#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
GANAB	23193	broad.mit.edu	37	11	62398507	62398512	+	In_Frame_Del	DEL	AGACTA	AGACTA	-			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08			AGACTA	-	AGACTA	AGACTA		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr11:62398507_62398512delAGACTA	ENST00000356638.3	-	10	1156_1161	c.1140_1145delTAGTCT	c.(1138-1146)gctagtctc>gcc	p.SL381del	GANAB_ENST00000534779.1_In_Frame_Del_p.SL289del|GANAB_ENST00000346178.4_In_Frame_Del_p.SL403del|GANAB_ENST00000534422.1_5'Flank|GANAB_ENST00000540933.1_In_Frame_Del_p.SL284del	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	381					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	TGTACCTGTGAGACTAGCATATTGCC	0.495																																					Melanoma(23;1005 1074 15747 18937)	ENST00000356638.3	0.820000	5.200000e-01	7.400000e-01	5.900000e-01	0.660000	0.670947	0.660000	0.660000																										0				35						c.(1138-1146)gctagtctc>gcc		glucosidase, alpha; neutral AB	Miglitol(DB00491)																																			SO:0001651	inframe_deletion	23193	0	0					g.chr11:62398507_62398512delAGACTA	AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.1140_1145delTAGTCT	chr11.hg19:g.62398507_62398512delAGACTA	ENSP00000349053:p.Ser381_Leu382del	0					GANAB_ENST00000534779.1_In_Frame_Del_p.SL289del|GANAB_ENST00000534422.1_5'Flank|GANAB_ENST00000346178.4_In_Frame_Del_p.SL403del|GANAB_ENST00000540933.1_In_Frame_Del_p.SL284del	p.SL381del	NM_198334.1	NP_938148.1	1	2	3	2.015408	Q14697	GANAB_HUMAN		10	1156_1161	-			A6NC20|Q8WTS9|Q9P0X0	In_Frame_Del	DEL	ENST00000356638.3	1	1	hg19	c.1140_1145delTAGTCT	CCDS8026.1	0																																																																																								0.301048		TCGA-2J-AAB4-01A-12D-A40W-08	0.495	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395689.1	1	0	1		2	2		0		0	0	174		174	170	1	1.950000	-19.981250	1	0.300000	NM_198334			74	93		668	679	0		1	1		0	0	174	0		1.000000	1		5	0	321	0	74	668
SMAD4	4089	broad.mit.edu	37	18	48584504	48584504	+	Frame_Shift_Del	DEL	C	C	-	rs539739051		TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08			C	-	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr18:48584504delC	ENST00000342988.3	+	6	1215	c.677delC	c.(676-678)gccfs	p.A226fs	SMAD4_ENST00000398417.2_Frame_Shift_Del_p.A226fs|SMAD4_ENST00000588745.1_Intron|RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000452201.2_3'UTR	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	226					atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GGTCAGCCTGCCAGTATACTG	0.438																																						ENST00000342988.3	0.950000	5.100000e-01	8.600000e-01	6.100000e-01	0.730000	0.739496	0.730000	0.730000																										38	Whole gene deletion(36)|Unknown(2)	p.0?(36)|p.?(2)	pancreas(26)|stomach(3)|breast(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	454						c.(676-678)gccfs		SMAD family member 4							65.0	60.0	62.0					18																	48584504		2203	4300	6503	SO:0001589	frameshift_variant	4089	0	0					g.chr18:48584504delC	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.677delC	chr18.hg19:g.48584504delC	ENSP00000341551:p.Ala226fs	1					SMAD4_ENST00000452201.2_3'UTR|SMAD4_ENST00000588745.1_Intron|RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000398417.2_Frame_Shift_Del_p.A226fs	p.A226fs	NM_005359.5	NP_005350.1	0	1	1	1.716786	Q13485	SMAD4_HUMAN		6	1215	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Frame_Shift_Del	DEL	ENST00000342988.3	1	1	hg19	c.677delC	CCDS11950.1	0																																																																																								0.176471		TCGA-2J-AAB4-01A-12D-A40W-08	0.438	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1		2	2	2	0		0	0	52		52	51	1	1.950000	-14.496740	1	0.300000	NM_005359			30	32		198	189	0		1	0	1	0	0	52	358		1.000000	9.583934e-01	1	0	37	37	232	30	198
TMF1	7110	broad.mit.edu	37	3	69082709	69082710	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr3:69082709_69082710delAG	ENST00000398559.2	-	10	2606_2607	c.2390_2391delCT	c.(2389-2391)tctfs	p.S797fs	CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000596274.1_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|TMF1_ENST00000543976.1_Frame_Shift_Del_p.S800fs|CTD-2013N24.2_ENST00000597366.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000599467.1_RNA|CTD-2013N24.2_ENST00000601511.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	797					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		CAAGCCTATCAGAAAGATTCTT	0.366																																						ENST00000398559.2	0.760000	4.000000e-01	6.700000e-01	4.700000e-01	0.560000	0.576713	0.560000	0.570000																										0				22						c.(2389-2391)tctfs		TATA element modulatory factor 1																																				SO:0001589	frameshift_variant	7110	0	0					g.chr3:69082709_69082710delAG		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.2390_2391delCT	chr3.hg19:g.69082709_69082710delAG	ENSP00000381567:p.Ser797fs	0					TMF1_ENST00000543976.1_Frame_Shift_Del_p.S800fs|CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000596274.1_RNA|CTD-2013N24.2_ENST00000601511.1_RNA|CTD-2013N24.2_ENST00000599467.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000597366.1_RNA|CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA	p.S797fs			0	1	1	2.008791	P82094	TMF1_HUMAN		10	2606_2607	-		Lung NSC(201;0.0193)|Prostate(884;0.174)	B7ZLJ2|Q17R87|Q59GK0	Frame_Shift_Del	DEL	ENST00000398559.2	1	1	hg19	c.2390_2391delCT	CCDS43105.1	0																																																																																								0.297894		TCGA-2J-AAB4-01A-12D-A40W-08	0.366	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	1	0	1		2	2		0		0	0	111		111	110	1	1.950000	-2.716734	1	0.300000	NM_007114			34	38		365	365	0		1	0		0	0	111	0		1.000000	9.524761e-01		0	0	56	0	34	365
SEC61B	10952	broad.mit.edu	37	9	101992661	101992668	+	Frame_Shift_Del	DEL	TTCTGTAT	TTCTGTAT	-	rs1804433		TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08			TTCTGTAT	-	TTCTGTAT	TTCTGTAT		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr9:101992661_101992668delTTCTGTAT	ENST00000223641.4	+	4	309_316	c.246_253delTTCTGTAT	c.(244-255)gcttctgtatttfs	p.SVF83fs	SEC61B_ENST00000498603.1_Frame_Shift_Del_p.SVF29fs	NM_006808.2	NP_006799.1	P60468	SC61B_HUMAN	Sec61 beta subunit	83					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|gene expression (GO:0010467)|protein import into nucleus, translocation (GO:0000060)|retrograde protein transport, ER to cytosol (GO:0030970)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum Sec complex (GO:0031205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	epidermal growth factor binding (GO:0048408)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)			kidney(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(62;0.0559)				TGTTCATCGCTTCTGTATTTATGTTGCA	0.38																																						ENST00000223641.4	0.440000	2.400000e-01	3.900000e-01	2.800000e-01	0.330000	0.342323	0.330000	0.330000																										0				2						c.(244-255)gcttctgtatttfs		Sec61 beta subunit																																				SO:0001589	frameshift_variant	10952	0	0					g.chr9:101992661_101992668delTTCTGTAT	L25085	CCDS6741.1	9q22.32-q31.3	2009-03-19			ENSG00000106803	ENSG00000106803			16993	protein-coding gene	gene with protein product		609214				8107851, 10212142	Standard	NM_006808		Approved		uc004azh.3	P60468	OTTHUMG00000020354	ENST00000223641.4:c.246_253delTTCTGTAT	chr9.hg19:g.101992661_101992668delTTCTGTAT	ENSP00000223641:p.Ser83fs	0					SEC61B_ENST00000498603.1_Frame_Shift_Del_p.SVF29fs	p.SVF83fs	NM_006808.2	NP_006799.1	0	0	0	2.001353	P60468	SC61B_HUMAN		4	309_316	+		Acute lymphoblastic leukemia(62;0.0559)	P38390|P38391|Q6IBC1	Frame_Shift_Del	DEL	ENST00000223641.4	1	1	hg19	c.246_253delTTCTGTAT	CCDS6741.1	0																																																																																								0.295775		TCGA-2J-AAB4-01A-12D-A40W-08	0.380	SEC61B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053391.1	1	0	1		34	2		0		0	4	186		186	190	1	1.950000	-6.000279	1	0.300000	NM_006808			42	81		786	813	0		1	1		0	0	186	0		0.918239	1		7	0	699	0	42	786
RASGEF1A	221002	broad.mit.edu	37	10	43697262	43697262	+	Silent	SNP	A	A	G			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr10:43697262A>G	ENST00000395809.1	-	4	2959	c.453T>C	c.(451-453)tgT>tgC	p.C151C	RASGEF1A_ENST00000472864.1_5'UTR|RASGEF1A_ENST00000395810.1_Silent_p.C151C|RASGEF1A_ENST00000374459.1_Silent_p.C159C			Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A	151	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				cell migration (GO:0016477)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)	11						TCACCTCATCACACTGGGTGA	0.617																																						ENST00000395809.1	1.000000	4.400000e-01	1	6.000000e-01	0.790000	0.793284	0.790000	1.000000																										0				11						c.(451-453)tgT>tgC		RasGEF domain family, member 1A							69.0	58.0	62.0					10																	43697262		2203	4300	6503	SO:0001819	synonymous_variant	221002	0	0					g.chr10:43697262A>G	AK095136	CCDS7202.2, CCDS60517.1	10q11.21	2006-01-11			ENSG00000198915	ENSG00000198915			24246	protein-coding gene	gene with protein product		614531				12477932	Standard	XM_005271808		Approved	CG4853, FLJ37817	uc001jap.1	Q8N9B8	OTTHUMG00000018025	ENST00000395809.1:c.453T>C	chr10.hg19:g.43697262A>G		0					RASGEF1A_ENST00000374459.1_Silent_p.C159C|RASGEF1A_ENST00000395810.1_Silent_p.C151C|RASGEF1A_ENST00000472864.1_5'UTR	p.C151C			0	1	1	2.007126	Q8N9B8	RGF1A_HUMAN		4	2959	-			Q8TBF1	Silent	SNP	ENST00000395809.1	0	1	hg19	c.453T>C	CCDS7202.2	0	.	.	.	.	.	.	.	.	.	.	A	2.707	-0.269595	0.05716	.	.	ENSG00000198915	ENST00000374455	.	.	.	5.5	-2.64	0.06114	5.5	-2.64	0.06114	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2198	0.59881	0.6996:0.0:0.3004:0.0	.	.	.	.	R	53	.	.	X	-	1	0	0	RASGEF1A	43017268	43017268	0.139000	0.22563	0.434000	0.26772	0.171000	0.22731	-0.404000	0.07205	-0.801000	0.04427	-1.215000	0.01618	TGA	0.297894		TCGA-2J-AAB4-01A-12D-A40W-08	0.617	RASGEF1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313989.1	1	0	1		2	2	2	0		0	0	21		21	21	1	1.950000	-19.471930	1	0.300000	NM_145313			12	11		89	88	1		1	1		0	0	21	0		0.999223	5.296683e-01	0	3	0	11	0	12	89
CXCL12	6387	broad.mit.edu	37	10	44876321	44876321	+	Silent	SNP	G	G	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr10:44876321G>A	ENST00000374429.2	-	2	155	c.69C>T	c.(67-69)ccC>ccT	p.P23P	CXCL12_ENST00000343575.6_Silent_p.P23P|CXCL12_ENST00000395794.2_Silent_p.P23P|CXCL12_ENST00000496375.1_5'UTR|CXCL12_ENST00000374426.2_Silent_p.P23P|CXCL12_ENST00000395795.4_Silent_p.P23P|CXCL12_ENST00000395793.3_Silent_p.P23P|AL137026.1_ENST00000593376.1_Intron	NM_000609.5|NM_001277990.1	NP_000600.1|NP_001264919.1	P48061	SDF1_HUMAN	chemokine (C-X-C motif) ligand 12	23					adult locomotory behavior (GO:0008344)|ameboidal cell migration (GO:0001667)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cellular calcium ion homeostasis (GO:0006874)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|motor neuron axon guidance (GO:0008045)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of leukocyte tethering or rolling (GO:1903237)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|patterning of blood vessels (GO:0001569)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell adhesion (GO:0045785)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of T cell migration (GO:2000406)|regulation of actin polymerization or depolymerization (GO:0008064)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to peptide hormone (GO:0043434)|response to radiation (GO:0009314)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)|telencephalon cell migration (GO:0022029)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	chemokine activity (GO:0008009)|chemokine receptor binding (GO:0042379)|CXCR chemokine receptor binding (GO:0045236)|receptor binding (GO:0005102)	p.P23P(3)		endometrium(1)|large_intestine(1)|lung(3)|skin(1)	6					Tinzaparin(DB06822)	TCAGGCTGACGGGCTTCCCTA	0.507																																						ENST00000374429.2	1.000000	7.500000e-01	1	8.300000e-01	0.920000	0.918657	0.920000	1.000000																										3	Substitution - coding silent(3)	p.P23P(3)	lung(3)	6						c.(67-69)ccC>ccT		chemokine (C-X-C motif) ligand 12	Tinzaparin(DB06822)						197.0	185.0	189.0					10																	44876321		2203	4300	6503	SO:0001819	synonymous_variant	6387	7	121412	42				g.chr10:44876321G>A	L36033	CCDS7207.1, CCDS31186.1, CCDS44373.1, CCDS53527.1, CCDS60518.1	10q11.1	2013-02-28	2010-05-11	2002-08-23	ENSG00000107562	ENSG00000107562		"""Endogenous ligands"""	10672	protein-coding gene	gene with protein product		600835	"""stromal cell-derived factor 1"""	SDF1A, SDF1B, SDF1		7490086	Standard	NM_001033886		Approved	SCYB12, SDF-1a, SDF-1b, PBSF, TLSF-a, TLSF-b, TPAR1	uc021ppm.1	P48061	OTTHUMG00000018054	ENST00000374429.2:c.69C>T	chr10.hg19:g.44876321G>A		0					CXCL12_ENST00000496375.1_5'UTR|CXCL12_ENST00000395795.4_Silent_p.P23P|CXCL12_ENST00000343575.6_Silent_p.P23P|AL137026.1_ENST00000593376.1_Intron|CXCL12_ENST00000374426.2_Silent_p.P23P|CXCL12_ENST00000395794.2_Silent_p.P23P|CXCL12_ENST00000395793.3_Silent_p.P23P	p.P23P	NM_000609.5|NM_001277990.1	NP_000600.1|NP_001264919.1	0	1	1	2.007126	P48061	SDF1_HUMAN		2	155	-			B2R4G0|E7EVL0|H7BYN8|Q2L985|Q2L986|Q2L988|Q5IT36|Q6ICW0|Q9H554	Silent	SNP	ENST00000374429.2	1	1	hg19	c.69C>T	CCDS44373.1	1																																																																																								0.297894		TCGA-2J-AAB4-01A-12D-A40W-08	0.507	CXCL12-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047738.2	1	0	1		2	2	2	0		0	0	163		163	160	1	1.950000	-2.744775	1	0.300000	NM_000609			92	91		568	558	1		1	0		0	0	163	0		1.000000	7.376464e-01	0	0	0	18	0	92	568
MARCH5	54708	broad.mit.edu	37	10	94109589	94109589	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr10:94109589A>G	ENST00000358935.2	+	5	1047	c.715A>G	c.(715-717)Atc>Gtc	p.I239V		NM_017824.4	NP_060294.1	Q9NX47	MARH5_HUMAN	membrane-associated ring finger (C3HC4) 5	239					negative regulation of cell aging (GO:0090344)|positive regulation of mitochondrial fission (GO:0090141)|protein autoubiquitination (GO:0051865)|protein localization to mitochondrion (GO:0070585)|protein polyubiquitination (GO:0000209)|regulation of mitochondrial fission (GO:0090140)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	GTPase binding (GO:0051020)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						ACAAAGGACAATCTTGGTAAG	0.348																																						ENST00000358935.2	1.000000	6.500000e-01	1	7.500000e-01	0.870000	0.871807	0.870000	1.000000																										0				9						c.(715-717)Atc>Gtc		membrane-associated ring finger (C3HC4) 5							105.0	101.0	102.0					10																	94109589		2203	4300	6503	SO:0001583	missense	54708	2	121412	35				g.chr10:94109589A>G	BC015480	CCDS7420.1	10q23.32-q23.33	2013-01-09	2005-01-26	2005-01-27	ENSG00000198060	ENSG00000198060		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26025	protein-coding gene	gene with protein product		610637	"""ring finger protein 153"""	RNF153		14722266	Standard	XM_005269923		Approved	FLJ20445, MARCH-V	uc001khx.1	Q9NX47	OTTHUMG00000018757	ENST00000358935.2:c.715A>G	chr10.hg19:g.94109589A>G	ENSP00000351813:p.Ile239Val	0						p.I239V	NM_017824.4	NP_060294.1	1	2	3	2.031374	Q9NX47	MARH5_HUMAN		5	1047	+				Missense_Mutation	SNP	ENST00000358935.2	1	1	hg19	c.715A>G	CCDS7420.1	1	.	.	.	.	.	.	.	.	.	.	A	16.49	3.139263	0.56936	.	.	ENSG00000198060	ENST00000358935	T	0.46819	0.86	5.91	5.91	0.95273	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.36853	0.0982	N	0.25380	0.74	0.80722	D	1	B	0.21606	0.058	B	0.15484	0.013	T	0.10917	-1.0609	10	0.27785	T	0.31	-6.4219	16.3512	0.83208	1.0:0.0:0.0:0.0	.	239	Q9NX47	MARH5_HUMAN	V	239	ENSP00000351813:I239V	ENSP00000351813:I239V	I	+	1	0	0	MARCH5	94099569	94099569	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.102000	0.94226	2.266000	0.75297	0.533000	0.62120	ATC	0.304175		TCGA-2J-AAB4-01A-12D-A40W-08	0.348	MARCH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049388.1	0	0	1		2	2	2	0		0	0	136		136	136	1	1.950000	-20.000000	1	0.300000	NM_017824			48	48		322	319	1		1	1		0	0	136	0		1.000000	9.999970e-01	0	35	0	93	0	48	322
