#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
DNM1L	10059	broad.mit.edu	37	12	32861115	32861117	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08			AAG	-	AAG	AAG		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr12:32861115_32861117delAAG	ENST00000549701.1	+	4	400_402	c.326_328delAAG	c.(325-330)caagaa>caa	p.E110del	DNM1L_ENST00000548671.1_3'UTR|DNM1L_ENST00000381000.4_In_Frame_Del_p.E123del|DNM1L_ENST00000547312.1_In_Frame_Del_p.E110del|DNM1L_ENST00000553257.1_In_Frame_Del_p.E123del|DNM1L_ENST00000358214.5_In_Frame_Del_p.E123del|DNM1L_ENST00000452533.2_In_Frame_Del_p.E110del|DNM1L_ENST00000266481.6_In_Frame_Del_p.E110del|Y_RNA_ENST00000364693.1_RNA|DNM1L_ENST00000414834.2_Intron			O00429	DNM1L_HUMAN	dynamin 1-like	110	Dynamin-type G.|GTPase domain.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dynamin polymerization involved in mitochondrial fission (GO:0003374)|endocytosis (GO:0006897)|GTP catabolic process (GO:0006184)|membrane fission involved in mitochondrial fission (GO:0090149)|membrane fusion (GO:0061025)|mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrion morphogenesis (GO:0070584)|necroptotic process (GO:0070266)|peroxisome fission (GO:0016559)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein secretion (GO:0050714)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homotetramerization (GO:0051289)|protein localization to mitochondrion (GO:0070585)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|regulation of protein oligomerization (GO:0032459)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|protein complex (GO:0043234)|synapse (GO:0045202)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	23	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					GAAATTCGACAAGAAATTGAAAA	0.291																																						ENST00000549701.1	1.000000	8.100000e-01	1	9.100000e-01	0.990000	0.969769	0.990000	1.000000																										0				23						c.(325-330)caagaa>caa		dynamin 1-like																																				SO:0001651	inframe_deletion	10059	0	0					g.chr12:32861115_32861117delAAG	AF000430	CCDS8728.1, CCDS8729.1, CCDS8730.1, CCDS61095.1, CCDS61096.1, CCDS61098.1, CCDS61099.1	12p11.21	2012-10-02			ENSG00000087470	ENSG00000087470			2973	protein-coding gene	gene with protein product		603850				9348079, 9731200	Standard	NM_012062		Approved	DRP1, DVLP, HDYNIV, DYMPLE, VPS1	uc001rld.2	O00429	OTTHUMG00000169451	ENST00000549701.1:c.326_328delAAG	chr12.hg19:g.32861115_32861117delAAG	ENSP00000450399:p.Glu110del	1					Y_RNA_ENST00000364693.1_RNA|DNM1L_ENST00000414834.2_Intron|DNM1L_ENST00000547312.1_In_Frame_Del_p.E110del|DNM1L_ENST00000358214.5_In_Frame_Del_p.E123del|DNM1L_ENST00000381000.4_In_Frame_Del_p.E123del|DNM1L_ENST00000266481.6_In_Frame_Del_p.E110del|DNM1L_ENST00000553257.1_In_Frame_Del_p.E123del|DNM1L_ENST00000452533.2_In_Frame_Del_p.E110del|DNM1L_ENST00000548671.1_3'UTR	p.E110del			0	2	2	1.944943	O00429	DNM1L_HUMAN		4	400_402	+	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)		A8K4X9|B4DGC9|B4DSU8|J3KPI2|O14541|O60709|Q59GN9|Q7L6B3|Q8TBT7|Q9BWM1|Q9Y5J2	In_Frame_Del	DEL	ENST00000549701.1	1	1	hg19	c.326_328delAAG	CCDS8729.1	1																																																																																								0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.291	DNM1L-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404124.1	1	0	1		2	2		0		0	0	75		75	75	1	2.400000	-20.000000	1	0.540000	NM_012062			65	70		170	176	0		1	1	0	0	0	75	0		1.000000	9.997524e-01	0	13	0	23	0	65	170
C5	727	broad.mit.edu	37	9	123785771	123785772	+	Frame_Shift_Ins	INS	-	-	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr9:123785771_123785772insT	ENST00000223642.1	-	10	1055_1056	c.1026_1027insA	c.(1024-1029)atacctfs	p.P343fs		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	343					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	TTGATGCCAGGTATTTCTGCCT	0.411																																						ENST00000223642.1	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999589	0.990000	1.000000																										0				46						c.(1024-1029)atacctfs		complement component 5	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)																																			SO:0001589	frameshift_variant	727	0	0					g.chr9:123785771_123785772insT	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.1027dupA	chr9.hg19:g.123785772_123785772dupT	ENSP00000223642:p.Pro343fs	1						p.P343fs	NM_001735.2	NP_001726.2	0	2	2	1.772324	P01031	CO5_HUMAN		10	1055_1056	-			Q14CJ0|Q27I61	Frame_Shift_Ins	INS	ENST00000223642.1	0	1	hg19	c.1026_1027insA	CCDS6826.1	1																																																																																								0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.411	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	1	0	1		2	2		0		0	0	113		113	108	1	2.400000	-12.270970	1	0.540000	NM_001735			159	161		349	345	0		1	0	0	0	0	113	0		1.000000	9.884502e-02	0	0	0	2	0	159	349
GPR26	2849	broad.mit.edu	37	10	125426411	125426411	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr10:125426411C>T	ENST00000284674.1	+	1	541	c.488C>T	c.(487-489)cCa>cTa	p.P163L		NM_153442.3	NP_703143.1	Q8NDV2	GPR26_HUMAN	G protein-coupled receptor 26	163					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	20		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)				AGCCGGCGGCCAGACGAGCGC	0.682																																						ENST00000284674.1	1.000000	4.200000e-01	8.900000e-01	5.500000e-01	0.700000	0.719057	0.700000	1.000000																										0				20						c.(487-489)cCa>cTa		G protein-coupled receptor 26							18.0	17.0	17.0					10																	125426411		2202	4296	6498	SO:0001583	missense	2849	0	0					g.chr10:125426411C>T		CCDS7636.1	10q26.2-q26.3	2012-08-21			ENSG00000154478	ENSG00000154478		"""GPCR / Class A : Orphans"""	4481	protein-coding gene	gene with protein product		604847					Standard	NM_153442		Approved		uc001lhh.3	Q8NDV2	OTTHUMG00000019204	ENST00000284674.1:c.488C>T	chr10.hg19:g.125426411C>T	ENSP00000284674:p.Pro163Leu	0						p.P163L	NM_153442.3	NP_703143.1	1	2	3	1.835361	Q8NDV2	GPR26_HUMAN		1	541	+		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)	Q2M2E2	Missense_Mutation	SNP	ENST00000284674.1	1	1	hg19	c.488C>T	CCDS7636.1	0	.	.	.	.	.	.	.	.	.	.	C	10.87	1.472992	0.26423	.	.	ENSG00000154478	ENST00000284674	T	0.39229	1.09	4.02	3.02	0.34903	4.02	3.02	0.34903	GPCR, rhodopsin-like superfamily (1);	0.137029	0.49916	D	0.000132	T	0.28632	0.0709	L	0.36672	1.1	0.51233	D	0.99991	B	0.09022	0.002	B	0.11329	0.006	T	0.07195	-1.0785	10	0.20046	T	0.44	-26.7238	8.7659	0.34702	0.1627:0.7461:0.0:0.0912	.	163	Q8NDV2	GPR26_HUMAN	L	163	ENSP00000284674:P163L	ENSP00000284674:P163L	P	+	2	0	0	GPR26	125416401	125416401	1.000000	0.71417	0.902000	0.35471	0.707000	0.40811	4.679000	0.61649	2.067000	0.61834	0.655000	0.94253	CCA	0.544915		TCGA-2J-AAB6-01A-11D-A40W-08	0.682	GPR26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050850.1	1	0	1		2	2	2	0		0	0	35		35	35	1	2.400000	-20.000000	1	0.540000				15	15		66	64	1		1			0	0	35	0		0.999910	0	0	0	0	0	0	15	66
C10orf90	118611	broad.mit.edu	37	10	128147738	128147738	+	Missense_Mutation	SNP	G	G	A	rs139123090	byFrequency	TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr10:128147738G>A	ENST00000284694.7	-	6	1888	c.1768C>T	c.(1768-1770)Cgg>Tgg	p.R590W	C10orf90_ENST00000480379.1_De_novo_Start_OutOfFrame|C10orf90_ENST00000356858.3_Missense_Mutation_p.R543W|C10orf90_ENST00000544758.1_Missense_Mutation_p.R687W|C10orf90_ENST00000454341.1_Missense_Mutation_p.R493W	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	590	ALMS motif. {ECO:0000250}.				mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		TTCTTCAGCCGTTCTTGTGAG	0.498													G|||	5	0.000998403	0.0	0.0014	5008	,	,		22360	0.0		0.004	False		,,,				2504	0.0					ENST00000284694.7	1.000000	8.700000e-01	1	9.500000e-01	0.990000	0.984163	0.990000	1.000000																										0				65						c.(1768-1770)Cgg>Tgg		chromosome 10 open reading frame 90		G	TRP/ARG	3,4403	6.2+/-15.9	0,3,2200	176.0	147.0	157.0		1768	4.1	1.0	10	dbSNP_134	157	33,8567	22.2+/-67.0	0,33,4267	yes	missense	C10orf90	NM_001004298.2	101	0,36,6467	AA,AG,GG		0.3837,0.0681,0.2768	probably-damaging	590/700	128147738	36,12970	2203	4300	6503	SO:0001583	missense	118611	400	121412	59				g.chr10:128147738G>A	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.1768C>T	chr10.hg19:g.128147738G>A	ENSP00000284694:p.Arg590Trp	0					C10orf90_ENST00000544758.1_Missense_Mutation_p.R687W|C10orf90_ENST00000480379.1_De_novo_Start_OutOfFrame|C10orf90_ENST00000356858.3_Missense_Mutation_p.R543W|C10orf90_ENST00000454341.1_Missense_Mutation_p.R493W	p.R590W	NM_001004298.2	NP_001004298.2	1	2	3	1.835361	Q96M02	CJ090_HUMAN		6	1888	-		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	ENST00000284694.7	1	0	hg19	c.1768C>T	CCDS31310.1	1	4	0.0018315018315018315	0	0.0	0	0.0	0	0.0	4	0.005277044854881266	G	17.42	3.384498	0.61845	6.81E-4	0.003837	ENSG00000154493	ENST00000356858;ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642	T;T;T;T	0.68025	-0.3;-0.04;-0.04;-0.0	5.01	4.09	0.47781	5.01	4.09	0.47781	.	0.000000	0.40064	N	0.001191	T	0.72020	0.3409	M	0.65498	2.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.77216	-0.2669	10	0.87932	D	0	-28.7011	10.2933	0.43610	0.0:0.0:0.6407:0.3593	.	687;590;493	F5GZL2;Q96M02;Q96M02-2	.;CJ090_HUMAN;.	W	543;590;493;687;590	ENSP00000284694:R590W;ENSP00000398786:R493W;ENSP00000444369:R687W;ENSP00000405995:R590W	ENSP00000284694:R590W	R	-	1	2	2	C10orf90	128137728	128137728	0.993000	0.37304	0.992000	0.48379	0.861000	0.49209	2.467000	0.45093	1.289000	0.44618	0.655000	0.94253	CGG	0.544915		TCGA-2J-AAB6-01A-11D-A40W-08	0.498	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	1		2	2	2	0		0	0	102		102	101	1	2.400000	-2.248795	0	0.540000	NM_001004298			109	109		283	281	1		1			0	0	102	0		1.000000	0	0	0	0	0	0	109	283
ZNF365	22891	broad.mit.edu	37	10	64136259	64136259	+	Missense_Mutation	SNP	A	A	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr10:64136259A>T	ENST00000395254.3	+	2	587	c.307A>T	c.(307-309)Agc>Tgc	p.S103C	ZNF365_ENST00000395255.3_Missense_Mutation_p.S103C|ZNF365_ENST00000466727.1_Intron|ZNF365_ENST00000410046.3_Missense_Mutation_p.S103C	NM_014951.2	NP_055766.2	Q70YC4	TALAN_HUMAN	zinc finger protein 365	62										breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	Prostate(12;0.0297)|all_hematologic(501;0.228)					TAACTTGTACAGCATTTCACA	0.498																																						ENST00000395254.3	1.000000	8.300000e-01	1	9.200000e-01	0.990000	0.974801	0.990000	1.000000																										0				27						c.(307-309)Agc>Tgc		zinc finger protein 365							126.0	110.0	115.0					10																	64136259		2203	4300	6503	SO:0001583	missense	22891	1	121412	32				g.chr10:64136259A>T	AB020651	CCDS7264.1, CCDS7265.1, CCDS31209.1, CCDS41531.1	10q21.2	2008-10-28			ENSG00000138311	ENSG00000138311		"""Zinc fingers, C2H2-type"""	18194	protein-coding gene	gene with protein product	"""Talanin"""	607818				10048485, 12740763	Standard	NM_199450		Approved	KIAA0844, UAN	uc001jmc.2	Q70YC4	OTTHUMG00000018302	ENST00000395254.3:c.307A>T	chr10.hg19:g.64136259A>T	ENSP00000378674:p.Ser103Cys	0					ZNF365_ENST00000410046.3_Missense_Mutation_p.S103C|ZNF365_ENST00000395255.3_Missense_Mutation_p.S103C|ZNF365_ENST00000466727.1_Intron	p.S103C	NM_014951.2	NP_055766.2	1	2	3	1.823038	Q70YC4	TALAN_HUMAN		2	587	+	Prostate(12;0.0297)|all_hematologic(501;0.228)			Missense_Mutation	SNP	ENST00000395254.3	1	1	hg19	c.307A>T	CCDS31209.1	1	.	.	.	.	.	.	.	.	.	.	A	16.46	3.130161	0.56721	.	.	ENSG00000138311	ENST00000395254;ENST00000395255;ENST00000410046	T;T;T	0.35973	1.28;1.28;1.28	5.61	3.18	0.36537	5.61	3.18	0.36537	.	0.272643	0.36740	N	0.002435	T	0.45418	0.1341	L	0.56769	1.78	0.24242	N	0.995357	D;D;D;D	0.76494	0.999;0.992;0.992;0.992	D;P;P;P	0.64595	0.927;0.794;0.724;0.794	T	0.33904	-0.9850	10	0.66056	D	0.02	-2.0655	2.9212	0.05770	0.536:0.2348:0.2292:0.0	.	103;103;103;118	Q70YC5-3;Q70YC5-2;Q70YC5;Q70YC5-4	.;.;ZN365_HUMAN;.	C	103	ENSP00000378674:S103C;ENSP00000378675:S103C;ENSP00000387091:S103C	ENSP00000378674:S103C	S	+	1	0	0	ZNF365	63806265	63806265	0.838000	0.29461	0.979000	0.43373	0.724000	0.41520	2.696000	0.47052	2.138000	0.66242	0.454000	0.30748	AGC	0.542471		TCGA-2J-AAB6-01A-11D-A40W-08	0.498	ZNF365-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048238.2	1	0	1		2	2	2	0		0	0	62		62	62	1	2.400000	-20.000000	1	0.540000	NM_014951			75	75		196	196	1		1	1		0	0	62	0		1.000000	9.910017e-01	0	7	0	15	0	75	196
TCERG1L	256536	broad.mit.edu	37	10	133058648	133058648	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr10:133058648C>T	ENST00000368642.4	-	4	815	c.730G>A	c.(730-732)Gcc>Acc	p.A244T		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	244	Poly-Ala.									cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		gcagcggcggcggcggtggcg	0.662																																						ENST00000368642.4	1.000000	3.100000e-01	9.200000e-01	4.600000e-01	0.660000	0.682207	0.660000	1.000000																										0				31						c.(730-732)Gcc>Acc		transcription elongation regulator 1-like							16.0	18.0	18.0					10																	133058648		2193	4283	6476	SO:0001583	missense	256536	9	120466	31				g.chr10:133058648C>T	AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.730G>A	chr10.hg19:g.133058648C>T	ENSP00000357631:p.Ala244Thr	0						p.A244T	NM_174937.3	NP_777597.2	1	2	3	1.835361	Q5VWI1	TCRGL_HUMAN		4	815	-		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)	Q5VWI2|Q86XM8	Missense_Mutation	SNP	ENST00000368642.4	0	1	hg19	c.730G>A	CCDS7662.2	0	.	.	.	.	.	.	.	.	.	.	C	9.872	1.199205	0.22121	.	.	ENSG00000176769	ENST00000368642	T	0.30448	1.53	4.78	2.6	0.31112	4.78	2.6	0.31112	.	0.315243	0.26439	N	0.024363	T	0.14700	0.0355	N	0.19112	0.55	0.09310	N	1	B	0.25850	0.136	B	0.15052	0.012	T	0.10337	-1.0634	9	.	.	.	-6.2774	6.1164	0.20130	0.1907:0.6978:0.0:0.1115	.	244	Q5VWI1	TCRGL_HUMAN	T	244	ENSP00000357631:A244T	.	A	-	1	0	0	TCERG1L	132948638	132948638	0.050000	0.20438	0.652000	0.29579	0.039000	0.13416	0.093000	0.15086	2.189000	0.69895	0.655000	0.94253	GCC	0.544915		TCGA-2J-AAB6-01A-11D-A40W-08	0.662	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091619.2	0	0	1		2	2	2	0		0	0	10		10	9	1	2.400000	-14.923980	1	0.540000	NM_174937			7	7		34	32	0		1	0		0	0	10	0		0.980647	0	0	0	0	1	0	7	34
GRIK4	2900	broad.mit.edu	37	11	120776148	120776148	+	Silent	SNP	C	C	T	rs144767530		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr11:120776148C>T	ENST00000527524.2	+	13	1709	c.1422C>T	c.(1420-1422)ggC>ggT	p.G474G	GRIK4_ENST00000438375.2_Silent_p.G474G	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	474					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.G474G(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		GCGTGTACGGCGTTCCCGAGG	0.612																																						ENST00000527524.2	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										1	Substitution - coding silent(1)	p.G474G(1)	ovary(1)	69						c.(1420-1422)ggC>ggT		glutamate receptor, ionotropic, kainate 4							133.0	131.0	132.0					11																	120776148		2203	4299	6502	SO:0001819	synonymous_variant	2900	2	121412	37				g.chr11:120776148C>T	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1422C>T	chr11.hg19:g.120776148C>T		1					GRIK4_ENST00000438375.2_Silent_p.G474G	p.G474G	NM_001282470.1	NP_001269399.1	1	2	3	2.286670	Q16099	GRIK4_HUMAN		13	1709	+		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)	A8K9L1	Silent	SNP	ENST00000527524.2	1	1	hg19	c.1422C>T	CCDS8433.1	1																																																																																								0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.612	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	1	0	1		2	2	2	0		0	0	148		148	146	1	2.400000	-20.000000	1	0.540000	NM_014619			246	244		370	363	1		1			0	0	148	0		1.000000	0	0	0	0	0	0	246	370
OR4S2	219431	broad.mit.edu	37	11	55418398	55418398	+	Missense_Mutation	SNP	G	G	A	rs145635951	byFrequency	TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr11:55418398G>A	ENST00000312422.2	+	1	19	c.19G>A	c.(19-21)Gta>Ata	p.V7I		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	7						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				AATAAACAACGTAACTGAATT	0.313													g|||	44	0.00878594	0.0	0.0	5008	,	,		14384	0.0		0.007	False		,,,				2504	0.0378					ENST00000312422.2	1.000000	7.400000e-01	1	8.300000e-01	0.930000	0.925229	0.930000	1.000000																										0				45						c.(19-21)Gta>Ata		olfactory receptor, family 4, subfamily S, member 2		G	ILE/VAL	2,4350		0,2,2174	54.0	50.0	51.0		19	1.0	0.7	11	dbSNP_134	51	25,7979		5,15,3982	yes	missense	OR4S2	NM_001004059.2	29	5,17,6156	AA,AG,GG		0.3123,0.046,0.2185	benign	7/312	55418398	27,12329	2176	4002	6178	SO:0001583	missense	219431	744	112414	58				g.chr11:55418398G>A	BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.19G>A	chr11.hg19:g.55418398G>A	ENSP00000310337:p.Val7Ile	1						p.V7I	NM_001004059.2	NP_001004059.2	1	2	3	2.254921	Q8NH73	OR4S2_HUMAN		1	19	+		all_epithelial(135;0.0748)	Q6IF72	Missense_Mutation	SNP	ENST00000312422.2	1	0	hg19	c.19G>A	CCDS31505.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	7.327	0.618153	0.14129	4.6E-4	0.003123	ENSG00000174982	ENST00000312422	T	0.00672	5.89	5.05	1.02	0.19986	5.05	1.02	0.19986	.	0.141107	0.32015	N	0.006710	T	0.00754	0.0025	L	0.45228	1.405	0.09310	N	1	B	0.28850	0.225	B	0.16722	0.016	T	0.49234	-0.8961	10	0.48119	T	0.1	.	7.0124	0.24869	0.513:0.0:0.487:0.0	.	7	Q8NH73	OR4S2_HUMAN	I	7	ENSP00000310337:V7I	ENSP00000310337:V7I	V	+	1	0	0	OR4S2	55174974	55174974	0.000000	0.05858	0.696000	0.30242	0.445000	0.32107	-0.700000	0.05081	0.530000	0.28619	0.448000	0.29417	GTA	0.633904		TCGA-2J-AAB6-01A-11D-A40W-08	0.313	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391503.1	0	0	1		2	2	2	0		0	0	109		109	109	1	2.400000	-2.421942	0	0.540000	NM_001004059			69	66		275	271	1		1			0	0	109	0		1.000000	0	0	0	0	0	0	69	275
MS4A1	931	broad.mit.edu	37	11	60235849	60235849	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr11:60235849C>T	ENST00000534668.1	+	7	1091	c.802C>T	c.(802-804)Caa>Taa	p.Q268*	MS4A1_ENST00000389939.2_Nonsense_Mutation_p.Q268*|MS4A1_ENST00000532073.1_Nonsense_Mutation_p.Q255*|MS4A1_ENST00000345732.4_Nonsense_Mutation_p.Q268*|MS4A1_ENST00000528313.1_Nonsense_Mutation_p.Q101*	NM_152866.2	NP_690605.1	P11836	CD20_HUMAN	membrane-spanning 4-domains, subfamily A, member 1	268					B cell proliferation (GO:0042100)|humoral immune response (GO:0006959)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	MHC class II protein complex binding (GO:0023026)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24					Ibritumomab(DB00078)|Obinutuzumab(DB08935)|Rituximab(DB00073)|Tositumomab(DB00081)	TATTCCAATCCAAGAAGAGGA	0.373																																						ENST00000534668.1	1.000000	7.500000e-01	1	8.600000e-01	0.980000	0.947510	0.980000	1.000000																										0				24						c.(802-804)Caa>Taa		membrane-spanning 4-domains, subfamily A, member 1	Ibritumomab(DB00078)|Obinutuzumab(DB08935)|Rituximab(DB00073)|Tositumomab(DB00081)						85.0	83.0	84.0					11																	60235849		2203	4300	6503	SO:0001587	stop_gained	931	0	0					g.chr11:60235849C>T	M27394	CCDS31570.1	11q12-q13.1	2014-09-17				ENSG00000156738		"""CD molecules"""	7315	protein-coding gene	gene with protein product		112210		CD20		2448768	Standard	NM_152866		Approved	B1, Bp35, MS4A2	uc001npq.3	P11836		ENST00000534668.1:c.802C>T	chr11.hg19:g.60235849C>T	ENSP00000433277:p.Gln268*	1					MS4A1_ENST00000528313.1_Nonsense_Mutation_p.Q101*|MS4A1_ENST00000532073.1_Nonsense_Mutation_p.Q255*|MS4A1_ENST00000389939.2_Nonsense_Mutation_p.Q268*|MS4A1_ENST00000345732.4_Nonsense_Mutation_p.Q268*	p.Q268*	NM_152866.2	NP_690605.1	1	2	3	2.254921	P11836	CD20_HUMAN		7	1091	+			A6NMS4|B4DT24|P08984|Q13963	Nonsense_Mutation	SNP	ENST00000534668.1	0	1	hg19	c.802C>T	CCDS31570.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.224347	0.95139	.	.	ENSG00000156738	ENST00000345732;ENST00000532073;ENST00000534668;ENST00000528313;ENST00000389939	.	.	.	5.32	3.34	0.38264	5.32	3.34	0.38264	.	0.624912	0.17254	N	0.181052	.	.	.	.	.	.	0.51482	D	0.999925	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-22.9187	8.6631	0.34103	0.158:0.6261:0.2159:0.0	.	.	.	.	X	268;255;268;101;268	.	ENSP00000314620:Q268X	Q	+	1	0	0	MS4A1	59992425	59992425	0.973000	0.33851	0.913000	0.36048	0.966000	0.64601	2.113000	0.41902	0.651000	0.30788	0.655000	0.94253	CAA	0.633904		TCGA-2J-AAB6-01A-11D-A40W-08	0.373	MS4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395402.1	1	0	1		2	2	2	0		0	0	39		39	38	1	2.400000	-3.813851	1	0.540000				53	52		199	199	1		1			0	0	39	0		1.000000	0	0	0	0	0	0	53	199
PITPNM1	9600	broad.mit.edu	37	11	67262964	67262964	+	Silent	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr11:67262964G>A	ENST00000534749.1	-	15	2615	c.2427C>T	c.(2425-2427)gcC>gcT	p.A809A	PITPNM1_ENST00000526450.1_5'Flank|PITPNM1_ENST00000436757.2_Silent_p.A808A|PITPNM1_ENST00000356404.3_Silent_p.A809A			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	809	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						GGGGGTCAGTGGCCAACTCAC	0.647																																					GBM(28;144 709 4607 5525)	ENST00000534749.1	1.000000	7.600000e-01	1	9.900000e-01	0.990000	0.981546	0.990000	1.000000																										0				18						c.(2425-2427)gcC>gcT		phosphatidylinositol transfer protein, membrane-associated 1							20.0	17.0	18.0					11																	67262964		2188	4284	6472	SO:0001819	synonymous_variant	9600	0	0					g.chr11:67262964G>A	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.2427C>T	chr11.hg19:g.67262964G>A		1					PITPNM1_ENST00000356404.3_Silent_p.A809A|PITPNM1_ENST00000436757.2_Silent_p.A808A|PITPNM1_ENST00000526450.1_5'Flank	p.A809A			1	2	3	2.286670	O00562	PITM1_HUMAN		15	2615	-			A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Silent	SNP	ENST00000534749.1	0	1	hg19	c.2427C>T	CCDS31620.1	1																																																																																								0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.647	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395520.1	1	0	1		2	2	2	0		0	0	10		10	9	1	2.400000	-19.999710	1	0.540000	NM_004910			11	8		28	27	1		1	1		0	0	10	0		0.998360	9.999995e-01	0	28	0	78	0	11	28
ETS1	2113	broad.mit.edu	37	11	128391808	128391808	+	Splice_Site	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr11:128391808C>T	ENST00000319397.6	-	1	391	c.82G>A	c.(82-84)Gat>Aat	p.D28N	ETS1_ENST00000392668.4_Intron|ETS1_ENST00000526145.2_Splice_Site_p.D28N|ETS1_ENST00000531611.1_Splice_Site_p.D28N|ETS1_ENST00000345075.4_Splice_Site_p.D28N|ETS1_ENST00000535549.1_Splice_Site_p.G28S	NM_005238.3	NP_005229.1	P14921	ETS1_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 1	28					angiogenesis involved in wound healing (GO:0060055)|cell motility (GO:0048870)|cellular response to hydrogen peroxide (GO:0070301)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|pituitary gland development (GO:0021983)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of apoptotic process (GO:0042981)|regulation of extracellular matrix disassembly (GO:0010715)|response to antibiotic (GO:0046677)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to laminar fluid shear stress (GO:0034616)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|pleura(1)|prostate(1)|upper_aerodigestive_tract(3)	35	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		CGCCACTCACCCGGGGAGGGG	0.652																																						ENST00000319397.6	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				35						c.(82-84)Gat>Aat		v-ets avian erythroblastosis virus E26 oncogene homolog 1							39.0	44.0	42.0					11																	128391808		2201	4297	6498	SO:0001630	splice_region_variant	2113	0	0					g.chr11:128391808C>T		CCDS8475.1, CCDS44767.1, CCDS53724.1	11q23.3	2013-07-09	2013-07-09		ENSG00000134954	ENSG00000134954			3488	protein-coding gene	gene with protein product	"""Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1"", ""ets protein"""	164720		EWSR2		1522903	Standard	NM_005238		Approved	FLJ10768, ETS-1	uc001qej.2	P14921	OTTHUMG00000165799	ENST00000319397.6:c.82+1G>A	chr11.hg19:g.128391808C>T		1					ETS1_ENST00000531611.1_Splice_Site_p.D28N|ETS1_ENST00000526145.2_Splice_Site_p.D28N|ETS1_ENST00000535549.1_Splice_Site_p.G28S|ETS1_ENST00000345075.4_Splice_Site_p.D28N|ETS1_ENST00000392668.4_Intron	p.D28N	NM_005238.3	NP_005229.1	1	2	3	2.286670	P14921	ETS1_HUMAN		1	391	-	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)	A9UL17|F5GYX9|Q14278|Q16080|Q6N087|Q96AC5	Splice_Site	SNP	ENST00000319397.6	1	0	hg19	c.82G>A	CCDS8475.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.090046|5.090046	0.94149|0.94149	.|.	.|.	ENSG00000134954|ENSG00000134954	ENST00000345075;ENST00000531611;ENST00000319397;ENST00000526145|ENST00000535549	T;T;T;T|T	0.51817|0.17691	2.93;0.69;2.59;2.93|2.26	4.72|4.72	4.72|4.72	0.59763|0.59763	4.72|4.72	4.72|4.72	0.59763|0.59763	.|.	.|.	.|.	.|.	.|.	T|T	0.20333|0.20333	0.0489|0.0489	M|M	0.64404|0.64404	1.975|1.975	0.58432|0.58432	D|D	0.999999|0.999999	P;P|B	0.52316|0.17038	0.743;0.952|0.02	B;P|B	0.49140|0.18871	0.097;0.601|0.023	T|T	0.02901|0.02901	-1.1096|-1.1096	8|8	.|.	.|.	.|.	.|.	14.9724|14.9724	0.71243|0.71243	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	28;28|28	P14921;Q96AC5|F5GYX9	ETS1_HUMAN;.|.	N|S	28|28	ENSP00000340485:D28N;ENSP00000435666:D28N;ENSP00000324578:D28N;ENSP00000433500:D28N|ENSP00000441430:G28S	.|.	D|G	-|-	1|1	0|0	0|0	ETS1|ETS1	127897018|127897018	127897018|127897018	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.060000|4.060000	0.57477|0.57477	2.325000|2.325000	0.78763|0.78763	0.591000|0.591000	0.81541|0.81541	GAT|GGT	0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.652	ETS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386269.2	1	0	1		2	2	2	0		0	0	66		66	64	1	2.400000	-19.603950	1	0.540000	NM_005238	Missense_Mutation		134	133		200	192	0		1	1		0	0	66	0		1.000000	9.999990e-01	0	3	0	32	0	134	200
