#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
EXPH5	23086	broad.mit.edu	37	11	108382677	108382678	+	Frame_Shift_Ins	INS	-	-	G			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr11:108382677_108382678insG	ENST00000265843.4	-	6	3666_3667	c.3556_3557insC	c.(3556-3558)caafs	p.Q1186fs	EXPH5_ENST00000524840.1_5'Flank|EXPH5_ENST00000443411.1_Frame_Shift_Ins_p.Q998fs|EXPH5_ENST00000428840.1_Frame_Shift_Ins_p.Q1110fs|EXPH5_ENST00000525344.1_Frame_Shift_Ins_p.Q1179fs	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1186					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		AGTGTATTCTTGGAAGTTTTCC	0.416																																						ENST00000265843.4	0.800000	5.000000e-01	0.710000	0.560000	0.630000	0.645534	0.630000	0.630000																										0				91						c.(3556-3558)caafs		exophilin 5																																				SO:0001589	frameshift_variant	23086	0	0					g.chr11:108382677_108382678insG		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.3557dupC	chr11.hg19:g.108382679_108382679dupG	ENSP00000265843:p.Gln1186fs	0					EXPH5_ENST00000524840.1_5'Flank|EXPH5_ENST00000443411.1_Frame_Shift_Ins_p.Q998fs|EXPH5_ENST00000428840.1_Frame_Shift_Ins_p.Q1110fs|EXPH5_ENST00000525344.1_Frame_Shift_Ins_p.Q1179fs	p.Q1186fs	NM_015065.2	NP_055880	1	2	3	2.042490	Q8NEV8	EXPH5_HUMAN		6	3666_3667	-		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)	Q2KHM1|Q9Y4D6	Frame_Shift_Ins	INS	ENST00000265843.4	0	1	hg19	c.3556_3557insC	CCDS8341.1	0																																																																																								0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.416	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	1	0	1		2	2		0		0	0	91		91	89	1	1.940000	-2.841672	1	0.380000	NM_015065			76	77		554	550	0		1	0	0	0	0	91	0		1.000000	4.117291e-02	0	0	0	3	0	76	554
MBD6	114785	broad.mit.edu	37	12	57919654	57919666	+	Frame_Shift_Del	DEL	GGGGCCCCTGGGA	GGGGCCCCTGGGA	-			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr12:57919654_57919666delGGGGCCCCTGGGA	ENST00000355673.3	+	6	1259_1271	c.903_915delGGGGCCCCTGGGA	c.(901-915)ctggggcccctgggafs	p.LGPLG301fs	MBD6_ENST00000431731.2_Frame_Shift_Del_p.LGPLG301fs	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	301	Pro-rich.					chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						CCCTGGTCCTGGGGCCCCTGGGAGGGGCCCCCA	0.695																																						ENST00000355673.3	0.650000	3.000000e-01	0.560000	0.370000	0.460000	0.471682	0.460000	0.460000																										0				31						c.(901-915)ctggggcccctgggafs		methyl-CpG binding domain protein 6																																				SO:0001589	frameshift_variant	114785	0	0					g.chr12:57919654_57919666delGGGGCCCCTGGGA	AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.903_915delGGGGCCCCTGGGA	chr12.hg19:g.57919654_57919666delGGGGCCCCTGGGA	ENSP00000347896:p.Leu301fs	0					MBD6_ENST00000431731.2_Frame_Shift_Del_p.LGPLG301fs	p.LGPLG301fs	NM_052897.3	NP_443129.3	0	0	0	1.993904	Q96DN6	MBD6_HUMAN		6	1259_1271	+			Q8N3M0|Q8NA81|Q96Q00	Frame_Shift_Del	DEL	ENST00000355673.3	0	1	hg19	c.903_915delGGGGCCCCTGGGA	CCDS8944.1	0																																																																																								0.370431		TCGA-2J-AAB1-01A-11D-A40W-08	0.695	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407250.1	1	0	1		59	2		0		0	5	39		39	42	1	1.940000	-2.841673	1	0.380000				24	73		247	292	0		2	0	0	0	0	39	0		0.004121	9.626537e-01	0	0	0	58	0	24	247
PLEK	5341	broad.mit.edu	37	2	68622834	68622834	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr2:68622834delC	ENST00000234313.7	+	9	1118	c.939delC	c.(937-939)aacfs	p.N313fs		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	313	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		AGGAAGAGAACCTTTTTGAGA	0.542																																						ENST00000234313.7	0.790000	5.300000e-01	0.730000	0.590000	0.650000	0.664314	0.650000	0.660000																										0				24						c.(937-939)aacfs		pleckstrin							153.0	138.0	143.0					2																	68622834		2203	4300	6503	SO:0001589	frameshift_variant	5341	0	0					g.chr2:68622834delC	X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.939delC	chr2.hg19:g.68622834delC	ENSP00000234313:p.Asn313fs	0						p.N313fs	NM_002664.2	NP_002655.2	0	0	0	2.015667	P08567	PLEK_HUMAN		9	1118	+		Ovarian(717;0.0129)	B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Frame_Shift_Del	DEL	ENST00000234313.7	1	1	hg19	c.939delC	CCDS1887.1	0																																																																																								0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.542	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251755.1	1	0	1		46	2		0		0	5	121		121	118	1	1.940000	-20.000000	1	0.380000	NM_002664			86	91		597	591	0		1	0	0	0	0	121	0		0.999916	6.824359e-01	0	0	0	18	0	86	597
WDR37	22884	broad.mit.edu	37	10	1149626	1149626	+	Missense_Mutation	SNP	C	C	A	rs150728900		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr10:1149626C>A	ENST00000358220.1	+	10	955	c.811C>A	c.(811-813)Cgc>Agc	p.R271S	WDR37_ENST00000263150.4_Missense_Mutation_p.R271S			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	271										breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		CCCCACCATCCGCGTCCCACT	0.622																																						ENST00000358220.1	1.000000	7.000000e-01	1.000000	0.800000	0.910000	0.904915	0.910000	1.000000																										0				17						c.(811-813)Cgc>Agc		WD repeat domain 37							77.0	69.0	72.0					10																	1149626		2203	4300	6503	SO:0001583	missense	22884	0	0					g.chr10:1149626C>A	AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540	ENST00000358220.1:c.811C>A	chr10.hg19:g.1149626C>A	ENSP00000350954:p.Arg271Ser	0					WDR37_ENST00000263150.4_Missense_Mutation_p.R271S	p.R271S			0	1	1	2.022886	Q9Y2I8	WDR37_HUMAN		10	955	+		all_epithelial(10;0.0449)|Colorectal(49;0.142)	A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Missense_Mutation	SNP	ENST00000358220.1	1	1	hg19	c.811C>A	CCDS7057.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.976358	0.74360	.	.	ENSG00000047056	ENST00000358220;ENST00000263150	T;T	0.01265	5.08;5.08	5.95	4.98	0.66077	5.95	4.98	0.66077	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.10981	0.0268	M	0.92604	3.325	0.80722	D	1	D;D	0.63046	0.992;0.992	P;D	0.65987	0.9;0.94	T	0.00033	-1.2272	10	0.72032	D	0.01	.	13.835	0.63404	0.2572:0.7428:0.0:0.0	.	272;271	A8K976;Q9Y2I8	.;WDR37_HUMAN	S	271	ENSP00000350954:R271S;ENSP00000263150:R271S	ENSP00000263150:R271S	R	+	1	0	0	WDR37	1139626	1139626	1.000000	0.71417	0.536000	0.28039	0.675000	0.39556	2.057000	0.41365	2.811000	0.96726	0.655000	0.94253	CGC	0.378820		TCGA-2J-AAB1-01A-11D-A40W-08	0.622	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046418.1	1	0	1		2	2	2	0		0	0	47		47	46	1	1.940000	-2.733687	1	0.380000	NM_014023			52	52		246	243	1		1	1		0	0	47	0		1.000000	6.913251e-01	0	2	0	11	0	52	246
NEBL	10529	broad.mit.edu	37	10	21098813	21098813	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr10:21098813G>A	ENST00000377122.4	-	25	2929	c.2533C>T	c.(2533-2535)Cgc>Tgc	p.R845C	NEBL_ENST00000417816.2_Intron|NEBL_ENST00000377159.4_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	845	Linker.				cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)	p.R845C(1)		NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						GGATCTGTGCGCCAAACTTTG	0.383																																						ENST00000377122.4	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.998819	0.990000	1.000000																										1	Substitution - Missense(1)	p.R845C(1)	lung(1)	70						c.(2533-2535)Cgc>Tgc		nebulette							85.0	85.0	85.0					10																	21098813		2203	4300	6503	SO:0001583	missense	10529	5	121412	36				g.chr10:21098813G>A	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.2533C>T	chr10.hg19:g.21098813G>A	ENSP00000366326:p.Arg845Cys	0					NEBL_ENST00000417816.2_Intron|NEBL_ENST00000377159.4_Intron	p.R845C	NM_006393.2	NP_006384.1	0	1	1	2.022886	O76041	NEBL_HUMAN		25	2929	-			B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Missense_Mutation	SNP	ENST00000377122.4	1	1	hg19	c.2533C>T	CCDS7134.1	1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.664498	0.88251	.	.	ENSG00000078114	ENST00000377122	T	0.09538	2.97	6.05	6.05	0.98169	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.30759	0.0775	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.66351	0.943	T	0.00069	-1.2136	10	0.62326	D	0.03	.	20.6087	0.99469	0.0:0.0:1.0:0.0	.	845	O76041	NEBL_HUMAN	C	845	ENSP00000366326:R845C	ENSP00000366326:R845C	R	-	1	0	0	NEBL	21138819	21138819	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.001000	0.57046	2.866000	0.98385	0.650000	0.86243	CGC	0.378820		TCGA-2J-AAB1-01A-11D-A40W-08	0.383	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1	1	0	1		2	2	2	0		0	0	44		44	42	1	1.940000	-4.142076	1	0.380000	NM_006393			68	67		220	215	1		1			0	0	44	0		1.000000	0	0	0	0	0	0	68	220
NT5C2	22978	broad.mit.edu	37	10	104934648	104934648	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr10:104934648G>A	ENST00000404739.3	-	1	91	c.68C>T	c.(67-69)gCc>gTc	p.A23V	NT5C2_ENST00000470299.1_Missense_Mutation_p.A23V|NT5C2_ENST00000369857.4_Intron|NT5C2_ENST00000343289.5_Missense_Mutation_p.A23V			P49902	5NTC_HUMAN	5'-nucleotidase, cytosolic II	23					cell death (GO:0008219)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|nucleobase-containing small molecule metabolic process (GO:0055086)|phosphorylation (GO:0016310)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleoside phosphotransferase activity (GO:0050146)|nucleotide binding (GO:0000166)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|urinary_tract(1)	16		all_hematologic(284;0.176)|Colorectal(252;0.178)		Epithelial(162;1.33e-08)|all cancers(201;1.04e-07)|BRCA - Breast invasive adenocarcinoma(275;0.159)	Adenosine triphosphate(DB00171)|Ribavirin(DB00811)	CTTTTTCAGGGCATGCTTATC	0.378																																						ENST00000404739.3	0.100000	1.000000e-02	0.070000	0.020000	0.040000	0.061253	0.040000	0.040000																										0				16						c.(67-69)gCc>gTc		5'-nucleotidase, cytosolic II	Adenosine triphosphate(DB00171)|Ribavirin(DB00811)						237.0	220.0	226.0					10																	104934648		2203	4300	6503	SO:0001583	missense	22978	0	0					g.chr10:104934648G>A	D38524	CCDS7544.1	10q24.32	2014-03-03	2002-04-18	2002-04-19	ENSG00000076685	ENSG00000076685			8022	protein-coding gene	gene with protein product	"""purine 5' nucleotidase"""	600417	"""5'-nucleotidase (purine), cytosolic type B"""	NT5B		7999131, 24482476	Standard	NM_012229		Approved	PNT5, GMP, cN-II, SPG65	uc001kwq.3	P49902	OTTHUMG00000018981	ENST00000404739.3:c.68C>T	chr10.hg19:g.104934648G>A	ENSP00000383960:p.Ala23Val	0					NT5C2_ENST00000343289.5_Missense_Mutation_p.A23V|NT5C2_ENST00000369857.4_Intron|NT5C2_ENST00000470299.1_Missense_Mutation_p.A23V	p.A23V			1	2	3	2.036995	P49902	5NTC_HUMAN		1	91	-		all_hematologic(284;0.176)|Colorectal(252;0.178)	B7Z382|D3DR91|Q5JUV5	Missense_Mutation	SNP	ENST00000404739.3	0	1	hg19	c.68C>T	CCDS7544.1	0	.	.	.	.	.	.	.	.	.	.	G	16.87	3.240896	0.58995	.	.	ENSG00000076685	ENST00000343289;ENST00000404739;ENST00000452156	T;T;T	0.18502	2.21;2.21;2.22	5.39	4.49	0.54785	5.39	4.49	0.54785	.	0.159024	0.56097	D	0.000039	T	0.10637	0.0260	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12142	-1.0559	10	0.24483	T	0.36	-2.4411	13.313	0.60390	0.0782:0.0:0.9218:0.0	.	23	P49902	5NTC_HUMAN	V	23	ENSP00000339479:A23V;ENSP00000383960:A23V;ENSP00000396468:A23V	ENSP00000339479:A23V	A	-	2	0	0	NT5C2	104924638	104924638	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	5.904000	0.69886	1.256000	0.44068	0.650000	0.86243	GCC	0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.378	NT5C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050121.1	0	0	1		2	2	2	0		0	0	141		141	138	1	1.940000	-2.186632	0	0.380000	NM_012229			7	7		804	795	0		1	0		0	0	141	0		0.979851	1.651182e-01	0	0	0	72	0	7	804
FDX1	2230	broad.mit.edu	37	11	110327723	110327723	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr11:110327723C>A	ENST00000260270.2	+	3	630	c.392C>A	c.(391-393)aCt>aAt	p.T131N		NM_004109.4	NP_004100.1	P10109	ADX_HUMAN	ferredoxin 1	131	2Fe-2S ferredoxin-type. {ECO:0000255|PROSITE-ProRule:PRU00465}.				cholesterol metabolic process (GO:0008203)|hormone biosynthetic process (GO:0042446)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|iron ion binding (GO:0005506)			lung(2)	2		all_cancers(61;1.59e-12)|all_epithelial(67;8.38e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.01e-06)|BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|all cancers(92;5.27e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0384)|Colorectal(284;0.228)	Mitotane(DB00648)	GATGCAATCACTGATGAGGAG	0.403																																						ENST00000260270.2	0.170000	4.000000e-02	0.130000	0.060000	0.090000	0.106037	0.090000	0.090000																										0				2						c.(391-393)aCt>aAt		ferredoxin 1	Mitotane(DB00648)						259.0	223.0	236.0					11																	110327723		2201	4298	6499	SO:0001583	missense	2230	0	0					g.chr11:110327723C>A	M23668	CCDS8344.1	11q22.3	2008-02-01			ENSG00000137714	ENSG00000137714			3638	protein-coding gene	gene with protein product	"""adrenodoxin"""	103260		FDX		2969697	Standard	NM_004109		Approved	ADX	uc001pkx.3	P10109	OTTHUMG00000166589	ENST00000260270.2:c.392C>A	chr11.hg19:g.110327723C>A	ENSP00000260270:p.Thr131Asn	0						p.T131N	NM_004109.4	NP_004100.1	1	2	3	2.042490	P10109	ADX_HUMAN		3	630	+		all_cancers(61;1.59e-12)|all_epithelial(67;8.38e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)	B0YJ14|Q53YD6	Missense_Mutation	SNP	ENST00000260270.2	0	1	hg19	c.392C>A	CCDS8344.1	0	.	.	.	.	.	.	.	.	.	.	C	21.9	4.222520	0.79464	.	.	ENSG00000137714	ENST00000260270	.	.	.	5.46	4.55	0.56014	5.46	4.55	0.56014	Beta-grasp fold, ferredoxin-type (1);Ferredoxin (3);	0.049070	0.85682	D	0.000000	T	0.66886	0.2835	L	0.52759	1.655	0.49483	D	0.999795	P	0.41366	0.747	P	0.49301	0.606	T	0.66284	-0.5962	9	0.39692	T	0.17	-2.2088	16.052	0.80772	0.0:0.8654:0.1346:0.0	.	131	P10109	ADX_HUMAN	N	131	.	ENSP00000260270:T131N	T	+	2	0	0	FDX1	109832933	109832933	1.000000	0.71417	0.999000	0.59377	0.837000	0.47467	4.678000	0.61641	1.304000	0.44892	0.561000	0.74099	ACT	0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.403	FDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390590.1	0	0	1		2	2	2	0		0	0	109		109	107	1	1.940000	-3.231405	1	0.380000	NM_004109			12	12		691	678	0		1	1		0	0	109	0		0.999014	4.030271e-01	0	4	0	72	0	12	691
UBASH3B	84959	broad.mit.edu	37	11	122659916	122659916	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr11:122659916G>A	ENST00000284273.5	+	6	1255	c.880G>A	c.(880-882)Ggt>Agt	p.G294S		NM_032873.4	NP_116262.2	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing B	294	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein kinase activity (GO:0006469)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|prostate(1)|skin(2)|stomach(2)	26		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		CACCAGCGAGGGTTGGATCTA	0.532																																						ENST00000284273.5	1.000000	8.800000e-01	1.000000	0.940000	0.990000	0.979838	0.990000	1.000000																										0				26						c.(880-882)Ggt>Agt		ubiquitin associated and SH3 domain containing B							180.0	173.0	175.0					11																	122659916		2202	4299	6501	SO:0001583	missense	84959	0	0					g.chr11:122659916G>A	AB075839	CCDS31694.1	11q24.1	2010-04-28	2010-04-28		ENSG00000154127	ENSG00000154127			29884	protein-coding gene	gene with protein product	"""SH3 domain-containing 70 kDa protein, suppressor of T-cell receptor signaling 1, nm23-phosphorylated unknown substrate"""	609201				11853319, 12370296	Standard	NM_032873		Approved	KIAA1959, STS-1	uc001pyi.4	Q8TF42	OTTHUMG00000166025	ENST00000284273.5:c.880G>A	chr11.hg19:g.122659916G>A	ENSP00000284273:p.Gly294Ser	0						p.G294S	NM_032873.4	NP_116262.2	1	2	3	2.042490	Q8TF42	UBS3B_HUMAN		6	1255	+		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)	Q53GT5|Q53GT8|Q8NBV7|Q96IG9|Q96NZ2	Missense_Mutation	SNP	ENST00000284273.5	1	1	hg19	c.880G>A	CCDS31694.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.789502	0.96945	.	.	ENSG00000154127	ENST00000284273	T	0.58797	0.31	5.86	5.86	0.93980	5.86	5.86	0.93980	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.82042	0.4951	M	0.89840	3.065	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84720	0.0739	10	0.87932	D	0	-7.8749	20.1931	0.98233	0.0:0.0:1.0:0.0	.	294	Q8TF42	UBS3B_HUMAN	S	294	ENSP00000284273:G294S	ENSP00000284273:G294S	G	+	1	0	0	UBASH3B	122165126	122165126	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.476000	0.97823	2.771000	0.95319	0.563000	0.77884	GGT	0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.532	UBASH3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387499.1	1	0	1		2	2	2	0		0	0	176		176	172	1	1.940000	-20.000000	1	0.380000	NM_032873			194	191		820	810	1		1	1		0	0	176	0		1.000000	4.007568e-01	0	2	0	5	0	194	820
OR51I2	390064	broad.mit.edu	37	11	5475025	5475025	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr11:5475025C>A	ENST00000341449.2	+	1	388	c.307C>A	c.(307-309)Ctt>Att	p.L103I	HBE1_ENST00000380237.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron	NM_001004754.2	NP_001004754.1	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I, member 2	103					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCAGATGTTTCTTATTCACTT	0.483																																						ENST00000341449.2	1.000000	7.900000e-01	1.000000	0.870000	0.960000	0.946672	0.960000	1.000000																										0				29						c.(307-309)Ctt>Att		olfactory receptor, family 51, subfamily I, member 2							132.0	129.0	130.0					11																	5475025		2201	4297	6498	SO:0001583	missense	390064	0	0					g.chr11:5475025C>A	BK004381	CCDS31383.1	11p15.4	2012-08-09			ENSG00000187918	ENSG00000187918		"""GPCR / Class A : Olfactory receptors"""	15201	protein-coding gene	gene with protein product							Standard	NM_001004754		Approved		uc010qzf.2	Q9H344	OTTHUMG00000066902	ENST00000341449.2:c.307C>A	chr11.hg19:g.5475025C>A	ENSP00000341987:p.Leu103Ile	0					HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron	p.L103I	NM_001004754.2	NP_001004754.1	1	2	3	2.042490	Q9H344	O51I2_HUMAN		1	388	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	Q6IF81	Missense_Mutation	SNP	ENST00000341449.2	1	1	hg19	c.307C>A	CCDS31383.1	1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.634332	0.47049	.	.	ENSG00000187918	ENST00000341449	T	0.40756	1.02	5.57	0.255	0.15561	5.57	0.255	0.15561	GPCR, rhodopsin-like superfamily (1);	0.460534	0.20519	N	0.090739	T	0.22975	0.0555	L	0.28344	0.845	0.25272	N	0.989505	P	0.39665	0.682	B	0.31390	0.129	T	0.13202	-1.0518	10	0.87932	D	0	.	7.8771	0.29599	0.0:0.4244:0.0:0.5756	.	103	Q9H344	O51I2_HUMAN	I	103	ENSP00000341987:L103I	ENSP00000341987:L103I	L	+	1	0	0	OR51I2	5431601	5431601	0.000000	0.05858	0.991000	0.47740	0.981000	0.71138	-0.078000	0.11375	0.162000	0.19483	0.650000	0.86243	CTT	0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.483	OR51I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143385.1	1	0	1		2	2	2	0		0	0	100		100	100	1	1.940000	-20.000000	1	0.380000	NM_001004754			95	93		425	422	1		1			0	0	100	0		1.000000	0	0	0	0	0	0	95	425
OR51I2	390064	broad.mit.edu	37	11	5475027	5475027	+	Silent	SNP	T	T	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr11:5475027T>A	ENST00000341449.2	+	1	390	c.309T>A	c.(307-309)ctT>ctA	p.L103L	HBE1_ENST00000380237.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron	NM_001004754.2	NP_001004754.1	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I, member 2	103					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGATGTTTCTTATTCACTTCT	0.483																																						ENST00000341449.2	1.000000	7.600000e-01	1.000000	0.840000	0.920000	0.921979	0.920000	1.000000																										0				29						c.(307-309)ctT>ctA		olfactory receptor, family 51, subfamily I, member 2							132.0	128.0	129.0					11																	5475027		2201	4297	6498	SO:0001819	synonymous_variant	390064	0	0					g.chr11:5475027T>A	BK004381	CCDS31383.1	11p15.4	2012-08-09			ENSG00000187918	ENSG00000187918		"""GPCR / Class A : Olfactory receptors"""	15201	protein-coding gene	gene with protein product							Standard	NM_001004754		Approved		uc010qzf.2	Q9H344	OTTHUMG00000066902	ENST00000341449.2:c.309T>A	chr11.hg19:g.5475027T>A		0					HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron	p.L103L	NM_001004754.2	NP_001004754.1	1	2	3	2.042490	Q9H344	O51I2_HUMAN		1	390	+		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)	Q6IF81	Silent	SNP	ENST00000341449.2	1	1	hg19	c.309T>A	CCDS31383.1	1																																																																																								0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.483	OR51I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143385.1	1	0	1		2	2	2	0		0	0	101		101	101	1	1.940000	-20.000000	1	0.380000	NM_001004754			92	91		431	428	1		1			0	0	101	0		1.000000	0	0	0	0	0	0	92	431
OR8J3	81168	broad.mit.edu	37	11	55905125	55905125	+	Missense_Mutation	SNP	G	G	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr11:55905125G>T	ENST00000301529.1	-	1	69	c.70C>A	c.(70-72)Cag>Aag	p.Q24K		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					AGGGGAATCTGGAGCTCTGGA	0.488																																						ENST00000301529.1	1.000000	8.800000e-01	1.000000	0.960000	0.990000	0.986273	0.990000	1.000000																										0				59						c.(70-72)Cag>Aag		olfactory receptor, family 8, subfamily J, member 3							117.0	117.0	117.0					11																	55905125		2201	4296	6497	SO:0001583	missense	81168	0	0					g.chr11:55905125G>T		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.70C>A	chr11.hg19:g.55905125G>T	ENSP00000301529:p.Gln24Lys	0						p.Q24K	NM_001004064.1	NP_001004064.1	1	2	3	2.042490	Q8NGG0	OR8J3_HUMAN		1	69	-	Esophageal squamous(21;0.00693)		Q6IFB6|Q96RC2	Missense_Mutation	SNP	ENST00000301529.1	1	1	hg19	c.70C>A	CCDS31520.1	1	.	.	.	.	.	.	.	.	.	.	G	15.62	2.887120	0.52014	.	.	ENSG00000167822	ENST00000301529	T	0.00591	6.35	3.26	3.26	0.37387	3.26	3.26	0.37387	.	0.000000	0.64402	D	0.000017	T	0.00998	0.0033	L	0.51422	1.61	0.21782	N	0.999543	P	0.47350	0.894	P	0.49853	0.624	T	0.51834	-0.8655	10	0.48119	T	0.1	.	8.7991	0.34898	0.0:0.1604:0.6748:0.1647	.	24	Q8NGG0	OR8J3_HUMAN	K	24	ENSP00000301529:Q24K	ENSP00000301529:Q24K	Q	-	1	0	0	OR8J3	55661701	55661701	0.879000	0.30193	0.274000	0.24659	0.245000	0.25701	1.766000	0.38491	1.548000	0.49413	0.289000	0.19496	CAG	0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.488	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	1	0	1		2	2	2	0		0	0	104		104	104	1	1.940000	-3.384226	1	0.380000	NM_001004064			110	109		441	430	1		1			0	0	104	0		1.000000	0	0	0	0	0	0	110	441
DNAJC4	3338	broad.mit.edu	37	11	63999972	63999972	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr11:63999972G>A	ENST00000321685.3	+	4	716	c.251G>A	c.(250-252)cGt>cAt	p.R84H	DNAJC4_ENST00000321460.5_Missense_Mutation_p.R84H|VEGFB_ENST00000426086.2_5'Flank|DNAJC4_ENST00000355040.4_Intron|RP11-783K16.14_ENST00000534988.1_RNA|VEGFB_ENST00000309422.2_5'Flank|RP11-783K16.14_ENST00000539963.1_RNA	NM_005528.3	NP_005519.2	Q9NNZ3	DNJC4_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 4	84	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	unfolded protein binding (GO:0051082)			endometrium(1)|lung(1)|prostate(1)	3						GAGGCATACCGTGTGCTCAGC	0.632																																						ENST00000321685.3	0.410000	9.000000e-02	0.300000	0.140000	0.200000	0.227048	0.200000	0.200000																										0				3						c.(250-252)cGt>cAt		DnaJ (Hsp40) homolog, subfamily C, member 4							65.0	75.0	72.0					11																	63999972		2115	4223	6338	SO:0001583	missense	3338	1	121126	26				g.chr11:63999972G>A	AF012106	CCDS41666.1	11q13	2011-09-02			ENSG00000110011	ENSG00000110011		"""Heat shock proteins / DNAJ (HSP40)"""	5271	protein-coding gene	gene with protein product		604189		HSPF2		9473517, 11147971	Standard	NM_005528		Approved	MCG18	uc001nys.3	Q9NNZ3	OTTHUMG00000167792	ENST00000321685.3:c.251G>A	chr11.hg19:g.63999972G>A	ENSP00000396896:p.Arg84His	0					RP11-783K16.14_ENST00000539963.1_RNA|VEGFB_ENST00000309422.2_5'Flank|VEGFB_ENST00000426086.2_5'Flank|DNAJC4_ENST00000355040.4_Intron|RP11-783K16.14_ENST00000534988.1_RNA|DNAJC4_ENST00000321460.5_Missense_Mutation_p.R84H	p.R84H	NM_005528.3	NP_005519.2	1	2	3	2.042490	Q9NNZ3	DNJC4_HUMAN		4	716	+			O14716	Missense_Mutation	SNP	ENST00000321685.3	1	1	hg19	c.251G>A	CCDS41666.1	0	.	.	.	.	.	.	.	.	.	.	G	11.20	1.569823	0.28003	.	.	ENSG00000110011	ENST00000321685;ENST00000321460	T;T	0.29917	1.55;1.55	4.04	-6.62	0.01813	4.04	-6.62	0.01813	Heat shock protein DnaJ, N-terminal (5);	0.346876	0.25135	N	0.032869	T	0.14614	0.0353	N	0.25890	0.77	0.25398	N	0.98846	P;B	0.38565	0.637;0.029	B;B	0.25506	0.061;0.011	T	0.02220	-1.1193	10	0.59425	D	0.04	-0.004	15.2131	0.73241	0.2268:0.0:0.7732:0.0	.	84;84	Q6PIN0;Q9NNZ3	.;DNJC4_HUMAN	H	84	ENSP00000396896:R84H;ENSP00000320548:R84H	ENSP00000320548:R84H	R	+	2	0	0	DNAJC4	63756548	63756548	0.063000	0.20901	0.002000	0.10522	0.787000	0.44495	0.222000	0.17699	-1.482000	0.01860	-0.448000	0.05591	CGT	0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.632	DNAJC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396305.1	1	0	1		2	2	2	0		0	0	35		35	35	1	1.940000	-9.110572	1	0.380000				7	7		182	179	0		1	1		0	0	35	0		0.980095	9.383940e-01	0	7	0	124	0	7	182
UBASH3B	84959	broad.mit.edu	37	11	122667627	122667627	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr11:122667627A>G	ENST00000284273.5	+	9	1618	c.1243A>G	c.(1243-1245)Ata>Gta	p.I415V		NM_032873.4	NP_116262.2	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing B	415	Protein tyrosine phosphatase. {ECO:0000250}.				negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein kinase activity (GO:0006469)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|prostate(1)|skin(2)|stomach(2)	26		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		AGGCCGCTACATACGCACCAA	0.473																																						ENST00000284273.5	0.460000	1.600000e-01	0.360000	0.210000	0.280000	0.298889	0.280000	0.280000																										0				26						c.(1243-1245)Ata>Gta		ubiquitin associated and SH3 domain containing B							164.0	131.0	143.0					11																	122667627		2202	4299	6501	SO:0001583	missense	84959	0	0					g.chr11:122667627A>G	AB075839	CCDS31694.1	11q24.1	2010-04-28	2010-04-28		ENSG00000154127	ENSG00000154127			29884	protein-coding gene	gene with protein product	"""SH3 domain-containing 70 kDa protein, suppressor of T-cell receptor signaling 1, nm23-phosphorylated unknown substrate"""	609201				11853319, 12370296	Standard	NM_032873		Approved	KIAA1959, STS-1	uc001pyi.4	Q8TF42	OTTHUMG00000166025	ENST00000284273.5:c.1243A>G	chr11.hg19:g.122667627A>G	ENSP00000284273:p.Ile415Val	0						p.I415V	NM_032873.4	NP_116262.2	1	2	3	2.042490	Q8TF42	UBS3B_HUMAN		9	1618	+		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)	Q53GT5|Q53GT8|Q8NBV7|Q96IG9|Q96NZ2	Missense_Mutation	SNP	ENST00000284273.5	1	1	hg19	c.1243A>G	CCDS31694.1	0	.	.	.	.	.	.	.	.	.	.	A	8.583	0.882830	0.17467	.	.	ENSG00000154127	ENST00000284273	T	0.04917	3.53	5.94	3.61	0.41365	5.94	3.61	0.41365	Histidine phosphatase superfamily, clade-1 (1);	0.337134	0.34110	N	0.004260	T	0.01835	0.0058	N	0.00677	-1.265	0.31402	N	0.676504	B	0.02656	0.0	B	0.01281	0.0	T	0.33343	-0.9872	10	0.15066	T	0.55	-1.7035	9.0924	0.36619	0.6732:0.0:0.3268:0.0	.	415	Q8TF42	UBS3B_HUMAN	V	415	ENSP00000284273:I415V	ENSP00000284273:I415V	I	+	1	0	0	UBASH3B	122172837	122172837	0.980000	0.34600	0.994000	0.49952	0.906000	0.53458	0.760000	0.26475	0.495000	0.27882	0.528000	0.53228	ATA	0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.473	UBASH3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387499.1	1	0	1		2	2	2	0		0	0	74		74	73	1	1.940000	-18.273270	1	0.380000	NM_032873			16	16		288	284	0		1	0		0	0	74	0		0.999932	1.057222e-01	0	0	0	10	0	16	288
TMEM116	89894	broad.mit.edu	37	12	112374530	112374530	+	Missense_Mutation	SNP	A	A	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr12:112374530A>T	ENST00000550831.3	-	7	646	c.278T>A	c.(277-279)cTg>cAg	p.L93Q	TMEM116_ENST00000354825.3_Missense_Mutation_p.L93Q|TMEM116_ENST00000355445.3_Missense_Mutation_p.L150Q|TMEM116_ENST00000552374.2_Missense_Mutation_p.L185Q|TMEM116_ENST00000549537.2_Intron|TMEM116_ENST00000437003.2_Missense_Mutation_p.L93Q	NM_138341.2	NP_612350.1	Q8NCL8	TM116_HUMAN	transmembrane protein 116	93						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(1)	8						AAAGCTGCCCAGGAAAATGGC	0.478																																						ENST00000550831.3	1.000000	7.300000e-01	1.000000	0.840000	0.950000	0.934309	0.950000	1.000000																										0				8						c.(277-279)cTg>cAg		transmembrane protein 116							139.0	123.0	128.0					12																	112374530		2203	4300	6503	SO:0001583	missense	89894	0	0					g.chr12:112374530A>T	AK074648	CCDS9157.1, CCDS55886.1, CCDS55887.1	12q24.13	2012-03-02			ENSG00000198270	ENSG00000198270			25084	protein-coding gene	gene with protein product						12477932	Standard	NM_001193453		Approved	FLJ90167	uc001ttd.2	Q8NCL8	OTTHUMG00000169606	ENST00000550831.3:c.278T>A	chr12.hg19:g.112374530A>T	ENSP00000450377:p.Leu93Gln	0					TMEM116_ENST00000552374.2_Missense_Mutation_p.L185Q|TMEM116_ENST00000354825.3_Missense_Mutation_p.L93Q|TMEM116_ENST00000437003.2_Missense_Mutation_p.L93Q|TMEM116_ENST00000549537.2_Intron|TMEM116_ENST00000355445.3_Missense_Mutation_p.L150Q	p.L93Q	NM_138341.2	NP_612350.1	0	0	0	1.993904	Q8NCL8	TM116_HUMAN		7	646	-			G3V1W7|G5E985|Q6NSH5|Q8IZ66	Missense_Mutation	SNP	ENST00000550831.3	1	1	hg19	c.278T>A	CCDS9157.1	1	.	.	.	.	.	.	.	.	.	.	a	19.40	3.819870	0.71028	.	.	ENSG00000198270	ENST00000355445;ENST00000354825;ENST00000550831;ENST00000437003;ENST00000552374	T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99	5.12	5.12	0.69794	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000014	T	0.58921	0.2156	L	0.59436	1.845	0.40890	D	0.98406	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.63501	-0.6623	10	0.87932	D	0	-6.5126	11.3186	0.49407	1.0:0.0:0.0:0.0	.	150;185;93	G5E985;G3V1W7;Q8NCL8	.;.;TM116_HUMAN	Q	150;93;93;93;185	ENSP00000347620:L150Q;ENSP00000346883:L93Q;ENSP00000450377:L93Q;ENSP00000395861:L93Q;ENSP00000447731:L185Q	ENSP00000346883:L93Q	L	-	2	0	0	TMEM116	110858913	110858913	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	4.791000	0.62460	1.939000	0.56221	0.383000	0.25322	CTG	0.370431		TCGA-2J-AAB1-01A-11D-A40W-08	0.478	TMEM116-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405026.3	1	0	1		2	2	2	0		0	0	43		43	42	1	1.940000	-20.000000	1	0.380000	NM_138341			52	51		228	224	1		1	1		0	0	43	0		1.000000	7.611682e-01	0	6	0	8	0	52	228
