#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
PMEPA1	56937	broad.mit.edu	37	20	56227291	56227309	+	Frame_Shift_Del	DEL	GCCCCTCCATGCGCCCGCC	GCCCCTCCATGCGCCCGCC	-	rs561316732|rs551031813		TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08			GCCCCTCCATGCGCCCGCC	-	GCCCCTCCATGCGCCCGCC	GCCCCTCCATGCGCCCGCC		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr20:56227291_56227309delGCCCCTCCATGCGCCCGCC	ENST00000341744.3	-	4	983_1001	c.664_682delGGCGGGCGCATGGAGGGGC	c.(664-684)ggcgggcgcatggaggggccgfs	p.GGRMEGP222fs	PMEPA1_ENST00000265626.4_Frame_Shift_Del_p.GGRMEGP172fs|PMEPA1_ENST00000347215.4_Frame_Shift_Del_p.GGRMEGP187fs|PMEPA1_ENST00000395816.3_Frame_Shift_Del_p.GGRMEGP172fs|PMEPA1_ENST00000395814.1_Frame_Shift_Del_p.GGRMEGP172fs	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	222					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						GTGGGCGGCGGCCCCTCCATGCGCCCGCCGCTGCCGTAG	0.694																																						ENST00000341744.3	0.850000	2.900000e-01	0.700000	0.400000	0.530000	0.556949	0.530000	0.520000																										0				16						c.(664-684)ggcgggcgcatggaggggccgfs		prostate transmembrane protein, androgen induced 1																																				SO:0001589	frameshift_variant	56937	0	0					g.chr20:56227291_56227309delGCCCCTCCATGCGCCCGCC	AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.664_682delGGCGGGCGCATGGAGGGGC	chr20.hg19:g.56227291_56227309delGCCCCTCCATGCGCCCGCC	ENSP00000345826:p.Gly222fs	0					PMEPA1_ENST00000395814.1_Frame_Shift_Del_p.GGRMEGP172fs|PMEPA1_ENST00000347215.4_Frame_Shift_Del_p.GGRMEGP187fs|PMEPA1_ENST00000265626.4_Frame_Shift_Del_p.GGRMEGP172fs|PMEPA1_ENST00000395816.3_Frame_Shift_Del_p.GGRMEGP172fs	p.GGRMEGP222fs	NM_020182.4	NP_064567.2	0	1	1	2.057827	Q969W9	PMEPA_HUMAN		4	983_1001	-			Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Frame_Shift_Del	DEL	ENST00000341744.3	0	1	hg19	c.664_682delGGCGGGCGCATGGAGGGGC	CCDS13463.1	0																																																																																								0.338876		TCGA-2J-AABA-01A-21D-A40W-08	0.694	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079858.2	1	0	1		2	2		0		0	0	36		36	34	1	1.830000	-18.219060	1	0.340000	NM_020182			12	18		121	118	0		1	0	0	0	0	36	0		0.999358	9.999954e-01	0	0	0	265	0	12	121
GTF3C3	9330	broad.mit.edu	37	2	197636516	197636516	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr2:197636516delT	ENST00000263956.3	-	15	2305	c.2216delA	c.(2215-2217)aatfs	p.N739fs		NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	739					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						ATTGTGTCCATTTAAGACACA	0.428																																						ENST00000263956.3	1.000000	5.800000e-01	0.920000	0.680000	0.790000	0.805588	0.790000	1.000000																										0				33						c.(2215-2217)aatfs		general transcription factor IIIC, polypeptide 3, 102kDa							153.0	135.0	141.0					2																	197636516		2203	4300	6503	SO:0001589	frameshift_variant	9330	0	0					g.chr2:197636516delT	AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.2216delA	chr2.hg19:g.197636516delT	ENSP00000263956:p.Asn739fs	0						p.N739fs	NM_012086.4	NP_036218.1	0	1	1	2.053808	Q9Y5Q9	TF3C3_HUMAN		15	2305	-			Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Frame_Shift_Del	DEL	ENST00000263956.3	1	0	hg19	c.2216delA	CCDS2316.1	0																																																																																								0.338876		TCGA-2J-AABA-01A-21D-A40W-08	0.428	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256104.1	1	0	1		2	2		0		0	0	67		67	67	1	1.830000	-20.000000	1	0.340000				41	44		260	257	0		1	0	0	0	0	67	0		1.000000	7.994480e-01	0	1	0	20	0	41	260
APOB	338	broad.mit.edu	37	2	21225066	21225069	+	Frame_Shift_Del	DEL	GACT	GACT	-			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr2:21225066_21225069delGACT	ENST00000233242.1	-	29	13352_13355	c.13225_13228delAGTC	c.(13225-13230)agtctgfs	p.SL4409fs	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4409					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCTTGATCAGACTGACTATCTTT	0.373																																						ENST00000233242.1	0.860000	4.700000e-01	0.760000	0.550000	0.650000	0.662996	0.650000	0.650000																										0				305						c.(13225-13230)agtctgfs		apolipoprotein B																																				SO:0001589	frameshift_variant	338	0	0					g.chr2:21225066_21225069delGACT	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.13225_13228delAGTC	chr2.hg19:g.21225070_21225073delGACT	ENSP00000233242:p.Ser4409fs	0					RP11-116D2.1_ENST00000567376.2_lincRNA	p.SL4409fs	NM_000384.2	NP_000375	0	0	0	2.048860	P04114	APOB_HUMAN		29	13352_13355	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Del	DEL	ENST00000233242.1	1	0	hg19	c.13225_13228delAGTC	CCDS1703.1	0																																																																																								0.337748		TCGA-2J-AABA-01A-21D-A40W-08	0.373	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1	1	0	0		31	2		0		0	3	64		64	63	1	1.830000	-14.282990	1	0.340000				37	51		295	304	0		1	0	0	0	0	64	0		0.879521	2.296132e-01	0	0	0	8	0	37	295