PRMT8	56341	broad.mit.edu	37	12	3701463	3701463	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr12:3701463G>A	ENST00000382622.3	+	9	1436	c.1046G>A	c.(1045-1047)cGg>cAg	p.R349Q	PRMT8_ENST00000452611.2_Missense_Mutation_p.R340Q|PRMT8_ENST00000261252.4_3'UTR	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8	349	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.R349Q(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			CTCACTGTCCGGAGGGGGGAG	0.542																																						ENST00000382622.3	0.080000	0	6.000000e-02	1.000000e-02	0.030000	0.044247	0.030000	0.040000																										1	Substitution - Missense(1)	p.R349Q(1)	lung(1)	37						c.(1045-1047)cGg>cAg		protein arginine methyltransferase 8							123.0	124.0	124.0					12																	3701463		2203	4300	6503	SO:0001583	missense	56341	8	121412	45				g.chr12:3701463G>A	AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.1046G>A	chr12.hg19:g.3701463G>A	ENSP00000372067:p.Arg349Gln	1					PRMT8_ENST00000452611.2_Missense_Mutation_p.R340Q|PRMT8_ENST00000261252.4_3'UTR	p.R349Q	NM_019854.4	NP_062828.3	0	2	2	1.955916	Q9NR22	ANM8_HUMAN	OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)	9	1436	+			B2RDP0|Q8TBJ8	Missense_Mutation	SNP	ENST00000382622.3	0	1	hg19	c.1046G>A	CCDS8521.2	0	.	.	.	.	.	.	.	.	.	.	G	15.73	2.920919	0.52653	.	.	ENSG00000111218	ENST00000452611;ENST00000382622	T;T	0.76316	-1.01;-1.01	5.24	5.24	0.73138	5.24	5.24	0.73138	.	0.045992	0.85682	D	0.000000	T	0.68035	0.2957	N	0.25647	0.755	0.43476	D	0.995693	B;B	0.18863	0.031;0.01	B;B	0.16722	0.016;0.007	T	0.63462	-0.6632	10	0.37606	T	0.19	.	16.3206	0.82950	0.0:0.0:1.0:0.0	.	340;349	Q9NR22-2;Q9NR22	.;ANM8_HUMAN	Q	340;349	ENSP00000414507:R340Q;ENSP00000372067:R349Q	ENSP00000372067:R349Q	R	+	2	0	0	PRMT8	3571724	3571724	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.377000	0.52425	2.440000	0.82611	0.561000	0.74099	CGG	0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.542	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250297.2	0	0	1		2	2	2	0		0	0	157		157	154	1	2.400000	-2.030957	0	0.540000	NM_019854			5	5		491	481	0		1			0	0	157	0		0.934432	0	0	0	0	0	0	5	491
PLEKHA5	54477	broad.mit.edu	37	12	19501393	19501393	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr12:19501393G>T	ENST00000299275.6	+	19	2467	c.2461G>T	c.(2461-2463)Gaa>Taa	p.E821*	PLEKHA5_ENST00000359180.3_Intron|PLEKHA5_ENST00000317589.4_Nonsense_Mutation_p.E884*|PLEKHA5_ENST00000543806.1_Nonsense_Mutation_p.E803*|PLEKHA5_ENST00000355397.3_Nonsense_Mutation_p.E879*|PLEKHA5_ENST00000538714.1_Nonsense_Mutation_p.E879*|PLEKHA5_ENST00000424268.1_Nonsense_Mutation_p.E810*|PLEKHA5_ENST00000429027.2_Nonsense_Mutation_p.E987*|PLEKHA5_ENST00000539256.1_Nonsense_Mutation_p.E579*	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	821					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					AGAAGTTGATGAATCTAATGG	0.348																																					Pancreas(196;329 2193 11246 14234 19524)	ENST00000299275.6	1.000000	2.000000e-02	1	5.000000e-02	0.100000	0.292132	0.100000	0.070000																										0				35						c.(2461-2463)Gaa>Taa		pleckstrin homology domain containing, family A member 5							97.0	98.0	97.0					12																	19501393		2203	4299	6502	SO:0001587	stop_gained	54477	0	0					g.chr12:19501393G>T	AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.2461G>T	chr12.hg19:g.19501393G>T	ENSP00000299275:p.Glu821*	1					PLEKHA5_ENST00000424268.1_Nonsense_Mutation_p.E810*|PLEKHA5_ENST00000429027.2_Nonsense_Mutation_p.E987*|PLEKHA5_ENST00000317589.4_Nonsense_Mutation_p.E884*|PLEKHA5_ENST00000543806.1_Nonsense_Mutation_p.E803*|PLEKHA5_ENST00000355397.3_Nonsense_Mutation_p.E879*|PLEKHA5_ENST00000539256.1_Nonsense_Mutation_p.E579*|PLEKHA5_ENST00000538714.1_Nonsense_Mutation_p.E879*|PLEKHA5_ENST00000359180.3_Intron	p.E821*	NM_019012.5	NP_061885.2	1	3	4	2.006261	Q9HAU0	PKHA5_HUMAN		19	2467	+	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)		A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Nonsense_Mutation	SNP	ENST00000299275.6	0	1	hg19	c.2461G>T	CCDS8682.1	0	.	.	.	.	.	.	.	.	.	.	G	42	9.521210	0.99193	.	.	ENSG00000052126	ENST00000317589;ENST00000355397;ENST00000542828;ENST00000429027;ENST00000299275;ENST00000539256;ENST00000538714;ENST00000424268;ENST00000543806;ENST00000536974	.	.	.	5.09	5.09	0.68999	5.09	5.09	0.68999	.	0.284028	0.37136	N	0.002230	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-19.7244	18.8652	0.92289	0.0:0.0:1.0:0.0	.	.	.	.	X	884;879;983;987;821;579;879;810;803;776	.	ENSP00000299275:E821X	E	+	1	0	0	PLEKHA5	19392660	19392660	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.173000	0.89680	2.489000	0.83994	0.563000	0.77884	GAA	0.660867		TCGA-2J-AAB6-01A-11D-A40W-08	0.348	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	0	0	1		2	2	2	0		0	0	81		81	81	1	2.400000	-4.151663	1	0.540000	NM_019012			5	4		305	301	0		1	0		0	0	81	0		0.935342	7.672791e-02	0	0	0	23	0	5	305
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	0	4	4	2.493078	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.679978		TCGA-2J-AAB6-01A-11D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	82		82	81	1	2.400000	-20.000000	1	0.540000	NM_033360			101	101		90	90	1		1	1	1	0	0	82	412		1.000000	9.855492e-01	1	7	178	2	157	101	90
CAPRIN2	65981	broad.mit.edu	37	12	30873750	30873750	+	Missense_Mutation	SNP	G	G	C			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr12:30873750G>C	ENST00000298892.5	-	12	2893	c.2143C>G	c.(2143-2145)Cct>Gct	p.P715A	CAPRIN2_ENST00000251071.5_Missense_Mutation_p.P715A|CAPRIN2_ENST00000395805.2_Intron|CAPRIN2_ENST00000308433.5_Missense_Mutation_p.P382A|CAPRIN2_ENST00000417045.1_Missense_Mutation_p.P715A	NM_023925.3	NP_076414.2			caprin family member 2											breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TTTACCTCAGGAGTCTCTGAG	0.373																																						ENST00000298892.5	0.160000	3.000000e-02	1.200000e-01	5.000000e-02	0.080000	0.091758	0.080000	0.080000																										0				48						c.(2143-2145)Cct>Gct		caprin family member 2							81.0	85.0	84.0					12																	30873750		2203	4300	6503	SO:0001583	missense	65981	0	0					g.chr12:30873750G>C	AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000298892.5:c.2143C>G	chr12.hg19:g.30873750G>C	ENSP00000298892:p.Pro715Ala	1					CAPRIN2_ENST00000251071.5_Missense_Mutation_p.P715A|CAPRIN2_ENST00000395805.2_Intron|CAPRIN2_ENST00000417045.1_Missense_Mutation_p.P715A|CAPRIN2_ENST00000308433.5_Missense_Mutation_p.P382A	p.P715A	NM_023925.3	NP_076414.2	0	2	2	1.944943				12	2893	-	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)			Missense_Mutation	SNP	ENST00000298892.5	0	1	hg19	c.2143C>G	CCDS8720.1	0	.	.	.	.	.	.	.	.	.	.	G	15.66	2.900537	0.52227	.	.	ENSG00000110888	ENST00000433722;ENST00000298892;ENST00000251071;ENST00000308433;ENST00000417045;ENST00000537108	T;T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05;2.05	5.45	3.56	0.40772	5.45	3.56	0.40772	.	0.402823	0.26041	N	0.026690	T	0.18087	0.0434	L	0.46157	1.445	0.37841	D	0.92906	B;B;B;B	0.24721	0.11;0.012;0.015;0.026	B;B;B;B	0.22152	0.028;0.027;0.016;0.038	T	0.06427	-1.0827	10	0.09338	T	0.73	-5.5419	14.5087	0.67769	0.0:0.42:0.58:0.0	.	715;715;715;715	Q6IMN6-3;Q6IMN6;Q6IMN6-2;E4NKG2	.;CAPR2_HUMAN;.;.	A	461;715;715;382;715;634	ENSP00000415407:P461A;ENSP00000298892:P715A;ENSP00000251071:P715A;ENSP00000309785:P382A;ENSP00000391479:P715A;ENSP00000438010:P634A	ENSP00000251071:P715A	P	-	1	0	0	CAPRIN2	30765017	30765017	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.051000	0.30417	0.619000	0.30197	-0.282000	0.10007	CCT	0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.373	CAPRIN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402778.1	0	0	1		2	2	2	0		0	0	105		105	101	1	2.400000	-2.931896	1	0.540000	NM_023925			7	7		313	313	0		1	0		0	0	105	0		0.980909	1.713652e-02	0	1	0	7	0	7	313
KSR2	283455	broad.mit.edu	37	12	117914339	117914339	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr12:117914339G>A	ENST00000339824.5	-	17	3239	c.2512C>T	c.(2512-2514)Cgc>Tgc	p.R838C	KSR2_ENST00000302438.5_3'UTR|KSR2_ENST00000425217.1_Missense_Mutation_p.R809C			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	838	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GACAGCTGGCGGATGATCTCT	0.582																																						ENST00000339824.5	1.000000	4.800000e-01	1	6.600000e-01	0.890000	0.854298	0.890000	1.000000																										0				67						c.(2512-2514)Cgc>Tgc		kinase suppressor of ras 2							61.0	74.0	69.0					12																	117914339		2071	4213	6284	SO:0001583	missense	283455	1	121006	29				g.chr12:117914339G>A	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.2512C>T	chr12.hg19:g.117914339G>A	ENSP00000339952:p.Arg838Cys	0					KSR2_ENST00000302438.5_3'UTR|KSR2_ENST00000425217.1_Missense_Mutation_p.R809C	p.R838C			2	2	4	1.949391	Q6VAB6	KSR2_HUMAN		17	3239	-	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)		A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	ENST00000339824.5	1	1	hg19	c.2512C>T		1	.	.	.	.	.	.	.	.	.	.	G	15.89	2.965842	0.53507	.	.	ENSG00000171435	ENST00000425217;ENST00000339824	D;D	0.83419	-1.72;-1.72	5.69	4.81	0.61882	5.69	4.81	0.61882	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.057415	0.64402	D	0.000001	D	0.85217	0.5646	M	0.89904	3.07	0.58432	D	0.999999	B	0.19935	0.04	B	0.19391	0.025	D	0.83736	0.0201	10	0.66056	D	0.02	.	10.7666	0.46297	0.1442:0.0:0.8558:0.0	.	838	Q6VAB6	KSR2_HUMAN	C	809;838	ENSP00000389715:R809C;ENSP00000339952:R838C	ENSP00000339952:R838C	R	-	1	0	0	KSR2	116398722	116398722	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	8.061000	0.89467	1.407000	0.46875	-0.142000	0.14014	CGC	0.574468		TCGA-2J-AAB6-01A-11D-A40W-08	0.582	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	1	0	1		2	2	2	0		0	0	16		16	16	1	2.400000	-3.657225	1	0.540000	NM_173598			11	11		41	41	1		1			0	0	16	0		0.998946	0	0	0	0	0	0	11	41
CENPJ	55835	broad.mit.edu	37	13	25466782	25466782	+	Splice_Site	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr13:25466782G>A	ENST00000381884.4	-	10	3400	c.3215C>T	c.(3214-3216)gCg>gTg	p.A1072V	CENPJ_ENST00000545981.1_Splice_Site_p.A1072V	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	1072					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		CCTGCCTACCGCAAGCTTGTC	0.522																																						ENST00000381884.4	1.000000	8.400000e-01	1	9.300000e-01	0.990000	0.976214	0.990000	1.000000																										0				47						c.(3214-3216)gCg>gTg		centromere protein J							124.0	117.0	120.0					13																	25466782		2203	4300	6503	SO:0001630	splice_region_variant	55835	1	121412	34				g.chr13:25466782G>A	AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.3216+1C>T	chr13.hg19:g.25466782G>A		1					CENPJ_ENST00000545981.1_Splice_Site_p.A1072V	p.A1072V	NM_018451.4	NP_060921.3	2	2	4	2.750899	Q9HC77	CENPJ_HUMAN		10	3400	-		Lung SC(185;0.0225)|Breast(139;0.0602)	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Splice_Site	SNP	ENST00000381884.4	1	0	hg19	c.3215C>T	CCDS9310.1	1	.	.	.	.	.	.	.	.	.	.	G	3.659	-0.070010	0.07228	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	T;T	0.34667	1.35;1.82	4.42	0.612	0.17591	4.42	0.612	0.17591	.	1.551700	0.03144	N	0.167020	T	0.19208	0.0461	N	0.08118	0	0.09310	N	1	B;B	0.13594	0.008;0.005	B;B	0.11329	0.006;0.003	T	0.15122	-1.0448	10	0.31617	T	0.26	.	3.6362	0.08150	0.5195:0.0:0.3135:0.1669	.	153;1072	Q5T6R6;Q9HC77	.;CENPJ_HUMAN	V	1072	ENSP00000371308:A1072V;ENSP00000441090:A1072V	ENSP00000371308:A1072V	A	-	2	0	0	CENPJ	24364782	24364782	0.001000	0.12720	0.342000	0.25602	0.003000	0.03518	-0.331000	0.07914	0.206000	0.20587	-0.391000	0.06502	GCG	0.699189		TCGA-2J-AAB6-01A-11D-A40W-08	0.522	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	1	0	1		2	2	2	0		0	0	80		80	78	1	2.400000	-20.000000	1	0.540000	NM_018451	Missense_Mutation		91	87		410	398	1		1	0		0	0	80	0		1.000000	4.446425e-01	0	0	0	8	0	91	410
FRY	10129	broad.mit.edu	37	13	32776604	32776604	+	Missense_Mutation	SNP	G	G	A	rs138780336	byFrequency	TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr13:32776604G>A	ENST00000380250.3	+	31	4454	c.3958G>A	c.(3958-3960)Gcc>Acc	p.A1320T		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	1320						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CGTGTCACTTGCCCTCTTGTC	0.493													G|||	10	0.00199681	0.0	0.0	5008	,	,		15212	0.0		0.0099	False		,,,				2504	0.0					ENST00000380250.3	1.000000	7.900000e-01	1	8.800000e-01	0.980000	0.957021	0.980000	1.000000																										0				132						c.(3958-3960)Gcc>Acc		furry homolog (Drosophila)		G	THR/ALA	3,3995		0,3,1996	82.0	82.0	82.0		3958	0.4	0.0	13	dbSNP_134	82	74,8254		0,74,4090	yes	missense	FRY	NM_023037.2	58	0,77,6086	AA,AG,GG		0.8886,0.075,0.6247	benign	1320/3014	32776604	77,12249	1999	4164	6163	SO:0001583	missense	10129	1040	120918	63				g.chr13:32776604G>A	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.3958G>A	chr13.hg19:g.32776604G>A	ENSP00000369600:p.Ala1320Thr	1						p.A1320T	NM_023037.2	NP_075463.2	2	2	4	2.750899	Q5TBA9	FRY_HUMAN		31	4454	+		Lung SC(185;0.0271)	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	1	0	hg19	c.3958G>A	CCDS41875.1	1	7	0.003205128205128205	0	0.0	0	0.0	0	0.0	7	0.009234828496042216	G	2.769	-0.256043	0.05829	7.5E-4	0.008886	ENSG00000073910	ENST00000380250;ENST00000380257	T	0.22134	1.97	5.39	0.368	0.16146	5.39	0.368	0.16146	.	0.470626	0.24400	N	0.038856	T	0.06234	0.0161	N	0.08118	0	0.19775	N	0.999957	B	0.10296	0.003	B	0.13407	0.009	T	0.27872	-1.0061	10	0.32370	T	0.25	.	7.9252	0.29870	0.2558:0.0:0.6374:0.1067	.	1320	Q5TBA9	FRY_HUMAN	T	1320;159	ENSP00000369600:A1320T	ENSP00000369600:A1320T	A	+	1	0	0	FRY	31674604	31674604	0.044000	0.20184	0.003000	0.11579	0.002000	0.02628	0.854000	0.27791	-0.182000	0.10602	-1.644000	0.00765	GCC	0.699189		TCGA-2J-AAB6-01A-11D-A40W-08	0.493	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	0	0	1		2	2	2	0		0	0	86		86	86	1	2.400000	-2.742349	1	0.540000	NM_023037			79	78		374	371	1		1	0		0	0	86	0		1.000000	8.248782e-02	0	0	0	3	0	79	374
CKAP2	26586	broad.mit.edu	37	13	53035900	53035900	+	Silent	SNP	A	A	G			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr13:53035900A>G	ENST00000378037.5	+	4	1032	c.942A>G	c.(940-942)ctA>ctG	p.L314L	CKAP2_ENST00000378034.3_Silent_p.L313L|CKAP2_ENST00000258607.5_Silent_p.L313L|CKAP2_ENST00000490903.1_Silent_p.L265L	NM_001098525.1|NM_018204.3	NP_001091995.1|NP_060674.3			cytoskeleton associated protein 2											breast(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(3)|skin(1)|urinary_tract(1)	20		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		ATAAGACTCTATCAAGATCCA	0.388																																						ENST00000378037.5	0.160000	1.000000e-02	1.200000e-01	4.000000e-02	0.070000	0.093031	0.070000	0.080000																										0				20						c.(940-942)ctA>ctG		cytoskeleton associated protein 2							77.0	82.0	81.0					13																	53035900		2203	4300	6503	SO:0001819	synonymous_variant	26586	0	0					g.chr13:53035900A>G	AF177227	CCDS9435.1, CCDS41893.1, CCDS66557.1, CCDS73578.1	13q14	2014-03-21			ENSG00000136108	ENSG00000136108			1990	protein-coding gene	gene with protein product		611569				9771967	Standard	XM_005266343		Approved	LB1, FLJ10749, se20-10, TMAP	uc001vgv.2	Q8WWK9	OTTHUMG00000016967	ENST00000378037.5:c.942A>G	chr13.hg19:g.53035900A>G		1					CKAP2_ENST00000378034.3_Silent_p.L313L|CKAP2_ENST00000258607.5_Silent_p.L313L|CKAP2_ENST00000490903.1_Silent_p.L265L	p.L314L	NM_001098525.1|NM_018204.3	NP_001091995.1|NP_060674.3	2	2	4	2.750899				4	1032	+		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		Silent	SNP	ENST00000378037.5	0	1	hg19	c.942A>G	CCDS41893.1	0																																																																																								0.699189		TCGA-2J-AAB6-01A-11D-A40W-08	0.388	CKAP2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355010.2	0	0	1		2	2	2	0		0	0	112		112	112	1	2.400000	-6.558445	1	0.540000				8	8		598	596	0		1	0		0	0	112	0		0.989295	1.033552e-01	0	0	0	35	0	8	598
PCDH9	5101	broad.mit.edu	37	13	66878849	66878849	+	Missense_Mutation	SNP	T	T	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr13:66878849T>A	ENST00000377865.2	-	4	3786	c.3652A>T	c.(3652-3654)Aat>Tat	p.N1218Y	PCDH9_ENST00000328454.5_Missense_Mutation_p.N1184Y|PCDH9-AS1_ENST00000430861.1_RNA|PCDH9_ENST00000456367.1_Missense_Mutation_p.N1184Y|PCDH9_ENST00000544246.1_Missense_Mutation_p.N1218Y			Q9HC56	PCDH9_HUMAN	protocadherin 9	1218					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GACTTCAGATTTGCCAGAGGA	0.438																																						ENST00000377865.2	1.000000	5.600000e-01	8.800000e-01	6.500000e-01	0.760000	0.770280	0.760000	0.750000																										0				103						c.(3652-3654)Aat>Tat		protocadherin 9							125.0	113.0	117.0					13																	66878849		2203	4300	6503	SO:0001583	missense	5101	0	0					g.chr13:66878849T>A	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3652A>T	chr13.hg19:g.66878849T>A	ENSP00000367096:p.Asn1218Tyr	1					PCDH9-AS1_ENST00000430861.1_RNA|PCDH9_ENST00000328454.5_Missense_Mutation_p.N1184Y|PCDH9_ENST00000456367.1_Missense_Mutation_p.N1184Y|PCDH9_ENST00000544246.1_Missense_Mutation_p.N1218Y	p.N1218Y			2	2	4	2.750899	Q9HC56	PCDH9_HUMAN		4	3786	-		Hepatocellular(98;0.0906)|Breast(118;0.107)	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	1	1	hg19	c.3652A>T	CCDS9444.1	0	.	.	.	.	.	.	.	.	.	.	T	15.50	2.852432	0.51270	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	T;T;T;T	0.55588	0.58;0.58;0.51;0.51	6.05	6.05	0.98169	6.05	6.05	0.98169	.	0.000000	0.50627	D	0.000113	T	0.43389	0.1245	N	0.19112	0.55	0.41796	D	0.989894	B;B;B	0.23442	0.085;0.042;0.085	B;B;B	0.28139	0.064;0.086;0.064	T	0.36890	-0.9729	10	0.56958	D	0.05	.	16.5932	0.84781	0.0:0.0:0.0:1.0	.	1176;1184;1218	B7ZM79;Q9HC56-2;Q9HC56	.;.;PCDH9_HUMAN	Y	1218;1218;1184;1184	ENSP00000442186:N1218Y;ENSP00000367096:N1218Y;ENSP00000401699:N1184Y;ENSP00000332060:N1184Y	ENSP00000332060:N1184Y	N	-	1	0	0	PCDH9	65776850	65776850	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.698000	0.84413	2.320000	0.78422	0.528000	0.53228	AAT	0.699189		TCGA-2J-AAB6-01A-11D-A40W-08	0.438	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	1	0	1		2	2	2	0		0	0	57		57	56	1	2.400000	-20.000000	1	0.540000	NM_203487			44	44		285	284	1		1			0	0	57	0		1.000000	0	0	0	0	0	0	44	285
SALL2	6297	broad.mit.edu	37	14	21991588	21991588	+	Silent	SNP	C	C	T	rs200356033	byFrequency	TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr14:21991588C>T	ENST00000327430.3	-	2	2568	c.2274G>A	c.(2272-2274)ccG>ccA	p.P758P	AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000450879.2_Silent_p.P621P|SALL2_ENST00000538754.1_Intron|SALL2_ENST00000317492.5_Intron	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	758					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		ACTCCTCTTCCGGTGATGGCT	0.577													C|||	2	0.000399361	0.0	0.0029	5008	,	,		19925	0.0		0.0	False		,,,				2504	0.0					ENST00000327430.3	1.000000	5.600000e-01	9.200000e-01	6.700000e-01	0.780000	0.795850	0.780000	1.000000																										0				43						c.(2272-2274)ccG>ccA		spalt-like transcription factor 2		C		0,4406		0,0,2203	51.0	50.0	50.0		2274	-4.5	0.2	14		50	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SALL2	NM_005407.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		758/1008	21991588	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6297	4	121412	38				g.chr14:21991588C>T	AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.2274G>A	chr14.hg19:g.21991588C>T		1					AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000538754.1_Intron|SALL2_ENST00000317492.5_Intron|SALL2_ENST00000450879.2_Silent_p.P621P	p.P758P	NM_005407.1	NP_005398.1	1	2	3	2.230265	Q9Y467	SALL2_HUMAN		2	2568	-	all_cancers(95;0.000662)		B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Silent	SNP	ENST00000327430.3	1	1	hg19	c.2274G>A	CCDS32045.1	0	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	5.549	0.286213	0.10513	0.0	1.16E-4	ENSG00000165821	ENST00000546363	.	.	.	4.76	-4.5	0.03493	4.76	-4.5	0.03493	.	.	.	.	.	T	0.30198	0.0757	.	.	.	0.33671	D	0.61096	.	.	.	.	.	.	T	0.38023	-0.9680	4	.	.	.	-4.7548	2.0412	0.03550	0.1233:0.2335:0.3794:0.2638	.	.	.	.	Q	617	.	.	R	-	2	0	0	SALL2	21061428	21061428	0.000000	0.05858	0.236000	0.24074	0.786000	0.44442	-1.953000	0.01526	-1.030000	0.03312	-1.264000	0.01445	CGG	0.637024		TCGA-2J-AAB6-01A-11D-A40W-08	0.577	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	1	0	1		2	2	2	0		0	0	35		35	34	1	2.400000	-3.031295	1	0.540000	NM_005407			33	33		164	161	1		1	0		0	0	35	0		1.000000	6.692840e-01	0	0	0	13	0	33	164
DHRS2	10202	broad.mit.edu	37	14	24108419	24108419	+	Missense_Mutation	SNP	C	C	T	rs74036809		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr14:24108419C>T	ENST00000250383.6	+	3	648	c.172C>T	c.(172-174)Cgg>Tgg	p.R58W	DHRS2_ENST00000553896.1_3'UTR|DHRS2_ENST00000344777.7_Missense_Mutation_p.R58W	NM_005794.3	NP_005785.1	Q13268	DHRS2_HUMAN	dehydrogenase/reductase (SDR family) member 2	58					C21-steroid hormone metabolic process (GO:0008207)|cellular response to oxidative stress (GO:0034599)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	carbonyl reductase (NADPH) activity (GO:0004090)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00659)		ACGTCTGGCCCGGGACGGGGC	0.642													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16784	0.0		0.0	False		,,,				2504	0.0					ENST00000250383.6	1.000000	8.400000e-01	1	9.100000e-01	0.980000	0.966183	0.980000	1.000000																										0				14						c.(172-174)Cgg>Tgg		dehydrogenase/reductase (SDR family) member 2							76.0	83.0	81.0					14																	24108419		2203	4300	6503	SO:0001583	missense	10202	1	121412	36				g.chr14:24108419C>T		CCDS9604.1, CCDS41927.1	14q11.2	2011-09-14			ENSG00000100867	ENSG00000100867		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18349	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 1"""	615194				7556196, 11944995, 16685466, 19027726	Standard	NM_182908		Approved	HEP27, SDR25C1	uc001wkt.4	Q13268	OTTHUMG00000028771	ENST00000250383.6:c.172C>T	chr14.hg19:g.24108419C>T	ENSP00000250383:p.Arg58Trp	1					DHRS2_ENST00000553896.1_3'UTR|DHRS2_ENST00000344777.7_Missense_Mutation_p.R58W	p.R58W	NM_005794.3	NP_005785.1	1	2	3	2.214976	Q13268	DHRS2_HUMAN		3	648	+			D3DS54|Q53GS4|Q7Z789|Q9H2R2	Missense_Mutation	SNP	ENST00000250383.6	1	1	hg19	c.172C>T	CCDS9604.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	.	13.16	2.155684	0.38021	.	.	ENSG00000100867	ENST00000432832;ENST00000250383;ENST00000344777	T;T;T	0.45276	0.9;0.9;0.9	4.91	0.99	0.19807	4.91	0.99	0.19807	NAD(P)-binding domain (1);	0.667396	0.15085	N	0.281419	T	0.52435	0.1734	M	0.78285	2.405	0.22591	N	0.998957	D;D;D;P	0.69078	0.991;0.978;0.997;0.875	P;P;P;B	0.56648	0.773;0.773;0.803;0.193	T	0.43782	-0.9370	10	0.87932	D	0	.	5.0764	0.14634	0.2895:0.5478:0.0:0.1626	.	36;58;58;36	Q13268;C9JZP6;D3DS54;Q13268-2	DHRS2_HUMAN;.;.;.	W	58	ENSP00000401213:R58W;ENSP00000250383:R58W;ENSP00000344674:R58W	ENSP00000250383:R58W	R	+	1	2	2	DHRS2	23178259	23178259	0.112000	0.22096	0.511000	0.27724	0.002000	0.02628	0.432000	0.21461	0.007000	0.14760	-0.350000	0.07774	CGG	0.632324		TCGA-2J-AAB6-01A-11D-A40W-08	0.642	DHRS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000071842.2	1	0	1		2	2	2	0		0	0	170		170	165	1	2.400000	-3.145736	1	0.540000	NM_182908			157	156		583	572	1		1	0		0	0	170	0		1.000000	9.685178e-01	0	0	0	23	0	157	583
PRPF39	55015	broad.mit.edu	37	14	45578898	45578898	+	Missense_Mutation	SNP	T	T	C	rs377585844		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr14:45578898T>C	ENST00000355765.6	+	8	1261	c.1091T>C	c.(1090-1092)aTt>aCt	p.I364T	SNORD127_ENST00000458892.1_RNA	NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	364					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						GAATTTGAAATTGAAAATGGG	0.333																																						ENST00000355765.6	1.000000	4.400000e-01	1	5.900000e-01	0.780000	0.782465	0.780000	1.000000																										0				12						c.(1090-1092)aTt>aCt		pre-mRNA processing factor 39		T	THR/ILE	1,4403	2.1+/-5.4	0,1,2201	65.0	61.0	62.0		1091	5.7	1.0	14		62	0,8598		0,0,4299	no	missense	PRPF39	NM_017922.3	89	0,1,6500	CC,CT,TT		0.0,0.0227,0.0077	benign	364/670	45578898	1,13001	2202	4299	6501	SO:0001583	missense	55015	0	0					g.chr14:45578898T>C	AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.1091T>C	chr14.hg19:g.45578898T>C	ENSP00000348010:p.Ile364Thr	1					SNORD127_ENST00000458892.1_RNA	p.I364T	NM_017922.3	NP_060392.3	1	2	3	2.243838	Q86UA1	PRP39_HUMAN		8	1261	+			Q08AL1|Q08AL2|Q9NUU5	Missense_Mutation	SNP	ENST00000355765.6	1	1	hg19	c.1091T>C	CCDS9682.2	0	.	.	.	.	.	.	.	.	.	.	T	15.07	2.725036	0.48833	2.27E-4	0.0	ENSG00000185246	ENST00000355765	T	0.34072	1.38	5.72	5.72	0.89469	5.72	5.72	0.89469	.	0.099811	0.64402	D	0.000003	T	0.44222	0.1283	M	0.61703	1.905	0.80722	D	1	P	0.38129	0.619	P	0.46299	0.511	T	0.24870	-1.0148	10	0.14252	T	0.57	-0.4776	14.8233	0.70091	0.0:0.0:0.0:1.0	.	364	Q86UA1	PRP39_HUMAN	T	364	ENSP00000348010:I364T	ENSP00000348010:I364T	I	+	2	0	0	PRPF39	44648648	44648648	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.845000	0.86875	2.184000	0.69523	0.383000	0.25322	ATT	0.633115		TCGA-2J-AAB6-01A-11D-A40W-08	0.333	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319683.2	1	0	1		2	2	2	0		0	0	18		18	18	1	2.400000	-19.999770	1	0.540000				13	13		67	67	1		1	1		0	0	18	0		0.999688	9.632648e-01	0	12	0	20	0	13	67