TPCN1	53373	broad.mit.edu	37	12	113711435	113711435	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr12:113711435G>A	ENST00000335509.6	+	10	1218	c.904G>A	c.(904-906)Gtg>Atg	p.V302M	TPCN1_ENST00000392569.4_Missense_Mutation_p.V234M|TPCN1_ENST00000541517.1_Missense_Mutation_p.V374M|TPCN1_ENST00000550785.1_Missense_Mutation_p.V374M	NM_017901.4	NP_060371.2	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1	302					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|voltage-gated calcium channel activity (GO:0005245)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(1)	40						CTTCTTCATCGTGTACCTCTC	0.557																																						ENST00000335509.6	0.970000	6.900000e-01	0.910000	0.760000	0.830000	0.837777	0.830000	0.830000																										0				40						c.(904-906)Gtg>Atg		two pore segment channel 1							285.0	219.0	241.0					12																	113711435		2203	4300	6503	SO:0001583	missense	53373	0	0					g.chr12:113711435G>A	AB032995	CCDS31908.1, CCDS44985.1	12q24.21	2011-07-05			ENSG00000186815	ENSG00000186815		"""Voltage-gated ion channels / Two-pore channels"""	18182	protein-coding gene	gene with protein product		609666				10574461, 10753632, 16382101	Standard	XM_005253905		Approved	KIAA1169, FLJ20612, TPC1	uc001tux.3	Q9ULQ1	OTTHUMG00000169625	ENST00000335509.6:c.904G>A	chr12.hg19:g.113711435G>A	ENSP00000335300:p.Val302Met	0					TPCN1_ENST00000550785.1_Missense_Mutation_p.V374M|TPCN1_ENST00000541517.1_Missense_Mutation_p.V374M|TPCN1_ENST00000392569.4_Missense_Mutation_p.V234M	p.V302M	NM_017901.4	NP_060371.2	0	0	0	1.993904	Q9ULQ1	TPC1_HUMAN		10	1218	+			A7E258|Q86XS9|Q8NC20	Missense_Mutation	SNP	ENST00000335509.6	1	1	hg19	c.904G>A	CCDS31908.1	0	.	.	.	.	.	.	.	.	.	.	G	24.5	4.538199	0.85917	.	.	ENSG00000186815	ENST00000335509;ENST00000550785;ENST00000541517;ENST00000392569	D;D;D;D	0.98701	-5.08;-5.08;-5.08;-5.08	5.64	5.64	0.86602	5.64	5.64	0.86602	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98576	0.9524	L	0.60845	1.875	0.47214	D	0.999354	D;D;D	0.76494	0.999;0.999;0.998	D;D;P	0.66847	0.947;0.919;0.848	D	0.98287	1.0511	10	0.48119	T	0.1	-26.0173	12.9637	0.58472	0.0742:0.0:0.9258:0.0	.	302;374;302	A5PKY2;Q9ULQ1-3;Q9ULQ1	.;.;TPC1_HUMAN	M	302;374;374;234	ENSP00000335300:V302M;ENSP00000448083:V374M;ENSP00000438125:V374M;ENSP00000376350:V234M	ENSP00000335300:V302M	V	+	1	0	0	TPCN1	112195818	112195818	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.600000	0.82769	2.656000	0.90262	0.655000	0.94253	GTG	0.370431		TCGA-2J-AAB1-01A-11D-A40W-08	0.557	TPCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405156.3	1	0	1		2	2	2	0		0	0	147		147	143	1	1.940000	-20.000000	1	0.380000	NM_017901			117	115		609	597	1		1	1		0	0	147	0		1.000000	9.973635e-01	0	6	0	42	0	117	609
RSRC2	65117	broad.mit.edu	37	12	123005948	123005948	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr12:123005948C>T	ENST00000331738.7	-	3	336	c.191G>A	c.(190-192)cGg>cAg	p.R64Q	RSRC2_ENST00000354654.2_Missense_Mutation_p.G9R	NM_023012.5	NP_075388.2	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2	64	Ser-rich.						poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|urinary_tract(2)	24	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		GCTTCTGCTCCGGCTCCTGTG	0.308																																						ENST00000331738.7	0.190000	2.000000e-02	0.140000	0.050000	0.080000	0.099011	0.080000	0.080000																										0				24						c.(190-192)cGg>cAg		arginine/serine-rich coiled-coil 2							89.0	85.0	86.0					12																	123005948		2202	4299	6501	SO:0001583	missense	65117	1	121398	38				g.chr12:123005948C>T	AF161432	CCDS31920.1	12q24.31	2007-02-13			ENSG00000111011	ENSG00000111011			30559	protein-coding gene	gene with protein product						17203224	Standard	NM_023012		Approved	FLJ11021	uc001ucr.3	Q7L4I2	OTTHUMG00000167572	ENST00000331738.7:c.191G>A	chr12.hg19:g.123005948C>T	ENSP00000330188:p.Arg64Gln	0					RSRC2_ENST00000354654.2_Missense_Mutation_p.G9R	p.R64Q	NM_023012.5	NP_075388.2	0	0	0	1.993904	Q7L4I2	RSRC2_HUMAN		3	336	-	all_neural(191;0.0837)|Medulloblastoma(191;0.163)		Q6N040|Q6NW16|Q9H864	Missense_Mutation	SNP	ENST00000331738.7	0	1	hg19	c.191G>A	CCDS31920.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.99|14.99	2.700233|2.700233	0.48307|0.48307	.|.	.|.	ENSG00000111011|ENSG00000111011	ENST00000354654;ENST00000528279|ENST00000331738;ENST00000418773	T|T	0.46063|0.20332	0.88|2.08	5.44|5.44	5.44|5.44	0.79542|0.79542	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	.|0.220291	.|0.47852	.|D	.|0.000206	T|T	0.16599|0.16599	0.0399|0.0399	N|N	0.19112|0.19112	0.55|0.55	0.26343|0.26343	N|N	0.977338|0.977338	P|D;D	0.41673|0.56521	0.759|0.976;0.976	B|B;B	0.30495|0.40825	0.116|0.341;0.341	T|T	0.07520|0.07520	-1.0768|-1.0768	9|10	0.41790|0.39692	T|T	0.15|0.17	.|.	19.2639|19.2639	0.93979|0.93979	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	9|64;64	Q7L4I2-2|F5GXM2;Q7L4I2	.|.;RSRC2_HUMAN	R|Q	9|64	ENSP00000346678:G9R|ENSP00000330188:R64Q	ENSP00000346678:G9R|ENSP00000330188:R64Q	G|R	-|-	1|2	0|0	0|0	RSRC2|RSRC2	121571901|121571901	121571901|121571901	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.313000|5.313000	0.65798|0.65798	2.541000|2.541000	0.85698|0.85698	0.555000|0.555000	0.69702|0.69702	GGA|CGG	0.370431		TCGA-2J-AAB1-01A-11D-A40W-08	0.308	RSRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395096.3	0	0	1		2	2	2	0		0	0	52		52	50	1	1.940000	-2.796904	1	0.380000	NM_023012			4	4		254	249	0		1	0		0	0	52	0		0.886451	7.612298e-01	0	1	0	169	0	4	254
KRAS	3845	broad.mit.edu	37	12	25398284	25398285	+	Missense_Mutation	DNP	CC	CC	TG	rs121913530|rs121913529		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			C	T|G	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr12:25398284_25398285CC>TG	ENST00000256078.4	-	2	97_98	c.34_35GG>CA	c.(34-36)GGt>CAt	p.G12H	KRAS_ENST00000311936.3_Missense_Mutation_p.G12H|KRAS_ENST00000556131.1_Missense_Mutation_p.G12H|KRAS_ENST00000557334.1_Missense_Mutation_p.G12H	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12C(3001)|p.G12A(1407)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAACT	0.347	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	0.370000|0.890000	9.000000e-02|4.400000e-01	0.290000|0.780000	0.140000|0.540000	0.200000|0.650000	0.221373|0.663868	0.200000|0.650000	0.200000|0.640000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)|G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	20892	Substitution - Missense(20889)|Insertion - In frame(2)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)|p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(11786)|pancreas(3650)|lung(3132)|ovary(556)|biliary_tract(494)|endometrium(373)|haematopoietic_and_lymphoid_tissue(212)|stomach(145)|thyroid(97)|prostate(70)|small_intestine(56)|upper_aerodigestive_tract(47)|urinary_tract(47)|soft_tissue(42)|cervix(41)|skin(35)|liver(22)|breast(20)|testis(16)|oesophagus(11)|central_nervous_system(8)|peritoneum(6)|kidney(5)|eye(4)|NS(4)|autonomic_ganglia(3)|gastrointestinal_tract_(site_indeterminate)(3)|thymus(3)|penis(1)|adrenal_gland(1)|salivary_gland(1)|bone(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)gGt>gAt|c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog																																				SO:0001583	missense	3845	2|0	121404|0	44|	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T|g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34_35delinsTG	chr12.hg19:g.25398284_25398285delinsTG	ENSP00000256078:p.Gly12His	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12D|p.G12R	NM_033360.2	NP_203524.1	0	0	0	1.993904	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98|97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A|c.34G>C	CCDS8703.1	0																									5.68	5.68	0.88126																																												0			25289551|25289552														0.370431		TCGA-2J-AAB1-01A-11D-A40W-08	0.347	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	53		53|55	51|53	1	1.940000	-4.074507|-12.853510	1	0.380000	NM_033360			8|26	8|26		199|181	199|181	0|1		1	0|1	1	0	0	53|55	365|364		0.989787|1.000000	1.537874e-01|6.511692e-01	9.993325e-01|1	1|10	11|47	15|7	354|316	8	181
ARNTL2	56938	broad.mit.edu	37	12	27533278	27533278	+	Missense_Mutation	SNP	G	G	A	rs149871988		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr12:27533278G>A	ENST00000266503.5	+	5	443	c.425G>A	c.(424-426)cGt>cAt	p.R142H	ARNTL2_ENST00000546179.1_Missense_Mutation_p.R105H|ARNTL2_ENST00000395901.2_Missense_Mutation_p.R105H|ARNTL2_ENST00000542388.1_Missense_Mutation_p.R57H|ARNTL2_ENST00000311001.5_Missense_Mutation_p.R128H|ARNTL2_ENST00000544915.1_Missense_Mutation_p.R108H|ARNTL2_ENST00000261178.5_Missense_Mutation_p.R94H			Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear translocator-like 2	142	Interaction with PER2. {ECO:0000250|UniProtKB:Q2VPD4}.|bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	E-box binding (GO:0070888)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	21	Colorectal(261;0.0847)|Lung SC(9;0.184)					CCCATGGCGCGTAAACTGGAC	0.418																																						ENST00000266503.5	0.130000	1.000000e-02	0.090000	0.030000	0.050000	0.067790	0.050000	0.060000																										0				21						c.(424-426)cGt>cAt		aryl hydrocarbon receptor nuclear translocator-like 2		G	HIS/ARG	0,4406		0,0,2203	128.0	115.0	119.0		425	2.4	0.1	12	dbSNP_134	119	1,8599	1.2+/-3.3	0,1,4299	no	missense	ARNTL2	NM_020183.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	142/637	27533278	1,13005	2203	4300	6503	SO:0001583	missense	56938	4	121412	39				g.chr12:27533278G>A	AF246961	CCDS8712.1, CCDS58219.1, CCDS58220.1, CCDS58221.1, CCDS58222.1	12p12.2-p11.2	2013-05-21			ENSG00000029153	ENSG00000029153		"""Basic helix-loop-helix proteins"""	18984	protein-coding gene	gene with protein product		614517				10864977, 10964693	Standard	NM_020183		Approved	BMAL2, MOP9, CLIF, PASD9, bHLHe6	uc001rht.2	Q8WYA1	OTTHUMG00000169257	ENST00000266503.5:c.425G>A	chr12.hg19:g.27533278G>A	ENSP00000266503:p.Arg142His	0					ARNTL2_ENST00000261178.5_Missense_Mutation_p.R94H|ARNTL2_ENST00000395901.2_Missense_Mutation_p.R105H|ARNTL2_ENST00000542388.1_Missense_Mutation_p.R57H|ARNTL2_ENST00000311001.5_Missense_Mutation_p.R128H|ARNTL2_ENST00000544915.1_Missense_Mutation_p.R108H|ARNTL2_ENST00000546179.1_Missense_Mutation_p.R105H	p.R142H			0	0	0	1.993904	Q8WYA1	BMAL2_HUMAN		5	443	+	Colorectal(261;0.0847)|Lung SC(9;0.184)		B7Z429|F5H402|Q8WYA2|Q8WYA3|Q8WYA4|Q96J63|Q9H2M4|Q9NS70|Q9NYQ4|Q9NYQ5	Missense_Mutation	SNP	ENST00000266503.5	0	1	hg19	c.425G>A	CCDS8712.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.36|15.36	2.809399|2.809399	0.50421|0.50421	0.0|0.0	1.16E-4|1.16E-4	ENSG00000029153|ENSG00000029153	ENST00000544915;ENST00000395901;ENST00000546179;ENST00000311001;ENST00000261178;ENST00000266503;ENST00000542388|ENST00000457040	D;D;D;D;D;D;D|.	0.98044|.	-4.68;-4.68;-4.68;-4.68;-4.68;-4.68;-4.68|.	3.33|3.33	2.41|2.41	0.29592|0.29592	3.33|3.33	2.41|2.41	0.29592|0.29592	Helix-loop-helix DNA-binding (5);|.	0.166448|.	0.41294|.	N|.	0.000915|.	T|T	0.52933|0.52933	0.1765|0.1765	L|L	0.43701|0.43701	1.375|1.375	0.45962|0.45962	D|D	0.998786|0.998786	P;P;P;P;P;P|.	0.46578|.	0.507;0.708;0.647;0.647;0.501;0.88|.	B;B;B;B;B;P|.	0.44696|.	0.169;0.329;0.233;0.233;0.109;0.458|.	T|T	0.42932|0.42932	-0.9422|-0.9422	10|5	0.54805|.	T|.	0.06|.	.|.	8.1033|8.1033	0.30870|0.30870	0.1179:0.0:0.8821:0.0|0.1179:0.0:0.8821:0.0	.|.	105;108;105;94;128;142|.	F5H402;Q8WYA1-5;Q8WYA1-3;Q8WYA1-4;Q8WYA1-2;Q8WYA1|.	.;.;.;.;.;BMAL2_HUMAN|.	H|I	108;105;105;128;94;142;57|94	ENSP00000442438:R108H;ENSP00000379238:R105H;ENSP00000438545:R105H;ENSP00000312247:R128H;ENSP00000261178:R94H;ENSP00000266503:R142H;ENSP00000445836:R57H|.	ENSP00000261178:R94H|.	R|V	+|+	2|1	0|0	0|0	ARNTL2|ARNTL2	27424545|27424545	27424545|27424545	0.987000|0.987000	0.35691|0.35691	0.059000|0.059000	0.19551|0.19551	0.969000|0.969000	0.65631|0.65631	6.556000|6.556000	0.73932|0.73932	0.728000|0.728000	0.32382|0.32382	0.655000|0.655000	0.94253|0.94253	CGT|GTA	0.370431		TCGA-2J-AAB1-01A-11D-A40W-08	0.418	ARNTL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403162.1	0	0	1		2	2	2	0		0	0	86		86	84	1	1.940000	-2.520841	1	0.380000	NM_020183			5	5		450	437	0		1	0		0	0	86	0		0.932983	2.298764e-02	0	0	0	17	0	5	450
SLC6A15	55117	broad.mit.edu	37	12	85255590	85255590	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr12:85255590C>T	ENST00000266682.5	-	12	2555	c.2014G>A	c.(2014-2016)Gat>Aat	p.D672N	SLC6A15_ENST00000552192.1_Missense_Mutation_p.D565N|SLC6A15_ENST00000309283.7_3'UTR	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	672					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)			kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						CTTGTATCATCGCCCTCTAAG	0.423																																						ENST00000266682.5	1.000000	8.600000e-01	1.000000	0.940000	0.990000	0.979447	0.990000	1.000000																										0				44						c.(2014-2016)Gat>Aat		solute carrier family 6 (neutral amino acid transporter), member 15							127.0	124.0	125.0					12																	85255590		2203	4300	6503	SO:0001583	missense	55117	0	0					g.chr12:85255590C>T	AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.2014G>A	chr12.hg19:g.85255590C>T	ENSP00000266682:p.Asp672Asn	0					SLC6A15_ENST00000309283.7_3'UTR|SLC6A15_ENST00000552192.1_Missense_Mutation_p.D565N	p.D672N	NM_182767.5	NP_877499.1	0	0	0	1.993904	Q9H2J7	S6A15_HUMAN		12	2555	-			A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Missense_Mutation	SNP	ENST00000266682.5	1	1	hg19	c.2014G>A	CCDS9026.1	1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.699502	0.88830	.	.	ENSG00000072041	ENST00000266682;ENST00000552192;ENST00000548267	T;T	0.77620	-0.93;-1.11	5.85	5.85	0.93711	5.85	5.85	0.93711	.	0.182364	0.64402	D	0.000018	D	0.86581	0.5967	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85436	0.1152	10	0.49607	T	0.09	.	20.1649	0.98147	0.0:1.0:0.0:0.0	.	672	Q9H2J7	S6A15_HUMAN	N	672;565;150	ENSP00000266682:D672N;ENSP00000450145:D565N	ENSP00000266682:D672N	D	-	1	0	0	SLC6A15	83779721	83779721	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	5.665000	0.68052	2.753000	0.94483	0.655000	0.94253	GAT	0.370431		TCGA-2J-AAB1-01A-11D-A40W-08	0.423	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	1	0	1		2	2	2	0		0	0	142		142	135	1	1.940000	-20.000000	1	0.380000	NM_018057, NM_182767			126	125		511	506	1		1			0	0	142	0		1.000000	0	0	0	0	0	0	126	511
USP44	84101	broad.mit.edu	37	12	95922666	95922666	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr12:95922666G>A	ENST00000258499.3	-	3	1829	c.1541C>T	c.(1540-1542)cCa>cTa	p.P514L	USP44_ENST00000537435.2_Missense_Mutation_p.P514L|USP44_ENST00000552440.1_Intron|USP44_ENST00000393091.2_Missense_Mutation_p.P514L	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	Q9H0E7	UBP44_HUMAN	ubiquitin specific peptidase 44	514	USP.				mitotic nuclear division (GO:0007067)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deubiquitination (GO:0016579)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|regulation of spindle checkpoint (GO:0090231)	nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(5)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	36						AACCAGACATGGCTGGGAAGC	0.393																																						ENST00000258499.3	1.000000	6.600000e-01	0.990000	0.760000	0.860000	0.870168	0.860000	1.000000																										0				36						c.(1540-1542)cCa>cTa		ubiquitin specific peptidase 44							104.0	100.0	102.0					12																	95922666		2203	4300	6503	SO:0001583	missense	84101	0	0					g.chr12:95922666G>A	AK027434	CCDS9053.1	12q21.33	2005-08-08	2005-08-08			ENSG00000136014		"""Ubiquitin-specific peptidases"""	20064	protein-coding gene	gene with protein product		610993	"""ubiquitin specific protease 44"""			12838346	Standard	NM_001278393		Approved	FLJ14528	uc001teg.3	Q9H0E7		ENST00000258499.3:c.1541C>T	chr12.hg19:g.95922666G>A	ENSP00000258499:p.Pro514Leu	0					USP44_ENST00000552440.1_Intron|USP44_ENST00000537435.2_Missense_Mutation_p.P514L|USP44_ENST00000393091.2_Missense_Mutation_p.P514L	p.P514L	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	0	0	0	1.993904	Q9H0E7	UBP44_HUMAN		3	1829	-			B2RDW3	Missense_Mutation	SNP	ENST00000258499.3	1	1	hg19	c.1541C>T	CCDS9053.1	1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787659	0.70337	.	.	ENSG00000136014	ENST00000258499;ENST00000393091;ENST00000537435	T;T;T	0.02631	4.22;4.22;4.22	5.94	5.94	0.96194	5.94	5.94	0.96194	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.049563	0.85682	D	0.000000	T	0.06050	0.0157	L	0.31371	0.925	0.58432	D	0.999998	P	0.37731	0.607	P	0.45913	0.497	T	0.52845	-0.8521	10	0.35671	T	0.21	.	20.3632	0.98871	0.0:0.0:1.0:0.0	.	514	Q9H0E7	UBP44_HUMAN	L	514	ENSP00000258499:P514L;ENSP00000376806:P514L;ENSP00000442629:P514L	ENSP00000258499:P514L	P	-	2	0	0	USP44	94446797	94446797	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	6.662000	0.74426	2.826000	0.97356	0.561000	0.74099	CCA	0.370431		TCGA-2J-AAB1-01A-11D-A40W-08	0.393	USP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408312.1	1	0	0		2	2	2	0		0	0	57		57	57	1	1.940000	-20.000000	1	0.380000	NM_032147			50	50		247	244	1		1	0		0	0	57	0		1.000000	1.385372e-01	0	0	0	4	0	50	247
NOC4L	79050	broad.mit.edu	37	12	132635870	132635870	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr12:132635870C>T	ENST00000330579.1	+	11	1071	c.1030C>T	c.(1030-1032)Cgc>Tgc	p.R344C	NOC4L_ENST00000538784.1_5'UTR|NOC4L_ENST00000535343.1_3'UTR	NM_024078.1	NP_076983.1	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog (S. cerevisiae)	344					rRNA processing (GO:0006364)	integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|skin(2)	14	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		CGTCAAGTACCGCGCCCGCTT	0.652																																						ENST00000330579.1	1.000000	7.300000e-01	0.970000	0.800000	0.880000	0.890903	0.880000	1.000000																										0				14						c.(1030-1032)Cgc>Tgc		nucleolar complex associated 4 homolog (S. cerevisiae)							117.0	122.0	120.0					12																	132635870		2202	4299	6501	SO:0001583	missense	79050	9	121290	44				g.chr12:132635870C>T		CCDS9277.1	12q24.33	2011-08-12			ENSG00000184967	ENSG00000184967			28461	protein-coding gene	gene with protein product		612819				12446671	Standard	NM_024078		Approved	MGC3162, NET49, UTP19	uc001ujz.1	Q9BVI4	OTTHUMG00000168260	ENST00000330579.1:c.1030C>T	chr12.hg19:g.132635870C>T	ENSP00000328854:p.Arg344Cys	0					NOC4L_ENST00000535343.1_3'UTR|NOC4L_ENST00000538784.1_5'UTR	p.R344C	NM_024078.1	NP_076983.1	0	0	0	1.993904	Q9BVI4	NOC4L_HUMAN		11	1071	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		Q8N2S5|Q96I14	Missense_Mutation	SNP	ENST00000330579.1	1	1	hg19	c.1030C>T	CCDS9277.1	1	.	.	.	.	.	.	.	.	.	.	C	15.18	2.755773	0.49362	.	.	ENSG00000184967	ENST00000330579	T	0.65178	-0.14	5.2	4.3	0.51218	5.2	4.3	0.51218	CCAAT-binding factor (1);	0.000000	0.85682	D	0.000000	D	0.83908	0.5356	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.88477	0.3066	10	0.87932	D	0	-22.5329	15.3287	0.74190	0.0:0.8591:0.1409:0.0	.	344	Q9BVI4	NOC4L_HUMAN	C	344	ENSP00000328854:R344C	ENSP00000328854:R344C	R	+	1	0	0	NOC4L	131201823	131201823	1.000000	0.71417	0.489000	0.27452	0.056000	0.15407	2.615000	0.46368	1.165000	0.42670	0.561000	0.74099	CGC	0.370431		TCGA-2J-AAB1-01A-11D-A40W-08	0.652	NOC4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398999.1	0	0	1		16	2	2	0		0	1	135		135	129	1	1.940000	-2.827600	1	0.380000	NM_024078			101	99		486	477	1		1	1		0	0	135	0		1.000000	9.999963e-01	0	26	0	61	0	101	486
LRCH1	23143	broad.mit.edu	37	13	47266683	47266683	+	Missense_Mutation	SNP	G	G	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr13:47266683G>T	ENST00000389798.3	+	8	1224	c.1027G>T	c.(1027-1029)Gac>Tac	p.D343Y	LRCH1_ENST00000311191.6_Missense_Mutation_p.D343Y|LRCH1_ENST00000389797.3_Missense_Mutation_p.D343Y	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	343										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		TTCTGACGAAGACACTGTTAG	0.418																																						ENST00000389798.3	1.000000	8.500000e-01	1.000000	0.930000	0.990000	0.975856	0.990000	1.000000																										0				26						c.(1027-1029)Gac>Tac		leucine-rich repeats and calponin homology (CH) domain containing 1							168.0	136.0	147.0					13																	47266683		2203	4300	6503	SO:0001583	missense	23143	0	0					g.chr13:47266683G>T	AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.1027G>T	chr13.hg19:g.47266683G>T	ENSP00000374448:p.Asp343Tyr	0					LRCH1_ENST00000311191.6_Missense_Mutation_p.D343Y|LRCH1_ENST00000389797.3_Missense_Mutation_p.D343Y	p.D343Y	NM_015116.2	NP_055931	0	0	0	2.015661	Q9Y2L9	LRCH1_HUMAN	KIRC - Kidney renal clear cell carcinoma(16;0.234)	8	1224	+		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Missense_Mutation	SNP	ENST00000389798.3	1	1	hg19	c.1027G>T	CCDS31972.1	1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882904	0.72410	.	.	ENSG00000136141	ENST00000311191;ENST00000389798;ENST00000389797;ENST00000463929	T;T;T	0.59906	0.35;0.39;0.23	5.83	5.83	0.93111	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.77928	0.4204	M	0.82630	2.6	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.994;0.999;0.999	T	0.73448	-0.3979	10	0.21540	T	0.41	-24.1686	19.122	0.93367	0.0:0.0:1.0:0.0	.	343;343;343;343	Q17R43;Q9Y2L9-2;F8W6F0;Q9Y2L9	.;.;.;LRCH1_HUMAN	Y	343;343;343;89	ENSP00000308493:D343Y;ENSP00000374448:D343Y;ENSP00000374447:D343Y	ENSP00000308493:D343Y	D	+	1	0	0	LRCH1	46164684	46164684	1.000000	0.71417	1.000000	0.80357	0.640000	0.38277	7.924000	0.87555	2.770000	0.95276	0.655000	0.94253	GAC	0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.418	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044824.2	1	0	1		2	2	2	0		0	0	90		90	89	1	1.940000	-20.000000	1	0.380000	NM_015116			113	112		468	467	1		1	1		0	0	90	0		1.000000	9.994734e-01	0	14	0	34	0	113	468
PCDH9	5101	broad.mit.edu	37	13	66878827	66878827	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr13:66878827G>A	ENST00000377865.2	-	4	3808	c.3674C>T	c.(3673-3675)gCa>gTa	p.A1225V	PCDH9_ENST00000456367.1_Missense_Mutation_p.A1191V|PCDH9_ENST00000544246.1_Missense_Mutation_p.A1225V|PCDH9-AS1_ENST00000430861.1_RNA|PCDH9_ENST00000328454.5_Missense_Mutation_p.A1191V			Q9HC56	PCDH9_HUMAN	protocadherin 9	1225					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A1225E(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		AGCACCTCCTGCTTGCTTATA	0.438																																						ENST00000377865.2	1.000000	8.600000e-01	1.000000	0.970000	0.990000	0.987129	0.990000	1.000000																										1	Substitution - Missense(1)	p.A1225E(1)	upper_aerodigestive_tract(1)	103						c.(3673-3675)gCa>gTa		protocadherin 9							120.0	112.0	114.0					13																	66878827		2203	4300	6503	SO:0001583	missense	5101	0	0					g.chr13:66878827G>A	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3674C>T	chr13.hg19:g.66878827G>A	ENSP00000367096:p.Ala1225Val	0					PCDH9-AS1_ENST00000430861.1_RNA|PCDH9_ENST00000328454.5_Missense_Mutation_p.A1191V|PCDH9_ENST00000456367.1_Missense_Mutation_p.A1191V|PCDH9_ENST00000544246.1_Missense_Mutation_p.A1225V	p.A1225V			0	0	0	2.015661	Q9HC56	PCDH9_HUMAN		4	3808	-		Hepatocellular(98;0.0906)|Breast(118;0.107)	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	1	1	hg19	c.3674C>T	CCDS9444.1	1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.950604	0.53186	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	T;T;T;T	0.57907	0.47;0.47;0.37;0.37	6.05	5.2	0.72013	6.05	5.2	0.72013	.	0.461993	0.18412	N	0.142037	T	0.38374	0.1038	N	0.19112	0.55	0.32371	N	0.555834	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.46803	-0.9165	10	0.56958	D	0.05	.	11.2657	0.49110	0.1389:0.0:0.8611:0.0	.	1183;1191;1225	B7ZM79;Q9HC56-2;Q9HC56	.;.;PCDH9_HUMAN	V	1225;1225;1191;1191	ENSP00000442186:A1225V;ENSP00000367096:A1225V;ENSP00000401699:A1191V;ENSP00000332060:A1191V	ENSP00000332060:A1191V	A	-	2	0	0	PCDH9	65776828	65776828	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.884000	0.56175	1.561000	0.49584	0.650000	0.86243	GCA	0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.438	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	1	0	1		2	2	2	0		0	0	56		56	56	1	1.940000	-20.000000	1	0.380000	NM_203487			59	59		221	218	1		1	0		0	0	56	0		1.000000	1.175597e-01	0	0	0	3	0	59	221
KLHL1	57626	broad.mit.edu	37	13	70535555	70535555	+	Silent	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr13:70535555G>A	ENST00000377844.4	-	3	1461	c.702C>T	c.(700-702)tcC>tcT	p.S234S	KLHL1_ENST00000545028.1_Silent_p.S41S	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	234	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)	p.S234S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		CAAAATAGTCGGAGACTGAAC	0.453																																						ENST00000377844.4	0.880000	4.500000e-01	0.770000	0.540000	0.650000	0.664462	0.650000	0.640000																										1	Substitution - coding silent(1)	p.S234S(1)	endometrium(1)	84						c.(700-702)tcC>tcT		kelch-like family member 1							114.0	100.0	105.0					13																	70535555		2203	4300	6503	SO:0001819	synonymous_variant	57626	2	121388	38				g.chr13:70535555G>A	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.702C>T	chr13.hg19:g.70535555G>A		0					KLHL1_ENST00000545028.1_Silent_p.S41S	p.S234S	NM_020866.2	NP_065917.1	0	0	0	2.015661	Q9NR64	KLHL1_HUMAN		3	1461	-		Breast(118;0.000162)	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Silent	SNP	ENST00000377844.4	1	1	hg19	c.702C>T	CCDS9445.1	0																																																																																								0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.453	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	1	0	1		2	2	2	0		0	0	48		48	48	1	1.940000	-2.691054	1	0.380000	NM_020866			29	29		204	200	1		1			0	0	48	0		1.000000	0	0	0	0	0	0	29	204
OR4M1	441670	broad.mit.edu	37	14	20248817	20248817	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr14:20248817G>A	ENST00000315957.4	+	1	417	c.336G>A	c.(334-336)atG>atA	p.M112I		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	112						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTTCGGAGATGTTCTTGCTCA	0.478																																						ENST00000315957.4	0.470000	3.300000e-01	0.440000	0.360000	0.390000	0.404155	0.390000	0.390000																										0				42						c.(334-336)atG>atA		olfactory receptor, family 4, subfamily M, member 1							240.0	252.0	248.0					14																	20248817		2203	4300	6503	SO:0001583	missense	441670	0	0					g.chr14:20248817G>A		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.336G>A	chr14.hg19:g.20248817G>A	ENSP00000319654:p.Met112Ile	1						p.M112I	NM_001005500.1	NP_001005500.1	1	2	3	2.350241	Q8NGD0	OR4M1_HUMAN	Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	1	417	+	all_cancers(95;0.00108)		B9EH18|Q6IFA3	Missense_Mutation	SNP	ENST00000315957.4	1	1	hg19	c.336G>A	CCDS32021.1	0	.	.	.	.	.	.	.	.	.	.	.	1.041	-0.678902	0.03378	.	.	ENSG00000176299	ENST00000315957	T	0.00388	7.59	4.33	4.33	0.51752	4.33	4.33	0.51752	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000014	T	0.00210	0.0006	L	0.31207	0.915	0.27921	N	0.938258	B	0.30439	0.279	B	0.27608	0.081	T	0.41945	-0.9480	10	0.05959	T	0.93	-21.4932	14.6986	0.69139	0.0:0.0:1.0:0.0	.	112	Q8NGD0	OR4M1_HUMAN	I	112	ENSP00000319654:M112I	ENSP00000319654:M112I	M	+	3	0	0	OR4M1	19318657	19318657	0.000000	0.05858	1.000000	0.80357	0.945000	0.59286	-0.007000	0.12810	2.407000	0.81776	0.506000	0.49869	ATG	0.478992		TCGA-2J-AAB1-01A-11D-A40W-08	0.478	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1	0	0	1		2	2	2	0		0	0	354		354	346	1	1.940000	-18.041860	1	0.380000				130	129		1897	1880	0		1			0	0	354	0		1.000000	0	0	0	0	0	0	130	1897
