-0.9512	10	0.87932	D	0	-12.8564	12.3333	0.55051	0.0:0.0:0.0:1.0	.	1236	Q5QGS0	K2022_HUMAN	E	1236	ENSP00000362567:K1236E;ENSP00000055682:K1236E	ENSP00000055682:K1236E	K	-	1	0	KIAA2022	73877411	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.482000	0.81143	1.823000	0.53134	0.486000	0.48141	AAA		PASS	0.493	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537		17	79	17	79	---	---	---	---
PNMA5	114824	broad.mit.edu	37	X	152159319	152159319	+	Missense_Mutation	SNP	T	T	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chrX:152159319T>A	ENST00000439251.1	-	2	1262	c.824A>T	c.(823-825)cAc>cTc	p.H275L	PNMA5_ENST00000535214.1_Missense_Mutation_p.H275L|PNMA5_ENST00000452693.1_Missense_Mutation_p.H275L|PNMA5_ENST00000361887.5_Missense_Mutation_p.H275L	NM_001103150.1	NP_001096620.1	Q96PV4	PNMA5_HUMAN	paraneoplastic Ma antigen family member 5	275					positive regulation of apoptotic process (GO:0043065)			p.H275L(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					GGGGCTCTTGTGCACGGCTTT	0.567																																						uc010ntw.2																			1	Substitution - Missense(1)		lung(1)	ovary(1)|skin(1)	2						c.(823-825)CAC>CTC		paraneoplastic antigen like 5							55.0	55.0	55.0					X																	152159319		2203	4299	6502	SO:0001583	missense	114824				apoptosis			g.chrX:152159319T>A	AB067521	CCDS14718.1	Xq28	2012-02-09	2012-02-09		ENSG00000198883	ENSG00000198883		"""Paraneoplastic Ma antigens"""	18743	protein-coding gene	gene with protein product	"""paraneoplastic antigen family 5"""	300916	"""paraneoplastic antigen like 5"""			16214224	Standard	NM_052926		Approved	KIAA1934	uc004fgy.4	Q96PV4	OTTHUMG00000024184	ENST00000439251.1:c.824A>T	X.37:g.152159319T>A	ENSP00000388850:p.His275Leu					PNMA5_uc004fha.3_Missense_Mutation_p.H275L|PNMA5_uc010ntx.2_Missense_Mutation_p.H275L|PNMA5_uc004fgy.3_Missense_Mutation_p.H275L	p.H275L	NM_001103151	NP_001096621	Q96PV4	PNMA5_HUMAN			3	1163	-	Acute lymphoblastic leukemia(192;6.56e-05)		275					B4DI72|B7Z9Y9|Q495L5|Q8NET3	Missense_Mutation	SNP	ENST00000439251.1	37	c.824A>T	CCDS14718.1	.	.	.	.	.	.	.	.	.	.	t	10.54	1.378472	0.24944	.	.	ENSG00000198883	ENST00000361887;ENST00000535214;ENST00000439251;ENST00000452693	T;T;T;T	0.09350	2.99;2.99;2.99;2.99	3.07	1.9	0.25705	.	.	.	.	.	T	0.05227	0.0139	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.36335	-0.9752	9	0.66056	D	0.02	-4.9951	4.3446	0.11126	0.0:0.1628:0.0:0.8372	.	275	Q96PV4	PNMA5_HUMAN	L	275	ENSP00000354834:H275L;ENSP00000445775:H275L;ENSP00000388850:H275L;ENSP00000392342:H275L	ENSP00000354834:H275L	H	-	2	0	PNMA5	151909975	0.030000	0.19436	0.001000	0.08648	0.004000	0.04260	0.743000	0.26231	0.448000	0.26722	0.237000	0.17872	CAC		PASS	0.567	PNMA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060925.1	NM_052926		112	196	112	196	---	---	---	---
PDZD4	57595	broad.mit.edu	37	X	153072220	153072220	+	Missense_Mutation	SNP	C	C	A			TCGA-66-2778-01A-02D-1522-08	TCGA-66-2778-11A-01D-1522-08								Untested	Somatic	Phase_I	Capture	none			Illumina GAIIx	5215060d-5ffd-49f3-a7a7-73167e7af74a	e93edfbf-333c-4f5f-94db-96bb9941221a	g.chrX:153072220C>A	ENST00000164640.4	-	4	654	c.463G>T	c.(463-465)Gac>Tac	p.D155Y	PDZD4_ENST00000475140.1_5'UTR|PDZD4_ENST00000393758.2_Missense_Mutation_p.D80Y|PDZD4_ENST00000544474.1_Missense_Mutation_p.D46Y	NM_032512.2	NP_115901.2	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	155	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cytoplasm (GO:0005737)		p.D155Y(1)		breast(3)|cervix(1)|endometrium(5)|lung(13)|skin(1)	23	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATGCCCAGGTCCTCCTCGTCG	0.627																																						uc004fiz.1																			1	Substitution - Missense(1)		lung(1)	breast(1)	1						c.(463-465)GAC>TAC		PDZ domain containing 4							141.0	108.0	119.0					X																	153072220		2202	4300	6502	SO:0001583	missense	57595					cell cortex		g.chrX:153072220C>A	AK091444	CCDS14732.1	Xq28	2008-02-05		2006-01-24	ENSG00000067840	ENSG00000067840			21167	protein-coding gene	gene with protein product		300634		PDZK4		10819331, 15077175	Standard	NM_032512		Approved	KIAA1444, LU1, FLJ34125, PDZRN4L	uc004fiz.1	Q76G19	OTTHUMG00000024209	ENST00000164640.4:c.463G>T	X.37:g.153072220C>A	ENSP00000164640:p.Asp155Tyr					PDZD4_uc004fiy.1_Missense_Mutation_p.D80Y|PDZD4_uc004fix.2_Missense_Mutation_p.D59Y|PDZD4_uc004fja.1_Missense_Mutation_p.D161Y|PDZD4_uc011mze.1_Missense_Mutation_p.D46Y	p.D155Y	NM_032512	NP_115901	Q76G19	PDZD4_HUMAN			4	713	-	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)		155			PDZ.		B3KXB1|B7ZKY3|Q8NB75|Q9BUH9|Q9P284	Missense_Mutation	SNP	ENST00000164640.4	37	c.463G>T	CCDS14732.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.804596	0.90623	.	.	ENSG00000067840	ENST00000164640;ENST00000393758;ENST00000537633;ENST00000544474	T;T;T	0.32023	1.47;1.47;1.47	5.34	5.34	0.76211	PDZ/DHR/GLGF (4);	0.047534	0.85682	D	0.000000	T	0.62319	0.2418	M	0.86343	2.81	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.993;0.999;0.999;1.0	D;D;D;D;D	0.87578	0.998;0.985;0.992;0.993;0.998	T	0.70146	-0.4952	10	0.87932	D	0	-52.1495	16.765	0.85521	0.0:1.0:0.0:0.0	.	46;161;155;80;59	B7ZKY3;Q17RL8;Q76G19;D3DWW0;B3KVR9	.;.;PDZD4_HUMAN;.;.	Y	155;80;59;46	ENSP00000164640:D155Y;ENSP00000377355:D80Y;ENSP00000442033:D46Y	ENSP00000164640:D155Y	D	-	1	0	PDZD4	152725414	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.752000	0.85141	2.218000	0.71995	0.600000	0.82982	GAC		PASS	0.627	PDZD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061013.3	NM_032512		48	78	48	78	---	---	---	---