PCNX	22990	broad.mit.edu	37	14	71500186	71500186	+	Missense_Mutation	SNP	T	T	G			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr14:71500186T>G	ENST00000304743.2	+	17	4045	c.3599T>G	c.(3598-3600)aTt>aGt	p.I1200S	PCNX_ENST00000238570.5_Missense_Mutation_p.I1200S|PCNX_ENST00000439984.3_Missense_Mutation_p.I1089S	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1200						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		CTTTTCTCCATTTTTTGTGGT	0.338																																						ENST00000304743.2	1.000000	8.300000e-01	1	9.200000e-01	0.990000	0.972186	0.990000	1.000000																										0				87						c.(3598-3600)aTt>aGt		pecanex homolog (Drosophila)							168.0	150.0	156.0					14																	71500186		2203	4300	6503	SO:0001583	missense	22990	0	0					g.chr14:71500186T>G	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.3599T>G	chr14.hg19:g.71500186T>G	ENSP00000304192:p.Ile1200Ser	1					PCNX_ENST00000439984.3_Missense_Mutation_p.I1089S|PCNX_ENST00000238570.5_Missense_Mutation_p.I1200S	p.I1200S	NM_014982.2	NP_055797.2	1	2	3	2.243838	Q96RV3	PCX1_HUMAN	KIRC - Kidney renal clear cell carcinoma(12;0.206)	17	4045	+			B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	1	1	hg19	c.3599T>G	CCDS9806.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.1|20.1	3.934512|3.934512	0.73442|0.73442	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000554691|ENST00000304743;ENST00000238570;ENST00000439984	.|T;T;T	.|0.11063	.|3.25;3.23;2.81	5.72|5.72	5.72|5.72	0.89469|0.89469	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	.|0.547984	.|0.21165	.|N	.|0.079081	T|T	0.14743|0.14743	0.0356|0.0356	L|L	0.43923|0.43923	1.385|1.385	0.25807|0.25807	N|N	0.984448|0.984448	.|B;B;B	.|0.21606	.|0.039;0.037;0.058	.|B;B;B	.|0.31191	.|0.125;0.053;0.085	T|T	0.13442|0.13442	-1.0509|-1.0509	5|10	.|0.87932	.|D	.|0	.|.	15.9971|15.9971	0.80260|0.80260	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1200;1089;1200	.|Q96RV3-3;B2RTR6;Q96RV3	.|.;.;PCX1_HUMAN	V|S	259|1200;1200;1089	.|ENSP00000304192:I1200S;ENSP00000238570:I1200S;ENSP00000396617:I1089S	.|ENSP00000238570:I1200S	F|I	+|+	1|2	0|0	0|0	PCNX|PCNX	70569939|70569939	70569939|70569939	1.000000|1.000000	0.71417|0.71417	0.286000|0.286000	0.24833|0.24833	0.995000|0.995000	0.86356|0.86356	7.436000|7.436000	0.80404|0.80404	2.186000|2.186000	0.69663|0.69663	0.528000|0.528000	0.53228|0.53228	TTT|ATT	0.633115		TCGA-2J-AAB6-01A-11D-A40W-08	0.338	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	1	0	1		2	2	2	0		0	0	83		83	83	1	2.400000	-20.000000	1	0.540000	NM_014982			83	82		296	294	1		1	0		0	0	83	0		1.000000	6.793613e-01	0	0	0	10	0	83	296
YLPM1	56252	broad.mit.edu	37	14	75248343	75248343	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr14:75248343A>G	ENST00000552421.1	+	4	1721	c.1597A>G	c.(1597-1599)Atg>Gtg	p.M533V	YLPM1_ENST00000238571.3_Intron|YLPM1_ENST00000325680.7_Missense_Mutation_p.M533V			P49750	YLPM1_HUMAN	YLP motif containing 1	0					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TCTACCTACAATGCCCCCTCC	0.527																																						ENST00000552421.1	1.000000	3.000000e-02	1.100000e-01	4.000000e-02	0.070000	0.119925	0.070000	0.060000																										0				62						c.(1597-1599)Atg>Gtg		YLP motif containing 1							209.0	217.0	214.0					14																	75248343		2100	4203	6303	SO:0001583	missense	56252	5	121060	41				g.chr14:75248343A>G	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.1597A>G	chr14.hg19:g.75248343A>G	ENSP00000447921:p.Met533Val	1					YLPM1_ENST00000325680.7_Missense_Mutation_p.M533V|YLPM1_ENST00000238571.3_Intron	p.M533V			1	2	3	2.243838	P49750	YLPM1_HUMAN	KIRC - Kidney renal clear cell carcinoma(43;0.238)	4	1721	+			P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000552421.1	0	1	hg19	c.1597A>G		0	.	.	.	.	.	.	.	.	.	.	A	11.07	1.531914	0.27387	.	.	ENSG00000119596	ENST00000552421;ENST00000325680;ENST00000423680	.	.	.	5.84	4.67	0.58626	5.84	4.67	0.58626	.	.	.	.	.	T	0.39572	0.1083	N	0.24115	0.695	0.80722	D	1	B	0.15930	0.015	B	0.14023	0.01	T	0.14282	-1.0478	8	0.12430	T	0.62	.	10.5131	0.44874	0.8549:0.0:0.0:0.1451	.	533	P49750-4	.	V	533;533;246	.	ENSP00000324463:M533V	M	+	1	0	0	YLPM1	74318096	74318096	0.874000	0.30092	1.000000	0.80357	0.994000	0.84299	1.654000	0.37334	1.006000	0.39211	0.482000	0.46254	ATG	0.633115		TCGA-2J-AAB6-01A-11D-A40W-08	0.527	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1	0	0	1		2	2	2	0		0	0	135		135	130	1	2.400000	-3.322154	1	0.540000	NM_019589			11	11		715	689	0		1	0		0	0	135	0		0.997973	9.677420e-03	0	0	0	9	0	11	715
PTPN21	11099	broad.mit.edu	37	14	88946299	88946299	+	Silent	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr14:88946299G>A	ENST00000556564.1	-	13	1760	c.1476C>T	c.(1474-1476)agC>agT	p.S492S	PTPN21_ENST00000328736.3_Silent_p.S492S	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	492					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TCTCGGGCTGGCTGTAGACCA	0.677																																						ENST00000556564.1	1.000000	2.000000e-02	1.500000e-01	5.000000e-02	0.090000	0.143305	0.090000	0.090000																										0				45						c.(1474-1476)agC>agT		protein tyrosine phosphatase, non-receptor type 21							31.0	37.0	35.0					14																	88946299		2203	4299	6502	SO:0001819	synonymous_variant	11099	0	0					g.chr14:88946299G>A	X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.1476C>T	chr14.hg19:g.88946299G>A		1					PTPN21_ENST00000328736.3_Silent_p.S492S	p.S492S	NM_007039.3	NP_008970.2	1	2	3	2.243838	Q16825	PTN21_HUMAN		13	1760	-				Silent	SNP	ENST00000556564.1	0	1	hg19	c.1476C>T	CCDS9884.1	0																																																																																								0.633115		TCGA-2J-AAB6-01A-11D-A40W-08	0.677	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1	0	0	0		2	2	2	0		0	0	55		55	54	1	2.400000	-6.152917	1	0.540000				5	3		268	264	0		1	0		0	0	55	0		0.934398	1.628116e-03	0	0	0	3	0	5	268
DUOXA2	405753	broad.mit.edu	37	15	45410081	45410081	+	Missense_Mutation	SNP	T	T	G			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08			T	G	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr15:45410081T>G	ENST00000323030.5	+	6	1222	c.937T>G	c.(937-939)Tta>Gta	p.L313V	DUOXA1_ENST00000559014.1_Intron|DUOXA1_ENST00000267803.4_Intron|DUOXA1_ENST00000430224.2_Intron|DUOXA1_ENST00000558996.1_3'UTR	NM_207581.3	NP_997464.2	Q1HG44	DOXA2_HUMAN	dual oxidase maturation factor 2	313					hydrogen peroxide metabolic process (GO:0042743)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)							all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		TCTCCCAGACTTAAAATGTAT	0.627											OREG0023102	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000323030.5	1.000000	9.200000e-01	1	9.900000e-01	0.990000	0.994786	0.990000	1.000000																										0										c.(937-939)Tta>Gta		dual oxidase maturation factor 2							56.0	67.0	63.0					15																	45410081		2198	4298	6496	SO:0001583	missense	405753	0	0					g.chr15:45410081T>G	BX537581	CCDS10118.2	15q21.1	2008-10-30		2006-07-25	ENSG00000140274	ENSG00000140274			32698	protein-coding gene	gene with protein product		612772				16651268	Standard	NM_207581		Approved		uc001zuo.3	Q1HG44	OTTHUMG00000131354	ENST00000323030.5:c.937T>G	chr15.hg19:g.45410081T>G	ENSP00000319705:p.Leu313Val	0		OREG0023102	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	931	DUOXA1_ENST00000559014.1_Intron|DUOXA1_ENST00000558996.1_3'UTR|DUOXA1_ENST00000430224.2_Intron|DUOXA1_ENST00000267803.4_Intron	p.L313V	NM_207581.3	NP_997464.2	0	0	0	1.785055	Q1HG44	DOXA2_HUMAN		6	1222	+		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)	B2RPI9|H0YNQ6	Missense_Mutation	SNP	ENST00000323030.5	1	1	hg19	c.937T>G	CCDS10118.2	1	.	.	.	.	.	.	.	.	.	.	T	12.13	1.847058	0.32606	.	.	ENSG00000140274	ENST00000323030	T	0.58060	0.36	4.74	0.676	0.17958	4.74	0.676	0.17958	.	1.222260	0.05905	N	0.630659	T	0.29684	0.0741	N	0.08118	0	0.09310	N	0.999996	B	0.22800	0.075	B	0.19148	0.024	T	0.19976	-1.0289	10	0.34782	T	0.22	-0.0761	4.5387	0.12047	0.3478:0.0:0.18:0.4722	.	313	Q1HG44	DOXA2_HUMAN	V	313	ENSP00000319705:L313V	ENSP00000319705:L313V	L	+	1	2	2	DUOXA2	43197373	43197373	0.002000	0.14202	0.005000	0.12908	0.048000	0.14542	0.541000	0.23207	0.346000	0.23899	0.459000	0.35465	TTA	0.534978		TCGA-2J-AAB6-01A-11D-A40W-08	0.627	DUOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254142.1	1	0	1		2	2	2	0		0	0	125		125	122	1	2.400000	-20.000000	1	0.540000	NM_207581			119	115		280	275	1		1	1		0	0	125	0		1.000000	9.963306e-01	0	2	0	21	0	119	280
PIF1	80119	broad.mit.edu	37	15	65116102	65116102	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr15:65116102G>A	ENST00000268043.4	-	2	527	c.433C>T	c.(433-435)Cgc>Tgc	p.R145C	PIF1_ENST00000559239.1_Missense_Mutation_p.R145C|PIF1_ENST00000333425.6_Missense_Mutation_p.R145C					PIF1 5'-to-3' DNA helicase											kidney(1)|lung(1)	2						ACGAAGTCGCGGGGCCGCGGG	0.761																																						ENST00000268043.4	1.000000	7.600000e-01	1	9.700000e-01	0.990000	0.977838	0.990000	1.000000																										0				2						c.(433-435)Cgc>Tgc		PIF1 5'-to-3' DNA helicase							4.0	5.0	5.0					15																	65116102		1528	3381	4909	SO:0001583	missense	80119	0	0					g.chr15:65116102G>A	AK026345	CCDS10195.2, CCDS66797.1	15q22.1	2013-05-13	2013-05-13	2006-11-24	ENSG00000140451	ENSG00000140451	3.6.4.12		26220	protein-coding gene	gene with protein product		610953	"""chromosome 15 open reading frame 20"", ""PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae)"""	C15orf20		10926538, 16522649	Standard	NM_025049		Approved	FLJ22692	uc002ant.2	Q9H611	OTTHUMG00000132974	ENST00000268043.4:c.433C>T	chr15.hg19:g.65116102G>A	ENSP00000268043:p.Arg145Cys	0					PIF1_ENST00000333425.6_Missense_Mutation_p.R145C|PIF1_ENST00000559239.1_Missense_Mutation_p.R145C	p.R145C			0	0	0	1.785055				2	527	-				Missense_Mutation	SNP	ENST00000268043.4	0	1	hg19	c.433C>T	CCDS10195.2	1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.528021	0.44969	.	.	ENSG00000140451	ENST00000268043;ENST00000333425	T;T	0.78364	-0.14;-1.17	4.47	4.47	0.54385	4.47	4.47	0.54385	.	0.272984	0.35677	N	0.003051	T	0.80385	0.4613	M	0.61703	1.905	0.53688	D	0.999977	D;D	0.69078	0.968;0.997	B;P	0.49999	0.406;0.628	T	0.83148	-0.0105	10	0.59425	D	0.04	-11.2753	15.0059	0.71513	0.0:0.0:1.0:0.0	.	145;145	Q9H611-2;Q9H611	.;PIF1_HUMAN	C	145	ENSP00000268043:R145C;ENSP00000328174:R145C	ENSP00000268043:R145C	R	-	1	0	0	PIF1	62903155	62903155	1.000000	0.71417	0.996000	0.52242	0.071000	0.16799	4.455000	0.60075	2.188000	0.69820	0.313000	0.20887	CGC	0.534978		TCGA-2J-AAB6-01A-11D-A40W-08	0.761	PIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256533.1	1	0	1		2	2	2	0		0	0	8		8	8	1	2.400000	-20.000000	1	0.540000	NM_025049			15	15		30	28	0		1	0		0	0	8	0		0.999941	0	0	1	0	0	0	15	30
OR4F6	390648	broad.mit.edu	37	15	102345944	102345944	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr15:102345944G>A	ENST00000328882.4	+	1	43	c.22G>A	c.(22-24)Gtg>Atg	p.V8M		NM_001005326.1	NP_001005326.1	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F, member 6	8						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(1)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			CAATCACTCTGTGGTCTCTGA	0.473																																						ENST00000328882.4	1.000000	8.000000e-01	1	8.900000e-01	0.970000	0.957006	0.970000	1.000000																										0				22						c.(22-24)Gtg>Atg		olfactory receptor, family 4, subfamily F, member 6							133.0	121.0	125.0					15																	102345944		2203	4300	6503	SO:0001583	missense	390648	0	0					g.chr15:102345944G>A	AC025234	CCDS32341.1	15q26.3	2014-02-19	2002-02-28		ENSG00000184140	ENSG00000184140		"""GPCR / Class A : Olfactory receptors"""	15372	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily F, member 12"""	OR4F12			Standard	NM_001005326		Approved		uc010utr.2	Q8NGB9	OTTHUMG00000172267	ENST00000328882.4:c.22G>A	chr15.hg19:g.102345944G>A	ENSP00000327525:p.Val8Met	0						p.V8M	NM_001005326.1	NP_001005326.1	0	0	0	1.785055	Q8NGB9	OR4F6_HUMAN	OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)	1	43	+	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		B9EH28|Q6IF95	Missense_Mutation	SNP	ENST00000328882.4	1	1	hg19	c.22G>A	CCDS32341.1	1	.	.	.	.	.	.	.	.	.	.	.	7.495	0.651526	0.14516	.	.	ENSG00000184140	ENST00000328882	T	0.20069	2.1	4.68	0.44	0.16572	4.68	0.44	0.16572	.	0.780148	0.10877	N	0.624199	T	0.17365	0.0417	L	0.46670	1.46	0.24977	N	0.991629	B	0.25351	0.124	B	0.25405	0.06	T	0.26326	-1.0106	10	0.38643	T	0.18	.	6.7176	0.23312	0.4434:0.0:0.5566:0.0	.	8	Q8NGB9	OR4F6_HUMAN	M	8	ENSP00000327525:V8M	ENSP00000327525:V8M	V	+	1	0	0	OR4F6	100163467	100163467	0.000000	0.05858	0.314000	0.25224	0.168000	0.22595	0.041000	0.13927	-0.002000	0.14469	0.591000	0.81541	GTG	0.534978		TCGA-2J-AAB6-01A-11D-A40W-08	0.473	OR4F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417593.1	1	0	1		2	2	2	0		0	0	86		86	86	1	2.400000	-20.000000	1	0.540000				86	85		234	229	1		1			0	0	86	0		1.000000	0	0	0	0	0	0	86	234
ZNF500	26048	broad.mit.edu	37	16	4803036	4803036	+	Missense_Mutation	SNP	C	C	T	rs142409847		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr16:4803036C>T	ENST00000219478.6	-	6	1083	c.784G>A	c.(784-786)Ggc>Agc	p.G262S	ZNF500_ENST00000591026.1_5'UTR|RP11-127I20.7_ENST00000588099.1_RNA|ZNF500_ENST00000545009.1_Missense_Mutation_p.G262S			O60304	ZN500_HUMAN	zinc finger protein 500	262					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	21						CCATCACCGCCGTCCTCCAAC	0.587																																						ENST00000219478.6	0.970000	5.700000e-01	8.800000e-01	6.600000e-01	0.760000	0.775649	0.760000	0.760000																										0				21						c.(784-786)Ggc>Agc		zinc finger protein 500		C	SER/GLY	0,4382		0,0,2191	39.0	46.0	43.0		784	3.1	0.0	16	dbSNP_134	43	1,8583		0,1,4291	no	missense	ZNF500	NM_021646.1	56	0,1,6482	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	262/481	4803036	1,12965	2191	4292	6483	SO:0001583	missense	26048	5	120886	38				g.chr16:4803036C>T	AB011129	CCDS32383.1	16p13.3	2013-01-09				ENSG00000103199		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23716	protein-coding gene	gene with protein product						9628581	Standard	XM_005255243		Approved	ZKSCAN18, KIAA0557, ZSCAN50	uc002cxp.1	O60304		ENST00000219478.6:c.784G>A	chr16.hg19:g.4803036C>T	ENSP00000219478:p.Gly262Ser	1					ZNF500_ENST00000545009.1_Missense_Mutation_p.G262S|ZNF500_ENST00000591026.1_5'UTR|RP11-127I20.7_ENST00000588099.1_RNA	p.G262S			0	2	2	1.776729	O60304	ZN500_HUMAN		6	1083	-			A8K6X7|B4DNN9|Q0VAL2|Q96CQ8|Q9BTG0	Missense_Mutation	SNP	ENST00000219478.6	1	1	hg19	c.784G>A	CCDS32383.1	0	.	.	.	.	.	.	.	.	.	.	C	9.305	1.054035	0.19907	0.0	1.16E-4	ENSG00000103199	ENST00000545009;ENST00000219478	T;T	0.06294	3.41;3.32	4.04	3.08	0.35506	4.04	3.08	0.35506	Krueppel-associated box (1);	.	.	.	.	T	0.03305	0.0096	N	0.14661	0.345	0.09310	N	1	B;B	0.33755	0.424;0.27	B;B	0.17098	0.017;0.017	T	0.45629	-0.9248	9	0.23891	T	0.37	.	9.1061	0.36698	0.0:0.8891:0.0:0.1109	.	262;262	B4DNN9;O60304	.;ZN500_HUMAN	S	262	ENSP00000445714:G262S;ENSP00000219478:G262S	ENSP00000219478:G262S	G	-	1	0	0	ZNF500	4743037	4743037	0.001000	0.12720	0.048000	0.18961	0.011000	0.07611	1.284000	0.33249	0.694000	0.31654	0.655000	0.94253	GGC	0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.587	ZNF500-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432461.1	1	0	1		2	2	2	0		0	0	49		49	47	1	2.400000	-3.316967	1	0.540000	XM_085507			43	41		164	158	1		1	1		0	0	49	0		1.000000	6.491619e-01	0	3	0	7	0	43	164
HYDIN	54768	broad.mit.edu	37	16	70866926	70866926	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr16:70866926C>A	ENST00000393567.2	-	80	13874	c.13724G>T	c.(13723-13725)aGc>aTc	p.S4575I		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4575					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TTCTTCTGGGCTAATGGAGAA	0.408																																						ENST00000393567.2	1.000000	6.400000e-01	1	7.700000e-01	0.910000	0.896391	0.910000	1.000000																										0				43						c.(13723-13725)aGc>aTc		HYDIN, axonemal central pair apparatus protein							12.0	11.0	11.0					16																	70866926		1774	4001	5775	SO:0001583	missense	54768	0	0					g.chr16:70866926C>A	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.13724G>T	chr16.hg19:g.70866926C>A	ENSP00000377197:p.Ser4575Ile	1						p.S4575I	NM_001270974.1	NP_001257903.1	0	2	2	1.807789	Q4G0P3	HYDIN_HUMAN		80	13874	-		Ovarian(137;0.0654)	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	0	1	hg19	c.13724G>T	CCDS59269.1	1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.244960	0.39697	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01092	5.35	4.62	-0.853	0.10709	4.62	-0.853	0.10709	.	0.182103	0.24965	U	0.034191	T	0.01835	0.0058	M	0.78801	2.425	0.09310	N	1	B	0.32862	0.387	B	0.34418	0.182	T	0.38436	-0.9661	10	0.34782	T	0.22	.	8.4169	0.32676	0.0:0.4301:0.424:0.1459	.	4574	F8WD23	.	I	4575;4574	ENSP00000377197:S4575I	ENSP00000313052:S4574I	S	-	2	0	0	HYDIN	69424427	69424427	0.000000	0.05858	0.991000	0.47740	0.958000	0.62258	-0.587000	0.05780	0.231000	0.21079	0.511000	0.50034	AGC	0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.408	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3	0	0	1		2	2	2	0		0	0	32		32	52	1	2.400000	-20.000000	1	0.540000				28	15		85	61	0		1			0	0	32	0		0.999999	0	0	0	0	0	0	28	85
ADAD2	161931	broad.mit.edu	37	16	84228145	84228145	+	Silent	SNP	G	G	A	rs541603528		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr16:84228145G>A	ENST00000315906.5	+	2	568	c.516G>A	c.(514-516)gcG>gcA	p.A172A	RP11-486L19.2_ENST00000565643.1_RNA|RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA|RP11-486L19.2_ENST00000561900.1_RNA|ADAD2_ENST00000268624.3_Silent_p.A244A	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	172	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						AGCAGGCAGCGCTCTCTGCCC	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		18538	0.001		0.0	False		,,,				2504	0.0					ENST00000315906.5	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				13						c.(514-516)gcG>gcA		adenosine deaminase domain containing 2							43.0	39.0	41.0					16																	84228145		2200	4299	6499	SO:0001819	synonymous_variant	161931	20	121292	39				g.chr16:84228145G>A	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.516G>A	chr16.hg19:g.84228145G>A		1					RP11-486L19.2_ENST00000536986.1_RNA|ADAD2_ENST00000268624.3_Silent_p.A244A|RP11-486L19.2_ENST00000569834.1_RNA|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA	p.A172A	NM_001145400.1	NP_001138872.1	0	2	2	1.807789	Q8NCV1	ADAD2_HUMAN		2	568	+			B2RCL6|Q8NA94	Silent	SNP	ENST00000315906.5	0	1	hg19	c.516G>A	CCDS45536.1	1	.	.	.	.	.	.	.	.	.	.	G	1.347	-0.592612	0.03799	.	.	ENSG00000250685	ENST00000536986	.	.	.	4.15	-8.3	0.01005	4.15	-8.3	0.01005	.	0.000000	0.51477	D	0.000099	T	0.12050	0.0293	.	.	.	0.23791	N	0.996838	P	0.37997	0.614	B	0.29785	0.107	T	0.04825	-1.0924	8	0.87932	D	0	-25.5618	1.4709	0.02415	0.2479:0.1681:0.4182:0.1658	.	73	Q6ZW55	.	V	59	.	ENSP00000444170:A59V	A	-	2	0	0	AC009123.1	82785646	82785646	0.000000	0.05858	0.003000	0.11579	0.170000	0.22686	-3.759000	0.00373	-2.298000	0.00660	-1.291000	0.01355	GCG	0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.642	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	1	0	1		2	2	2	0		0	0	18		18	18	1	2.400000	-20.000000	1	0.540000	NM_139174			37	36		32	31	0		1			0	0	18	0		1.000000	0	0	0	0	0	0	37	32
MRPL45	84311	broad.mit.edu	37	17	36478035	36478035	+	Silent	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr17:36478035C>T	ENST00000312513.5	+	7	848	c.687C>T	c.(685-687)ggC>ggT	p.G229G		NM_032351.4	NP_115727.4	Q9BRJ2	RM45_HUMAN	mitochondrial ribosomal protein L45	229						mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	13	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				ACCGGTTTGGCCGGTTGATGT	0.438																																						ENST00000312513.5	0.100000	0	7.000000e-02	2.000000e-02	0.040000	0.051799	0.040000	0.040000																										0				13						c.(685-687)ggC>ggT		mitochondrial ribosomal protein L45							120.0	113.0	115.0					17																	36478035		2203	4300	6503	SO:0001819	synonymous_variant	84311	0	0					g.chr17:36478035C>T	BC006235	CCDS11326.1, CCDS74047.1	17q21.2	2014-05-06			ENSG00000174100	ENSG00000278845		"""Mitochondrial ribosomal proteins / large subunits"""	16651	protein-coding gene	gene with protein product		611850				11551941, 12706105	Standard	XM_006725366		Approved	MGC11321	uc002hpy.3	Q9BRJ2	OTTHUMG00000188489	ENST00000312513.5:c.687C>T	chr17.hg19:g.36478035C>T		1						p.G229G	NM_032351.4	NP_115727.4	0	2	2	1.795413	Q9BRJ2	RM45_HUMAN		7	848	+	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)	A1L436|Q6ZMJ5	Silent	SNP	ENST00000312513.5	0	1	hg19	c.687C>T	CCDS11326.1	0																																																																																								0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.438	MRPL45-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256792.3	0	0	1		2	2	2	0		0	0	139		139	139	1	2.400000	-1.932933	0	0.540000	NM_032351			5	5		420	407	0		1	0		0	0	139	0		0.932649	1.423286e-01	0	0	0	46	0	5	420
TP53	7157	broad.mit.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	24185	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576	c.(817-819)cGt>cAt	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						67.0	58.0	61.0					17																	7577120		2203	4300	6503	SO:0001583	missense	7157	3	121412	34	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577120C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	chr17.hg19:g.7577120C>T	ENSP00000269305:p.Arg273His	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron	p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	2	2	1.797329	P04637	P53_HUMAN		8	1007	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.818G>A	CCDS11118.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	0	TP53	7517845	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT	0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	6	0		0	0	33		33	33	1	2.400000	-20.000000	1	0.540000	NM_000546			53	53		59	57	1		1	1	1	0	1	33	1036		1.000000	1	1	30	529	17	414	53	59
GUCY2D	3000	broad.mit.edu	37	17	7917216	7917216	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr17:7917216G>A	ENST00000254854.4	+	12	2432	c.2282G>A	c.(2281-2283)cGg>cAg	p.R761Q		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	761	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				CAGAGGGTGCGGAGCCCCCCT	0.622																																						ENST00000254854.4	0.120000	1.000000e-02	9.000000e-02	3.000000e-02	0.060000	0.068255	0.060000	0.060000																										0				1						c.(2281-2283)cGg>cAg		guanylate cyclase 2D, membrane (retina-specific)							76.0	78.0	78.0					17																	7917216		2203	4300	6503	SO:0001583	missense	3000	2	121412	35				g.chr17:7917216G>A	L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.2282G>A	chr17.hg19:g.7917216G>A	ENSP00000254854:p.Arg761Gln	1						p.R761Q	NM_000180.3	NP_000171.1	0	2	2	1.797329	Q02846	GUC2D_HUMAN		12	2432	+		Prostate(122;0.157)	Q6LEA7	Missense_Mutation	SNP	ENST00000254854.4	0	1	hg19	c.2282G>A	CCDS11127.1	0	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109704	0.37242	.	.	ENSG00000132518	ENST00000254854	D	0.82619	-1.63	5.44	-5.28	0.02755	5.44	-5.28	0.02755	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.898770	0.09283	N	0.823427	T	0.71745	0.3376	L	0.48642	1.525	0.09310	N	1	B	0.19583	0.037	B	0.13407	0.009	T	0.58405	-0.7642	10	0.45353	T	0.12	.	5.9913	0.19465	0.447:0.0:0.3698:0.1832	.	761	Q02846	GUC2D_HUMAN	Q	761	ENSP00000254854:R761Q	ENSP00000254854:R761Q	R	+	2	0	0	GUCY2D	7857941	7857941	0.000000	0.05858	0.462000	0.27118	0.976000	0.68499	-0.284000	0.08422	-0.603000	0.05767	-0.345000	0.07892	CGG	0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.622	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2	0	0	1		2	2	2	0		0	0	100		100	99	1	2.400000	-2.876445	1	0.540000				6	7		371	364	0		1			0	0	100	0		0.963506	0	0	0	0	0	0	6	371
STXBP4	252983	broad.mit.edu	37	17	53158469	53158469	+	Missense_Mutation	SNP	C	C	T	rs199941077	byFrequency	TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr17:53158469C>T	ENST00000376352.2	+	16	1621	c.1414C>T	c.(1414-1416)Cgt>Tgt	p.R472C	STXBP4_ENST00000434978.2_Missense_Mutation_p.R450C	NM_178509.5	NP_848604.3	Q6ZWJ1	STXB4_HUMAN	syntaxin binding protein 4	472					cellular response to DNA damage stimulus (GO:0006974)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of keratinocyte proliferation (GO:0010838)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19						AAGGAATGGACGTAGCATCCC	0.398													C|||	2	0.000399361	0.0015	0.0	5008	,	,		17175	0.0		0.0	False		,,,				2504	0.0					ENST00000376352.2	1.000000	8.700000e-01	1	9.700000e-01	0.990000	0.987616	0.990000	1.000000																										0				19						c.(1414-1416)Cgt>Tgt		syntaxin binding protein 4							136.0	123.0	127.0					17																	53158469		2203	4300	6503	SO:0001583	missense	252983	5	121358	39				g.chr17:53158469C>T	BC041485	CCDS11584.2	17q22	2008-02-05			ENSG00000166263	ENSG00000166263			19694	protein-coding gene	gene with protein product		610415				12855681	Standard	XM_005257187		Approved	Synip, MGC50337	uc002iuf.1	Q6ZWJ1	OTTHUMG00000074043	ENST00000376352.2:c.1414C>T	chr17.hg19:g.53158469C>T	ENSP00000365530:p.Arg472Cys	1					STXBP4_ENST00000434978.2_Missense_Mutation_p.R450C	p.R472C	NM_178509.5	NP_848604.3	0	2	2	1.795413	Q6ZWJ1	STXB4_HUMAN		16	1621	+			Q8IVZ5	Missense_Mutation	SNP	ENST00000376352.2	1	1	hg19	c.1414C>T	CCDS11584.2	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	15.85	2.954687	0.53293	.	.	ENSG00000166263	ENST00000376352;ENST00000434978	T;T	0.48201	0.82;0.82	5.47	4.5	0.54988	5.47	4.5	0.54988	.	0.308438	0.36234	N	0.002705	T	0.50069	0.1594	M	0.63428	1.95	0.80722	D	1	D;D	0.60160	0.973;0.987	B;P	0.45610	0.325;0.487	T	0.58312	-0.7658	10	0.87932	D	0	-5.9541	13.5669	0.61824	0.1561:0.8439:0.0:0.0	.	450;472	E7EPP7;Q6ZWJ1	.;STXB4_HUMAN	C	472;450	ENSP00000365530:R472C;ENSP00000391087:R450C	ENSP00000365530:R472C	R	+	1	0	0	STXBP4	50513468	50513468	0.902000	0.30710	0.162000	0.22713	0.460000	0.32559	2.902000	0.48703	1.513000	0.48852	0.650000	0.86243	CGT	0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.398	STXBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157184.1	1	0	1		2	2	2	0		0	0	105		105	105	1	2.400000	-20.000000	1	0.540000	NM_178509			67	65		161	161	1		1	0		0	0	105	0		1.000000	8.831169e-02	0	0	0	2	0	67	161