MLLT4	4301	broad.mit.edu	37	6	168299092	168299092	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr6:168299092delG	ENST00000447894.2	+	11	1525	c.1525delG	c.(1525-1527)gcafs	p.A509fs	MLLT4_ENST00000366806.2_Frame_Shift_Del_p.A509fs|MLLT4_ENST00000392112.1_Frame_Shift_Del_p.A493fs|MLLT4_ENST00000351017.4_Frame_Shift_Del_p.A509fs|MLLT4_ENST00000400822.3_Frame_Shift_Del_p.A508fs|MLLT4_ENST00000344191.4_Frame_Shift_Del_p.A509fs|MLLT4_ENST00000392108.3_Frame_Shift_Del_p.A509fs			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	509					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TCATGCTCTTGCAAAAAGATC	0.438			T	MLL	AL																																	ENST00000447894.2	0.760000	3.700000e-01	0.660000	0.450000	0.550000	0.564640	0.550000	0.550000				Dom	yes			Dom	yes		6	6q27	6q27	4301	T	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""				L	L	MLL		AL		0				65						c.(1525-1527)gcafs		myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4							63.0	57.0	59.0					6																	168299092		2203	4300	6503	SO:0001589	frameshift_variant	4301	0	0					g.chr6:168299092delG	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.1525delG	chr6.hg19:g.168299092delG	ENSP00000404595:p.Ala509fs	1					MLLT4_ENST00000392108.3_Frame_Shift_Del_p.A509fs|MLLT4_ENST00000351017.4_Frame_Shift_Del_p.A509fs|MLLT4_ENST00000392112.1_Frame_Shift_Del_p.A493fs|MLLT4_ENST00000344191.4_Frame_Shift_Del_p.A509fs|MLLT4_ENST00000400822.3_Frame_Shift_Del_p.A508fs|MLLT4_ENST00000366806.2_Frame_Shift_Del_p.A509fs	p.A509fs			0	1	1	1.739085	P55196	AFAD_HUMAN		11	1525	+		Breast(66;1.07e-05)|Ovarian(120;0.024)	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Frame_Shift_Del	DEL	ENST00000447894.2	0	1	hg19	c.1525delG		0																																																																																								0.206445		TCGA-2J-AABA-01A-21D-A40W-08	0.438	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	1	0	1		2	2		0		0	0	56		56	55	1	1.830000	-20.000000	1	0.340000	NM_005936			26	27		202	200	0		1	0	0	0	0	56	0		1.000000	7.183328e-02	0	1	0	3	0	26	202
NEBL	10529	broad.mit.edu	37	10	21158753	21158753	+	Silent	SNP	G	G	A	rs371105861		TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr10:21158753G>A	ENST00000377122.4	-	6	894	c.498C>T	c.(496-498)gaC>gaT	p.D166D	NEBL_ENST00000417816.2_Intron|NEBL_ENST00000377159.4_Intron|NEBL_ENST00000377119.1_Silent_p.D166D	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	166					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TGTCCTGCACGTCTTTCCTAT	0.358																																						ENST00000377122.4	1.000000	7.300000e-01	0.970000	0.810000	0.900000	0.895666	0.900000	0.940000																										0				70						c.(496-498)gaC>gaT		nebulette		G	,,	0,4406		0,0,2203	173.0	147.0	155.0		,498,	2.2	0.5	10		155	1,8599	1.2+/-3.3	0,1,4299	no	intron,coding-synonymous,intron	NEBL	NM_001173484.1,NM_006393.2,NM_213569.2	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	,166/1015,	21158753	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10529	6	121400	41				g.chr10:21158753G>A	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.498C>T	chr10.hg19:g.21158753G>A		1					NEBL_ENST00000417816.2_Intron|NEBL_ENST00000377159.4_Intron|NEBL_ENST00000377119.1_Silent_p.D166D	p.D166D	NM_006393.2	NP_006384.1	0	1	1	1.772244	O76041	NEBL_HUMAN		6	894	-			B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Silent	SNP	ENST00000377122.4	1	1	hg19	c.498C>T	CCDS7134.1	1																																																																																								0.204819		TCGA-2J-AABA-01A-21D-A40W-08	0.358	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1	1	0	1		2	2	2	0		0	0	83		83	82	1	1.830000	-20.000000	1	0.340000	NM_006393			62	61		256	252	0		1			0	0	83	0		1.000000	0	0	0	0	0	0	62	256