ADAMTS15	170689	broad.mit.edu	37	11	130343247	130343247	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr11:130343247G>A	ENST00000299164.2	+	8	2384	c.2384G>A	c.(2383-2385)cGc>cAc	p.R795H		NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15	795	Spacer.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		CCCCGGGTCCGCTACTCCTTC	0.657																																						ENST00000299164.2	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				36						c.(2383-2385)cGc>cAc		ADAM metallopeptidase with thrombospondin type 1 motif, 15							86.0	98.0	94.0					11																	130343247		2201	4297	6498	SO:0001583	missense	170689	2	121380	36				g.chr11:130343247G>A	AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.2384G>A	chr11.hg19:g.130343247G>A	ENSP00000299164:p.Arg795His	1						p.R795H	NM_139055.2	NP_620686.1	1	2	3	2.315870	Q8TE58	ATS15_HUMAN		8	2384	+	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)	Q32MI6	Missense_Mutation	SNP	ENST00000299164.2	1	1	hg19	c.2384G>A	CCDS8488.1	1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.964311	0.92791	.	.	ENSG00000166106	ENST00000299164	T	0.52526	0.66	5.91	4.99	0.66335	5.91	4.99	0.66335	ADAM-TS Spacer 1 (1);	.	.	.	.	T	0.58177	0.2104	L	0.38692	1.165	0.80722	D	1	D	0.89917	1.0	D	0.70016	0.967	T	0.55366	-0.8152	9	0.30854	T	0.27	.	16.5512	0.84473	0.0:0.0:0.8684:0.1316	.	795	Q8TE58	ATS15_HUMAN	H	795	ENSP00000299164:R795H	ENSP00000299164:R795H	R	+	2	0	0	ADAMTS15	129848457	129848457	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	6.428000	0.73383	1.498000	0.48600	0.655000	0.94253	CGC	0.384886		TCGA-2J-AAB4-01A-12D-A40W-08	0.657	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385638.1	0	0	1		21	2	2	1		1	1	146		146	144	1	1.950000	-20.000000	1	0.300000	NM_139055			218	215		693	673	1		1	1		1	0	146	0		1.000000	5.773642e-02	0	2	0	0	0	218	693
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	4.200000e-01	1	5.500000e-01	0.720000	0.752612	0.720000	0.650000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	0	2	2	1.894994	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.300000		TCGA-2J-AAB4-01A-12D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	67		67	67	1	1.950000	-8.782162	1	0.300000	NM_033360			18	18		165	164	1		1	1	1	0	0	67	343		0.999986	5.240795e-01	9.999992e-01	9	28	8	215	18	165
LMBR1L	55716	broad.mit.edu	37	12	49491751	49491751	+	Missense_Mutation	SNP	G	G	A	rs371228926		TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr12:49491751G>A	ENST00000267102.8	-	16	1720	c.1378C>T	c.(1378-1380)Cgg>Tgg	p.R460W	LMBR1L_ENST00000547382.1_Missense_Mutation_p.R440W|LMBR1L_ENST00000395141.4_Missense_Mutation_p.R455W	NM_018113.2	NP_060583.2	Q6UX01	LMBRL_HUMAN	limb development membrane protein 1-like	460					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						AGCTCTGCCCGCACAGCTGCA	0.562											OREG0021783	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000267102.8			0	0																														0				15						c.(1378-1380)Cgg>Tgg		limb development membrane protein 1-like		G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	105.0	107.0	106.0		1378	2.5	1.0	12		106	0,8600		0,0,4300	no	missense	LMBR1L	NM_018113.2	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	460/490	49491751	1,13005	2203	4300	6503	SO:0001583	missense	55716	3	121412	40				g.chr12:49491751G>A	AB033000	CCDS8780.2, CCDS73466.1	12q13.12	2013-08-05	2013-08-05		ENSG00000139636	ENSG00000139636			18268	protein-coding gene	gene with protein product		610007	"""limb region 1 homolog (mouse)-like"""			10574461, 11287427	Standard	XM_005269022		Approved	FLJ10494, KIAA1174	uc001rth.4	Q6UX01	OTTHUMG00000150511	ENST00000267102.8:c.1378C>T	chr12.hg19:g.49491751G>A	ENSP00000267102:p.Arg460Trp			OREG0021783	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	962	LMBR1L_ENST00000395141.4_Missense_Mutation_p.R455W|LMBR1L_ENST00000547382.1_Missense_Mutation_p.R440W	p.R460W	NM_018113.2	NP_060583.2					Q6UX01	LMBRL_HUMAN		16	1720	-			Q969J4|Q96BY8|Q96HN8|Q9NT09|Q9NVE1|Q9NVU9|Q9ULP6	Missense_Mutation	SNP	ENST00000267102.8	0	1	hg19	c.1378C>T	CCDS8780.2		.	.	.	.	.	.	.	.	.	.	G	22.0	4.231485	0.79688	2.27E-4	0.0	ENSG00000139636	ENST00000267102;ENST00000547382;ENST00000395141	T;T;T	0.58506	0.41;0.33;0.37	5.84	2.54	0.30619	5.84	2.54	0.30619	.	0.054147	0.64402	D	0.000001	T	0.66287	0.2774	L	0.43923	1.385	0.41689	D	0.989332	D;D;D	0.89917	0.996;0.993;1.0	P;P;D	0.67231	0.649;0.548;0.95	T	0.69439	-0.5145	10	0.87932	D	0	.	13.789	0.63128	0.0:0.0:0.5232:0.4768	.	440;460;455	Q6UX01-3;Q6UX01;Q6UX01-4	.;LMBRL_HUMAN;.	W	460;440;455	ENSP00000267102:R460W;ENSP00000447329:R440W;ENSP00000378573:R455W	ENSP00000267102:R460W	R	-	1	2	2	LMBR1L	47778018	47778018	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.523000	0.73787	0.620000	0.30215	0.563000	0.77884	CGG			TCGA-2J-AAB4-01A-12D-A40W-08	0.562	LMBR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318696.1	0	0	1		19	6	2	1		1	1	93		93	92	1	1.950000	-1.997445	0	0.300000	NM_018113			6	6		521	509	0		0	0		1	0	93	0		0.005661	3.575592e-03	0	0	0	90	0	6	521
FBXO34	55030	broad.mit.edu	37	14	55818287	55818287	+	Silent	SNP	G	G	A	rs553317019		TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr14:55818287G>A	ENST00000313833.4	+	2	1424	c.1179G>A	c.(1177-1179)tcG>tcA	p.S393S	FBXO34_ENST00000440021.1_Silent_p.S393S	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	393										breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						AGCCGGGTTCGCAAACTGCCG	0.507													G|||	1	0.000199681	0.0	0.0	5008	,	,		19849	0.0		0.0	False		,,,				2504	0.001					ENST00000313833.4	0.190000	3.000000e-02	1.400000e-01	6.000000e-02	0.090000	0.110434	0.090000	0.090000																										0				22						c.(1177-1179)tcG>tcA		F-box protein 34							121.0	105.0	110.0					14																	55818287		2203	4300	6503	SO:0001819	synonymous_variant	55030	1	121412	33				g.chr14:55818287G>A	AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.1179G>A	chr14.hg19:g.55818287G>A		0					FBXO34_ENST00000440021.1_Silent_p.S393S	p.S393S	NM_017943.3	NP_060413.2	1	2	3	2.023443	Q9NWN3	FBX34_HUMAN		2	1424	+			Q2VPB5|Q4VBP5|Q86TY4	Silent	SNP	ENST00000313833.4	0	1	hg19	c.1179G>A	CCDS32086.1	0																																																																																								0.302094		TCGA-2J-AAB4-01A-12D-A40W-08	0.507	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411322.1	0	0	1		2	2	2	0		0	0	129		129	125	1	1.950000	-2.032865	0	0.300000				7	6		515	509	0		1	0		0	0	129	0		0.979640	2.978547e-01	0	0	0	71	0	7	515
VPS13C	54832	broad.mit.edu	37	15	62255003	62255003	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr15:62255003G>A	ENST00000261517.5	-	33	3453	c.3380C>T	c.(3379-3381)gCc>gTc	p.A1127V	VPS13C_ENST00000395896.4_Missense_Mutation_p.A1127V|VPS13C_ENST00000249837.3_Missense_Mutation_p.A1084V|VPS13C_ENST00000395898.3_Missense_Mutation_p.A1084V	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TTCTAGTCGGGCAAAAAGTGA	0.328																																						ENST00000261517.5	0.290000	5.000000e-02	2.100000e-01	8.000000e-02	0.140000	0.154581	0.140000	0.130000																										0				117						c.(3379-3381)gCc>gTc		vacuolar protein sorting 13 homolog C (S. cerevisiae)							79.0	80.0	79.0					15																	62255003		2203	4299	6502	SO:0001583	missense	54832	0	0					g.chr15:62255003G>A	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.3380C>T	chr15.hg19:g.62255003G>A	ENSP00000261517:p.Ala1127Val	0					VPS13C_ENST00000395896.4_Missense_Mutation_p.A1127V|VPS13C_ENST00000395898.3_Missense_Mutation_p.A1084V|VPS13C_ENST00000249837.3_Missense_Mutation_p.A1084V	p.A1127V	NM_020821.2	NP_065872.1	0	1	1	2.013936				33	3453	-				Missense_Mutation	SNP	ENST00000261517.5	0	1	hg19	c.3380C>T	CCDS32257.1	0	.	.	.	.	.	.	.	.	.	.	G	12.69	2.012850	0.35511	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.45276	0.9;0.9;0.9	5.93	5.01	0.66863	5.93	5.01	0.66863	.	0.386164	0.25909	N	0.027516	T	0.38214	0.1032	M	0.62266	1.93	0.53005	D	0.999967	B;B;B;B	0.29232	0.238;0.238;0.238;0.153	B;B;B;B	0.30855	0.121;0.121;0.121;0.076	T	0.12293	-1.0553	10	0.23891	T	0.37	.	9.4557	0.38753	0.0712:0.0:0.7853:0.1436	.	1084;1127;1084;1127	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	V	1084;1127;1127;1127	ENSP00000249837:A1084V;ENSP00000261517:A1127V;ENSP00000379233:A1127V	ENSP00000249837:A1084V	A	-	2	0	0	VPS13C	60042295	60042295	1.000000	0.71417	1.000000	0.80357	0.139000	0.21198	6.845000	0.75394	2.805000	0.96524	0.655000	0.94253	GCC	0.298948		TCGA-2J-AAB4-01A-12D-A40W-08	0.328	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	0	0	1		2	2	2	0		0	0	65		65	65	1	1.950000	-2.522317	1	0.300000	NM_017684			5	6		249	244	0		1	0		0	0	65	0		0.935521	1.990316e-02	0	0	0	9	0	5	249
CASKIN1	57524	broad.mit.edu	37	16	2228635	2228635	+	Silent	SNP	C	C	T	rs369309592		TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr16:2228635C>T	ENST00000343516.6	-	20	4304	c.4212G>A	c.(4210-4212)gcG>gcA	p.A1404A		NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	1404					signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						TGCTCTTTTCCGCCGCCGAGT	0.716													C|||	1	0.000199681	0.0008	0.0	5008	,	,		7187	0.0		0.0	False		,,,				2504	0.0					ENST00000343516.6	1.000000	4.600000e-01	1	6.100000e-01	0.790000	0.789378	0.790000	1.000000																										0				28						c.(4210-4212)gcG>gcA		CASK interacting protein 1		C		7,4207		0,7,2100	18.0	23.0	21.0		4212	-8.9	0.0	16		21	0,8496		0,0,4248	no	coding-synonymous	CASKIN1	NM_020764.3		0,7,6348	TT,TC,CC		0.0,0.1661,0.0551		1404/1432	2228635	7,12703	2107	4248	6355	SO:0001819	synonymous_variant	57524	9	119936	37				g.chr16:2228635C>T	AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.4212G>A	chr16.hg19:g.2228635C>T		0						p.A1404A	NM_020764.3	NP_065815.1	1	2	3	2.023048	Q8WXD9	CSKI1_HUMAN		20	4304	-			Q9P2P0	Silent	SNP	ENST00000343516.6	1	1	hg19	c.4212G>A	CCDS42103.1	0																																																																																								0.302094		TCGA-2J-AAB4-01A-12D-A40W-08	0.716	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435055.1	1	0	1		2	2	2	0		0	0	38		38	38	1	1.950000	-3.323279	1	0.300000	NM_020764			14	14		106	104	0		1			0	0	38	0		0.999792	0	0	0	0	0	0	14	106
MEFV	4210	broad.mit.edu	37	16	3293521	3293521	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr16:3293521C>T	ENST00000219596.1	-	10	2005	c.1966G>A	c.(1966-1968)Gag>Aag	p.E656K	MEFV_ENST00000536379.1_Missense_Mutation_p.E445K|MEFV_ENST00000541159.1_3'UTR|MEFV_ENST00000339854.4_Missense_Mutation_p.E476K	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	656	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.		E -> A (in arFMF). {ECO:0000269|PubMed:16730661}.		inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						ACCTCCACCTCCCAGTAACGG	0.542																																						ENST00000219596.1	1.000000	9.200000e-01	1	9.900000e-01	0.990000	0.994754	0.990000	1.000000																										0				50						c.(1966-1968)Gag>Aag		Mediterranean fever							105.0	106.0	105.0					16																	3293521		2197	4300	6497	SO:0001583	missense	4210	0	0					g.chr16:3293521C>T	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1966G>A	chr16.hg19:g.3293521C>T	ENSP00000219596:p.Glu656Lys	0					MEFV_ENST00000339854.4_Missense_Mutation_p.E476K|MEFV_ENST00000541159.1_3'UTR|MEFV_ENST00000536379.1_Missense_Mutation_p.E445K	p.E656K	NM_000243.2	NP_000234.1	1	2	3	2.023048	O15553	MEFV_HUMAN		10	2005	-			D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	ENST00000219596.1	1	1	hg19	c.1966G>A	CCDS10498.1	1	.	.	.	.	.	.	.	.	.	.	C	19.25	3.791684	0.70452	.	.	ENSG00000103313	ENST00000545159;ENST00000219596;ENST00000339854;ENST00000536379	T;T;T	0.77620	-1.11;-1.11;-1.11	5.03	4.02	0.46733	5.03	4.02	0.46733	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.139173	0.33110	N	0.005270	D	0.92750	0.7695	H	0.99312	4.51	0.37407	D	0.913101	D	0.89917	1.0	D	0.85130	0.997	D	0.96110	0.9076	10	0.87932	D	0	.	13.8796	0.63674	0.0:0.846:0.154:0.0	.	656	O15553	MEFV_HUMAN	K	656;656;476;445	ENSP00000219596:E656K;ENSP00000339639:E476K;ENSP00000445079:E445K	ENSP00000219596:E656K	E	-	1	0	0	MEFV	3233522	3233522	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	3.985000	0.56930	2.496000	0.84212	0.650000	0.86243	GAG	0.302094		TCGA-2J-AAB4-01A-12D-A40W-08	0.542	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	1	0	1		2	2	2	0		0	0	134		134	132	1	1.950000	-3.331202	1	0.300000	NM_000243			95	94		471	452	1		1			0	0	134	0		1.000000	0	0	0	0	0	0	95	471
DNAH3	55567	broad.mit.edu	37	16	21080894	21080894	+	Missense_Mutation	SNP	G	G	A	rs541368919	byFrequency	TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr16:21080894G>A	ENST00000261383.3	-	23	3222	c.3223C>T	c.(3223-3225)Cgc>Tgc	p.R1075C	DNAH3_ENST00000415178.1_Missense_Mutation_p.R1075C	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1075	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.R1075C(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TCTTGTATGCGAATTAGCTTT	0.458													G|||	2	0.000399361	0.0	0.0	5008	,	,		19096	0.0		0.0	False		,,,				2504	0.002					ENST00000261383.3	1.000000	6.400000e-01	9.900000e-01	7.400000e-01	0.850000	0.858019	0.850000	1.000000																										2	Substitution - Missense(2)	p.R1075C(2)	large_intestine(2)	202						c.(3223-3225)Cgc>Tgc		dynein, axonemal, heavy chain 3							168.0	126.0	140.0					16																	21080894		2201	4300	6501	SO:0001583	missense	55567	3	121410	35				g.chr16:21080894G>A	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.3223C>T	chr16.hg19:g.21080894G>A	ENSP00000261383:p.Arg1075Cys	0					DNAH3_ENST00000415178.1_Missense_Mutation_p.R1075C	p.R1075C	NM_017539.1	NP_060009.1	1	2	3	2.023048	Q8TD57	DYH3_HUMAN		23	3222	-			O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	1	1	hg19	c.3223C>T	CCDS10594.1	1	.	.	.	.	.	.	.	.	.	.	G	11.04	1.521152	0.27211	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.62232	0.04;0.04	5.4	4.38	0.52667	5.4	4.38	0.52667	Dynein heavy chain, domain-2 (1);	0.726956	0.12981	N	0.423277	T	0.67571	0.2907	M	0.61703	1.905	0.09310	N	0.999999	D	0.71674	0.998	P	0.56916	0.809	T	0.59920	-0.7363	10	0.49607	T	0.09	.	5.2981	0.15764	0.0831:0.1449:0.6224:0.1496	.	1075	Q8TD57	DYH3_HUMAN	C	1075	ENSP00000261383:R1075C;ENSP00000394245:R1075C	ENSP00000261383:R1075C	R	-	1	0	0	DNAH3	20988395	20988395	0.019000	0.18553	0.931000	0.37212	0.665000	0.39181	1.662000	0.37418	2.696000	0.92011	0.655000	0.94253	CGC	0.302094		TCGA-2J-AAB4-01A-12D-A40W-08	0.458	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	1	0	1		2	2	2	0		0	0	115		115	114	1	1.950000	-19.241680	1	0.300000	NM_017539			46	46		313	311	1		1			0	0	115	0		1.000000	0	0	0	0	0	0	46	313