AQP4	361	broad.mit.edu	37	18	24436417	24436417	+	Missense_Mutation	SNP	C	C	T	rs374302276		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr18:24436417C>T	ENST00000383168.4	-	5	858	c.730G>A	c.(730-732)Gct>Act	p.A244T	AQP4_ENST00000581374.1_Missense_Mutation_p.A222T|AQP4_ENST00000440832.3_Missense_Mutation_p.A222T|AQP4_ENST00000583022.1_5'UTR|AQP4-AS1_ENST00000582605.1_RNA|AQP4-AS1_ENST00000579964.1_RNA	NM_001650.4|NM_004028.3	NP_001641.1|NP_004019.1	P55087	AQP4_HUMAN	aquaporin 4	244					carbon dioxide transport (GO:0015670)|cellular response to estradiol stimulus (GO:0071392)|cellular response to interferon-gamma (GO:0071346)|female pregnancy (GO:0007565)|hyperosmotic salinity response (GO:0042538)|multicellular organismal water homeostasis (GO:0050891)|protein homooligomerization (GO:0051260)|renal water absorption (GO:0070295)|response to glucocorticoid (GO:0051384)|response to radiation (GO:0009314)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)	porin activity (GO:0015288)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			kidney(2)|large_intestine(3)|lung(5)|skin(1)	11	all_cancers(21;0.0172)|Lung NSC(5;0.00299)|all_lung(6;0.00747)|Ovarian(20;0.124)					AGGCCACCAGCGAGGACAGCT	0.433																																						ENST00000383168.4	1.000000	8.600000e-01	1	9.500000e-01	0.990000	0.982487	0.990000	1.000000																										0				11						c.(730-732)Gct>Act		aquaporin 4		C	THR/ALA,THR/ALA	0,4406		0,0,2203	83.0	82.0	82.0		730,664	5.8	1.0	18		82	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	AQP4	NM_001650.4,NM_004028.3	58,58	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging	244/324,222/302	24436417	2,13004	2203	4300	6503	SO:0001583	missense	361	3	121412	35				g.chr18:24436417C>T	U63622	CCDS11889.1, CCDS58617.1	18q11.2-q12.1	2005-09-20			ENSG00000171885	ENSG00000171885		"""Ion channels / Aquaporins"""	637	protein-coding gene	gene with protein product		600308				7528931	Standard	NM_001650		Approved	MIWC	uc002kwa.3	P55087	OTTHUMG00000131955	ENST00000383168.4:c.730G>A	chr18.hg19:g.24436417C>T	ENSP00000372654:p.Ala244Thr	1					AQP4_ENST00000583022.1_5'UTR|AQP4_ENST00000440832.3_Missense_Mutation_p.A222T|AQP4_ENST00000581374.1_Missense_Mutation_p.A222T|AQP4-AS1_ENST00000579964.1_RNA|AQP4-AS1_ENST00000582605.1_RNA	p.A244T	NM_001650.4|NM_004028.3	NP_001641.1|NP_004019.1	0	2	2	1.872823	P55087	AQP4_HUMAN		5	858	-	all_cancers(21;0.0172)|Lung NSC(5;0.00299)|all_lung(6;0.00747)|Ovarian(20;0.124)		P78564	Missense_Mutation	SNP	ENST00000383168.4	1	1	hg19	c.730G>A	CCDS11889.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.463024	0.96257	0.0	2.33E-4	ENSG00000171885	ENST00000383168;ENST00000440832;ENST00000383170	D	0.96265	-3.96	5.84	5.84	0.93424	5.84	5.84	0.93424	Aquaporin-like (2);	0.000000	0.85682	D	0.000000	D	0.98220	0.9411	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.68943	0.961	D	0.98652	1.0680	10	0.87932	D	0	.	20.1535	0.98095	0.0:1.0:0.0:0.0	.	244	P55087	AQP4_HUMAN	T	244;224;140	ENSP00000372654:A244T	ENSP00000372654:A244T	A	-	1	0	0	AQP4	22690415	22690415	1.000000	0.71417	0.966000	0.40874	0.958000	0.62258	7.263000	0.78421	2.764000	0.94973	0.650000	0.86243	GCT	0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.433	AQP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254914.2	1	0	1		2	2	2	0		0	0	117		117	117	1	2.400000	-7.111425	1	0.540000	NM_001650, NM_004028			92	90		234	232	0		1			0	0	117	0		1.000000	0	0	0	0	0	0	92	234
CCDC105	126402	broad.mit.edu	37	19	15131402	15131402	+	Nonsense_Mutation	SNP	C	C	T	rs372493151		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr19:15131402C>T	ENST00000292574.3	+	3	887	c.805C>T	c.(805-807)Cga>Tga	p.R269*		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	269						extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						GAACCTCTCCCGAGCCCCCAC	0.597																																						ENST00000292574.3	1.000000	6.600000e-01	1	7.700000e-01	0.890000	0.888945	0.890000	1.000000																										0				23						c.(805-807)Cga>Tga		coiled-coil domain containing 105		C	stop/ARG	0,4406		0,0,2203	55.0	51.0	52.0		805	-1.6	0.2	19		52	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	CCDC105	NM_173482.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		269/500	15131402	1,13005	2203	4300	6503	SO:0001587	stop_gained	126402	7	121412	40				g.chr19:15131402C>T	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.805C>T	chr19.hg19:g.15131402C>T	ENSP00000292574:p.Arg269*	0						p.R269*	NM_173482.2	NP_775753.2	0	0	0	1.760489	Q8IYK2	CC105_HUMAN		3	887	+			Q8N7T5|Q8NDL5	Nonsense_Mutation	SNP	ENST00000292574.3	0	1	hg19	c.805C>T	CCDS12322.1	1	.	.	.	.	.	.	.	.	.	.	C	18.01	3.528521	0.64860	0.0	1.16E-4	ENSG00000160994	ENST00000292574	.	.	.	4.09	-1.59	0.08453	4.09	-1.59	0.08453	.	0.492673	0.16678	N	0.204050	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.9272	5.0347	0.14428	0.5189:0.3698:0.0:0.1113	.	.	.	.	X	269	.	ENSP00000292574:R269X	R	+	1	2	2	CCDC105	14992402	14992402	0.001000	0.12720	0.185000	0.23176	0.317000	0.28152	-0.171000	0.09883	-0.391000	0.07763	0.558000	0.71614	CGA	0.527235		TCGA-2J-AAB6-01A-11D-A40W-08	0.597	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466293.1	1	0	1		2	2	2	0		0	0	39		39	39	1	2.400000	-4.277767	1	0.540000	NM_173482			36	35		108	107	1		1			0	0	39	0		1.000000	0	0	0	0	0	0	36	108
ZNF554	115196	broad.mit.edu	37	19	2834140	2834140	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr19:2834140C>T	ENST00000317243.5	+	5	1105	c.907C>T	c.(907-909)Cag>Tag	p.Q303*	ZNF554_ENST00000591265.1_3'UTR	NM_001102651.1	NP_001096121.1	Q86TJ5	ZN554_HUMAN	zinc finger protein 554	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAAAATGGGCAGTCATTGAA	0.478																																						ENST00000317243.5	1.000000	8.900000e-01	1	9.600000e-01	0.990000	0.987359	0.990000	1.000000																										0				23						c.(907-909)Cag>Tag		zinc finger protein 554							88.0	94.0	92.0					19																	2834140		2007	4165	6172	SO:0001587	stop_gained	115196	0	0					g.chr19:2834140C>T	AK027860	CCDS42462.1	19p13.3	2013-09-20			ENSG00000172006	ENSG00000172006		"""Zinc fingers, C2H2-type"", ""-"""	26629	protein-coding gene	gene with protein product						12477932	Standard	NM_001102651		Approved	FLJ34817	uc002lwm.2	Q86TJ5	OTTHUMG00000180493	ENST00000317243.5:c.907C>T	chr19.hg19:g.2834140C>T	ENSP00000321132:p.Gln303*	0					ZNF554_ENST00000591265.1_3'UTR	p.Q303*	NM_001102651.1	NP_001096121.1	0	0	0	1.760489	Q86TJ5	ZN554_HUMAN		5	1105	+		Hepatocellular(1079;0.137)	Q8NAT3|Q9BWN3	Nonsense_Mutation	SNP	ENST00000317243.5	0	1	hg19	c.907C>T	CCDS42462.1	1	.	.	.	.	.	.	.	.	.	.	C	18.67	3.673776	0.67928	.	.	ENSG00000172006	ENST00000317243	.	.	.	2.77	0.44	0.16572	2.77	0.44	0.16572	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.99999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.9143	0.05748	0.5402:0.2836:0.1762:0.0	.	.	.	.	X	303	.	ENSP00000321132:Q303X	Q	+	1	0	0	ZNF554	2785140	2785140	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.558000	0.23469	-0.062000	0.13088	-0.505000	0.04504	CAG	0.527235		TCGA-2J-AAB6-01A-11D-A40W-08	0.478	ZNF554-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451598.3	1	0	1		2	2	2	0		0	0	101		101	101	1	2.400000	-20.000000	1	0.540000	NM_152303			120	118		292	289	0		1	0		0	0	101	0		1.000000	8.592049e-02	0	0	0	2	0	120	292
ZNF99	7652	broad.mit.edu	37	19	22940908	22940908	+	Silent	SNP	A	A	G			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr19:22940908A>G	ENST00000596209.1	-	4	1893	c.1803T>C	c.(1801-1803)gcT>gcC	p.A601A	ZNF99_ENST00000397104.3_Silent_p.A510A	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	601					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				AGTGGTTAAAAGCTTTGCCAC	0.378																																						ENST00000596209.1	1.000000	8.800000e-01	1	9.800000e-01	0.990000	0.989848	0.990000	1.000000																										0				124						c.(1801-1803)gcT>gcC		zinc finger protein 99							42.0	47.0	45.0					19																	22940908		2045	4238	6283	SO:0001819	synonymous_variant	7652	0	0					g.chr19:22940908A>G	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1803T>C	chr19.hg19:g.22940908A>G		0					ZNF99_ENST00000397104.3_Silent_p.A510A	p.A601A	NM_001080409.2	NP_001073878.2	0	0	0	1.760489	A8MXY4	ZNF99_HUMAN		4	1893	-		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)	M0R335	Silent	SNP	ENST00000596209.1	1	1	hg19	c.1803T>C	CCDS59369.1	1																																																																																								0.527235		TCGA-2J-AAB6-01A-11D-A40W-08	0.378	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	1	0	1		2	2	2	0		0	0	108		108	122	1	2.400000	-20.000000	1	0.540000	XM_065124			74	73		170	161	1		1			0	0	108	0		1.000000	0	0	0	0	0	0	74	170
TYROBP	7305	broad.mit.edu	37	19	36399086	36399086	+	Silent	SNP	G	G	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08			G	T	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr19:36399086G>T	ENST00000262629.4	-	1	111	c.45C>A	c.(43-45)ctC>ctA	p.L15L	TYROBP_ENST00000589517.1_Silent_p.L15L|TYROBP_ENST00000424586.3_Silent_p.L15L|TYROBP_ENST00000585901.2_Silent_p.L15L|TYROBP_ENST00000544690.2_Silent_p.L15L	NM_003332.3|NM_198125.2	NP_003323.1|NP_937758.1	O43914	TYOBP_HUMAN	TYRO protein tyrosine kinase binding protein	15					axon guidance (GO:0007411)|cellular defense response (GO:0006968)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|regulation of immune response (GO:0050776)|regulation of osteoclast development (GO:2001204)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|receptor binding (GO:0005102)|receptor signaling protein activity (GO:0005057)			NS(1)|central_nervous_system(1)|large_intestine(1)|lung(4)|skin(1)	8	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CAGCCAGCAGGAGAGGCAGGA	0.657																																						ENST00000262629.4	1.000000	9.000000e-02	3.400000e-01	1.400000e-01	0.220000	0.286751	0.220000	0.200000																										0				8						c.(43-45)ctC>ctA		TYRO protein tyrosine kinase binding protein							39.0	38.0	39.0					19																	36399086		2203	4300	6503	SO:0001819	synonymous_variant	7305	0	0					g.chr19:36399086G>T	AF019563	CCDS12482.1, CCDS46058.1, CCDS54255.1, CCDS59378.1	19q13.1	2014-09-17				ENSG00000011600			12449	protein-coding gene	gene with protein product	"""killer activating receptor associated protein"", ""DNAX-activation protein 12"""	604142		PLOSL		9490415, 10888890	Standard	NM_003332		Approved	DAP12, PLO-SL, KARAP	uc002ocm.3	O43914		ENST00000262629.4:c.45C>A	chr19.hg19:g.36399086G>T		1					TYROBP_ENST00000589517.1_Silent_p.L15L|TYROBP_ENST00000424586.3_Silent_p.L15L|TYROBP_ENST00000585901.2_Silent_p.L15L|TYROBP_ENST00000544690.2_Silent_p.L15L	p.L15L	NM_003332.3|NM_198125.2	NP_003323.1|NP_937758.1	1	3	4	2.641795	O43914	TYOBP_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0515)	1	111	-	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		A8K2X0|F5H389|Q6FGA5|Q9UMT3	Silent	SNP	ENST00000262629.4	0	1	hg19	c.45C>A	CCDS12482.1	0																																																																																								0.691565		TCGA-2J-AAB6-01A-11D-A40W-08	0.657	TYROBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457397.1	0	0	1		2	2	2	0		0	0	23		23	22	1	2.400000	-9.607467	1	0.540000				7	6		182	173	0		1	0		0	0	23	0		0.977186	9.966925e-01	0	0	0	289	0	7	182
ZNF585A	199704	broad.mit.edu	37	19	37644404	37644404	+	Missense_Mutation	SNP	C	C	T	rs533790578		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr19:37644404C>T	ENST00000356958.4	-	5	655	c.397G>A	c.(397-399)Gcc>Acc	p.A133T	ZNF585A_ENST00000392157.2_Missense_Mutation_p.A78T|ZNF585A_ENST00000588723.1_Intron|ZNF585A_ENST00000292841.5_Missense_Mutation_p.A78T|ZNF585A_ENST00000355533.2_Missense_Mutation_p.A78T			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	133					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCAAATTTGGCGCATTCATAA	0.383													C|||	1	0.000199681	0.0	0.0	5008	,	,		17776	0.0		0.0	False		,,,				2504	0.001					ENST00000356958.4	1.000000	0	7.000000e-02	1.000000e-02	0.030000	0.112655	0.030000	0.040000																										0				42						c.(397-399)Gcc>Acc		zinc finger protein 585A							160.0	160.0	160.0					19																	37644404		2203	4300	6503	SO:0001583	missense	199704	7	121410	43				g.chr19:37644404C>T	AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.397G>A	chr19.hg19:g.37644404C>T	ENSP00000349440:p.Ala133Thr	1					ZNF585A_ENST00000355533.2_Missense_Mutation_p.A78T|ZNF585A_ENST00000292841.5_Missense_Mutation_p.A78T|ZNF585A_ENST00000588723.1_Intron|ZNF585A_ENST00000392157.2_Missense_Mutation_p.A78T	p.A133T			1	3	4	2.641795	Q6P3V2	Z585A_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)	5	655	-			Q8TE95|Q96MV3	Missense_Mutation	SNP	ENST00000356958.4	0	1	hg19	c.397G>A		0	.	.	.	.	.	.	.	.	.	.	C	9.121	1.009054	0.19199	.	.	ENSG00000196967	ENST00000356958;ENST00000292841;ENST00000392157;ENST00000355533	T;T;T;T	0.35789	1.29;1.29;1.29;1.67	2.95	1.88	0.25563	2.95	1.88	0.25563	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.224693	0.22663	U	0.057163	T	0.11067	0.0270	N	0.01742	-0.745	0.09310	N	1	B	0.26935	0.164	B	0.20577	0.03	T	0.23048	-1.0199	10	0.20046	T	0.44	.	5.5634	0.17157	0.2297:0.5464:0.2238:0.0	.	133	Q6P3V2	Z585A_HUMAN	T	133;78;78;78	ENSP00000349440:A133T;ENSP00000292841:A78T;ENSP00000375998:A78T;ENSP00000347724:A78T	ENSP00000292841:A78T	A	-	1	0	0	ZNF585A	42336244	42336244	0.000000	0.05858	0.004000	0.12327	0.002000	0.02628	-4.249000	0.00266	0.770000	0.33336	0.655000	0.94253	GCC	0.691565		TCGA-2J-AAB6-01A-11D-A40W-08	0.383	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000457980.2	0	0	1		2	2	2	0		0	0	167		167	165	1	2.400000	-1.706341	0	0.540000	NM_152655			6	6		877	874	0		1	0		0	0	167	0		0.964657	2.128063e-04	0	0	0	3	0	6	877
CEACAM4	1089	broad.mit.edu	37	19	42132119	42132119	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr19:42132119C>T	ENST00000221954.2	-	2	390	c.280G>A	c.(280-282)Gca>Aca	p.A94T	CEACAM4_ENST00000600925.1_Missense_Mutation_p.A94T	NM_001817.2	NP_001808.2	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 4	94	Ig-like V-type.					integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.A94T(1)		NS(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|skin(3)|urinary_tract(1)	16						CCACTGTATGCGGCCCCTGGG	0.488																																						ENST00000221954.2	1.000000	0	9.000000e-02	2.000000e-02	0.040000	0.120559	0.040000	0.040000																										1	Substitution - Missense(1)	p.A94T(1)	lung(1)	16						c.(280-282)Gca>Aca		carcinoembryonic antigen-related cell adhesion molecule 4							166.0	157.0	160.0					19																	42132119		2203	4300	6503	SO:0001583	missense	1089	4	121412	41				g.chr19:42132119C>T	D90276	CCDS33033.1	19q13.2	2013-01-11			ENSG00000105352	ENSG00000105352		"""Immunoglobulin superfamily / V-set domain containing"""	1816	protein-coding gene	gene with protein product				CGM7		2050678	Standard	XM_005258434		Approved		uc002orh.1	O75871	OTTHUMG00000151065	ENST00000221954.2:c.280G>A	chr19.hg19:g.42132119C>T	ENSP00000221954:p.Ala94Thr	1					CEACAM4_ENST00000600925.1_Missense_Mutation_p.A94T	p.A94T	NM_001817.2	NP_001808.2	1	3	4	2.641795	O75871	CEAM4_HUMAN		2	390	-			Q03715|Q7LDZ7	Missense_Mutation	SNP	ENST00000221954.2	0	1	hg19	c.280G>A	CCDS33033.1	0	.	.	.	.	.	.	.	.	.	.	C	14.79	2.639939	0.47153	.	.	ENSG00000105352	ENST00000221954	T	0.66280	-0.2	1.76	1.76	0.24704	1.76	1.76	0.24704	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76278	0.3965	M	0.84219	2.685	0.09310	N	1	D;D	0.89917	0.997;1.0	D;D	0.73380	0.921;0.98	T	0.61207	-0.7109	9	0.66056	D	0.02	.	6.9535	0.24558	0.0:1.0:0.0:0.0	.	94;94	E7EMX3;O75871	.;CEAM4_HUMAN	T	94	ENSP00000221954:A94T	ENSP00000221954:A94T	A	-	1	0	0	CEACAM4	46823959	46823959	0.000000	0.05858	0.009000	0.14445	0.015000	0.08874	0.618000	0.24373	1.281000	0.44480	0.205000	0.17691	GCA	0.691565		TCGA-2J-AAB6-01A-11D-A40W-08	0.488	CEACAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321148.1	0	0	1		17	2	2	1		1	1	213		213	210	1	2.400000	-1.549873	0	0.540000	NM_001817			9	9		993	980	0		0	0		1	0	213	0		0.077538	0	0	0	0	1	0	9	993
RSPH6A	81492	broad.mit.edu	37	19	46307741	46307741	+	Silent	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr19:46307741C>T	ENST00000221538.3	-	3	1564	c.1422G>A	c.(1420-1422)ccG>ccA	p.P474P	RSPH6A_ENST00000597055.1_Silent_p.P474P|RSPH6A_ENST00000600188.1_Silent_p.P210P	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	474						intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						CCTCGTTGCCCGGGAAGGGTG	0.632																																						ENST00000221538.3	1.000000	5.800000e-01	9.000000e-01	6.700000e-01	0.770000	0.788522	0.770000	0.760000																										0				32						c.(1420-1422)ccG>ccA		radial spoke head 6 homolog A (Chlamydomonas)							73.0	60.0	65.0					19																	46307741		2203	4300	6503	SO:0001819	synonymous_variant	81492	10	121412	41				g.chr19:46307741C>T	AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1422G>A	chr19.hg19:g.46307741C>T		1					RSPH6A_ENST00000600188.1_Silent_p.P210P|RSPH6A_ENST00000597055.1_Silent_p.P474P	p.P474P	NM_030785.3	NP_110412.1	1	3	4	2.641795	Q9H0K4	RSH6A_HUMAN		3	1564	-			Q53FE2|Q6PEZ9	Silent	SNP	ENST00000221538.3	1	1	hg19	c.1422G>A	CCDS12675.1	0																																																																																								0.691565		TCGA-2J-AAB6-01A-11D-A40W-08	0.632	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461657.1	1	0	1		2	2	2	0		0	0	74		74	73	1	2.400000	-2.578769	1	0.540000				55	53		343	332	1		1			0	0	74	0		1.000000	0	0	0	0	0	0	55	343
PLEKHA4	57664	broad.mit.edu	37	19	49362745	49362745	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr19:49362745G>A	ENST00000263265.6	-	7	1228	c.673C>T	c.(673-675)Cgg>Tgg	p.R225W	PLEKHA4_ENST00000355496.5_Missense_Mutation_p.R225W|PLEKHA4_ENST00000596713.1_5'UTR	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	225	Pro-rich.					cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		CTCGCCCTCCGCATCTGGAGT	0.637																																						ENST00000263265.6	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				30						c.(673-675)Cgg>Tgg		pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4							45.0	39.0	41.0					19																	49362745		2203	4300	6503	SO:0001583	missense	57664	0	0					g.chr19:49362745G>A	AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.673C>T	chr19.hg19:g.49362745G>A	ENSP00000263265:p.Arg225Trp	1					PLEKHA4_ENST00000355496.5_Missense_Mutation_p.R225W|PLEKHA4_ENST00000596713.1_5'UTR	p.R225W	NM_020904.2	NP_065955.2	1	3	4	2.641795	Q9H4M7	PKHA4_HUMAN		7	1228	-		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)	Q8N4M8|Q8N658	Missense_Mutation	SNP	ENST00000263265.6	1	1	hg19	c.673C>T	CCDS12737.1	1	.	.	.	.	.	.	.	.	.	.	G	13.25	2.179782	0.38511	.	.	ENSG00000105559	ENST00000263265;ENST00000355496	T;T	0.15834	2.99;2.39	4.7	2.52	0.30459	4.7	2.52	0.30459	.	0.654908	0.13453	N	0.386789	T	0.15435	0.0372	L	0.27053	0.805	0.09310	N	1	D;D	0.71674	0.987;0.998	P;P	0.50896	0.653;0.65	T	0.10132	-1.0643	10	0.41790	T	0.15	.	5.648	0.17600	0.1:0.0:0.7059:0.1941	.	225;225	Q9H4M7-2;Q9H4M7	.;PKHA4_HUMAN	W	225	ENSP00000263265:R225W;ENSP00000347683:R225W	ENSP00000263265:R225W	R	-	1	2	2	PLEKHA4	54054557	54054557	0.004000	0.15560	0.354000	0.25760	0.004000	0.04260	0.418000	0.21230	0.691000	0.31592	0.462000	0.41574	CGG	0.691565		TCGA-2J-AAB6-01A-11D-A40W-08	0.637	PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466216.1	1	0	1		2	2	2	0		0	0	68		68	66	1	2.400000	-20.000000	1	0.540000				184	182		150	146	1		1	0		0	0	68	0		1.000000	9.999209e-01	0	1	0	15	0	184	150
SIGLEC6	946	broad.mit.edu	37	19	52023419	52023419	+	Missense_Mutation	SNP	C	C	T	rs200754981		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr19:52023419C>T	ENST00000425629.3	-	8	1433	c.1279G>A	c.(1279-1281)Gct>Act	p.A427T	SIGLEC6_ENST00000346477.3_Missense_Mutation_p.A411T|SIGLEC6_ENST00000436458.1_Missense_Mutation_p.A375T|SIGLEC6_ENST00000391797.3_3'UTR|SIGLEC6_ENST00000343300.4_3'UTR|CTD-3073N11.9_ENST00000598220.1_RNA|SIGLEC6_ENST00000474054.1_5'UTR|SIGLEC6_ENST00000359982.4_3'UTR	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	427					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		TGTAGGACAGCGTAGTGGAGC	0.507																																						ENST00000425629.3	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				28						c.(1279-1281)Gct>Act		sialic acid binding Ig-like lectin 6		C	THR/ALA,,,THR/ALA,THR/ALA,	0,4008		0,0,2004	212.0	204.0	207.0		1123,,,1279,1231,	2.6	0.0	19		207	5,8373		0,5,4184	yes	missense,utr-3,utr-3,missense,missense,utr-3	SIGLEC6	NM_001177547.1,NM_001177548.1,NM_001177549.1,NM_001245.5,NM_198845.4,NM_198846.4	58,,,58,58,	0,5,6188	TT,TC,CC		0.0597,0.0,0.0404	benign,,,benign,benign,	375/402,,,427/454,411/438,	52023419	5,12381	2004	4189	6193	SO:0001583	missense	946	18	120938	47				g.chr19:52023419C>T	D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.1279G>A	chr19.hg19:g.52023419C>T	ENSP00000401502:p.Ala427Thr	1					SIGLEC6_ENST00000359982.4_3'UTR|SIGLEC6_ENST00000474054.1_5'UTR|CTD-3073N11.9_ENST00000598220.1_RNA|SIGLEC6_ENST00000343300.4_3'UTR|SIGLEC6_ENST00000346477.3_Missense_Mutation_p.A411T|SIGLEC6_ENST00000436458.1_Missense_Mutation_p.A375T|SIGLEC6_ENST00000391797.3_3'UTR	p.A427T	NM_001245.5	NP_001236.4	1	3	4	2.641795	O43699	SIGL6_HUMAN		8	1433	-		all_neural(266;0.0199)	A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Missense_Mutation	SNP	ENST00000425629.3	1	1	hg19	c.1279G>A	CCDS12834.3	1	.	.	.	.	.	.	.	.	.	.	.	12.92	2.081368	0.36758	0.0	5.97E-4	ENSG00000105492	ENST00000346477;ENST00000391797;ENST00000425629;ENST00000436458	T;T	0.09630	2.96;2.96	2.57	2.57	0.30868	2.57	2.57	0.30868	.	.	.	.	.	T	0.33206	0.0855	M	0.84948	2.725	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.955;0.994;0.955	T	0.03212	-1.1060	9	0.87932	D	0	.	8.7521	0.34622	0.0:1.0:0.0:0.0	.	375;411;427	C9JBE5;O43699-3;O43699	.;.;SIGL6_HUMAN	T	400;411;427;375	ENSP00000401502:A427T;ENSP00000410679:A375T	ENSP00000344064:A400T	A	-	1	0	0	SIGLEC6	56715231	56715231	0.165000	0.22948	0.028000	0.17463	0.009000	0.06853	1.102000	0.31050	1.726000	0.51525	0.609000	0.83330	GCT	0.691565		TCGA-2J-AAB6-01A-11D-A40W-08	0.507	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257670.3	1	0	1		2	2	2	0		0	0	212		212	209	1	2.400000	-20.000000	1	0.540000	NM_001245			507	501		574	562	1		1			0	0	212	0		1.000000	0	0	0	0	0	0	507	574
FPR1	2357	broad.mit.edu	37	19	52249584	52249584	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr19:52249584C>T	ENST00000595042.1	-	3	805	c.664G>A	c.(664-666)Ggg>Agg	p.G222R	FPR1_ENST00000304748.4_Missense_Mutation_p.G222R	NM_001193306.1	NP_001180235.1	P21462	FPR1_HUMAN	formyl peptide receptor 1	222					activation of MAPK activity (GO:0000187)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|nitric oxide mediated signal transduction (GO:0007263)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)|receptor activity (GO:0004872)			endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(3)	20		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Nedocromil(DB00716)	GCAATAAGCCCATAACTGACA	0.517																																						ENST00000595042.1	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				20						c.(664-666)Ggg>Agg		formyl peptide receptor 1	Nedocromil(DB00716)						122.0	110.0	114.0					19																	52249584		2203	4300	6503	SO:0001583	missense	2357	0	0					g.chr19:52249584C>T	M60627	CCDS12839.1	19q13.41	2014-09-17				ENSG00000171051		"""GPCR / Class A : Formyl peptide receptors"""	3826	protein-coding gene	gene with protein product		136537				2161213, 12595898	Standard	NM_001193306		Approved	FPR, FMLP	uc002pxq.3	P21462		ENST00000595042.1:c.664G>A	chr19.hg19:g.52249584C>T	ENSP00000471493:p.Gly222Arg	1					FPR1_ENST00000304748.4_Missense_Mutation_p.G222R	p.G222R	NM_001193306.1	NP_001180235.1	1	3	4	2.641795	P21462	FPR1_HUMAN		3	805	-		all_neural(266;0.0189)|Medulloblastoma(540;0.146)	Q14939|Q7Z6A4|Q86U52|Q9NS48	Missense_Mutation	SNP	ENST00000595042.1	1	1	hg19	c.664G>A	CCDS12839.1	1	.	.	.	.	.	.	.	.	.	.	.	12.24	1.878537	0.33162	.	.	ENSG00000171051	ENST00000304748	T	0.72725	-0.68	3.65	3.65	0.41850	3.65	3.65	0.41850	GPCR, rhodopsin-like superfamily (1);	0.431534	0.23098	N	0.051955	D	0.85465	0.5703	M	0.94063	3.49	0.30381	N	0.781935	D	0.89917	1.0	D	0.87578	0.998	T	0.82550	-0.0401	10	0.62326	D	0.03	.	7.6654	0.28428	0.0:0.8765:0.0:0.1235	.	222	P21462	FPR1_HUMAN	R	222	ENSP00000302707:G222R	ENSP00000302707:G222R	G	-	1	0	0	FPR1	56941396	56941396	0.000000	0.05858	0.484000	0.27391	0.048000	0.14542	0.029000	0.13666	1.956000	0.56807	0.650000	0.86243	GGG	0.691565		TCGA-2J-AAB6-01A-11D-A40W-08	0.517	FPR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466905.1	1	0	1		2	2	2	0		0	0	102		102	102	1	2.400000	-20.000000	1	0.540000	NM_002029			250	248		276	273	1		1	1		0	0	102	0		1.000000	1	0	8	0	28	0	250	276
LCE2C	353140	broad.mit.edu	37	1	152648628	152648628	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr1:152648628C>A	ENST00000368783.1	+	2	192	c.137C>A	c.(136-138)tCt>tAt	p.S46Y	LCE2B_ENST00000417924.2_Intron	NM_178429.2	NP_848516.1	Q5TA81	LCE2C_HUMAN	late cornified envelope 2C	46	Cys-rich.				keratinization (GO:0031424)					endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	13	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCAGTCTCTTCTTGCTGTGGT	0.627																																						ENST00000368783.1	1.000000	8.800000e-01	1	9.400000e-01	0.990000	0.980940	0.990000	1.000000																										0				13						c.(136-138)tCt>tAt		late cornified envelope 2C							123.0	131.0	129.0					1																	152648628		2203	4300	6503	SO:0001583	missense	353140	0	0					g.chr1:152648628C>A		CCDS1019.1	1q21.3	2008-02-05			ENSG00000187180	ENSG00000187180		"""Late cornified envelopes"""	29460	protein-coding gene	gene with protein product		612611				11698679	Standard	NM_178429		Approved	LEP11	uc001fah.4	Q5TA81	OTTHUMG00000012389	ENST00000368783.1:c.137C>A	chr1.hg19:g.152648628C>A	ENSP00000357772:p.Ser46Tyr	1					LCE2B_ENST00000417924.2_Intron	p.S46Y	NM_178429.2	NP_848516.1	1	3	4	2.695261	Q5TA81	LCE2C_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	2	192	+	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)			Missense_Mutation	SNP	ENST00000368783.1	1	1	hg19	c.137C>A	CCDS1019.1	1	.	.	.	.	.	.	.	.	.	.	C	1.426	-0.571575	0.03882	.	.	ENSG00000187180	ENST00000368783	T	0.06218	3.33	3.39	0.0799	0.14418	3.39	0.0799	0.14418	.	.	.	.	.	T	0.02727	0.0082	M	0.79805	2.47	0.09310	N	1	P	0.47910	0.902	B	0.35413	0.202	T	0.33523	-0.9865	9	0.87932	D	0	.	5.4015	0.16299	0.0:0.4654:0.4079:0.1267	.	46	Q5TA81	LCE2C_HUMAN	Y	46	ENSP00000357772:S46Y	ENSP00000357772:S46Y	S	+	2	0	0	LCE2C	150915252	150915252	0.023000	0.18921	0.264000	0.24511	0.299000	0.27559	0.291000	0.18994	-0.081000	0.12662	0.563000	0.77884	TCT	0.693782		TCGA-2J-AAB6-01A-11D-A40W-08	0.627	LCE2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034509.1	1	0	1		2	2	2	0		0	0	216		216	215	1	2.400000	-20.000000	1	0.540000	NM_178429			191	187		859	840	1		1			0	0	216	0		1.000000	0	0	0	0	0	0	191	859