DIO3	1735	broad.mit.edu	37	14	102028329	102028329	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr14:102028329G>A	ENST00000510508.4	+	1	642	c.496G>A	c.(496-498)Ggc>Agc	p.G166S	DIO3OS_ENST00000408206.1_lincRNA|DIO3_ENST00000359323.3_Missense_Mutation_p.G140S			P55073	IOD3_HUMAN	deiodinase, iodothyronine, type III	166					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|positive regulation of multicellular organism growth (GO:0040018)|small molecule metabolic process (GO:0044281)|thyroid hormone catabolic process (GO:0042404)|thyroid hormone generation (GO:0006590)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thyroxine 5'-deiodinase activity (GO:0004800)|thyroxine 5-deiodinase activity (GO:0033798)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(3)|skin(1)	22		all_neural(303;0.185)				TCTCAATTTCGGCAGCTGCAC	0.627																																						ENST00000510508.4	0.440000	1.500000e-01	0.360000	0.200000	0.270000	0.288239	0.270000	0.270000																										0				22						c.(496-498)Ggc>Agc		deiodinase, iodothyronine, type III							31.0	36.0	34.0					14																	102028329		2058	4203	6261	SO:0001583	missense	1735	0	0					g.chr14:102028329G>A	S79854	CCDS41992.1, CCDS41992.2	14q32	2012-10-08			ENSG00000197406	ENSG00000197406			2885	protein-coding gene	gene with protein product		601038		TXDI3		9787088, 7593630	Standard	NM_001362		Approved		uc021sdx.1	P55073	OTTHUMG00000160681	ENST00000510508.4:c.496G>A	chr14.hg19:g.102028329G>A	ENSP00000427336:p.Gly166Ser	0					DIO3_ENST00000359323.3_Missense_Mutation_p.G140S|DIO3OS_ENST00000408206.1_lincRNA	p.G166S			0	0	0	2.012091	P55073	IOD3_HUMAN		1	642	+		all_neural(303;0.185)	G3XAM0|Q8WVN5	Missense_Mutation	SNP	ENST00000510508.4	1	1	hg19	c.496G>A	CCDS41992.2	0	.	.	.	.	.	.	.	.	.	.	G	29.7	5.030514	0.93575	.	.	ENSG00000197406;ENSG00000258865	ENST00000359323;ENST00000510508	T;T	0.57907	0.37;0.37	3.51	3.51	0.40186	3.51	3.51	0.40186	Thioredoxin-like fold (1);	0.000000	0.47852	U	0.000217	T	0.75184	0.3815	M	0.91510	3.215	0.46927	D	0.999255	D	0.89917	1.0	D	0.64877	0.93	T	0.82051	-0.0649	10	0.59425	D	0.04	-16.4547	14.2065	0.65737	0.0:0.0:1.0:0.0	.	140	P55073	IOD3_HUMAN	S	140;166	ENSP00000352273:G140S;ENSP00000427336:G166S	ENSP00000352273:G166S	G	+	1	0	0	DIO3;AL049836.1	101098082	101098082	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.515000	0.98015	1.799000	0.52666	0.462000	0.41574	GGC	0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.627	DIO3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000361712.4	0	0	1		2	2	2	0		0	0	54		54	52	1	1.940000	-3.328041	1	0.380000	NM_001362			13	13		238	234	0		1	0		0	0	54	0		0.999525	3.817580e-01	0	0	0	24	0	13	238
FBN1	2200	broad.mit.edu	37	15	48704920	48704920	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr15:48704920C>T	ENST00000316623.5	-	65	8527	c.8072G>A	c.(8071-8073)gGc>gAc	p.G2691D	FBN1_ENST00000561429.1_5'UTR	NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2691					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TCGGCCCATGCCCATTCCAGA	0.502																																						ENST00000316623.5	0.100000	0	0.070000	0.020000	0.040000	0.050708	0.040000	0.040000																										0				139						c.(8071-8073)gGc>gAc		fibrillin 1							157.0	151.0	153.0					15																	48704920		2198	4296	6494	SO:0001583	missense	2200	0	0					g.chr15:48704920C>T	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.8072G>A	chr15.hg19:g.48704920C>T	ENSP00000325527:p.Gly2691Asp	0					FBN1_ENST00000561429.1_5'UTR	p.G2691D	NM_000138.4	NP_000129	1	2	3	2.029824	P35555	FBN1_HUMAN		65	8527	-		all_lung(180;0.00279)	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	0	1	hg19	c.8072G>A	CCDS32232.1	0	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647484	0.87958	.	.	ENSG00000166147	ENST00000316623	D	0.81821	-1.54	5.38	5.38	0.77491	5.38	5.38	0.77491	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.88599	0.6480	M	0.73598	2.24	0.80722	D	1	D	0.69078	0.997	D	0.66196	0.942	D	0.85789	0.1366	10	0.27785	T	0.31	.	18.926	0.92544	0.0:1.0:0.0:0.0	.	2691	P35555	FBN1_HUMAN	D	2691	ENSP00000325527:G2691D	ENSP00000325527:G2691D	G	-	2	0	0	FBN1	46492212	46492212	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.793000	0.96121	0.655000	0.94253	GGC	0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.502	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1	0	0	1		2	2	2	0		0	0	127		127	125	1	1.940000	-1.655459	0	0.380000				6	6		718	709	0		1	0		0	0	127	0		0.963687	4.193274e-01	0	0	0	152	0	6	718
ANPEP	290	broad.mit.edu	37	15	90334315	90334315	+	Silent	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr15:90334315G>A	ENST00000300060.6	-	19	2851	c.2538C>T	c.(2536-2538)agC>agT	p.S846S		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	846	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	TCAGGGTGTAGCTCAGGTACC	0.532																																					NSCLC(30;827 977 2459 19669 26125)	ENST00000300060.6	0.300000	9.000000e-02	0.240000	0.130000	0.180000	0.192936	0.180000	0.180000																										0				57						c.(2536-2538)agC>agT		alanyl (membrane) aminopeptidase	Ezetimibe(DB00973)|Icatibant(DB06196)						146.0	129.0	134.0					15																	90334315		2200	4299	6499	SO:0001819	synonymous_variant	290	0	0					g.chr15:90334315G>A	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.2538C>T	chr15.hg19:g.90334315G>A		0						p.S846S	NM_001150.2	NP_001141.2	1	2	3	2.029824	P15144	AMPN_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)	19	2851	-	Lung NSC(78;0.0221)|all_lung(78;0.0448)		Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Silent	SNP	ENST00000300060.6	1	1	hg19	c.2538C>T	CCDS10356.1	0																																																																																								0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.532	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1	0	0	1		2	2	2	0		0	0	80		80	79	1	1.940000	-3.816047	1	0.380000				13	13		366	363	0		1	1		0	0	80	0		0.999529	9.447764e-01	0	2	0	139	0	13	366
CACNA1H	8912	broad.mit.edu	37	16	1256207	1256208	+	Missense_Mutation	DNP	CG	CG	AA			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr16:1256207_1256208CG>AA	ENST00000348261.5	+	12	2955_2956	c.2707_2708CG>AA	c.(2707-2709)CGc>AAc	p.R903N	CACNA1H_ENST00000358590.4_Missense_Mutation_p.R903N|RP11-616M22.3_ENST00000564700.1_RNA|CACNA1H_ENST00000565831.1_Missense_Mutation_p.R903N	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	903					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	AGCCCTGCGGCGCCAGCTCGTG	0.634																																						ENST00000348261.5	1.000000	5.100000e-01|5.200000e-01	1.000000	0.730000|0.740000	0.990000	0.896701|0.904532	0.990000	1.000000																										0				34						c.(2707-2709)Cgc>Agc|c.(2707-2709)cGc>cAc		calcium channel, voltage-dependent, T type, alpha 1H subunit	Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)																																			SO:0001583	missense	8912	0	0					g.chr16:1256207C>A|g.chr16:1256208G>A	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		Exception_encountered	chr16.hg19:g.1256207_1256208delinsAA	ENSP00000334198:p.Arg903Asn	0					CACNA1H_ENST00000565831.1_Missense_Mutation_p.R903S|RP11-616M22.3_ENST00000564700.1_RNA|CACNA1H_ENST00000358590.4_Missense_Mutation_p.R903S|CACNA1H_ENST00000565831.1_Missense_Mutation_p.R903H|RP11-616M22.3_ENST00000564700.1_RNA|CACNA1H_ENST00000358590.4_Missense_Mutation_p.R903H	p.R903S|p.R903H	NM_021098.2	NP_066921.2	1	2	3	2.023473	O95180	CAC1H_HUMAN		12	2955|2956	+		Hepatocellular(780;0.00369)	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	1	1	hg19	c.2707C>A|c.2708G>A	CCDS45375.1	1																									3.96	3.96	0.45880																																												0			1196208|1196209														0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.634	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	1	0	1		2	2	2	0		0	0	14		14	14	1	1.940000	-17.915760|-17.943830	1	0.380000	NM_001005407			9	9		39|38	39|38	1		1	0		0	0	14	0		0.995741|0.995774	3.444169e-01|4.285151e-01	0	0	0	6|7	0	9	38
PRR35	146325	broad.mit.edu	37	16	615296	615296	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr16:615296G>A	ENST00000409413.3	+	3	1984	c.1705G>A	c.(1705-1707)Gcc>Acc	p.A569T	NHLRC4_ENST00000424439.2_5'Flank|PIGQ_ENST00000409527.2_5'Flank|NHLRC4_ENST00000540585.1_5'Flank	NM_145270.2	NP_660313.1	P0CG20	PRR35_HUMAN		569										central_nervous_system(1)|endometrium(1)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10						CCCCCAGGGCGCCGAGGTCTG	0.677																																						ENST00000409413.3	1.000000	6.700000e-01	1.000000	0.910000	0.990000	0.963165	0.990000	1.000000																										0				10						c.(1705-1707)Gcc>Acc									6.0	7.0	7.0					16																	615296		1982	4129	6111	SO:0001583	missense	0	5	117812	30				g.chr16:615296G>A																												ENST00000409413.3:c.1705G>A	chr16.hg19:g.615296G>A	ENSP00000386499:p.Ala569Thr	0					NHLRC4_ENST00000424439.2_5'Flank|NHLRC4_ENST00000540585.1_5'Flank|PIGQ_ENST00000409527.2_5'Flank	p.A569T	NM_145270.2	NP_660313.1	1	2	3	2.023473	P0CG20	PRR35_HUMAN		3	1984	+			B8ZZ27|Q8N233|Q96AX3|Q96S23	Missense_Mutation	SNP	ENST00000409413.3	1	1	hg19	c.1705G>A	CCDS45365.1	1	.	.	.	.	.	.	.	.	.	.	G	13.28	2.189481	0.38707	.	.	ENSG00000161992	ENST00000409413	.	.	.	5.25	1.61	0.23674	5.25	1.61	0.23674	.	1.152320	0.06446	N	0.726940	T	0.23766	0.0575	N	0.20986	0.625	0.09310	N	1	B	0.30021	0.265	B	0.20577	0.03	T	0.26573	-1.0099	9	0.87932	D	0	.	6.6076	0.22734	0.1873:0.0:0.6619:0.1507	.	569	P0CG20	CP011_HUMAN	T	569	.	ENSP00000386499:A569T	A	+	1	0	0	C16orf11	555297	555297	0.000000	0.05858	0.006000	0.13384	0.021000	0.10359	0.126000	0.15769	0.554000	0.29061	0.491000	0.48974	GCC	0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.677	C16orf11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000333913.1	1	0	1		2	2	2	0		0	0	12		12	12	1	1.940000	-19.998620	1	0.380000				11	11		37	37	1		1			0	0	12	0		0.998993	0	0	0	0	0	0	11	37
CYLD	1540	broad.mit.edu	37	16	50827516	50827516	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr16:50827516G>A	ENST00000427738.3	+	16	2615	c.2410G>A	c.(2410-2412)Gac>Aac	p.D804N	RP11-327F22.4_ENST00000575917.1_RNA|CYLD_ENST00000566206.1_Missense_Mutation_p.D801N|RP11-327F22.4_ENST00000564510.1_RNA|CYLD_ENST00000311559.9_Missense_Mutation_p.D804N|CYLD_ENST00000398568.2_Missense_Mutation_p.D801N|CYLD_ENST00000564326.1_Missense_Mutation_p.D801N|CYLD_ENST00000569418.1_Missense_Mutation_p.D801N|CYLD_ENST00000540145.1_Missense_Mutation_p.D804N|CYLD_ENST00000568704.2_Missense_Mutation_p.D619N			Q9NQC7	CYLD_HUMAN	cylindromatosis (turban tumor syndrome)	804	USP.				cell cycle (GO:0007049)|innate immune response (GO:0045087)|necroptotic process (GO:0070266)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein K63-linked deubiquitination (GO:0070536)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of mitotic cell cycle (GO:0007346)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule (GO:0005874)|nucleus (GO:0005634)	Lys63-specific deubiquitinase activity (GO:0061578)|proline-rich region binding (GO:0070064)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(9)|lung(17)|pancreas(1)|skin(22)|upper_aerodigestive_tract(1)	62		all_cancers(37;0.0156)				AGAATGCTACGACGATCCGGA	0.438			"""Mis, N, F, S"""		cylindroma	cylindroma			Multiple Trichoepithelioma, Familial;Familial Cylindromatosis																													ENST00000427738.3	0.200000	6.000000e-02	0.160000	0.080000	0.110000	0.124440	0.110000	0.120000			yes	Rec	yes	Familial cylindromatosis	yes	Rec	yes	Familial cylindromatosis	16	16q12-q13	16q12-q13	1540	Mis, N, F, S	familial cylindromatosis gene				E	E		cylindroma	cylindroma		0				62						c.(2410-2412)Gac>Aac		cylindromatosis (turban tumor syndrome)							160.0	147.0	151.0					16																	50827516		1900	4129	6029	SO:0001583	missense	1540	0	0		Multiple Trichoepithelioma, Familial;Familial Cylindromatosis	Familial Cancer Database	;FADC, Turban Tumor syndrome, Epithelioma Adenoides Cysticum of Brooke, Hereditary Multiple Benign Cystic Epithelioma, Dermal Eccrine Cylindromatosis, Brooke-Spiegler s.	g.chr16:50827516G>A	AB020656	CCDS42164.1, CCDS45482.1	16q12-q13	2014-09-17							2584	protein-coding gene	gene with protein product	"""ubiquitin specific peptidase like 2"""	605018		CYLD1		7493027	Standard	NM_015247		Approved	KIAA0849, USPL2	uc002egq.1	Q9NQC7		ENST00000427738.3:c.2410G>A	chr16.hg19:g.50827516G>A	ENSP00000392025:p.Asp804Asn	0					CYLD_ENST00000398568.2_Missense_Mutation_p.D801N|CYLD_ENST00000566206.1_Missense_Mutation_p.D801N|CYLD_ENST00000568704.2_Missense_Mutation_p.D619N|RP11-327F22.4_ENST00000575917.1_RNA|CYLD_ENST00000564326.1_Missense_Mutation_p.D801N|CYLD_ENST00000540145.1_Missense_Mutation_p.D804N|RP11-327F22.4_ENST00000564510.1_RNA|CYLD_ENST00000569418.1_Missense_Mutation_p.D801N|CYLD_ENST00000311559.9_Missense_Mutation_p.D804N	p.D804N			1	2	3	2.027735	Q9NQC7	CYLD_HUMAN		16	2615	+		all_cancers(37;0.0156)	O94934|Q7L3N6|Q96EH0|Q9NZX9	Missense_Mutation	SNP	ENST00000427738.3	0	1	hg19	c.2410G>A	CCDS45482.1	0	.	.	.	.	.	.	.	.	.	.	G	20.8	4.052407	0.75960	.	.	ENSG00000083799	ENST00000540145;ENST00000311559;ENST00000427738;ENST00000398568	T;T;T	0.74002	-0.8;-0.8;-0.8	5.25	5.25	0.73442	5.25	5.25	0.73442	.	0.188320	0.56097	D	0.000035	T	0.62183	0.2407	N	0.14661	0.345	0.58432	D	0.999999	P;P	0.45176	0.852;0.821	B;B	0.40165	0.321;0.215	T	0.67011	-0.5778	10	0.45353	T	0.12	-19.1886	19.2041	0.93723	0.0:0.0:1.0:0.0	.	801;801	A8KAB0;Q9NQC7-2	.;.	N	804;804;801;801	ENSP00000445447:D804N;ENSP00000308928:D804N;ENSP00000381574:D801N	ENSP00000308928:D804N	D	+	1	0	0	CYLD	49385017	49385017	1.000000	0.71417	0.273000	0.24645	0.846000	0.48090	7.522000	0.81844	2.620000	0.88729	0.655000	0.94253	GAC	0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.438	CYLD-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422998.2	0	0	1		2	2	2	0		0	0	129		129	126	1	1.940000	-2.758398	1	0.380000				14	14		618	616	0		1	0		0	0	129	0		0.999751	4.095970e-01	0	1	0	59	0	14	618
CES3	23491	broad.mit.edu	37	16	67006841	67006841	+	Silent	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr16:67006841C>T	ENST00000303334.4	+	13	1676	c.1605C>T	c.(1603-1605)gcC>gcT	p.A535A	CES3_ENST00000394037.1_Silent_p.A532A|CES3_ENST00000543856.1_Silent_p.A174A	NM_024922.5	NP_079198.2	Q6UWW8	EST3_HUMAN	carboxylesterase 3	535						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	24		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		TGCCACGGGCCGGACAGAAGT	0.582																																						ENST00000303334.4	0.380000	1.500000e-01	0.310000	0.190000	0.240000	0.257139	0.240000	0.240000																										0				24						c.(1603-1605)gcC>gcT		carboxylesterase 3							89.0	88.0	88.0					16																	67006841		2200	4300	6500	SO:0001819	synonymous_variant	23491	2	121412	34				g.chr16:67006841C>T	AK025389	CCDS10826.1, CCDS54022.1, CCDS54023.1	16q22.1	2014-05-13	2008-07-25		ENSG00000172828	ENSG00000172828		"""Carboxylesterases"""	1865	protein-coding gene	gene with protein product	"""esterase 31"", ""brain carboxylesterase BR3"""	605279	"""carboxylesterase 3 (brain)"""			10518925, 14581373, 15100172, 20931200	Standard	NM_001185176		Approved	FLJ21736, ES31	uc002eqt.3	Q6UWW8	OTTHUMG00000137525	ENST00000303334.4:c.1605C>T	chr16.hg19:g.67006841C>T		0					CES3_ENST00000543856.1_Silent_p.A174A|CES3_ENST00000394037.1_Silent_p.A532A	p.A535A	NM_024922.5	NP_079198.2	1	2	3	2.027735	Q6UWW8	EST3_HUMAN		13	1676	+		Ovarian(137;0.0563)	B2Z3W9|F5H242|Q7Z6J1|Q9H6X7	Silent	SNP	ENST00000303334.4	1	1	hg19	c.1605C>T	CCDS10826.1	0																																																																																								0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.582	CES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268848.1	1	0	1		2	2	2	0		0	0	63		63	62	1	1.940000	-4.545027	1	0.380000	NM_024922			18	18		368	357	0		1	0		0	0	63	0		0.999978	5.348096e-01	0	1	0	36	0	18	368
SMYD4	114826	broad.mit.edu	37	17	1703597	1703597	+	Missense_Mutation	SNP	C	C	T	rs535301214		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr17:1703597C>T	ENST00000305513.7	-	5	1258	c.1091G>A	c.(1090-1092)cGc>cAc	p.R364H		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	364	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						TATGATTTTGCGAACATCCTC	0.453													C|||	1	0.000199681	0.0	0.0	5008	,	,		22688	0.001		0.0	False		,,,				2504	0.0					ENST00000305513.7	0.170000	3.000000e-02	0.130000	0.050000	0.080000	0.094556	0.080000	0.080000																										0				21						c.(1090-1092)cGc>cAc		SET and MYND domain containing 4							126.0	119.0	121.0					17																	1703597		2203	4300	6503	SO:0001583	missense	114826	4	121412	38				g.chr17:1703597C>T	AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.1091G>A	chr17.hg19:g.1703597C>T	ENSP00000304360:p.Arg364His	0						p.R364H	NM_052928.2	NP_443160.2	0	0	0	1.952011	Q8IYR2	SMYD4_HUMAN		5	1258	-			Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Missense_Mutation	SNP	ENST00000305513.7	0	1	hg19	c.1091G>A	CCDS11013.1	0	.	.	.	.	.	.	.	.	.	.	C	10.27	1.304550	0.23736	.	.	ENSG00000186532	ENST00000305513	T	0.10099	2.91	6.17	3.9	0.45041	6.17	3.9	0.45041	SET domain (2);	0.633514	0.19290	N	0.117933	T	0.06280	0.0162	N	0.08118	0	0.09310	N	1	P	0.40660	0.726	P	0.44860	0.462	T	0.19224	-1.0312	10	0.45353	T	0.12	-4.1382	2.4272	0.04462	0.1423:0.5342:0.1385:0.1849	.	364	Q8IYR2	SMYD4_HUMAN	H	364	ENSP00000304360:R364H	ENSP00000304360:R364H	R	-	2	0	0	SMYD4	1650347	1650347	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	0.710000	0.25748	0.647000	0.30713	0.655000	0.94253	CGC	0.355509		TCGA-2J-AAB1-01A-11D-A40W-08	0.453	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207108.4	0	0	1		16	2	2	1		1	1	78		78	78	1	1.940000	-2.303287	0	0.380000	XM_056082			6	6		365	363	0		0	0		1	0	78	0		0.023796	7.781872e-03	0	0	0	7	0	6	365
RTN4RL1	146760	broad.mit.edu	37	17	1840902	1840902	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr17:1840902C>T	ENST00000331238.6	-	2	693	c.214G>A	c.(214-216)Ggc>Agc	p.G72S		NM_178568.2	NP_848663.1			reticulon 4 receptor-like 1											breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|prostate(2)|skin(1)	11						CTGAAGTGGCCGGGCTGGAGG	0.637																																					GBM(68;949 1139 14865 32798 38342)	ENST00000331238.6	1.000000	6.100000e-01	1.000000	0.730000	0.870000	0.864865	0.870000	1.000000																										0				11						c.(214-216)Ggc>Agc		reticulon 4 receptor-like 1							63.0	78.0	73.0					17																	1840902		2186	4273	6459	SO:0001583	missense	146760	2	121282	33				g.chr17:1840902C>T	AF532859	CCDS45569.1	17p13.3	2008-02-05				ENSG00000185924			21329	protein-coding gene	gene with protein product	"""nogo-66 receptor homolog 2"""	610461					Standard	NM_178568		Approved	NGRH2, NgR3, DKFZp547J144	uc002ftp.3	Q86UN2		ENST00000331238.6:c.214G>A	chr17.hg19:g.1840902C>T	ENSP00000330631:p.Gly72Ser	0						p.G72S	NM_178568.2	NP_848663.1	0	0	0	1.952011				2	693	-				Missense_Mutation	SNP	ENST00000331238.6	1	1	hg19	c.214G>A	CCDS45569.1	1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.242161	0.79912	.	.	ENSG00000185924	ENST00000331238	T	0.02323	4.34	5.49	5.49	0.81192	5.49	5.49	0.81192	.	0.000000	0.40064	N	0.001187	T	0.10895	0.0266	L	0.53780	1.695	0.80722	D	1	D	0.55605	0.972	P	0.59012	0.85	T	0.03051	-1.1078	10	0.38643	T	0.18	.	19.4381	0.94806	0.0:1.0:0.0:0.0	.	72	Q86UN2	R4RL1_HUMAN	S	72	ENSP00000330631:G72S	ENSP00000330631:G72S	G	-	1	0	0	RTN4RL1	1787652	1787652	1.000000	0.71417	0.998000	0.56505	0.576000	0.36127	7.813000	0.86123	2.606000	0.88127	0.650000	0.86243	GGC	0.355509		TCGA-2J-AAB1-01A-11D-A40W-08	0.637	RTN4RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450155.2	1	0	1		2	2	2	0		0	0	32		32	31	1	1.940000	-20.000000	1	0.380000	NM_178568			29	23		139	135	1		1	0		0	0	32	0		1.000000	4.859141e-01	0	0	0	9	0	29	139
MAP2K3	5606	broad.mit.edu	37	17	21208417	21208417	+	Missense_Mutation	SNP	G	G	A	rs150613942	byFrequency	TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr17:21208417G>A	ENST00000342679.4	+	9	1000	c.751G>A	c.(751-753)Gtc>Atc	p.V251I	MAP2K3_ENST00000316920.6_Missense_Mutation_p.V222I|MAP2K3_ENST00000361818.5_Missense_Mutation_p.V222I	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	251	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.V255I(1)							COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CAAGTCCGACGTCTGGAGCCT	0.637																																						ENST00000342679.4	0.360000	1.600000e-01	0.300000	0.200000	0.240000	0.254729	0.240000	0.240000																										1	Substitution - Missense(1)	p.V255I(1)	large_intestine(1)							c.(751-753)Gtc>Atc		mitogen-activated protein kinase kinase 3		G	ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	159.0	134.0	143.0		664,751	5.1	1.0	17	dbSNP_134	143	12,8588	5.7+/-21.5	0,12,4288	yes	missense,missense	MAP2K3	NM_002756.4,NM_145109.2	29,29	0,13,6490	AA,AG,GG		0.1395,0.0227,0.1	benign,benign	222/319,251/348	21208417	13,12993	2203	4300	6503	SO:0001583	missense	5606	273	121412	50				g.chr17:21208417G>A	L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.751G>A	chr17.hg19:g.21208417G>A	ENSP00000345083:p.Val251Ile	0					MAP2K3_ENST00000361818.5_Missense_Mutation_p.V222I|MAP2K3_ENST00000316920.6_Missense_Mutation_p.V222I	p.V251I	NM_145109.2	NP_659731.1	1	2	3	2.024650	P46734	MP2K3_HUMAN		9	1000	+			B3KSK7|Q99441|Q9UE71|Q9UE72	Missense_Mutation	SNP	ENST00000342679.4	1	1	hg19	c.751G>A	CCDS11217.1	0	.	.	.	.	.	.	.	.	.	.	G	13.88	2.369435	0.42003	2.27E-4	0.001395	ENSG00000034152	ENST00000342679;ENST00000395491;ENST00000361818;ENST00000316920	T;T	0.40756	1.02;1.02	5.13	5.13	0.70059	5.13	5.13	0.70059	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.085299	0.46758	D	0.000277	T	0.19565	0.0470	N	0.02345	-0.59	0.58432	D	0.99999	B	0.10296	0.003	B	0.11329	0.006	T	0.08351	-1.0726	10	0.32370	T	0.25	-49.0281	11.9966	0.53206	0.0796:0.0:0.9204:0.0	.	251	P46734	MP2K3_HUMAN	I	251;222;222;255	ENSP00000345083:V251I;ENSP00000355081:V222I	ENSP00000319139:V255I	V	+	1	0	0	MAP2K3	21149010	21149010	1.000000	0.71417	0.951000	0.38953	0.735000	0.41995	3.362000	0.52314	2.387000	0.81309	0.462000	0.41574	GTC	0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.637	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	1	0	1		2	2	2	0		0	0	129		129	128	1	1.940000	-2.281329	0	0.380000	NM_145109			27	27		549	537	0		1	0		0	0	129	0		1.000000	9.997718e-01	0	0	0	262	0	27	549
TOP2A	7153	broad.mit.edu	37	17	38564781	38564781	+	Missense_Mutation	SNP	G	G	C			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr17:38564781G>C	ENST00000423485.1	-	11	1463	c.1305C>G	c.(1303-1305)atC>atG	p.I435M		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	435					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	GAATTCCCTTGATTCTATTAT	0.338																																						ENST00000423485.1	0.360000	9.000000e-02	0.270000	0.130000	0.190000	0.208987	0.190000	0.180000																										0				39						c.(1303-1305)atC>atG		topoisomerase (DNA) II alpha 170kDa	Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)						136.0	121.0	126.0					17																	38564781		1847	4102	5949	SO:0001583	missense	7153	0	0					g.chr17:38564781G>C		CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.1305C>G	chr17.hg19:g.38564781G>C	ENSP00000411532:p.Ile435Met	0						p.I435M	NM_001067.3	NP_001058.2	1	2	3	2.039392	P11388	TOP2A_HUMAN	STAD - Stomach adenocarcinoma(5;0.00183)	11	1463	-		Breast(137;0.00328)	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Missense_Mutation	SNP	ENST00000423485.1	1	1	hg19	c.1305C>G	CCDS45672.1	0	.	.	.	.	.	.	.	.	.	.	G	18.48	3.632601	0.67015	.	.	ENSG00000131747	ENST00000423485;ENST00000269577;ENST00000348049;ENST00000357601	T	0.25250	1.81	5.5	4.51	0.55191	5.5	4.51	0.55191	DNA topoisomerase, type IIA, subunit B/N-terminal, alpha-beta (1);DNA topoisomerase, type IIA, central (1);DNA topoisomerase, type IIA, subunit B/N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.38401	0.1039	M	0.73372	2.23	0.58432	D	0.999992	P	0.50443	0.935	P	0.54460	0.753	T	0.14227	-1.0480	10	0.35671	T	0.21	.	8.5579	0.33492	0.232:0.0:0.7679:0.0	.	435	P11388	TOP2A_HUMAN	M	435;515;458;471	ENSP00000411532:I435M	ENSP00000269577:I515M	I	-	3	3	3	TOP2A	35818307	35818307	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.709000	0.54853	1.277000	0.44412	0.591000	0.81541	ATC	0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.338	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1	0	0	1		2	2	2	0		0	0	47		47	47	1	1.940000	-3.733343	1	0.380000				9	9		250	246	0		1	1		0	0	47	0		0.994037	1.024245e-01	0	2	0	12	0	9	250
KRT38	8687	broad.mit.edu	37	17	39596894	39596894	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr17:39596894C>T	ENST00000246646.3	-	1	279	c.280G>A	c.(280-282)Gcc>Acc	p.A94T		NM_006771.3	NP_006762.3	O76015	KRT38_HUMAN	keratin 38	94	Head.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	29		Breast(137;0.000496)				TCACCATAGGCCCCACAGATT	0.602																																						ENST00000246646.3	1.000000	7.600000e-01	1.000000	0.860000	0.960000	0.942156	0.960000	1.000000																										0				29						c.(280-282)Gcc>Acc		keratin 38							93.0	84.0	87.0					17																	39596894		2203	4300	6503	SO:0001583	missense	8687	5	121412	39				g.chr17:39596894C>T	Y16794	CCDS11392.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000171360	ENSG00000171360		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6456	protein-coding gene	gene with protein product		604542	"""keratin, hair, acidic, 8"""	KRTHA8		9756910, 16831889	Standard	NM_006771		Approved		uc002hwq.1	O76015	OTTHUMG00000133439	ENST00000246646.3:c.280G>A	chr17.hg19:g.39596894C>T	ENSP00000246646:p.Ala94Thr	0						p.A94T	NM_006771.3	NP_006762.3	1	2	3	2.039392	O76015	KRT38_HUMAN		1	279	-		Breast(137;0.000496)	A2RRM5|Q6A164	Missense_Mutation	SNP	ENST00000246646.3	1	1	hg19	c.280G>A	CCDS11392.1	1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.500176	0.26861	.	.	ENSG00000171360	ENST00000246646	T	0.81330	-1.48	4.89	-9.78	0.00496	4.89	-9.78	0.00496	.	1.660260	0.03712	N	0.250436	T	0.55986	0.1955	N	0.11064	0.09	0.09310	N	1	B	0.14438	0.01	B	0.10450	0.005	T	0.48139	-0.9061	10	0.26408	T	0.33	.	4.3812	0.11295	0.2664:0.4535:0.1747:0.1055	.	94	O76015	KRT38_HUMAN	T	94	ENSP00000246646:A94T	ENSP00000246646:A94T	A	-	1	0	0	KRT38	36850420	36850420	0.000000	0.05858	0.000000	0.03702	0.177000	0.22998	-1.774000	0.01784	-2.506000	0.00507	-0.912000	0.02778	GCC	0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.602	KRT38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257307.2	1	0	1		2	2	2	0		0	0	62		62	60	1	1.940000	-3.992291	1	0.380000	NM_006771			70	68		313	306	1		1			0	0	62	0		1.000000	0	0	0	0	0	0	70	313
ALOX15	246	broad.mit.edu	37	17	4544868	4544868	+	Missense_Mutation	SNP	C	C	G			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr17:4544868C>G	ENST00000570836.1	-	2	175	c.79G>C	c.(79-81)Gtc>Ctc	p.V27L	ALOX15_ENST00000293761.3_Missense_Mutation_p.V27L|ALOX15_ENST00000574640.1_Missense_Mutation_p.V27L|ALOX15_ENST00000545513.1_Missense_Mutation_p.V49L			P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase	27	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				apoptotic cell clearance (GO:0043277)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|cellular response to calcium ion (GO:0071277)|cellular response to interleukin-13 (GO:0035963)|hepoxilin biosynthetic process (GO:0051122)|inflammatory response (GO:0006954)|leukotriene metabolic process (GO:0006691)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxygenase pathway (GO:0019372)|negative regulation of adaptive immune response (GO:0002820)|ossification (GO:0001503)|phosphatidylethanolamine biosynthetic process (GO:0006646)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of engulfment of apoptotic cell (GO:1901074)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arachidonate 12-lipoxygenase activity (GO:0004052)|arachidonate 15-lipoxygenase activity (GO:0050473)|eoxin A4 synthase activity (GO:0097260)|iron ion binding (GO:0005506)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(5)	20				READ - Rectum adenocarcinoma(115;0.0327)		TGCTGGCCGACCAGCCACAGC	0.687																																						ENST00000570836.1	1.000000	6.900000e-01	1.000000	0.810000	0.940000	0.921623	0.940000	1.000000																										0				20						c.(79-81)Gtc>Ctc		arachidonate 15-lipoxygenase							29.0	28.0	28.0					17																	4544868		2198	4295	6493	SO:0001583	missense	246	0	0					g.chr17:4544868C>G	M23892	CCDS11049.1	17p13.3	2010-09-24			ENSG00000161905	ENSG00000161905	1.13.11.33	"""Arachidonate lipoxygenases"""	433	protein-coding gene	gene with protein product		152392				1570320	Standard	NM_001140		Approved	15-LOX-1	uc002fyh.3	P16050	OTTHUMG00000090746	ENST00000570836.1:c.79G>C	chr17.hg19:g.4544868C>G	ENSP00000458832:p.Val27Leu	0					ALOX15_ENST00000293761.3_Missense_Mutation_p.V27L|ALOX15_ENST00000545513.1_Missense_Mutation_p.V49L|ALOX15_ENST00000574640.1_Missense_Mutation_p.V27L	p.V27L			0	0	0	1.952011	P16050	LOX15_HUMAN		2	175	-			A8K2P4|B7ZA11|Q8N6R7|Q99657	Missense_Mutation	SNP	ENST00000570836.1	1	1	hg19	c.79G>C	CCDS11049.1	1	.	.	.	.	.	.	.	.	.	.	C	18.79	3.698666	0.68501	.	.	ENSG00000161905	ENST00000293761;ENST00000545513	T;T	0.65549	-0.16;-0.16	5.33	3.31	0.37934	5.33	3.31	0.37934	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.294429	0.26891	N	0.021975	T	0.68979	0.3060	M	0.88906	2.99	0.27340	N	0.956541	B;B;B	0.31859	0.106;0.343;0.129	B;B;B	0.38712	0.169;0.125;0.28	T	0.65940	-0.6046	10	0.66056	D	0.02	-16.6582	9.0593	0.36425	0.0:0.8459:0.0:0.1541	.	49;27;27	F5H0G8;B7ZA11;P16050	.;.;LOX15_HUMAN	L	27;49	ENSP00000293761:V27L;ENSP00000439855:V49L	ENSP00000293761:V27L	V	-	1	0	0	ALOX15	4491617	4491617	1.000000	0.71417	0.921000	0.36526	0.960000	0.62799	2.813000	0.48002	0.607000	0.29982	0.655000	0.94253	GTC	0.355509		TCGA-2J-AAB1-01A-11D-A40W-08	0.687	ALOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207487.2	1	0	1		2	2	2	0		0	0	32		32	32	1	1.940000	-20.000000	1	0.380000				36	36		155	153	1		1			0	0	32	0		1.000000	0	0	0	0	0	0	36	155