DLG4	1742	broad.mit.edu	37	17	7100076	7100076	+	Splice_Site	SNP	C	C	T			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr17:7100076C>T	ENST00000399506.2	-	9	1274	c.1083G>A	c.(1081-1083)tcG>tcA	p.S361S	DLG4_ENST00000302955.6_Splice_Site_p.S358S|DLG4_ENST00000399510.2_Splice_Site_p.S404S			P78352	DLG4_HUMAN	discs, large homolog 4 (Drosophila)	361	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|axon guidance (GO:0007411)|dendritic spine morphogenesis (GO:0060997)|establishment of protein localization (GO:0045184)|learning (GO:0007612)|locomotory exploration behavior (GO:0035641)|negative regulation of receptor internalization (GO:0002091)|nervous system development (GO:0007399)|neuromuscular process controlling balance (GO:0050885)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synaptic transmission (GO:0050806)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|receptor localization to synapse (GO:0097120)|regulation of grooming behavior (GO:2000821)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vocalization behavior (GO:0071625)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|juxtaparanode region of axon (GO:0044224)|neuron projection terminus (GO:0044306)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	acetylcholine receptor binding (GO:0033130)|beta-1 adrenergic receptor binding (GO:0031697)|D1 dopamine receptor binding (GO:0031748)|ionotropic glutamate receptor binding (GO:0035255)|P2Y1 nucleotide receptor binding (GO:0031812)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein phosphatase binding (GO:0019903)|scaffold protein binding (GO:0097110)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)	18					Guanidine(DB00536)	CTTCCCTCACCGACAGGATCT	0.667																																						ENST00000399506.2	1.000000	3.300000e-01	9.300000e-01	5.000000e-01	0.720000	0.716573	0.720000	1.000000																										0				18						c.(1081-1083)tcG>tcA		discs, large homolog 4 (Drosophila)	Guanidine(DB00536)						12.0	15.0	14.0					17																	7100076		2039	4180	6219	SO:0001630	splice_region_variant	1742	0	0					g.chr17:7100076C>T	U83192	CCDS45599.1, CCDS45600.1	17p13.1	2008-12-15	2001-12-04		ENSG00000132535	ENSG00000132535			2903	protein-coding gene	gene with protein product		602887				9286702	Standard	NM_001128827		Approved	PSD-95, PSD95, SAP90, SAP-90	uc010cly.3	P78352	OTTHUMG00000134327	ENST00000399506.2:c.1083+1G>A	chr17.hg19:g.7100076C>T		1					DLG4_ENST00000399510.2_Splice_Site_p.S404S|DLG4_ENST00000302955.6_Splice_Site_p.S358S	p.S361S			0	1	1	1.759855	P78352	DLG4_HUMAN		9	1274	-			B7Z1S1|G5E939|Q92941|Q9UKK8	Splice_Site	SNP	ENST00000399506.2	0	1	hg19	c.1083G>A		0																																																																																								0.185099		TCGA-2J-AAB4-01A-12D-A40W-08	0.667	DLG4-002	KNOWN	non_canonical_TEC|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000259419.2	0	0	1		2	2	2	0		0	0	13		13	13	1	1.950000	-12.956960	1	0.300000	NM_001365	Silent		6	5		37	36	0		1	0		0	0	13	0		0.963670	9.190821e-01	0	0	0	31	0	6	37
TP53	7157	broad.mit.edu	37	17	7578554	7578554	+	Splice_Site	SNP	A	A	T			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr17:7578554A>T	ENST00000269305.4	-	5	565	c.376T>A	c.(376-378)Tac>Aac	p.Y126N	TP53_ENST00000455263.2_Splice_Site_p.Y126N|TP53_ENST00000359597.4_Splice_Site_p.Y126N|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Splice_Site_p.Y126N|TP53_ENST00000413465.2_Splice_Site_p.Y126N|TP53_ENST00000445888.2_Splice_Site_p.Y126N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	126	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> G (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y126D(9)|p.0?(8)|p.Y126N(6)|p.Y126_K132delYSPALNK(6)|p.Y126_N131delYSPALN(3)|p.Y33D(2)|p.V73fs*9(1)|p.?(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)|p.Y126fs*18(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAGGGGAGTACTGTAGGAAG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	6.600000e-01	1	8.000000e-01	0.930000	0.911469	0.930000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		40	Substitution - Missense(17)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(4)|Insertion - In frame(1)|Unknown(1)	p.Y126D(9)|p.0?(8)|p.Y126N(6)|p.Y126_K132delYSPALNK(6)|p.Y126_N131delYSPALN(3)|p.Y33D(2)|p.V73fs*9(1)|p.?(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)|p.Y126fs*18(1)	central_nervous_system(6)|haematopoietic_and_lymphoid_tissue(6)|upper_aerodigestive_tract(4)|large_intestine(4)|lung(4)|prostate(4)|bone(4)|breast(3)|ovary(2)|stomach(1)|liver(1)|oesophagus(1)	24185	GRCh37	CI004819	TP53	I		c.(376-378)Tac>Aac	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						42.0	43.0	43.0					17																	7578554		2203	4300	6503	SO:0001630	splice_region_variant	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578554A>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.376-1T>A	chr17.hg19:g.7578554A>T		1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Splice_Site_p.Y126N|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Splice_Site_p.Y126N|TP53_ENST00000420246.2_Splice_Site_p.Y126N|TP53_ENST00000359597.4_Splice_Site_p.Y126N|TP53_ENST00000413465.2_Splice_Site_p.Y126N	p.Y126N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.759855	P04637	P53_HUMAN		5	565	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	1	0	hg19	c.376T>A	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.639687	0.87760	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D;D	0.99869	-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33	5.48	5.48	0.80851	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.90483	3.12	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.961;1.0;1.0;1.0	D	0.96375	0.9277	10	0.87932	D	0	-28.2517	13.8301	0.63375	1.0:0.0:0.0:0.0	.	87;126;126;33;126;126;126	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	N	126;126;126;126;126;126;115;33;33;126;126	ENSP00000410739:Y126N;ENSP00000352610:Y126N;ENSP00000269305:Y126N;ENSP00000398846:Y126N;ENSP00000391127:Y126N;ENSP00000391478:Y126N;ENSP00000423862:Y33N;ENSP00000424104:Y126N;ENSP00000426252:Y126N	ENSP00000269305:Y126N	Y	-	1	0	0	TP53	7519279	7519279	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.240000	0.95396	2.206000	0.71126	0.533000	0.62120	TAC	0.185099		TCGA-2J-AAB4-01A-12D-A40W-08	0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0		0	0	31		31	31	1	1.950000	-20.000000	1	0.300000	NM_000546	Missense_Mutation		20	20		81	80	1		1	1	1	0	0	31	1826		0.999998	9.977699e-01	1	9	215	35	1138	20	81
RBBP8	5932	broad.mit.edu	37	18	20602110	20602110	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr18:20602110G>A	ENST00000399722.2	+	18	2824	c.2473G>A	c.(2473-2475)Gca>Aca	p.A825T	Y_RNA_ENST00000411091.1_RNA|RBBP8_ENST00000581687.1_Missense_Mutation_p.A3T|RBBP8_ENST00000327155.5_Missense_Mutation_p.A825T|RBBP8_ENST00000360790.5_Missense_Mutation_p.A830T|RBBP8_ENST00000399725.2_Silent_p.Q792Q	NM_203291.1	NP_976036.1	Q99708	COM1_HUMAN	retinoblastoma binding protein 8	825					blastocyst hatching (GO:0001835)|cell cycle checkpoint (GO:0000075)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|G2 DNA damage checkpoint (GO:0031572)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	damaged DNA binding (GO:0003684)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			central_nervous_system(1)|cervix(2)|endometrium(5)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	24	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			AGATATGCCAGCAGAAGAAAG	0.353								Homologous recombination																														ENST00000399722.2	1.000000	1.000000e-02	1	4.000000e-02	0.070000	0.291718	0.070000	0.060000																										0				24						c.(2473-2475)Gca>Aca	Homologous recombination	retinoblastoma binding protein 8							122.0	131.0	128.0					18																	20602110		2203	4300	6503	SO:0001583	missense	5932	0	0					g.chr18:20602110G>A	AF043431	CCDS11874.1, CCDS11875.1	18q11.2	2012-11-05	2001-11-28		ENSG00000101773	ENSG00000101773			9891	protein-coding gene	gene with protein product	"""CTBP-interacting protein"""	604124	"""retinoblastoma-binding protein 8"", ""Seckel syndrome 2"""	SCKL2		9721205, 17965729, 21998596	Standard	NM_002894		Approved	CtIP, RIM, COM1	uc002ktw.3	Q99708	OTTHUMG00000131769	ENST00000399722.2:c.2473G>A	chr18.hg19:g.20602110G>A	ENSP00000382628:p.Ala825Thr	1					RBBP8_ENST00000360790.5_Missense_Mutation_p.A830T|RBBP8_ENST00000581687.1_Missense_Mutation_p.A3T|RBBP8_ENST00000399725.2_Silent_p.Q792Q|RBBP8_ENST00000327155.5_Missense_Mutation_p.A825T|Y_RNA_ENST00000411091.1_RNA	p.A825T	NM_203291.1	NP_976036.1	2	2	4	2.345917	Q99708	COM1_HUMAN	OV - Ovarian serous cystadenocarcinoma(1;0.00196)	18	2824	+	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		A6NKN2|A8K8W6|E7ETY1|O75371|Q8NHQ3	Missense_Mutation	SNP	ENST00000399722.2	0	1	hg19	c.2473G>A	CCDS11875.1	0	.	.	.	.	.	.	.	.	.	.	G	14.30	2.495044	0.44352	.	.	ENSG00000101773	ENST00000327155;ENST00000399722;ENST00000360790	T;T;T	0.32272	1.47;1.47;1.46	5.93	3.14	0.36123	5.93	3.14	0.36123	.	0.054739	0.64402	D	0.000001	T	0.25606	0.0623	L	0.29908	0.895	0.32479	N	0.541741	P;P	0.47191	0.891;0.656	P;B	0.46419	0.516;0.297	T	0.22695	-1.0209	10	0.25751	T	0.34	-9.1687	10.6324	0.45545	0.0674:0.2497:0.6829:0.0	.	830;825	E7ETY1;Q99708	.;COM1_HUMAN	T	825;825;830	ENSP00000323050:A825T;ENSP00000382628:A825T;ENSP00000354024:A830T	ENSP00000323050:A825T	A	+	1	0	0	RBBP8	18856108	18856108	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	7.513000	0.81739	0.384000	0.24942	0.585000	0.79938	GCA	0.400685		TCGA-2J-AAB4-01A-12D-A40W-08	0.353	RBBP8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446387.1	0	0	1		2	2	2	0		0	0	181		181	181	1	1.950000	-2.510822	1	0.300000	NM_203291			6	6		773	761	0		1	0		0	0	181	0		0.963331	1.998452e-01	0	0	0	91	0	6	773
SYT4	6860	broad.mit.edu	37	18	40853958	40853958	+	Missense_Mutation	SNP	T	T	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr18:40853958T>A	ENST00000255224.3	-	2	804	c.436A>T	c.(436-438)Act>Tct	p.T146S	SYT4_ENST00000590752.1_Missense_Mutation_p.T128S|SYT4_ENST00000586678.1_Intron	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	146					exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						TCTTCTGAAGTAAGGGAAGTG	0.448																																					NSCLC(85;81 1419 2855 22820 35912)	ENST00000255224.3	1.000000	6.900000e-01	9.700000e-01	8.000000e-01	0.900000	0.893530	0.900000	0.990000																										0				44						c.(436-438)Act>Tct		synaptotagmin IV							49.0	49.0	49.0					18																	40853958		2203	4300	6503	SO:0001583	missense	6860	0	0					g.chr18:40853958T>A	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.436A>T	chr18.hg19:g.40853958T>A	ENSP00000255224:p.Thr146Ser	1					SYT4_ENST00000586678.1_Intron|SYT4_ENST00000590752.1_Missense_Mutation_p.T128S	p.T146S	NM_020783.3	NP_065834.1	0	1	1	1.716786	Q9H2B2	SYT4_HUMAN		2	804	-			B4DEU3|Q9P2K4	Missense_Mutation	SNP	ENST00000255224.3	1	1	hg19	c.436A>T	CCDS11922.1	1	.	.	.	.	.	.	.	.	.	.	T	0	-2.718377	0.00093	.	.	ENSG00000132872	ENST00000255224	T	0.07800	3.16	5.87	0.661	0.17874	5.87	0.661	0.17874	.	0.510618	0.23724	N	0.045196	T	0.02230	0.0069	N	0.02539	-0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.45977	-0.9224	10	0.02654	T	1	.	6.2987	0.21101	0.5002:0.1473:0.0:0.3526	.	128;146	B4DEU3;Q9H2B2	.;SYT4_HUMAN	S	146	ENSP00000255224:T146S	ENSP00000255224:T146S	T	-	1	0	0	SYT4	39107956	39107956	0.020000	0.18652	0.091000	0.20842	0.126000	0.20510	0.155000	0.16362	-0.290000	0.09025	-1.427000	0.01099	ACT	0.176471		TCGA-2J-AAB4-01A-12D-A40W-08	0.448	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	1	0	1		2	2	2	0		0	0	60		60	60	1	1.950000	-20.000000	1	0.300000	NM_020783			36	36		163	162	1		1	0		0	0	60	0		1.000000	7.797522e-01	0	0	0	15	0	36	163
ZNF506	440515	broad.mit.edu	37	19	19905821	19905821	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr19:19905821T>C	ENST00000540806.2	-	4	963	c.875A>G	c.(874-876)aAa>aGa	p.K292R	ZNF506_ENST00000450683.2_Missense_Mutation_p.K260R|ZNF506_ENST00000443905.2_Missense_Mutation_p.K292R|ZNF506_ENST00000587461.1_Intron|CTC-559E9.4_ENST00000590274.1_lincRNA|CTC-559E9.6_ENST00000591884.1_RNA|CTC-559E9.6_ENST00000589657.1_RNA			Q5JVG8	ZN506_HUMAN	zinc finger protein 506	292					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(7)|lung(3)|skin(1)|stomach(1)	14						AATAAAGGCTTTGCCACATTT	0.383																																						ENST00000540806.2	1.000000	6.800000e-01	1	7.900000e-01	0.920000	0.909832	0.920000	1.000000																										0				14						c.(874-876)aAa>aGa		zinc finger protein 506							48.0	52.0	51.0					19																	19905821		2198	4300	6498	SO:0001583	missense	440515	0	0					g.chr19:19905821T>C	AK095575	CCDS42531.1, CCDS46027.1	19p13.11	2013-01-08				ENSG00000081665		"""Zinc fingers, C2H2-type"", ""-"""	23780	protein-coding gene	gene with protein product							Standard	NM_001099269		Approved	DKFZp761G1812	uc010eci.2	Q5JVG8		ENST00000540806.2:c.875A>G	chr19.hg19:g.19905821T>C	ENSP00000440625:p.Lys292Arg	0					CTC-559E9.4_ENST00000590274.1_lincRNA|CTC-559E9.6_ENST00000589657.1_RNA|CTC-559E9.6_ENST00000591884.1_RNA|ZNF506_ENST00000450683.2_Missense_Mutation_p.K260R|ZNF506_ENST00000587461.1_Intron|ZNF506_ENST00000443905.2_Missense_Mutation_p.K292R	p.K292R			1	2	3	2.064520	Q5JVG8	ZN506_HUMAN		4	963	-			B3KTH6	Missense_Mutation	SNP	ENST00000540806.2	1	1	hg19	c.875A>G	CCDS42531.1	1	.	.	.	.	.	.	.	.	.	.	-	12.46	1.944705	0.34283	.	.	ENSG00000081665	ENST00000443905;ENST00000540806;ENST00000450683	T;T;T	0.35789	1.75;1.75;1.29	0.974	0.974	0.19715	0.974	0.974	0.19715	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.28366	0.0701	L	0.33339	1.005	0.30874	N	0.732139	B;B	0.20368	0.044;0.005	B;B	0.32465	0.146;0.009	T	0.37174	-0.9717	9	0.62326	D	0.03	.	5.7771	0.18285	0.0:0.0:0.0:1.0	.	292;260	Q5JVG8;Q5JVG8-2	ZN506_HUMAN;.	R	292;292;260	ENSP00000393835:K292R;ENSP00000440625:K292R;ENSP00000408892:K260R	ENSP00000393835:K292R	K	-	2	0	0	ZNF506	19766821	19766821	0.999000	0.42202	0.339000	0.25562	0.301000	0.27625	5.174000	0.65015	0.358000	0.24211	0.347000	0.21830	AAA	0.310345		TCGA-2J-AAB4-01A-12D-A40W-08	0.383	ZNF506-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460794.1	1	0	1		13	2	2	0		0	1	98		98	98	1	1.950000	-20.000000	1	0.300000	XM_036218			44	44		281	275	1		1	1		0	0	98	0		0.999996	7.496107e-01	0	3	0	16	0	44	281