MUC2	4583	broad.mit.edu	37	11	1092201	1092201	+	Silent	SNP	G	G	A			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr11:1092201G>A	ENST00000441003.2	+	30	4047	c.4020G>A	c.(4018-4020)tcG>tcA	p.S1340S	MUC2_ENST00000359061.5_Silent_p.S1341S|MUC2_ENST00000361558.6_Silent_p.S6S|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	1340					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	AGTGCAGGTCGGTCAAGGATC	0.557																																						ENST00000441003.2	1.000000	5.700000e-01	1.000000	0.720000	0.900000	0.877461	0.900000	1.000000																										0				102						c.(4018-4020)tcG>tcA		mucin 2, oligomeric mucus/gel-forming	Pranlukast(DB01411)						110.0	118.0	116.0					11																	1092201		2152	4239	6391	SO:0001819	synonymous_variant	4583	0	0					g.chr11:1092201G>A	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4020G>A	chr11.hg19:g.1092201G>A		0					MUC2_ENST00000359061.5_Silent_p.S1341S|MUC2_ENST00000361558.6_Silent_p.S6S|MUC2_ENST00000333592.6_5'Flank	p.S1340S	NM_002457.2	NP_002448.2	1	2	3	2.064705	Q02817	MUC2_HUMAN		30	4047	+		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)	Q14878	Silent	SNP	ENST00000441003.2	1	1	hg19	c.4020G>A		1																																																																																								0.341120		TCGA-2J-AABA-01A-21D-A40W-08	0.557	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	1	0	1		2	2	2	0		0	0	21		21	20	1	1.830000	-12.141570	1	0.340000	NM_002457			19	19		105	103	1		1			0	0	21	0		0.999994	0	0	0	0	0	0	19	105
ACCS	84680	broad.mit.edu	37	11	44089316	44089316	+	Missense_Mutation	SNP	C	C	G			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr11:44089316C>G	ENST00000263776.8	+	2	573	c.139C>G	c.(139-141)Ctc>Gtc	p.L47V	ACCS_ENST00000432284.2_Missense_Mutation_p.L47V|ACCS_ENST00000533208.1_3'UTR	NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	47					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						GCTGCCAGAGCTCCGTGGAGT	0.552																																					Esophageal Squamous(158;148 1889 8077 23160 41213)	ENST00000263776.8	1.000000	6.100000e-01	1.000000	0.720000	0.850000	0.853770	0.850000	1.000000																										0				35						c.(139-141)Ctc>Gtc		1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)							91.0	90.0	91.0					11																	44089316		2203	4300	6503	SO:0001583	missense	84680	0	0					g.chr11:44089316C>G	AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.139C>G	chr11.hg19:g.44089316C>G	ENSP00000263776:p.Leu47Val	0					ACCS_ENST00000432284.2_Missense_Mutation_p.L47V|ACCS_ENST00000533208.1_3'UTR	p.L47V	NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	1	2	3	2.064705	Q96QU6	1A1L1_HUMAN		2	573	+			B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	ENST00000263776.8	1	1	hg19	c.139C>G	CCDS7907.1	1	.	.	.	.	.	.	.	.	.	.	C	2.726	-0.265394	0.05754	.	.	ENSG00000110455	ENST00000524990;ENST00000263776;ENST00000432284;ENST00000533404	T;T;T;T	0.60548	1.21;0.18;1.21;0.82	4.94	-0.726	0.11170	4.94	-0.726	0.11170	.	1.197120	0.05715	N	0.596590	T	0.44095	0.1277	L	0.40543	1.245	0.09310	N	1	B;B	0.32829	0.386;0.099	B;B	0.34242	0.178;0.027	T	0.33727	-0.9857	10	0.38643	T	0.18	-1.6262	1.7604	0.02991	0.1416:0.4323:0.1391:0.287	.	47;47	B4E219;Q96QU6	.;1A1L1_HUMAN	V	47	ENSP00000434156:L47V;ENSP00000263776:L47V;ENSP00000391775:L47V;ENSP00000435919:L47V	ENSP00000263776:L47V	L	+	1	0	0	ACCS	44045892	44045892	0.000000	0.05858	0.001000	0.08648	0.101000	0.19017	-1.526000	0.02229	-0.001000	0.14495	0.655000	0.94253	CTC	0.341120		TCGA-2J-AABA-01A-21D-A40W-08	0.552	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389721.1	1	0	1		2	2	2	0		0	0	38		38	38	1	1.830000	-20.000000	1	0.340000	NM_032592			35	35		206	205	1		1	0		0	0	38	0		1.000000	4.463793e-01	0	1	0	9	0	35	206
STT3A	3703	broad.mit.edu	37	11	125476284	125476284	+	Missense_Mutation	SNP	G	G	A	rs188651061		TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr11:125476284G>A	ENST00000529196.1	+	9	910	c.704G>A	c.(703-705)cGg>cAg	p.R235Q	STT3A_ENST00000531491.1_Missense_Mutation_p.R143Q|STT3A_ENST00000392708.4_Missense_Mutation_p.R235Q			P46977	STT3A_HUMAN	STT3A, subunit of the oligosaccharyltransferase complex (catalytic)	235					cellular protein metabolic process (GO:0044267)|co-translational protein modification (GO:0043686)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			NS(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	33	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		TTCTCTCACCGGATCTATGTG	0.493													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17546	0.0		0.0	False		,,,				2504	0.0					ENST00000529196.1	0.120000	2.000000e-02	0.090000	0.030000	0.060000	0.070568	0.060000	0.060000																										0				33						c.