TNR	7143	broad.mit.edu	37	1	175365844	175365844	+	Missense_Mutation	SNP	T	T	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr1:175365844T>A	ENST00000367674.2	-	5	1784	c.1076A>T	c.(1075-1077)tAc>tTc	p.Y359F	TNR_ENST00000263525.2_Missense_Mutation_p.Y359F			Q92752	TENR_HUMAN	tenascin R	359	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CGTCGGCTGGTAAGAGATCAC	0.617																																						ENST00000367674.2	1.000000	7.600000e-01	1	8.400000e-01	0.920000	0.923011	0.920000	1.000000																										0				177						c.(1075-1077)tAc>tTc		tenascin R							74.0	75.0	75.0					1																	175365844		2203	4300	6503	SO:0001583	missense	7143	0	0					g.chr1:175365844T>A	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1076A>T	chr1.hg19:g.175365844T>A	ENSP00000356646:p.Tyr359Phe	1					TNR_ENST00000263525.2_Missense_Mutation_p.Y359F	p.Y359F			1	2	3	2.278732	Q92752	TENR_HUMAN		5	1784	-	Renal(580;0.146)		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	1	1	hg19	c.1076A>T	CCDS1318.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	29.5|29.5	5.010028|5.010028	0.93346|0.93346	.|.	.|.	ENSG00000116147|ENSG00000116147	ENST00000422274|ENST00000367674;ENST00000263525;ENST00000367673	.|T;T	.|0.61859	.|0.07;0.07	5.96|5.96	5.96|5.96	0.96718|0.96718	5.96|5.96	5.96|5.96	0.96718|0.96718	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.067516	.|0.64402	.|D	.|0.000009	T|T	0.72342|0.72342	0.3448|0.3448	L|L	0.54965|0.54965	1.715|1.715	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.87578	.|0.998	T|T	0.72779|0.72779	-0.4190|-0.4190	5|10	.|0.51188	.|T	.|0.08	.|.	16.0892|16.0892	0.81080|0.81080	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|359	.|Q92752	.|TENR_HUMAN	F|F	83|359	.|ENSP00000356646:Y359F;ENSP00000263525:Y359F	.|ENSP00000263525:Y359F	L|Y	-|-	3|2	2|0	2|0	TNR|TNR	173632467|173632467	173632467|173632467	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	3.774000|3.774000	0.55341|0.55341	2.279000|2.279000	0.76181|0.76181	0.533000|0.533000	0.62120|0.62120	TTA|TAC	0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.617	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	1	0	1		2	2	2	0		0	0	111		111	108	1	2.400000	-2.936603	1	0.540000	NM_003285			98	95		398	381	1		1			0	0	111	0		1.000000	0	0	0	0	0	0	98	398
NPHS2	7827	broad.mit.edu	37	1	179530445	179530445	+	Missense_Mutation	SNP	G	G	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr1:179530445G>T	ENST00000367615.4	-	3	498	c.430C>A	c.(430-432)Cct>Act	p.P144T	NPHS2_ENST00000367616.4_Missense_Mutation_p.P144T	NM_014625.2	NP_055440.1	Q9NP85	PODO_HUMAN	nephrosis 2, idiopathic, steroid-resistant (podocin)	144					actin cytoskeleton reorganization (GO:0031532)|excretion (GO:0007588)|metanephric glomerular visceral epithelial cell development (GO:0072249)	cell-cell junction (GO:0005911)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)				NS(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	20						GCTCTTCCAGGAAGCAGATGT	0.373																																						ENST00000367615.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				20						c.(430-432)Cct>Act		nephrosis 2, idiopathic, steroid-resistant (podocin)							142.0	160.0	154.0					1																	179530445		2203	4300	6503	SO:0001583	missense	7827	0	0					g.chr1:179530445G>T	AJ279254	CCDS1331.1, CCDS72988.1	1q25-q31	2014-06-27			ENSG00000116218	ENSG00000116218			13394	protein-coding gene	gene with protein product		604766				8589695, 10742096	Standard	XM_005245483		Approved	SRN1, PDCN	uc001gmq.4	Q9NP85	OTTHUMG00000035252	ENST00000367615.4:c.430C>A	chr1.hg19:g.179530445G>T	ENSP00000356587:p.Pro144Thr	1					NPHS2_ENST00000367616.4_Missense_Mutation_p.P144T	p.P144T	NM_014625.2	NP_055440.1	1	2	3	2.278732	Q9NP85	PODO_HUMAN		3	498	-			B1AM32|B1AM33|Q8N6Q5	Missense_Mutation	SNP	ENST00000367615.4	1	1	hg19	c.430C>A	CCDS1331.1	1	.	.	.	.	.	.	.	.	.	.	G	15.31	2.794586	0.50102	.	.	ENSG00000116218	ENST00000367615;ENST00000367616	D;D	0.99607	-6.27;-6.27	5.82	5.82	0.92795	5.82	5.82	0.92795	.	0.210004	0.44097	D	0.000495	D	0.99140	0.9703	L	0.43923	1.385	0.38352	D	0.944353	D;D	0.59767	0.986;0.985	P;P	0.60886	0.88;0.844	D	0.98710	1.0704	10	0.54805	T	0.06	-18.3363	12.0534	0.53520	0.0787:0.0:0.9213:0.0	.	144;144	Q9NP85-2;Q9NP85	.;PODO_HUMAN	T	144	ENSP00000356587:P144T;ENSP00000356588:P144T	ENSP00000356587:P144T	P	-	1	0	0	NPHS2	177797068	177797068	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.032000	0.41127	2.765000	0.95021	0.650000	0.86243	CCT	0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.373	NPHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085283.1	1	0	1		2	2	2	0		0	0	220		220	219	1	2.400000	-20.000000	1	0.540000				366	362		539	535	1		1			0	0	220	0		1.000000	0	0	0	0	0	0	366	539
ASPM	259266	broad.mit.edu	37	1	197112823	197112823	+	Silent	SNP	T	T	G	rs201333656		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr1:197112823T>G	ENST00000367409.4	-	3	815	c.559A>C	c.(559-561)Aga>Cga	p.R187R	ASPM_ENST00000294732.7_Silent_p.R187R	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	187					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						CTCCTAACTCTGTCAACTTTT	0.343																																						ENST00000367409.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				165						c.(559-561)Aga>Cga		asp (abnormal spindle) homolog, microcephaly associated (Drosophila)							53.0	56.0	55.0					1																	197112823		2203	4299	6502	SO:0001819	synonymous_variant	259266	0	0					g.chr1:197112823T>G	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.559A>C	chr1.hg19:g.197112823T>G		1					ASPM_ENST00000294732.7_Silent_p.R187R	p.R187R	NM_018136.4	NP_060606.3	1	2	3	2.311165	Q8IZT6	ASPM_HUMAN		3	815	-			Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Silent	SNP	ENST00000367409.4	1	1	hg19	c.559A>C	CCDS1389.1	1																																																																																								0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.343	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	1	0	1		2	2	2	0		0	0	98		98	97	1	2.400000	-20.000000	1	0.540000	NM_018136			160	158		242	240	1		1	1		0	0	98	0		1.000000	1.594059e-01	0	2	0	0	0	160	242
OR14A16	284532	broad.mit.edu	37	1	247978702	247978702	+	Silent	SNP	C	C	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr1:247978702C>A	ENST00000357627.1	-	1	329	c.330G>T	c.(328-330)ctG>ctT	p.L110L		NM_001001966.1	NP_001001966.1	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A, member 16	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(32)|skin(2)|stomach(1)	45						TGAGGAGGAGCAGCTCTGCAG	0.468																																					Ovarian(112;180 1586 15073 21914 33526)	ENST00000357627.1	1.000000	7.000000e-01	9.800000e-01	7.800000e-01	0.870000	0.880006	0.870000	1.000000																										0				45						c.(328-330)ctG>ctT		olfactory receptor, family 14, subfamily A, member 16							108.0	102.0	104.0					1																	247978702		2203	4300	6503	SO:0001819	synonymous_variant	284532	0	0					g.chr1:247978702C>A	BK004366	CCDS31097.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000196772	ENSG00000196772		"""GPCR / Class A : Olfactory receptors"""	15022	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AT, member 1"""	OR5AT1			Standard	NM_001001966		Approved		uc001idm.1	Q8NHC5	OTTHUMG00000040199	ENST00000357627.1:c.330G>T	chr1.hg19:g.247978702C>A		1						p.L110L	NM_001001966.1	NP_001001966.1	1	2	3	2.277302	Q8NHC5	O14AG_HUMAN		1	329	-			Q6IF96	Silent	SNP	ENST00000357627.1	1	1	hg19	c.330G>T	CCDS31097.1	1																																																																																								0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.468	OR14A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096856.1	1	0	1		2	2	2	0		0	0	67		67	67	1	2.400000	-20.000000	1	0.540000	NM_001001966			69	69		300	298	1		1			0	0	67	0		1.000000	0	0	0	0	0	0	69	300
OR2L8	391190	broad.mit.edu	37	1	248112943	248112943	+	Silent	SNP	A	A	C			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr1:248112943A>C	ENST00000357191.3	+	1	784	c.784A>C	c.(784-786)Aga>Cga	p.R262R	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	262						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TCTACGTCCAAGATCCCTGCG	0.483																																						ENST00000357191.3	1.000000	8.300000e-01	1	9.200000e-01	0.990000	0.972078	0.990000	1.000000																										0				42						c.(784-786)Aga>Cga		olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)							120.0	91.0	101.0					1																	248112943		2203	4297	6500	SO:0001819	synonymous_variant	391190	0	0					g.chr1:248112943A>C	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.784A>C	chr1.hg19:g.248112943A>C		1					OR2L13_ENST00000366478.2_Intron	p.R262R	NM_001001963.1	NP_001001963.1	1	2	3	2.277302	Q8NGY9	OR2L8_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0152)	1	784	+	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		Q6IF03	Silent	SNP	ENST00000357191.3	1	1	hg19	c.784A>C	CCDS31101.1	1																																																																																								0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.483	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2	1	0	1		2	2	2	0		0	0	104		104	116	1	2.400000	-20.000000	1	0.540000				81	77		292	279	0		1			0	0	104	0		1.000000	0	0	0	0	0	0	81	292
OR2L2	26246	broad.mit.edu	37	1	248202362	248202362	+	Nonsense_Mutation	SNP	C	C	T	rs546778867		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr1:248202362C>T	ENST00000366479.2	+	1	889	c.793C>T	c.(793-795)Cga>Tga	p.R265*	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			AAGATCCCTGCGATCTCCAAC	0.498													c|||	1	0.000199681	0.0	0.0014	5008	,	,		19946	0.0		0.0	False		,,,				2504	0.0					ENST00000366479.2	1.000000	8.200000e-01	1	9.000000e-01	0.990000	0.966244	0.990000	1.000000																										0				42						c.(793-795)Cga>Tga		olfactory receptor, family 2, subfamily L, member 2							138.0	125.0	130.0					1																	248202362		2203	4300	6503	SO:0001587	stop_gained	26246	7	121412	38				g.chr1:248202362C>T	X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.793C>T	chr1.hg19:g.248202362C>T	ENSP00000355435:p.Arg265*	1					OR2L13_ENST00000366478.2_Intron	p.R265*	NM_001004686.2	NP_001004686.1	1	2	3	2.277302	Q8NH16	OR2L2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0278)	1	889	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		Q2M3T5	Nonsense_Mutation	SNP	ENST00000366479.2	0	1	hg19	c.793C>T	CCDS31103.1	1	.	.	.	.	.	.	.	.	.	.	.	16.24	3.067941	0.55539	.	.	ENSG00000203663	ENST00000366479	.	.	.	1.9	0.911	0.19343	1.9	0.911	0.19343	.	0.000000	0.27636	U	0.018492	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	.	3.04	0.06135	0.243:0.5305:0.0:0.2264	.	.	.	.	X	265	.	ENSP00000355435:R265X	R	+	1	2	2	OR2L2	246268985	246268985	0.000000	0.05858	0.000000	0.03702	0.207000	0.24258	-2.234000	0.01203	0.005000	0.14708	0.194000	0.17425	CGA	0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.498	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	1	0	1		2	2	2	0		0	0	80		80	79	1	2.400000	-20.000000	1	0.540000	NM_001004686			91	91		336	334	0		1			0	0	80	0		1.000000	0	0	0	0	0	0	91	336
AJAP1	55966	broad.mit.edu	37	1	4772146	4772146	+	Silent	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr1:4772146G>A	ENST00000378191.4	+	2	597	c.216G>A	c.(214-216)gcG>gcA	p.A72A	AJAP1_ENST00000466761.1_3'UTR|AJAP1_ENST00000378190.3_Silent_p.A72A	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	72					cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A72A(1)		endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		GACAGCCAGCGCGGGTCCCGG	0.771																																						ENST00000378191.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999455	0.990000	1.000000																										1	Substitution - coding silent(1)	p.A72A(1)	urinary_tract(1)	24						c.(214-216)gcG>gcA		adherens junctions associated protein 1							9.0	13.0	12.0					1																	4772146		1651	3572	5223	SO:0001819	synonymous_variant	55966	2	112412	31				g.chr1:4772146G>A	AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.216G>A	chr1.hg19:g.4772146G>A		1					AJAP1_ENST00000466761.1_3'UTR|AJAP1_ENST00000378190.3_Silent_p.A72A	p.A72A	NM_018836.3	NP_061324.1	1	2	3	2.334486	Q9UKB5	AJAP1_HUMAN		2	597	+	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)	Q9Y229	Silent	SNP	ENST00000378191.4	1	1	hg19	c.216G>A	CCDS54.1	1																																																																																								0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.771	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001542.3	1	0	1		2	2	2	0		0	0	38		38	38	1	2.400000	-20.000000	1	0.540000	NM_018836			36	32		83	74	0		1			0	0	38	0		1.000000	0	0	0	0	0	0	36	83
GPR153	387509	broad.mit.edu	37	1	6313858	6313858	+	Missense_Mutation	SNP	C	C	T	rs189356842		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr1:6313858C>T	ENST00000377893.2	-	3	965	c.706G>A	c.(706-708)Gcc>Acc	p.A236T		NM_207370.2	NP_997253.2	Q6NV75	GP153_HUMAN	G protein-coupled receptor 153	236						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|liver(1)|lung(7)|skin(1)	14	Ovarian(185;0.0634)	all_cancers(23;8.07e-33)|all_epithelial(116;4.45e-18)|all_lung(118;1.09e-06)|all_neural(13;3.68e-06)|Lung NSC(185;1.52e-05)|all_hematologic(16;2.39e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.91e-37)|GBM - Glioblastoma multiforme(13;4.87e-29)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;1.33e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.246)		GAGGTTTTGGCGGGCTCCGAG	0.677													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17995	0.0		0.0	False		,,,				2504	0.0					ENST00000377893.2	0.280000	5.000000e-02	2.100000e-01	9.000000e-02	0.140000	0.155623	0.140000	0.130000																										0				14						c.(706-708)Gcc>Acc		G protein-coupled receptor 153							77.0	79.0	79.0					1																	6313858		2201	4300	6501	SO:0001583	missense	387509	20	121064	42				g.chr1:6313858C>T	AY255529	CCDS64.1	1p36.31	2012-08-21			ENSG00000158292	ENSG00000158292		"""GPCR / Class A : Orphans"""	23618	protein-coding gene	gene with protein product		614269				12679517	Standard	NM_207370		Approved	PGR1	uc001amp.2	Q6NV75	OTTHUMG00000001272	ENST00000377893.2:c.706G>A	chr1.hg19:g.6313858C>T	ENSP00000367125:p.Ala236Thr	1						p.A236T	NM_207370.2	NP_997253.2	1	2	3	2.334486	Q6NV75	GP153_HUMAN		3	965	-	Ovarian(185;0.0634)	all_cancers(23;8.07e-33)|all_epithelial(116;4.45e-18)|all_lung(118;1.09e-06)|all_neural(13;3.68e-06)|Lung NSC(185;1.52e-05)|all_hematologic(16;2.39e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)	Q5TGR5|Q6AHW8|Q86SP8	Missense_Mutation	SNP	ENST00000377893.2	0	1	hg19	c.706G>A	CCDS64.1	0	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	12.87	2.067016	0.36470	.	.	ENSG00000158292	ENST00000377893	T	0.71934	-0.61	4.9	3.77	0.43336	4.9	3.77	0.43336	GPCR, rhodopsin-like superfamily (1);	0.373744	0.28914	N	0.013730	T	0.56949	0.2020	N	0.19112	0.55	0.29397	N	0.86221	D	0.54772	0.968	P	0.47346	0.544	T	0.53753	-0.8394	10	0.28530	T	0.3	-50.623	9.4756	0.38869	0.0:0.8127:0.0:0.1873	.	236	Q6NV75	GP153_HUMAN	T	236	ENSP00000367125:A236T	ENSP00000367125:A236T	A	-	1	0	0	GPR153	6236445	6236445	0.042000	0.20092	0.950000	0.38849	0.814000	0.46013	0.331000	0.19733	2.277000	0.76020	0.462000	0.41574	GCC	0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.677	GPR153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003717.2	0	0	1		2	2	2	0		0	0	45		45	45	1	2.400000	-2.895820	1	0.540000				6	6		203	198	0		1	0		0	0	45	0		0.962946	7.031154e-01	0	0	0	81	0	6	203
OR2T6	254879	broad.mit.edu	37	1	248551551	248551551	+	Silent	SNP	G	G	C	rs373005006		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr1:248551551G>C	ENST00000355728.2	+	1	642	c.642G>C	c.(640-642)gtG>gtC	p.V214V		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	214						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCTCGGTGGTGACTGCATCCT	0.537																																						ENST00000355728.2	0.250000	7.000000e-02	2.100000e-01	1.000000e-01	0.150000	0.160543	0.150000	0.150000																										0				55						c.(640-642)gtG>gtC		olfactory receptor, family 2, subfamily T, member 6							303.0	230.0	255.0					1																	248551551		2203	4300	6503	SO:0001819	synonymous_variant	254879	0	0					g.chr1:248551551G>C	AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.642G>C	chr1.hg19:g.248551551G>C		1						p.V214V	NM_001005471.1	NP_001005471.1	1	2	3	2.277302	Q8NHC8	OR2T6_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0265)	1	642	+	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		A6NE36	Silent	SNP	ENST00000355728.2	0	1	hg19	c.642G>C	CCDS31114.1	0																																																																																								0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.537	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	0	0	1		2	2	2	0		0	0	75		75	75	1	2.400000	-3.461027	1	0.540000	NM_001005471			11	11		338	334	0		1			0	0	75	0		0.998264	0	0	0	0	0	0	11	338
MYL9	10398	broad.mit.edu	37	20	35177521	35177521	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr20:35177521A>G	ENST00000279022.2	+	4	492	c.388A>G	c.(388-390)Atg>Gtg	p.M130V	RP5-977B1.7_ENST00000439595.1_RNA|RP5-977B1.7_ENST00000425233.1_RNA|RP5-977B1.11_ENST00000561134.1_RNA|MYL9_ENST00000346786.2_Missense_Mutation_p.M76V	NM_006097.4	NP_006088.2	P24844	MYL9_HUMAN	myosin, light chain 9, regulatory	130	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				axon guidance (GO:0007411)|muscle contraction (GO:0006936)|platelet aggregation (GO:0070527)|regulation of muscle contraction (GO:0006937)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|stress fiber (GO:0001725)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			endometrium(2)|kidney(1)|large_intestine(3)|lung(2)	8	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				GCTCACCACCATGGGTGACCG	0.577																																						ENST00000279022.2	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				8						c.(388-390)Atg>Gtg		myosin, light chain 9, regulatory							96.0	83.0	87.0					20																	35177521		2203	4300	6503	SO:0001583	missense	10398	0	0					g.chr20:35177521A>G	J02854	CCDS13276.1, CCDS13277.1	20q11.23	2013-01-10	2006-09-29		ENSG00000101335	ENSG00000101335		"""Myosins / Light chain"", ""EF-hand domain containing"""	15754	protein-coding gene	gene with protein product	"""myosin regulatory light chain 2, smooth muscle isoform"", ""myosin regulatory light chain 1"""	609905	"""myosin, light polypeptide 9, regulatory"""			2526655	Standard	NM_006097		Approved	MYRL2, MLC2, LC20, MRLC1	uc002xfl.2	P24844	OTTHUMG00000032387	ENST00000279022.2:c.388A>G	chr20.hg19:g.35177521A>G	ENSP00000279022:p.Met130Val	1					MYL9_ENST00000346786.2_Missense_Mutation_p.M76V|RP5-977B1.11_ENST00000561134.1_RNA|RP5-977B1.7_ENST00000439595.1_RNA|RP5-977B1.7_ENST00000425233.1_RNA	p.M130V	NM_006097.4	NP_006088.2	2	2	4	2.648007	P24844	MYL9_HUMAN		4	492	+	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)	E1P5T6|Q9BQL9|Q9BUF9|Q9H136	Missense_Mutation	SNP	ENST00000279022.2	1	1	hg19	c.388A>G	CCDS13276.1	1	.	.	.	.	.	.	.	.	.	.	A	18.75	3.690061	0.68271	.	.	ENSG00000101335	ENST00000279022;ENST00000346786	T;T	0.78595	-1.19;-1.01	4.7	4.7	0.59300	4.7	4.7	0.59300	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.75339	0.3836	L	0.48642	1.525	0.30375	N	0.782556	P;B	0.36392	0.551;0.006	P;B	0.44394	0.448;0.004	T	0.71563	-0.4555	10	0.19590	T	0.45	.	13.3054	0.60349	1.0:0.0:0.0:0.0	.	76;130	Q9BUF9;P24844	.;MYL9_HUMAN	V	130;76	ENSP00000279022:M130V;ENSP00000217313:M76V	ENSP00000279022:M130V	M	+	1	0	0	MYL9	34610935	34610935	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.236000	0.95360	1.880000	0.54463	0.533000	0.62120	ATG	0.687032		TCGA-2J-AAB6-01A-11D-A40W-08	0.577	MYL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079015.2	1	0	1		2	2	2	0		0	0	51		51	51	1	2.400000	-20.000000	1	0.540000	NM_006097			112	110		199	197	1		1	1		0	0	51	0		1.000000	1	0	32	0	619	0	112	199
TPTE	7179	broad.mit.edu	37	21	10951332	10951332	+	Missense_Mutation	SNP	C	C	T	rs113140892	byFrequency	TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr21:10951332C>T	ENST00000361285.4	-	10	709	c.380G>A	c.(379-381)cGt>cAt	p.R127H	TPTE_ENST00000342420.5_Missense_Mutation_p.R89H|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Missense_Mutation_p.R109H	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	127					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R109H(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AGAAATAGAACGATACTCCAA	0.338																																						ENST00000361285.4			0	0																														1	Substitution - Missense(1)	p.R109H(1)	central_nervous_system(1)	130						c.(379-381)cGt>cAt		transmembrane phosphatase with tensin homology		C	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	99.0	107.0	104.0		326,266,380	0.9	0.0	21	dbSNP_132	104	1,8593		0,1,4296	no	missense,missense,missense	TPTE	NM_199259.2,NM_199260.2,NM_199261.2	29,29,29	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	109/534,89/514,127/552	10951332	1,12999	2203	4297	6500	SO:0001583	missense	7179	6	121412	39				g.chr21:10951332C>T	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.380G>A	chr21.hg19:g.10951332C>T	ENSP00000355208:p.Arg127His						TPTE_ENST00000298232.7_Missense_Mutation_p.R109H|TPTE_ENST00000342420.5_Missense_Mutation_p.R89H|TPTE_ENST00000415664.2_5'UTR	p.R127H	NM_199261.2	NP_954870					P56180	TPTE_HUMAN	Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	10	709	-			B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	1	1	hg19	c.380G>A	CCDS13560.2		.	.	.	.	.	.	.	.	.	.	.	9.751	1.167533	0.21621	0.0	1.16E-4	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420;ENST00000328758	D;D;D	0.97430	-4.38;-4.38;-4.38	1.8	0.877	0.19145	1.8	0.877	0.19145	.	0.456228	0.21930	U	0.067036	D	0.92140	0.7508	L	0.49126	1.545	0.09310	N	1	P;P;P	0.39759	0.687;0.687;0.56	B;B;B	0.30716	0.119;0.119;0.056	D	0.86249	0.1648	10	0.52906	T	0.07	-1.829	4.1712	0.10331	0.0:0.7811:0.0:0.2189	.	89;109;127	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	H	109;127;89;109	ENSP00000298232:R109H;ENSP00000355208:R127H;ENSP00000344441:R89H	ENSP00000298232:R109H	R	-	2	0	0	TPTE	9973203	9973203	0.000000	0.05858	0.031000	0.17742	0.132000	0.20833	-0.561000	0.05957	0.313000	0.23062	0.194000	0.17425	CGT			TCGA-2J-AAB6-01A-11D-A40W-08	0.338	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1	1	0	1		2	2	2	1		1	0	166		166	175	1	2.400000	-18.030330	1	0.540000				67	64		655	609	0		1			1	0	166	0		1.000000	0	0	0	0	0	0	67	655
ITGB2	3689	broad.mit.edu	37	21	46306690	46306690	+	Silent	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr21:46306690C>T	ENST00000397850.2	-	16	2660	c.2208G>A	c.(2206-2208)agG>agA	p.R736R	ITGB2_ENST00000397857.1_Silent_p.R736R|ITGB2_ENST00000302347.5_Silent_p.R736R|ITGB2_ENST00000397852.1_Silent_p.R736R|ITGB2_ENST00000355153.4_Silent_p.R736R|ITGB2_ENST00000397854.3_Silent_p.R679R			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	736					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	TCTCAAAGCGCCTGTACTCCC	0.617																																						ENST00000397850.2	1.000000	8.100000e-01	1	9.100000e-01	0.990000	0.967891	0.990000	1.000000																										0				35						c.(2206-2208)agG>agA		integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	Simvastatin(DB00641)						100.0	83.0	89.0					21																	46306690		2203	4300	6503	SO:0001819	synonymous_variant	3689	0	0					g.chr21:46306690C>T	AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.2208G>A	chr21.hg19:g.46306690C>T		1					ITGB2_ENST00000397852.1_Silent_p.R736R|ITGB2_ENST00000397857.1_Silent_p.R736R|ITGB2_ENST00000302347.5_Silent_p.R736R|ITGB2_ENST00000355153.4_Silent_p.R736R|ITGB2_ENST00000397854.3_Silent_p.R679R	p.R736R			0	2	2	1.807900	P05107	ITB2_HUMAN		16	2660	-			B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Silent	SNP	ENST00000397850.2	1	1	hg19	c.2208G>A	CCDS13716.1	1																																																																																								0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.617	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206566.2	1	0	1		2	2	2	0		0	0	70		70	70	1	2.400000	-20.000000	1	0.540000	NM_000211			71	71		188	185	1		1	1		0	0	70	0		1.000000	1	0	49	0	330	0	71	188
SGSM1	129049	broad.mit.edu	37	22	25294015	25294015	+	Missense_Mutation	SNP	A	A	G	rs373981289		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr22:25294015A>G	ENST00000400359.4	+	20	2271	c.2264A>G	c.(2263-2265)aAt>aGt	p.N755S	SGSM1_ENST00000400358.4_Missense_Mutation_p.N700S	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	755	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						AAGATCCCCAATGGGAACCTA	0.552																																						ENST00000400359.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				41						c.(2263-2265)aAt>aGt		small G protein signaling modulator 1		A	SER/ASN,SER/ASN,SER/ASN,SER/ASN	0,4072		0,0,2036	66.0	77.0	74.0		2264,2099,1916,2081	3.1	1.0	22		74	1,8387		0,1,4193	no	missense,missense,missense,missense	SGSM1	NM_001039948.2,NM_001098497.1,NM_001098498.1,NM_133454.2	46,46,46,46	0,1,6229	GG,GA,AA		0.0119,0.0,0.0080	probably-damaging,probably-damaging,probably-damaging,probably-damaging	755/1149,700/1094,639/1033,694/1088	25294015	1,12459	2036	4194	6230	SO:0001583	missense	129049	14	121002	42				g.chr22:25294015A>G	AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.2264A>G	chr22.hg19:g.25294015A>G	ENSP00000383212:p.Asn755Ser	1					SGSM1_ENST00000400358.4_Missense_Mutation_p.N700S	p.N755S	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	0	2	2	1.807357	Q2NKQ1	SGSM1_HUMAN		20	2271	+			A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	ENST00000400359.4	1	1	hg19	c.2264A>G	CCDS46674.1	1	.	.	.	.	.	.	.	.	.	.	A	8.860	0.946679	0.18356	0.0	1.19E-4	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.06608	3.29;3.28	5.24	3.13	0.36017	5.24	3.13	0.36017	Rab-GAP/TBC domain (2);	0.054567	0.64402	U	0.000001	T	0.05640	0.0148	N	0.25890	0.77	0.50467	D	0.999874	P;P;P;P	0.50369	0.571;0.934;0.914;0.85	B;P;P;P	0.49276	0.121;0.53;0.605;0.449	T	0.33214	-0.9877	10	0.05351	T	0.99	-9.6086	8.7962	0.34881	0.8466:0.0:0.1534:0.0	.	700;755;772;755	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1	.;.;.;SGSM1_HUMAN	S	755;700;755	ENSP00000383211:N700S;ENSP00000383212:N755S	ENSP00000383211:N700S	N	+	2	0	0	SGSM1	23624015	23624015	1.000000	0.71417	0.991000	0.47740	0.987000	0.75469	4.392000	0.59659	0.419000	0.25927	0.482000	0.46254	AAT	0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.552	SGSM1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320282.1	1	0	1		2	2	2	0		0	0	29		29	29	1	2.400000	-20.000000	1	0.540000	XM_059318			69	67		61	60	1		1	0		0	0	29	0		1.000000	5.450618e-01	0	0	0	3	0	69	61