DHX58	79132	broad.mit.edu	37	17	40263826	40263826	+	Missense_Mutation	SNP	C	C	T	rs377046797		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr17:40263826C>T	ENST00000251642.3	-	3	307	c.85G>A	c.(85-87)Ggg>Agg	p.G29R		NM_024119.2	NP_077024.2	Q96C10	DHX58_HUMAN	DEXH (Asp-Glu-X-His) box polypeptide 58	29	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of innate immune response (GO:0045824)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of type I interferon production (GO:0032481)|regulation of innate immune response (GO:0045088)|response to virus (GO:0009615)|viral process (GO:0016032)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CGGGTCTTCCCGGCACCCGTG	0.592																																						ENST00000251642.3	0.150000	2.000000e-02	0.110000	0.040000	0.060000	0.084300	0.060000	0.060000																										0				16						c.(85-87)Ggg>Agg		DEXH (Asp-Glu-X-His) box polypeptide 58		C	ARG/GLY	0,4406		0,0,2203	95.0	92.0	93.0		85	4.0	0.8	17		93	1,8599	1.2+/-3.3	0,1,4299	no	missense	DHX58	NM_024119.2	125	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	29/679	40263826	1,13005	2203	4300	6503	SO:0001583	missense	79132	4	121412	40				g.chr17:40263826C>T	BC014949	CCDS11416.1	17q21.2	2008-02-05			ENSG00000108771	ENSG00000108771			29517	protein-coding gene	gene with protein product	"""RNA helicase LGP2"""	608588				11735219	Standard	NM_024119		Approved	LGP2, D11LGP2	uc002hyw.3	Q96C10	OTTHUMG00000133493	ENST00000251642.3:c.85G>A	chr17.hg19:g.40263826C>T	ENSP00000251642:p.Gly29Arg	0						p.G29R	NM_024119.2	NP_077024.2	1	2	3	2.039392	Q96C10	DHX58_HUMAN		3	307	-		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)	Q9HAM6	Missense_Mutation	SNP	ENST00000251642.3	0	1	hg19	c.85G>A	CCDS11416.1	0	.	.	.	.	.	.	.	.	.	.	C	21.0	4.089390	0.76756	0.0	1.16E-4	ENSG00000108771	ENST00000251642;ENST00000423748;ENST00000413196;ENST00000430773	D;D;D	0.95554	-3.23;-3.74;-3.74	4.99	4.02	0.46733	4.99	4.02	0.46733	DEAD-like helicase (2);Helicase/UvrB domain (1);	0.000000	0.85682	D	0.000000	D	0.98673	0.9555	H	0.99169	4.455	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98660	1.0683	10	0.87932	D	0	-2.8477	12.3178	0.54966	0.0:0.9172:0.0:0.0828	.	29;29	B7Z455;Q96C10	.;DHX58_HUMAN	R	29	ENSP00000251642:G29R;ENSP00000416389:G29R;ENSP00000404639:G29R	ENSP00000251642:G29R	G	-	1	0	0	DHX58	37517352	37517352	1.000000	0.71417	0.836000	0.33094	0.493000	0.33554	5.333000	0.65917	1.348000	0.45733	0.455000	0.32223	GGG	0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.592	DHX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257396.1	0	0	1		2	2	2	0		0	0	93		93	89	1	1.940000	-2.414314	0	0.380000	NM_024119			6	6		482	476	0		1	0		0	0	93	1		0.963816	1.308777e-01	0	0	0	43	0	6	482
POLR2A	5430	broad.mit.edu	37	17	7401414	7401414	+	Missense_Mutation	SNP	G	G	A	rs141769858		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr17:7401414G>A	ENST00000322644.6	+	8	1619	c.1220G>A	c.(1219-1221)cGc>cAc	p.R407H	POLR2A_ENST00000572844.1_Missense_Mutation_p.R407H	NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	407					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				GAACTAGTGCGCAGGGGGAAC	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		19258	0.0		0.0	False		,,,				2504	0.001					ENST00000322644.6	0.160000	2.000000e-02	0.120000	0.040000	0.070000	0.087686	0.070000	0.070000																										0				50						c.(1219-1221)cGc>cAc		polymerase (RNA) II (DNA directed) polypeptide A, 220kDa		G	HIS/ARG	10,4396	16.8+/-37.8	0,10,2193	98.0	86.0	90.0		1220	5.6	1.0	17	dbSNP_134	90	0,8600		0,0,4300	yes	missense	POLR2A	NM_000937.4	29	0,10,6493	AA,AG,GG		0.0,0.227,0.0769	possibly-damaging	407/1971	7401414	10,12996	2203	4300	6503	SO:0001583	missense	5430	27	121412	45				g.chr17:7401414G>A			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.1220G>A	chr17.hg19:g.7401414G>A	ENSP00000314949:p.Arg407His	0					POLR2A_ENST00000572844.1_Missense_Mutation_p.R407H	p.R407H	NM_000937.4	NP_000928	0	0	0	1.959757	P24928	RPB1_HUMAN		8	1619	+		Prostate(122;0.173)	A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	0	1	hg19	c.1220G>A	CCDS32548.1	0	.	.	.	.	.	.	.	.	.	.	G	20.3	3.969615	0.74246	0.00227	0.0	ENSG00000181222	ENST00000535204;ENST00000322644	T	0.68765	-0.35	5.6	5.6	0.85130	5.6	5.6	0.85130	RNA polymerase, alpha subunit (1);RNA polymerase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.73567	0.3603	M	0.86343	2.81	0.58432	D	0.999999	B;B	0.23490	0.086;0.024	B;B	0.22152	0.038;0.014	T	0.73572	-0.3940	10	0.62326	D	0.03	-11.3406	18.3894	0.90477	0.0:0.0:1.0:0.0	.	407;407	P24928;Q6NX41	RPB1_HUMAN;.	H	363;407	ENSP00000314949:R407H	ENSP00000314949:R407H	R	+	2	0	0	SLC35G6	7342138	7342138	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.828000	0.92047	2.653000	0.90120	0.563000	0.77884	CGC	0.358045		TCGA-2J-AAB1-01A-11D-A40W-08	0.517	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	0	0	1		21	7	2	1		1	1	51		51	51	1	1.940000	-3.238978	1	0.380000	NM_000937			5	5		339	337	0		0	0		1	0	51	0		0.000960	2.325891e-03	0	0	0	80	0	5	339
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	0.420000	1.400000e-01	0.350000	0.200000	0.260000	0.279280	0.260000	0.260000	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	24185	GRCh37	CM062017|CM951224	TP53	M	rs28934578	c.(523-525)cGc>cAc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						50.0	50.0	50.0					17																	7578406		2203	4300	6503	SO:0001583	missense	7157	1	121412	41	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578406C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	chr17.hg19:g.7578406C>T	ENSP00000269305:p.Arg175His	0	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H	p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	0	0	1.959757	P04637	P53_HUMAN		5	713	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.524G>A	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	0	TP53	7519131	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	0.358045		TCGA-2J-AAB1-01A-11D-A40W-08	0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	7	0		0	0	49		49	48	1	1.940000	-3.027011	1	0.380000	NM_000546			13	13		238	235	0		1	1	1	0	1	49	857		0.999538	8.920237e-01	9.999992e-01	8	52	66	1018	13	238
ABCA9	10350	broad.mit.edu	37	17	67016614	67016614	+	Missense_Mutation	SNP	C	C	T	rs61740908		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr17:67016614C>T	ENST00000340001.4	-	19	2726	c.2515G>A	c.(2515-2517)Gtg>Atg	p.V839M	ABCA9_ENST00000453985.2_Missense_Mutation_p.V839M|ABCA9-AS1_ENST00000458677.1_RNA|ABCA9_ENST00000370732.2_Missense_Mutation_p.V839M	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	839					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.V839M(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					CAGAGCGCCACGCCACTGATT	0.443																																						ENST00000340001.4	0.170000	4.000000e-02	0.130000	0.060000	0.090000	0.103253	0.090000	0.100000																										1	Substitution - Missense(1)	p.V839M(1)	central_nervous_system(1)	91						c.(2515-2517)Gtg>Atg		ATP-binding cassette, sub-family A (ABC1), member 9							117.0	108.0	111.0					17																	67016614		2203	4300	6503	SO:0001583	missense	10350	6	121410	41				g.chr17:67016614C>T	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.2515G>A	chr17.hg19:g.67016614C>T	ENSP00000342216:p.Val839Met	0					ABCA9_ENST00000370732.2_Missense_Mutation_p.V839M|ABCA9_ENST00000453985.2_Missense_Mutation_p.V839M|ABCA9-AS1_ENST00000458677.1_RNA	p.V839M	NM_080283.3	NP_525022.2	0	1	1	2.019142	Q8IUA7	ABCA9_HUMAN		19	2726	-	Breast(10;1.47e-12)		Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	ENST00000340001.4	0	1	hg19	c.2515G>A	CCDS11681.1	0	.	.	.	.	.	.	.	.	.	.	c	0.305	-0.971160	0.02232	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	T;T	0.75938	-0.98;-0.98	5.08	-4.05	0.03998	5.08	-4.05	0.03998	.	0.703590	0.12727	N	0.444186	T	0.26593	0.0650	N	0.00413	-1.525	0.22684	N	0.998856	B;B	0.11235	0.004;0.001	B;B	0.08055	0.003;0.001	T	0.45205	-0.9277	10	0.02654	T	1	.	2.4227	0.04452	0.1895:0.1485:0.43:0.232	.	839;839	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	M	839;822;839;834	ENSP00000342216:V839M;ENSP00000359767:V839M	ENSP00000342216:V839M	V	-	1	0	0	ABCA9	64528209	64528209	0.000000	0.05858	0.810000	0.32431	0.644000	0.38419	-0.621000	0.05559	-0.594000	0.05836	-0.464000	0.05259	GTG	0.378820		TCGA-2J-AAB1-01A-11D-A40W-08	0.443	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	0	0	1		2	2	2	0		0	0	86		86	83	1	1.940000	-3.166621	1	0.380000	NM_172386			10	10		546	540	0		1	0		0	0	86	0		0.996753	4.231827e-04	0	0	0	2	0	10	546
LAMA1	284217	broad.mit.edu	37	18	7023334	7023334	+	Missense_Mutation	SNP	C	C	T	rs369294134		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr18:7023334C>T	ENST00000389658.3	-	19	2623	c.2530G>A	c.(2530-2532)Gaa>Aaa	p.E844K		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	844	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ACACAAGATTCGCCAGGCACT	0.532																																						ENST00000389658.3	1.000000	9.000000e-01	1.000000	0.990000	0.990000	0.993917	0.990000	1.000000																										0				205						c.(2530-2532)Gaa>Aaa		laminin, alpha 1		C	LYS/GLU	0,4406		0,0,2203	103.0	95.0	98.0		2530	4.6	0.7	18		98	1,8599	1.2+/-3.3	0,1,4299	no	missense	LAMA1	NM_005559.3	56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	844/3076	7023334	1,13005	2203	4300	6503	SO:0001583	missense	284217	4	121412	38				g.chr18:7023334C>T	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2530G>A	chr18.hg19:g.7023334C>T	ENSP00000374309:p.Glu844Lys	0						p.E844K	NM_005559.3	NP_005550.2	1	2	3	2.043860	P25391	LAMA1_HUMAN		19	2623	-		Colorectal(10;0.172)		Missense_Mutation	SNP	ENST00000389658.3	1	1	hg19	c.2530G>A	CCDS32787.1	1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.767948	0.31320	0.0	1.16E-4	ENSG00000101680	ENST00000389658	T	0.61392	0.11	5.47	4.61	0.57282	5.47	4.61	0.57282	EGF-like, laminin (4);	0.325995	0.26971	N	0.021577	T	0.49440	0.1557	L	0.52573	1.65	0.22745	N	0.99879	B	0.12013	0.005	B	0.10450	0.005	T	0.38478	-0.9659	10	0.31617	T	0.26	.	10.5047	0.44826	0.0:0.753:0.1702:0.0769	.	844	P25391	LAMA1_HUMAN	K	844	ENSP00000374309:E844K	ENSP00000374309:E844K	E	-	1	0	0	LAMA1	7013334	7013334	0.334000	0.24739	0.677000	0.29947	0.127000	0.20565	3.215000	0.51169	1.323000	0.45263	-0.149000	0.13747	GAA	0.384676		TCGA-2J-AAB1-01A-11D-A40W-08	0.532	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	1	0	1		2	2	2	0		0	0	39		39	38	1	1.940000	-3.749639	1	0.380000	NM_005559			49	48		171	168	1		1	0		0	0	39	0		1.000000	0	0	0	0	1	0	49	171
C19orf57	79173	broad.mit.edu	37	19	14006194	14006194	+	Missense_Mutation	SNP	G	G	A	rs145142690		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr19:14006194G>A	ENST00000586783.1	-	2	196	c.197C>T	c.(196-198)gCc>gTc	p.A66V	C19orf57_ENST00000346736.2_Missense_Mutation_p.A66V|C19orf57_ENST00000591586.1_Missense_Mutation_p.A66V|C19orf57_ENST00000454313.1_Missense_Mutation_p.A66V			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57	66					multicellular organismal development (GO:0007275)					breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			CCTGGAGACGGCCTTTCCTGG	0.562																																						ENST00000586783.1	1.000000	6.800000e-01	0.950000	0.760000	0.850000	0.857597	0.850000	1.000000																										0				14						c.(196-198)gCc>gTc		chromosome 19 open reading frame 57		G	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	165.0	144.0	151.0		197	-0.7	0.0	19	dbSNP_134	151	0,8600		0,0,4300	no	missense	C19orf57	NM_024323.3	64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	66/638	14006194	1,13005	2203	4300	6503	SO:0001583	missense	79173	2	121412	37				g.chr19:14006194G>A	BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.197C>T	chr19.hg19:g.14006194G>A	ENSP00000465822:p.Ala66Val	0					C19orf57_ENST00000346736.2_Missense_Mutation_p.A66V|C19orf57_ENST00000454313.1_Missense_Mutation_p.A66V|C19orf57_ENST00000591586.1_Missense_Mutation_p.A66V	p.A66V			1	2	3	2.047246	Q0VDD7	CS057_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;2e-21)	2	196	-			Q13411|Q8N825|Q96D63|Q9BU49	Missense_Mutation	SNP	ENST00000586783.1	1	1	hg19	c.197C>T		1	.	.	.	.	.	.	.	.	.	.	G	5.727	0.318640	0.10845	2.27E-4	0.0	ENSG00000132016	ENST00000454313;ENST00000346736	T;T	0.35605	1.3;1.3	4.03	-0.708	0.11241	4.03	-0.708	0.11241	.	0.461071	0.16102	N	0.229524	T	0.15825	0.0381	N	0.12746	0.255	0.09310	N	1	B	0.16603	0.018	B	0.17433	0.018	T	0.12243	-1.0555	10	0.38643	T	0.18	-3.5745	3.3117	0.07018	0.2027:0.0:0.4413:0.356	.	66	Q0VDD7-2	.	V	66	ENSP00000404382:A66V;ENSP00000254336:A66V	ENSP00000254336:A66V	A	-	2	0	0	C19orf57	13867194	13867194	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.281000	0.08456	-0.011000	0.14247	-0.137000	0.14449	GCC	0.384676		TCGA-2J-AAB1-01A-11D-A40W-08	0.562	C19orf57-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000457947.1	1	0	1		2	2	2	0		0	0	77		77	77	1	1.940000	-20.000000	1	0.380000	NM_024323			78	76		408	401	1		1	0		0	0	77	0		1.000000	2.648429e-02	0	0	0	2	0	78	408
SARS2	54938	broad.mit.edu	37	19	39421234	39421234	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr19:39421234G>A	ENST00000221431.6	-	1	302	c.143C>T	c.(142-144)gCg>gTg	p.A48V	MRPS12_ENST00000308018.4_5'UTR|MRPS12_ENST00000402029.3_5'Flank|SARS2_ENST00000448145.2_Intron|SARS2_ENST00000594171.1_5'Flank|SARS2_ENST00000600042.1_Missense_Mutation_p.A48V|CTC-360G5.8_ENST00000599996.1_Intron|MRPS12_ENST00000407800.2_5'Flank|SARS2_ENST00000430193.3_Missense_Mutation_p.A48V	NM_017827.3	NP_060297.1	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2, mitochondrial	48					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|serine-tRNA ligase activity (GO:0004828)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GCCCTCGCGCGCATACTCGTA	0.627											OREG0025455	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000221431.6	0.110000	1.000000e-02	0.080000	0.030000	0.050000	0.060873	0.050000	0.060000																										0				15						c.(142-144)gCg>gTg		seryl-tRNA synthetase 2, mitochondrial							97.0	84.0	88.0					19																	39421234		2203	4300	6503	SO:0001583	missense	54938	2	121412	37				g.chr19:39421234G>A	AB029948	CCDS33017.1, CCDS54265.1	19q13.2	2014-05-06	2007-02-23			ENSG00000104835	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	17697	protein-coding gene	gene with protein product	"""serine tRNA ligase 2, mitochondrial"""	612804	"""serine-tRNA ligase, mitochondrial"", ""seryl-tRNA synthetase 2"""	SARSM		10764807	Standard	NM_001145901		Approved	FLJ20450, mtSerRS, SerRSmt, SARS, SERS, SYS	uc010xup.1	Q9NP81	OTTHUMG00000182691	ENST00000221431.6:c.143C>T	chr19.hg19:g.39421234G>A	ENSP00000221431:p.Ala48Val	0		OREG0025455	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	885	MRPS12_ENST00000308018.4_5'UTR|MRPS12_ENST00000402029.3_5'Flank|SARS2_ENST00000600042.1_Missense_Mutation_p.A48V|SARS2_ENST00000430193.3_Missense_Mutation_p.A48V|MRPS12_ENST00000407800.2_5'Flank|SARS2_ENST00000448145.2_Intron|CTC-360G5.8_ENST00000599996.1_Intron|SARS2_ENST00000594171.1_5'Flank	p.A48V	NM_017827.3	NP_060297.1	1	2	3	2.030287	Q9NP81	SYSM_HUMAN	Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)	1	302	-	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		A6NHW7|B4DE10|Q9BVP3	Missense_Mutation	SNP	ENST00000221431.6	0	1	hg19	c.143C>T	CCDS33017.1	0	.	.	.	.	.	.	.	.	.	.	G	14.36	2.512002	0.44660	.	.	ENSG00000104835	ENST00000430193;ENST00000221431;ENST00000455102	T;T;T	0.55588	0.51;0.51;1.49	5.65	4.57	0.56435	5.65	4.57	0.56435	.	0.122893	0.53938	D	0.000045	T	0.40979	0.1139	L	0.43923	1.385	.	.	.	D;B;B	0.56746	0.977;0.206;0.257	B;B;B	0.43623	0.425;0.014;0.007	T	0.44952	-0.9294	9	0.16896	T	0.51	.	8.6175	0.33840	0.1027:0.0:0.8973:0.0	.	48;48;48	B4DJP6;B4DE10;Q9NP81	.;.;SYSM_HUMAN	V	48	ENSP00000406754:A48V;ENSP00000221431:A48V;ENSP00000414954:A48V	ENSP00000221431:A48V	A	-	2	0	0	FBXO17	44113074	44113074	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	3.764000	0.55264	2.941000	0.99782	0.655000	0.94253	GCG	0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.627	SARS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463139.1	0	0	1		2	2	2	0		0	0	129		129	127	1	1.940000	-1.740918	0	0.380000	NM_017827			6	6		597	586	0		1	0		0	0	129	0		0.963070	3.925745e-02	0	0	0	26	0	6	597
ZNF404	342908	broad.mit.edu	37	19	44388109	44388109	+	Splice_Site	SNP	C	C	T	rs550096239	byFrequency	TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr19:44388109C>T	ENST00000587539.1	-	1	7	c.8G>A	c.(7-9)cGg>cAg	p.R3Q	ZNF404_ENST00000588094.1_5'UTR	NM_001033719.2	NP_001028891.2	Q494X3	ZN404_HUMAN	zinc finger protein 404	3					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|stomach(2)|urinary_tract(1)	17		Prostate(69;0.0352)				TCAACTCACCCGGGCCATGGT	0.388													T|||	8	0.00159744	0.0	0.0	5008	,	,		19816	0.0		0.0	False		,,,				2504	0.0082					ENST00000587539.1	1.000000	7.400000e-01	1.000000	0.860000	0.990000	0.951392	0.990000	1.000000																										0				17						c.(7-9)cGg>cAg		zinc finger protein 404							95.0	99.0	98.0					19																	44388109		1836	4093	5929	SO:0001630	splice_region_variant	342908	132	119076	49				g.chr19:44388109C>T	XM_092027	CCDS59394.1	19q13.31	2013-01-08				ENSG00000176222		"""Zinc fingers, C2H2-type"", ""-"""	19417	protein-coding gene	gene with protein product							Standard	NM_001033719		Approved		uc002oxs.5	Q494X3		ENST00000587539.1:c.9+1G>A	chr19.hg19:g.44388109C>T		0					ZNF404_ENST00000588094.1_5'UTR	p.R3Q	NM_001033719.2	NP_001028891.2	0	0	0	1.990385	Q494X3	ZN404_HUMAN		1	7	-		Prostate(69;0.0352)	A4FU30|K7ELF2	Splice_Site	SNP	ENST00000587539.1	1	0	hg19	c.8G>A	CCDS59394.1	1																																																																																								0.367992		TCGA-2J-AAB1-01A-11D-A40W-08	0.388	ZNF404-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460019.1	0	0	1		2	2	2	0		0	0	40		40	40	1	1.940000	-2.534310	1	0.380000	NM_001033719	Missense_Mutation		41	41		169	162	1		1	0		0	0	40	0		1.000000	0	0	0	0	1	0	41	169
ZNF227	7770	broad.mit.edu	37	19	44739673	44739673	+	Missense_Mutation	SNP	A	A	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr19:44739673A>T	ENST00000313040.7	+	6	1295	c.1090A>T	c.(1090-1092)Agt>Tgt	p.S364C	ZNF227_ENST00000589005.1_Missense_Mutation_p.S313C|ZNF227_ENST00000391961.2_Missense_Mutation_p.S313C	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	364					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				CTTTAGTCAAAGTTCAAATTT	0.423																																						ENST00000313040.7	0.170000	2.000000e-02	0.130000	0.050000	0.080000	0.092276	0.080000	0.080000																										0				24						c.(1090-1092)Agt>Tgt		zinc finger protein 227							74.0	81.0	79.0					19																	44739673		2203	4300	6503	SO:0001583	missense	7770	0	0					g.chr19:44739673A>T	AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.1090A>T	chr19.hg19:g.44739673A>T	ENSP00000321049:p.Ser364Cys	0					ZNF227_ENST00000589005.1_Missense_Mutation_p.S313C|ZNF227_ENST00000391961.2_Missense_Mutation_p.S313C	p.S364C	NM_182490.1	NP_872296.1	0	0	0	1.990385	Q86WZ6	ZN227_HUMAN		6	1295	+		Prostate(69;0.0435)	B3KRU7|B7Z5P9	Missense_Mutation	SNP	ENST00000313040.7	0	1	hg19	c.1090A>T	CCDS12636.1	0	.	.	.	.	.	.	.	.	.	.	A	15.35	2.808701	0.50421	.	.	ENSG00000131115	ENST00000313040;ENST00000328297;ENST00000391961;ENST00000418980;ENST00000377916	T;T	0.16743	2.32;3.13	4.54	4.54	0.55810	4.54	4.54	0.55810	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.27027	0.0662	M	0.78285	2.405	0.18873	N	0.999988	B;B;D;B	0.64830	0.238;0.114;0.994;0.114	B;B;P;B	0.47402	0.016;0.023;0.546;0.023	T	0.21484	-1.0244	9	0.52906	T	0.07	.	8.7324	0.34507	0.8306:0.0:0.0:0.1694	.	285;343;316;364	B7Z6M2;Q658S5;Q9NS43;Q86WZ6	.;.;.;ZN227_HUMAN	C	364;321;313;343;65	ENSP00000321049:S364C;ENSP00000375823:S313C	ENSP00000321049:S364C	S	+	1	0	0	ZNF227	49431513	49431513	0.062000	0.20869	0.998000	0.56505	0.993000	0.82548	1.890000	0.39728	1.801000	0.52704	0.460000	0.39030	AGT	0.367992		TCGA-2J-AAB1-01A-11D-A40W-08	0.423	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	0	0	0		2	2	2	0		0	0	43		43	43	1	1.940000	-5.855425	1	0.380000	NM_182490			5	4		327	324	0		1	0		0	0	43	0		0.935993	4.043804e-02	0	0	0	17	0	5	327
ZNF114	163071	broad.mit.edu	37	19	48789674	48789674	+	Missense_Mutation	SNP	A	A	C			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr19:48789674A>C	ENST00000595607.1	+	6	1287	c.793A>C	c.(793-795)Atg>Ctg	p.M265L	ZNF114_ENST00000600687.1_Missense_Mutation_p.M265L|ZNF114_ENST00000315849.1_Missense_Mutation_p.M265L|ZNF114_ENST00000597695.1_Missense_Mutation_p.M231L			Q8NC26	ZN114_HUMAN	zinc finger protein 114	265					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(6)|lung(11)	18		all_epithelial(76;8.01e-05)|all_lung(116;0.000112)|Lung NSC(112;0.000192)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;7.56e-05)|all cancers(93;0.000113)|Epithelial(262;0.00962)|GBM - Glioblastoma multiforme(486;0.0153)		AATTCACGCCATGCAGATGCA	0.463																																						ENST00000595607.1	0.260000	8.000000e-02	0.210000	0.110000	0.150000	0.167493	0.150000	0.150000																										0				18						c.(793-795)Atg>Ctg		zinc finger protein 114							93.0	85.0	88.0					19																	48789674		2203	4300	6503	SO:0001583	missense	163071	0	0					g.chr19:48789674A>C	BC014935	CCDS12713.1, CCDS74412.1	19q13.32	2013-01-08			ENSG00000178150	ENSG00000178150		"""Zinc fingers, C2H2-type"", ""-"""	12894	protein-coding gene	gene with protein product		603996					Standard	XM_005258580		Approved	MGC17986	uc002pim.1	Q8NC26		ENST00000595607.1:c.793A>C	chr19.hg19:g.48789674A>C	ENSP00000469998:p.Met265Leu	0					ZNF114_ENST00000315849.1_Missense_Mutation_p.M265L|ZNF114_ENST00000597695.1_Missense_Mutation_p.M231L|ZNF114_ENST00000600687.1_Missense_Mutation_p.M265L	p.M265L			0	0	0	1.990385	Q8NC26	ZN114_HUMAN		6	1287	+		all_epithelial(76;8.01e-05)|all_lung(116;0.000112)|Lung NSC(112;0.000192)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)	A8K6B0|Q08AQ6	Missense_Mutation	SNP	ENST00000595607.1	1	1	hg19	c.793A>C	CCDS12713.1	0	.	.	.	.	.	.	.	.	.	.	G	1.280	-0.610640	0.03690	.	.	ENSG00000178150	ENST00000315849	T	0.04502	3.61	2.01	0.895	0.19247	2.01	0.895	0.19247	.	.	.	.	.	T	0.02304	0.0071	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48234	-0.9053	9	0.24483	T	0.36	.	4.187	0.10402	0.1438:0.0:0.6304:0.2258	.	265	Q8NC26	ZN114_HUMAN	L	265	ENSP00000318898:M265L	ENSP00000318898:M265L	M	+	1	0	0	ZNF114	53481486	53481486	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.407000	0.07178	0.016000	0.14998	-0.349000	0.07799	ATG	0.367992		TCGA-2J-AAB1-01A-11D-A40W-08	0.463	ZNF114-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465601.1	0	0	1		15	2	2	1		1	1	95		95	95	1	1.940000	-12.119060	1	0.380000	NM_153608			12	12		385	380	0		0			1	0	95	0		0.333234	0	0	0	0	0	0	12	385
RPL28	6158	broad.mit.edu	37	19	55899358	55899358	+	Missense_Mutation	SNP	C	C	T	rs150642428		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr19:55899358C>T	ENST00000344063.2	+	4	895	c.266C>T	c.(265-267)aCg>aTg	p.T89M	RPL28_ENST00000458349.2_Missense_Mutation_p.T89M|RPL28_ENST00000559463.1_Missense_Mutation_p.T89M|RPL28_ENST00000560583.1_Missense_Mutation_p.T89M|RPL28_ENST00000558131.1_Missense_Mutation_p.R83C|RPL28_ENST00000558815.1_Missense_Mutation_p.T89M|RPL28_ENST00000560055.1_Missense_Mutation_p.T89M			P46779	RL28_HUMAN	ribosomal protein L28	89					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(2)|large_intestine(2)|lung(1)	6	Breast(117;0.191)	Renal(1328;0.245)	LUSC - Lung squamous cell carcinoma(43;0.13)|BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0443)		GCTCGCGCCACGCTCAGCAGC	0.622																																						ENST00000344063.2	0.340000	1.300000e-01	0.280000	0.170000	0.220000	0.232081	0.220000	0.220000																										0				6						c.(265-267)aCg>aTg		ribosomal protein L28							95.0	86.0	89.0					19																	55899358		2203	4300	6503	SO:0001583	missense	6158	9	121410	41				g.chr19:55899358C>T	U14969	CCDS12924.1, CCDS46189.1, CCDS46190.1, CCDS46191.1, CCDS46192.1	19q13.4	2011-04-06				ENSG00000108107		"""L ribosomal proteins"""	10330	protein-coding gene	gene with protein product	"""60S ribosomal protein L28"""	603638				7772601, 9582194	Standard	NM_001136134		Approved	FLJ43307, L28	uc010yga.2	P46779		ENST00000344063.2:c.266C>T	chr19.hg19:g.55899358C>T	ENSP00000342787:p.Thr89Met	0					RPL28_ENST00000558815.1_Missense_Mutation_p.T89M|RPL28_ENST00000458349.2_Missense_Mutation_p.T89M|RPL28_ENST00000560055.1_Missense_Mutation_p.T89M|RPL28_ENST00000558131.1_Missense_Mutation_p.R83C|RPL28_ENST00000559463.1_Missense_Mutation_p.T89M|RPL28_ENST00000560583.1_Missense_Mutation_p.T89M	p.T89M			0	0	0	2.014203	P46779	RL28_HUMAN	LUSC - Lung squamous cell carcinoma(43;0.13)|BRCA - Breast invasive adenocarcinoma(297;0.209)	4	895	+	Breast(117;0.191)	Renal(1328;0.245)	B2R4A6|B4DEP9|C9JB50|E9PB24|G5E9L2|Q6IAY0|Q96FX1|Q9BWQ0	Missense_Mutation	SNP	ENST00000344063.2	1	1	hg19	c.266C>T	CCDS12924.1	0	.	.	.	.	.	.	.	.	.	.	C	16.19	3.054549	0.55218	.	.	ENSG00000108107	ENST00000344063;ENST00000426763;ENST00000458349	T;T	0.44881	0.91;0.91	3.44	3.44	0.39384	3.44	3.44	0.39384	.	0.000000	0.85682	D	0.000000	T	0.51075	0.1653	L	0.53617	1.68	0.58432	D	0.999996	D;D;P	0.65815	0.978;0.995;0.607	P;P;B	0.56042	0.543;0.79;0.427	T	0.54925	-0.8220	10	0.52906	T	0.07	.	13.1887	0.59697	0.0:1.0:0.0:0.0	.	89;89;89	B4DEP9;E9PB24;P46779	.;.;RL28_HUMAN	M	89	ENSP00000342787:T89M;ENSP00000401450:T89M	ENSP00000342787:T89M	T	+	2	0	0	RPL28	60591170	60591170	1.000000	0.71417	1.000000	0.80357	0.651000	0.38670	7.107000	0.77047	1.864000	0.54056	0.462000	0.41574	ACG	0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.622	RPL28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416277.2	1	0	1		2	2	2	0		0	0	80		80	75	1	1.940000	-4.410952	1	0.380000	NM_000991			17	17		386	377	0		1	1		0	0	80	0		0.999960	1	0	326	0	6836	0	17	386
DCLRE1B	64858	broad.mit.edu	37	1	114454068	114454068	+	Missense_Mutation	SNP	T	T	G			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr1:114454068T>G	ENST00000369563.3	+	4	1300	c.854T>G	c.(853-855)tTt>tGt	p.F285C	DCLRE1B_ENST00000466480.1_3'UTR	NM_022836.3	NP_073747.1	Q9H816	DCR1B_HUMAN	DNA cross-link repair 1B	285					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|protection from non-homologous end joining at telomere (GO:0031848)|telomere maintenance (GO:0000723)|telomeric 3' overhang formation (GO:0031860)|telomeric loop formation (GO:0031627)	centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)			breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(6)|stomach(1)	18	Lung SC(450;0.184)	all_cancers(81;1.46e-05)|all_epithelial(167;2.42e-05)|all_lung(203;0.000353)|Lung NSC(69;0.000518)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTTCGTGCCTTTGTCGCAGCA	0.567								Other identified genes with known or suspected DNA repair function																														ENST00000369563.3	1.000000	7.300000e-01	1.000000	0.820000	0.920000	0.917342	0.920000	1.000000																										0				18						c.(853-855)tTt>tGt	Other identified genes with known or suspected DNA repair function	DNA cross-link repair 1B							119.0	102.0	108.0					1																	114454068		2203	4300	6503	SO:0001583	missense	64858	0	0					g.chr1:114454068T>G	BC029687	CCDS866.1	1p11.1	2010-06-24	2010-06-24		ENSG00000118655	ENSG00000118655			17641	protein-coding gene	gene with protein product	"""APOLLO"", ""PSO2 homolog (S. cerevisiae)"""	609683	"""DNA cross-link repair 1B (PSO2 homolog, S. cerevisiae)"""				Standard	NM_022836		Approved	SNM1B, FLJ12810, FLJ13998	uc001eeg.3	Q9H816	OTTHUMG00000011937	ENST00000369563.3:c.854T>G	chr1.hg19:g.114454068T>G	ENSP00000358576:p.Phe285Cys	0					DCLRE1B_ENST00000466480.1_3'UTR	p.F285C	NM_022836.3	NP_073747.1	1	2	3	2.038935	Q9H816	DCR1B_HUMAN		4	1300	+	Lung SC(450;0.184)	all_cancers(81;1.46e-05)|all_epithelial(167;2.42e-05)|all_lung(203;0.000353)|Lung NSC(69;0.000518)	Q9H9E5	Missense_Mutation	SNP	ENST00000369563.3	1	1	hg19	c.854T>G	CCDS866.1	1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.298120	0.81025	.	.	ENSG00000118655	ENST00000369563	T	0.61980	0.06	6.02	4.9	0.64082	6.02	4.9	0.64082	DNA repair metallo-beta-lactamase (1);	0.000000	0.85682	D	0.000000	T	0.70439	0.3224	M	0.85630	2.765	0.58432	D	0.999998	D	0.63046	0.992	P	0.59357	0.856	T	0.75983	-0.3125	10	0.59425	D	0.04	-9.6429	11.9514	0.52956	0.0:0.0672:0.0:0.9328	.	285	Q9H816	DCR1B_HUMAN	C	285	ENSP00000358576:F285C	ENSP00000358576:F285C	F	+	2	0	0	DCLRE1B	114255591	114255591	1.000000	0.71417	0.988000	0.46212	0.939000	0.58152	7.967000	0.87967	1.116000	0.41820	0.533000	0.62120	TTT	0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.567	DCLRE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033020.2	1	0	1		2	2	2	0		0	0	61		61	60	1	1.940000	-20.000000	1	0.380000	NM_022836			64	63		300	292	1		1	1		0	0	61	0		1.000000	6.953711e-01	0	3	0	10	0	64	300
SPAG17	200162	broad.mit.edu	37	1	118550780	118550780	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr1:118550780G>A	ENST00000336338.5	-	31	4539	c.4474C>T	c.(4474-4476)Cgg>Tgg	p.R1492W		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1492						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CTTTCTACCCGCATACACTTC	0.493																																						ENST00000336338.5	0.650000	2.400000e-01	0.510000	0.310000	0.400000	0.420318	0.400000	0.390000																										0				123						c.(4474-4476)Cgg>Tgg		sperm associated antigen 17							127.0	103.0	111.0					1																	118550780		2203	4300	6503	SO:0001583	missense	200162	3	121402	36				g.chr1:118550780G>A		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.4474C>T	chr1.hg19:g.118550780G>A	ENSP00000337804:p.Arg1492Trp	0						p.R1492W	NM_206996.2	NP_996879.1	1	2	3	2.038935	Q6Q759	SPG17_HUMAN		31	4539	-	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	1	1	hg19	c.4474C>T	CCDS899.1	0	.	.	.	.	.	.	.	.	.	.	G	11.93	1.785810	0.31593	.	.	ENSG00000155761	ENST00000336338	T	0.23348	1.91	5.83	2.83	0.33086	5.83	2.83	0.33086	.	0.346719	0.27932	N	0.017261	T	0.26048	0.0635	L	0.41961	1.31	0.30207	N	0.798109	D	0.89917	1.0	D	0.66196	0.942	T	0.11470	-1.0586	10	0.62326	D	0.03	.	14.1367	0.65291	0.0:0.0:0.6081:0.3919	.	1492	Q6Q759	SPG17_HUMAN	W	1492	ENSP00000337804:R1492W	ENSP00000337804:R1492W	R	-	1	2	2	SPAG17	118352303	118352303	0.805000	0.28982	0.998000	0.56505	0.340000	0.28889	1.437000	0.34991	0.326000	0.23384	0.563000	0.77884	CGG	0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.493	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	1	0	1		2	2	2	0		0	0	46		46	46	1	1.940000	-3.017764	1	0.380000	NM_206996			16	15		197	193	0		1	0		0	0	46	0		0.999932	0	0	0	0	1	0	16	197