ZNF345	25850	broad.mit.edu	37	19	37368703	37368703	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr19:37368703G>A	ENST00000529555.1	+	2	1759	c.971G>A	c.(970-972)aGa>aAa	p.R324K	ZNF345_ENST00000420450.1_Missense_Mutation_p.R324K|ZNF345_ENST00000526123.1_Intron|ZNF345_ENST00000589046.1_Missense_Mutation_p.R324K|ZNF345_ENST00000432005.2_Intron			Q14585	ZN345_HUMAN	zinc finger protein 345	324					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|ovary(2)|prostate(1)	24	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAAGCCTTTAGAAGTGGTTCA	0.413																																						ENST00000529555.1	1.000000	8.800000e-01	1	9.900000e-01	0.990000	0.991548	0.990000	1.000000																										0				24						c.(970-972)aGa>aAa		zinc finger protein 345							75.0	81.0	79.0					19																	37368703		2203	4300	6503	SO:0001583	missense	25850	0	0					g.chr19:37368703G>A	X78933	CCDS12497.1	19q13.12	2013-01-08			ENSG00000251247	ENSG00000251247		"""Zinc fingers, C2H2-type"""	16367	protein-coding gene	gene with protein product						7865130	Standard	NM_003419		Approved	HZF10	uc002oey.4	Q14585	OTTHUMG00000048162	ENST00000529555.1:c.971G>A	chr19.hg19:g.37368703G>A	ENSP00000431202:p.Arg324Lys	1					ZNF345_ENST00000589046.1_Missense_Mutation_p.R324K|ZNF345_ENST00000420450.1_Missense_Mutation_p.R324K|ZNF345_ENST00000432005.2_Intron|ZNF345_ENST00000526123.1_Intron	p.R324K			1	2	3	2.258037	Q14585	ZN345_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)	2	1759	+	Esophageal squamous(110;0.183)			Missense_Mutation	SNP	ENST00000529555.1	1	1	hg19	c.971G>A	CCDS12497.1	1	.	.	.	.	.	.	.	.	.	.	G	11.11	1.543390	0.27563	.	.	ENSG00000251247	ENST00000420450;ENST00000529555;ENST00000344705	T;T	0.07327	3.2;3.2	3.8	2.71	0.32032	3.8	2.71	0.32032	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03695	0.0105	N	0.03304	-0.355	0.09310	N	0.999994	B	0.13594	0.008	B	0.18561	0.022	T	0.39482	-0.9612	9	0.45353	T	0.12	.	5.1601	0.15056	0.117:0.2162:0.6668:0.0	.	324	Q14585	ZN345_HUMAN	K	324;324;88	ENSP00000431216:R324K;ENSP00000431202:R324K	ENSP00000442320:R88K	R	+	2	0	0	ZNF345	42060543	42060543	0.000000	0.05858	0.999000	0.59377	0.978000	0.69477	-1.214000	0.02988	0.857000	0.35407	0.462000	0.41574	AGA	0.386503		TCGA-2J-AAB4-01A-12D-A40W-08	0.413	ZNF345-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388258.1	1	0	1		2	2	2	0		0	0	86		86	86	1	1.950000	-20.000000	1	0.300000				60	60		342	339	1		1	0		0	0	86	0		1.000000	1.116853e-01	0	0	0	4	0	60	342
PSG1	5669	broad.mit.edu	37	19	43383710	43383710	+	Silent	SNP	G	G	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr19:43383710G>A	ENST00000436291.2	-	1	140	c.24C>T	c.(22-24)ccC>ccT	p.P8P	PSG1_ENST00000403380.3_Silent_p.P8P|PSG1_ENST00000595124.1_Silent_p.P8P|PSG1_ENST00000312439.6_Silent_p.P8P|PSG1_ENST00000601073.1_5'UTR|PSG1_ENST00000244296.2_Silent_p.P8P|PSG1_ENST00000595356.1_Silent_p.P8P	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	8					female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				GCTGTGTGCAGGGAGGGGCTG	0.572																																						ENST00000436291.2	1.000000	9.500000e-01	1	9.900000e-01	0.990000	0.997662	0.990000	1.000000																										0				30						c.(22-24)ccC>ccT		pregnancy specific beta-1-glycoprotein 1							186.0	159.0	169.0					19																	43383710		1510	2707	4217	SO:0001819	synonymous_variant	5669	3	121344	37				g.chr19:43383710G>A		CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.24C>T	chr19.hg19:g.43383710G>A		1					PSG1_ENST00000403380.3_Silent_p.P8P|PSG1_ENST00000601073.1_5'UTR|PSG1_ENST00000595356.1_Silent_p.P8P|PSG1_ENST00000244296.2_Silent_p.P8P|PSG1_ENST00000312439.6_Silent_p.P8P|PSG1_ENST00000595124.1_Silent_p.P8P	p.P8P	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	0	2	2	1.866741	P11464	PSG1_HUMAN		1	140	-		Prostate(69;0.00682)	O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Silent	SNP	ENST00000436291.2	1	1	hg19	c.24C>T	CCDS54275.1	1																																																																																								0.300000		TCGA-2J-AAB4-01A-12D-A40W-08	0.572	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321426.1	1	0	1		2	2	2	0		0	0	108		108	108	1	1.950000	-2.921238	1	0.300000				89	87		417	404	1		1			0	0	108	0		1.000000	0	0	0	0	0	0	89	417
NTNG1	22854	broad.mit.edu	37	1	107867468	107867468	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr1:107867468G>A	ENST00000370068.1	+	3	1657	c.811G>A	c.(811-813)Gtt>Att	p.V271I	NTNG1_ENST00000370067.1_Missense_Mutation_p.V271I|NTNG1_ENST00000370065.1_Missense_Mutation_p.V271I|NTNG1_ENST00000370073.2_Missense_Mutation_p.V271I|NTNG1_ENST00000370072.3_Missense_Mutation_p.V271I|NTNG1_ENST00000477948.1_3'UTR|NTNG1_ENST00000370070.2_Missense_Mutation_p.V271I|NTNG1_ENST00000542803.1_Missense_Mutation_p.V271I|NTNG1_ENST00000370061.3_Missense_Mutation_p.V271I|NTNG1_ENST00000370066.1_Missense_Mutation_p.V271I|NTNG1_ENST00000370071.2_Missense_Mutation_p.V271I|NTNG1_ENST00000370074.4_Missense_Mutation_p.V271I			Q9Y2I2	NTNG1_HUMAN	netrin G1	271	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)		p.V271I(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		AAGACCAGCCGTTGGGGAAAT	0.458																																						ENST00000370068.1	1.000000	5.400000e-01	8.800000e-01	6.300000e-01	0.740000	0.759956	0.740000	0.730000																										2	Substitution - Missense(2)	p.V271I(2)	large_intestine(2)	37						c.(811-813)Gtt>Att		netrin G1							54.0	56.0	56.0					1																	107867468		2203	4299	6502	SO:0001583	missense	22854	0	0					g.chr1:107867468G>A	AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.811G>A	chr1.hg19:g.107867468G>A	ENSP00000359085:p.Val271Ile	0					NTNG1_ENST00000370070.2_Missense_Mutation_p.V271I|NTNG1_ENST00000542803.1_Missense_Mutation_p.V271I|NTNG1_ENST00000370073.2_Missense_Mutation_p.V271I|NTNG1_ENST00000370066.1_Missense_Mutation_p.V271I|NTNG1_ENST00000370074.4_Missense_Mutation_p.V271I|NTNG1_ENST00000370065.1_Missense_Mutation_p.V271I|NTNG1_ENST00000370072.3_Missense_Mutation_p.V271I|NTNG1_ENST00000370067.1_Missense_Mutation_p.V271I|NTNG1_ENST00000477948.1_3'UTR|NTNG1_ENST00000370061.3_Missense_Mutation_p.V271I|NTNG1_ENST00000370071.2_Missense_Mutation_p.V271I	p.V271I			1	2	3	2.043436	Q9Y2I2	NTNG1_HUMAN		3	1657	+		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)	Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Missense_Mutation	SNP	ENST00000370068.1	1	1	hg19	c.811G>A	CCDS44180.1	0	.	.	.	.	.	.	.	.	.	.	G	11.41	1.630818	0.28978	.	.	ENSG00000162631	ENST00000370076;ENST00000370073;ENST00000370071;ENST00000542803;ENST00000370061;ENST00000370072;ENST00000370070;ENST00000535584;ENST00000370064;ENST00000370062;ENST00000370074;ENST00000370068;ENST00000294649;ENST00000370067;ENST00000370066;ENST00000370065	T;T;T;T;T;T;T;T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91	5.94	3.92	0.45320	5.94	3.92	0.45320	Laminin, N-terminal (3);	0.336633	0.24492	N	0.038046	T	0.29850	0.0746	N	0.04508	-0.205	0.33178	D	0.549223	B;B;B;B;B	0.25772	0.001;0.134;0.007;0.021;0.076	B;B;B;B;B	0.28709	0.007;0.093;0.019;0.024;0.046	T	0.05435	-1.0885	10	0.40728	T	0.16	.	4.7071	0.12855	0.6449:0.0:0.3551:0.0	.	271;271;271;271;271	B4DKF0;Q9Y2I2;Q9Y2I2-4;Q9Y2I2-2;Q9Y2I2-1	.;NTNG1_HUMAN;.;.;.	I	271;271;271;271;271;271;271;271;32;32;271;271;271;271;271;271	ENSP00000359090:V271I;ENSP00000359088:V271I;ENSP00000440561:V271I;ENSP00000359078:V271I;ENSP00000359089:V271I;ENSP00000359087:V271I;ENSP00000359091:V271I;ENSP00000359085:V271I;ENSP00000359084:V271I;ENSP00000359083:V271I;ENSP00000359082:V271I	ENSP00000294649:V271I	V	+	1	0	0	NTNG1	107668991	107668991	1.000000	0.71417	0.787000	0.31911	0.994000	0.84299	7.637000	0.83313	0.752000	0.32923	0.655000	0.94253	GTT	0.306244		TCGA-2J-AAB4-01A-12D-A40W-08	0.458	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000030340.1	1	0	1		2	2	2	0		0	0	57		57	56	1	1.950000	-3.221884	1	0.300000	NM_014917			42	41		340	336	1		1			0	0	57	0		1.000000	0	0	0	0	0	0	42	340
CD1B	910	broad.mit.edu	37	1	158300606	158300606	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr1:158300606G>A	ENST00000368168.3	-	2	415	c.308C>T	c.(307-309)gCc>gTc	p.A103V		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	103					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					GAAATCACCGGCAAAGTCTTG	0.433																																						ENST00000368168.3	0.080000	0	6.000000e-02	2.000000e-02	0.030000	0.044061	0.030000	0.040000																										0				30						c.(307-309)gCc>gTc		CD1b molecule							203.0	208.0	206.0					1																	158300606		2203	4300	6503	SO:0001583	missense	910	0	0					g.chr1:158300606G>A	M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.308C>T	chr1.hg19:g.158300606G>A	ENSP00000357150:p.Ala103Val	0						p.A103V	NM_001764.2	NP_001755.1	1	2	3	2.016659	P29016	CD1B_HUMAN		2	415	-	all_hematologic(112;0.0378)		Q5TDK9|Q5TDL0|Q9UMM2	Missense_Mutation	SNP	ENST00000368168.3	0	1	hg19	c.308C>T	CCDS1176.1	0	.	.	.	.	.	.	.	.	.	.	G	7.665	0.685781	0.14973	.	.	ENSG00000158485	ENST00000368168	T	0.06371	3.31	4.28	-3.93	0.04143	4.28	-3.93	0.04143	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	1.257440	0.05775	N	0.607617	T	0.00845	0.0028	N	0.11023	0.085	0.09310	N	1	B;B	0.32396	0.369;0.008	B;B	0.24541	0.054;0.012	T	0.44907	-0.9297	10	0.13108	T	0.6	-2.4627	10.7361	0.46126	0.7119:0.0:0.2881:0.0	.	103;103	B4E0D2;P29016	.;CD1B_HUMAN	V	103	ENSP00000357150:A103V	ENSP00000357150:A103V	A	-	2	0	0	CD1B	156567230	156567230	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.975000	0.03790	-0.705000	0.05035	0.655000	0.94253	GCC	0.301048		TCGA-2J-AAB4-01A-12D-A40W-08	0.433	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046350.2	0	0	1		15	2	2	1		1	1	303		303	302	1	1.950000	-2.219813	0	0.300000	NM_001764			7	7		1201	1185	0		0	0		1	0	303	0		0.061823	4.913636e-05	0	0	0	2	0	7	1201
DNAJC6	9829	broad.mit.edu	37	1	65845149	65845149	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr1:65845149G>A	ENST00000395325.3	+	5	594	c.437G>A	c.(436-438)cGg>cAg	p.R146Q	DNAJC6_ENST00000371069.4_Missense_Mutation_p.R203Q|DNAJC6_ENST00000263441.7_Missense_Mutation_p.R133Q	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	146	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						GCTGTGTGTCGGAATATGTAT	0.458																																						ENST00000395325.3	1.000000	8.200000e-01	1	9.100000e-01	0.990000	0.970232	0.990000	1.000000																										0				39						c.(436-438)cGg>cAg		DnaJ (Hsp40) homolog, subfamily C, member 6							217.0	200.0	206.0					1																	65845149		2203	4300	6503	SO:0001583	missense	9829	4	121412	39				g.chr1:65845149G>A	AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.437G>A	chr1.hg19:g.65845149G>A	ENSP00000378735:p.Arg146Gln	0					DNAJC6_ENST00000371069.4_Missense_Mutation_p.R203Q|DNAJC6_ENST00000263441.7_Missense_Mutation_p.R133Q	p.R146Q	NM_014787.3	NP_055602.1	1	2	3	2.043436	O75061	AUXI_HUMAN		5	594	+			B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Missense_Mutation	SNP	ENST00000395325.3	1	1	hg19	c.437G>A	CCDS30739.1	1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.005156	0.74932	.	.	ENSG00000116675	ENST00000263441;ENST00000395325;ENST00000371069	D;D;D	0.98649	-5.05;-5.05;-5.05	5.41	3.42	0.39159	5.41	3.42	0.39159	Phosphatase tensin type (1);	0.055637	0.64402	D	0.000001	D	0.90937	0.7151	N	0.17474	0.49	0.31432	N	0.672981	P;P;D	0.54397	0.932;0.811;0.966	B;B;B	0.40444	0.124;0.058;0.329	D	0.89605	0.3837	10	0.44086	T	0.13	.	4.517	0.11939	0.3974:0.0:0.6026:0.0	.	203;146;133	O75061-2;O75061;D3DQ66	.;AUXI_HUMAN;.	Q	133;146;203	ENSP00000263441:R133Q;ENSP00000378735:R146Q;ENSP00000360108:R203Q	ENSP00000263441:R133Q	R	+	2	0	0	DNAJC6	65617737	65617737	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.122000	0.77169	1.520000	0.48965	0.561000	0.74099	CGG	0.306244		TCGA-2J-AAB4-01A-12D-A40W-08	0.458	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025134.1	1	0	1		2	2	2	0		0	0	124		124	123	1	1.950000	-2.416268	0	0.300000				87	87		490	480	1		1	0		0	0	124	0		1.000000	2.286730e-01	0	0	0	6	0	87	490
ITLN1	55600	broad.mit.edu	37	1	160850421	160850421	+	Silent	SNP	G	G	A	rs201111955		TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr1:160850421G>A	ENST00000326245.3	-	6	757	c.642C>T	c.(640-642)ggC>ggT	p.G214G	ITLN1_ENST00000487531.1_5'UTR	NM_017625.2	NP_060095.2	Q8WWA0	ITLN1_HUMAN	intelectin 1 (galactofuranose binding)	214	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				positive regulation of glucose import (GO:0046326)|positive regulation of protein phosphorylation (GO:0001934)|response to nematode (GO:0009624)	anchored component of membrane (GO:0031225)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	21	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TCTGGGCGTCGCCAAAATCAT	0.443																																						ENST00000326245.3	0.120000	2.000000e-02	9.000000e-02	3.000000e-02	0.050000	0.066443	0.050000	0.060000																										0				21						c.(640-642)ggC>ggT		intelectin 1 (galactofuranose binding)							181.0	181.0	181.0					1																	160850421		2203	4300	6503	SO:0001819	synonymous_variant	55600	3	121412	42				g.chr1:160850421G>A	AB036706	CCDS1211.1	1q21.3	2008-02-05			ENSG00000179914	ENSG00000179914			18259	protein-coding gene	gene with protein product		609873				11313366, 11181563	Standard	NM_017625		Approved	ITLN, FLJ20022, LFR, HL-1, hIntL	uc001fxc.3	Q8WWA0	OTTHUMG00000028604	ENST00000326245.3:c.642C>T	chr1.hg19:g.160850421G>A		0					ITLN1_ENST00000487531.1_5'UTR	p.G214G	NM_017625.2	NP_060095.2	1	2	3	2.016659	Q8WWA0	ITLN1_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00737)	6	757	-	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		Q5IWS4|Q5VYI4|Q6YDJ3|Q9NP67	Silent	SNP	ENST00000326245.3	0	1	hg19	c.642C>T	CCDS1211.1	0																																																																																								0.301048		TCGA-2J-AAB4-01A-12D-A40W-08	0.443	ITLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071462.1	0	0	1		15	2	2	0		0	1	201		201	201	1	1.950000	-1.626615	0	0.300000	NM_017625			7	7		793	780	0		0	0		0	0	201	0		0.060036	6.581063e-04	0	0	0	4	0	7	793
TGM3	7053	broad.mit.edu	37	20	2290352	2290352	+	Silent	SNP	G	G	T			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr20:2290352G>T	ENST00000381458.5	+	2	120	c.57G>T	c.(55-57)gcG>gcT	p.A19A		NM_003245.3	NP_003236.3	Q08188	TGM3_HUMAN	transglutaminase 3	19					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|hair follicle morphogenesis (GO:0031069)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	calcium ion binding (GO:0005509)|catalytic activity (GO:0003824)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|transferase activity, transferring acyl groups (GO:0016746)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(11)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	39					L-Glutamine(DB00130)	ACCGACAAGCGCATCACACAG	0.517																																						ENST00000381458.5	1.000000	7.100000e-01	9.900000e-01	7.900000e-01	0.880000	0.889781	0.880000	1.000000																										0				39						c.(55-57)gcG>gcT		transglutaminase 3	L-Glutamine(DB00130)						133.0	118.0	123.0					20																	2290352		2203	4300	6503	SO:0001819	synonymous_variant	7053	0	0					g.chr20:2290352G>T	L10386	CCDS33435.1	20q11.2	2013-05-02	2013-05-02		ENSG00000125780	ENSG00000125780	2.3.2.13	"""Transglutaminases"""	11779	protein-coding gene	gene with protein product	"""E polypeptide, protein-glutamine-gamma-glutamyltransferase"""	600238	"""transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7851911, 9452468	Standard	NM_003245		Approved	TGE	uc002wfx.4	Q08188	OTTHUMG00000031690	ENST00000381458.5:c.57G>T	chr20.hg19:g.2290352G>T		0						p.A19A	NM_003245.3	NP_003236.3	0	1	1	2.008187	Q08188	TGM3_HUMAN		2	120	+			A8K5N6|B2RCR6|D3DVX1|O95933|Q32ML9|Q32MM0	Silent	SNP	ENST00000381458.5	1	1	hg19	c.57G>T	CCDS33435.1	1																																																																																								0.297894		TCGA-2J-AAB4-01A-12D-A40W-08	0.517	TGM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077579.2	1	0	1		2	2	2	0		0	0	123		123	123	1	1.950000	-3.221898	1	0.300000	NM_003245			74	72		477	472	1		1			0	0	123	0		1.000000	0	0	0	0	0	0	74	477