MN1	4330	broad.mit.edu	37	22	28194939	28194939	+	Silent	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr22:28194939C>T	ENST00000302326.4	-	1	2547	c.1593G>A	c.(1591-1593)caG>caA	p.Q531Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	531	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgttgctgctgctgctgct	0.652			T	ETV6	"""AML, meningioma"""																																	ENST00000302326.4	1.000000	7.800000e-01	1	9.900000e-01	0.990000	0.983738	0.990000	1.000000				Dom	yes			Dom	yes		22	22q13	22q13	4330	T	meningioma (disrupted in balanced translocation) 1				"""L, O"""	L, O	ETV6		AML, meningioma		0				45						c.(1591-1593)caG>caA		meningioma (disrupted in balanced translocation) 1							4.0	6.0	5.0					22																	28194939		1796	3654	5450	SO:0001819	synonymous_variant	4330	3	112886	25				g.chr22:28194939C>T	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1593G>A	chr22.hg19:g.28194939C>T		1						p.Q531Q	NM_002430.2	NP_002421.3	0	2	2	1.807357	Q10571	MN1_HUMAN		1	2547	-			A9Z1V9	Silent	SNP	ENST00000302326.4	0	1	hg19	c.1593G>A	CCDS42998.1	1																																																																																								0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.652	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	1	0	0		2	2	2	0		0	0	14		14	13	1	2.400000	-19.999990	1	0.540000	NM_002430			11	0		19	17	0		0	1	0	0	0	14	4		0.986496	6.053922e-01	1.477273e-01	4	0	1	2	11	19
MN1	4330	broad.mit.edu	37	22	28194945	28194945	+	Silent	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr22:28194945C>T	ENST00000302326.4	-	1	2541	c.1587G>A	c.(1585-1587)caG>caA	p.Q529Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	529	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgctgctgctgct	0.647			T	ETV6	"""AML, meningioma"""																																	ENST00000302326.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999121	0.990000	1.000000				Dom	yes			Dom	yes		22	22q13	22q13	4330	T	meningioma (disrupted in balanced translocation) 1				"""L, O"""	L, O	ETV6		AML, meningioma		0				45						c.(1585-1587)caG>caA		meningioma (disrupted in balanced translocation) 1							3.0	5.0	4.0					22																	28194945		1291	2827	4118	SO:0001819	synonymous_variant	4330	0	0					g.chr22:28194945C>T	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1587G>A	chr22.hg19:g.28194945C>T		1						p.Q529Q	NM_002430.2	NP_002421.3	0	2	2	1.807357	Q10571	MN1_HUMAN		1	2541	-			A9Z1V9	Silent	SNP	ENST00000302326.4	0	1	hg19	c.1587G>A	CCDS42998.1	1																																																																																								0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.647	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	1	0	0		2	2	2	0		0	0	14		14	14	1	2.400000	-20.000000	1	0.540000	NM_002430			16	0		19	17	0		0	1	0	0	0	14	4		0.997598	6.166430e-01	2.176387e-01	4	0	0	2	16	19
EIF4ENIF1	56478	broad.mit.edu	37	22	31837984	31837984	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr22:31837984C>T	ENST00000397525.1	-	17	2550	c.2327G>A	c.(2326-2328)cGt>cAt	p.R776H	EIF4ENIF1_ENST00000397523.1_Missense_Mutation_p.R752H|EIF4ENIF1_ENST00000441289.1_5'Flank|EIF4ENIF1_ENST00000344710.5_Missense_Mutation_p.R602H|EIF4ENIF1_ENST00000382180.2_Missense_Mutation_p.R431H|EIF4ENIF1_ENST00000330125.5_Missense_Mutation_p.R776H	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	776						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TTTGGTGTAACGGTTGGCCTG	0.507																																						ENST00000397525.1	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				36						c.(2326-2328)cGt>cAt		eukaryotic translation initiation factor 4E nuclear import factor 1							261.0	250.0	253.0					22																	31837984		2203	4300	6503	SO:0001583	missense	56478	1	121412	38				g.chr22:31837984C>T	AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.2327G>A	chr22.hg19:g.31837984C>T	ENSP00000380659:p.Arg776His	1					EIF4ENIF1_ENST00000397523.1_Missense_Mutation_p.R752H|EIF4ENIF1_ENST00000344710.5_Missense_Mutation_p.R602H|EIF4ENIF1_ENST00000382180.2_Missense_Mutation_p.R431H|EIF4ENIF1_ENST00000330125.5_Missense_Mutation_p.R776H|EIF4ENIF1_ENST00000441289.1_5'Flank	p.R776H	NM_001164501.1	NP_001157973.1	0	2	2	1.807357	Q9NRA8	4ET_HUMAN		17	2550	-			B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Missense_Mutation	SNP	ENST00000397525.1	1	1	hg19	c.2327G>A	CCDS13898.1	1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.419760	0.83559	.	.	ENSG00000184708	ENST00000344710;ENST00000397525;ENST00000330125;ENST00000397523;ENST00000382180	.	.	.	6.17	6.17	0.99709	6.17	6.17	0.99709	.	0.276957	0.42053	D	0.000777	T	0.77942	0.4206	M	0.61703	1.905	0.58432	D	0.999995	D;D;D;D	0.89917	0.988;1.0;0.975;0.999	P;D;P;D	0.78314	0.483;0.991;0.482;0.948	T	0.72871	-0.4161	9	0.35671	T	0.21	-4.8798	19.8676	0.96824	0.0:1.0:0.0:0.0	.	602;776;601;752	B1AKL3;Q9NRA8;Q9NRA8-2;B1AKL4	.;4ET_HUMAN;.;.	H	602;776;776;752;431	.	ENSP00000328103:R776H	R	-	2	0	0	EIF4ENIF1	30167984	30167984	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	4.410000	0.59774	2.941000	0.99782	0.655000	0.94253	CGT	0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.507	EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127926.1	1	0	1		2	2	2	0		0	0	112		112	110	1	2.400000	-20.000000	1	0.540000	NM_019843			226	223		207	204	1		1	1		0	0	112	0		1.000000	9.999965e-01	0	16	0	6	0	226	207
EFCAB6	64800	broad.mit.edu	37	22	43996133	43996133	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr22:43996133C>T	ENST00000262726.7	-	23	2945	c.2692G>A	c.(2692-2694)Gag>Aag	p.E898K	EFCAB6_ENST00000396231.2_Missense_Mutation_p.E746K	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	898	EF-hand 10. {ECO:0000255|PROSITE- ProRule:PRU00448}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.E898K(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				CCTTTTCCCTCGGTGTCGTAT	0.428																																						ENST00000262726.7	1.000000	8.100000e-01	1	8.700000e-01	0.940000	0.942525	0.940000	1.000000																										1	Substitution - Missense(1)	p.E898K(1)	lung(1)	68						c.(2692-2694)Gag>Aag		EF-hand calcium binding domain 6							112.0	115.0	114.0					22																	43996133		2203	4300	6503	SO:0001583	missense	64800	2	121412	36				g.chr22:43996133C>T	Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.2692G>A	chr22.hg19:g.43996133C>T	ENSP00000262726:p.Glu898Lys	1					EFCAB6_ENST00000396231.2_Missense_Mutation_p.E746K	p.E898K	NM_022785.3	NP_073622.2	0	2	2	1.836681	Q5THR3	EFCB6_HUMAN		23	2945	-		Ovarian(80;0.0247)|all_neural(38;0.025)	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	ENST00000262726.7	1	1	hg19	c.2692G>A	CCDS14049.1	1	.	.	.	.	.	.	.	.	.	.	C	13.14	2.149491	0.37923	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	T;T	0.07800	3.16;3.16	5.0	2.86	0.33363	5.0	2.86	0.33363	EF-hand-like domain (1);	0.251434	0.29940	N	0.010811	T	0.07999	0.0200	L	0.59436	1.845	0.22468	N	0.999077	P;D	0.56746	0.897;0.977	B;B	0.39465	0.196;0.3	T	0.31779	-0.9931	10	0.25751	T	0.34	-28.7596	9.1154	0.36755	0.0:0.8248:0.0:0.1752	.	746;898	Q5THR3-2;Q5THR3	.;EFCB6_HUMAN	K	746;898	ENSP00000379533:E746K;ENSP00000262726:E898K	ENSP00000262726:E898K	E	-	1	0	0	EFCAB6	42327466	42327466	0.060000	0.20803	0.872000	0.34217	0.680000	0.39746	1.029000	0.30140	1.333000	0.45449	0.655000	0.94253	GAG	0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.428	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	1	0	1		2	2	2	0		0	0	166		166	163	1	2.400000	-6.332775	1	0.540000	NM_022785			141	137		408	401	1		1			0	0	166	0		1.000000	0	0	0	0	0	0	141	408
LMF2	91289	broad.mit.edu	37	22	50941833	50941833	+	Missense_Mutation	SNP	C	C	T	rs144342127		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr22:50941833C>T	ENST00000474879.2	-	14	2126	c.2111G>A	c.(2110-2112)cGg>cAg	p.R704Q	LMF2_ENST00000216080.5_Missense_Mutation_p.R679Q|LMF2_ENST00000505981.1_5'Flank|LMF2_ENST00000380796.3_Missense_Mutation_p.R591Q	NM_033200.2	NP_149977.2	Q9BU23	LMF2_HUMAN	lipase maturation factor 2	704						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|cervix(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CTTCTTTCGCCGGGTGGTCCT	0.672													c|||	1	0.000199681	0.0	0.0	5008	,	,		13642	0.0		0.001	False		,,,				2504	0.0					ENST00000474879.2	1.000000	7.100000e-01	1	8.300000e-01	0.950000	0.930405	0.950000	1.000000																										0				10						c.(2110-2112)cGg>cAg		lipase maturation factor 2		C	GLN/ARG	1,4313		0,1,2156	28.0	26.0	27.0		2111	5.1	1.0	22	dbSNP_134	27	0,8452		0,0,4226	no	missense	LMF2	NM_033200.2	43	0,1,6382	TT,TC,CC		0.0,0.0232,0.0078	probably-damaging	704/708	50941833	1,12765	2157	4226	6383	SO:0001583	missense	91289	3	120878	34				g.chr22:50941833C>T	BC002942	CCDS14093.1, CCDS14093.2	22q13.33	2008-02-04	2007-11-29	2007-11-29	ENSG00000100258	ENSG00000100258			25096	protein-coding gene	gene with protein product			"""transmembrane protein 153"", ""transmembrane protein 112B"""	TMEM153, TMEM112B		12477932	Standard	NM_033200		Approved		uc003blp.2	Q9BU23	OTTHUMG00000150206	ENST00000474879.2:c.2111G>A	chr22.hg19:g.50941833C>T	ENSP00000424381:p.Arg704Gln	1					LMF2_ENST00000380796.3_Missense_Mutation_p.R591Q|LMF2_ENST00000505981.1_5'Flank|LMF2_ENST00000216080.5_Missense_Mutation_p.R679Q	p.R704Q	NM_033200.2	NP_149977.2	0	2	2	1.836681	Q9BU23	LMF2_HUMAN		14	2126	-		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)	A6NEZ0|Q13392|Q6ZNR2|Q8WU74|Q96C62	Missense_Mutation	SNP	ENST00000474879.2	1	1	hg19	c.2111G>A	CCDS14093.2	1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.543489	0.65198	2.32E-4	0.0	ENSG00000100258	ENST00000380796;ENST00000474879;ENST00000216080	T;T;T	0.41758	0.99;1.65;1.64	5.14	5.14	0.70334	5.14	5.14	0.70334	.	0.512980	0.18854	N	0.129333	T	0.61048	0.2316	M	0.71581	2.175	0.23356	N	0.997846	D;D	0.76494	0.999;0.999	P;P	0.62649	0.806;0.905	T	0.55995	-0.8052	10	0.62326	D	0.03	-0.3442	14.4462	0.67352	0.0:1.0:0.0:0.0	.	704;679	Q9BU23;Q9BU23-2	LMF2_HUMAN;.	Q	591;704;679	ENSP00000370173:R591Q;ENSP00000424381:R704Q;ENSP00000216080:R679Q	ENSP00000216080:R679Q	R	-	2	0	0	LMF2	49288699	49288699	0.435000	0.25577	0.972000	0.41901	0.066000	0.16364	1.010000	0.29898	2.549000	0.85964	0.491000	0.48974	CGG	0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.672	LMF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316833.2	1	0	1		2	2	2	0		0	0	32		32	30	1	2.400000	-4.580515	1	0.540000	NM_033200			40	38		114	111	1		1	1		0	0	32	0		1.000000	1	0	72	0	125	0	40	114
ARHGEF4	50649	broad.mit.edu	37	2	131797606	131797606	+	Silent	SNP	C	C	T	rs551214782		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr2:131797606C>T	ENST00000326016.5	+	7	1284	c.765C>T	c.(763-765)gaC>gaT	p.D255D	ARHGEF4_ENST00000355771.3_Silent_p.D184D|ARHGEF4_ENST00000409303.1_Silent_p.D255D|ARHGEF4_ENST00000439368.2_3'UTR|ARHGEF4_ENST00000525839.1_Silent_p.D255D|ARHGEF4_ENST00000392953.3_Silent_p.D255D|ARHGEF4_ENST00000428230.2_Intron	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	255					apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		TGAATCAGGACGAGCCCGCGG	0.731																																						ENST00000326016.5	1.000000	2.000000e-01	9.900000e-01	3.700000e-01	0.640000	0.654354	0.640000	1.000000																										0				29						c.(763-765)gaC>gaT		Rho guanine nucleotide exchange factor (GEF) 4							26.0	28.0	28.0					2																	131797606		2166	4258	6424	SO:0001819	synonymous_variant	50649	0	0					g.chr2:131797606C>T	AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.765C>T	chr2.hg19:g.131797606C>T		0					ARHGEF4_ENST00000355771.3_Silent_p.D184D|ARHGEF4_ENST00000428230.2_Intron|ARHGEF4_ENST00000525839.1_Silent_p.D255D|ARHGEF4_ENST00000392953.3_Silent_p.D255D|ARHGEF4_ENST00000409303.1_Silent_p.D255D|ARHGEF4_ENST00000439368.2_3'UTR	p.D255D	NM_015320.2	NP_056135.2	1	2	3	1.827132	Q9NR80	ARHG4_HUMAN		7	1284	+		Prostate(154;0.055)	Q9HDC6|Q9UPP0	Silent	SNP	ENST00000326016.5	0	1	hg19	c.765C>T	CCDS2165.1	0																																																																																								0.542471		TCGA-2J-AAB6-01A-11D-A40W-08	0.731	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254554.4	0	0	1		2	2	2	0		0	0	8		8	8	1	2.400000	-10.203690	1	0.540000				3	3		16	15	0		1	0		0	0	8	0		0.795367	4.329004e-02	0	1	0	1	0	3	16
POTEE	445582	broad.mit.edu	37	2	132021474	132021474	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr2:132021474C>T	ENST00000356920.5	+	15	2540	c.2446C>T	c.(2446-2448)Cgc>Tgc	p.R816C	PLEKHB2_ENST00000303908.3_Intron|POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000404460.1_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	816	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.R816C(1)									CAAGGCCAACCGCGAGAAGAT	0.612																																						ENST00000356920.5	1.000000	7.100000e-01	9.200000e-01	7.700000e-01	0.840000	0.851509	0.840000	0.850000																										1	Substitution - Missense(1)	p.R816C(1)	endometrium(1)							c.(2446-2448)Cgc>Tgc		POTE ankyrin domain family, member E							76.0	79.0	78.0					2																	132021474		2132	4201	6333	SO:0001583	missense	445582	38	120786	49				g.chr2:132021474C>T	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2446C>T	chr2.hg19:g.132021474C>T	ENSP00000439189:p.Arg816Cys	0					POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron	p.R816C	NM_001083538.1	NP_001077007.1	1	2	3	1.827132	Q6S8J3	POTEE_HUMAN		15	2540	+			Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	0	1	hg19	c.2446C>T	CCDS46414.1	0	.	.	.	.	.	.	.	.	.	.	.	13.51	2.259391	0.39995	.	.	ENSG00000188219	ENST00000356920	D	0.97114	-4.25	.	.	.	.	.	.	Actin/actin-like conserved site (1);	.	.	.	.	D	0.98988	0.9655	H	0.99954	5.04	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.95089	0.8220	8	0.87932	D	0	.	2.8768	0.05634	0.4949:0.5045:2.0E-4:3.0E-4	.	816	Q6S8J3	POTEE_HUMAN	C	816	ENSP00000439189:R816C	ENSP00000439189:R816C	R	+	1	0	0	AC131180.1	131737944	131737944	1.000000	0.71417	0.221000	0.23827	0.224000	0.24922	3.183000	0.50918	0.119000	0.18210	0.121000	0.15741	CGC	0.542471		TCGA-2J-AAB6-01A-11D-A40W-08	0.612	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	169		169	237	1	2.400000	-3.122278	1	0.540000	NM_001083538			115	99		390	285	0		1	0		0	0	169	0		1.000000	6.436756e-01	0	0	0	9	0	115	390
TTN	7273	broad.mit.edu	37	2	179455980	179455980	+	Missense_Mutation	SNP	C	C	T	rs375009570		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr2:179455980C>T	ENST00000591111.1	-	254	55773	c.55549G>A	c.(55549-55551)Ggt>Agt	p.G18517S	TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.G11285S|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.G11093S|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.G11218S|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.G20158S|TTN-AS1_ENST00000590743.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.G17590S			Q8WZ42	TITIN_HUMAN	titin	18517	Ig-like 106.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTTTGCTACCGGCTGCATTG	0.418																																						ENST00000591111.1	1.000000	8.600000e-01	1	9.200000e-01	0.990000	0.972368	0.990000	1.000000																										0				1448						c.(55549-55551)Ggt>Agt		titin							230.0	235.0	233.0					2																	179455980		1910	4131	6041	SO:0001583	missense	7273	3	120846	41				g.chr2:179455980C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.55549G>A	chr2.hg19:g.179455980C>T	ENSP00000465570:p.Gly18517Ser	0					TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.G17590S|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.G11093S|TTN_ENST00000589042.1_Missense_Mutation_p.G20158S|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.G11285S|TTN_ENST00000359218.5_Missense_Mutation_p.G11218S|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA	p.G18517S			1	2	3	1.976685	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	254	55773	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.55549G>A		1	.	.	.	.	.	.	.	.	.	.	C	14.91	2.675466	0.47781	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83	6.11	6.11	0.99139	6.11	6.11	0.99139	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Fibronectin, type III (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.89729	0.6799	M	0.90369	3.11	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.90351	0.4366	9	0.87932	D	0	.	20.7342	0.99715	0.0:1.0:0.0:0.0	.	11093;11218;11285;18517	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	17590;11093;11285;11218;11091	ENSP00000343764:G17590S;ENSP00000434586:G11093S;ENSP00000340554:G11285S;ENSP00000352154:G11218S	ENSP00000340554:G11285S	G	-	1	0	0	TTN	179164226	179164226	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.818000	0.86416	2.906000	0.99361	0.655000	0.94253	GGT	0.563567		TCGA-2J-AAB6-01A-11D-A40W-08	0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	1	0	1		2	2	2	0		0	0	265		265	260	1	2.400000	-7.015944	1	0.540000	NM_133378			202	198		600	588	0		1			0	0	265	0		1.000000	0	0	0	0	0	0	202	600
MYT1L	23040	broad.mit.edu	37	2	1893097	1893097	+	Silent	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr2:1893097G>A	ENST00000399161.2	-	16	3183	c.2436C>T	c.(2434-2436)ggC>ggT	p.G812G	MYT1L_ENST00000428368.2_Silent_p.G810G	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	812					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		AGTCGCCCTCGCCCAGCTGGA	0.582																																						ENST00000399161.2	1.000000	8.400000e-01	1	9.300000e-01	0.990000	0.978110	0.990000	1.000000																										0				97						c.(2434-2436)ggC>ggT		myelin transcription factor 1-like							71.0	77.0	75.0					2																	1893097		2041	4156	6197	SO:0001819	synonymous_variant	23040	0	0					g.chr2:1893097G>A	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.2436C>T	chr2.hg19:g.1893097G>A		0					MYT1L_ENST00000428368.2_Silent_p.G810G	p.G812G	NM_015025.2	NP_055840.2	1	2	3	1.902247	Q9UL68	MYT1L_HUMAN		16	3183	-	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	ENST00000399161.2	1	1	hg19	c.2436C>T		1																																																																																								0.553268		TCGA-2J-AAB6-01A-11D-A40W-08	0.582	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	1	0	1		2	2	2	0		0	0	78		78	76	1	2.400000	-20.000000	1	0.540000	NM_015025			78	77		210	206	1		1			0	0	78	0		1.000000	0	0	0	0	0	0	78	210
SESTD1	91404	broad.mit.edu	37	2	180014068	180014068	+	Missense_Mutation	SNP	C	C	G			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr2:180014068C>G	ENST00000428443.3	-	7	853	c.537G>C	c.(535-537)ttG>ttC	p.L179F		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	179							phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			CATTGTTAATCAAAGCAAGTT	0.294																																						ENST00000428443.3	1.000000	4.600000e-01	1	5.800000e-01	0.730000	0.758573	0.730000	1.000000																										0				30						c.(535-537)ttG>ttC		SEC14 and spectrin domains 1							90.0	79.0	83.0					2																	180014068		2201	4297	6498	SO:0001583	missense	91404	0	0					g.chr2:180014068C>G	AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.537G>C	chr2.hg19:g.180014068C>G	ENSP00000415332:p.Leu179Phe	0						p.L179F	NM_178123.4	NP_835224.3	1	2	3	1.976685	Q86VW0	SESD1_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)	7	853	-			Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	ENST00000428443.3	1	1	hg19	c.537G>C	CCDS33338.1	0	.	.	.	.	.	.	.	.	.	.	C	10.14	1.269212	0.23221	.	.	ENSG00000187231	ENST00000428443	T	0.05258	3.47	5.45	3.65	0.41850	5.45	3.65	0.41850	.	0.133962	0.48286	D	0.000189	T	0.02610	0.0079	N	0.08118	0	0.47123	D	0.999326	B	0.29085	0.232	B	0.27170	0.077	T	0.50988	-0.8762	9	.	.	.	-11.3706	3.1066	0.06344	0.1961:0.5273:0.0:0.2766	.	179	Q86VW0	SESD1_HUMAN	F	179	ENSP00000415332:L179F	.	L	-	3	2	2	SESTD1	179722313	179722313	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.934000	0.28910	1.296000	0.44742	0.655000	0.94253	TTG	0.563567		TCGA-2J-AAB6-01A-11D-A40W-08	0.294	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	1	0	1		2	2	2	0		0	0	37		37	37	1	2.400000	-20.000000	1	0.540000	NM_178123			19	19		87	87	1		1	1		0	0	37	0		0.999995	9.259439e-01	0	7	0	16	0	19	87
MAP2	4133	broad.mit.edu	37	2	210574822	210574822	+	Silent	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr2:210574822G>A	ENST00000360351.4	+	12	5423	c.4917G>A	c.(4915-4917)ccG>ccA	p.P1639P	MAP2_ENST00000361559.4_Silent_p.P283P|MAP2_ENST00000392194.1_Silent_p.P283P|MAP2_ENST00000199940.6_Silent_p.P340P|MAP2_ENST00000475600.1_3'UTR|MAP2_ENST00000447185.1_Silent_p.P1635P	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1639					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TCTTGGTGCCGAGTGAGAAGA	0.542																																					Pancreas(27;423 979 28787 29963)	ENST00000360351.4	1.000000	2.000000e-02	1.300000e-01	4.000000e-02	0.070000	0.164182	0.070000	0.070000																										0				124						c.(4915-4917)ccG>ccA		microtubule-associated protein 2	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)						111.0	101.0	104.0					2																	210574822		2203	4300	6503	SO:0001819	synonymous_variant	4133	2	121412	37				g.chr2:210574822G>A		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4917G>A	chr2.hg19:g.210574822G>A		0					MAP2_ENST00000361559.4_Silent_p.P283P|MAP2_ENST00000447185.1_Silent_p.P1635P|MAP2_ENST00000199940.6_Silent_p.P340P|MAP2_ENST00000475600.1_3'UTR|MAP2_ENST00000392194.1_Silent_p.P283P	p.P1639P	NM_002374.3	NP_002365.3	1	2	3	1.909500	P11137	MTAP2_HUMAN		12	5423	+		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	ENST00000360351.4	0	1	hg19	c.4917G>A	CCDS2384.1	0																																																																																								0.553268		TCGA-2J-AAB6-01A-11D-A40W-08	0.542	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	0	0	1		2	2	2	0		0	0	57		57	57	1	2.400000	-2.763555	1	0.540000	NM_001039538			5	5		269	260	0		1	0		0	0	57	0		0.932469	3.987886e-02	0	0	0	14	0	5	269
TMEM198	130612	broad.mit.edu	37	2	220409474	220409474	+	Missense_Mutation	SNP	C	C	T	rs201245165		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr2:220409474C>T	ENST00000344458.2	+	3	610	c.25C>T	c.(25-27)Cgg>Tgg	p.R9W	RP11-256I23.1_ENST00000596829.1_RNA|CHPF_ENST00000535926.1_5'Flank|TMEM198_ENST00000373883.3_Missense_Mutation_p.R9W|CHPF_ENST00000243776.6_5'Flank|CHPF_ENST00000373891.2_5'Flank			Q66K66	TM198_HUMAN	transmembrane protein 198	9					multicellular organismal development (GO:0007275)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	16		Renal(207;0.0376)		Epithelial(149;6.49e-08)|all cancers(144;6.45e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		GGCAACACTGCGGTTCCAGCT	0.617													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18477	0.0		0.0	False		,,,				2504	0.0					ENST00000344458.2	1.000000	6.600000e-01	1	7.500000e-01	0.860000	0.867010	0.860000	1.000000																										0				16						c.(25-27)Cgg>Tgg		transmembrane protein 198							97.0	89.0	92.0					2																	220409474		2203	4300	6503	SO:0001583	missense	130612	1	121412	28				g.chr2:220409474C>T	BC068567	CCDS33385.1	2q35	2011-12-06			ENSG00000188760	ENSG00000188760			33704	protein-coding gene	gene with protein product							Standard	NM_001005209		Approved	MGC99813, TMEM198A	uc002vmf.3	Q66K66	OTTHUMG00000059156	ENST00000344458.2:c.25C>T	chr2.hg19:g.220409474C>T	ENSP00000343507:p.Arg9Trp	0					RP11-256I23.1_ENST00000596829.1_RNA|CHPF_ENST00000243776.6_5'Flank|CHPF_ENST00000373891.2_5'Flank|TMEM198_ENST00000373883.3_Missense_Mutation_p.R9W|CHPF_ENST00000535926.1_5'Flank	p.R9W			1	2	3	1.909500	Q66K66	TM198_HUMAN		3	610	+		Renal(207;0.0376)		Missense_Mutation	SNP	ENST00000344458.2	1	1	hg19	c.25C>T	CCDS33385.1	1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	19.17	3.776201	0.70107	.	.	ENSG00000188760	ENST00000344458;ENST00000421791;ENST00000373883	.	.	.	3.94	3.94	0.45596	3.94	3.94	0.45596	.	0.562550	0.17727	N	0.164020	T	0.39911	0.1096	N	0.08118	0	0.39157	D	0.962335	B	0.12013	0.005	B	0.01281	0.0	T	0.42899	-0.9424	9	0.66056	D	0.02	-9.0173	16.1416	0.81528	0.0:1.0:0.0:0.0	.	9	Q66K66	TM198_HUMAN	W	9	.	ENSP00000343507:R9W	R	+	1	2	2	TMEM198	220117718	220117718	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	2.182000	0.42556	2.226000	0.72624	0.555000	0.69702	CGG	0.553268		TCGA-2J-AAB6-01A-11D-A40W-08	0.617	TMEM198-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131063.1	1	0	1		2	2	2	0		0	0	65		65	65	1	2.400000	-3.807542	1	0.540000	NM_001005209			57	54		198	195	1		1	0		0	0	65	0		1.000000	4.069410e-01	0	0	0	6	0	57	198
SP140	11262	broad.mit.edu	37	2	231120208	231120208	+	Missense_Mutation	SNP	C	C	T	rs201685101		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr2:231120208C>T	ENST00000392045.3	+	12	1315	c.1201C>T	c.(1201-1203)Cgc>Tgc	p.R401C	SP140_ENST00000417495.3_Missense_Mutation_p.R287C|SP140_ENST00000350136.5_Missense_Mutation_p.R270C|SP140_ENST00000420434.3_Intron|SP140_ENST00000486687.2_Missense_Mutation_p.R325C|SP140_ENST00000343805.6_Missense_Mutation_p.R341C	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	401					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TGGAGAAGAGCGCCAGGAAGC	0.527																																						ENST00000392045.3	1.000000	6.500000e-01	9.800000e-01	7.300000e-01	0.830000	0.847919	0.830000	1.000000																										0				12						c.(1201-1203)Cgc>Tgc		SP140 nuclear body protein							100.0	94.0	96.0					2																	231120208		1909	4105	6014	SO:0001583	missense	11262	8	120848	39				g.chr2:231120208C>T	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.1201C>T	chr2.hg19:g.231120208C>T	ENSP00000375899:p.Arg401Cys	0					SP140_ENST00000343805.6_Missense_Mutation_p.R341C|SP140_ENST00000486687.2_Missense_Mutation_p.R325C|SP140_ENST00000417495.3_Missense_Mutation_p.R287C|SP140_ENST00000350136.5_Missense_Mutation_p.R270C|SP140_ENST00000420434.3_Intron	p.R401C	NM_007237.4	NP_009168.4	1	2	3	1.909500	Q13342	SP140_HUMAN		12	1315	+		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	ENST00000392045.3	1	1	hg19	c.1201C>T	CCDS42831.1	0	.	.	.	.	.	.	.	.	.	.	c	9.688	1.151170	0.21371	.	.	ENSG00000079263	ENST00000486687;ENST00000392044;ENST00000350136;ENST00000392045;ENST00000343805	T;T;T;T	0.60040	0.56;0.86;0.62;0.22	2.9	-1.08	0.09936	2.9	-1.08	0.09936	.	.	.	.	.	T	0.30198	0.0757	N	0.14661	0.345	0.09310	N	1	P;D;P	0.56968	0.688;0.978;0.561	B;B;B	0.37422	0.188;0.249;0.063	T	0.24190	-1.0167	9	0.66056	D	0.02	3.0597	3.4175	0.07381	0.0:0.4239:0.2039:0.3723	.	341;401;367	E9PFJ6;Q13342;E7EX75	.;LY10_HUMAN;.	C	325;367;270;401;341	ENSP00000440107:R325C;ENSP00000345846:R270C;ENSP00000375899:R401C;ENSP00000342096:R341C	ENSP00000342096:R341C	R	+	1	0	0	SP140	230828452	230828452	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.367000	0.20382	-0.283000	0.09115	-0.283000	0.09986	CGC	0.553268		TCGA-2J-AAB6-01A-11D-A40W-08	0.527	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	1	0	1		2	2	2	0		0	0	69		69	66	1	2.400000	-20.000000	1	0.540000	NM_007237			57	57		205	201	1		1			0	0	69	0		1.000000	0	0	0	0	0	0	57	205