SV2A	9900	broad.mit.edu	37	1	149877463	149877463	+	Missense_Mutation	SNP	A	A	C			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr1:149877463A>C	ENST00000369146.3	-	12	2504	c.2014T>G	c.(2014-2016)Ttg>Gtg	p.L672V	SV2A_ENST00000369145.1_Missense_Mutation_p.L672V	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	672					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	TCAACAGTCAACACGTCCAGC	0.557																																						ENST00000369146.3	0.130000	3.000000e-02	0.100000	0.040000	0.070000	0.085386	0.070000	0.070000																										0				55						c.(2014-2016)Ttg>Gtg		synaptic vesicle glycoprotein 2A	Levetiracetam(DB01202)						204.0	186.0	192.0					1																	149877463		2203	4300	6503	SO:0001583	missense	9900	0	0					g.chr1:149877463A>C	AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.2014T>G	chr1.hg19:g.149877463A>C	ENSP00000358142:p.Leu672Val	0					SV2A_ENST00000369145.1_Missense_Mutation_p.L672V	p.L672V	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	1	2	3	2.040103	Q7L0J3	SV2A_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)	12	2504	-	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Missense_Mutation	SNP	ENST00000369146.3	0	1	hg19	c.2014T>G	CCDS940.1	0	.	.	.	.	.	.	.	.	.	.	A	2.739	-0.262762	0.05754	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	T;T	0.06371	3.31;3.31	3.89	-0.377	0.12501	3.89	-0.377	0.12501	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.982908	0.08311	N	0.965306	T	0.00695	0.0023	N	0.02865	-0.47	0.48632	D	0.999689	B;B	0.16802	0.019;0.005	B;B	0.21360	0.034;0.023	T	0.48768	-0.9006	10	0.02654	T	1	-9.4314	8.0509	0.30577	0.3216:0.0:0.6784:0.0	.	124;672	B4E000;Q7L0J3	.;SV2A_HUMAN	V	672	ENSP00000358142:L672V;ENSP00000358141:L672V	ENSP00000358141:L672V	L	-	1	2	2	SV2A	148144087	148144087	0.954000	0.32549	0.999000	0.59377	0.960000	0.62799	0.088000	0.14979	0.030000	0.15379	0.247000	0.18012	TTG	0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.557	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1	0	0	1		2	2	2	0		0	0	128		128	125	1	1.940000	-8.023559	1	0.380000				12	11		884	863	0		1	0		0	0	128	0		0.998968	5.892605e-03	0	0	0	8	0	12	884
CRNN	49860	broad.mit.edu	37	1	152382863	152382863	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr1:152382863G>A	ENST00000271835.3	-	3	757	c.695C>T	c.(694-696)aCt>aTt	p.T232I	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	232	Gln-rich.				response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGGGTCTGAGTTCCAGATCC	0.572																																						ENST00000271835.3	1.000000	8.500000e-01	1.000000	0.910000	0.970000	0.963924	0.970000	1.000000																										0				35						c.(694-696)aCt>aTt		cornulin							270.0	271.0	271.0					1																	152382863		2203	4300	6503	SO:0001583	missense	49860	0	0					g.chr1:152382863G>A	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.695C>T	chr1.hg19:g.152382863G>A	ENSP00000271835:p.Thr232Ile	0					RP1-91G5.3_ENST00000411804.1_RNA	p.T232I	NM_016190.2	NP_057274.1	1	2	3	2.040103	Q9UBG3	CRNN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	3	757	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		B2RE60|Q8N613	Missense_Mutation	SNP	ENST00000271835.3	1	1	hg19	c.695C>T	CCDS1010.1	1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.900907	0.33535	.	.	ENSG00000143536	ENST00000271835	T	0.05025	3.51	4.93	1.99	0.26369	4.93	1.99	0.26369	.	0.507715	0.18383	N	0.142896	T	0.01254	0.0041	L	0.43923	1.385	0.09310	N	0.999999	P	0.43431	0.807	B	0.35470	0.203	T	0.46176	-0.9210	10	0.16896	T	0.51	.	4.0875	0.09953	0.1931:0.0:0.6221:0.1848	.	232	Q9UBG3	CRNN_HUMAN	I	232	ENSP00000271835:T232I	ENSP00000271835:T232I	T	-	2	0	0	CRNN	150649487	150649487	0.996000	0.38824	0.242000	0.24170	0.021000	0.10359	2.827000	0.48112	0.255000	0.21593	-0.237000	0.12165	ACT	0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.572	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1	1	0	1		2	2	2	0		0	0	194		194	191	1	1.940000	-20.000000	1	0.380000	NM_016190			186	185		817	805	1		1			0	0	194	0		1.000000	0	0	0	0	0	0	186	817
S100A8	6279	broad.mit.edu	37	1	153362970	153362970	+	Silent	SNP	G	G	A	rs373891072		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr1:153362970G>A	ENST00000368733.3	-	2	211	c.42C>T	c.(40-42)gaC>gaT	p.D14D	S100A8_ENST00000368732.1_Silent_p.D14D|S100A8_ENST00000477801.1_5'UTR	NM_002964.4	NP_002955.2	P05109	S10A8_HUMAN	S100 calcium binding protein A8	14	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|acute inflammatory response (GO:0002526)|autophagy (GO:0006914)|chemokine production (GO:0032602)|chronic inflammatory response (GO:0002544)|cytokine production (GO:0001816)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|neutrophil aggregation (GO:0070488)|neutrophil chemotaxis (GO:0030593)|positive regulation of cell growth (GO:0030307)|positive regulation of inflammatory response (GO:0050729)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of cytoskeleton organization (GO:0051493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to zinc ion (GO:0010043)|sequestering of zinc ion (GO:0032119)|wound healing (GO:0042060)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonic acid binding (GO:0050544)|calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|RAGE receptor binding (GO:0050786)|Toll-like receptor 4 binding (GO:0035662)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|lung(1)|urinary_tract(1)	4	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGTGGTAGACGTCGATGATAG	0.507													N|||	1	0.000199681	0.0	0.0	5008	,	,		19401	0.0		0.0	False		,,,				2504	0.001					ENST00000368733.3	0.120000	2.000000e-02	0.090000	0.040000	0.060000	0.078264	0.060000	0.060000																										0				4						c.(40-42)gaC>gaT		S100 calcium binding protein A8		A		0,4406		0,0,2203	184.0	185.0	185.0		42	-8.3	0.0	1		185	1,8599		0,1,4299	no	coding-synonymous	S100A8	NM_002964.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		14/94	153362970	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6279	14	121412	45				g.chr1:153362970G>A	BC005928	CCDS1038.1	1q12-q22	2013-01-10	2006-09-11		ENSG00000143546	ENSG00000143546		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10498	protein-coding gene	gene with protein product		123885	"""S100 calcium-binding protein A8 (calgranulin A)"", ""S100 calcium binding protein A8 (calgranulin A)"""	CAGA, CFAG			Standard	NM_002964		Approved	P8, MRP8, 60B8AG, CGLA	uc001fbs.3	P05109	OTTHUMG00000013124	ENST00000368733.3:c.42C>T	chr1.hg19:g.153362970G>A		0					S100A8_ENST00000368732.1_Silent_p.D14D|S100A8_ENST00000477801.1_5'UTR	p.D14D	NM_002964.4	NP_002955.2	1	2	3	2.040103	P05109	S10A8_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)	2	211	-	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		A8K5L3|D3DV37|Q5SY70|Q9UC84|Q9UC92|Q9UCJ0|Q9UCM6	Silent	SNP	ENST00000368733.3	0	1	hg19	c.42C>T	CCDS1038.1	0																																																																																								0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.507	S100A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036791.1	0	0	1		2	2	2	0		0	0	169		169	166	1	1.940000	-2.744861	1	0.380000	NM_002964			11	10		902	884	0		1	0		0	0	169	0		0.998115	6.464373e-02	0	0	0	31	0	11	902
OLFML2B	25903	broad.mit.edu	37	1	161953983	161953983	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr1:161953983G>A	ENST00000294794.3	-	8	2158	c.1735C>T	c.(1735-1737)Cgc>Tgc	p.R579C	OLFML2B_ENST00000367938.1_Missense_Mutation_p.R62C|OLFML2B_ENST00000367940.2_Missense_Mutation_p.R580C	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	579	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			GTGAAGGCGCGATTGTAGTAG	0.597																																						ENST00000294794.3	1.000000	7.400000e-01	1.000000	0.840000	0.950000	0.933171	0.950000	1.000000																										0				48						c.(1735-1737)Cgc>Tgc		olfactomedin-like 2B							98.0	80.0	86.0					1																	161953983		2203	4300	6503	SO:0001583	missense	25903	0	0					g.chr1:161953983G>A	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.1735C>T	chr1.hg19:g.161953983G>A	ENSP00000294794:p.Arg579Cys	0					OLFML2B_ENST00000367938.1_Missense_Mutation_p.R62C|OLFML2B_ENST00000367940.2_Missense_Mutation_p.R580C	p.R579C	NM_015441.1	NP_056256.1	1	2	3	2.040103	Q68BL8	OLM2B_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.0172)	8	2158	-	all_hematologic(112;0.156)		B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	ENST00000294794.3	1	1	hg19	c.1735C>T	CCDS1236.1	1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.968748	0.74131	.	.	ENSG00000162745	ENST00000294794;ENST00000367940;ENST00000367938	D;D;D	0.90004	-2.6;-2.6;-2.6	5.06	5.06	0.68205	5.06	5.06	0.68205	Olfactomedin-like (3);	.	.	.	.	D	0.92453	0.7604	M	0.77313	2.365	0.46849	D	0.999222	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.977	D	0.93668	0.6987	8	0.87932	D	0	.	11.0657	0.47974	0.0:0.0:0.8145:0.1855	.	580;579	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	C	579;580;62	ENSP00000294794:R579C;ENSP00000356917:R580C;ENSP00000356915:R62C	ENSP00000294794:R579C	R	-	1	0	0	OLFML2B	160220607	160220607	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.692000	0.84203	2.328000	0.79073	0.561000	0.74099	CGC	0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.597	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	1	0	1		2	2	2	0		0	0	57		57	56	1	1.940000	-3.417237	1	0.380000	NM_015441			60	60		272	265	1		1	0		0	0	57	0		1.000000	9.999855e-01	0	0	0	77	0	60	272
RNF207	388591	broad.mit.edu	37	1	6279452	6279452	+	Silent	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr1:6279452G>A	ENST00000377939.4	+	18	2017	c.1890G>A	c.(1888-1890)agG>agA	p.R630R	RNF207_ENST00000377948.2_3'UTR|ICMT_ENST00000495791.1_5'Flank	NM_207396.2	NP_997279.2	Q6ZRF8	RN207_HUMAN	ring finger protein 207	630						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(2)	16	Ovarian(185;0.0634)	all_cancers(23;1.22e-38)|all_epithelial(116;4.25e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.84e-38)|GBM - Glioblastoma multiforme(13;5.77e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.88e-19)|Colorectal(212;6.9e-08)|COAD - Colon adenocarcinoma(227;8.13e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		CCACATGGAGGGAACACCCGA	0.532																																						ENST00000377939.4	1.000000	8.400000e-01	1.000000	0.990000	0.990000	0.987780	0.990000	1.000000																										0				16						c.(1888-1890)agG>agA		ring finger protein 207							39.0	41.0	40.0					1																	6279452		1900	4114	6014	SO:0001819	synonymous_variant	388591	0	0					g.chr1:6279452G>A	AK128246	CCDS59.2	1p36.31	2008-11-19			ENSG00000158286	ENSG00000158286		"""RING-type (C3HC4) zinc fingers"""	32947	protein-coding gene	gene with protein product	"""OTTHUMG00000001089"""		"""chromosome 1 open reading frame 188"""	C1orf188			Standard	NM_207396		Approved	FLJ46380, FLJ32096	uc001amg.3	Q6ZRF8	OTTHUMG00000001089	ENST00000377939.4:c.1890G>A	chr1.hg19:g.6279452G>A		0					RNF207_ENST00000377948.2_3'UTR|ICMT_ENST00000495791.1_5'Flank	p.R630R	NM_207396.2	NP_997279.2	1	2	3	2.041574	Q6ZRF8	RN207_HUMAN		18	2017	+	Ovarian(185;0.0634)	all_cancers(23;1.22e-38)|all_epithelial(116;4.25e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)	A2VCM8|B4DFR6|Q5TGS6|Q6ZS63|Q96MP2	Silent	SNP	ENST00000377939.4	1	1	hg19	c.1890G>A	CCDS59.2	1																																																																																								0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.532	RNF207-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003669.2	1	0	1		2	2	2	0		0	0	26		26	25	1	1.940000	-20.000000	1	0.380000	NM_207396			29	29		99	98	1		1	1		0	0	26	0		1.000000	9.609944e-01	0	11	0	10	0	29	99
OPRD1	4985	broad.mit.edu	37	1	29189523	29189523	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr1:29189523G>A	ENST00000234961.2	+	3	1089	c.847G>A	c.(847-849)Gtc>Atc	p.V283I		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	283					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CTTCGTCATCGTCTGGACGCT	0.662																																						ENST00000234961.2	0.530000	8.000000e-02	0.390000	0.150000	0.250000	0.278751	0.250000	0.230000																										0				15						c.(847-849)Gtc>Atc		opioid receptor, delta 1	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)						30.0	25.0	27.0					1																	29189523		2201	4298	6499	SO:0001583	missense	4985	0	0					g.chr1:29189523G>A	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.847G>A	chr1.hg19:g.29189523G>A	ENSP00000234961:p.Val283Ile	1						p.V283I	NM_000911.3	NP_000902.3	0	1	1	1.664513	P41143	OPRD_HUMAN		3	1089	+		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	0	1	hg19	c.847G>A	CCDS329.1	0	.	.	.	.	.	.	.	.	.	.	G	16.11	3.029141	0.54790	.	.	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.37235	1.21	4.06	4.06	0.47325	4.06	4.06	0.47325	GPCR, rhodopsin-like superfamily (1);	0.149246	0.44688	D	0.000439	T	0.28499	0.0705	N	0.25992	0.78	0.80722	D	1	B	0.24768	0.111	B	0.32805	0.153	T	0.07673	-1.0760	10	0.23891	T	0.37	.	13.7884	0.63123	0.0:0.0:1.0:0.0	.	283	P41143	OPRD_HUMAN	I	283;235	ENSP00000234961:V283I	ENSP00000234961:V283I	V	+	1	0	0	OPRD1	29062110	29062110	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.554000	0.73923	2.097000	0.63578	0.462000	0.41574	GTC	0.234568		TCGA-2J-AAB1-01A-11D-A40W-08	0.662	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	0	0	1		2	2	2	0		0	0	13		13	13	1	1.940000	-8.354660	1	0.380000	NM_000911			4	4		67	66	0		1			0	0	13	0		0.888999	0	0	0	0	0	0	4	67
CSMD2	114784	broad.mit.edu	37	1	34286109	34286109	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr1:34286109C>T	ENST00000373381.4	-	8	1336	c.1160G>A	c.(1159-1161)gGc>gAc	p.G387D		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	347	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TTCGGGTATGCCAGGGTCTGG	0.448																																						ENST00000373381.4	1.000000	0	0.070000	0.020000	0.040000	0.077185	0.040000	0.040000																										0				246						c.(1159-1161)gGc>gAc		CUB and Sushi multiple domains 2							174.0	172.0	172.0					1																	34286109		2203	4300	6503	SO:0001583	missense	114784	0	0					g.chr1:34286109C>T	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.1160G>A	chr1.hg19:g.34286109C>T	ENSP00000362479:p.Gly387Asp	0						p.G387D	NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	1	2	3	2.045202	Q7Z408	CSMD2_HUMAN		8	1336	-		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	0	1	hg19	c.1160G>A		0	.	.	.	.	.	.	.	.	.	.	C	31	5.068273	0.93950	.	.	ENSG00000121904	ENST00000373381	T	0.63417	-0.04	5.81	5.81	0.92471	5.81	5.81	0.92471	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.78194	0.4245	M	0.76938	2.355	0.80722	D	1	D;B	0.57257	0.979;0.07	P;B	0.60473	0.875;0.102	T	0.76310	-0.3006	10	0.38643	T	0.18	.	19.0707	0.93134	0.0:1.0:0.0:0.0	.	347;387	Q7Z408;E7EUA6	CSMD2_HUMAN;.	D	387	ENSP00000362479:G387D	ENSP00000241312:G347D	G	-	2	0	0	CSMD2	34058696	34058696	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.069000	0.71209	2.746000	0.94184	0.655000	0.94253	GGC	0.384676		TCGA-2J-AAB1-01A-11D-A40W-08	0.448	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		0	0	1		2	2	2	0		0	0	148		148	144	1	1.940000	-1.872151	0	0.380000	NM_052896			7	7		842	815	0		1			0	0	148	0		0.978267	0	0	0	0	0	0	7	842
LHX8	431707	broad.mit.edu	37	1	75622617	75622617	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr1:75622617G>A	ENST00000294638.5	+	9	1514	c.850G>A	c.(850-852)Gtc>Atc	p.V284I	LHX8_ENST00000356261.3_Missense_Mutation_p.V274I	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	284					female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						CAAGAAACACGTCAGTCCTAA	0.502																																						ENST00000294638.5	1.000000	1.000000e-01	0.210000	0.130000	0.160000	0.196597	0.160000	0.160000																										0				30						c.(850-852)Gtc>Atc		LIM homeobox 8							295.0	264.0	274.0					1																	75622617		2203	4300	6503	SO:0001583	missense	431707	2	121412	36				g.chr1:75622617G>A	AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.850G>A	chr1.hg19:g.75622617G>A	ENSP00000294638:p.Val284Ile	0					LHX8_ENST00000356261.3_Missense_Mutation_p.V274I	p.V284I	NM_001001933.1	NP_001001933.1	1	2	3	2.045202	Q68G74	LHX8_HUMAN		9	1514	+			E9PGE3	Missense_Mutation	SNP	ENST00000294638.5	1	1	hg19	c.850G>A	CCDS30756.1	0	.	.	.	.	.	.	.	.	.	.	G	15.50	2.852331	0.51270	.	.	ENSG00000162624	ENST00000294638;ENST00000356261	D;D	0.86097	-2.07;-2.06	5.12	5.12	0.69794	5.12	5.12	0.69794	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.70185	0.3195	L	0.29908	0.895	0.80722	D	1	B	0.22480	0.07	B	0.16722	0.016	T	0.66400	-0.5933	10	0.27785	T	0.31	.	18.9441	0.92615	0.0:0.0:1.0:0.0	.	284	Q68G74	LHX8_HUMAN	I	284;274	ENSP00000294638:V284I;ENSP00000348597:V274I	ENSP00000294638:V284I	V	+	1	0	0	LHX8	75395205	75395205	1.000000	0.71417	0.990000	0.47175	0.940000	0.58332	7.404000	0.79996	2.556000	0.86216	0.455000	0.32223	GTC	0.384676		TCGA-2J-AAB1-01A-11D-A40W-08	0.502	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026700.1	0	0	1		2	2	2	0		0	0	123		123	120	1	1.940000	-3.184890	1	0.380000	NM_001001933			23	23		710	702	0		1			0	0	123	0		0.999999	0	0	0	0	0	0	23	710
ABCA4	24	broad.mit.edu	37	1	94497517	94497517	+	Silent	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr1:94497517C>T	ENST00000370225.3	-	27	4031	c.3945G>A	c.(3943-3945)caG>caA	p.Q1315Q		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1315					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CATTGGAGTCCTGGGGTGTCT	0.632																																						ENST00000370225.3	1.000000	1.500000e-01	0.320000	0.190000	0.250000	0.279655	0.250000	0.250000																										0				147						c.(3943-3945)caG>caA		ATP-binding cassette, sub-family A (ABC1), member 4							45.0	53.0	50.0					1																	94497517		2203	4300	6503	SO:0001819	synonymous_variant	24	0	0					g.chr1:94497517C>T	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.3945G>A	chr1.hg19:g.94497517C>T		0						p.Q1315Q	NM_000350.2	NP_000341.2	1	2	3	2.045202	P78363	ABCA4_HUMAN		27	4031	-		all_lung(203;0.000757)|Lung NSC(277;0.00335)	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	1	1	hg19	c.3945G>A	CCDS747.1	0																																																																																								0.384676		TCGA-2J-AAB1-01A-11D-A40W-08	0.632	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	1	0	1		2	2	2	0		0	0	62		62	59	1	1.940000	-3.308679	1	0.380000	NM_000350			19	19		388	378	0		1	0		0	0	62	0		0.999989	0	0	0	0	1	0	19	388
DPYD	1806	broad.mit.edu	37	1	98205957	98205957	+	Missense_Mutation	SNP	A	A	C			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr1:98205957A>C	ENST00000370192.3	-	4	412	c.312T>G	c.(310-312)atT>atG	p.I104M	DPYD_ENST00000423006.2_Missense_Mutation_p.I67M|DPYD_ENST00000306031.5_Missense_Mutation_p.I104M	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	104					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	CCTTGTTTGCAATACTTGTGA	0.343																																						ENST00000370192.3	1.000000	7.600000e-01	1.000000	0.850000	0.950000	0.940137	0.950000	1.000000																										0				83						c.(310-312)atT>atG		dihydropyrimidine dehydrogenase	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)						155.0	156.0	156.0					1																	98205957		2203	4299	6502	SO:0001583	missense	1806	2	121408	32				g.chr1:98205957A>C	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.312T>G	chr1.hg19:g.98205957A>C	ENSP00000359211:p.Ile104Met	0					DPYD_ENST00000306031.5_Missense_Mutation_p.I104M|DPYD_ENST00000423006.2_Missense_Mutation_p.I67M	p.I104M	NM_000110.3	NP_000101	1	2	3	2.045202	Q12882	DPYD_HUMAN		4	412	-		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	1	1	hg19	c.312T>G	CCDS30777.1	1	.	.	.	.	.	.	.	.	.	.	A	18.70	3.679197	0.68042	.	.	ENSG00000188641	ENST00000370192;ENST00000423006;ENST00000306031	T;T;T	0.76186	-1.0;-1.0;-1.0	5.69	-5.09	0.02920	5.69	-5.09	0.02920	Fumarate reductase, C-terminal (1);Alpha-helical ferredoxin (1);	0.000000	0.85682	D	0.000000	D	0.83464	0.5260	H	0.96604	3.85	0.54753	D	0.999984	D;D	0.89917	1.0;1.0	D;D	0.91635	0.993;0.999	T	0.82926	-0.0215	10	0.87932	D	0	-18.9959	7.7046	0.28642	0.5443:0.0:0.3574:0.0983	.	104;104	E9PFN1;Q12882	.;DPYD_HUMAN	M	104;67;104	ENSP00000359211:I104M;ENSP00000398884:I67M;ENSP00000307107:I104M	ENSP00000307107:I104M	I	-	3	3	3	DPYD	97978545	97978545	0.973000	0.33851	0.958000	0.39756	0.987000	0.75469	0.190000	0.17057	-0.884000	0.03976	-0.361000	0.07541	ATT	0.384676		TCGA-2J-AAB1-01A-11D-A40W-08	0.343	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	1	0	1		2	2	2	0		0	0	89		89	88	1	1.940000	-20.000000	1	0.380000	NM_000110			72	70		326	325	1		1	1		0	0	89	0		1.000000	9.786672e-01	0	2	0	28	0	72	326
ELF3	1999	broad.mit.edu	37	1	201981145	201981145	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr1:201981145G>A	ENST00000359651.3	+	2	3416	c.224G>A	c.(223-225)tGg>tAg	p.W75*	RP11-510N19.5_ENST00000504773.1_RNA|RP11-465N4.4_ENST00000419190.1_RNA|ELF3_ENST00000495848.1_3'UTR|ELF3_ENST00000367283.3_Nonsense_Mutation_p.W75*|ELF3_ENST00000367284.5_Nonsense_Mutation_p.W75*					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						GTTCTGGACTGGATCAGCTAC	0.577																																						ENST00000359651.3	1.000000	7.300000e-01	0.960000	0.800000	0.870000	0.881466	0.870000	1.000000																										0				20						c.(223-225)tGg>tAg		E74-like factor 3 (ets domain transcription factor, epithelial-specific )							128.0	127.0	127.0					1																	201981145		2203	4300	6503	SO:0001587	stop_gained	1999	0	0					g.chr1:201981145G>A	AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.224G>A	chr1.hg19:g.201981145G>A	ENSP00000352673:p.Trp75*	0					RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000367284.5_Nonsense_Mutation_p.W75*|ELF3_ENST00000495848.1_3'UTR|RP11-465N4.4_ENST00000419190.1_RNA|ELF3_ENST00000367283.3_Nonsense_Mutation_p.W75*	p.W75*			1	2	3	2.040103				2	3416	+				Nonsense_Mutation	SNP	ENST00000359651.3	0	1	hg19	c.224G>A	CCDS1419.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.948324	0.97956	.	.	ENSG00000163435	ENST00000359651;ENST00000367284;ENST00000367283;ENST00000310044;ENST00000446188	.	.	.	5.56	5.56	0.83823	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.5332	0.95237	0.0:0.0:1.0:0.0	.	.	.	.	X	75;75;75;75;73	.	ENSP00000311348:W75X	W	+	2	0	0	ELF3	200247768	200247768	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.149000	0.94659	2.608000	0.88229	0.591000	0.81541	TGG	0.382347		TCGA-2J-AAB1-01A-11D-A40W-08	0.577	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	1	0	1		2	2	2	0		0	0	131		131	128	1	1.940000	-3.323569	1	0.380000	NM_004433			123	117		616	599	1		1	1		0	0	131	0		1.000000	1	0	465	0	1498	0	123	616
DHX35	60625	broad.mit.edu	37	20	37653909	37653909	+	Missense_Mutation	SNP	C	C	G			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr20:37653909C>G	ENST00000252011.3	+	18	1741	c.1708C>G	c.(1708-1710)Ctg>Gtg	p.L570V	DHX35_ENST00000373323.4_Missense_Mutation_p.L539V|DHX35_ENST00000373325.2_Missense_Mutation_p.L570V	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	570					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				GGAACATTTCCTGAATTACAA	0.418																																						ENST00000252011.3	1.000000	8.600000e-01	1.000000	0.920000	0.990000	0.973634	0.990000	1.000000																										0				40						c.(1708-1710)Ctg>Gtg		DEAH (Asp-Glu-Ala-His) box polypeptide 35							207.0	208.0	208.0					20																	37653909		2203	4300	6503	SO:0001583	missense	60625	0	0					g.chr20:37653909C>G	AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.1708C>G	chr20.hg19:g.37653909C>G	ENSP00000252011:p.Leu570Val	0					DHX35_ENST00000373325.2_Missense_Mutation_p.L570V|DHX35_ENST00000373323.4_Missense_Mutation_p.L539V	p.L570V	NM_021931.3	NP_068750.2	0	0	0	2.013459	Q9H5Z1	DHX35_HUMAN		18	1741	+		Myeloproliferative disorder(115;0.00878)	A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Missense_Mutation	SNP	ENST00000252011.3	1	1	hg19	c.1708C>G	CCDS13310.1	1	.	.	.	.	.	.	.	.	.	.	C	15.64	2.894638	0.52121	.	.	ENSG00000101452	ENST00000373325;ENST00000252011;ENST00000373323;ENST00000373321;ENST00000449559	T;T;T;T	0.41758	3.7;3.65;3.59;0.99	5.41	4.46	0.54185	5.41	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.43545	0.1252	L	0.45228	1.405	0.80722	D	1	P;B	0.40534	0.72;0.429	P;B	0.49752	0.621;0.088	T	0.19778	-1.0295	10	0.25751	T	0.34	.	9.8859	0.41262	0.0:0.834:0.0:0.166	.	539;570	F5GXM6;Q9H5Z1	.;DHX35_HUMAN	V	570;570;539;50;34	ENSP00000362422:L570V;ENSP00000252011:L570V;ENSP00000362420:L539V;ENSP00000397997:L34V	ENSP00000252011:L570V	L	+	1	2	2	DHX35	37087323	37087323	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.399000	0.44495	1.269000	0.44280	0.655000	0.94253	CTG	0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.418	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079212.2	1	0	1		2	2	2	0		0	0	157		157	155	1	1.940000	-2.997715	1	0.380000	NM_021931			184	181		782	773	1		1	1		0	0	157	0		1.000000	9.285829e-01	0	6	0	15	0	184	782
CHD6	84181	broad.mit.edu	37	20	40085993	40085993	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr20:40085993C>T	ENST00000373233.3	-	18	2917	c.2740G>A	c.(2740-2742)Gag>Aag	p.E914K	CHD6_ENST00000309279.7_Intron	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	914	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				ATCTCGCGCTCGTAGGAATTT	0.542																																						ENST00000373233.3	1.000000	8.200000e-01	1.000000	0.920000	0.990000	0.974932	0.990000	1.000000																										0				129						c.(2740-2742)Gag>Aag		chromodomain helicase DNA binding protein 6							138.0	107.0	117.0					20																	40085993		2203	4300	6503	SO:0001583	missense	84181	0	0					g.chr20:40085993C>T	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.2740G>A	chr20.hg19:g.40085993C>T	ENSP00000362330:p.Glu914Lys	0					CHD6_ENST00000309279.7_Intron	p.E914K	NM_032221.3	NP_115597.3	0	0	0	2.013459	Q8TD26	CHD6_HUMAN		18	2917	-		Myeloproliferative disorder(115;0.00425)	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	1	1	hg19	c.2740G>A	CCDS13317.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.210518	0.95069	.	.	ENSG00000124177	ENST00000373233	D	0.85088	-1.94	5.42	5.42	0.78866	5.42	5.42	0.78866	Helicase, C-terminal (1);	0.000000	0.56097	D	0.000021	D	0.95449	0.8522	H	0.97077	3.935	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96602	0.9445	10	0.87932	D	0	-28.0288	19.5951	0.95533	0.0:1.0:0.0:0.0	.	914	Q8TD26	CHD6_HUMAN	K	914	ENSP00000362330:E914K	ENSP00000362330:E914K	E	-	1	0	0	CHD6	39519407	39519407	1.000000	0.71417	0.998000	0.56505	0.479000	0.33129	7.729000	0.84864	2.705000	0.92388	0.591000	0.81541	GAG	0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.542	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1	1	0	1		2	2	2	0		0	0	44		44	43	1	1.940000	-20.000000	1	0.380000				58	55		231	231	1		1	0		0	0	44	0		1.000000	5.026555e-01	0	0	0	8	0	58	231
GNAS	2778	broad.mit.edu	37	20	57484421	57484421	+	Missense_Mutation	SNP	G	G	A	rs121913495		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr20:57484421G>A	ENST00000371085.3	+	8	1026	c.602G>A	c.(601-603)cGt>cAt	p.R201H	GNAS_ENST00000371100.4_Missense_Mutation_p.R844H|GNAS_ENST00000354359.7_Missense_Mutation_p.R202H|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.R186H|GNAS_ENST00000371102.4_Missense_Mutation_p.R830H|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000371095.3_Missense_Mutation_p.R187H|GNAS_ENST00000306090.10_Missense_Mutation_p.R187H	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	201			R -> C (in MAS and somatotrophinoma; dbSNP:rs11554273). {ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> G (in MAS). {ECO:0000269|PubMed:10571700}.|R -> H (in MAS, somatotrophinoma and AIMAH1). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:1594625, ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> L (in non-MAS endocrine tumors). {ECO:0000269|PubMed:7751320}.|R -> S (in AIMAH1, pituitary tumor and polyostotic fibrous dysplasia). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:8766942, ECO:0000269|PubMed:9267696}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R201H(81)|p.R844H(4)|p.R201L(2)|p.R844L(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CTTCGCTGCCGTGTCCTGACT	0.423			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	ENST00000371085.3	0.180000	2.000000e-02	0.130000	0.050000	0.080000	0.097200	0.080000	0.080000				Dom	yes			Dom	yes		20	20q13.2	20q13.2	2778	Mis	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	yes	McCune-Albright syndrome; pseudohypoparathyroidism, type IA	E	E			pituitary adenoma		88	Substitution - Missense(88)	p.R201H(81)|p.R844H(4)|p.R201L(2)|p.R844L(1)	pancreas(28)|large_intestine(19)|thyroid(12)|pituitary(12)|liver(6)|biliary_tract(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|stomach(1)|small_intestine(1)|ovary(1)	441						c.(601-603)cGt>cAt		GNAS complex locus							80.0	78.0	79.0					20																	57484421		2203	4300	6503	SO:0001583	missense	2778	10	121412	32				g.chr20:57484421G>A	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.602G>A	chr20.hg19:g.57484421G>A	ENSP00000360126:p.Arg201His	0	TSP Lung(22;0.16)				GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.R186H|GNAS_ENST00000371102.4_Missense_Mutation_p.R830H|GNAS_ENST00000354359.7_Missense_Mutation_p.R202H|GNAS_ENST00000371095.3_Missense_Mutation_p.R187H|GNAS_ENST00000306090.10_Missense_Mutation_p.R187H|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371100.4_Missense_Mutation_p.R844H	p.R201H	NM_000516.4	NP_000507.1	0	0	0	2.013459	P63092	GNAS2_HUMAN	BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)	8	1026	+	all_lung(29;0.0104)		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371085.3	0	1	hg19	c.602G>A	CCDS13472.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.430570	0.96150	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	D;D;D;D;D;D;D	0.99458	-5.93;-5.93;-5.93;-5.93;-5.93;-2.96;-5.93	5.53	5.53	0.82687	5.53	5.53	0.82687	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.99799	0.9914	H	0.98965	4.385	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.994;0.983;1.0	D	0.96812	0.9597	10	0.87932	D	0	.	19.4606	0.94915	0.0:0.0:1.0:0.0	.	201;202;186;844	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	H	844;830;187;201;202;186;187	ENSP00000360141:R844H;ENSP00000360143:R830H;ENSP00000360136:R187H;ENSP00000360126:R201H;ENSP00000346328:R202H;ENSP00000265620:R186H;ENSP00000304472:R187H	ENSP00000265620:R186H	R	+	2	0	0	GNAS	56917816	56917816	1.000000	0.71417	0.963000	0.40424	0.936000	0.57629	9.291000	0.96070	2.596000	0.87737	0.563000	0.77884	CGT	0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.423	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2	0	0	1		2	2	6	0		0	0	50		50	48	1	1.940000	-2.938661	1	0.380000	NM_000516			5	5		315	307	0		1	1	1	0	1	50	545		0.933250	9.999926e-01	8.695476e-01	24	6	2779	622	5	315