RPRD1B	58490	broad.mit.edu	37	20	36687836	36687836	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr20:36687836C>T	ENST00000373433.4	+	5	971	c.569C>T	c.(568-570)gCc>gTc	p.A190V		NM_021215.3	NP_067038.1	Q9NQG5	RPR1B_HUMAN	regulation of nuclear pre-mRNA domain containing 1B	190					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle process (GO:0010564)|transcription, DNA-templated (GO:0006351)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)	12						CTGGAAAATGCCGCATCAGGG	0.413																																						ENST00000373433.4	0.210000	3.000000e-02	1.600000e-01	6.000000e-02	0.100000	0.115468	0.100000	0.100000																										0				12						c.(568-570)gCc>gTc		regulation of nuclear pre-mRNA domain containing 1B							108.0	101.0	103.0					20																	36687836		2203	4300	6503	SO:0001583	missense	58490	0	0					g.chr20:36687836C>T	AL109823	CCDS13301.1	20q11.21-q12	2012-02-09	2008-08-15	2008-07-28	ENSG00000101413	ENSG00000101413			16209	protein-coding gene	gene with protein product		614694	"""chromosome 20 open reading frame 77"""	C20orf77		22231121	Standard	NM_021215		Approved	dJ1057B20.2, DKFZp434P0735, CREPT, FLJ44520, NET60	uc002xho.4	Q9NQG5	OTTHUMG00000032434	ENST00000373433.4:c.569C>T	chr20.hg19:g.36687836C>T	ENSP00000362532:p.Ala190Val	0						p.A190V	NM_021215.3	NP_067038.1	0	1	1	2.008187	Q9NQG5	RPR1B_HUMAN		5	971	+			Q1WDE7|Q6PKF4	Missense_Mutation	SNP	ENST00000373433.4	0	1	hg19	c.569C>T	CCDS13301.1	0	.	.	.	.	.	.	.	.	.	.	C	36	5.667224	0.96745	.	.	ENSG00000101413	ENST00000373433;ENST00000449186	.	.	.	5.4	5.4	0.78164	5.4	5.4	0.78164	.	0.046127	0.85682	D	0.000000	T	0.71005	0.3289	M	0.68593	2.085	0.80722	D	1	P	0.51653	0.947	P	0.50537	0.643	T	0.74438	-0.3665	9	0.72032	D	0.01	-10.9352	18.3479	0.90328	0.0:1.0:0.0:0.0	.	190	Q9NQG5	RPR1B_HUMAN	V	190;72	.	ENSP00000362532:A190V	A	+	2	0	0	RPRD1B	36121250	36121250	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	7.651000	0.83577	2.814000	0.96858	0.563000	0.77884	GCC	0.297894		TCGA-2J-AAB4-01A-12D-A40W-08	0.413	RPRD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079142.2	0	0	1		2	2	2	0		0	0	69		69	69	1	1.950000	-2.228903	0	0.300000	NM_021215			5	5		336	330	0		1	0		0	0	69	0		0.935032	1.192916e-01	0	0	0	33	0	5	336
ABCG1	9619	broad.mit.edu	37	21	43706012	43706012	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr21:43706012A>G	ENST00000361802.2	+	8	1026	c.881A>G	c.(880-882)cAa>cGa	p.Q294R	ABCG1_ENST00000398449.3_Missense_Mutation_p.Q294R|ABCG1_ENST00000347800.2_Missense_Mutation_p.Q291R|ABCG1_ENST00000343687.3_Missense_Mutation_p.Q305R|ABCG1_ENST00000462050.1_3'UTR|ABCG1_ENST00000398457.2_Missense_Mutation_p.Q296R|ABCG1_ENST00000398437.1_Missense_Mutation_p.Q440R|ABCG1_ENST00000340588.4_Missense_Mutation_p.Q402R	NM_004915.3	NP_004906.3	P45844	ABCG1_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 1	294	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				amyloid precursor protein catabolic process (GO:0042987)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|detection of hormone stimulus (GO:0009720)|glycoprotein transport (GO:0034436)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of cholesterol efflux (GO:0010875)|regulation of cholesterol esterification (GO:0010872)|regulation of transcription, DNA-templated (GO:0006355)|response to high density lipoprotein particle (GO:0055099)|response to lipid (GO:0033993)|response to organic substance (GO:0010033)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|glycoprotein transporter activity (GO:0034437)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sterol-transporting ATPase activity (GO:0034041)|toxin transporter activity (GO:0019534)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(3)|prostate(2)|stomach(1)	29					Adenosine triphosphate(DB00171)	AGTCAAGGACAATGTGTGTAC	0.493																																						ENST00000361802.2	0.980000	6.900000e-01	9.100000e-01	7.600000e-01	0.830000	0.841728	0.830000	0.830000																										0				29						c.(880-882)cAa>cGa		ATP-binding cassette, sub-family G (WHITE), member 1	Adenosine triphosphate(DB00171)						235.0	238.0	237.0					21																	43706012		2203	4300	6503	SO:0001583	missense	9619	0	0					g.chr21:43706012A>G	U34919	CCDS13681.1, CCDS13682.1, CCDS13683.1, CCDS42937.1, CCDS42938.1	21q22.3	2012-03-14			ENSG00000160179	ENSG00000160179		"""ATP binding cassette transporters / subfamily G"""	73	protein-coding gene	gene with protein product	"""ATP-binding cassette transporter 8"""	603076				8659545, 16870176	Standard	NM_016818		Approved	ABC8	uc002zaq.3	P45844	OTTHUMG00000086791	ENST00000361802.2:c.881A>G	chr21.hg19:g.43706012A>G	ENSP00000354995:p.Gln294Arg	0					ABCG1_ENST00000398449.3_Missense_Mutation_p.Q294R|ABCG1_ENST00000398457.2_Missense_Mutation_p.Q296R|ABCG1_ENST00000340588.4_Missense_Mutation_p.Q402R|ABCG1_ENST00000343687.3_Missense_Mutation_p.Q305R|ABCG1_ENST00000462050.1_3'UTR|ABCG1_ENST00000347800.2_Missense_Mutation_p.Q291R|ABCG1_ENST00000398437.1_Missense_Mutation_p.Q440R	p.Q294R	NM_004915.3	NP_004906.3	0	1	1	2.008717	P45844	ABCG1_HUMAN		8	1026	+			Q86SU8|Q96L76|Q9BXK6|Q9BXK7|Q9BXK8|Q9BXK9|Q9BXL0|Q9BXL1|Q9BXL2|Q9BXL3|Q9BXL4	Missense_Mutation	SNP	ENST00000361802.2	1	1	hg19	c.881A>G	CCDS13682.1	0	.	.	.	.	.	.	.	.	.	.	A	17.08	3.296969	0.60086	.	.	ENSG00000160179	ENST00000398457;ENST00000347800;ENST00000398449;ENST00000361802;ENST00000343687;ENST00000398437;ENST00000340588	T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89;0.89	4.04	4.04	0.47022	4.04	4.04	0.47022	ABC transporter-like (1);	0.000000	0.85682	D	0.000000	T	0.29389	0.0732	N	0.00841	-1.15	0.80722	D	1	B;B;D;B;B;D	0.67145	0.11;0.02;0.996;0.057;0.049;0.981	B;B;P;B;B;D	0.67900	0.074;0.032;0.889;0.032;0.061;0.954	T	0.44787	-0.9305	9	.	.	.	-14.5189	13.2943	0.60288	1.0:0.0:0.0:0.0	.	305;305;294;294;291;296	B4DPT7;P45844-2;P45844;P45844-4;P45844-5;P45844-3	.;.;ABCG1_HUMAN;.;.;.	R	296;291;294;294;305;440;402	ENSP00000381475:Q296R;ENSP00000291524:Q291R;ENSP00000381467:Q294R;ENSP00000354995:Q294R;ENSP00000339744:Q305R;ENSP00000381464:Q440R;ENSP00000343820:Q402R	.	Q	+	2	0	0	ABCG1	42579081	42579081	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	8.449000	0.90337	1.581000	0.49865	0.482000	0.46254	CAA	0.297894		TCGA-2J-AAB4-01A-12D-A40W-08	0.493	ABCG1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195318.2	1	0	1		2	2	2	0		0	0	256		256	253	1	1.950000	-20.000000	1	0.300000	NM_207174			115	112		796	786	1		1	1		0	0	256	0		1.000000	9.999769e-01	0	38	0	66	0	115	796
USP34	9736	broad.mit.edu	37	2	61448662	61448662	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr2:61448662G>A	ENST00000398571.2	-	66	7950	c.7874C>T	c.(7873-7875)tCt>tTt	p.S2625F	USP34_ENST00000472689.1_5'UTR	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2625					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CAGAATATAAGATGCAAAGGG	0.383																																						ENST00000398571.2	1.000000	6.400000e-01	1	7.800000e-01	0.940000	0.908524	0.940000	1.000000																										0				138						c.(7873-7875)tCt>tTt		ubiquitin specific peptidase 34							81.0	77.0	78.0					2																	61448662		1869	4105	5974	SO:0001583	missense	9736	0	0					g.chr2:61448662G>A	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.7874C>T	chr2.hg19:g.61448662G>A	ENSP00000381577:p.Ser2625Phe	0					USP34_ENST00000472689.1_5'UTR	p.S2625F	NM_014709.3	NP_055524.3	0	0	0	2.001658	Q70CQ2	UBP34_HUMAN	Epithelial(17;0.229)	66	7950	-			A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	1	1	hg19	c.7874C>T	CCDS42686.1	1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.619780	0.87460	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.36699	1.24	6.07	6.07	0.98685	6.07	6.07	0.98685	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.43366	0.1244	L	0.36672	1.1	0.80722	D	1	D	0.56968	0.978	P	0.54664	0.758	T	0.04811	-1.0925	10	0.09590	T	0.72	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	2625	Q70CQ2	UBP34_HUMAN	F	2473;2473;2625	ENSP00000381577:S2625F	ENSP00000263989:S2473F	S	-	2	0	0	USP34	61302166	61302166	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.701000	0.98710	2.885000	0.99019	0.655000	0.94253	TCT	0.295775		TCGA-2J-AAB4-01A-12D-A40W-08	0.383	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4	1	0	1		2	2	2	0		0	0	42		42	39	1	1.950000	-3.332045	1	0.300000				25	25		150	149	1		1	1		0	0	42	0		1.000000	8.705726e-01	0	5	0	19	0	25	150
DNER	92737	broad.mit.edu	37	2	230312173	230312173	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr2:230312173C>T	ENST00000341772.4	-	8	1479	c.1345G>A	c.(1345-1347)Ggg>Agg	p.G449R		NM_139072.3	NP_620711.3	Q8NFT8	DNER_HUMAN	delta/notch-like EGF repeat containing	449	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|glial cell differentiation (GO:0010001)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|skeletal muscle fiber development (GO:0048741)|synapse assembly (GO:0007416)	dendrite (GO:0030425)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	63		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		AAGTGTACCCCGTCCACATAG	0.572																																						ENST00000341772.4	1.000000	5.400000e-01	1	6.800000e-01	0.850000	0.846710	0.850000	1.000000																										0				63						c.(1345-1347)Ggg>Agg		delta/notch-like EGF repeat containing							55.0	52.0	53.0					2																	230312173		2203	4300	6503	SO:0001583	missense	92737	2	121412	38				g.chr2:230312173C>T	AY358891	CCDS33390.1	2q36.3	2006-10-26			ENSG00000187957	ENSG00000187957			24456	protein-coding gene	gene with protein product		607299				11950833, 11997712	Standard	NM_139072		Approved	UNQ26, bet	uc002vpv.3	Q8NFT8	OTTHUMG00000153637	ENST00000341772.4:c.1345G>A	chr2.hg19:g.230312173C>T	ENSP00000345229:p.Gly449Arg	0						p.G449R	NM_139072.3	NP_620711.3	0	0	0	2.001658	Q8NFT8	DNER_HUMAN		8	1479	-		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)	A6NP39|Q53R88|Q53TP7|Q53TQ5|Q8IYT0|Q8TB42|Q9NTF1|Q9UDM2	Missense_Mutation	SNP	ENST00000341772.4	1	1	hg19	c.1345G>A	CCDS33390.1	1	.	.	.	.	.	.	.	.	.	.	C	5.804	0.332713	0.11013	.	.	ENSG00000187957	ENST00000341772	D	0.87412	-2.25	4.94	4.01	0.46588	4.94	4.01	0.46588	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.209202	0.49916	D	0.000132	T	0.78660	0.4318	L	0.42529	1.33	0.46499	D	0.999072	B	0.25719	0.132	B	0.18871	0.023	T	0.70952	-0.4732	10	0.15066	T	0.55	.	9.0768	0.36527	0.0:0.6526:0.2599:0.0876	.	449	Q8NFT8	DNER_HUMAN	R	449	ENSP00000345229:G449R	ENSP00000345229:G449R	G	-	1	0	0	DNER	230020417	230020417	0.942000	0.31987	0.080000	0.20451	0.198000	0.23893	2.742000	0.47434	2.442000	0.82660	0.655000	0.94253	GGG	0.295775		TCGA-2J-AAB4-01A-12D-A40W-08	0.572	DNER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331902.1	1	0	1		2	2	2	0		0	0	25		25	25	1	1.950000	-2.723487	1	0.300000	NM_139072			19	18		128	122	1		1	0		0	0	25	0		0.999990	0	0	0	0	1	0	19	128
FBLN2	2199	broad.mit.edu	37	3	13679189	13679189	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr3:13679189G>A	ENST00000295760.7	+	17	3394	c.3325G>A	c.(3325-3327)Gcg>Acg	p.A1109T	FBLN2_ENST00000404922.3_Missense_Mutation_p.A1156T|FBLN2_ENST00000535798.1_Missense_Mutation_p.A1135T|FBLN2_ENST00000492059.1_Missense_Mutation_p.A1156T	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	1109	Domain III.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)	p.A1156T(2)|p.A575T(2)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CATTGGCCCCGCGCCAGCCTT	0.622																																						ENST00000295760.7	0.530000	1.100000e-01	4.000000e-01	1.800000e-01	0.280000	0.299381	0.280000	0.260000																										4	Substitution - Missense(4)	p.A1156T(2)|p.A575T(2)	large_intestine(2)|prostate(2)	24						c.(3325-3327)Gcg>Acg		fibulin 2							43.0	48.0	46.0					3																	13679189		2154	4245	6399	SO:0001583	missense	2199	0	0					g.chr3:13679189G>A	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.3325G>A	chr3.hg19:g.13679189G>A	ENSP00000295760:p.Ala1109Thr	0					FBLN2_ENST00000492059.1_Missense_Mutation_p.A1156T|FBLN2_ENST00000404922.3_Missense_Mutation_p.A1156T|FBLN2_ENST00000535798.1_Missense_Mutation_p.A1135T	p.A1109T	NM_001998.2	NP_001989.2	0	1	1	2.008791	P98095	FBLN2_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)	17	3394	+			B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	0	1	hg19	c.3325G>A	CCDS46762.1	0	.	.	.	.	.	.	.	.	.	.	G	12.47	1.946543	0.34377	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	T;T;T;T	0.79554	-1.28;-1.24;-1.19;-1.24	4.6	2.63	0.31362	4.6	2.63	0.31362	.	0.194173	0.46442	D	0.000286	T	0.44871	0.1314	N	0.01729	-0.75	0.35567	D	0.805155	B;P;P	0.48998	0.313;0.918;0.72	B;B;B	0.34138	0.058;0.176;0.131	T	0.54221	-0.8326	10	0.14656	T	0.56	.	5.867	0.18781	0.1026:0.0:0.5213:0.376	.	1109;1156;1135	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	T	1135;1156;1109;1156	ENSP00000445705:A1135T;ENSP00000384169:A1156T;ENSP00000295760:A1109T;ENSP00000420042:A1156T	ENSP00000295760:A1109T	A	+	1	0	0	FBLN2	13654190	13654190	0.993000	0.37304	0.747000	0.31113	0.616000	0.37450	3.099000	0.50267	1.157000	0.42530	0.462000	0.41574	GCG	0.297894		TCGA-2J-AAB4-01A-12D-A40W-08	0.622	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	0	0	1		2	2	2	0		0	0	34		34	34	1	1.950000	-8.786218	1	0.300000	NM_001004019			6	6		145	140	0		1	0	1	0	0	34	651		0.962180	9.763739e-01	9.998847e-01	0	8	169	555	6	145