KCNG3	170850	broad.mit.edu	37	2	42671164	42671164	+	Missense_Mutation	SNP	A	A	T	rs373276662		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr2:42671164A>T	ENST00000306078.1	-	2	1816	c.1221T>A	c.(1219-1221)ttT>ttA	p.F407L	KCNG3_ENST00000394973.4_Missense_Mutation_p.F396L	NM_133329.5|NM_172344.2	NP_579875.1|NP_758847.1	Q8TAE7	KCNG3_HUMAN	potassium voltage-gated channel, subfamily G, member 3	407					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	6						TATGGTAGATAAAAGTGATAG	0.398																																						ENST00000306078.1	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999688	0.990000	1.000000																										0				6						c.(1219-1221)ttT>ttA		potassium voltage-gated channel, subfamily G, member 3							128.0	126.0	127.0					2																	42671164		2203	4300	6503	SO:0001583	missense	170850	0	0					g.chr2:42671164A>T	AB070604	CCDS1809.1, CCDS42674.1	2p21	2011-07-05			ENSG00000171126	ENSG00000171126		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18306	protein-coding gene	gene with protein product		606767				11852086, 16382104	Standard	NM_133329		Approved	Kv6.3	uc002rsn.3	Q8TAE7	OTTHUMG00000128604	ENST00000306078.1:c.1221T>A	chr2.hg19:g.42671164A>T	ENSP00000304127:p.Phe407Leu	0					KCNG3_ENST00000394973.4_Missense_Mutation_p.F396L	p.F407L	NM_133329.5|NM_172344.2	NP_579875.1|NP_758847.1	1	2	3	1.810924	Q8TAE7	KCNG3_HUMAN		2	1816	-			Q53SC1	Missense_Mutation	SNP	ENST00000306078.1	1	1	hg19	c.1221T>A	CCDS1809.1	1	.	.	.	.	.	.	.	.	.	.	A	12.45	1.943128	0.34283	.	.	ENSG00000171126	ENST00000306078;ENST00000394973	D;D	0.98207	-4.79;-4.79	5.2	-0.932	0.10435	5.2	-0.932	0.10435	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.96734	0.8934	N	0.11698	0.16	0.47065	D	0.999303	D;D	0.63046	0.992;0.974	D;D	0.76071	0.987;0.969	D	0.94389	0.7612	10	0.66056	D	0.02	.	12.9539	0.58416	0.3285:0.0:0.6715:0.0	.	407;396	Q8TAE7;Q8TAE7-2	KCNG3_HUMAN;.	L	407;396	ENSP00000304127:F407L;ENSP00000378424:F396L	ENSP00000304127:F407L	F	-	3	2	2	KCNG3	42524668	42524668	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	1.574000	0.36482	-0.176000	0.10707	-0.400000	0.06385	TTT	0.541239		TCGA-2J-AAB6-01A-11D-A40W-08	0.398	KCNG3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250464.2	1	0	1		2	2	2	0		0	0	108		108	108	1	2.400000	-20.000000	1	0.540000	NM_172344			133	133		283	281	1		1	0		0	0	108	0		1.000000	0	0	0	0	1	0	133	283
FSHR	2492	broad.mit.edu	37	2	49190190	49190190	+	Missense_Mutation	SNP	G	G	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr2:49190190G>T	ENST00000406846.2	-	10	1889	c.1770C>A	c.(1768-1770)ttC>ttA	p.F590L	FSHR_ENST00000346173.3_Missense_Mutation_p.F528L|FSHR_ENST00000304421.4_Missense_Mutation_p.F564L|FSHR_ENST00000541117.1_Missense_Mutation_p.F326L	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	590					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)	p.F590L(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	AAATGGCAAAGAAAGAAATGG	0.532									Gonadal Dysgenesis, 46 XX																													ENST00000406846.2	1.000000	6.500000e-01	1	7.600000e-01	0.890000	0.888134	0.890000	1.000000																										1	Substitution - Missense(1)	p.F590L(1)	large_intestine(1)	73						c.(1768-1770)ttC>ttA		follicle stimulating hormone receptor	Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)						61.0	60.0	60.0					2																	49190190		2203	4300	6503	SO:0001583	missense	2492	0	0		Gonadal Dysgenesis, 46 XX	Familial Cancer Database		g.chr2:49190190G>T		CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1770C>A	chr2.hg19:g.49190190G>T	ENSP00000384708:p.Phe590Leu	0					FSHR_ENST00000304421.4_Missense_Mutation_p.F564L|FSHR_ENST00000346173.3_Missense_Mutation_p.F528L|FSHR_ENST00000541117.1_Missense_Mutation_p.F326L	p.F590L	NM_000145.3	NP_000136.2	1	2	3	1.810924	P23945	FSHR_HUMAN	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)	10	1889	-		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	ENST00000406846.2	1	1	hg19	c.1770C>A	CCDS1843.1	1	.	.	.	.	.	.	.	.	.	.	G	12.17	1.857498	0.32791	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000541117	T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45	5.35	4.47	0.54385	5.35	4.47	0.54385	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.57725	0.2073	L	0.53561	1.675	0.80722	D	1	B;B;B	0.11235	0.004;0.002;0.003	B;B;B	0.15870	0.014;0.008;0.014	T	0.53429	-0.8440	9	.	.	.	.	8.786	0.34821	0.231:0.0:0.769:0.0	.	564;528;590	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	L	590;528;564;326	ENSP00000384708:F590L;ENSP00000333908:F528L;ENSP00000306780:F564L;ENSP00000444172:F326L	.	F	-	3	2	2	FSHR	49043694	49043694	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.409000	0.44583	1.620000	0.50308	0.655000	0.94253	TTC	0.541239		TCGA-2J-AAB6-01A-11D-A40W-08	0.532	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2	1	0	1		2	2	2	0		0	0	51		51	51	1	2.400000	-20.000000	1	0.540000				33	33		103	101	1		1			0	0	51	0		1.000000	0	0	0	0	0	0	33	103
GGCX	2677	broad.mit.edu	37	2	85779621	85779621	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr2:85779621G>A	ENST00000233838.4	-	10	1437	c.1357C>T	c.(1357-1359)Cgc>Tgc	p.R453C	GGCX_ENST00000473665.1_5'UTR|GGCX_ENST00000430215.3_Missense_Mutation_p.R396C	NM_000821.5	NP_000812.2	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase	453					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	gamma-glutamyl carboxylase activity (GO:0008488)			endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|stomach(1)|urinary_tract(2)	15					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Phylloquinone(DB01022)	GGAAGCAGGCGGCTCAGGCAA	0.522											OREG0014747	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000233838.4	1.000000	9.700000e-01	1	9.900000e-01	0.990000	0.998834	0.990000	1.000000																										0				15						c.(1357-1359)Cgc>Tgc		gamma-glutamyl carboxylase	Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Phylloquinone(DB01022)						137.0	129.0	132.0					2																	85779621		2203	4300	6503	SO:0001583	missense	2677	2	121412	37				g.chr2:85779621G>A		CCDS1978.1, CCDS46353.1	2p12	2008-05-21			ENSG00000115486	ENSG00000115486			4247	protein-coding gene	gene with protein product	"""vitamin K-dependent gamma-carboxylase"""	137167				1749935	Standard	NM_000821		Approved	VKCFD1	uc002sps.3	P38435	OTTHUMG00000130173	ENST00000233838.4:c.1357C>T	chr2.hg19:g.85779621G>A	ENSP00000233838:p.Arg453Cys	0		OREG0014747	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1239	GGCX_ENST00000430215.3_Missense_Mutation_p.R396C|GGCX_ENST00000473665.1_5'UTR	p.R453C	NM_000821.5	NP_000812.2	1	2	3	1.810924	P38435	VKGC_HUMAN		10	1437	-			B4DMC5|E9PEE1|Q14415|Q6GU45	Missense_Mutation	SNP	ENST00000233838.4	1	1	hg19	c.1357C>T	CCDS1978.1	1	.	.	.	.	.	.	.	.	.	.	G	19.07	3.756141	0.69648	.	.	ENSG00000115486	ENST00000233838;ENST00000430215	D;D	0.92299	-3.01;-3.01	5.95	5.95	0.96441	5.95	5.95	0.96441	.	0.567099	0.20201	N	0.097085	D	0.92120	0.7502	L	0.49778	1.585	0.34474	D	0.703168	D;P;D	0.61080	0.978;0.807;0.989	P;B;P	0.51453	0.606;0.417;0.67	D	0.94367	0.7592	10	0.54805	T	0.06	-1.5644	13.4692	0.61273	0.0:0.1567:0.8433:0.0	.	396;292;453	E9PEE1;B4DQW4;P38435	.;.;VKGC_HUMAN	C	453;396	ENSP00000233838:R453C;ENSP00000408045:R396C	ENSP00000233838:R453C	R	-	1	0	0	GGCX	85633132	85633132	0.988000	0.35896	0.998000	0.56505	0.996000	0.88848	1.939000	0.40213	2.824000	0.97209	0.655000	0.94253	CGC	0.541239		TCGA-2J-AAB6-01A-11D-A40W-08	0.522	GGCX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252490.3	1	0	1		2	2	2	0		0	0	127		127	125	1	2.400000	-10.712790	1	0.540000	NM_000821			150	148		342	340	1		1	1		0	0	127	0		1.000000	9.390689e-01	0	2	0	11	0	150	342
KIF1A	547	broad.mit.edu	37	2	241713624	241713624	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr2:241713624T>C	ENST00000320389.7	-	12	1171	c.1013A>G	c.(1012-1014)tAc>tGc	p.Y338C	KIF1A_ENST00000498729.2_Missense_Mutation_p.Y338C	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	338	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GGTCTCATCGTAGTTGATGTC	0.572																																						ENST00000320389.7	1.000000	8.200000e-01	1	9.300000e-01	0.990000	0.977504	0.990000	1.000000																										0				66						c.(1012-1014)tAc>tGc		kinesin family member 1A							76.0	83.0	81.0					2																	241713624		2159	4257	6416	SO:0001583	missense	547	0	0					g.chr2:241713624T>C	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.1013A>G	chr2.hg19:g.241713624T>C	ENSP00000322791:p.Tyr338Cys	0					KIF1A_ENST00000498729.2_Missense_Mutation_p.Y338C	p.Y338C	NM_004321.6	NP_004312.2	1	2	3	1.909500	Q12756	KIF1A_HUMAN		12	1171	-		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	1	1	hg19	c.1013A>G	CCDS46561.1	1	.	.	.	.	.	.	.	.	.	.	T	17.53	3.413213	0.62511	.	.	ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283	T;T;T	0.76186	-1.0;-1.0;-1.0	4.33	4.33	0.51752	4.33	4.33	0.51752	Kinesin, motor domain (3);	0.000000	0.85682	U	0.000000	D	0.87406	0.6169	M	0.88775	2.98	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.996;0.998;1.0	D	0.89725	0.3922	10	0.87932	D	0	.	13.1872	0.59688	0.0:0.0:0.0:1.0	.	338;338;338	F5H045;Q12756-2;Q12756	.;.;KIF1A_HUMAN	C	338	ENSP00000322791:Y338C;ENSP00000438388:Y338C;ENSP00000384231:Y338C	ENSP00000322791:Y338C	Y	-	2	0	0	KIF1A	241362297	241362297	1.000000	0.71417	0.952000	0.39060	0.601000	0.36947	7.764000	0.85297	1.593000	0.50029	0.374000	0.22700	TAC	0.553268		TCGA-2J-AAB6-01A-11D-A40W-08	0.572	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	1	0	1		2	2	2	0		0	0	59		59	58	1	2.400000	-20.000000	1	0.540000	NM_138483			52	52		136	135	1		1	0		0	0	59	0		1.000000	4.274396e-01	0	0	0	5	0	52	136
STXBP5L	9515	broad.mit.edu	37	3	120959317	120959317	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr3:120959317C>A	ENST00000273666.6	+	14	1634	c.1363C>A	c.(1363-1365)Ctt>Att	p.L455I	STXBP5L_ENST00000471454.1_Missense_Mutation_p.L455I|STXBP5L_ENST00000497029.1_Missense_Mutation_p.L455I|STXBP5L_ENST00000472879.1_Missense_Mutation_p.L455I|STXBP5L_ENST00000492541.1_Missense_Mutation_p.L455I	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	455					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		AGCTTGGAACCTTGGAGCACA	0.323																																						ENST00000273666.6	0.190000	3.000000e-02	1.500000e-01	6.000000e-02	0.090000	0.106381	0.090000	0.090000																										0				68						c.(1363-1365)Ctt>Att		syntaxin binding protein 5-like							90.0	88.0	89.0					3																	120959317		1825	4080	5905	SO:0001583	missense	9515	0	0					g.chr3:120959317C>A	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.1363C>A	chr3.hg19:g.120959317C>A	ENSP00000273666:p.Leu455Ile	1					STXBP5L_ENST00000497029.1_Missense_Mutation_p.L455I|STXBP5L_ENST00000492541.1_Missense_Mutation_p.L455I|STXBP5L_ENST00000471454.1_Missense_Mutation_p.L455I|STXBP5L_ENST00000472879.1_Missense_Mutation_p.L455I	p.L455I	NM_014980.2	NP_055795.1	1	2	3	2.282908	Q9Y2K9	STB5L_HUMAN		14	1634	+			Q4G1B4|Q6PIC3	Missense_Mutation	SNP	ENST00000273666.6	0	1	hg19	c.1363C>A	CCDS43137.1	0	.	.	.	.	.	.	.	.	.	.	C	10.67	1.416075	0.25552	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.63096	1.59;-0.02;0.56;0.56;-0.02;-0.02	5.21	0.825	0.18824	5.21	0.825	0.18824	WD40 repeat-like-containing domain (2);	0.346259	0.27214	N	0.020399	T	0.52693	0.1750	L	0.55103	1.725	0.47737	D	0.999504	B;B	0.16603	0.018;0.01	B;B	0.19148	0.024;0.021	T	0.46978	-0.9152	10	0.37606	T	0.19	-8.1379	10.0091	0.41975	0.3776:0.554:0.0:0.0684	.	455;455	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	I	455	ENSP00000273666:L455I;ENSP00000420019:L455I;ENSP00000419627:L455I;ENSP00000420287:L455I;ENSP00000420666:L455I;ENSP00000420167:L455I	ENSP00000273666:L455I	L	+	1	0	0	STXBP5L	122442007	122442007	0.232000	0.23762	0.997000	0.53966	0.892000	0.51952	0.713000	0.25794	0.297000	0.22615	-0.397000	0.06425	CTT	0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.323	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3	0	0	1		2	2	2	0		0	0	71		71	71	1	2.400000	-3.142602	1	0.540000				6	6		301	295	0		1			0	0	71	0		0.963191	0	0	0	0	0	0	6	301
NUP210	23225	broad.mit.edu	37	3	13360637	13360637	+	Missense_Mutation	SNP	G	G	A	rs184792881	byFrequency	TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr3:13360637G>A	ENST00000254508.5	-	39	5580	c.5498C>T	c.(5497-5499)aCg>aTg	p.T1833M		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1833					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					ATCCCGGGGCGTGCAGACAGT	0.637													G|||	3	0.000599042	0.0	0.0	5008	,	,		18218	0.003		0.0	False		,,,				2504	0.0					ENST00000254508.5	1.000000	6.300000e-01	1	7.900000e-01	0.970000	0.918725	0.970000	1.000000																										0				66						c.(5497-5499)aCg>aTg		nucleoporin 210kDa							73.0	73.0	73.0					3																	13360637		2203	4300	6503	SO:0001583	missense	23225	9	121382	34				g.chr3:13360637G>A	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.5498C>T	chr3.hg19:g.13360637G>A	ENSP00000254508:p.Thr1833Met	1						p.T1833M	NM_024923.2	NP_079199.2	1	2	3	2.282908	Q8TEM1	PO210_HUMAN		39	5580	-	all_neural(104;0.187)		A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	0	1	hg19	c.5498C>T	CCDS33704.1	1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	15.41	2.826752	0.50739	.	.	ENSG00000132182	ENST00000254508	T	0.05081	3.5	5.45	4.56	0.56223	5.45	4.56	0.56223	.	1.369470	0.04485	N	0.378425	T	0.10078	0.0247	N	0.22421	0.69	0.09310	N	1	D	0.59767	0.986	P	0.47528	0.549	T	0.50591	-0.8810	10	0.46703	T	0.11	-0.0018	14.191	0.65637	0.0:0.1496:0.8504:0.0	.	1833	Q8TEM1	PO210_HUMAN	M	1833	ENSP00000254508:T1833M	ENSP00000254508:T1833M	T	-	2	0	0	NUP210	13335637	13335637	0.493000	0.26035	0.003000	0.11579	0.045000	0.14185	4.575000	0.60908	1.288000	0.44600	0.561000	0.74099	ACG	0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.637	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	1	0	1		2	2	2	0		0	0	9		9	9	1	2.400000	-20.000000	1	0.540000	NM_024923			19	18		73	69	1		1	0		0	0	9	0		0.999993	3.751306e-01	0	1	0	5	0	19	73
TRH	7200	broad.mit.edu	37	3	129696025	129696025	+	Missense_Mutation	SNP	G	G	A	rs199889071	byFrequency	TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr3:129696025G>A	ENST00000302649.3	+	3	1222	c.695G>A	c.(694-696)cGg>cAg	p.R232Q	TRH_ENST00000507066.1_Missense_Mutation_p.R228Q	NM_007117.3	NP_009048.1	P20396	TRH_HUMAN	thyrotropin-releasing hormone	232					adult walking behavior (GO:0007628)|cell-cell signaling (GO:0007267)|eating behavior (GO:0042755)|histamine metabolic process (GO:0001692)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of feeding behavior (GO:2000252)|negative regulation of glutamate secretion (GO:0014050)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of insulin secretion (GO:0032024)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	thyrotropin-releasing hormone activity (GO:0008437)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	14						CCTGGTCGGCGGGCAGCCTGG	0.617													g|||	54	0.0107827	0.0	0.0	5008	,	,		13422	0.002		0.0	False		,,,				2504	0.0532				Esophageal Squamous(60;321 1330 17401 41911)	ENST00000302649.3	1.000000	6.900000e-01	1	8.000000e-01	0.930000	0.915051	0.930000	1.000000																										0				14						c.(694-696)cGg>cAg		thyrotropin-releasing hormone		G	GLN/ARG	1,4397		0,1,2198	20.0	21.0	21.0		695	3.5	0.0	3		21	1,8547		0,1,4273	yes	missense	TRH	NM_007117.3	43	0,2,6471	AA,AG,GG		0.0117,0.0227,0.0154	possibly-damaging	232/243	129696025	2,12944	2199	4274	6473	SO:0001583	missense	7200	422	118390	53				g.chr3:129696025G>A		CCDS3066.1	3q13.3-q21	2013-02-28				ENSG00000170893		"""Endogenous ligands"""	12298	protein-coding gene	gene with protein product	"""prothyroliberin"""	613879				2126343, 1900134	Standard	NM_007117		Approved		uc003enc.4	P20396		ENST00000302649.3:c.695G>A	chr3.hg19:g.129696025G>A	ENSP00000303452:p.Arg232Gln	1					TRH_ENST00000507066.1_Missense_Mutation_p.R228Q	p.R232Q	NM_007117.3	NP_009048.1	1	2	3	2.282908	P20396	TRH_HUMAN		3	1222	+			B2R8R1|Q2TB83	Missense_Mutation	SNP	ENST00000302649.3	1	1	hg19	c.695G>A	CCDS3066.1	1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	8.889	0.953444	0.18431	2.27E-4	1.17E-4	ENSG00000170893	ENST00000302649;ENST00000507066	T;T	0.56941	0.44;0.43	4.42	3.51	0.40186	4.42	3.51	0.40186	.	0.302445	0.35013	N	0.003517	T	0.40171	0.1106	L	0.49126	1.545	0.09310	N	0.999999	P	0.48640	0.913	B	0.35240	0.198	T	0.40831	-0.9542	10	0.56958	D	0.05	-6.4951	9.4211	0.38553	0.0:0.0:0.7781:0.2219	.	232	P20396	TRH_HUMAN	Q	232;228	ENSP00000303452:R232Q;ENSP00000426522:R228Q	ENSP00000303452:R232Q	R	+	2	0	0	TRH	131178715	131178715	0.660000	0.27420	0.018000	0.16275	0.005000	0.04900	1.356000	0.34079	1.146000	0.42352	0.563000	0.77884	CGG	0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.617	TRH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356592.1	1	0	1		2	2	2	0		0	0	34		34	33	1	2.400000	-20.000000	1	0.540000	NM_007117			38	37		153	150	1		1			0	0	34	0		1.000000	0	0	0	0	0	0	38	153
SCN5A	6331	broad.mit.edu	37	3	38662392	38662392	+	Missense_Mutation	SNP	C	C	T	rs192113333		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr3:38662392C>T	ENST00000333535.4	-	5	702	c.553G>A	c.(553-555)Gcg>Acg	p.A185T	SCN5A_ENST00000414099.2_Missense_Mutation_p.A185T|SCN5A_ENST00000425664.1_Missense_Mutation_p.A185T|SCN5A_ENST00000443581.1_Missense_Mutation_p.A185T|SCN5A_ENST00000449557.2_Missense_Mutation_p.A185T|SCN5A_ENST00000413689.1_Missense_Mutation_p.A185T|SCN5A_ENST00000451551.2_Missense_Mutation_p.A185T|SCN5A_ENST00000423572.2_Missense_Mutation_p.A185T|SCN5A_ENST00000450102.2_Missense_Mutation_p.A185T|SCN5A_ENST00000455624.2_Missense_Mutation_p.A185T			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	185					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	AAAGTGAACGCGTGCAGGCAG	0.527													C|||	1	0.000199681	0.0	0.0	5008	,	,		21080	0.0		0.001	False		,,,				2504	0.0					ENST00000333535.4	1.000000	7.400000e-01	1	9.000000e-01	0.990000	0.964923	0.990000	1.000000																										0				107	GRCh37	CM044054	SCN5A	M	rs192113333	c.(553-555)Gcg>Acg		sodium channel, voltage-gated, type V, alpha subunit	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)						54.0	61.0	59.0					3																	38662392		1985	4185	6170	SO:0001583	missense	6331	36	120930	44				g.chr3:38662392C>T	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.553G>A	chr3.hg19:g.38662392C>T	ENSP00000328968:p.Ala185Thr	1					SCN5A_ENST00000450102.2_Missense_Mutation_p.A185T|SCN5A_ENST00000451551.2_Missense_Mutation_p.A185T|SCN5A_ENST00000413689.1_Missense_Mutation_p.A185T|SCN5A_ENST00000423572.2_Missense_Mutation_p.A185T|SCN5A_ENST00000455624.2_Missense_Mutation_p.A185T|SCN5A_ENST00000443581.1_Missense_Mutation_p.A185T|SCN5A_ENST00000425664.1_Missense_Mutation_p.A185T|SCN5A_ENST00000449557.2_Missense_Mutation_p.A185T|SCN5A_ENST00000414099.2_Missense_Mutation_p.A185T	p.A185T			1	2	3	2.282908	Q14524	SCN5A_HUMAN		5	702	-	Medulloblastoma(35;0.163)		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	1	1	hg19	c.553G>A	CCDS46796.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	13.26	2.182805	0.38511	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.98585	-5.01;-5.01;-5.01;-5.01;-5.01;-5.01;-5.01;-5.01;-5.01;-5.01	4.13	4.13	0.48395	4.13	4.13	0.48395	Ion transport (1);	0.272885	0.36893	N	0.002355	D	0.94568	0.8250	N	0.22421	0.69	0.09310	N	1	P;P;P;P;P;P	0.50710	0.898;0.936;0.898;0.873;0.938;0.846	B;B;B;B;B;B	0.40165	0.249;0.321;0.249;0.255;0.299;0.079	D	0.90051	0.4149	10	0.44086	T	0.13	.	12.7806	0.57474	0.0:0.835:0.165:0.0	.	185;185;185;185;185;185	E9PEF3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;SCN5A_HUMAN;.;.	T	185	ENSP00000398962:A185T;ENSP00000398266:A185T;ENSP00000410257:A185T;ENSP00000388797:A185T;ENSP00000397915:A185T;ENSP00000416634:A185T;ENSP00000328968:A185T;ENSP00000399524:A185T;ENSP00000403355:A185T;ENSP00000413996:A185T	ENSP00000328968:A185T	A	-	1	0	0	SCN5A	38637396	38637396	0.008000	0.16893	0.142000	0.22268	0.893000	0.52053	1.343000	0.33930	2.306000	0.77630	0.561000	0.74099	GCG	0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.527	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	1	0	1		2	2	2	0		0	0	24		24	24	1	2.400000	-20.000000	1	0.540000	NM_198056			25	22		84	84	1		1			0	0	24	0		1.000000	0	0	0	0	0	0	25	84
CDC25A	993	broad.mit.edu	37	3	48219349	48219349	+	Missense_Mutation	SNP	G	G	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr3:48219349G>T	ENST00000302506.3	-	7	1087	c.679C>A	c.(679-681)Ctg>Atg	p.L227M	RNU7-128P_ENST00000517247.1_RNA|CDC25A_ENST00000351231.3_Missense_Mutation_p.L187M	NM_001789.2	NP_001780.2	P30304	MPIP1_HUMAN	cell division cycle 25A	227					cell proliferation (GO:0008283)|cellular response to UV (GO:0034644)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to radiation (GO:0009314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.000685)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		GGTACCTTCAGATTCTCTCCA	0.448																																						ENST00000302506.3	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				20						c.(679-681)Ctg>Atg		cell division cycle 25A							184.0	178.0	180.0					3																	48219349		2203	4300	6503	SO:0001583	missense	993	0	0					g.chr3:48219349G>T	M81933	CCDS2760.1, CCDS2761.1	3p21	2013-01-17	2013-01-17		ENSG00000164045	ENSG00000164045		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1725	protein-coding gene	gene with protein product		116947	"""cell division cycle 25A"", ""cell division cycle 25 homolog A (S. cerevisiae)"", ""cell division cycle 25 homolog A (S. pombe)"""			1836978	Standard	NM_001789		Approved		uc003csh.1	P30304	OTTHUMG00000133535	ENST00000302506.3:c.679C>A	chr3.hg19:g.48219349G>T	ENSP00000303706:p.Leu227Met	1					CDC25A_ENST00000351231.3_Missense_Mutation_p.L187M|RNU7-128P_ENST00000517247.1_RNA	p.L227M	NM_001789.2	NP_001780.2	1	2	3	2.282908	P30304	MPIP1_HUMAN		7	1087	-			Q8IZH5|Q96IL3|Q9H2F2	Missense_Mutation	SNP	ENST00000302506.3	1	1	hg19	c.679C>A	CCDS2760.1	1	.	.	.	.	.	.	.	.	.	.	G	12.09	1.834951	0.32421	.	.	ENSG00000164045	ENST00000302506;ENST00000351231;ENST00000443342	T;T;T	0.36520	1.25;1.25;1.25	5.86	-1.61	0.08399	5.86	-1.61	0.08399	.	0.298652	0.32068	N	0.006637	T	0.25195	0.0612	L	0.40543	1.245	0.31540	N	0.660029	B;B	0.22746	0.074;0.053	B;B	0.36534	0.145;0.227	T	0.17228	-1.0376	10	0.37606	T	0.19	.	0.6643	0.00848	0.2883:0.1209:0.3425:0.2483	.	187;227	P30304-2;P30304	.;MPIP1_HUMAN	M	227;187;226	ENSP00000303706:L227M;ENSP00000343166:L187M;ENSP00000416483:L226M	ENSP00000303706:L227M	L	-	1	2	2	CDC25A	48194353	48194353	0.984000	0.35163	0.843000	0.33291	0.723000	0.41478	0.184000	0.16939	-0.685000	0.05177	-0.291000	0.09656	CTG	0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.448	CDC25A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257512.2	1	0	1		2	2	2	0		0	0	296		296	289	1	2.400000	-20.000000	1	0.540000	NM_001789			487	487		644	623	1		1	1		0	0	296	0		1.000000	8.107497e-01	0	4	0	2	0	487	644
PXK	54899	broad.mit.edu	37	3	58385103	58385103	+	Splice_Site	SNP	C	C	G			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr3:58385103C>G	ENST00000356151.2	+	12	1289	c.1180C>G	c.(1180-1182)Cca>Gca	p.P394A	PXK_ENST00000479241.1_Splice_Site_p.P377A|PXK_ENST00000383716.3_Splice_Site_p.P361A|PXK_ENST00000463280.1_Splice_Site_p.P361A|PXK_ENST00000536660.1_Splice_Site_p.P257A|PXK_ENST00000383715.4_Splice_Site_p.P377A|PXK_ENST00000484288.1_Splice_Site_p.P394A|PXK_ENST00000302779.5_Splice_Site_p.P377A	NM_017771.3	NP_060241.2			PX domain containing serine/threonine kinase											cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000249)|KIRC - Kidney renal clear cell carcinoma(10;0.00346)|Kidney(10;0.00368)|OV - Ovarian serous cystadenocarcinoma(275;0.22)		CTTACAGATGCCGTAAGTCAA	0.448																																						ENST00000356151.2	1.000000	7.200000e-01	1	8.300000e-01	0.950000	0.928815	0.950000	1.000000																										0				19						c.(1180-1182)Cca>Gca		PX domain containing serine/threonine kinase							142.0	122.0	129.0					3																	58385103		2203	4300	6503	SO:0001630	splice_region_variant	54899	0	0					g.chr3:58385103C>G	AY274811	CCDS2889.1, CCDS74952.1, CCDS74954.1, CCDS74955.1	3p21.2	2008-02-05			ENSG00000168297	ENSG00000168297			23326	protein-coding gene	gene with protein product		611450					Standard	XM_005265255		Approved	FLJ20335	uc003djz.1	Q7Z7A4	OTTHUMG00000159149	ENST00000356151.2:c.1181+1C>G	chr3.hg19:g.58385103C>G		1					PXK_ENST00000383715.4_Splice_Site_p.P377A|PXK_ENST00000484288.1_Splice_Site_p.P394A|PXK_ENST00000383716.3_Splice_Site_p.P361A|PXK_ENST00000463280.1_Splice_Site_p.P361A|PXK_ENST00000536660.1_Splice_Site_p.P257A|PXK_ENST00000302779.5_Splice_Site_p.P377A|PXK_ENST00000479241.1_Splice_Site_p.P377A	p.P394A	NM_017771.3	NP_060241.2	1	2	3	2.282908				12	1289	+				Splice_Site	SNP	ENST00000356151.2	1	0	hg19	c.1180C>G	CCDS2889.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.8|26.8	4.770248|4.770248	0.90108|0.90108	.|.	.|.	ENSG00000168297|ENSG00000168297	ENST00000479134|ENST00000356151;ENST00000302779;ENST00000383716;ENST00000463280;ENST00000383715;ENST00000484288;ENST00000479241;ENST00000536660;ENST00000536750	.|T;T;T;T;T;T;T;T	.|0.34667	.|2.12;2.11;2.12;1.4;1.39;1.4;1.35;2.12	5.87|5.87	5.87|5.87	0.94306|0.94306	5.87|5.87	5.87|5.87	0.94306|0.94306	.|Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.65196|0.65196	0.2668|0.2668	M|M	0.80183|0.80183	2.485|2.485	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|0.996;0.998;0.989;1.0;0.997;1.0	.|D;D;P;D;D;D	.|0.79108	.|0.953;0.943;0.9;0.992;0.942;0.979	T|T	0.63497|0.63497	-0.6624|-0.6624	5|10	.|0.49607	.|T	.|0.09	-14.302|-14.302	20.5827|20.5827	0.99408|0.99408	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|361;361;361;394;377;394	.|E9PD56;Q7Z7A4-6;B4DID9;Q7Z7A4;Q7Z7A4-4;Q7Z7A4-2	.|.;.;.;PXK_HUMAN;.;.	W|A	148|394;377;361;361;377;394;377;257;257	.|ENSP00000348472:P394A;ENSP00000305045:P377A;ENSP00000373222:P361A;ENSP00000417903:P361A;ENSP00000373221:P377A;ENSP00000417915:P394A;ENSP00000419049:P377A;ENSP00000438356:P257A	.|ENSP00000305045:P377A	C|P	+|+	3|1	2|0	2|0	PXK|PXK	58360143|58360143	58360143|58360143	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.715000|4.715000	0.61909|0.61909	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	TGC|CCA	0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.448	PXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353499.1	1	0	1		2	2	2	0		0	0	64		64	63	1	2.400000	-3.680894	1	0.540000	NM_017771	Missense_Mutation		46	46		181	180	1		1	1		0	0	64	0		1.000000	8.611607e-01	0	2	0	14	0	46	181