DIDO1	11083	broad.mit.edu	37	20	61525110	61525110	+	Silent	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr20:61525110C>T	ENST00000266070.4	-	12	3334	c.3009G>A	c.(3007-3009)ttG>ttA	p.L1003L	DIDO1_ENST00000395343.1_Silent_p.L1003L|DIDO1_ENST00000395340.1_Silent_p.L1003L|DIDO1_ENST00000395335.2_Silent_p.L1003L	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1003					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					TCACAGAAGTCAAGACAGGCT	0.567																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	ENST00000266070.4	0.130000	2.000000e-02	0.100000	0.040000	0.060000	0.074668	0.060000	0.060000																										0				99						c.(3007-3009)ttG>ttA		death inducer-obliterator 1							127.0	105.0	112.0					20																	61525110		2203	4300	6503	SO:0001819	synonymous_variant	11083	1	121412	29				g.chr20:61525110C>T	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.3009G>A	chr20.hg19:g.61525110C>T		0					DIDO1_ENST00000395340.1_Silent_p.L1003L|DIDO1_ENST00000395335.2_Silent_p.L1003L|DIDO1_ENST00000395343.1_Silent_p.L1003L	p.L1003L	NM_033081.2	NP_149072.2	0	0	0	2.013459	Q9BTC0	DIDO1_HUMAN		12	3334	-	Breast(26;5.68e-08)		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Silent	SNP	ENST00000266070.4	0	1	hg19	c.3009G>A	CCDS33506.1	0																																																																																								0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.567	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	0	0	1		18	3	2	1		1	1	92		92	92	1	1.940000	-2.880596	1	0.380000	NM_080796			6	6		482	476	0		0	0		1	0	92	0		0.009572	8.715306e-03	0	0	0	27	0	6	482
CHAF1B	8208	broad.mit.edu	37	21	37783861	37783861	+	Silent	SNP	C	C	T	rs370336150		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr21:37783861C>T	ENST00000314103.5	+	11	1171	c.1020C>T	c.(1018-1020)taC>taT	p.Y340Y		NM_005441.2	NP_005432.1	Q13112	CAF1B_HUMAN	chromatin assembly factor 1, subunit B (p60)	340					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(2)	20						CTTTTGGTTACGTGTCTAATA	0.522																																						ENST00000314103.5	0.090000	0	0.070000	0.020000	0.040000	0.047333	0.040000	0.040000																										0				20						c.(1018-1020)taC>taT		chromatin assembly factor 1, subunit B (p60)		C		1,4405	2.1+/-5.4	0,1,2202	228.0	199.0	209.0		1020	-3.6	0.5	21		209	0,8600		0,0,4300	no	coding-synonymous	CHAF1B	NM_005441.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		340/560	37783861	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8208	1	121412	37				g.chr21:37783861C>T	U20980	CCDS13644.1	21q22.2	2013-01-10			ENSG00000159259	ENSG00000159259		"""WD repeat domain containing"""	1911	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 7"", ""Chromatin assembly factor I, p60 subunit"", ""human chromatin assembly factor-I p60 subunit"""	601245				7600578, 8792829	Standard	NM_005441		Approved	CAF1P60, CAF-1, CAF1, CAF1A, MPP7, MPHOSPH7	uc002yvj.3	Q13112	OTTHUMG00000086606	ENST00000314103.5:c.1020C>T	chr21.hg19:g.37783861C>T		0						p.Y340Y	NM_005441.2	NP_005432.1	0	0	0	2.008296	Q13112	CAF1B_HUMAN		11	1171	+			Q99548	Silent	SNP	ENST00000314103.5	0	1	hg19	c.1020C>T	CCDS13644.1	0																																																																																								0.375252		TCGA-2J-AAB1-01A-11D-A40W-08	0.522	CHAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194616.2	0	0	1		19	2	2	1		1	1	145		145	139	1	1.940000	-2.614970	1	0.380000	NM_005441			6	5		762	751	0		0	0		1	0	145	0		0.006037	5.719412e-03	0	0	0	12	0	6	762
BRWD1	54014	broad.mit.edu	37	21	40578077	40578077	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr21:40578077G>A	ENST00000333229.2	-	37	4648	c.4321C>T	c.(4321-4323)Cgg>Tgg	p.R1441W	BRWD1_ENST00000342449.3_Missense_Mutation_p.R1441W|BRWD1_ENST00000380800.3_Missense_Mutation_p.R1441W	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1441					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				CAATTTTGCCGTTGCTTGAAC	0.328																																					Melanoma(170;988 1986 4794 16843 39731)	ENST00000333229.2	1.000000	7.800000e-01	0.990000	0.840000	0.910000	0.915689	0.910000	1.000000																										0				58						c.(4321-4323)Cgg>Tgg		bromodomain and WD repeat domain containing 1							127.0	133.0	131.0					21																	40578077		2203	4300	6503	SO:0001583	missense	54014	4	121412	43				g.chr21:40578077G>A	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.4321C>T	chr21.hg19:g.40578077G>A	ENSP00000330753:p.Arg1441Trp	0					BRWD1_ENST00000342449.3_Missense_Mutation_p.R1441W|BRWD1_ENST00000380800.3_Missense_Mutation_p.R1441W	p.R1441W	NM_018963.4	NP_061836.2	0	0	0	2.008296	Q9NSI6	BRWD1_HUMAN		37	4648	-		Prostate(19;8.44e-08)|all_epithelial(19;0.223)	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	1	1	hg19	c.4321C>T	CCDS13662.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.62|14.62	2.589350|2.589350	0.46214|0.46214	.|.	.|.	ENSG00000185658|ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800;ENST00000380783|ENST00000424441	T;T;T|.	0.59638|.	0.25;0.28;0.34|.	4.87|4.87	-4.09|-4.09	0.03951|0.03951	4.87|4.87	-4.09|-4.09	0.03951|0.03951	.|.	0.173450|.	0.35970|.	N|.	0.002879|.	T|T	0.47432|0.47432	0.1445|0.1445	L|L	0.58101|0.58101	1.795|1.795	0.09310|0.09310	N|N	0.999995|0.999995	D;D;B|.	0.71674|.	0.997;0.998;0.009|.	P;P;B|.	0.56474|.	0.799;0.785;0.003|.	T|T	0.52366|0.52366	-0.8585|-0.8585	10|5	0.87932|.	D|.	0|.	-0.1605|-0.1605	11.4109|11.4109	0.49925|0.49925	0.0715:0.0:0.3738:0.5547|0.0715:0.0:0.3738:0.5547	.|.	1441;1441;1441|.	Q9NSI6-3;Q9NSI6-2;Q9NSI6|.	.;.;BRWD1_HUMAN|.	W|M	1441;1441;1441;397|378	ENSP00000330753:R1441W;ENSP00000344333:R1441W;ENSP00000370178:R1441W|.	ENSP00000330753:R1441W|.	R|T	-|-	1|2	2|0	2|0	BRWD1|BRWD1	39499947|39499947	39499947|39499947	0.044000|0.044000	0.20184|0.20184	0.347000|0.347000	0.25668|0.25668	0.557000|0.557000	0.35523|0.35523	0.106000|0.106000	0.15354|0.15354	-0.524000|-0.524000	0.06400|0.06400	-0.215000|-0.215000	0.12644|0.12644	CGG|ACG	0.375252		TCGA-2J-AAB1-01A-11D-A40W-08	0.328	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	1	0	1		21	2	2	0		0	1	125		125	124	1	1.940000	-20.000000	1	0.380000	NM_033656			141	138		661	644	1		1	0		0	0	125	0		1.000000	8.499323e-01	0	1	0	17	0	141	661
DSCAM	1826	broad.mit.edu	37	21	41559185	41559185	+	Splice_Site	SNP	C	C	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr21:41559185C>A	ENST00000400454.1	-	14	3129	c.2652G>T	c.(2650-2652)gaG>gaT	p.E884D		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	884					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GGTCTGGGGGCTCTGTGCCAT	0.483																																					Melanoma(134;970 1778 1785 21664 32388)	ENST00000400454.1	0.410000	7.000000e-02	0.310000	0.130000	0.200000	0.224334	0.200000	0.190000																										0				142						c.(2650-2652)gaG>gaT		Down syndrome cell adhesion molecule							94.0	94.0	94.0					21																	41559185		1945	4152	6097	SO:0001630	splice_region_variant	1826	0	0					g.chr21:41559185C>A	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.2651-1G>T	chr21.hg19:g.41559185C>A		0						p.E884D	NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	0	0	0	2.008296	O60469	DSCAM_HUMAN		14	3129	-		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)	O60468	Splice_Site	SNP	ENST00000400454.1	0	1	hg19	c.2652G>T	CCDS42929.1	0	.	.	.	.	.	.	.	.	.	.	C	13.91	2.378979	0.42207	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.39229	1.09;1.09	5.18	2.29	0.28610	5.18	2.29	0.28610	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.28863	0.0716	N	0.25332	0.735	0.40427	D	0.979904	B	0.17465	0.022	B	0.12156	0.007	T	0.12993	-1.0526	10	0.62326	D	0.03	.	10.457	0.44557	0.0:0.6553:0.0:0.3447	.	884	O60469	DSCAM_HUMAN	D	884;636	ENSP00000383303:E884D;ENSP00000385342:E636D	ENSP00000383303:E884D	E	-	3	2	2	DSCAM	40481055	40481055	0.293000	0.24371	1.000000	0.80357	0.973000	0.67179	-0.338000	0.07842	0.659000	0.30945	0.561000	0.74099	GAG	0.375252		TCGA-2J-AAB1-01A-11D-A40W-08	0.483	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	0	0	1		2	2	2	0		0	0	26		26	26	1	1.940000	-8.004621	1	0.380000	NM_001389	Missense_Mutation		5	4		131	128	0		1			0	0	26	0		0.933734	0	0	0	0	0	0	5	131
SEZ6L	23544	broad.mit.edu	37	22	26736580	26736580	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr22:26736580T>C	ENST00000248933.6	+	10	2289	c.2194T>C	c.(2194-2196)Ttt>Ctt	p.F732L	SEZ6L_ENST00000529632.2_Missense_Mutation_p.F732L|SEZ6L_ENST00000404234.3_Missense_Mutation_p.F732L|SEZ6L_ENST00000402979.1_Missense_Mutation_p.F505L|SEZ6L_ENST00000360929.3_Missense_Mutation_p.F732L|SEZ6L_ENST00000343706.4_Missense_Mutation_p.F732L|SEZ6L_ENST00000403121.1_Missense_Mutation_p.F505L			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	732	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						GGGCCAGGGATTTATCATGAA	0.458																																						ENST00000248933.6	1.000000	5.500000e-01	0.930000	0.660000	0.780000	0.792180	0.780000	1.000000																										0				80						c.(2194-2196)Ttt>Ctt		seizure related 6 homolog (mouse)-like							85.0	76.0	79.0					22																	26736580		2203	4300	6503	SO:0001583	missense	23544	0	0					g.chr22:26736580T>C	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.2194T>C	chr22.hg19:g.26736580T>C	ENSP00000248933:p.Phe732Leu	0					SEZ6L_ENST00000403121.1_Missense_Mutation_p.F505L|SEZ6L_ENST00000360929.3_Missense_Mutation_p.F732L|SEZ6L_ENST00000404234.3_Missense_Mutation_p.F732L|SEZ6L_ENST00000343706.4_Missense_Mutation_p.F732L|SEZ6L_ENST00000529632.2_Missense_Mutation_p.F732L|SEZ6L_ENST00000402979.1_Missense_Mutation_p.F505L	p.F732L			1	2	3	2.064369	Q9BYH1	SE6L1_HUMAN		10	2289	+			A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	1	1	hg19	c.2194T>C	CCDS13833.1	0	.	.	.	.	.	.	.	.	.	.	T	17.70	3.455009	0.63290	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	T;T;T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22	5.01	5.01	0.66863	5.01	5.01	0.66863	CUB (4);	0.000000	0.56097	D	0.000031	T	0.73916	0.3648	M	0.91663	3.23	0.80722	D	1	B;B;B;B;B;B;B	0.22480	0.007;0.07;0.007;0.056;0.05;0.07;0.07	B;B;B;B;B;B;B	0.23574	0.022;0.046;0.024;0.027;0.047;0.046;0.046	T	0.75761	-0.3204	10	0.56958	D	0.05	.	14.0549	0.64761	0.0:0.0:0.0:1.0	.	732;732;505;732;732;732;732	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;.;SE6L1_HUMAN	L	732;732;732;732;732;505;505	ENSP00000384772:F732L;ENSP00000437037:F732L;ENSP00000354185:F732L;ENSP00000248933:F732L;ENSP00000342661:F732L;ENSP00000384838:F505L;ENSP00000384733:F505L	ENSP00000248933:F732L	F	+	1	0	0	SEZ6L	25066580	25066580	1.000000	0.71417	0.959000	0.39883	0.971000	0.66376	7.350000	0.79385	2.104000	0.64026	0.260000	0.18958	TTT	0.386988		TCGA-2J-AAB1-01A-11D-A40W-08	0.458	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3	1	0	1		2	2	2	0		0	0	47		47	47	1	1.940000	-17.006960	1	0.380000				33	33		194	192	1		1	0		0	0	47	0		1.000000	0	0	0	0	1	0	33	194
RANGAP1	5905	broad.mit.edu	37	22	41650338	41650338	+	Missense_Mutation	SNP	G	G	A	rs139571477	byFrequency	TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr22:41650338G>A	ENST00000455915.2	-	10	2703	c.1234C>T	c.(1234-1236)Cgg>Tgg	p.R412W	RANGAP1_ENST00000407260.4_Missense_Mutation_p.R357W|RANGAP1_ENST00000356244.3_Missense_Mutation_p.R412W|RANGAP1_ENST00000405486.1_Missense_Mutation_p.R412W			P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	412					mitotic cell cycle (GO:0000278)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear pore (GO:0005643)|perinuclear region of cytoplasm (GO:0048471)	Ran GTPase activator activity (GO:0005098)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AGAATCTTCCGTGAGGGCGTG	0.552													G|||	6	0.00119808	0.0015	0.0029	5008	,	,		17459	0.0		0.001	False		,,,				2504	0.001					ENST00000455915.2	1.000000	8.300000e-01	1.000000	0.940000	0.990000	0.979999	0.990000	1.000000																										0				19						c.(1234-1236)Cgg>Tgg		Ran GTPase activating protein 1		G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	304.0	213.0	244.0		1234	2.2	0.4	22	dbSNP_134	244	12,8588	9.1+/-34.3	0,12,4288	yes	missense	RANGAP1	NM_002883.2	101	0,13,6490	AA,AG,GG		0.1395,0.0227,0.1	probably-damaging	412/588	41650338	13,12993	2203	4300	6503	SO:0001583	missense	5905	35	121412	55				g.chr22:41650338G>A	X82260	CCDS14012.1	22q13	2013-01-17			ENSG00000100401	ENSG00000100401			9854	protein-coding gene	gene with protein product		602362	"""segregation distorter homolog (Drosophila)"""	SD		7878053	Standard	NM_002883		Approved	Fug1, KIAA1835	uc003azu.3	P46060	OTTHUMG00000150940	ENST00000455915.2:c.1234C>T	chr22.hg19:g.41650338G>A	ENSP00000401470:p.Arg412Trp	0					RANGAP1_ENST00000405486.1_Missense_Mutation_p.R412W|RANGAP1_ENST00000356244.3_Missense_Mutation_p.R412W|RANGAP1_ENST00000407260.4_Missense_Mutation_p.R357W	p.R412W			1	2	3	2.064369	P46060	RAGP1_HUMAN		10	2703	-			Q96JJ2	Missense_Mutation	SNP	ENST00000455915.2	1	0	hg19	c.1234C>T	CCDS14012.1	1	.	.	.	.	.	.	.	.	.	.	G	12.98	2.101483	0.37048	2.27E-4	0.001395	ENSG00000100401	ENST00000405486;ENST00000356244;ENST00000405383;ENST00000455915;ENST00000407260	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	4.39	2.17	0.27698	4.39	2.17	0.27698	Ran-GTPase activating protein 1, C-terminal (1);	1.014230	0.07853	N	0.965026	T	0.45975	0.1369	L	0.36672	1.1	0.19775	N	0.999959	D;D	0.76494	0.999;0.995	P;P	0.54372	0.711;0.75	T	0.34054	-0.9844	10	0.72032	D	0.01	-21.7601	8.6119	0.33808	0.0:0.0:0.4106:0.5894	.	357;412	F8W7I9;P46060	.;RAGP1_HUMAN	W	412;412;412;412;357	ENSP00000385866:R412W;ENSP00000348577:R412W;ENSP00000401470:R412W;ENSP00000385354:R357W	ENSP00000348577:R412W	R	-	1	2	2	RANGAP1	39980284	39980284	0.792000	0.28813	0.401000	0.26359	0.093000	0.18481	0.893000	0.28336	0.297000	0.22615	-0.521000	0.04368	CGG	0.386988		TCGA-2J-AAB1-01A-11D-A40W-08	0.552	RANGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320606.1	0	0	1		2	2	2	0		0	0	79		79	77	1	1.940000	-2.933500	1	0.380000	NM_002883			63	63		253	249	1		1	1		0	0	79	0		1.000000	1	0	56	0	157	0	63	253
MOV10L1	54456	broad.mit.edu	37	22	50538027	50538027	+	Silent	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr22:50538027C>T	ENST00000262794.5	+	3	521	c.438C>T	c.(436-438)tgC>tgT	p.C146C	MOV10L1_ENST00000395858.3_Silent_p.C146C|MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000475190.1_3'UTR|MOV10L1_ENST00000545383.1_Silent_p.C146C|MOV10L1_ENST00000540615.1_Silent_p.C126C	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	146					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		AGAGTGTGTGCGAAGGTATGC	0.512																																						ENST00000262794.5	1.000000	6.800000e-01	1.000000	0.790000	0.910000	0.901233	0.910000	1.000000																										0				67						c.(436-438)tgC>tgT		Mov10 RISC complex RNA helicase like 1							113.0	94.0	101.0					22																	50538027		2203	4300	6503	SO:0001819	synonymous_variant	54456	4	121412	35				g.chr22:50538027C>T	AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.438C>T	chr22.hg19:g.50538027C>T		0					MOV10L1_ENST00000540615.1_Silent_p.C126C|MOV10L1_ENST00000395858.3_Silent_p.C146C|MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000545383.1_Silent_p.C146C|MOV10L1_ENST00000475190.1_3'UTR	p.C146C	NM_018995.2	NP_061868.1	1	2	3	2.064369	Q9BXT6	M10L1_HUMAN		3	521	+		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Silent	SNP	ENST00000262794.5	1	1	hg19	c.438C>T	CCDS14084.1	1																																																																																								0.386988		TCGA-2J-AAB1-01A-11D-A40W-08	0.512	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	1	0	1		2	2	2	0		0	0	70		70	68	1	1.940000	-19.999990	1	0.380000	NM_018995			47	46		229	228	0		1	0		0	0	70	0		1.000000	0	0	0	0	1	0	47	229
GLI2	2736	broad.mit.edu	37	2	121740416	121740416	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr2:121740416C>T	ENST00000452319.1	+	11	1703	c.1643C>T	c.(1642-1644)tCg>tTg	p.S548L	GLI2_ENST00000314490.11_Missense_Mutation_p.S220L|GLI2_ENST00000361492.4_Missense_Mutation_p.S548L|GLI2_ENST00000435313.2_3'UTR					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				TCCAACGCCTCGGACCGCGCC	0.637																																						ENST00000452319.1	0.990000	6.000000e-01	0.900000	0.680000	0.780000	0.795310	0.780000	0.790000																										0				64						c.(1642-1644)tCg>tTg		GLI family zinc finger 2							89.0	77.0	81.0					2																	121740416		2203	4300	6503	SO:0001583	missense	2736	0	0					g.chr2:121740416C>T		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.1643C>T	chr2.hg19:g.121740416C>T	ENSP00000390436:p.Ser548Leu	0					GLI2_ENST00000361492.4_Missense_Mutation_p.S548L|GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000314490.11_Missense_Mutation_p.S220L	p.S548L			0	0	0	2.015667				11	1703	+	Renal(3;0.0496)	Prostate(154;0.0623)		Missense_Mutation	SNP	ENST00000452319.1	1	1	hg19	c.1643C>T	CCDS33283.1	0	.	.	.	.	.	.	.	.	.	.	C	33	5.240212	0.95240	.	.	ENSG00000074047	ENST00000452319;ENST00000361492;ENST00000314490	T;T;T	0.52526	0.66;0.66;0.66	4.59	4.59	0.56863	4.59	4.59	0.56863	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.67126	0.2860	M	0.64676	1.99	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.996;0.994;0.998;0.999;0.994	T	0.70967	-0.4728	10	0.87932	D	0	.	17.9271	0.88987	0.0:1.0:0.0:0.0	.	548;531;203;203;220	P10070;Q0VGA0;P10070-2;P10070-4;P10070-3	GLI2_HUMAN;.;.;.;.	L	548;548;220	ENSP00000390436:S548L;ENSP00000354586:S548L;ENSP00000312694:S220L	ENSP00000312694:S220L	S	+	2	0	0	GLI2	121456886	121456886	1.000000	0.71417	0.998000	0.56505	0.850000	0.48378	7.599000	0.82757	2.536000	0.85505	0.484000	0.47621	TCG	0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.637	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	1	0	1		2	2	2	0		0	0	51		51	48	1	1.940000	-3.022880	1	0.380000	NM_005270			50	48		282	279	1		1	0		0	0	51	0		1.000000	3.510172e-01	0	0	0	8	0	50	282
EPC2	26122	broad.mit.edu	37	2	149542414	149542414	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr2:149542414A>G	ENST00000258484.6	+	13	2229	c.2195A>G	c.(2194-2196)cAc>cGc	p.H732R		NM_015630.3	NP_056445.3	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2 (Drosophila)	732					chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0516)		AATGCAGTGCACCTCAATAAT	0.473																																						ENST00000258484.6	0.810000	3.800000e-01	0.700000	0.470000	0.570000	0.588896	0.570000	0.570000																										0				13						c.(2194-2196)cAc>cGc		enhancer of polycomb homolog 2 (Drosophila)							124.0	120.0	121.0					2																	149542414		2107	4231	6338	SO:0001583	missense	26122	0	0					g.chr2:149542414A>G	AF286904	CCDS46422.1	2q23	2008-02-05			ENSG00000135999	ENSG00000135999			24543	protein-coding gene	gene with protein product		611000					Standard	NM_015630		Approved	DKFZP566F2124	uc010zbt.2	Q52LR7	OTTHUMG00000153739	ENST00000258484.6:c.2195A>G	chr2.hg19:g.149542414A>G	ENSP00000258484:p.His732Arg	0						p.H732R	NM_015630.3	NP_056445.3	0	0	0	2.015667	Q52LR7	EPC2_HUMAN		13	2229	+			B3KWT7|D3DP89|Q7L9J1|Q96RR7|Q9NUT8|Q9NVR1|Q9UFM9	Missense_Mutation	SNP	ENST00000258484.6	1	1	hg19	c.2195A>G	CCDS46422.1	0	.	.	.	.	.	.	.	.	.	.	A	12.37	1.916638	0.33815	.	.	ENSG00000135999	ENST00000258484	.	.	.	5.93	5.93	0.95920	5.93	5.93	0.95920	.	0.105505	0.64402	D	0.000005	T	0.68449	0.3002	L	0.44542	1.39	0.80722	D	1	D	0.54772	0.968	D	0.67900	0.954	T	0.65713	-0.6101	9	0.34782	T	0.22	-2.9627	16.3783	0.83418	1.0:0.0:0.0:0.0	.	732	Q52LR7	EPC2_HUMAN	R	732	.	ENSP00000258484:H732R	H	+	2	0	0	EPC2	149258884	149258884	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.746000	0.74866	2.261000	0.74972	0.477000	0.44152	CAC	0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.473	EPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332278.1	1	0	1		2	2	2	0		0	0	34		34	34	1	1.940000	-10.431350	1	0.380000	NM_015630			23	22		187	186	1		1	1		0	0	34	0		1.000000	9.015453e-01	0	8	0	27	0	23	187
TANC1	85461	broad.mit.edu	37	2	160087288	160087288	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr2:160087288C>T	ENST00000263635.6	+	27	5588	c.5351C>T	c.(5350-5352)aCc>aTc	p.T1784I	TANC1_ENST00000454300.1_Missense_Mutation_p.T1678I	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1784					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						CAAGCCAAAACCTGTTCTGTT	0.498																																						ENST00000263635.6	1.000000	8.700000e-01	1.000000	0.990000	0.990000	0.990875	0.990000	1.000000																										0				77						c.(5350-5352)aCc>aTc		tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1							108.0	109.0	109.0					2																	160087288		1957	4157	6114	SO:0001583	missense	85461	0	0					g.chr2:160087288C>T	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.5351C>T	chr2.hg19:g.160087288C>T	ENSP00000263635:p.Thr1784Ile	0					TANC1_ENST00000454300.1_Missense_Mutation_p.T1678I	p.T1784I	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	0	0	0	2.015667	Q9C0D5	TANC1_HUMAN		27	5588	+			C9JD88|Q49AI8	Missense_Mutation	SNP	ENST00000263635.6	1	1	hg19	c.5351C>T	CCDS42766.1	1	.	.	.	.	.	.	.	.	.	.	C	9.077	0.998461	0.19121	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	T;T	0.69685	-0.42;-0.42	5.96	4.9	0.64082	5.96	4.9	0.64082	.	0.635444	0.17407	N	0.175331	T	0.50939	0.1645	N	0.22421	0.69	0.18873	N	0.999989	B	0.15473	0.013	B	0.16289	0.015	T	0.24261	-1.0165	9	.	.	.	.	12.4187	0.55508	0.0:0.8581:0.0:0.1419	.	1784	Q9C0D5	TANC1_HUMAN	I	1678;1784	ENSP00000396339:T1678I;ENSP00000263635:T1784I	.	T	+	2	0	0	TANC1	159795534	159795534	0.992000	0.36948	0.283000	0.24790	0.386000	0.30323	0.906000	0.28517	2.823000	0.97156	0.655000	0.94253	ACC	0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.498	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1	1	0	1		2	2	2	0		0	0	26		26	26	1	1.940000	-20.000000	1	0.380000				40	40		138	134	1		1	1		0	0	26	0		1.000000	9.994377e-01	0	18	0	25	0	40	138
PDE11A	50940	broad.mit.edu	37	2	178762794	178762794	+	Silent	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr2:178762794G>A	ENST00000286063.6	-	4	1610	c.1293C>T	c.(1291-1293)atC>atT	p.I431I	PDE11A_ENST00000358450.4_Silent_p.I181I|PDE11A_ENST00000409504.1_Silent_p.I73I|PDE11A_ENST00000449286.2_Silent_p.I73I|PDE11A_ENST00000497003.1_5'UTR	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	431	GAF 2.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)	p.I431I(2)|p.I181I(2)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	CTGGTGATTCGATGTCCTCTA	0.348									Primary Pigmented Nodular Adrenocortical Disease, Familial																													ENST00000286063.6	1.000000	9.400000e-01	1.000000	0.990000	0.990000	0.996523	0.990000	1.000000																										4	Substitution - coding silent(4)	p.I431I(2)|p.I181I(2)	large_intestine(4)	58						c.(1291-1293)atC>atT		phosphodiesterase 11A	Caffeine(DB00201)|Tadalafil(DB00820)						116.0	112.0	114.0					2																	178762794		2203	4300	6503	SO:0001819	synonymous_variant	50940	2	121412	32	Primary Pigmented Nodular Adrenocortical Disease, Familial	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	g.chr2:178762794G>A	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.1293C>T	chr2.hg19:g.178762794G>A		0					PDE11A_ENST00000409504.1_Silent_p.I73I|PDE11A_ENST00000449286.2_Silent_p.I73I|PDE11A_ENST00000497003.1_5'UTR|PDE11A_ENST00000358450.4_Silent_p.I181I	p.I431I	NM_016953.3	NP_058649.3	0	0	0	2.015667	Q9HCR9	PDE11_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)	4	1610	-			Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Silent	SNP	ENST00000286063.6	1	1	hg19	c.1293C>T	CCDS33334.1	1	.	.	.	.	.	.	.	.	.	.	G	9.329	1.059928	0.19987	.	.	ENSG00000128655	ENST00000433879	.	.	.	5.89	0.569	0.17340	5.89	0.569	0.17340	.	.	.	.	.	T	0.57417	0.2052	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49808	-0.8900	4	.	.	.	.	9.715	0.40270	0.7158:0.0:0.2842:0.0	.	.	.	.	L	70	.	.	S	-	2	0	0	PDE11A	178471040	178471040	0.922000	0.31269	0.995000	0.50966	0.966000	0.64601	0.180000	0.16860	-0.128000	0.11641	-0.302000	0.09304	TCG	0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.348	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2	1	0	1		2	2	2	0		0	0	77		77	77	1	1.940000	-3.842923	1	0.380000				94	93		338	336	1		1	0		0	0	77	0		1.000000	4.830764e-02	0	1	0	1	0	94	338
SF3B1	23451	broad.mit.edu	37	2	198267359	198267359	+	Missense_Mutation	SNP	C	C	G	rs377023736		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr2:198267359C>G	ENST00000335508.6	-	14	2089	c.1998G>C	c.(1996-1998)aaG>aaC	p.K666N	SF3B1_ENST00000462613.1_5'Flank|SNORA4_ENST00000365564.1_RNA	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	666					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.K666N(19)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GTTGTACAATCTTAATACCAG	0.413			Mis		myelodysplastic syndrome																																	ENST00000335508.6	0.300000	9.000000e-02	0.240000	0.130000	0.170000	0.188569	0.170000	0.180000				Dom	yes			Dom	yes		2	2q33.1	2q33.1	23451	Mis	"""splicing factor 3b, subunit 1, 155kDa"""				L	L			myelodysplastic syndrome		19	Substitution - Missense(19)	p.K666N(19)	haematopoietic_and_lymphoid_tissue(15)|NS(3)|endometrium(1)	633						c.(1996-1998)aaG>aaC		splicing factor 3b, subunit 1, 155kDa		C	ASN/LYS	0,4406		0,0,2203	116.0	116.0	116.0		1998	4.8	1.0	2		116	1,8599	1.2+/-3.3	0,1,4299	no	missense	SF3B1	NM_012433.2	94	0,1,6502	GG,GC,CC		0.0116,0.0,0.0077	probably-damaging	666/1305	198267359	1,13005	2203	4300	6503	SO:0001583	missense	23451	7	121412	39				g.chr2:198267359C>G	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1998G>C	chr2.hg19:g.198267359C>G	ENSP00000335321:p.Lys666Asn	0					SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'Flank	p.K666N	NM_012433.2	NP_036565.2	0	0	0	2.015667	O75533	SF3B1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.246)	14	2089	-			E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	1	1	hg19	c.1998G>C	CCDS33356.1	0	.	.	.	.	.	.	.	.	.	.	C	21.5	4.159735	0.78226	0.0	1.16E-4	ENSG00000115524	ENST00000335508	T	0.65732	-0.17	5.68	4.81	0.61882	5.68	4.81	0.61882	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.83575	0.5284	H	0.95645	3.7	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.87121	0.2191	10	0.87932	D	0	.	11.0204	0.47715	0.0:0.8576:0.0:0.1424	.	666	O75533	SF3B1_HUMAN	N	666	ENSP00000335321:K666N	ENSP00000335321:K666N	K	-	3	2	2	SF3B1	197975604	197975604	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.643000	0.46604	1.410000	0.46936	0.561000	0.74099	AAG	0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.413	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2	0	0	1		2	2	2	0		0	0	56		56	55	1	1.940000	-3.187404	1	0.380000				11	11		319	317	0		1	1	1	0	0	56	794		0.998349	9.944347e-01	9.999981e-01	7	15	253	840	11	319
ZDBF2	57683	broad.mit.edu	37	2	207175041	207175041	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr2:207175041A>G	ENST00000374423.3	+	5	6175	c.5789A>G	c.(5788-5790)aAg>aGg	p.K1930R		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1930							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						CCTAAGCAAAAGGGGCGTGTG	0.428																																						ENST00000374423.3	0.140000	1.000000e-02	0.100000	0.030000	0.060000	0.071245	0.060000	0.060000																										0				95						c.(5788-5790)aAg>aGg		zinc finger, DBF-type containing 2							70.0	70.0	70.0					2																	207175041		1960	4152	6112	SO:0001583	missense	57683	0	0					g.chr2:207175041A>G	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.5789A>G	chr2.hg19:g.207175041A>G	ENSP00000363545:p.Lys1930Arg	0						p.K1930R	NM_020923.1	NP_065974.1	0	0	0	2.015667	Q9HCK1	ZDBF2_HUMAN		5	6175	+			Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	0	1	hg19	c.5789A>G	CCDS46501.1	0	.	.	.	.	.	.	.	.	.	.	A	4.060	0.008959	0.07912	.	.	ENSG00000204186	ENST00000374423	T	0.44482	0.92	5.64	-2.84	0.05751	5.64	-2.84	0.05751	.	.	.	.	.	T	0.19525	0.0469	N	0.22421	0.69	0.09310	N	1	P	0.40144	0.704	B	0.33799	0.17	T	0.22556	-1.0213	9	0.16896	T	0.51	.	5.9471	0.19225	0.1465:0.6094:0.0829:0.1612	.	1930	Q9HCK1	ZDBF2_HUMAN	R	1930	ENSP00000363545:K1930R	ENSP00000363545:K1930R	K	+	2	0	0	ZDBF2	206883286	206883286	0.023000	0.18921	0.000000	0.03702	0.003000	0.03518	0.647000	0.24812	-0.083000	0.12618	0.456000	0.33151	AAG	0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.428	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	0	0	1		2	2	2	0		0	0	52		52	52	1	1.940000	-3.207332	1	0.380000	NM_020923			4	4		360	339	0		1			0	0	52	0		0.876406	0	0	0	0	0	0	4	360