(703-705)cGg>cAg		STT3A, subunit of the oligosaccharyltransferase complex (catalytic)							346.0	296.0	313.0					11																	125476284		2201	4299	6500	SO:0001583	missense	3703	2	121412	39				g.chr11:125476284G>A	BC020965	CCDS8458.1, CCDS60998.1	11q23.3	2013-03-06	2013-03-06	2006-02-07	ENSG00000134910	ENSG00000134910	2.4.99.18		6172	protein-coding gene	gene with protein product	"""dolichyl-diphosphooligosaccharide protein glycotransferase"""	601134	"""integral membrane protein 1"", ""STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)"", ""STT3A, cataylic subunit of the oligosaccharyltransferase complex"""	ITM1		8941377, 8634329, 10234787	Standard	NM_152713		Approved	TMC, MGC9042, STT3-A	uc001qcd.2	P46977	OTTHUMG00000165852	ENST00000529196.1:c.704G>A	chr11.hg19:g.125476284G>A	ENSP00000436962:p.Arg235Gln	0					STT3A_ENST00000392708.4_Missense_Mutation_p.R235Q|STT3A_ENST00000531491.1_Missense_Mutation_p.R143Q	p.R235Q			0	1	1	2.057508	P46977	STT3A_HUMAN		9	910	+	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)	B4DJ24|E9PNQ1|Q86XU9|Q8TE35|Q8WUB4	Missense_Mutation	SNP	ENST00000529196.1	0	1	hg19	c.704G>A	CCDS8458.1	0	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	37	6.154801	0.97329	.	.	ENSG00000134910	ENST00000392708;ENST00000529196;ENST00000531491	.	.	.	6.03	6.03	0.97812	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.85243	0.5652	M	0.88775	2.98	0.80722	D	1	D;D;D	0.76494	0.995;0.999;0.999	P;D;D	0.68765	0.74;0.96;0.96	D	0.86443	0.1768	9	0.66056	D	0.02	-15.5244	20.177	0.98182	0.0:0.0:1.0:0.0	.	143;143;235	B4DJ24;E9PNQ1;P46977	.;.;STT3A_HUMAN	Q	235;235;143	.	ENSP00000376472:R235Q	R	+	2	0	0	STT3A	124981494	124981494	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	7.912000	0.87465	2.854000	0.98071	0.655000	0.94253	CGG	0.338876		TCGA-2J-AABA-01A-21D-A40W-08	0.493	STT3A-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386691.1	0	0	1		2	2	2	0		0	0	185		185	177	1	1.830000	-1.947696	0	0.340000	NM_152713			7	7		655	650	0		1	0		0	0	185	0		0.980255	5.101609e-01	0	0	0	148	0	7	655
PAWR	5074	broad.mit.edu	37	12	79990331	79990331	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr12:79990331G>A	ENST00000328827.4	-	5	1163	c.791C>T	c.(790-792)tCa>tTa	p.S264L		NM_002583.2	NP_002574.2	Q96IZ0	PAWR_HUMAN	PRKC, apoptosis, WT1, regulator	264					actin filament bundle assembly (GO:0051017)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|interleukin-2 biosynthetic process (GO:0042094)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|positive regulation of apoptotic process (GO:0043065)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|enzyme binding (GO:0019899)|leucine zipper domain binding (GO:0043522)|transcription corepressor activity (GO:0003714)			NS(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						TGTGCTACTTGAAACCAGAGT	0.323																																						ENST00000328827.4	1.000000	6.700000e-01	1.000000	0.770000	0.890000	0.887011	0.890000	1.000000																										0				8						c.(790-792)tCa>tTa		PRKC, apoptosis, WT1, regulator							104.0	103.0	103.0					12																	79990331		2203	4300	6503	SO:0001583	missense	5074	0	0					g.chr12:79990331G>A	U63809	CCDS31863.1	12q21.2	2013-03-07			ENSG00000177425	ENSG00000177425			8614	protein-coding gene	gene with protein product	"""prostate apoptosis response-4"""	601936				8943350, 9790775	Standard	NM_002583		Approved	par-4, PAR4	uc001syx.3	Q96IZ0	OTTHUMG00000170080	ENST00000328827.4:c.791C>T	chr12.hg19:g.79990331G>A	ENSP00000328088:p.Ser264Leu	0						p.S264L	NM_002583.2	NP_002574.2	0	0	0	2.005386	Q96IZ0	PAWR_HUMAN		5	1163	-			O75796|Q6FHY9|Q8N700	Missense_Mutation	SNP	ENST00000328827.4	1	1	hg19	c.791C>T	CCDS31863.1	1	.	.	.	.	.	.	.	.	.	.	G	15.10	2.732142	0.48939	.	.	ENSG00000177425	ENST00000328827	T	0.17370	2.28	5.21	5.21	0.72293	5.21	5.21	0.72293	.	0.977772	0.08368	N	0.956530	T	0.17450	0.0419	L	0.29908	0.895	0.32789	N	0.501387	P	0.36535	0.557	B	0.39258	0.295	T	0.07481	-1.0770	9	.	.	.	-0.0939	13.6695	0.62416	0.0:0.0:0.8453:0.1547	.	264	Q96IZ0	PAWR_HUMAN	L	264	ENSP00000328088:S264L	.	S	-	2	0	0	PAWR	78514462	78514462	1.000000	0.71417	0.985000	0.45067	0.148000	0.21650	4.049000	0.57397	2.601000	0.87937	0.585000	0.79938	TCA	0.321546		TCGA-2J-AABA-01A-21D-A40W-08	0.323	PAWR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407175.1	1	0	1		2	2	2	0		0	0	87		87	83	1	1.830000	-3.234357	1	0.340000	NM_002583			48	47		259	254	1		1	1		0	0	87	0		1.000000	9.994344e-01	0	19	0	44	0	48	259