KY	339855	broad.mit.edu	37	3	134322916	134322916	+	Silent	SNP	G	G	A	rs142832129	byFrequency	TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr3:134322916G>A	ENST00000423778.2	-	11	1552	c.1491C>T	c.(1489-1491)caC>caT	p.H497H	KY_ENST00000503669.1_3'UTR|KY_ENST00000508956.1_Silent_p.H476H	NM_178554.4	NP_848649.3	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	497					muscle organ development (GO:0007517)|neuromuscular junction development (GO:0007528)	cytoskeleton (GO:0005856)|Z disc (GO:0030018)	peptidase activity (GO:0008233)			central_nervous_system(1)|endometrium(3)|kidney(1)|lung(12)|ovary(2)|upper_aerodigestive_tract(2)	21						CATCATCCCCGTGGAGGGAAG	0.617													G|||	30	0.00599042	0.0	0.0	5008	,	,		19751	0.0298		0.0	False		,,,				2504	0.0					ENST00000423778.2	1.000000	6.500000e-01	1	7.900000e-01	0.950000	0.913937	0.950000	1.000000																										0				21						c.(1489-1491)caC>caT		kyphoscoliosis peptidase		G		2,4152		0,2,2075	33.0	35.0	34.0		1491	-3.1	0.9	3	dbSNP_134	34	1,8411		0,1,4205	no	coding-synonymous	KY	NM_178554.4		0,3,6280	AA,AG,GG		0.0119,0.0481,0.0239		497/662	134322916	3,12563	2077	4206	6283	SO:0001819	synonymous_variant	339855	202	121028	51				g.chr3:134322916G>A	AK090526	CCDS46920.1	3q22.1	2010-11-23			ENSG00000174611	ENSG00000174611			26576	protein-coding gene	gene with protein product		605739					Standard	NM_178554		Approved	FLJ33207	uc010hty.3	Q8NBH2	OTTHUMG00000159788	ENST00000423778.2:c.1491C>T	chr3.hg19:g.134322916G>A		1					KY_ENST00000508956.1_Silent_p.H476H|KY_ENST00000503669.1_3'UTR	p.H497H	NM_178554.4	NP_848649.3	1	2	3	2.282908	Q8NBH2	KY_HUMAN		11	1552	-			B7Z1S4|Q6ZT15	Silent	SNP	ENST00000423778.2	1	0	hg19	c.1491C>T	CCDS46920.1	1																																																																																								0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.617	KY-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357320.1	1	0	1		2	2	2	0		0	0	30		30	29	1	2.400000	-2.835508	1	0.540000	NM_178554			25	24		99	94	1		1			0	0	30	0		1.000000	0	0	0	0	0	0	25	99
PTPN13	5783	broad.mit.edu	37	4	87622708	87622708	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr4:87622708G>A	ENST00000411767.2	+	7	1012	c.949G>A	c.(949-951)Gag>Aag	p.E317K	PTPN13_ENST00000436978.1_Missense_Mutation_p.E317K|PTPN13_ENST00000427191.2_Missense_Mutation_p.E317K|PTPN13_ENST00000316707.6_Missense_Mutation_p.E317K|PTPN13_ENST00000511467.1_Missense_Mutation_p.E317K			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	317					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CTCTTCAGGAGAGACTGCCAC	0.458																																						ENST00000411767.2	1.000000	9.100000e-01	1	9.900000e-01	0.990000	0.993830	0.990000	1.000000																										0				93						c.(949-951)Gag>Aag		protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)							81.0	78.0	79.0					4																	87622708		1958	4148	6106	SO:0001583	missense	5783	0	0					g.chr4:87622708G>A		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.949G>A	chr4.hg19:g.87622708G>A	ENSP00000407249:p.Glu317Lys	0					PTPN13_ENST00000316707.6_Missense_Mutation_p.E317K|PTPN13_ENST00000511467.1_Missense_Mutation_p.E317K|PTPN13_ENST00000436978.1_Missense_Mutation_p.E317K|PTPN13_ENST00000427191.2_Missense_Mutation_p.E317K	p.E317K			1	2	3	1.849916	Q12923	PTN13_HUMAN		7	1012	+		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	1	1	hg19	c.949G>A	CCDS47094.1	1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.612102	0.46631	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93	6.02	5.17	0.71159	6.02	5.17	0.71159	.	0.473238	0.18118	N	0.151133	T	0.36853	0.0982	L	0.57536	1.79	0.34254	D	0.679118	B;P;P;B	0.44627	0.037;0.675;0.839;0.259	B;B;B;B	0.36567	0.093;0.228;0.114;0.067	T	0.54450	-0.8292	10	0.38643	T	0.18	.	11.0908	0.48115	0.14:0.0:0.86:0.0	.	317;317;317;317	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	K	317;317;317;317;317;285	ENSP00000408368:E317K;ENSP00000394794:E317K;ENSP00000322675:E317K;ENSP00000407249:E317K;ENSP00000426626:E317K	ENSP00000322675:E317K	E	+	1	0	0	PTPN13	87841732	87841732	1.000000	0.71417	0.990000	0.47175	0.428000	0.31595	3.582000	0.53921	1.547000	0.49401	0.650000	0.86243	GAG	0.546127		TCGA-2J-AAB6-01A-11D-A40W-08	0.458	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1	1	0	1		2	2	2	0		0	0	66		66	66	1	2.400000	-7.105578	1	0.540000				68	68		158	158	1		1	0		0	0	66	0		1.000000	3.532939e-01	0	1	0	3	0	68	158
SH3TC2	79628	broad.mit.edu	37	5	148424197	148424197	+	Missense_Mutation	SNP	A	A	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr5:148424197A>T	ENST00000515425.1	-	4	385	c.284T>A	c.(283-285)cTc>cAc	p.L95H	SH3TC2_ENST00000512049.1_Missense_Mutation_p.L95H|SH3TC2_ENST00000394358.2_5'UTR	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	95					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTGCTGAGAGGTCCTACGT	0.438																																						ENST00000515425.1	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				39						c.(283-285)cTc>cAc		SH3 domain and tetratricopeptide repeats 2							91.0	78.0	82.0					5																	148424197		2203	4300	6503	SO:0001583	missense	79628	0	0					g.chr5:148424197A>T	AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.284T>A	chr5.hg19:g.148424197A>T	ENSP00000423660:p.Leu95His	1					SH3TC2_ENST00000394358.2_5'UTR|SH3TC2_ENST00000512049.1_Missense_Mutation_p.L95H	p.L95H	NM_024577.3	NP_078853.2	0	2	2	1.794732	Q8TF17	S3TC2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	4	385	-			B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	1	1	hg19	c.284T>A	CCDS4293.1	1	.	.	.	.	.	.	.	.	.	.	A	17.32	3.360433	0.61403	.	.	ENSG00000169247	ENST00000515425;ENST00000512049	D;D	0.90069	-2.56;-2.61	5.92	5.92	0.95590	5.92	5.92	0.95590	.	0.085133	0.46758	D	0.000280	D	0.93973	0.8070	M	0.74647	2.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94506	0.7714	10	0.87932	D	0	.	14.5824	0.68300	1.0:0.0:0.0:0.0	.	95;95	Q14CC0;Q8TF17	.;S3TC2_HUMAN	H	95	ENSP00000423660:L95H;ENSP00000421860:L95H	ENSP00000313025:L95H	L	-	2	0	0	SH3TC2	148404390	148404390	1.000000	0.71417	1.000000	0.80357	0.210000	0.24377	7.355000	0.79434	2.255000	0.74692	0.533000	0.62120	CTC	0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.438	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	1	0	1		2	2	2	0		0	0	51		51	51	1	2.400000	-20.000000	1	0.540000	NM_024577			87	86		78	78	1		1	1		0	0	51	0		1.000000	2.791560e-01	0	2	0	0	0	87	78
HIST1H2BO	8348	broad.mit.edu	37	6	27861401	27861401	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr6:27861401G>A	ENST00000303806.4	+	1	199	c.161G>A	c.(160-162)gGc>gAc	p.G54D	HIST1H2AM_ENST00000359611.2_5'Flank|HIST1H3J_ENST00000479986.1_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank	NM_003527.4	NP_003518.2	P23527	H2B1O_HUMAN	histone cluster 1, H2bo	54					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)										CCCGACACCGGCATCTCATCG	0.557																																						ENST00000303806.4	0.070000	0	5.000000e-02	1.000000e-02	0.030000	0.037343	0.030000	0.040000																										0										c.(160-162)gGc>gAc		histone cluster 1, H2bo							161.0	145.0	151.0					6																	27861401		2203	4300	6503	SO:0001583	missense	8348	0	0					g.chr6:27861401G>A	X57138	CCDS4640.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196331			"""Histones / Replication-dependent"""	4758	protein-coding gene	gene with protein product		602808	"""H2B histone family, member N"", ""histone 1, H2bo"""	H2BFN		1768865, 12408966	Standard	NM_003527		Approved	H2B/n, H2B.2	uc003nkc.1	P23527	OTTHUMG00000014493	ENST00000303806.4:c.161G>A	chr6.hg19:g.27861401G>A	ENSP00000303408:p.Gly54Asp	0					HIST1H3J_ENST00000479986.1_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank|HIST1H2AM_ENST00000359611.2_5'Flank	p.G54D	NM_003527.4	NP_003518.2	0	1	1	1.799322	P23527	H2B1O_HUMAN		1	199	+			Q3KPI7|Q8TCV6	Missense_Mutation	SNP	ENST00000303806.4	0	1	hg19	c.161G>A	CCDS4640.1	0	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928991	0.73327	.	.	ENSG00000196331	ENST00000303806	T	0.69435	-0.4	3.55	3.55	0.40652	3.55	3.55	0.40652	Histone-fold (2);Histone core (1);	.	.	.	.	T	0.82240	0.4994	M	0.93150	3.385	0.51767	D	0.999939	D	0.61697	0.99	D	0.64595	0.927	D	0.87114	0.2187	9	0.87932	D	0	.	14.9186	0.70818	0.0:0.0:1.0:0.0	.	54	P23527	H2B1O_HUMAN	D	54	ENSP00000303408:G54D	ENSP00000303408:G54D	G	+	2	0	0	HIST1H2BO	27969380	27969380	1.000000	0.71417	1.000000	0.80357	0.528000	0.34623	7.022000	0.76431	2.275000	0.75901	0.561000	0.74099	GGC	0.538755		TCGA-2J-AAB6-01A-11D-A40W-08	0.557	HIST1H2BO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040161.1	0	0	1		2	2	2	0		0	0	211		211	208	1	2.400000	-1.756810	0	0.540000	NM_003527			6	6		675	666	0		1	0		0	0	211	0		0.963613	0	0	0	0	1	0	6	675
IGF2R	3482	broad.mit.edu	37	6	160501166	160501166	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr6:160501166G>A	ENST00000356956.1	+	39	5840	c.5692G>A	c.(5692-5694)Gat>Aat	p.D1898N		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1898	Fibronectin type-II. {ECO:0000255|PROSITE-ProRule:PRU00479}.				insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TCCAGAAACCGATGACGGCGT	0.532																																						ENST00000356956.1	1.000000	8.400000e-01	1	9.100000e-01	0.980000	0.966331	0.980000	1.000000																										0				95						c.(5692-5694)Gat>Aat		insulin-like growth factor 2 receptor	Mecasermin(DB01277)						155.0	142.0	146.0					6																	160501166		2203	4300	6503	SO:0001583	missense	3482	1	121412	35				g.chr6:160501166G>A	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.5692G>A	chr6.hg19:g.160501166G>A	ENSP00000349437:p.Asp1898Asn	0						p.D1898N	NM_000876.2	NP_000867	1	2	3	1.810553	P11717	MPRI_HUMAN		39	5840	+		Breast(66;0.000777)|Ovarian(120;0.0305)	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	1	1	hg19	c.5692G>A	CCDS5273.1	1	.	.	.	.	.	.	.	.	.	.	G	13.28	2.190890	0.38707	.	.	ENSG00000197081	ENST00000356956	T	0.42131	0.98	5.5	4.64	0.57946	5.5	4.64	0.57946	Mannose-6-phosphate receptor, binding (1);Fibronectin, type II, collagen-binding (3);Kringle-like fold (1);	0.753844	0.13297	N	0.398503	T	0.21145	0.0509	L	0.54323	1.7	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.14671	-1.0464	10	0.31617	T	0.26	-21.8803	12.8987	0.58113	0.0752:0.0:0.9248:0.0	.	1898	P11717	MPRI_HUMAN	N	1898	ENSP00000349437:D1898N	ENSP00000349437:D1898N	D	+	1	0	0	IGF2R	160421156	160421156	0.963000	0.33076	0.009000	0.14445	0.005000	0.04900	4.116000	0.57871	1.459000	0.47892	0.655000	0.94253	GAT	0.541239		TCGA-2J-AAB6-01A-11D-A40W-08	0.532	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	1	0	1		2	2	2	0		0	0	147		147	144	1	2.400000	-20.000000	1	0.540000	NM_000876			119	117		326	319	1		1	1		0	0	147	0		1.000000	9.999999e-01	0	20	0	46	0	119	326
PKD1L1	168507	broad.mit.edu	37	7	47970835	47970835	+	Silent	SNP	C	C	T	rs141425680		TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr7:47970835C>T	ENST00000289672.2	-	6	653	c.603G>A	c.(601-603)gcG>gcA	p.A201A		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	201					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CCACATCCTCCGCACAGCACA	0.607													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18733	0.0		0.0	False		,,,				2504	0.0					ENST00000289672.2	0.900000	5.400000e-01	8.200000e-01	6.200000e-01	0.710000	0.723363	0.710000	0.720000																									BBS9/PKD1L1(2)	0				142						c.(601-603)gcG>gcA		polycystic kidney disease 1 like 1		C		1,4405	2.1+/-5.4	0,1,2202	67.0	68.0	68.0		603	0.9	0.0	7	dbSNP_134	68	0,8600		0,0,4300	no	coding-synonymous	PKD1L1	NM_138295.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		201/2850	47970835	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	168507	16	121412	43				g.chr7:47970835C>T	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.603G>A	chr7.hg19:g.47970835C>T		1						p.A201A	NM_138295.3	NP_612152.1	1	2	3	2.303293	Q8TDX9	PK1L1_HUMAN		6	653	-			Q6UWK1	Silent	SNP	ENST00000289672.2	1	1	hg19	c.603G>A	CCDS34633.1	0																																																																																								0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.607	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	1	0	1		2	2	2	0		0	0	49		49	48	1	2.400000	-2.480665	0	0.540000	NM_138295			48	47		268	258	0		1			0	0	49	0		1.000000	0	0	0	0	0	0	48	268
SEMA3A	10371	broad.mit.edu	37	7	83764207	83764207	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr7:83764207T>C	ENST00000265362.4	-	2	487	c.173A>G	c.(172-174)cAt>cGt	p.H58R	SEMA3A_ENST00000436949.1_Missense_Mutation_p.H58R	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	58	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						AAGGAAGGTATGATAACTGGA	0.388																																						ENST00000265362.4	1.000000	9.900000e-01	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				53						c.(172-174)cAt>cGt		sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A							114.0	106.0	109.0					7																	83764207		2203	4300	6503	SO:0001583	missense	10371	0	0					g.chr7:83764207T>C	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.173A>G	chr7.hg19:g.83764207T>C	ENSP00000265362:p.His58Arg	1					SEMA3A_ENST00000436949.1_Missense_Mutation_p.H58R	p.H58R	NM_006080.2	NP_006071.1	1	2	3	2.280472	Q14563	SEM3A_HUMAN		2	487	-				Missense_Mutation	SNP	ENST00000265362.4	1	1	hg19	c.173A>G	CCDS5599.1	1	.	.	.	.	.	.	.	.	.	.	t	6.858	0.527583	0.13127	.	.	ENSG00000075213	ENST00000265362;ENST00000436949;ENST00000420047	T;T;T	0.20332	2.08;2.08;2.08	4.93	4.93	0.64822	4.93	4.93	0.64822	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.251915	0.47455	D	0.000223	T	0.12178	0.0296	N	0.12422	0.21	0.58432	D	0.999995	B	0.24132	0.098	B	0.31191	0.125	T	0.04537	-1.0944	10	0.02654	T	1	.	14.8712	0.70459	0.0:0.0:0.0:1.0	.	58	Q14563	SEM3A_HUMAN	R	58	ENSP00000265362:H58R;ENSP00000415260:H58R;ENSP00000391900:H58R	ENSP00000265362:H58R	H	-	2	0	0	SEMA3A	83602143	83602143	1.000000	0.71417	0.992000	0.48379	0.987000	0.75469	7.596000	0.82721	1.970000	0.57323	0.383000	0.25322	CAT	0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.388	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	1	0	1		2	2	2	0		0	0	79		79	78	1	2.400000	-20.000000	1	0.540000	NM_006080			144	143		183	182	1		1	1		0	0	79	0		1.000000	9.998715e-01	0	6	0	15	0	144	183
ZSCAN21	7589	broad.mit.edu	37	7	99654807	99654807	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr7:99654807C>T	ENST00000292450.4	+	2	342	c.178C>T	c.(178-180)Cga>Tga	p.R60*	ZSCAN21_ENST00000543588.1_Nonsense_Mutation_p.R60*|ZSCAN21_ENST00000477297.1_3'UTR|ZSCAN21_ENST00000456748.2_Nonsense_Mutation_p.R60*	NM_145914.2	NP_666019.1	Q9Y5A6	ZSC21_HUMAN	zinc finger and SCAN domain containing 21	60	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|skin(1)	21	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			CCCTGGACCCCGAGAGGCCCT	0.577																																						ENST00000292450.4	1.000000	9.800000e-01	1	9.900000e-01	0.990000	0.998908	0.990000	1.000000																										0				21						c.(178-180)Cga>Tga		zinc finger and SCAN domain containing 21							67.0	69.0	68.0					7																	99654807		2203	4300	6503	SO:0001587	stop_gained	7589	2	121412	36				g.chr7:99654807C>T	AL136865	CCDS5681.1	7q11.1	2013-01-08	2006-10-06	2006-10-06	ENSG00000166529	ENSG00000166529		"""-"", ""Zinc fingers, C2H2-type"""	13104	protein-coding gene	gene with protein product		601261	"""zinc finger protein 38 (KOX 25)"", ""zinc finger protein 38"""	ZNF38		2288909, 2014798	Standard	NM_145914		Approved	DKFZp434L134, NY-REN-21, Zipro1	uc003uso.3	Q9Y5A6	OTTHUMG00000154583	ENST00000292450.4:c.178C>T	chr7.hg19:g.99654807C>T	ENSP00000292450:p.Arg60*	1					ZSCAN21_ENST00000543588.1_Nonsense_Mutation_p.R60*|ZSCAN21_ENST00000456748.2_Nonsense_Mutation_p.R60*|ZSCAN21_ENST00000477297.1_3'UTR	p.R60*	NM_145914.2	NP_666019.1	1	2	3	2.280472	Q9Y5A6	ZSC21_HUMAN	STAD - Stomach adenocarcinoma(171;0.129)	2	342	+	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		A4D2A6|D6W5T9|Q9H0B5	Nonsense_Mutation	SNP	ENST00000292450.4	0	1	hg19	c.178C>T	CCDS5681.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.126050	0.94429	.	.	ENSG00000166529	ENST00000543588;ENST00000292450;ENST00000456748;ENST00000438937;ENST00000379635	.	.	.	4.91	3.06	0.35304	4.91	3.06	0.35304	.	0.000000	0.35436	N	0.003206	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.9397	0.19186	0.189:0.7149:0.0:0.0962	.	.	.	.	X	60	.	ENSP00000292450:R60X	R	+	1	2	2	ZSCAN21	99492743	99492743	0.350000	0.24878	0.968000	0.41197	0.669000	0.39330	0.544000	0.23253	0.758000	0.33059	0.655000	0.94253	CGA	0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.577	ZSCAN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336166.1	1	0	1		2	2	2	0		0	0	97		97	95	1	2.400000	-4.835991	1	0.540000	NM_145914			107	105		321	311	1		1	0		0	0	97	0		1.000000	6.996729e-01	0	1	0	8	0	107	321
ZC3HAV1	56829	broad.mit.edu	37	7	138749667	138749667	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr7:138749667G>A	ENST00000242351.5	-	8	2267	c.1951C>T	c.(1951-1953)Cca>Tca	p.P651S	ZC3HAV1_ENST00000471652.1_Missense_Mutation_p.P651S|ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.P773S	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	651	WWE. {ECO:0000255|PROSITE- ProRule:PRU00248}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						GCCTGAAATGGCACAACTCCC	0.453																																						ENST00000242351.5	0.120000	0	9.000000e-02	2.000000e-02	0.050000	0.061351	0.050000	0.060000																										0				37						c.(1951-1953)Cca>Tca		zinc finger CCCH-type, antiviral 1							131.0	122.0	125.0					7																	138749667		2203	4300	6503	SO:0001583	missense	56829	1	121412	30				g.chr7:138749667G>A	BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.1951C>T	chr7.hg19:g.138749667G>A	ENSP00000242351:p.Pro651Ser	1					ZC3HAV1_ENST00000471652.1_Missense_Mutation_p.P651S|ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.P773S	p.P651S	NM_020119.3	NP_064504.2	1	2	3	2.280472	Q7Z2W4	ZCCHV_HUMAN		8	2267	-			A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	ENST00000242351.5	0	1	hg19	c.1951C>T	CCDS5851.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.022|9.022	0.985173|0.985173	0.18889|0.18889	.|.	.|.	ENSG00000105939|ENSG00000105939	ENST00000460845|ENST00000242351;ENST00000464606;ENST00000471652;ENST00000540247	.|T;T;T	.|0.27402	.|1.67;1.67;1.67	4.32|4.32	1.18|1.18	0.20946|0.20946	4.32|4.32	1.18|1.18	0.20946|0.20946	.|WWE domain (1);	.|0.865061	.|0.09843	.|N	.|0.748673	T|T	0.17323|0.17323	0.0416|0.0416	N|N	0.26130|0.26130	0.795|0.795	0.09310|0.09310	N|N	1|1	.|B;B	.|0.13594	.|0.003;0.008	.|B;B	.|0.11329	.|0.004;0.006	T|T	0.32188|0.32188	-0.9916|-0.9916	5|10	.|0.16896	.|T	.|0.51	.|.	4.2286|4.2286	0.10592|0.10592	0.0932:0.1468:0.5896:0.1704|0.0932:0.1468:0.5896:0.1704	.|.	.|651;651	.|Q7Z2W4-2;Q7Z2W4	.|.;ZCCHV_HUMAN	V|S	215|651;773;651;411	.|ENSP00000242351:P651S;ENSP00000418385:P773S;ENSP00000419855:P651S	.|ENSP00000242351:P651S	A|P	-|-	2|1	0|0	0|0	ZC3HAV1|ZC3HAV1	138400207|138400207	138400207|138400207	0.001000|0.001000	0.12720|0.12720	0.027000|0.027000	0.17364|0.17364	0.001000|0.001000	0.01503|0.01503	0.409000|0.409000	0.21082|0.21082	0.536000|0.536000	0.28733|0.28733	-0.293000|-0.293000	0.09583|0.09583	GCC|CCA	0.637795		TCGA-2J-AAB6-01A-11D-A40W-08	0.453	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	0	0	1		2	2	2	0		0	0	73		73	73	1	2.400000	-2.686759	1	0.540000	NM_020119			5	5		448	440	0		1	0		0	0	73	0		0.934529	1.725222e-01	0	0	0	56	0	5	448
ZFAT	57623	broad.mit.edu	37	8	135614834	135614834	+	Silent	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr8:135614834C>T	ENST00000377838.3	-	6	1302	c.1128G>A	c.(1126-1128)gcG>gcA	p.A376A	ZFAT_ENST00000520727.1_Silent_p.A364A|ZFAT_ENST00000520356.1_Silent_p.A364A|ZFAT_ENST00000429442.2_Silent_p.A364A|ZFAT_ENST00000520214.1_Silent_p.A364A|ZFAT_ENST00000523399.1_Silent_p.A314A|ZFAT-AS1_ENST00000505776.1_RNA	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	376					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			GTGGGTCATGCGCGTCTCGGA	0.552																																						ENST00000377838.3	0.140000	2.000000e-02	1.100000e-01	4.000000e-02	0.070000	0.080058	0.070000	0.070000																										0				54						c.(1126-1128)gcG>gcA		zinc finger and AT hook domain containing							74.0	75.0	74.0					8																	135614834		2114	4240	6354	SO:0001819	synonymous_variant	57623	2	121082	34				g.chr8:135614834C>T	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.1128G>A	chr8.hg19:g.135614834C>T		0					ZFAT_ENST00000520214.1_Silent_p.A364A|ZFAT_ENST00000429442.2_Silent_p.A364A|ZFAT-AS1_ENST00000505776.1_RNA|ZFAT_ENST00000523399.1_Silent_p.A314A|ZFAT_ENST00000520356.1_Silent_p.A364A|ZFAT_ENST00000520727.1_Silent_p.A364A	p.A376A	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	0	0	0	1.766479	Q9P243	ZFAT_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0432)	6	1302	-	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Silent	SNP	ENST00000377838.3	0	1	hg19	c.1128G>A	CCDS47924.1	0																																																																																								0.529845		TCGA-2J-AAB6-01A-11D-A40W-08	0.552	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	0	0	1		2	2	2	0		0	0	104		104	104	1	2.400000	-2.114022	0	0.540000	NM_001029939			6	5		308	304	0		1	0		0	0	104	0		0.963596	0	0	0	0	1	0	6	308
NTNG2	84628	broad.mit.edu	37	9	135114577	135114577	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chr9:135114577C>T	ENST00000393229.3	+	6	1917	c.1141C>T	c.(1141-1143)Cga>Tga	p.R381*	NTNG2_ENST00000360670.3_Nonsense_Mutation_p.R387*|NTNG2_ENST00000393228.4_Nonsense_Mutation_p.R373*	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	381	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)				central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		GCACAACACGCGAGGTCAGCA	0.607																																						ENST00000393229.3	1.000000	9.900000e-01	1	9.900000e-01	0.990000	0.999413	0.990000	1.000000																										0				29						c.(1141-1143)Cga>Tga		netrin G2							86.0	67.0	74.0					9																	135114577		2203	4300	6503	SO:0001587	stop_gained	84628	0	0					g.chr9:135114577C>T	AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.1141C>T	chr9.hg19:g.135114577C>T	ENSP00000376921:p.Arg381*	1					NTNG2_ENST00000393228.4_Nonsense_Mutation_p.R373*|NTNG2_ENST00000360670.3_Nonsense_Mutation_p.R387*	p.R381*	NM_032536.2	NP_115925.2	0	2	2	1.772324	Q96CW9	NTNG2_HUMAN		6	1917	+			Q5JUJ2|Q6UXY0|Q96JH0	Nonsense_Mutation	SNP	ENST00000393229.3	0	1	hg19	c.1141C>T	CCDS6946.1	1	.	.	.	.	.	.	.	.	.	.	C	42	9.475566	0.99181	.	.	ENSG00000196358	ENST00000393229;ENST00000393228;ENST00000360670	.	.	.	4.94	3.05	0.35203	4.94	3.05	0.35203	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	12.9469	0.58376	0.2951:0.7048:0.0:0.0	.	.	.	.	X	381;373;387	.	ENSP00000353888:R387X	R	+	1	2	2	NTNG2	134104398	134104398	0.026000	0.19158	0.331000	0.25455	0.354000	0.29330	0.378000	0.20569	0.471000	0.27319	-0.310000	0.09108	CGA	0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.607	NTNG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054779.1	1	0	1		2	2	2	0		0	0	77		77	76	1	2.400000	-9.701947	1	0.540000	NM_032536			84	83		170	168	1		1	0		0	0	77	0		1.000000	2.549748e-01	0	0	0	3	0	84	170
CACNA1F	778	broad.mit.edu	37	X	49063557	49063557	+	Missense_Mutation	SNP	G	G	C			TCGA-2J-AAB6-01A-11D-A40W-08	TCGA-2J-AAB6-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	095c6a38-144a-466c-8d4f-f8a49a0f4741	d7a2fe3d-4d0f-468c-ae43-8c6ae58b2b7b	g.chrX:49063557G>C	ENST00000376265.2	-	44	5234	c.5173C>G	c.(5173-5175)Ctc>Gtc	p.L1725V	CACNA1F_ENST00000323022.5_Missense_Mutation_p.L1714V|CACNA1F_ENST00000376251.1_Missense_Mutation_p.L1660V	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1725					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GTGAAAATGAGAGCCCCAGAG	0.547																																						ENST00000376265.2	1.000000	7.400000e-01	9.900000e-01	8.600000e-01	0.940000	0.928455	0.940000	0.990000																										0				85						c.(5173-5175)Ctc>Gtc		calcium channel, voltage-dependent, L type, alpha 1F subunit	Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)						114.0	79.0	91.0					X																	49063557		2201	4296	6497	SO:0001583	missense	778	0	0					g.chrX:49063557G>C	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.5173C>G	chrX.hg19:g.49063557G>C	ENSP00000365441:p.Leu1725Val						CACNA1F_ENST00000323022.5_Missense_Mutation_p.L1714V|CACNA1F_ENST00000376251.1_Missense_Mutation_p.L1660V	p.L1725V	NM_005183.2	NP_005174.2	0	1	1		O60840	CAC1F_HUMAN		44	5234	-			A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	ENST00000376265.2	0	1	hg19	c.5173C>G	CCDS35253.1	1	.	.	.	.	.	.	.	.	.	.	G	2.789	-0.251861	0.05829	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.96265	-3.96;-3.88;-3.88	3.97	-0.788	0.10939	3.97	-0.788	0.10939	.	16.143700	0.00166	N	0.000000	D	0.89795	0.6818	N	0.08118	0	0.09310	N	1	B;B	0.21905	0.062;0.001	B;B	0.22152	0.038;0.001	D	0.83992	0.0338	10	0.15499	T	0.54	.	7.2841	0.26328	0.4927:0.0:0.5073:0.0	.	1714;1725	F5CIQ9;O60840	.;CAC1F_HUMAN	V	1660;1714;1725	ENSP00000365427:L1660V;ENSP00000321618:L1714V;ENSP00000365441:L1725V	ENSP00000321618:L1714V	L	-	1	0	0	CACNA1F	48950501	48950501	0.029000	0.19370	0.052000	0.19188	0.992000	0.81027	-0.100000	0.10990	-0.292000	0.08999	0.529000	0.55759	CTC	0.540000		TCGA-2J-AAB6-01A-11D-A40W-08	0.547	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	1	0	1		2	2	2	0		0	0	9		9	9	1	2.400000	-20.000000	1	0.540000	NM_005183			16	16		5	5	0		1			0	0	9	0		0.999999	0	0	0	0	0	0	16	5