ACADL	33	broad.mit.edu	37	2	211070474	211070474	+	Missense_Mutation	SNP	G	G	A	rs546101555		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr2:211070474G>A	ENST00000233710.3	-	6	877	c.650C>T	c.(649-651)gCg>gTg	p.A217V	AC006994.2_ENST00000412065.1_RNA	NM_001608.3	NP_001599.1	P28330	ACADL_HUMAN	acyl-CoA dehydrogenase, long chain	217					carnitine catabolic process (GO:0042413)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid catabolic process (GO:0044242)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|long-chain fatty acid catabolic process (GO:0042758)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|oxidation-reduction process (GO:0055114)|protein homotetramerization (GO:0051289)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|palmitoyl-CoA oxidase activity (GO:0016401)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14		Renal(323;0.202)		Epithelial(149;0.00631)|Lung(261;0.0438)|LUSC - Lung squamous cell carcinoma(261;0.0466)|all cancers(144;0.0621)		ATTTGTGACCGCAACTACAAT	0.398													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17317	0.0		0.0	False		,,,				2504	0.0					ENST00000233710.3	0.180000	3.000000e-02	0.140000	0.050000	0.090000	0.102334	0.090000	0.090000																										0				14						c.(649-651)gCg>gTg		acyl-CoA dehydrogenase, long chain							142.0	130.0	134.0					2																	211070474		2203	4300	6503	SO:0001583	missense	33	3	121400	38				g.chr2:211070474G>A	M74096	CCDS2389.1	2q34	2012-07-13	2010-04-30		ENSG00000115361	ENSG00000115361	1.3.99.13		88	protein-coding gene	gene with protein product		609576	"""acyl-Coenzyme A dehydrogenase, long chain"""			1774065	Standard	NM_001608		Approved	LCAD, ACAD4	uc002vdz.4	P28330	OTTHUMG00000132989	ENST00000233710.3:c.650C>T	chr2.hg19:g.211070474G>A	ENSP00000233710:p.Ala217Val	0					AC006994.2_ENST00000412065.1_RNA	p.A217V	NM_001608.3	NP_001599.1	0	0	0	2.015667	P28330	ACADL_HUMAN		6	877	-		Renal(323;0.202)	B2R8T3|Q8IUN8	Missense_Mutation	SNP	ENST00000233710.3	0	1	hg19	c.650C>T	CCDS2389.1	0	.	.	.	.	.	.	.	.	.	.	G	11.41	1.630025	0.28978	.	.	ENSG00000115361	ENST00000233710	D	0.97505	-4.41	5.28	4.41	0.53225	5.28	4.41	0.53225	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (2);	0.208411	0.49305	D	0.000151	D	0.95500	0.8538	L	0.46885	1.475	0.43141	D	0.994895	P	0.45594	0.862	P	0.44772	0.46	D	0.94867	0.8027	10	0.51188	T	0.08	.	14.1005	0.65051	0.0727:0.0:0.9273:0.0	.	217	P28330	ACADL_HUMAN	V	217	ENSP00000233710:A217V	ENSP00000233710:A217V	A	-	2	0	0	ACADL	210778719	210778719	1.000000	0.71417	0.009000	0.14445	0.008000	0.06430	7.334000	0.79224	1.240000	0.43803	-0.137000	0.14449	GCG	0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.398	ACADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256561.2	0	0	1		2	2	2	0		0	0	65		65	64	1	1.940000	-2.517377	1	0.380000	NM_001608			6	6		349	347	0		1			0	0	65	0		0.964691	0	0	0	0	0	0	6	349
DNPEP	23549	broad.mit.edu	37	2	220239025	220239025	+	Missense_Mutation	SNP	A	A	C			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr2:220239025A>C	ENST00000273075.4	-	15	1667	c.1447T>G	c.(1447-1449)Tta>Gta	p.L483V	DNPEP_ENST00000373972.1_Missense_Mutation_p.L408V|DNPEP_ENST00000523282.1_Missense_Mutation_p.L491V|DNPEP_ENST00000490371.1_5'UTR	NM_012100.2	NP_036232	Q9ULA0	DNPEP_HUMAN	aspartyl aminopeptidase	473					peptide metabolic process (GO:0006518)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Renal(207;0.0474)		Epithelial(149;1.09e-06)|all cancers(144;0.000179)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAATCCACTAAGAGATTATGG	0.473																																						ENST00000273075.4	1.000000	6.600000e-01	0.980000	0.760000	0.860000	0.869195	0.860000	1.000000																										0				17						c.(1447-1449)Tta>Gta		aspartyl aminopeptidase							110.0	106.0	107.0					2																	220239025		1950	4138	6088	SO:0001583	missense	23549	0	0					g.chr2:220239025A>C		CCDS42823.1	2q36.1	2008-05-22			ENSG00000123992	ENSG00000123992			2981	protein-coding gene	gene with protein product		611367				9632644	Standard	NM_012100		Approved	DAP, ASPEP	uc002vle.2	Q9ULA0	OTTHUMG00000058919	ENST00000273075.4:c.1447T>G	chr2.hg19:g.220239025A>C	ENSP00000273075:p.Leu483Val	0					DNPEP_ENST00000490371.1_5'UTR|DNPEP_ENST00000523282.1_Missense_Mutation_p.L491V|DNPEP_ENST00000373972.1_Missense_Mutation_p.L408V	p.L483V	NM_012100.2	NP_036232	0	0	0	2.015667	Q9ULA0	DNPEP_HUMAN		15	1667	-		Renal(207;0.0474)	Q9BW44|Q9NUV5	Missense_Mutation	SNP	ENST00000273075.4	1	1	hg19	c.1447T>G	CCDS42823.1	1	.	.	.	.	.	.	.	.	.	.	A	2.901	-0.227412	0.06022	.	.	ENSG00000123992	ENST00000273075;ENST00000373972;ENST00000523282;ENST00000535056	.	.	.	5.44	-10.9	0.00192	5.44	-10.9	0.00192	.	1.368830	0.04681	N	0.412341	T	0.11495	0.0280	N	0.11023	0.085	0.09310	N	0.999999	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.0;0.001	T	0.13388	-1.0511	9	0.13470	T	0.59	1.4126	0.5348	0.00635	0.2362:0.1861:0.301:0.2768	.	491;491;473;483	E7ETB3;B7Z7F0;Q9ULA0;Q53SB6	.;.;DNPEP_HUMAN;.	V	483;408;491;376	.	ENSP00000273075:L483V	L	-	1	2	2	DNPEP	219947269	219947269	0.000000	0.05858	0.016000	0.15963	0.364000	0.29643	-1.670000	0.01956	-1.757000	0.01316	-0.333000	0.08304	TTA	0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.473	DNPEP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000130212.1	1	0	1		2	2	2	0		0	0	50		50	49	1	1.940000	-20.000000	1	0.380000	NM_012100			51	51		256	254	1		1	1		0	0	50	0		1.000000	1	0	75	0	140	0	51	256
TBC1D23	55773	broad.mit.edu	37	3	100016873	100016873	+	Missense_Mutation	SNP	C	C	T	rs372446939		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr3:100016873C>T	ENST00000394144.4	+	9	990	c.983C>T	c.(982-984)gCg>gTg	p.A328V	TBC1D23_ENST00000475134.1_Missense_Mutation_p.A191V|TBC1D23_ENST00000486274.1_3'UTR|TBC1D23_ENST00000344949.5_Missense_Mutation_p.A328V	NM_001199198.2	NP_001186127.1	Q9NUY8	TBC23_HUMAN	TBC1 domain family, member 23	328					positive regulation of interleukin-6 production (GO:0032755)|regulation of inflammatory response (GO:0050727)|regulation of tumor necrosis factor production (GO:0032680)		Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(10)|ovary(1)|prostate(2)|skin(2)	25						ATCCTTCAAGCGAATCAGCTA	0.443																																						ENST00000394144.4	0.400000	1.000000e-01	0.320000	0.150000	0.220000	0.241633	0.220000	0.220000																										0				25						c.(982-984)gCg>gTg		TBC1 domain family, member 23		C	VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	75.0	68.0	71.0		983,983	5.8	1.0	3		71	0,8600		0,0,4300	no	missense,missense	TBC1D23	NM_001199198.1,NM_018309.3	64,64	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	328/700,328/685	100016873	1,13005	2203	4300	6503	SO:0001583	missense	55773	3	121410	33				g.chr3:100016873C>T	AK001908	CCDS2936.1, CCDS56265.1	3q12.2	2013-07-10			ENSG00000036054	ENSG00000036054			25622	protein-coding gene	gene with protein product						22312129	Standard	NM_001199198		Approved	FLJ11046	uc003dtt.4	Q9NUY8	OTTHUMG00000159067	ENST00000394144.4:c.983C>T	chr3.hg19:g.100016873C>T	ENSP00000377700:p.Ala328Val	0					TBC1D23_ENST00000475134.1_Missense_Mutation_p.A191V|TBC1D23_ENST00000344949.5_Missense_Mutation_p.A328V|TBC1D23_ENST00000486274.1_3'UTR	p.A328V	NM_001199198.2	NP_001186127.1	0	1	1	2.022971	Q9NUY8	TBC23_HUMAN		9	990	+			B9A6M5|Q8TCN8|Q8WUB7|Q96D90|Q9NV75	Missense_Mutation	SNP	ENST00000394144.4	0	1	hg19	c.983C>T	CCDS56265.1	0	.	.	.	.	.	.	.	.	.	.	C	34	5.350043	0.95830	2.27E-4	0.0	ENSG00000036054	ENST00000344949;ENST00000394144;ENST00000475134	T;T;T	0.32988	1.43;1.43;1.43	5.76	5.76	0.90799	5.76	5.76	0.90799	Rhodanese-like (2);	0.000000	0.85682	D	0.000000	T	0.41282	0.1152	N	0.22421	0.69	0.80722	D	1	D;D	0.71674	0.998;0.997	P;P	0.62885	0.908;0.851	T	0.09058	-1.0692	9	.	.	.	.	19.9533	0.97211	0.0:1.0:0.0:0.0	.	328;328	Q9NUY8;Q9NUY8-2	TBC23_HUMAN;.	V	328;328;191	ENSP00000340693:A328V;ENSP00000377700:A328V;ENSP00000418059:A191V	.	A	+	2	0	0	TBC1D23	101499563	101499563	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.086000	0.76885	2.725000	0.93324	0.585000	0.79938	GCG	0.378820		TCGA-2J-AAB1-01A-11D-A40W-08	0.443	TBC1D23-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353150.1	0	0	1		2	2	2	0		0	0	32		32	29	1	1.940000	-3.966471	1	0.380000	NM_018309			8	8		184	179	0		1	0		0	0	32	0		0.988665	4.577688e-01	0	1	0	33	0	8	184
TGFBR2	7048	broad.mit.edu	37	3	30732957	30732957	+	Missense_Mutation	SNP	G	G	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr3:30732957G>T	ENST00000295754.5	+	7	1952	c.1570G>T	c.(1570-1572)Gac>Tac	p.D524Y	TGFBR2_ENST00000359013.4_Missense_Mutation_p.D549Y	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	524	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.D524N(1)|p.D524Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						CTGGGACCACGACCCAGAGGC	0.607																																						ENST00000295754.5	1.000000	9.900000e-01	1.000000	0.990000	0.990000	1.000000	0.990000	1.000000																										2	Substitution - Missense(2)	p.D524N(1)|p.D524Y(1)	large_intestine(1)|pancreas(1)	53	GRCh37	CM064328	TGFBR2	M		c.(1570-1572)Gac>Tac		transforming growth factor, beta receptor II (70/80kDa)							71.0	64.0	67.0					3																	30732957		2203	4300	6503	SO:0001583	missense	7048	0	0					g.chr3:30732957G>T		CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.1570G>T	chr3.hg19:g.30732957G>T	ENSP00000295754:p.Asp524Tyr	1					TGFBR2_ENST00000359013.4_Missense_Mutation_p.D549Y	p.D524Y	NM_003242.5	NP_003233.4	0	2	2	2.018562	P37173	TGFR2_HUMAN		7	1952	+			B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	ENST00000295754.5	1	1	hg19	c.1570G>T	CCDS2648.1	1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.005083	0.93287	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000439925	D;D	0.95103	-3.61;-3.61	5.91	5.91	0.95273	5.91	5.91	0.95273	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98018	0.9347	M	0.91663	3.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98294	1.0515	10	0.87932	D	0	.	20.3052	0.98627	0.0:0.0:1.0:0.0	.	524;549	P37173;D2JYI1	TGFR2_HUMAN;.	Y	524;549;354	ENSP00000295754:D524Y;ENSP00000351905:D549Y	ENSP00000295754:D524Y	D	+	1	0	0	TGFBR2	30707961	30707961	1.000000	0.71417	0.974000	0.42286	0.985000	0.73830	9.869000	0.99810	2.808000	0.96608	0.655000	0.94253	GAC	0.380000		TCGA-2J-AAB1-01A-11D-A40W-08	0.607	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2	1	0	1		2	2	2	0		0	0	57		57	56	1	1.940000	-20.000000	1	0.380000				107	105		174	168	1		1	1	1	0	0	57	575		1.000000	1	1	103	286	153	423	107	174
DOCK3	1795	broad.mit.edu	37	3	51400102	51400102	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr3:51400102C>T	ENST00000266037.9	+	49	5313	c.5290C>T	c.(5290-5292)Cga>Tga	p.R1764*		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1764	Ser-rich.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TTCCAGTGCCCGAGGTAAGGA	0.562																																						ENST00000266037.9	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999933	0.990000	1.000000																										0				45						c.(5290-5292)Cga>Tga		dedicator of cytokinesis 3							47.0	48.0	48.0					3																	51400102		2043	4199	6242	SO:0001587	stop_gained	1795	0	0					g.chr3:51400102C>T	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.5290C>T	chr3.hg19:g.51400102C>T	ENSP00000266037:p.Arg1764*	0						p.R1764*	NM_004947.4	NP_004938.1	0	1	1	2.022556	Q8IZD9	DOCK3_HUMAN		49	5313	+			O15017	Nonsense_Mutation	SNP	ENST00000266037.9	0	1	hg19	c.5290C>T	CCDS46835.1	1	.	.	.	.	.	.	.	.	.	.	C	44	10.689336	0.99450	.	.	ENSG00000088538	ENST00000266037;ENST00000402669	.	.	.	5.26	5.26	0.73747	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	15.6164	0.76769	0.1379:0.862:0.0:0.0	.	.	.	.	X	1764;560	.	ENSP00000266037:R1764X	R	+	1	2	2	DOCK3	51375142	51375142	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.049000	0.49869	2.605000	0.88082	0.563000	0.77884	CGA	0.378820		TCGA-2J-AAB1-01A-11D-A40W-08	0.562	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	1	0	1		2	2	2	0		0	0	16		16	15	1	1.940000	-6.053581	1	0.380000	NM_004947			26	26		50	50	1		1	0	1	0	0	16	739		1.000000	0	1	0	185	1	678	26	50
EIF2B5	8893	broad.mit.edu	37	3	183855998	183855998	+	Silent	SNP	T	T	C			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr3:183855998T>C	ENST00000273783.3	+	5	851	c.729T>C	c.(727-729)gaT>gaC	p.D243D	RP11-778D9.12_ENST00000608135.1_RNA|EIF2B5_ENST00000444495.1_Silent_p.D243D	NM_003907.2	NP_003898.2	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa	243					astrocyte development (GO:0014002)|astrocyte differentiation (GO:0048708)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|positive regulation of translational initiation (GO:0045948)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|nucleus (GO:0005634)	guanyl-nucleotide exchange factor activity (GO:0005085)|translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(5)|urinary_tract(1)	27	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			TTCGATATGATTTACTGGATT	0.478																																						ENST00000273783.3	0.340000	1.400000e-01	0.290000	0.180000	0.220000	0.237419	0.220000	0.220000																										0				27						c.(727-729)gaT>gaC		eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa							182.0	166.0	172.0					3																	183855998		2203	4300	6503	SO:0001819	synonymous_variant	8893	0	0					g.chr3:183855998T>C	U23028	CCDS3252.1	3q27.3	2006-07-18	2002-08-29		ENSG00000145191	ENSG00000145191			3261	protein-coding gene	gene with protein product		603945	"""eukaryotic translation initiation factor 2B, subunit 5 (epsilon, 82kD)"""			8688466	Standard	NM_003907		Approved	EIF2Bepsilon, EIF-2B	uc003fmp.3	Q13144	OTTHUMG00000156840	ENST00000273783.3:c.729T>C	chr3.hg19:g.183855998T>C		0					RP11-778D9.12_ENST00000608135.1_RNA|EIF2B5_ENST00000444495.1_Silent_p.D243D	p.D243D	NM_003907.2	NP_003898.2	0	1	1	2.022971	Q13144	EI2BE_HUMAN	Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)	5	851	+	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Q541Z1|Q96D04	Silent	SNP	ENST00000273783.3	1	1	hg19	c.729T>C	CCDS3252.1	0																																																																																								0.378820		TCGA-2J-AAB1-01A-11D-A40W-08	0.478	EIF2B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346168.1	1	0	1		2	2	2	0		0	0	76		76	76	1	1.940000	-19.700530	1	0.380000				20	20		441	436	0		1	1		0	0	76	0		0.999995	5.750939e-01	0	4	0	39	0	20	441
GABRA4	2557	broad.mit.edu	37	4	46979145	46979145	+	Silent	SNP	C	C	T	rs556582200		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr4:46979145C>T	ENST00000264318.3	-	5	1492	c.510G>A	c.(508-510)gcG>gcA	p.A170A		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	170					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TGGGACACTCCGCACTTATGG	0.343													C|||	1	0.000199681	0.0	0.0	5008	,	,		13340	0.0		0.0	False		,,,				2504	0.001				Ovarian(6;283 369 8234 12290 33402)	ENST00000264318.3	1.000000	5.700000e-01	0.940000	0.680000	0.800000	0.807961	0.800000	1.000000																										0				45						c.(508-510)gcG>gcA		gamma-aminobutyric acid (GABA) A receptor, alpha 4	Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)						52.0	50.0	51.0					4																	46979145		2203	4300	6503	SO:0001819	synonymous_variant	2557	4	121372	36				g.chr4:46979145C>T		CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.510G>A	chr4.hg19:g.46979145C>T		0						p.A170A	NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	0	1	1	2.022977	P48169	GBRA4_HUMAN		5	1492	-			Q8IYR7	Silent	SNP	ENST00000264318.3	1	1	hg19	c.510G>A	CCDS3473.1	0																																																																																								0.378820		TCGA-2J-AAB1-01A-11D-A40W-08	0.343	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216893.1	0	0	1		18	2	2	1		1	1	38		38	38	1	1.940000	-2.684716	1	0.380000				33	32		183	179	1		1			1	0	38	0		0.989151	0	0	0	0	0	0	33	183
TMPRSS11D	9407	broad.mit.edu	37	4	68699089	68699089	+	Silent	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr4:68699089G>A	ENST00000283916.6	-	7	623	c.525C>T	c.(523-525)gcC>gcT	p.A175A	UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11D_ENST00000509584.1_5'UTR|TMPRSS11D_ENST00000545541.1_Silent_p.A58A	NM_004262.2	NP_004253.1	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	175					proteolysis (GO:0006508)|respiratory gaseous exchange (GO:0007585)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						GGTCTGGACCGGCCCCACATT	0.463																																						ENST00000283916.6	0.240000	9.000000e-02	0.200000	0.120000	0.150000	0.167193	0.150000	0.160000																										0				23						c.(523-525)gcC>gcT		transmembrane protease, serine 11D							111.0	105.0	107.0					4																	68699089		2203	4300	6503	SO:0001819	synonymous_variant	9407	9	121340	44				g.chr4:68699089G>A	AB002134	CCDS3518.1	4q13.2	2010-04-13			ENSG00000153802	ENSG00000153802		"""Serine peptidases / Transmembrane"""	24059	protein-coding gene	gene with protein product	"""airway trypsin like protease"""	605369				9565616, 9070615	Standard	XM_005265710		Approved		uc003hdq.3	O60235	OTTHUMG00000129300	ENST00000283916.6:c.525C>T	chr4.hg19:g.68699089G>A		0					TMPRSS11D_ENST00000545541.1_Silent_p.A58A|TMPRSS11D_ENST00000509584.1_5'UTR|UBA6-AS1_ENST00000500538.2_RNA	p.A175A	NM_004262.2	NP_004253.1	0	1	1	2.022977	O60235	TM11D_HUMAN		7	623	-			Q08AF6	Silent	SNP	ENST00000283916.6	0	1	hg19	c.525C>T	CCDS3518.1	0																																																																																								0.378820		TCGA-2J-AAB1-01A-11D-A40W-08	0.463	TMPRSS11D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251430.3	0	0	1		2	2	2	0		0	0	115		115	115	1	1.940000	-2.764799	1	0.380000	NM_004262			22	21		697	686	0		1			0	0	115	0		0.999999	0	0	0	0	0	0	22	697
APC	324	broad.mit.edu	37	5	112176765	112176765	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr5:112176765A>G	ENST00000457016.1	+	16	5854	c.5474A>G	c.(5473-5475)gAt>gGt	p.D1825G	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Missense_Mutation_p.D1825G|APC_ENST00000257430.4_Missense_Mutation_p.D1825G			P25054	APC_HUMAN	adenomatous polyposis coli	1825	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GTCTTCAATGATAAGCTCCCA	0.333		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	ENST00000457016.1	1.000000	7.800000e-01	1.000000	0.890000	0.990000	0.962495	0.990000	1.000000		12	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	5q21	324	D, Mis, N, F, S	adenomatous polyposis of the colon gene				"""E, M, O"""	E, M, O		colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS	colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS		2	Unknown(1)|Deletion - Frameshift(1)	p.K1192fs*3(1)|p.?(1)	soft_tissue(1)|skin(1)	3261						c.(5473-5475)gAt>gGt		adenomatous polyposis coli							74.0	70.0	71.0					5																	112176765		2201	4300	6501	SO:0001583	missense	324	0	0		Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	g.chr5:112176765A>G	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.5474A>G	chr5.hg19:g.112176765A>G	ENSP00000413133:p.Asp1825Gly	0	TSP Lung(16;0.13)				APC_ENST00000508376.2_Missense_Mutation_p.D1825G|APC_ENST00000257430.4_Missense_Mutation_p.D1825G|CTC-554D6.1_ENST00000520401.1_Intron	p.D1825G			1	2	3	2.028143	P25054	APC_HUMAN		16	5854	+		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	1	1	hg19	c.5474A>G	CCDS4107.1	1	.	.	.	.	.	.	.	.	.	.	A	11.59	1.683218	0.29872	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.90197	-2.63;-2.63;-2.63	6.07	6.07	0.98685	6.07	6.07	0.98685	.	0.322819	0.37955	N	0.001867	D	0.84822	0.5557	L	0.27053	0.805	0.39105	D	0.961357	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.80569	-0.1324	9	.	.	.	-12.6701	16.6277	0.84984	1.0:0.0:0.0:0.0	.	1827;1825	Q4LE70;P25054	.;APC_HUMAN	G	1825	ENSP00000413133:D1825G;ENSP00000257430:D1825G;ENSP00000427089:D1825G	.	D	+	2	0	0	APC	112204664	112204664	1.000000	0.71417	0.582000	0.28627	0.778000	0.44026	7.395000	0.79876	2.330000	0.79161	0.528000	0.53228	GAT	0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.333	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	1	0	1		2	2	2	0		0	0	37		37	35	1	1.940000	-20.000000	1	0.380000	NM_000038			49	47		203	200	1		1	0		0	0	37	0		1.000000	1.771917e-01	0	1	0	3	0	49	203
ETF1	2107	broad.mit.edu	37	5	137844426	137844426	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr5:137844426G>A	ENST00000360541.5	-	10	1384	c.1163C>T	c.(1162-1164)aCg>aTg	p.T388M	ETF1_ENST00000499810.2_Missense_Mutation_p.T355M|ETF1_ENST00000503014.1_Missense_Mutation_p.T374M	NM_004730.3	NP_004721.1	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	388					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)|translation termination factor activity (GO:0008079)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AATTTCCAACGTAGCTCCAAA	0.413																																						ENST00000360541.5	0.080000	0	0.060000	0.010000	0.030000	0.041317	0.030000	0.040000																										0				18						c.(1162-1164)aCg>aTg		eukaryotic translation termination factor 1							173.0	178.0	176.0					5																	137844426		2203	4300	6503	SO:0001583	missense	2107	0	0					g.chr5:137844426G>A	AF095901	CCDS4207.1, CCDS75313.1, CCDS75314.1	5q31.2	2008-02-05			ENSG00000120705	ENSG00000120705			3477	protein-coding gene	gene with protein product	"""sup45 (yeast omnipotent suppressor 45) homolog-like 1"", ""polypeptide chain release factor 1"""	600285		SUP45L1, ERF1, ERF		1546371, 7990965	Standard	NM_004730		Approved	eRF1, TB3-1, RF1	uc003ldc.5	P62495	OTTHUMG00000129199	ENST00000360541.5:c.1163C>T	chr5.hg19:g.137844426G>A	ENSP00000353741:p.Thr388Met	0					ETF1_ENST00000499810.2_Missense_Mutation_p.T355M|ETF1_ENST00000503014.1_Missense_Mutation_p.T374M	p.T388M	NM_004730.3	NP_004721.1	1	2	3	2.028143	P62495	ERF1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)	10	1384	-			B2R6B4|D3DQC1|P46055|Q5M7Z7|Q96CG1	Missense_Mutation	SNP	ENST00000360541.5	0	1	hg19	c.1163C>T	CCDS4207.1	0	.	.	.	.	.	.	.	.	.	.	G	21.4	4.150639	0.78001	.	.	ENSG00000120705	ENST00000499810;ENST00000360541;ENST00000503014	.	.	.	6.17	6.17	0.99709	6.17	6.17	0.99709	eRF1 domain 3 (1);	0.000000	0.85682	D	0.000000	D	0.83229	0.5209	M	0.88640	2.97	0.80722	D	1	D;P	0.64830	0.994;0.607	P;B	0.57324	0.818;0.087	D	0.83814	0.0243	9	0.51188	T	0.08	-6.0305	20.4745	0.99168	0.0:0.0:1.0:0.0	.	374;388	B7Z7P8;P62495	.;ERF1_HUMAN	M	355;388;374	.	ENSP00000353741:T388M	T	-	2	0	0	ETF1	137872325	137872325	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.857000	0.99534	2.941000	0.99782	0.655000	0.94253	ACG	0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.413	ETF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251276.2	0	0	1		2	2	2	0		0	0	162		162	162	1	1.940000	-2.489483	0	0.380000	NM_004730			6	6		878	874	0		1	0		0	0	162	0		0.964533	2.975263e-01	0	0	0	139	0	6	878
PCDHA9	9752	broad.mit.edu	37	5	140229874	140229874	+	Silent	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr5:140229874C>T	ENST00000532602.1	+	1	2827	c.1794C>T	c.(1792-1794)gaC>gaT	p.D598D	PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000378122.3_Silent_p.D598D|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	598	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCAGTGGACGCCGACTCGG	0.672																																					Melanoma(55;1800 1972 14909)	ENST00000532602.1	1.000000	8.100000e-01	1.000000	0.910000	0.990000	0.968228	0.990000	1.000000																										0				59						c.(1792-1794)gaC>gaT		protocadherin alpha 9							62.0	69.0	67.0					5																	140229874		2196	4267	6463	SO:0001819	synonymous_variant	9752	1	120728	17				g.chr5:140229874C>T	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1794C>T	chr5.hg19:g.140229874C>T		0					PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000378122.3_Silent_p.D598D|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron	p.D598D	NM_031857.1	NP_114063.1	1	2	3	2.028143	Q9Y5H5	PCDA9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	2827	+			O15053|Q2M3S5	Silent	SNP	ENST00000532602.1	1	1	hg19	c.1794C>T	CCDS54920.1	1																																																																																								0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.672	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	1	0	1		2	2	2	0		0	0	73		73	73	1	1.940000	-20.000000	1	0.380000	NM_031857			76	74		318	312	1		1			0	0	73	0		1.000000	0	0	0	0	0	0	76	318
PCDHA9	9752	broad.mit.edu	37	5	140230003	140230003	+	Silent	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr5:140230003C>T	ENST00000532602.1	+	1	2956	c.1923C>T	c.(1921-1923)gaC>gaT	p.D641D	PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000378122.3_Silent_p.D641D|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	641	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGAAACGGACGCACCGCGCC	0.682																																					Melanoma(55;1800 1972 14909)	ENST00000532602.1	0.940000	5.600000e-01	0.840000	0.640000	0.730000	0.745922	0.730000	0.740000																										0				59						c.(1921-1923)gaC>gaT		protocadherin alpha 9							59.0	61.0	60.0					5																	140230003		2197	4272	6469	SO:0001819	synonymous_variant	9752	0	0					g.chr5:140230003C>T	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1923C>T	chr5.hg19:g.140230003C>T		0					PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000378122.3_Silent_p.D641D|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron	p.D641D	NM_031857.1	NP_114063.1	1	2	3	2.028143	Q9Y5H5	PCDA9_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	2956	+			O15053|Q2M3S5	Silent	SNP	ENST00000532602.1	1	1	hg19	c.1923C>T	CCDS54920.1	0																																																																																								0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.682	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	1	0	1		2	2	2	0		0	0	91		91	90	1	1.940000	-19.999890	1	0.380000	NM_031857			53	53		325	321	1		1			0	0	91	0		1.000000	0	0	0	0	0	0	53	325
GLRA1	2741	broad.mit.edu	37	5	151271898	151271898	+	Missense_Mutation	SNP	T	T	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr5:151271898T>A	ENST00000455880.2	-	2	444	c.158A>T	c.(157-159)gAt>gTt	p.D53V	GLRA1_ENST00000545569.1_Intron|GLRA1_ENST00000471351.2_5'UTR|GLRA1_ENST00000274576.4_Missense_Mutation_p.D53V			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	53					acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GATCCTGGCATCATATCCGGA	0.498																																						ENST00000455880.2	0.320000	1.000000e-01	0.260000	0.140000	0.190000	0.204579	0.190000	0.200000																										0				23						c.(157-159)gAt>gTt		glycine receptor, alpha 1	Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)						103.0	93.0	97.0					5																	151271898		2203	4300	6503	SO:0001583	missense	2741	0	0					g.chr5:151271898T>A		CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.158A>T	chr5.hg19:g.151271898T>A	ENSP00000411593:p.Asp53Val	0					GLRA1_ENST00000545569.1_Intron|GLRA1_ENST00000471351.2_5'UTR|GLRA1_ENST00000274576.4_Missense_Mutation_p.D53V	p.D53V			1	2	3	2.028143	P23415	GLRA1_HUMAN	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	2	444	-		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	B2R6T3|Q14C77|Q6DJV9	Missense_Mutation	SNP	ENST00000455880.2	1	1	hg19	c.158A>T	CCDS54942.1	0	.	.	.	.	.	.	.	.	.	.	T	25.0	4.590090	0.86851	.	.	ENSG00000145888	ENST00000274576;ENST00000455880	T;T	0.81415	-1.49;-1.49	5.48	5.48	0.80851	5.48	5.48	0.80851	Neurotransmitter-gated ion-channel ligand-binding (3);	0.116646	0.56097	D	0.000030	D	0.91506	0.7318	M	0.91612	3.225	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.72982	0.979;0.964	D	0.93395	0.6755	10	0.87932	D	0	.	15.5709	0.76337	0.0:0.0:0.0:1.0	.	53;53	P23415;P23415-2	GLRA1_HUMAN;.	V	53	ENSP00000274576:D53V;ENSP00000411593:D53V	ENSP00000274576:D53V	D	-	2	0	0	GLRA1	151252091	151252091	1.000000	0.71417	0.993000	0.49108	0.943000	0.58893	7.516000	0.81772	2.089000	0.63090	0.482000	0.46254	GAT	0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.498	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373959.1	0	0	1		2	2	2	0		0	0	63		63	59	1	1.940000	-3.703570	1	0.380000				14	14		369	366	0		1			0	0	63	0		0.999753	0	0	0	0	0	0	14	369
GEMIN5	25929	broad.mit.edu	37	5	154292538	154292538	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr5:154292538G>A	ENST00000285873.7	-	14	1991	c.1916C>T	c.(1915-1917)aCg>aTg	p.T639M		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	639					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AATCTTGGCCGTATGCCCTGA	0.522																																						ENST00000285873.7	0.190000	2.000000e-02	0.140000	0.050000	0.080000	0.096572	0.080000	0.080000																										0				38						c.(1915-1917)aCg>aTg		gem (nuclear organelle) associated protein 5							116.0	101.0	106.0					5																	154292538		2203	4300	6503	SO:0001583	missense	25929	5	121412	34				g.chr5:154292538G>A	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.1916C>T	chr5.hg19:g.154292538G>A	ENSP00000285873:p.Thr639Met	0						p.T639M	NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	1	2	3	2.028143	Q8TEQ6	GEMI5_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)	14	1991	-	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	ENST00000285873.7	0	1	hg19	c.1916C>T	CCDS4330.1	0	.	.	.	.	.	.	.	.	.	.	G	19.12	3.766113	0.69878	.	.	ENSG00000082516	ENST00000285873	T	0.65549	-0.16	5.37	5.37	0.77165	5.37	5.37	0.77165	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.80742	0.4681	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.82647	-0.0354	10	0.87932	D	0	-17.564	19.0919	0.93229	0.0:0.0:1.0:0.0	.	638;639	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	M	639	ENSP00000285873:T639M	ENSP00000285873:T639M	T	-	2	0	0	GEMIN5	154272731	154272731	1.000000	0.71417	1.000000	0.80357	0.298000	0.27526	8.881000	0.92415	2.667000	0.90743	0.561000	0.74099	ACG	0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.522	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1	0	0	1		2	2	2	0		0	0	60		60	59	1	1.940000	-2.742171	1	0.380000				5	5		319	312	0		1	0		0	0	60	0		0.934364	1.266467e-02	0	0	0	9	0	5	319