SLITRK5	26050	broad.mit.edu	37	13	88329453	88329453	+	Missense_Mutation	SNP	C	C	T	rs371327441		TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr13:88329453C>T	ENST00000325089.6	+	2	2029	c.1810C>T	c.(1810-1812)Cgc>Tgc	p.R604C	SLITRK5_ENST00000400028.3_Missense_Mutation_p.R363C	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	604	LRRCT 2.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.R604C(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GACCGACATGCGCTCCATTAA	0.567																																						ENST00000325089.6	1.000000	0	0.070000	0.020000	0.040000	0.092934	0.040000	0.040000																										1	Substitution - Missense(1)	p.R604C(1)	prostate(1)	81						c.(1810-1812)Cgc>Tgc		SLIT and NTRK-like family, member 5		C	CYS/ARG	0,4406		0,0,2203	165.0	150.0	155.0		1810	4.5	1.0	13		155	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLITRK5	NM_015567.1	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	604/959	88329453	1,13005	2203	4300	6503	SO:0001583	missense	26050	1	121412	37				g.chr13:88329453C>T	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1810C>T	chr13.hg19:g.88329453C>T	ENSP00000366283:p.Arg604Cys	0					SLITRK5_ENST00000400028.3_Missense_Mutation_p.R363C	p.R604C	NM_015567.1	NP_056382.1	1	2	3	2.094580	O94991	SLIK5_HUMAN		2	2029	+	all_neural(89;0.101)|Medulloblastoma(90;0.163)		B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	0	1	hg19	c.1810C>T	CCDS9465.1	0	.	.	.	.	.	.	.	.	.	.	C	16.04	3.011439	0.54468	0.0	1.16E-4	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.61158	0.13;0.49	5.47	4.54	0.55810	5.47	4.54	0.55810	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.78033	0.4220	M	0.87971	2.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.987;0.993	T	0.81450	-0.0927	9	.	.	.	-15.1954	14.535	0.67953	0.1566:0.8434:0.0:0.0	.	363;604	B4DSH5;O94991	.;SLIK5_HUMAN	C	604;363	ENSP00000366283:R604C;ENSP00000442244:R363C	.	R	+	1	0	0	SLITRK5	87127454	87127454	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	3.167000	0.50793	2.554000	0.86153	0.555000	0.69702	CGC	0.346664		TCGA-2J-AABA-01A-21D-A40W-08	0.567	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3	0	0	1		2	2	2	0		0	0	165		165	158	1	1.830000	-1.757131	0	0.340000				6	7		851	833	0		1	0		0	0	165	0		0.962799	2.253067e-04	0	0	0	3	0	6	851
PARP6	56965	broad.mit.edu	37	15	72557486	72557486	+	Silent	SNP	G	G	A			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr15:72557486G>A	ENST00000569795.1	-	7	951	c.264C>T	c.(262-264)gtC>gtT	p.V88V	PARP6_ENST00000413097.2_5'UTR|PARP6_ENST00000287196.9_Silent_p.V88V|PARP6_ENST00000260376.7_Silent_p.V88V			Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6	88							NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	18						CTGTCCGGAGGACCTTCCAGG	0.473																																						ENST00000569795.1	0.630000	1.200000e-01	0.450000	0.200000	0.300000	0.332014	0.300000	0.290000																										0				18						c.(262-264)gtC>gtT		poly (ADP-ribose) polymerase family, member 6							53.0	54.0	53.0					15																	72557486		1909	4133	6042	SO:0001819	synonymous_variant	56965	0	0					g.chr15:72557486G>A	AL390093	CCDS10241.2	15q22	2010-02-16			ENSG00000137817	ENSG00000137817		"""Poly (ADP-ribose) polymerases"""	26921	protein-coding gene	gene with protein product						15273990	Standard	XM_005254557		Approved	pART17	uc002auc.3	Q2NL67	OTTHUMG00000133443	ENST00000569795.1:c.264C>T	chr15.hg19:g.72557486G>A		0					PARP6_ENST00000287196.9_Silent_p.V88V|PARP6_ENST00000413097.2_5'UTR|PARP6_ENST00000260376.7_Silent_p.V88V	p.V88V			1	2	3	2.068233	Q2NL67	PARP6_HUMAN		7	951	-			Q9H7C5|Q9H9X6|Q9HAF3|Q9NPS6|Q9UFG4	Silent	SNP	ENST00000569795.1	0	1	hg19	c.264C>T	CCDS10241.2	0																																																																																								0.342236		TCGA-2J-AABA-01A-21D-A40W-08	0.473	PARP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257315.2	1	0	1		2	2	2	0		0	0	21		21	20	1	1.830000	-9.388886	1	0.340000	NM_020214			6	6		117	114	1		1	1		0	0	21	0		0.963480	6.979104e-01	0	9	0	38	0	6	117
NF1	4763	broad.mit.edu	37	17	29559101	29559101	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr17:29559101C>T	ENST00000358273.4	+	25	3591	c.3208C>T	c.(3208-3210)Cag>Tag	p.Q1070*	NF1_ENST00000356175.3_Nonsense_Mutation_p.Q1070*	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1070					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AGATTTGGACCAGGCAAGCAT	0.373			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												ENST00000358273.4	0.990000	4.700000e-01	0.930000	0.630000	0.790000	0.784012	0.790000	0.860000			yes	Rec	yes	Neurofibromatosis type 1	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	17q12	4763	D, Mis, N, F, S, O	neurofibromatosis type 1 gene				O	O		neurofibroma, glioma	neurofibroma, glioma	NF1/ACCN1(2)	12	Whole gene deletion(8)|Unknown(4)	p.0?