WDR48	57599	broad.mit.edu	37	3	39136218	39136218	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr3:39136218G>A	ENST00000302313.5	+	19	2046	c.2018G>A	c.(2017-2019)cGt>cAt	p.R673H	WDR48_ENST00000544962.1_Missense_Mutation_p.R398H|WDR48_ENST00000396258.3_Missense_Mutation_p.R591H|WDR48_ENST00000418020.1_Missense_Mutation_p.R117H|WDR48_ENST00000466405.1_3'UTR	NM_020839.2	NP_065890.1	Q8TAF3	WDR48_HUMAN	WD repeat domain 48	673					double-strand break repair via homologous recombination (GO:0000724)|embryonic organ development (GO:0048568)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|positive regulation of epithelial cell proliferation (GO:0050679)|protein deubiquitination (GO:0016579)|regulation of protein monoubiquitination (GO:1902525)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CTCCATTACCGTCAGAAGTCC	0.473																																						ENST00000302313.5	1.000000	8.700000e-01	1	9.700000e-01	0.990000	0.987584	0.990000	1.000000																										0				15						c.(2017-2019)cGt>cAt		WD repeat domain 48							142.0	136.0	138.0					3																	39136218		2203	4300	6503	SO:0001583	missense	57599	4	121412	37				g.chr3:39136218G>A	AF468833	CCDS33738.1	3p21.33	2014-06-16			ENSG00000114742	ENSG00000114742		"""WD repeat domain containing"""	30914	protein-coding gene	gene with protein product		612167				10819331, 12196293, 24482476	Standard	NM_020839		Approved	KIAA1449, P80, SPG60	uc003cit.3	Q8TAF3	OTTHUMG00000155972	ENST00000302313.5:c.2018G>A	chr3.hg19:g.39136218G>A	ENSP00000307491:p.Arg673His	0					WDR48_ENST00000418020.1_Missense_Mutation_p.R117H|WDR48_ENST00000396258.3_Missense_Mutation_p.R591H|WDR48_ENST00000544962.1_Missense_Mutation_p.R398H|WDR48_ENST00000466405.1_3'UTR	p.R673H	NM_020839.2	NP_065890.1	0	1	1	2.008791	Q8TAF3	WDR48_HUMAN		19	2046	+			B4DM86|B4DQI2|B4DY84|Q63HJ2|Q658Y1|Q8N3Z1|Q9NSK8|Q9P279	Missense_Mutation	SNP	ENST00000302313.5	1	1	hg19	c.2018G>A	CCDS33738.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.507838	0.96386	.	.	ENSG00000114742	ENST00000302313;ENST00000544962;ENST00000396258;ENST00000418020	T;D;T	0.92699	0.47;-3.09;0.2	5.86	5.86	0.93980	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.96355	0.8811	M	0.79926	2.475	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.74674	0.984;0.961;0.961;0.975	D	0.96242	0.9176	10	0.87932	D	0	-14.2076	20.1865	0.98220	0.0:0.0:1.0:0.0	.	398;591;664;673	Q8TAF3-5;Q8TAF3-4;Q8TAF3-3;Q8TAF3	.;.;.;WDR48_HUMAN	H	673;398;591;117	ENSP00000307491:R673H;ENSP00000445187:R398H;ENSP00000379557:R591H	ENSP00000307491:R673H	R	+	2	0	0	WDR48	39111222	39111222	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	9.799000	0.99117	2.775000	0.95449	0.655000	0.94253	CGT	0.297894		TCGA-2J-AAB4-01A-12D-A40W-08	0.473	WDR48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342529.1	1	0	1		2	2	2	0		0	0	92		92	89	1	1.950000	-20.000000	1	0.300000	NM_020839			73	72		371	370	1		1	1		0	0	92	0		1.000000	9.919798e-01	0	6	0	34	0	73	371
ADAMTS9	56999	broad.mit.edu	37	3	64526867	64526867	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr3:64526867G>A	ENST00000498707.1	-	36	5767	c.5425C>T	c.(5425-5427)Cgg>Tgg	p.R1809W	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.R1781W	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1809	GON. {ECO:0000255|PROSITE- ProRule:PRU00383}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TCATCGCGCCGGCTCCCGTTA	0.473																																						ENST00000498707.1	1.000000	9.600000e-01	1	9.900000e-01	0.990000	0.998181	0.990000	1.000000																										0				100						c.(5425-5427)Cgg>Tgg		ADAM metallopeptidase with thrombospondin type 1 motif, 9							75.0	78.0	77.0					3																	64526867		2203	4300	6503	SO:0001583	missense	56999	1	121412	32				g.chr3:64526867G>A	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.5425C>T	chr3.hg19:g.64526867G>A	ENSP00000418735:p.Arg1809Trp	0					ADAMTS9_ENST00000295903.4_Missense_Mutation_p.R1781W	p.R1809W	NM_182920.1	NP_891550.1	0	1	1	2.008791	Q9P2N4	ATS9_HUMAN		36	5767	-		Lung NSC(201;0.00682)	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	1	1	hg19	c.5425C>T	CCDS2903.1	1	.	.	.	.	.	.	.	.	.	.	G	16.56	3.156860	0.57259	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.19394	2.15;2.15	5.73	3.76	0.43208	5.73	3.76	0.43208	Peptidase M12B, GON-ADAMTSs (2);	0.000000	0.85682	D	0.000000	T	0.49779	0.1577	M	0.86864	2.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.57015	-0.7883	10	0.87932	D	0	.	13.0992	0.59210	0.0:0.0:0.6673:0.3327	.	1781;1809	B7ZVX9;Q9P2N4	.;ATS9_HUMAN	W	1781;1809	ENSP00000295903:R1781W;ENSP00000418735:R1809W	ENSP00000295903:R1781W	R	-	1	2	2	ADAMTS9	64501907	64501907	1.000000	0.71417	0.998000	0.56505	0.359000	0.29487	2.444000	0.44890	2.706000	0.92434	0.655000	0.94253	CGG	0.297894		TCGA-2J-AAB4-01A-12D-A40W-08	0.473	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1	1	0	1		2	2	2	0		0	0	116		116	116	1	1.950000	-20.000000	1	0.300000				84	83		384	375	1		1	1		0	0	116	0		1.000000	9.586280e-01	0	5	0	21	0	84	384
PPP4R2	151987	broad.mit.edu	37	3	73047308	73047308	+	Splice_Site	SNP	A	A	G	rs150423598		TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr3:73047308A>G	ENST00000356692.5	+	2	368	c.115A>G	c.(115-117)Atg>Gtg	p.M39V	PPP4R2_ENST00000394284.3_Splice_Site_p.I39V|PPP4R2_ENST00000295862.9_5'UTR|PPP4R2_ENST00000495566.1_Splice_Site_p.M39V			Q9NY27	PP4R2_HUMAN	protein phosphatase 4, regulatory subunit 2	39					cellular protein modification process (GO:0006464)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA processing (GO:0006397)|regulation of catalytic activity (GO:0050790)|regulation of double-strand break repair via homologous recombination (GO:0010569)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)	protein binding, bridging (GO:0030674)|protein phosphatase type 4 regulator activity (GO:0030362)			breast(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|stomach(1)|urinary_tract(2)	12		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)		TGGAGAAACAATGTGAGTTGA	0.348																																						ENST00000356692.5	1.000000	6.700000e-01	9.500000e-01	7.500000e-01	0.840000	0.851242	0.840000	1.000000																										0				12						c.(115-117)Atg>Gtg		protein phosphatase 4, regulatory subunit 2		A	VAL/MET	0,4406		0,0,2203	94.0	96.0	95.0		115	5.5	1.0	3	dbSNP_134	95	1,8599	1.2+/-3.3	0,1,4299	no	missense-near-splice	PPP4R2	NM_174907.2	21	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	39/418	73047308	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	151987	1	121410	36				g.chr3:73047308A>G	AJ271448	CCDS2917.1	3q29	2010-06-18			ENSG00000163605	ENSG00000163605		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	18296	protein-coding gene	gene with protein product		613822				10769191	Standard	NM_174907		Approved		uc003dph.1	Q9NY27	OTTHUMG00000158816	ENST00000356692.5:c.116+1A>G	chr3.hg19:g.73047308A>G		0					PPP4R2_ENST00000295862.9_5'UTR|PPP4R2_ENST00000495566.1_Splice_Site_p.M39V|PPP4R2_ENST00000394284.3_Splice_Site_p.I39V	p.M39V			0	1	1	2.008791	Q9NY27	PP4R2_HUMAN		2	368	+		Prostate(10;0.0187)|Lung SC(41;0.236)	A8K1I6|Q2TAJ9|Q498B8|Q8WXX6	Splice_Site	SNP	ENST00000356692.5	0	0	hg19	c.115A>G	CCDS2917.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.536|9.536	1.112046|1.112046	0.20795|0.20795	0.0|0.0	1.16E-4|1.16E-4	ENSG00000163605|ENSG00000163605	ENST00000394284|ENST00000356692;ENST00000488810;ENST00000495566;ENST00000476505	T|T;T;T;T	0.40756|0.39406	1.02|1.08;1.08;1.08;1.08	5.46|5.46	5.46|5.46	0.80206|0.80206	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	.|0.122413	.|0.64402	.|D	.|0.000001	T|T	0.25606|0.25606	0.0623|0.0623	N|N	0.20328|0.20328	0.56|0.56	0.80722|0.80722	D|D	1|1	B|B	0.02656|0.02656	0.0|0.0	B|B	0.01281|0.04013	0.0|0.001	T|T	0.11179|0.11179	-1.0598|-1.0598	8|9	.|.	.|.	.|.	.|.	9.1019|9.1019	0.36673|0.36673	0.9171:0.0:0.0829:0.0|0.9171:0.0:0.0829:0.0	.|.	39|39	Q9NY27-2|Q9NY27	.|PP4R2_HUMAN	V|V	39|39;39;39;1	ENSP00000377825:I39V|ENSP00000349124:M39V;ENSP00000418750:M39V;ENSP00000418675:M39V;ENSP00000420098:M1V	.|.	I|M	+|+	1|1	0|0	0|0	PPP4R2|PPP4R2	73129998|73129998	73129998|73129998	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	3.326000|3.326000	0.52037|0.52037	2.077000|2.077000	0.62373|0.62373	0.533000|0.533000	0.62120|0.62120	ATT|ATG	0.297894		TCGA-2J-AAB4-01A-12D-A40W-08	0.348	PPP4R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352321.1	1	0	1		2	2	2	0		0	0	155		155	155	1	1.950000	-20.000000	1	0.300000	NM_174907	Missense_Mutation		70	70		478	472	1		1	0		0	0	155	0		1.000000	9.609307e-01	0	1	0	37	0	70	478
ACAP2	23527	broad.mit.edu	37	3	195027287	195027287	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr3:195027287G>A	ENST00000326793.6	-	13	1299	c.1069C>T	c.(1069-1071)Cag>Tag	p.Q357*		NM_012287.5	NP_036419.3	Q15057	ACAP2_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	357	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cellular response to nerve growth factor stimulus (GO:1990090)|protein localization to endosome (GO:0036010)|regulation of ARF GTPase activity (GO:0032312)	endosome membrane (GO:0010008)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	27						ATACTGGTCTGAACAGCCTTA	0.383																																						ENST00000326793.6	1.000000	6.900000e-01	9.300000e-01	7.600000e-01	0.840000	0.850098	0.840000	0.850000																										0				27						c.(1069-1071)Cag>Tag		ArfGAP with coiled-coil, ankyrin repeat and PH domains 2							177.0	178.0	178.0					3																	195027287		2203	4300	6503	SO:0001587	stop_gained	23527	0	0					g.chr3:195027287G>A		CCDS33924.1	3q29	2013-01-10	2008-09-22	2008-09-22	ENSG00000114331	ENSG00000114331		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16469	protein-coding gene	gene with protein product		607766	"""centaurin, beta 2"""	CENTB2		11050434, 11062263	Standard	NM_012287		Approved	KIAA0041, CNT-B2	uc003fun.4	Q15057	OTTHUMG00000155885	ENST00000326793.6:c.1069C>T	chr3.hg19:g.195027287G>A	ENSP00000324287:p.Gln357*	0						p.Q357*	NM_012287.5	NP_036419.3	0	1	1	2.008791	Q15057	ACAP2_HUMAN		13	1299	-			A8K2V4|Q8N5Z8|Q9UQR3	Nonsense_Mutation	SNP	ENST00000326793.6	0	1	hg19	c.1069C>T	CCDS33924.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.017412|6.017412	0.97205|0.97205	.|.	.|.	ENSG00000114331|ENSG00000114331	ENST00000326793|ENST00000439758	.|.	.|.	.|.	5.55|5.55	5.55|5.55	0.83447|0.83447	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	0.051792|.	0.85682|.	D|.	0.000000|.	.|T	.|0.74869	.|0.3773	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73167	.|-0.4068	.|3	0.72032|.	D|.	0.01|.	.|.	18.484|18.484	0.90821|0.90821	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	357|231	.|.	ENSP00000324287:Q357X|.	Q|S	-|-	1|2	0|0	0|0	ACAP2|ACAP2	196508576|196508576	196508576|196508576	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.869000|9.869000	0.99810|0.99810	2.593000|2.593000	0.87608|0.87608	0.511000|0.511000	0.50034|0.50034	CAG|TCA	0.297894		TCGA-2J-AAB4-01A-12D-A40W-08	0.383	ACAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342126.2	1	0	1		2	2	2	0		0	0	196		196	195	1	1.950000	-20.000000	1	0.300000	NM_012287			95	95		650	639	1		1	0		0	0	196	0		1.000000	7.679020e-01	0	0	0	21	0	95	650
EVC	2121	broad.mit.edu	37	4	5800472	5800472	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr4:5800472C>T	ENST00000264956.6	+	15	2441	c.2257C>T	c.(2257-2259)Cgg>Tgg	p.R753W	EVC_ENST00000382674.2_Missense_Mutation_p.R753W|EVC_ENST00000515113.1_3'UTR	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	753					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				GGTGCATGCACGGAATGCAGC	0.637																																						ENST00000264956.6	1.000000	3.200000e-01	8.900000e-01	4.700000e-01	0.660000	0.678718	0.660000	1.000000																										0				28						c.(2257-2259)Cgg>Tgg		Ellis van Creveld syndrome							23.0	20.0	21.0					4																	5800472		2194	4285	6479	SO:0001583	missense	2121	2	121222	26				g.chr4:5800472C>T	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.2257C>T	chr4.hg19:g.5800472C>T	ENSP00000264956:p.Arg753Trp	0					EVC_ENST00000515113.1_3'UTR|EVC_ENST00000382674.2_Missense_Mutation_p.R753W	p.R753W	NM_153717.2	NP_714928.1	0	0	0	1.999802	P57679	EVC_HUMAN		15	2441	+		Myeloproliferative disorder(84;0.117)		Missense_Mutation	SNP	ENST00000264956.6	0	1	hg19	c.2257C>T	CCDS3383.1	0	.	.	.	.	.	.	.	.	.	.	C	12.61	1.988209	0.35036	.	.	ENSG00000072840	ENST00000264956;ENST00000382674	T;T	0.59906	0.23;0.23	5.08	4.21	0.49690	5.08	4.21	0.49690	.	0.273076	0.32640	N	0.005837	T	0.72334	0.3447	M	0.66939	2.045	0.38150	D	0.938729	D	0.89917	1.0	D	0.87578	0.998	T	0.76602	-0.2899	10	0.62326	D	0.03	.	12.2208	0.54433	0.178:0.822:0.0:0.0	.	753	P57679	EVC_HUMAN	W	753	ENSP00000264956:R753W;ENSP00000372120:R753W	ENSP00000264956:R753W	R	+	1	2	2	EVC	5851373	5851373	0.143000	0.22626	0.024000	0.17045	0.027000	0.11550	0.701000	0.25616	1.068000	0.40764	0.561000	0.74099	CGG	0.295775		TCGA-2J-AAB4-01A-12D-A40W-08	0.637	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1	1	0	1		2	2	2	0		0	0	11		11	11	1	1.950000	-13.816400	1	0.300000				8	8		74	73	0		1	0		0	0	11	0		0.990089	9.700929e-02	0	0	0	5	0	8	74
PCDHA11	56138	broad.mit.edu	37	5	140250312	140250312	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr5:140250312C>T	ENST00000398640.2	+	1	1624	c.1624C>T	c.(1624-1626)Ccg>Tcg	p.P542S	PCDHA6_ENST00000527624.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	542	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCGGGCGTGCCGCCTCTGAG	0.692																																						ENST00000398640.2	0.140000	2.000000e-02	1.100000e-01	4.000000e-02	0.070000	0.079458	0.070000	0.070000																										0				2						c.(1624-1626)Ccg>Tcg		protocadherin alpha 11							73.0	81.0	78.0					5																	140250312		2202	4298	6500	SO:0001583	missense	56138	0	0					g.chr5:140250312C>T	AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1624C>T	chr5.hg19:g.140250312C>T	ENSP00000381636:p.Pro542Ser	0					PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA8_ENST00000531613.1_Intron	p.P542S	NM_018902.3	NP_061725.1	1	2	3	2.015780	Q9Y5I1	PCDAB_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1624	+			B2RN58|O75279	Missense_Mutation	SNP	ENST00000398640.2	0	1	hg19	c.1624C>T	CCDS47284.1	0	.	.	.	.	.	.	.	.	.	.	C	19.23	3.788483	0.70337	.	.	ENSG00000249158	ENST00000398640	T	0.56776	0.44	5.15	5.15	0.70609	5.15	5.15	0.70609	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.78698	0.4324	M	0.92026	3.265	0.35643	D	0.811176	D;D	0.89917	1.0;1.0	D;D	0.71414	0.969;0.973	D	0.87476	0.2417	9	0.87932	D	0	.	18.2779	0.90089	0.0:1.0:0.0:0.0	.	542;542	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	S	542	ENSP00000381636:P542S	ENSP00000381636:P542S	P	+	1	0	0	PCDHA11	140230496	140230496	0.999000	0.42202	0.994000	0.49952	0.949000	0.60115	5.585000	0.67497	2.398000	0.81561	0.556000	0.70494	CCG	0.301048		TCGA-2J-AAB4-01A-12D-A40W-08	0.692	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	0	0	1		2	2	2	0		0	0	159		159	156	1	1.950000	-2.017701	0	0.300000	NM_018902			7	8		661	631	0		1			0	0	159	0		0.977381	0	0	0	0	0	0	7	661
GABBR1	2550	broad.mit.edu	37	6	29574715	29574715	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr6:29574715C>T	ENST00000377034.4	-	18	2511	c.2176G>A	c.(2176-2178)Gcc>Acc	p.A726T	GABBR1_ENST00000377012.4_Missense_Mutation_p.A609T|GABBR1_ENST00000376977.3_3'UTR|GABBR1_ENST00000355973.3_Missense_Mutation_p.A609T|GABBR1_ENST00000377016.4_Missense_Mutation_p.A664T	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	726					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)	p.A726T(1)		endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	TGCCAGATGGCGAGAGTGAGG	0.577																																						ENST00000377034.4	0.990000	5.800000e-01	9.200000e-01	6.800000e-01	0.800000	0.805092	0.800000	0.810000																										1	Substitution - Missense(1)	p.A726T(1)	prostate(1)	47						c.(2176-2178)Gcc>Acc		gamma-aminobutyric acid (GABA) B receptor, 1	Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)						95.0	83.0	87.0					6																	29574715		1511	2709	4220	SO:0001583	missense	2550	1	121408	32				g.chr6:29574715C>T	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.2176G>A	chr6.hg19:g.29574715C>T	ENSP00000366233:p.Ala726Thr	1					GABBR1_ENST00000355973.3_Missense_Mutation_p.A609T|GABBR1_ENST00000377016.4_Missense_Mutation_p.A664T|GABBR1_ENST00000376977.3_3'UTR|GABBR1_ENST00000377012.4_Missense_Mutation_p.A609T	p.A726T	NM_001470.2	NP_001461.1	0	1	1	1.716742	Q9UBS5	GABR1_HUMAN		18	2511	-			B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	ENST00000377034.4	1	1	hg19	c.2176G>A	CCDS4663.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.202|8.202	0.798448|0.798448	0.16397|0.16397	.|.	.|.	ENSG00000204681|ENSG00000204681	ENST00000355973;ENST00000377016;ENST00000377012;ENST00000377034|ENST00000485026	D;D;D;D|.	0.87491|.	-2.26;-2.26;-2.26;-2.26|.	4.27|4.27	4.27|4.27	0.50696|0.50696	4.27|4.27	4.27|4.27	0.50696|0.50696	GPCR, family 3, C-terminal (2);|.	0.374080|.	0.26109|.	N|.	0.026294|.	T|T	0.14227|0.14227	0.0344|0.0344	N|N	0.01624|0.01624	-0.795|-0.795	0.47308|0.47308	D|D	0.999387|0.999387	P;P;P|.	0.48503|.	0.911;0.91;0.91|.	B;B;B|.	0.38056|.	0.224;0.264;0.195|.	T|T	0.16100|0.16100	-1.0414|-1.0414	10|5	0.14656|.	T|.	0.56|.	-14.1093|-14.1093	14.5609|14.5609	0.68136|0.68136	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	664;726;609|.	Q9UBS5-3;Q9UBS5;Q5SUJ9|.	.;GABR1_HUMAN;.|.	T|H	609;664;609;726|106	ENSP00000348248:A609T;ENSP00000366215:A664T;ENSP00000366211:A609T;ENSP00000366233:A726T|.	ENSP00000348248:A609T|.	A|R	-|-	1|2	0|0	0|0	GABBR1|GABBR1	29682694|29682694	29682694|29682694	0.852000|0.852000	0.29690|0.29690	0.930000|0.930000	0.37139|0.37139	0.882000|0.882000	0.50991|0.50991	1.632000|1.632000	0.37102|0.37102	2.075000|2.075000	0.62263|0.62263	0.563000|0.563000	0.77884|0.77884	GCC|CGC	0.179367		TCGA-2J-AAB4-01A-12D-A40W-08	0.577	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3	1	0	1		2	2	2	0		0	0	48		48	48	1	1.950000	-3.228534	1	0.300000				35	34		207	204	1		1	1		0	0	48	0		1.000000	9.867191e-01	0	5	0	38	0	35	207