ADAMTS16	170690	broad.mit.edu	37	5	5242275	5242275	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr5:5242275G>A	ENST00000274181.7	+	17	2771	c.2633G>A	c.(2632-2634)cGc>cAc	p.R878H		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	878	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GCCATCGTGCGCTCTGAGTGC	0.642																																						ENST00000274181.7	1.000000	5.400000e-01	0.920000	0.650000	0.780000	0.786994	0.780000	1.000000																										0				107						c.(2632-2634)cGc>cAc		ADAM metallopeptidase with thrombospondin type 1 motif, 16							45.0	50.0	49.0					5																	5242275		2104	4223	6327	SO:0001583	missense	170690	1	121060	31				g.chr5:5242275G>A	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2633G>A	chr5.hg19:g.5242275G>A	ENSP00000274181:p.Arg878His	0						p.R878H	NM_139056.2	NP_620687.2	1	2	3	2.028143	Q8TE57	ATS16_HUMAN		17	2771	+			C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	1	1	hg19	c.2633G>A	CCDS43299.1	0	.	.	.	.	.	.	.	.	.	.	G	10.82	1.458019	0.26161	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.61274	0.12	5.73	2.91	0.33838	5.73	2.91	0.33838	.	0.432157	0.23055	N	0.052451	T	0.45796	0.1360	L	0.52759	1.655	0.42913	D	0.994269	B;B	0.20550	0.046;0.021	B;B	0.12837	0.006;0.008	T	0.35351	-0.9792	10	0.49607	T	0.09	.	4.6802	0.12731	0.3127:0.152:0.5352:0.0	.	878;878	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	H	878	ENSP00000274181:R878H	ENSP00000274181:R878H	R	+	2	0	0	ADAMTS16	5295275	5295275	0.049000	0.20398	0.169000	0.22859	0.931000	0.56810	1.271000	0.33098	0.328000	0.23435	0.644000	0.83932	CGC	0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.642	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	0	0	1		2	2	2	0		0	0	49		49	49	1	1.940000	-20.000000	1	0.380000	NM_139056			30	29		173	170	1		1	0		0	0	49	0		1.000000	0	0	0	0	1	0	30	173
SEMA5A	9037	broad.mit.edu	37	5	9197372	9197372	+	Missense_Mutation	SNP	C	C	T	rs369851619		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr5:9197372C>T	ENST00000382496.5	-	10	1641	c.976G>A	c.(976-978)Gcc>Acc	p.A326T		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	326	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						TGCGCGATGGCGCTCAGGTTG	0.597																																						ENST00000382496.5	0.830000	4.900000e-01	0.740000	0.560000	0.640000	0.656748	0.640000	0.640000																										0				81						c.(976-978)Gcc>Acc		sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A		C	THR/ALA	0,4406		0,0,2203	82.0	82.0	82.0		976	4.5	1.0	5		82	1,8599	1.2+/-3.3	0,1,4299	no	missense	SEMA5A	NM_003966.2	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	326/1075	9197372	1,13005	2203	4300	6503	SO:0001583	missense	9037	1	121412	35				g.chr5:9197372C>T	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.976G>A	chr5.hg19:g.9197372C>T	ENSP00000371936:p.Ala326Thr	0						p.A326T	NM_003966.2	NP_003957.2	1	2	3	2.028143	Q13591	SEM5A_HUMAN		10	1641	-			D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	1	1	hg19	c.976G>A	CCDS3875.1	0	.	.	.	.	.	.	.	.	.	.	C	19.89	3.910739	0.72983	0.0	1.16E-4	ENSG00000112902	ENST00000382496	T	0.22539	1.95	5.35	4.48	0.54585	5.35	4.48	0.54585	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.049884	0.85682	N	0.000000	T	0.34978	0.0916	L	0.43701	1.375	0.58432	D	0.999998	D	0.89917	1.0	D	0.73708	0.981	T	0.03017	-1.1082	10	0.34782	T	0.22	.	11.7948	0.52093	0.0:0.9145:0.0:0.0855	.	326	Q13591	SEM5A_HUMAN	T	326	ENSP00000371936:A326T	ENSP00000371936:A326T	A	-	1	0	0	SEMA5A	9250372	9250372	1.000000	0.71417	0.971000	0.41717	0.171000	0.22731	4.769000	0.62300	1.385000	0.46445	0.650000	0.86243	GCC	0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.597	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2	1	0	1		2	2	2	0		0	0	97		97	92	1	1.940000	-19.983910	1	0.380000				55	55		391	386	1		1			0	0	97	0		1.000000	0	0	0	0	0	0	55	391
GRM6	2916	broad.mit.edu	37	5	178413623	178413623	+	Silent	SNP	G	G	A	rs139758482	byFrequency	TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr5:178413623G>A	ENST00000517717.1	-	9	1670	c.1632C>T	c.(1630-1632)gaC>gaT	p.D544D	GRM6_ENST00000231188.5_Silent_p.D544D|RP11-281O15.4_ENST00000519491.1_RNA			O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6	544					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|detection of light stimulus involved in visual perception (GO:0050908)|detection of visible light (GO:0009584)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|locomotory behavior (GO:0007626)|positive regulation of calcium ion import (GO:0090280)|regulation of synaptic transmission, glutamatergic (GO:0051966)|retina development in camera-type eye (GO:0060041)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|new growing cell tip (GO:0035841)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|endometrium(9)|large_intestine(12)|lung(21)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	55	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		AGCGGTACCCGTCACAGGCCT	0.682													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17212	0.0		0.0	False		,,,				2504	0.0					ENST00000517717.1	0.320000	7.000000e-02	0.240000	0.120000	0.170000	0.184922	0.170000	0.160000																										0				55						c.(1630-1632)gaC>gaT		glutamate receptor, metabotropic 6		G		1,4405		0,1,2202	45.0	39.0	41.0		1632	-1.2	0.8	5	dbSNP_134	41	2,8592		0,2,4295	yes	coding-synonymous	GRM6	NM_000843.3		0,3,6497	AA,AG,GG		0.0233,0.0227,0.0231		544/878	178413623	3,12997	2203	4297	6500	SO:0001819	synonymous_variant	2916	41	121358	47				g.chr5:178413623G>A	U82083	CCDS4442.1	5q35	2014-01-28						"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4598	protein-coding gene	gene with protein product		604096				9215706	Standard	NM_000843		Approved	GPRC1F, mGlu6, MGLUR6, CSNB1B	uc003mjr.3	O15303	OTTHUMG00000130889	ENST00000517717.1:c.1632C>T	chr5.hg19:g.178413623G>A		0					RP11-281O15.4_ENST00000519491.1_RNA|GRM6_ENST00000231188.5_Silent_p.D544D	p.D544D			1	2	3	2.028143	O15303	GRM6_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	9	1670	-	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)		Silent	SNP	ENST00000517717.1	0	1	hg19	c.1632C>T	CCDS4442.1	0																																																																																								0.381176		TCGA-2J-AAB1-01A-11D-A40W-08	0.682	GRM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253474.2	0	0	1		18	2	2	1		1	1	44		44	43	1	1.940000	-9.201594	1	0.380000				8	8		245	242	0		0			1	0	44	0		0.031009	0	0	0	0	0	0	8	245
EEF1A1	1915	broad.mit.edu	37	6	74227973	74227973	+	Missense_Mutation	SNP	G	G	T	rs190893068		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			G	T	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr6:74227973G>T	ENST00000316292.9	-	6	2035	c.1044C>A	c.(1042-1044)aaC>aaA	p.N348K	EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000331523.2_Missense_Mutation_p.N348K|EEF1A1_ENST00000309268.6_Missense_Mutation_p.N348K	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	348					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						GGCCTGGATGGTTCAGGATAA	0.423																																						ENST00000316292.9	0.800000	4.100000e-01	0.700000	0.490000	0.590000	0.603762	0.590000	0.590000																										0				18						c.(1042-1044)aaC>aaA		eukaryotic translation elongation factor 1 alpha 1							45.0	49.0	47.0					6																	74227973		2199	4298	6497	SO:0001583	missense	1915	961	121368	47				g.chr6:74227973G>T	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.1044C>A	chr6.hg19:g.74227973G>T	ENSP00000339063:p.Asn348Lys	1					EEF1A1_ENST00000331523.2_Missense_Mutation_p.N348K|EEF1A1_ENST00000309268.6_Missense_Mutation_p.N348K|EEF1A1_ENST00000491404.1_Intron	p.N348K	NM_001402.5	NP_001393.1	0	1	1	1.673221	P68104	EF1A1_HUMAN		6	2035	-			P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	1	0	hg19	c.1044C>A	CCDS4980.1	0	.	.	.	.	.	.	.	.	.	.	G	13.71	2.319688	0.41096	.	.	ENSG00000156508	ENST00000316292;ENST00000358190;ENST00000309268;ENST00000331523;ENST00000391977	T;T;T	0.43688	0.94;0.94;0.94	4.71	3.84	0.44239	4.71	3.84	0.44239	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (2);Translation elongation factor EFTu/EF1A, C-terminal (2);	0.000000	0.85682	U	0.000000	T	0.52354	0.1729	H	0.98866	4.355	0.80722	D	1	B;B;B	0.26483	0.027;0.027;0.15	B;B;B	0.30316	0.074;0.074;0.114	T	0.65533	-0.6145	10	0.87932	D	0	.	13.2814	0.60216	0.0779:0.0:0.9221:0.0	.	348;348;348	P68104;Q6IPS9;Q5VTE0	EF1A1_HUMAN;.;EF1A3_HUMAN	K	348;346;348;348;327	ENSP00000339063:N348K;ENSP00000339053:N348K;ENSP00000330054:N348K	ENSP00000339053:N348K	N	-	3	2	2	EEF1A1	74284694	74284694	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.738000	0.55067	1.107000	0.41642	0.556000	0.70494	AAC	0.252111		TCGA-2J-AAB1-01A-11D-A40W-08	0.423	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	0	0	1		2	2	2	0		0	0	38		38	36	1	1.940000	-1.194063	0	0.380000	NM_001402			30	27		189	189	1		1	0		0	0	38	0		1.000000	1	0	0	0	3972	0	30	189
T	6862	broad.mit.edu	37	6	166574388	166574388	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr6:166574388C>A	ENST00000296946.2	-	8	1439	c.971G>T	c.(970-972)gGa>gTa	p.G324V	T_ENST00000366871.3_Missense_Mutation_p.G266V	NM_003181.3	NP_003172.1	O15178	BRAC_HUMAN	T, brachyury homolog (mouse)	324					anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|canonical Wnt signaling pathway (GO:0060070)|determination of heart left/right asymmetry (GO:0061371)|embryonic skeletal system development (GO:0048706)|heart morphogenesis (GO:0003007)|mesoderm development (GO:0007498)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord formation (GO:0014028)|penetration of zona pellucida (GO:0007341)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|signal transduction (GO:0007165)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		GGCAGGCATTCCAAGGCTGGA	0.522									Chordoma, Familial Clustering of																													ENST00000296946.2	0.220000	5.000000e-02	0.170000	0.080000	0.120000	0.133428	0.120000	0.120000																										0				39						c.(970-972)gGa>gTa		T, brachyury homolog (mouse)							171.0	150.0	157.0					6																	166574388		2203	4300	6503	SO:0001583	missense	6862	0	0		Chordoma, Familial Clustering of	Familial Cancer Database		g.chr6:166574388C>A	AJ001699	CCDS5290.1, CCDS59045.1	6q27	2011-06-13	2001-11-28		ENSG00000164458	ENSG00000164458		"""T-boxes"""	11515	protein-coding gene	gene with protein product		601397	"""T brachyury (mouse) homolog"""			8963900	Standard	NM_003181		Approved		uc003quu.2	O15178	OTTHUMG00000015991	ENST00000296946.2:c.971G>T	chr6.hg19:g.166574388C>A	ENSP00000296946:p.Gly324Val	1					T_ENST00000366871.3_Missense_Mutation_p.G266V	p.G324V	NM_003181.3	NP_003172.1	0	1	1	1.673221	O15178	BRAC_HUMAN		8	1439	-		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)	E7ERD6|Q4KMP4	Missense_Mutation	SNP	ENST00000296946.2	0	1	hg19	c.971G>T	CCDS5290.1	0	.	.	.	.	.	.	.	.	.	.	C	8.205	0.798999	0.16397	.	.	ENSG00000164458	ENST00000366876;ENST00000296946;ENST00000366871	D;D	0.83837	-1.75;-1.77	4.88	4.88	0.63580	4.88	4.88	0.63580	.	0.142303	0.47852	D	0.000214	T	0.72179	0.3428	M	0.64997	1.995	0.58432	D	0.999998	P;P;P	0.37914	0.611;0.57;0.565	B;B;B	0.38106	0.265;0.142;0.146	T	0.73341	-0.4013	10	0.33141	T	0.24	.	10.9779	0.47478	0.0:0.9145:0.0:0.0855	.	266;324;266	E7ERD6;O15178;Q4KMP4	.;BRAC_HUMAN;.	V	324;324;266	ENSP00000296946:G324V;ENSP00000355836:G266V	ENSP00000296946:G324V	G	-	2	0	0	T	166494378	166494378	0.999000	0.42202	0.077000	0.20336	0.013000	0.08279	3.928000	0.56506	2.409000	0.81822	0.655000	0.94253	GGA	0.252111		TCGA-2J-AAB1-01A-11D-A40W-08	0.522	T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043037.2	0	0	1		2	2	2	0		0	0	52		52	51	1	1.940000	-2.858768	1	0.380000	NM_003181			9	9		313	310	0		1			0	0	52	0		0.994142	0	0	0	0	0	0	9	313
KCND2	3751	broad.mit.edu	37	7	119914985	119914985	+	Missense_Mutation	SNP	G	G	A	rs377746178		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr7:119914985G>A	ENST00000331113.4	+	1	1264	c.299G>A	c.(298-300)cGc>cAc	p.R100H		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	100					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	AATTTCTACCGCACTGGGAAG	0.522																																						ENST00000331113.4	1.000000	6.000000e-02	0.160000	0.080000	0.110000	0.202197	0.110000	0.110000																										0				75						c.(298-300)cGc>cAc		potassium voltage-gated channel, Shal-related subfamily, member 2	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)						142.0	143.0	142.0					7																	119914985		2203	4300	6503	SO:0001583	missense	3751	0	0					g.chr7:119914985G>A	AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.299G>A	chr7.hg19:g.119914985G>A	ENSP00000333496:p.Arg100His	0						p.R100H	NM_012281.2	NP_036413.1	1	2	3	2.111304	Q9NZV8	KCND2_HUMAN		1	1264	+	all_neural(327;0.117)		O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	ENST00000331113.4	0	1	hg19	c.299G>A	CCDS5776.1	0	.	.	.	.	.	.	.	.	.	.	G	27.5	4.840334	0.91117	.	.	ENSG00000184408	ENST00000331113	T	0.55760	0.5	5.71	5.71	0.89125	5.71	5.71	0.89125	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	T	0.81669	0.4871	H	0.94808	3.585	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86200	0.1618	9	.	.	.	.	19.8677	0.96824	0.0:0.0:1.0:0.0	.	100	Q9NZV8	KCND2_HUMAN	H	100	ENSP00000333496:R100H	.	R	+	2	0	0	KCND2	119702221	119702221	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.062000	0.89475	2.709000	0.92574	0.655000	0.94253	CGC	0.393821		TCGA-2J-AAB1-01A-11D-A40W-08	0.522	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	0	0	1		2	2	2	0		0	0	177		177	172	1	1.940000	-2.188806	0	0.380000	NM_012281			19	20		899	878	0		1	0		0	0	177	0		0.999988	4.946053e-04	0	0	0	2	0	19	899
USP42	84132	broad.mit.edu	37	7	6185257	6185257	+	Silent	SNP	C	C	T			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr7:6185257C>T	ENST00000306177.5	+	10	1259	c.1101C>T	c.(1099-1101)tgC>tgT	p.C367C		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	367	USP.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		GTTTTAATTGCCATGCTGGCC	0.423																																						ENST00000306177.5	1.000000	4.000000e-02	0.280000	0.090000	0.160000	0.246221	0.160000	0.130000																										0				35						c.(1099-1101)tgC>tgT		ubiquitin specific peptidase 42							138.0	122.0	127.0					7																	6185257		1913	4121	6034	SO:0001819	synonymous_variant	84132	2	120832	31				g.chr7:6185257C>T	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.1101C>T	chr7.hg19:g.6185257C>T		0						p.C367C	NM_032172.2	NP_115548.1	1	2	3	2.111304	Q9H9J4	UBP42_HUMAN		10	1259	+		Ovarian(82;0.0423)	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Silent	SNP	ENST00000306177.5	0	1	hg19	c.1101C>T	CCDS47535.1	0																																																																																								0.393821		TCGA-2J-AAB1-01A-11D-A40W-08	0.423	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	0	0	1		2	2	2	0		0	0	37		37	36	1	1.940000	-3.500347	1	0.380000	XM_166526			4	4		155	150	0		1	0		0	0	37	0		0.882168	1.520467e-02	0	0	0	6	0	4	155
SSPO	23145	broad.mit.edu	37	7	149513539	149513539	+	RNA	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr7:149513539G>A	ENST00000378016.2	+	0	11160							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCCACGTCACGCAGCAGGTGG	0.692																																						ENST00000378016.2	1.000000	4.100000e-01	1.000000	0.600000	0.860000	0.824554	0.860000	1.000000																										0												SCO-spondin							10.0	15.0	13.0					7																	149513539		2025	4138	6163			23145	2	117776	20				g.chr7:149513539G>A	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149513539G>A		0									1	2	3	2.111304	A2VEC9	SSPO_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00625)	0	11160	+	Melanoma(164;0.165)|Ovarian(565;0.177)		Q76B61	RNA	SNP	ENST00000378016.2	0	1	hg19			1																																																																																								0.393821		TCGA-2J-AAB1-01A-11D-A40W-08	0.692	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript		0	0	1		2	2	2	0		0	0	17		17	17	1	1.940000	-15.999350	1	0.380000				8	8		45	43	0		1	0		0	0	17	0		0.989769	0	0	0	0	1	0	8	45
KIF24	347240	broad.mit.edu	37	9	34256356	34256356	+	Missense_Mutation	SNP	C	C	G			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr9:34256356C>G	ENST00000402558.2	-	10	3273	c.3249G>C	c.(3247-3249)gaG>gaC	p.E1083D	KIF24_ENST00000345050.2_Missense_Mutation_p.E949D|KIF24_ENST00000379166.2_Missense_Mutation_p.E1083D|KIF24_ENST00000379174.3_Missense_Mutation_p.E949D			Q5T7B8	KIF24_HUMAN	kinesin family member 24	1083					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			CCCCTGTGCTCTCTGCCACTA	0.602																																						ENST00000402558.2	0.530000	1.800000e-01	0.430000	0.250000	0.330000	0.348125	0.330000	0.320000																										0				32						c.(3247-3249)gaG>gaC		kinesin family member 24							46.0	39.0	41.0					9																	34256356		2203	4300	6503	SO:0001583	missense	347240	0	0					g.chr9:34256356C>G	AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.3249G>C	chr9.hg19:g.34256356C>G	ENSP00000384433:p.Glu1083Asp	1					KIF24_ENST00000345050.2_Missense_Mutation_p.E949D|KIF24_ENST00000379166.2_Missense_Mutation_p.E1083D|KIF24_ENST00000379174.3_Missense_Mutation_p.E949D	p.E1083D			0	2	2	2.027475	Q5T7B8	KIF24_HUMAN	LUSC - Lung squamous cell carcinoma(29;0.0107)	10	3273	-			Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	ENST00000402558.2	1	1	hg19	c.3249G>C	CCDS6551.2	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.10|12.10	1.837588|1.837588	0.32513|0.32513	.|.	.|.	ENSG00000186638|ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050;ENST00000420188|ENST00000443226	T;T;T;T|.	0.73152|.	-0.5;-0.72;-0.5;-0.72|.	4.71|4.71	-2.5|-2.5	0.06384|0.06384	4.71|4.71	-2.5|-2.5	0.06384|0.06384	.|.	0.770342|0.770342	0.11063|0.11063	N|N	0.603757|0.603757	T|T	0.30135|0.30135	0.0755|0.0755	L|L	0.39898|0.39898	1.24|1.24	0.09310|0.09310	N|N	1|1	B|.	0.06786|.	0.001|.	B|.	0.06405|.	0.002|.	T|T	0.34527|0.34527	-0.9825|-0.9825	10|7	0.40728|0.20046	T|T	0.16|0.44	.|.	6.1763|6.1763	0.20444|0.20444	0.123:0.3985:0.0:0.4785|0.123:0.3985:0.0:0.4785	.|.	1083|.	Q5T7B8|.	KIF24_HUMAN|.	D|Q	1083;949;1083;949;1083|129	ENSP00000384433:E1083D;ENSP00000368472:E949D;ENSP00000368464:E1083D;ENSP00000340179:E949D|.	ENSP00000340179:E949D|ENSP00000414628:E129Q	E|E	-|-	3|1	2|0	2|0	KIF24|KIF24	34246356|34246356	34246356|34246356	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.120000|0.120000	0.20174|0.20174	-0.917000|-0.917000	0.04025|0.04025	-0.108000|-0.108000	0.12066|0.12066	0.563000|0.563000	0.77884|0.77884	GAG|GAG	0.380000		TCGA-2J-AAB1-01A-11D-A40W-08	0.602	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052150.5	1	0	1		2	2	2	0		0	0	45		45	45	1	1.940000	-16.899190	1	0.380000				13	13		195	193	0		1	0		0	0	45	0		0.999558	4.739336e-03	0	0	0	2	0	13	195
EPB41L4B	54566	broad.mit.edu	37	9	111970268	111970268	+	Missense_Mutation	SNP	G	G	A	rs201598200		TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chr9:111970268G>A	ENST00000374566.3	-	18	2331	c.1814C>T	c.(1813-1815)gCg>gTg	p.A605V		NM_019114.3	NP_061987.3	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	605					actomyosin structure organization (GO:0031032)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)	structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CACATGATCCGCAACAGGGGA	0.423													G|||	1	0.000199681	0.0	0.0	5008	,	,		19497	0.0		0.0	False		,,,				2504	0.001					ENST00000374566.3	0.110000	1.000000e-02	0.080000	0.020000	0.040000	0.057708	0.040000	0.050000																										0				39						c.(1813-1815)gCg>gTg		erythrocyte membrane protein band 4.1 like 4B		G	VAL/ALA	0,3688		0,0,1844	130.0	118.0	121.0		1814	5.5	0.1	9		121	4,8220		0,4,4108	yes	missense	EPB41L4B	NM_019114.3	64	0,4,5952	AA,AG,GG		0.0486,0.0,0.0336	benign	605/901	111970268	4,11908	1844	4112	5956	SO:0001583	missense	54566	18	120806	46				g.chr9:111970268G>A	AB032179	CCDS43859.1, CCDS43860.1	9q22.1-q22.3	2008-02-05			ENSG00000095203	ENSG00000095203			19818	protein-coding gene	gene with protein product		610340				10783258	Standard	NM_018424		Approved	EHM2	uc004bdz.1	Q9H329	OTTHUMG00000020470	ENST00000374566.3:c.1814C>T	chr9.hg19:g.111970268G>A	ENSP00000363694:p.Ala605Val	0						p.A605V	NM_019114.3	NP_061987.3	0	0	0	2.014026	Q9H329	E41LB_HUMAN		18	2331	-			Q5T4G5|Q5T4G6|Q9H328|Q9P2V3	Missense_Mutation	SNP	ENST00000374566.3	0	1	hg19	c.1814C>T	CCDS43859.1	0	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711206	0.48517	0.0	4.86E-4	ENSG00000095203	ENST00000262536;ENST00000374566	D	0.84516	-1.86	5.49	5.49	0.81192	5.49	5.49	0.81192	.	0.000000	0.39834	N	0.001248	T	0.78130	0.4235	N	0.22421	0.69	0.80722	D	1	B	0.22541	0.071	B	0.12156	0.007	T	0.75255	-0.3382	10	0.87932	D	0	.	16.9032	0.86118	0.0:0.0:1.0:0.0	.	605	Q9H329	E41LB_HUMAN	V	290;605	ENSP00000363694:A605V	ENSP00000262536:A290V	A	-	2	0	0	EPB41L4B	111010089	111010089	0.984000	0.35163	0.130000	0.21974	0.350000	0.29205	4.611000	0.61162	2.583000	0.87209	0.561000	0.74099	GCG	0.377635		TCGA-2J-AAB1-01A-11D-A40W-08	0.423	EPB41L4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053592.1	0	0	1		2	2	2	0		0	0	89		89	89	1	1.940000	-1.952813	0	0.380000	NM_018424			5	5		536	530	0		1			0	0	89	0		0.935959	0	0	0	0	0	0	5	536
BMX	660	broad.mit.edu	37	X	15526493	15526493	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chrX:15526493T>C	ENST00000357607.2	+	2	205	c.17T>C	c.(16-18)aTt>aCt	p.I6T	BMX_ENST00000342014.6_Missense_Mutation_p.I6T|BMX_ENST00000348343.6_Missense_Mutation_p.I6T|BMX_ENST00000463891.1_Intron			P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	6	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)|signal transduction (GO:0007165)	cytosol (GO:0005829)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(14)|ovary(2)|urinary_tract(3)	30	Hepatocellular(33;0.183)					ACAAAATCTATTCTAGAAGAA	0.294																																						ENST00000357607.2	0.130000	2.000000e-02	0.100000	0.040000	0.060000	0.074981	0.060000	0.070000																										0				30						c.(16-18)aTt>aCt		BMX non-receptor tyrosine kinase							30.0	31.0	31.0					X																	15526493		2199	4278	6477	SO:0001583	missense	660	0	0					g.chrX:15526493T>C	AF045459	CCDS14168.1	Xp22.2	2013-05-14			ENSG00000102010	ENSG00000102010		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1079	protein-coding gene	gene with protein product	"""BTK-like on X chromosome"""	300101				7970727	Standard	NM_203281		Approved	ETK, PSCTK3	uc004cwx.4	P51813	OTTHUMG00000021180	ENST00000357607.2:c.17T>C	chrX.hg19:g.15526493T>C	ENSP00000350224:p.Ile6Thr						BMX_ENST00000463891.1_Intron|BMX_ENST00000342014.6_Missense_Mutation_p.I6T|BMX_ENST00000348343.6_Missense_Mutation_p.I6T	p.I6T			0	1	1		P51813	BMX_HUMAN		2	205	+	Hepatocellular(33;0.183)		A6NIH9|O60564|Q12871	Missense_Mutation	SNP	ENST00000357607.2	0	1	hg19	c.17T>C	CCDS14168.1	0	.	.	.	.	.	.	.	.	.	.	T	18.97	3.735041	0.69189	.	.	ENSG00000102010	ENST00000357607;ENST00000348343;ENST00000342014	D;D;D	0.94232	-3.38;-3.38;-3.38	5.67	5.67	0.87782	5.67	5.67	0.87782	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.097450	0.44483	D	0.000449	D	0.95169	0.8434	M	0.79926	2.475	0.37061	D	0.89808	P	0.50819	0.939	P	0.53988	0.739	D	0.96917	0.9671	10	0.87932	D	0	.	11.1504	0.48455	0.0:0.0:0.0:1.0	.	6	P51813	BMX_HUMAN	T	6	ENSP00000350224:I6T;ENSP00000308774:I6T;ENSP00000340082:I6T	ENSP00000340082:I6T	I	+	2	0	0	BMX	15436414	15436414	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	5.182000	0.65059	1.904000	0.55121	0.486000	0.48141	ATT	0.380000		TCGA-2J-AAB1-01A-11D-A40W-08	0.294	BMX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055877.1	0	0	1		2	2	2	0		0	0	38		38	38	1	1.940000	-7.588117	1	0.380000	NM_001721			6	6		236	230	0		1	0		0	0	38	0		0.962730	1.741371e-02	0	0	0	7	0	6	236
OGT	8473	broad.mit.edu	37	X	70757810	70757810	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chrX:70757810G>A	ENST00000373719.3	+	3	567	c.350G>A	c.(349-351)cGt>cAt	p.R117H	OGT_ENST00000373701.3_Missense_Mutation_p.R107H|OGT_ENST00000498566.1_3'UTR	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	117					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)	p.R117H(1)|p.R107H(1)		breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					CATGCATTGCGTCTCAAACCT	0.493																																						ENST00000373719.3	1.000000	8.400000e-01	0.990000	0.900000	0.950000	0.952522	0.950000	0.990000																										2	Substitution - Missense(2)	p.R117H(1)|p.R107H(1)	breast(2)	43						c.(349-351)cGt>cAt		O-linked N-acetylglucosamine (GlcNAc) transferase							160.0	128.0	139.0					X																	70757810		2203	4300	6503	SO:0001583	missense	8473	0	0					g.chrX:70757810G>A	U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.350G>A	chrX.hg19:g.70757810G>A	ENSP00000362824:p.Arg117His						OGT_ENST00000373701.3_Missense_Mutation_p.R107H|OGT_ENST00000498566.1_3'UTR	p.R117H	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	0	1	1		O15294	OGT1_HUMAN		3	567	+	Renal(35;0.156)		Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Missense_Mutation	SNP	ENST00000373719.3	1	1	hg19	c.350G>A	CCDS14414.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	20.1|20.1	3.937205|3.937205	0.73557|0.73557	.|.	.|.	ENSG00000147162|ENSG00000147162	ENST00000373719;ENST00000373701;ENST00000444774|ENST00000455587	T;T;T|.	0.60920|.	0.15;0.15;0.15|.	4.86|4.86	4.86|4.86	0.63082|0.63082	4.86|4.86	4.86|4.86	0.63082|0.63082	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);|.	0.105470|.	0.64402|.	D|.	0.000011|.	T|T	0.73297|0.73297	0.3569|0.3569	M|M	0.66560|0.66560	2.04|2.04	0.80722|0.80722	D|D	1|1	D;D;B|.	0.71674|.	0.998;0.997;0.369|.	D;P;B|.	0.64042|.	0.921;0.832;0.045|.	T|T	0.73275|0.73275	-0.4034|-0.4034	10|5	0.46703|.	T|.	0.11|.	-19.0221|-19.0221	17.2684|17.2684	0.87093|0.87093	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	117;107;117|.	B4DTL6;O15294-3;O15294|.	.;.;OGT1_HUMAN|.	H|I	117;107;100|77	ENSP00000362824:R117H;ENSP00000362805:R107H;ENSP00000399729:R100H|.	ENSP00000362805:R107H|.	R|V	+|+	2|1	0|0	0|0	OGT|OGT	70674535|70674535	70674535|70674535	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.502000|9.502000	0.97981|0.97981	2.259000|2.259000	0.74868|0.74868	0.525000|0.525000	0.51046|0.51046	CGT|GTC	0.380000		TCGA-2J-AAB1-01A-11D-A40W-08	0.493	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000081829.3	1	0	1		2	2	2	0		0	0	30		30	29	1	1.940000	-20.000000	1	0.380000	NM_003605, NM_181672			75	74		106	105	1		1	1		0	0	30	0		1.000000	9.999572e-01	0	11	0	15	0	75	106
CUL4B	8450	broad.mit.edu	37	X	119674244	119674244	+	Missense_Mutation	SNP	A	A	C			TCGA-2J-AAB1-01A-11D-A40W-08	TCGA-2J-AAB1-10A-01D-A40W-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	3654586b-e1d2-42e7-8560-b339bd5e3488	8a1fecb6-04f4-413a-bed8-63fce4ac7072	g.chrX:119674244A>C	ENST00000404115.3	-	13	2072	c.1671T>G	c.(1669-1671)aaT>aaG	p.N557K	CUL4B_ENST00000336592.6_Missense_Mutation_p.N544K|CUL4B_ENST00000371322.5_Missense_Mutation_p.N539K	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	557					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CAGCTGGTTTATTTGGTCTTT	0.308																																						ENST00000404115.3	0.990000	6.600000e-01	0.940000	0.750000	0.850000	0.853511	0.850000	0.870000																										0				36						c.(1669-1671)aaT>aaG		cullin 4B							144.0	131.0	135.0					X																	119674244		2202	4298	6500	SO:0001583	missense	8450	0	0					g.chrX:119674244A>C	U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.1671T>G	chrX.hg19:g.119674244A>C	ENSP00000384109:p.Asn557Lys						CUL4B_ENST00000336592.6_Missense_Mutation_p.N544K|CUL4B_ENST00000371322.5_Missense_Mutation_p.N539K	p.N557K	NM_003588.3	NP_003579.3	0	1	1		Q13620	CUL4B_HUMAN		13	2072	-			B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Missense_Mutation	SNP	ENST00000404115.3	1	1	hg19	c.1671T>G	CCDS35379.1	1	.	.	.	.	.	.	.	.	.	.	A	11.67	1.707788	0.30322	.	.	ENSG00000158290	ENST00000371322;ENST00000336592;ENST00000404115	T;T;T	0.73363	-0.74;-0.74;-0.74	5.6	2.54	0.30619	5.6	2.54	0.30619	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);Cullin homology (1);	0.000000	0.85682	D	0.000000	D	0.84088	0.5395	M	0.83118	2.625	0.58432	D	0.999999	P;D;D	0.89917	0.535;1.0;1.0	B;D;D	0.83275	0.398;0.996;0.993	T	0.82067	-0.0641	9	.	.	.	-17.2501	7.9584	0.30057	0.5235:0.0:0.4765:0.0	.	361;557;539	Q13620-3;Q13620;Q13620-1	.;CUL4B_HUMAN;.	K	539;544;557	ENSP00000360373:N539K;ENSP00000338919:N544K;ENSP00000384109:N557K	.	N	-	3	2	2	CUL4B	119558272	119558272	1.000000	0.71417	1.000000	0.80357	0.233000	0.25261	1.401000	0.34589	0.413000	0.25759	-0.509000	0.04479	AAT	0.380000		TCGA-2J-AAB1-01A-11D-A40W-08	0.308	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058103.1	1	0	1		2	2	2	0		0	0	14		14	14	1	1.940000	-20.000000	1	0.380000	NM_003588			44	44		87	86	1		1	1		0	0	14	0		1.000000	9.999798e-01	0	23	0	15	0	44	87