(8)|p.?(4)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	599						c.(3208-3210)Cag>Tag		neurofibromin 1							32.0	30.0	31.0					17																	29559101		2203	4297	6500	SO:0001587	stop_gained	4763	0	0		Neurofibromatosis, type 1	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	g.chr17:29559101C>T		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.3208C>T	chr17.hg19:g.29559101C>T	ENSP00000351015:p.Gln1070*	1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)				NF1_ENST00000356175.3_Nonsense_Mutation_p.Q1070*	p.Q1070*	NM_001042492.2	NP_001035957.1	0	1	1	1.721658	P21359	NF1_HUMAN		25	3591	+		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)	O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	ENST00000358273.4	0	1	hg19	c.3208C>T	CCDS42292.1	0	.	.	.	.	.	.	.	.	.	.	C	46	12.239175	0.99649	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.35	5.35	0.76521	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	19.0592	0.93080	0.0:1.0:0.0:0.0	.	.	.	.	X	1070;1070;736	.	ENSP00000348498:Q1070X	Q	+	1	0	0	NF1	26583227	26583227	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.402000	0.79972	2.499000	0.84300	0.484000	0.47621	CAG	0.204819		TCGA-2J-AABA-01A-21D-A40W-08	0.373	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	0	0	1		2	2	2	0		0	0	12		12	12	1	1.830000	-19.996930	1	0.340000	NM_000267			12	11		53	52	1		1	0		0	0	12	0		0.999300	3.994732e-02	0	1	0	1	0	12	53
SMAD4	4089	broad.mit.edu	37	18	48604705	48604705	+	Nonsense_Mutation	SNP	G	G	A	rs377767370		TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr18:48604705G>A	ENST00000342988.3	+	12	2065	c.1527G>A	c.(1525-1527)tgG>tgA	p.W509*	SMAD4_ENST00000588745.1_Nonsense_Mutation_p.W413*|SMAD4_ENST00000398417.2_Nonsense_Mutation_p.W509*|SMAD4_ENST00000586253.1_3'UTR	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	509	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)|p.W509*(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TGAAAGGCTGGGGACCGGATT	0.473																																						ENST00000342988.3	1.000000	6.800000e-01	0.960000	0.770000	0.870000	0.869917	0.870000	1.000000																										39	Whole gene deletion(36)|Unknown(2)|Substitution - Nonsense(1)	p.0?(36)|p.?(2)|p.W509*(1)	pancreas(26)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|oesophagus(1)	454	GRCh37	CM086965	SMAD4	M		c.(1525-1527)tgG>tgA		SMAD family member 4							113.0	102.0	106.0					18																	48604705		2203	4300	6503	SO:0001587	stop_gained	4089	0	0					g.chr18:48604705G>A	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1527G>A	chr18.hg19:g.48604705G>A	ENSP00000341551:p.Trp509*	1					SMAD4_ENST00000588745.1_Nonsense_Mutation_p.W413*|SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Nonsense_Mutation_p.W509*	p.W509*	NM_005359.5	NP_005350.1	0	1	1	1.734443	Q13485	SMAD4_HUMAN		12	2065	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Nonsense_Mutation	SNP	ENST00000342988.3	0	1	hg19	c.1527G>A	CCDS11950.1	1	.	.	.	.	.	.	.	.	.	.	G	42	9.263344	0.99118	.	.	ENSG00000141646	ENST00000342988;ENST00000398417	.	.	.	6.08	6.08	0.98989	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.4362	0.94796	0.0:0.0:1.0:0.0	.	.	.	.	X	509	.	ENSP00000341551:W509X	W	+	3	0	0	SMAD4	46858703	46858703	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.586000	0.98226	2.890000	0.99128	0.655000	0.94253	TGG	0.208063		TCGA-2J-AABA-01A-21D-A40W-08	0.473	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1		2	2	5	0		0	0	50		50	47	1	1.830000	-2.787374	1	0.340000	NM_005359			56	55		250	250	1		1	1	1	0	1	50	1047		1.000000	9.986344e-01	1	24	125	23	607	56	250
PSMD8	5714	broad.mit.edu	37	19	38874009	38874009	+	Silent	SNP	G	G	A			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr19:38874009G>A	ENST00000215071.4	+	7	1098	c.1032G>A	c.(1030-1032)cgG>cgA	p.R344R	AC005789.9_ENST00000585411.1_RNA|GGN_ENST00000591809.1_5'Flank|PSMD8_ENST00000602911.1_Silent_p.R281R	NM_002812.4	NP_002803.2	P48556	PSMD8_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 8	344					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(1)	6	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AGTATGCCCGGCAGCTGGAGA	0.562																																						ENST00000215071.4	0.360000	5.000000e-02	0.260000	0.100000	0.160000	0.187231	0.160000	0.150000																										0				6						c.