ABCC10	89845	broad.mit.edu	37	6	43413586	43413586	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr6:43413586C>T	ENST00000372530.4	+	15	3495	c.3280C>T	c.(3280-3282)Cgc>Tgc	p.R1094C	ABCC10_ENST00000244533.3_Missense_Mutation_p.R1066C	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	1094	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	GGAGCTGCGGCGCCTGGGCAG	0.652																																						ENST00000372530.4	1.000000	7.200000e-01	1	8.500000e-01	0.980000	0.943224	0.980000	1.000000																										0				56						c.(3280-3282)Cgc>Tgc		ATP-binding cassette, sub-family C (CFTR/MRP), member 10	Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)						33.0	35.0	34.0					6																	43413586		2202	4299	6501	SO:0001583	missense	89845	5	121400	37				g.chr6:43413586C>T	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.3280C>T	chr6.hg19:g.43413586C>T	ENSP00000361608:p.Arg1094Cys	0					ABCC10_ENST00000244533.3_Missense_Mutation_p.R1066C	p.R1094C	NM_001198934.1	NP_001185863.1	0	0	0	2.000252	Q5T3U5	MRP7_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)	15	3495	+	all_lung(25;0.00536)		Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	ENST00000372530.4	1	1	hg19	c.3280C>T	CCDS56430.1	1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.299799	0.81136	.	.	ENSG00000124574	ENST00000372530;ENST00000244533	D;D	0.94376	-3.41;-3.41	4.81	3.92	0.45320	4.81	3.92	0.45320	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.97321	0.9124	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98014	1.0367	10	0.87932	D	0	-11.614	12.2499	0.54591	0.3088:0.6912:0.0:0.0	.	1066;1094	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	C	1094;1066	ENSP00000361608:R1094C;ENSP00000244533:R1066C	ENSP00000244533:R1066C	R	+	1	0	0	ABCC10	43521564	43521564	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.755000	0.68750	1.200000	0.43188	0.655000	0.94253	CGC	0.295775		TCGA-2J-AAB4-01A-12D-A40W-08	0.652	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	1	0	1		2	2	2	0		0	0	42		42	42	1	1.950000	-3.231492	1	0.300000	NM_033450			39	38		221	214	1		1	1		0	0	42	0		1.000000	9.322959e-01	0	7	0	21	0	39	221
KLHL31	401265	broad.mit.edu	37	6	53519025	53519025	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr6:53519025G>A	ENST00000407079.1	-	1	1045	c.1046C>T	c.(1045-1047)aCg>aTg	p.T349M	KLHL31_ENST00000370905.3_Missense_Mutation_p.T349M			Q9H511	KLH31_HUMAN	kelch-like family member 31	349					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(3)	20	Lung NSC(77;0.0158)					TGGCATTTCCGTAAGCTTGCT	0.483																																						ENST00000407079.1	0.200000	3.000000e-02	1.500000e-01	5.000000e-02	0.090000	0.108222	0.090000	0.090000																										0				20						c.(1045-1047)aCg>aTg		kelch-like family member 31							105.0	100.0	102.0					6																	53519025		2203	4300	6503	SO:0001583	missense	401265	0	0					g.chr6:53519025G>A		CCDS34478.1	6p12.1	2013-09-27	2013-02-22	2007-01-09	ENSG00000124743	ENSG00000124743		"""Kelch-like"", ""BTB/POZ domain containing"""	21353	protein-coding gene	gene with protein product		610749	"""kelch repeat and BTB (POZ) domain containing 1"", ""kelch-like 31 (Drosophila)"""	KBTBD1			Standard	NM_001003760		Approved	bA345L23.2, BKLHD6	uc003pcb.4	Q9H511	OTTHUMG00000014882	ENST00000407079.1:c.1046C>T	chr6.hg19:g.53519025G>A	ENSP00000384644:p.Thr349Met	0					KLHL31_ENST00000370905.3_Missense_Mutation_p.T349M	p.T349M			0	0	0	2.000252	Q9H511	KLH31_HUMAN		1	1045	-	Lung NSC(77;0.0158)		A6N9J2|B2RP49	Missense_Mutation	SNP	ENST00000407079.1	0	1	hg19	c.1046C>T	CCDS34478.1	0	.	.	.	.	.	.	.	.	.	.	G	17.70	3.453374	0.63290	.	.	ENSG00000124743	ENST00000370905;ENST00000407079	T;T	0.68025	-0.3;-0.3	5.25	5.25	0.73442	5.25	5.25	0.73442	Galactose oxidase, beta-propeller (1);	0.095468	0.64402	D	0.000001	T	0.75852	0.3906	M	0.82716	2.605	0.58432	D	0.999994	D	0.76494	0.999	P	0.57283	0.817	T	0.80621	-0.1301	10	0.87932	D	0	.	15.4902	0.75600	0.0:0.1482:0.8518:0.0	.	349	Q9H511	KLH31_HUMAN	M	349	ENSP00000359942:T349M;ENSP00000384644:T349M	ENSP00000359942:T349M	T	-	2	0	0	KLHL31	53626984	53626984	1.000000	0.71417	0.994000	0.49952	0.980000	0.70556	7.818000	0.86416	2.467000	0.83353	0.561000	0.74099	ACG	0.295775		TCGA-2J-AAB4-01A-12D-A40W-08	0.483	KLHL31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040965.1	0	0	1		2	2	2	0		0	0	102		102	102	1	1.950000	-2.509486	1	0.300000	NM_001003760			5	5		358	355	0		1	0		0	0	102	0		0.936587	3.143948e-04	0	0	0	2	0	5	358
SYNE1	23345	broad.mit.edu	37	6	152539461	152539461	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr6:152539461T>C	ENST00000367255.5	-	121	22723	c.22122A>G	c.(22120-22122)atA>atG	p.I7374M	SYNE1_ENST00000341594.5_Missense_Mutation_p.I6986M|SYNE1_ENST00000265368.4_Missense_Mutation_p.I7374M|SYNE1_ENST00000356820.4_Missense_Mutation_p.I1898M|SYNE1_ENST00000423061.1_Missense_Mutation_p.I7303M|SYNE1_ENST00000448038.1_Missense_Mutation_p.I7303M	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7374					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GCCCTTGTAGTATTTCTTCAG	0.433										HNSCC(10;0.0054)																												ENST00000367255.5	1.000000	8.500000e-01	1	9.100000e-01	0.970000	0.965202	0.970000	1.000000																										0				524						c.(22120-22122)atA>atG		spectrin repeat containing, nuclear envelope 1							221.0	230.0	227.0					6																	152539461		2203	4300	6503	SO:0001583	missense	23345	0	0					g.chr6:152539461T>C	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.22122A>G	chr6.hg19:g.152539461T>C	ENSP00000356224:p.Ile7374Met	0	HNSCC(10;0.0054)				SYNE1_ENST00000341594.5_Missense_Mutation_p.I6986M|SYNE1_ENST00000265368.4_Missense_Mutation_p.I7374M|SYNE1_ENST00000448038.1_Missense_Mutation_p.I7303M|SYNE1_ENST00000356820.4_Missense_Mutation_p.I1898M|SYNE1_ENST00000423061.1_Missense_Mutation_p.I7303M	p.I7374M	NM_182961.3	NP_892006.3	0	0	0	2.000252	Q8NF91	SYNE1_HUMAN	BRCA - Breast invasive adenocarcinoma(37;0.243)	121	22723	-		Ovarian(120;0.0955)	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	1	1	hg19	c.22122A>G	CCDS5236.2	1	.	.	.	.	.	.	.	.	.	.	T	12.11	1.839662	0.32513	.	.	ENSG00000131018	ENST00000367255;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000367251	T;T;T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65	5.68	-11.4	0.00090	5.68	-11.4	0.00090	.	0.421595	0.22458	N	0.059793	T	0.14917	0.0360	L	0.34521	1.04	0.09310	N	1	P;P;P;P	0.48764	0.915;0.915;0.896;0.915	P;P;P;P	0.52514	0.701;0.701;0.575;0.701	T	0.26538	-1.0100	10	0.46703	T	0.11	.	1.5785	0.02629	0.2272:0.2006:0.369:0.2032	.	7374;7374;7303;7303	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9	SYNE1_HUMAN;.;.;.	M	7374;20;7303;7374;7303;6986;1898;296	ENSP00000356224:I7374M;ENSP00000356226:I20M;ENSP00000396024:I7303M;ENSP00000265368:I7374M;ENSP00000390975:I7303M;ENSP00000341887:I6986M;ENSP00000349276:I1898M;ENSP00000356220:I296M	ENSP00000265368:I7374M	I	-	3	3	3	SYNE1	152581154	152581154	0.000000	0.05858	0.000000	0.03702	0.251000	0.25915	-1.289000	0.02780	-2.729000	0.00385	-0.321000	0.08615	ATA	0.295775		TCGA-2J-AAB4-01A-12D-A40W-08	0.433	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	1	0	1		2	2	2	0		0	0	330		330	328	1	1.950000	-20.000000	1	0.300000	NM_182961			206	202		1185	1166	1		1	0		0	0	330	0		1.000000	7.399696e-01	0	0	0	17	0	206	1185
DNAH11	8701	broad.mit.edu	37	7	21727066	21727066	+	Silent	SNP	C	C	A	rs372143147		TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr7:21727066C>A	ENST00000409508.3	+	34	5876	c.5845C>A	c.(5845-5847)Cga>Aga	p.R1949R	DNAH11_ENST00000328843.6_Silent_p.R1956R	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1956	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TGAGTTCAACCGAATCTCTGT	0.443									Kartagener syndrome																													ENST00000409508.3	1.000000	6.700000e-01	1	8.300000e-01	0.990000	0.940766	0.990000	1.000000																										0				230						c.(5845-5847)Cga>Aga		dynein, axonemal, heavy chain 11							78.0	82.0	81.0					7																	21727066		2197	4299	6496	SO:0001819	synonymous_variant	8701	2	121396	35	Kartagener syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	g.chr7:21727066C>A	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.5845C>A	chr7.hg19:g.21727066C>A		0					DNAH11_ENST00000328843.6_Silent_p.R1956R	p.R1949R	NM_001277115.1	NP_001264044.1	0	0	0	2.006018	Q96DT5	DYH11_HUMAN		34	5876	+			Q9UJ82	Silent	SNP	ENST00000409508.3	1	1	hg19	c.5845C>A		1																																																																																								0.295775		TCGA-2J-AAB4-01A-12D-A40W-08	0.443	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	0	0	1		2	2	2	0		0	0	32		32	32	1	1.950000	-3.016489	1	0.300000	NM_003777			21	20		114	112	1		1			0	0	32	0		0.999998	0	0	0	0	0	0	21	114
HECW1	23072	broad.mit.edu	37	7	43580819	43580819	+	Silent	SNP	C	C	T			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr7:43580819C>T	ENST00000395891.2	+	25	4682	c.4077C>T	c.(4075-4077)gaC>gaT	p.D1359D	HECW1_ENST00000453890.1_Silent_p.D1325D	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1359	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						ACCTTCTTGACGCTTTCTTCA	0.522																																						ENST00000395891.2	0.860000	5.000000e-01	7.700000e-01	5.800000e-01	0.670000	0.680132	0.670000	0.670000																										0				125						c.(4075-4077)gaC>gaT		HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1							168.0	162.0	164.0					7																	43580819		2005	4171	6176	SO:0001819	synonymous_variant	23072	1	120934	27				g.chr7:43580819C>T	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.4077C>T	chr7.hg19:g.43580819C>T		0					HECW1_ENST00000453890.1_Silent_p.D1325D	p.D1359D	NM_015052.3	NP_055867.3	0	0	0	2.006018	Q76N89	HECW1_HUMAN		25	4682	+			A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Silent	SNP	ENST00000395891.2	1	1	hg19	c.4077C>T	CCDS5469.2	0	.	.	.	.	.	.	.	.	.	.	C	7.599	0.672376	0.14776	.	.	ENSG00000002746	ENST00000429529	.	.	.	5.83	-11.7	0.00046	5.83	-11.7	0.00046	.	.	.	.	.	T	0.64260	0.2582	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.77778	-0.2460	4	.	.	.	.	19.7666	0.96346	0.0:0.5708:0.0:0.4292	.	.	.	.	M	83	.	.	T	+	2	0	0	HECW1	43547344	43547344	0.161000	0.22892	0.071000	0.20095	0.828000	0.46876	-0.564000	0.05936	-2.493000	0.00515	-0.965000	0.02619	ACG	0.295775		TCGA-2J-AAB4-01A-12D-A40W-08	0.522	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	1	0	1		2	2	2	0		0	0	100		100	98	1	1.950000	-16.041640	1	0.300000	NM_015052			48	48		425	424	0		1	0		0	0	100	0		1.000000	1.083591e-02	0	0	0	2	0	48	425
SUMF2	25870	broad.mit.edu	37	7	56142409	56142409	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr7:56142409C>T	ENST00000413756.1	+	5	538	c.515C>T	c.(514-516)gCc>gTc	p.A172V	SUMF2_ENST00000437307.2_Intron|SUMF2_ENST00000395435.2_Intron|SUMF2_ENST00000434526.2_Missense_Mutation_p.A191V|SUMF2_ENST00000342190.6_Missense_Mutation_p.A191V|SUMF2_ENST00000395436.2_Missense_Mutation_p.A176V|SUMF2_ENST00000275607.9_Missense_Mutation_p.A84V			Q8NBJ7	SUMF2_HUMAN	sulfatase modifying factor 2	172					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum lumen (GO:0005788)	metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	14	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TGGGAGTTTGCCGCCCGAGGG	0.567											OREG0018081	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000413756.1	0.190000	3.000000e-02	1.400000e-01	6.000000e-02	0.090000	0.104150	0.090000	0.090000																										0				14						c.(514-516)gCc>gTc		sulfatase modifying factor 2							80.0	82.0	81.0					7																	56142409		2203	4300	6503	SO:0001583	missense	25870	0	0					g.chr7:56142409C>T	AK075477	CCDS5524.2, CCDS43588.2, CCDS43589.2, CCDS47589.1, CCDS55111.1	7q11.1	2004-04-30			ENSG00000129103	ENSG00000129103			20415	protein-coding gene	gene with protein product		607940				12757706	Standard	NM_015411		Approved	DKFZp566I1024	uc003trv.3	Q8NBJ7	OTTHUMG00000129373	ENST00000413756.1:c.515C>T	chr7.hg19:g.56142409C>T	ENSP00000406445:p.Ala172Val	0		OREG0018081	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1013	SUMF2_ENST00000434526.2_Missense_Mutation_p.A191V|SUMF2_ENST00000437307.2_Intron|SUMF2_ENST00000395435.2_Intron|SUMF2_ENST00000395436.2_Missense_Mutation_p.A176V|SUMF2_ENST00000342190.6_Missense_Mutation_p.A191V|SUMF2_ENST00000275607.9_Missense_Mutation_p.A84V	p.A172V			0	0	0	2.006018	Q8NBJ7	SUMF2_HUMAN	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)	5	538	+	Breast(14;0.214)		B4DU41|B4DWQ0|Q14DW5|Q53ZE3|Q96BH2|Q9BRN3|Q9BWI1|Q9Y405	Missense_Mutation	SNP	ENST00000413756.1	0	1	hg19	c.515C>T		0	.	.	.	.	.	.	.	.	.	.	C	36	5.686691	0.96784	.	.	ENSG00000129103	ENST00000395436;ENST00000434526;ENST00000275607;ENST00000413952;ENST00000342190;ENST00000413756;ENST00000451338	D;D;D;D;D;D;D	0.98968	-5.28;-5.28;-5.28;-5.28;-5.28;-5.28;-5.28	5.53	5.53	0.82687	5.53	5.53	0.82687	C-type lectin fold (1);Formylglycine-generating sulphatase enzyme domain (2);	0.000000	0.85682	D	0.000000	D	0.99309	0.9758	M	0.90198	3.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.951	D	0.99226	1.0880	10	0.87932	D	0	-11.665	18.8414	0.92186	0.0:1.0:0.0:0.0	.	176;172;191	A8MXB9;Q8NBJ7;F8WA42	.;SUMF2_HUMAN;.	V	176;191;84;194;191;172;189	ENSP00000378824:A176V;ENSP00000400922:A191V;ENSP00000275607:A84V;ENSP00000414434:A194V;ENSP00000341938:A191V;ENSP00000406445:A172V;ENSP00000410796:A189V	ENSP00000275607:A84V	A	+	2	0	0	SUMF2	56109903	56109903	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.607000	0.82883	2.777000	0.95525	0.591000	0.81541	GCC	0.295775		TCGA-2J-AAB4-01A-12D-A40W-08	0.567	SUMF2-013	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000341457.2	0	0	1		2	2	2	0		0	0	105		105	103	1	1.950000	-1.915724	0	0.300000	NM_015411			6	6		435	428	0		1	0		0	0	105	0		0.963187	9.294211e-01	0	0	0	345	0	6	435