(1030-1032)cgG>cgA		proteasome (prosome, macropain) 26S subunit, non-ATPase, 8							48.0	40.0	43.0					19																	38874009		2203	4300	6503	SO:0001819	synonymous_variant	5714	0	0					g.chr19:38874009G>A	D38047	CCDS12515.2	19q13.2	2009-05-07			ENSG00000099341	ENSG00000099341		"""Proteasome (prosome, macropain) subunits"""	9566	protein-coding gene	gene with protein product						7621825	Standard	NM_002812		Approved	S14, Nin1p, p31, HIP6, HYPF, Rpn12	uc002oii.4	P48556	OTTHUMG00000150691	ENST00000215071.4:c.1032G>A	chr19.hg19:g.38874009G>A		0					GGN_ENST00000591809.1_5'Flank|AC005789.9_ENST00000585411.1_RNA|PSMD8_ENST00000602911.1_Silent_p.R281R	p.R344R	NM_002812.4	NP_002803.2	0	0	0	2.039874	P48556	PSMD8_HUMAN	Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)	7	1098	+	all_cancers(60;3.4e-06)		B4DX18|Q6P1L7	Silent	SNP	ENST00000215071.4	0	1	hg19	c.1032G>A	CCDS12515.2	0																																																																																								0.335481		TCGA-2J-AABA-01A-21D-A40W-08	0.562	PSMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319627.1	0	0	1		2	2	2	0		0	0	43		43	42	1	1.830000	-3.607143	1	0.340000	NM_002812			4	4		148	144	0		1	0		0	0	43	0		0.885046	9.933983e-01	0	0	0	410	0	4	148
ZNF28	7576	broad.mit.edu	37	19	53304471	53304471	+	Missense_Mutation	SNP	G	G	C			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr19:53304471G>C	ENST00000457749.2	-	4	746	c.627C>G	c.(625-627)caC>caG	p.H209Q	ZNF28_ENST00000360272.4_Missense_Mutation_p.H156Q|ZNF28_ENST00000414252.2_Missense_Mutation_p.H156Q|ZNF28_ENST00000438150.2_Missense_Mutation_p.H156Q	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	209					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TTTCTCTCATGTGTACATTCC	0.333																																						ENST00000457749.2	0.850000	5.600000e-01	0.780000	0.620000	0.690000	0.705427	0.690000	0.700000																										0				34						c.(625-627)caC>caG		zinc finger protein 28							127.0	134.0	132.0					19																	53304471		2203	4300	6503	SO:0001583	missense	7576	0	0					g.chr19:53304471G>C	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.627C>G	chr19.hg19:g.53304471G>C	ENSP00000397693:p.His209Gln	0					ZNF28_ENST00000414252.2_Missense_Mutation_p.H156Q|ZNF28_ENST00000360272.4_Missense_Mutation_p.H156Q|ZNF28_ENST00000438150.2_Missense_Mutation_p.H156Q	p.H209Q	NM_006969.3	NP_008900.3	0	1	1	2.054197	P17035	ZNF28_HUMAN		4	746	-			A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	ENST00000457749.2	1	1	hg19	c.627C>G	CCDS33093.2	0	.	.	.	.	.	.	.	.	.	.	-	8.679	0.904585	0.17760	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252;ENST00000391783	T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0	1.47	0.307	0.15811	1.47	0.307	0.15811	.	.	.	.	.	T	0.65863	0.2732	M	0.93720	3.45	0.09310	N	1	P	0.50156	0.932	D	0.63703	0.917	T	0.54629	-0.8265	9	0.87932	D	0	.	5.3957	0.16268	0.2136:0.0:0.7864:0.0	.	209	P17035	ZNF28_HUMAN	Q	156;209;156;156;156	ENSP00000412143:H156Q;ENSP00000397693:H209Q;ENSP00000353410:H156Q;ENSP00000444965:H156Q;ENSP00000375661:H156Q	ENSP00000353410:H156Q	H	-	3	2	2	ZNF28	57996283	57996283	0.009000	0.17119	0.001000	0.08648	0.036000	0.12997	0.142000	0.16096	-0.050000	0.13356	0.186000	0.17326	CAC	0.338876		TCGA-2J-AABA-01A-21D-A40W-08	0.333	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	1	0	1		2	2	2	0		0	0	125		125	124	1	1.830000	-20.000000	1	0.340000	NM_006969			79	79		583	575	1		1	1		0	0	125	0		1.000000	1.135772e-01	0	3	0	2	0	79	583
ZNF761	388561	broad.mit.edu	37	19	53960290	53960290	+	RNA	SNP	C	C	T			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr19:53960290C>T	ENST00000454407.1	+	0	2982							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		TCGCACCTGGCACAACATGCT	0.438																																						ENST00000454407.1	0.990000	3.200000e-01	0.800000	0.450000	0.610000	0.630304	0.610000	1.000000																										0				30								zinc finger protein 761																																						388561	0	0					g.chr19:53960290C>T	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		chr19.hg19:g.53960290C>T		0									0	1	1	2.054197	Q86XN6	ZN761_HUMAN		0	2982	+			Q6ZNB9	RNA	SNP	ENST00000454407.1	0	1	hg19			0																																																																																								0.338876		TCGA-2J-AABA-01A-21D-A40W-08	0.438	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		0	0	1		2	2	2	0		0	0	9		9	8	1	1.830000	-16.562990	1	0.340000	NM_001008401			10	10		88	86	0		1	1		0	0	9	0		0.997085	4.902955e-01	0	7	0	8	0	10	88