ZP3	7784	broad.mit.edu	37	7	76062797	76062797	+	Silent	SNP	C	C	T	rs371699247		TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr7:76062797C>T	ENST00000394857.3	+	4	604	c.546C>T	c.(544-546)aaC>aaT	p.N182N	ZP3_ENST00000416245.1_Silent_p.N6N|ZP3_ENST00000336517.4_Silent_p.N131N	NM_001110354.1	NP_001103824.1	P21754	ZP3_HUMAN	zona pellucida glycoprotein 3 (sperm receptor)	182	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|blastocyst formation (GO:0001825)|calcium ion transmembrane transport (GO:0070588)|egg coat formation (GO:0035803)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|intracellular protein transport (GO:0006886)|intracellular signal transduction (GO:0035556)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|negative regulation of transcription, DNA-templated (GO:0045892)|oocyte development (GO:0048599)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of acrosomal vesicle exocytosis (GO:2000368)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of antral ovarian follicle growth (GO:2000388)|positive regulation of calcium ion import (GO:0090280)|positive regulation of humoral immune response (GO:0002922)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of ovarian follicle development (GO:2000386)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type IV hypersensitivity (GO:0001809)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|outer acrosomal membrane (GO:0002081)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|carbohydrate binding (GO:0030246)|manganese ion transmembrane transporter activity (GO:0005384)|signal transducer activity (GO:0004871)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|large_intestine(3)|lung(2)|skin(1)	7						AGAACTGGAACGCTGAGAAGA	0.597																																						ENST00000394857.3	1.000000	8.700000e-01	1	9.900000e-01	0.990000	0.989322	0.990000	1.000000																										0				7						c.(544-546)aaC>aaT		zona pellucida glycoprotein 3 (sperm receptor)							69.0	67.0	67.0					7																	76062797		2203	4300	6503	SO:0001819	synonymous_variant	7784	5	121410	37				g.chr7:76062797C>T	M60504	CCDS5586.1, CCDS47618.1	7q11.23	2014-07-04	2002-09-17	2002-09-20	ENSG00000188372	ENSG00000188372		"""Zona pellucida glycoproteins"""	13189	protein-coding gene	gene with protein product		182889	"""zona pellucida glycoprotein 3A (sperm receptor)"""	ZP3A, ZP3B		1478648	Standard	NM_007155		Approved	ZP3-424, ZP3-372, ZPC	uc003ufd.4	P21754	OTTHUMG00000130575	ENST00000394857.3:c.546C>T	chr7.hg19:g.76062797C>T		0					ZP3_ENST00000416245.1_Silent_p.N6N|ZP3_ENST00000336517.4_Silent_p.N131N	p.N182N	NM_001110354.1	NP_001103824.1	0	0	0	2.006018	P21754	ZP3_HUMAN		4	604	+			Q06633|Q29RW0	Silent	SNP	ENST00000394857.3	1	1	hg19	c.546C>T	CCDS47618.1	1	.	.	.	.	.	.	.	.	.	.	C	3.906	-0.021105	0.07634	.	.	ENSG00000188372	ENST00000394860	.	.	.	5.4	-2.82	0.05787	5.4	-2.82	0.05787	.	.	.	.	.	T	0.18593	0.0446	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27088	-1.0084	4	.	.	.	-12.4296	1.8203	0.03109	0.1105:0.2938:0.2176:0.3782	.	.	.	.	M	4	.	.	T	+	2	0	0	ZP3	75900733	75900733	0.000000	0.05858	0.006000	0.13384	0.117000	0.20001	-3.225000	0.00550	-0.242000	0.09667	-0.258000	0.10820	ACG	0.295775		TCGA-2J-AAB4-01A-12D-A40W-08	0.597	ZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253004.1	1	0	1		2	2	2	0		0	0	58		58	58	1	1.950000	-20.000000	1	0.300000				52	51		251	246	1		1	1		0	0	58	0		1.000000	7.558091e-01	0	2	0	13	0	52	251
ZNF483	158399	broad.mit.edu	37	9	114304261	114304261	+	Missense_Mutation	SNP	G	G	A	rs201645923		TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr9:114304261G>A	ENST00000309235.5	+	6	1204	c.1046G>A	c.(1045-1047)cGc>cAc	p.R349H	ZNF483_ENST00000358151.4_Intron	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	349					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R349H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						GTTCTGAACCGCAAGGAGAAA	0.423																																						ENST00000309235.5	0.160000	3.000000e-02	1.200000e-01	5.000000e-02	0.080000	0.093809	0.080000	0.080000																										1	Substitution - Missense(1)	p.R349H(1)	large_intestine(1)	31						c.(1045-1047)cGc>cAc		zinc finger protein 483							80.0	91.0	87.0					9																	114304261		2203	4299	6502	SO:0001583	missense	158399	4	121412	41				g.chr9:114304261G>A	AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.1046G>A	chr9.hg19:g.114304261G>A	ENSP00000311679:p.Arg349His	0					ZNF483_ENST00000358151.4_Intron	p.R349H	NM_133464.2	NP_597721.2	0	0	0	2.001353	Q8TF39	ZN483_HUMAN		6	1204	+			Q5VZN2|Q8NAE1	Missense_Mutation	SNP	ENST00000309235.5	0	1	hg19	c.1046G>A	CCDS35106.1	0	.	.	.	.	.	.	.	.	.	.	G	10.19	1.281994	0.23392	.	.	ENSG00000173258	ENST00000309235	T	0.04917	3.53	4.55	2.71	0.32032	4.55	2.71	0.32032	.	0.470780	0.18592	N	0.136701	T	0.01489	0.0048	N	0.00138	-2.015	0.25163	N	0.990339	B	0.18968	0.032	B	0.10450	0.005	T	0.43798	-0.9369	10	0.30854	T	0.27	-6.2832	9.1112	0.36730	0.1807:0.0:0.8193:0.0	.	349	Q8TF39	ZN483_HUMAN	H	349	ENSP00000311679:R349H	ENSP00000311679:R349H	R	+	2	0	0	ZNF483	113344082	113344082	0.000000	0.05858	0.765000	0.31456	0.035000	0.12851	0.761000	0.26489	0.858000	0.35431	-0.150000	0.13652	CGC	0.295775		TCGA-2J-AAB4-01A-12D-A40W-08	0.423	ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053641.1	0	0	1		2	2	2	0		0	0	167		167	167	1	1.950000	-2.058381	0	0.300000	XM_088567			9	9		693	683	0		1	0		0	0	167	0		0.993865	0	0	0	0	1	0	9	693
DOCK8	81704	broad.mit.edu	37	9	372257	372257	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr9:372257C>T	ENST00000453981.1	+	18	2192	c.2080C>T	c.(2080-2082)Cca>Tca	p.P694S	DOCK8_ENST00000469391.1_Missense_Mutation_p.P626S|DOCK8_ENST00000382329.1_Missense_Mutation_p.P161S|DOCK8_ENST00000382331.1_5'UTR|DOCK8_ENST00000432829.2_Missense_Mutation_p.P626S			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	694	DHR-1.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		GGAAAAATTGCCACCCAACTA	0.448																																						ENST00000453981.1	0.170000	2.000000e-02	1.300000e-01	4.000000e-02	0.080000	0.090490	0.080000	0.080000																										0				65						c.(2080-2082)Cca>Tca		dedicator of cytokinesis 8							123.0	111.0	115.0					9																	372257		2203	4300	6503	SO:0001583	missense	81704	0	0					g.chr9:372257C>T	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.2080C>T	chr9.hg19:g.372257C>T	ENSP00000408464:p.Pro694Ser	0					DOCK8_ENST00000432829.2_Missense_Mutation_p.P626S|DOCK8_ENST00000382331.1_5'UTR|DOCK8_ENST00000382329.1_Missense_Mutation_p.P161S|DOCK8_ENST00000469391.1_Missense_Mutation_p.P626S	p.P694S			0	0	0	2.001353	Q8NF50	DOCK8_HUMAN		18	2192	+		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	0	1	hg19	c.2080C>T	CCDS6440.2	0	.	.	.	.	.	.	.	.	.	.	C	28.8	4.948470	0.92593	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.14766	2.48;2.48;2.48;2.48	5.63	5.63	0.86233	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.42653	0.1212	M	0.78223	2.4	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.996;1.0	T	0.24261	-1.0165	10	0.72032	D	0.01	.	20.0442	0.97604	0.0:1.0:0.0:0.0	.	626;161;694	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	S	694;694;626;626;161	ENSP00000408464:P694S;ENSP00000394888:P626S;ENSP00000419438:P626S;ENSP00000371766:P161S	ENSP00000287364:P694S	P	+	1	0	0	DOCK8	362257	362257	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.329000	0.79170	2.814000	0.96858	0.655000	0.94253	CCA	0.295775		TCGA-2J-AAB4-01A-12D-A40W-08	0.448	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	0	0	1		18	2	2	1		1	1	84		84	83	1	1.950000	-2.040655	0	0.300000	XM_036307			5	5		430	423	0		0	0		1	0	84	0		0.004233	2.115534e-03	0	0	0	5	0	5	430
KCNV2	169522	broad.mit.edu	37	9	2718192	2718192	+	Silent	SNP	C	C	T			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr9:2718192C>T	ENST00000382082.3	+	1	691	c.453C>T	c.(451-453)ttC>ttT	p.F151F		NM_133497.3	NP_598004.1	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2	151					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	35				GBM - Glioblastoma multiforme(50;0.0257)		AATACTTCTTCGACCGCGACC	0.652																																						ENST00000382082.3	1.000000	3.400000e-01	9.500000e-01	5.000000e-01	0.700000	0.714261	0.700000	1.000000																										0				35						c.(451-453)ttC>ttT		potassium channel, subfamily V, member 2							25.0	22.0	23.0					9																	2718192		2201	4298	6499	SO:0001819	synonymous_variant	169522	3	121358	29				g.chr9:2718192C>T	AF348983	CCDS6447.1	9p24.2	2011-07-05			ENSG00000168263	ENSG00000168263		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19698	protein-coding gene	gene with protein product		607604				12060745, 16382104	Standard	NM_133497		Approved	Kv8.2	uc003zho.2	Q8TDN2	OTTHUMG00000019449	ENST00000382082.3:c.453C>T	chr9.hg19:g.2718192C>T		0						p.F151F	NM_133497.3	NP_598004.1	0	0	0	2.001353	Q8TDN2	KCNV2_HUMAN		1	691	+			Q5T6X0	Silent	SNP	ENST00000382082.3	0	1	hg19	c.453C>T	CCDS6447.1	0																																																																																								0.295775		TCGA-2J-AAB4-01A-12D-A40W-08	0.652	KCNV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051528.1	1	0	1		2	2	2	0		0	0	13		13	13	1	1.950000	-14.404920	1	0.300000	NM_133497			8	8		69	69	1		1			0	0	13	0		0.990670	0	0	0	0	0	0	8	69
RLN2	6019	broad.mit.edu	37	9	5304440	5304440	+	Silent	SNP	G	G	A	rs544671340		TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr9:5304440G>A	ENST00000381627.3	-	1	529	c.141C>T	c.(139-141)tgC>tgT	p.C47C	RLN2_ENST00000308420.3_Silent_p.C47C	NM_134441.2	NP_604390.1	P04090	REL2_HUMAN	relaxin 2	47					female pregnancy (GO:0007565)	extracellular region (GO:0005576)				endometrium(2)|kidney(1)|large_intestine(2)|lung(6)	11	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0201)|Lung(218;0.0987)		TGCTCATGCCGCAAATGGCAA	0.552													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18840	0.0		0.0	False		,,,				2504	0.0					ENST00000381627.3	0.350000	7.000000e-02	2.700000e-01	1.200000e-01	0.180000	0.199585	0.180000	0.170000																										0				11						c.(139-141)tgC>tgT		relaxin 2							41.0	42.0	42.0					9																	5304440		2203	4297	6500	SO:0001819	synonymous_variant	6019	1	121400	34				g.chr9:5304440G>A		CCDS6460.1	9p24.1	2013-02-26	2004-11-15		ENSG00000107014	ENSG00000107014		"""Endogenous ligands"""	10027	protein-coding gene	gene with protein product	"""relaxin H2"", ""prorelaxin H2"", ""relaxin, ovarian, of pregnancy"""	179740	"""relaxin 2 (H2)"""			6548703, 6548702	Standard	NM_134441		Approved	H2, RLXH2, bA12D24.1.1, bA12D24.1.2	uc003zja.2	P04090	OTTHUMG00000019496	ENST00000381627.3:c.141C>T	chr9.hg19:g.5304440G>A		0					RLN2_ENST00000308420.3_Silent_p.C47C	p.C47C	NM_134441.2	NP_604390.1	0	0	0	2.001353	P04090	REL2_HUMAN		1	529	-	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)	A0AVM0|Q99936|Q9UCX3|Q9UQJ2	Silent	SNP	ENST00000381627.3	0	1	hg19	c.141C>T	CCDS6460.1	0																																																																																								0.295775		TCGA-2J-AAB4-01A-12D-A40W-08	0.552	RLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051619.1	0	0	1		2	2	2	0		0	0	62		62	65	1	1.950000	-3.071627	1	0.300000	NM_134441			6	6		222	219	0		1			0	0	62	0		0.964115	0	0	0	0	0	0	6	222
DENND1A	57706	broad.mit.edu	37	9	126144428	126144428	+	Silent	SNP	G	G	C			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chr9:126144428G>C	ENST00000373624.2	-	22	2514	c.2313C>G	c.(2311-2313)ggC>ggG	p.G771G	DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000542603.1_Silent_p.G556G|DENND1A_ENST00000394219.3_Silent_p.G782G	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	771	Pro-rich.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						CAGCCCCGGGGCCAGGGCTGA	0.716																																						ENST00000373624.2	1.000000	6.500000e-01	1	8.900000e-01	0.990000	0.958306	0.990000	1.000000																										0				43						c.(2311-2313)ggC>ggG		DENN/MADD domain containing 1A							10.0	15.0	13.0					9																	126144428		2179	4275	6454	SO:0001819	synonymous_variant	57706	0	0					g.chr9:126144428G>C	AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.2313C>G	chr9.hg19:g.126144428G>C		0					DENND1A_ENST00000542603.1_Silent_p.G556G|DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000394219.3_Silent_p.G782G	p.G771G	NM_020946.1	NP_065997.1	1	2	3	2.021689	Q8TEH3	DEN1A_HUMAN		22	2514	-			A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Silent	SNP	ENST00000373624.2	0	1	hg19	c.2313C>G	CCDS35133.1	1																																																																																								0.302094		TCGA-2J-AAB4-01A-12D-A40W-08	0.716	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	1	0	1		2	2	2	0		0	0	12		12	12	1	1.950000	-19.934610	1	0.300000	NM_024820			11	11		51	49	0		1	1		0	0	12	0		0.998611	3.859287e-01	0	2	0	5	0	11	51
GK	2710	broad.mit.edu	37	X	30718984	30718984	+	Silent	SNP	G	G	A			TCGA-2J-AAB4-01A-12D-A40W-08	TCGA-2J-AAB4-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c536d586-b6ba-4e8d-9ada-9ec4e90a0197	dd10ada8-8304-481c-bf31-f471efa940a3	g.chrX:30718984G>A	ENST00000378943.3	+	10	974	c.795G>A	c.(793-795)gtG>gtA	p.V265V	GK_ENST00000378945.3_Silent_p.V265V|GK-AS1_ENST00000464659.1_RNA|RP11-242C19.2_ENST00000497961.1_RNA|GK_ENST00000427190.1_Silent_p.V66V|GK_ENST00000378946.3_Silent_p.V271V	NM_001128127.2	NP_001121599.1	P32189	GLPK_HUMAN	glycerol kinase	271					cellular lipid metabolic process (GO:0044255)|glucose homeostasis (GO:0042593)|glycerol catabolic process (GO:0019563)|glycerol metabolic process (GO:0006071)|glycerol-3-phosphate biosynthetic process (GO:0046167)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|glycerol kinase activity (GO:0004370)			central_nervous_system(1)|large_intestine(3)	4						CTGCATTGGTGGGACAAATGT	0.353																																						ENST00000378943.3	1.000000	7.800000e-01	9.900000e-01	8.600000e-01	0.930000	0.930090	0.930000	0.990000																										0				4						c.(793-795)gtG>gtA		glycerol kinase							91.0	85.0	87.0					X																	30718984		2202	4300	6502	SO:0001819	synonymous_variant	2710	0	0					g.chrX:30718984G>A	X78711	CCDS14225.1, CCDS35224.1, CCDS48090.1, CCDS75963.1	Xp21.3	2014-09-17			ENSG00000198814	ENSG00000198814	2.7.1.30	"""Glycerol kinases"""	4289	protein-coding gene	gene with protein product		300474				7987308	Standard	NM_203391		Approved	GK1, GKD	uc022buj.1	P32189	OTTHUMG00000021328	ENST00000378943.3:c.795G>A	chrX.hg19:g.30718984G>A							GK_ENST00000378945.3_Silent_p.V265V|GK-AS1_ENST00000464659.1_RNA|GK_ENST00000378946.3_Silent_p.V271V|GK_ENST00000427190.1_Silent_p.V66V|RP11-242C19.2_ENST00000497961.1_RNA	p.V265V	NM_001128127.2	NP_001121599.1	0	1	1		P32189	GLPK_HUMAN		10	974	+			A6NJP5|B2R833|Q6IQ27|Q8IVR5|Q9UMP0|Q9UMP1	Silent	SNP	ENST00000378943.3	1	1	hg19	c.795G>A	CCDS48090.1	1																																																																																								0.300000		TCGA-2J-AAB4-01A-12D-A40W-08	0.353	GK-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056170.1	1	0	1		2	2	2	0		0	0	67		67	66	1	1.950000	-6.638431	1	0.300000	NM_000167			58	58		126	126	1		1	0		0	0	67	0		1.000000	8.690327e-01	0	1	0	9	0	58	126