PSMB4	5692	broad.mit.edu	37	1	151372561	151372561	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr1:151372561G>A	ENST00000290541.6	+	2	299	c.245G>A	c.(244-246)cGc>cAc	p.R82H		NM_002796.2	NP_002787.2	P28070	PSB4_HUMAN	proteasome (prosome, macropain) subunit, beta type, 4	82					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	lipopolysaccharide binding (GO:0001530)|threonine-type endopeptidase activity (GO:0004298)			endometrium(1)|lung(9)|ovary(2)|prostate(1)|skin(1)	14	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GCTCGTTTCCGCAACATCTCT	0.562																																						ENST00000290541.6	0.100000	0	0.070000	0.020000	0.040000	0.049969	0.040000	0.040000																										0				14						c.(244-246)cGc>cAc		proteasome (prosome, macropain) subunit, beta type, 4							146.0	148.0	148.0					1																	151372561		2203	4300	6503	SO:0001583	missense	5692	0	0					g.chr1:151372561G>A	D26600	CCDS996.1	1q21	2008-02-05			ENSG00000159377	ENSG00000159377		"""Proteasome (prosome, macropain) subunits"""	9541	protein-coding gene	gene with protein product		602177				7918633	Standard	NM_002796		Approved	HN3, PROS26	uc001eyc.1	P28070	OTTHUMG00000012494	ENST00000290541.6:c.245G>A	chr1.hg19:g.151372561G>A	ENSP00000290541:p.Arg82His	0						p.R82H	NM_002796.2	NP_002787.2	1	2	3	2.061605	P28070	PSB4_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)	2	299	+	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		B2R9L3|P31148|Q5SZS5|Q6IBI4|Q969L6	Missense_Mutation	SNP	ENST00000290541.6	0	1	hg19	c.245G>A	CCDS996.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.616730	0.96649	.	.	ENSG00000159377	ENST00000290541	T	0.23950	1.88	5.34	5.34	0.76211	5.34	5.34	0.76211	Proteasome, beta-type subunit, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.42765	0.1217	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.985	T	0.23226	-1.0194	10	0.48119	T	0.1	-10.0508	17.6208	0.88080	0.0:0.0:1.0:0.0	.	82;82	B4DFL3;P28070	.;PSB4_HUMAN	H	82	ENSP00000290541:R82H	ENSP00000290541:R82H	R	+	2	0	0	PSMB4	149639185	149639185	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.420000	0.97426	2.502000	0.84385	0.561000	0.74099	CGC	0.341120		TCGA-2J-AABA-01A-21D-A40W-08	0.562	PSMB4-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034885.1	0	0	1		16	10	2	1		1	1	185		185	178	1	1.830000	-2.119973	0	0.340000	NM_002796			6	6		815	793	0		0	0		1	0	185	0		0.021741	1.663031e-02	0	0	0	418	0	6	815
PIGM	93183	broad.mit.edu	37	1	160000872	160000872	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr1:160000872T>C	ENST00000368090.2	-	1	911	c.658A>G	c.(658-660)Aaa>Gaa	p.K220E		NM_145167.2	NP_660150.1	Q9H3S5	PIGM_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class M	220					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			kidney(1)|large_intestine(4)|lung(9)|ovary(2)|skin(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CACAGCCTTTTCAGGAGCTCG	0.493																																						ENST00000368090.2	0.120000	1.000000e-02	0.090000	0.030000	0.050000	0.062660	0.050000	0.060000																										0				17						c.(658-660)Aaa>Gaa		phosphatidylinositol glycan anchor biosynthesis, class M							93.0	98.0	96.0					1																	160000872		2203	4300	6503	SO:0001583	missense	93183	0	0					g.chr1:160000872T>C	AB028127	CCDS1192.1	1q23.2	2013-02-26	2006-06-28		ENSG00000143315	ENSG00000143315		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	18858	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 1"", ""DPM:GlcN-(acyl-)PI mannosyltransferase"", ""dol-P-Man dependent GPI mannosyltransferase"""	610273	"""phosphatidylinositol glycan, class M"""			11226175	Standard	NM_145167		Approved	GPI-MT-I	uc001fuv.1	Q9H3S5	OTTHUMG00000024081	ENST00000368090.2:c.658A>G	chr1.hg19:g.160000872T>C	ENSP00000357069:p.Lys220Glu	0						p.K220E	NM_145167.2	NP_660150.1	1	2	3	2.061605	Q9H3S5	PIGM_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)	1	911	-	all_hematologic(112;0.093)			Missense_Mutation	SNP	ENST00000368090.2	0	1	hg19	c.658A>G	CCDS1192.1	0	.	.	.	.	.	.	.	.	.	.	T	0.284	-0.984168	0.02180	.	.	ENSG00000143315	ENST00000368090	T	0.42513	0.97	5.01	-0.346	0.12620	5.01	-0.346	0.12620	.	1.434850	0.03898	N	0.279844	T	0.13157	0.0319	L	0.39898	1.24	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.15009	-1.0452	9	.	.	.	-16.8801	5.5481	0.17076	0.0:0.1892:0.4536:0.3572	.	220	Q9H3S5	PIGM_HUMAN	E	220	ENSP00000357069:K220E	.	K	-	1	0	0	PIGM	158267496	158267496	0.000000	0.05858	0.000000	0.03702	0.090000	0.18270	-0.053000	0.11846	0.035000	0.15519	0.379000	0.24179	AAA	0.341120		TCGA-2J-AABA-01A-21D-A40W-08	0.493	PIGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060643.2	0	0	0		2	2	2	0		0	0	88		88	87	1	1.830000	-4.538811	1	0.340000	NM_145167			5	4		555	548	0		1	0		0	0	88	0		0.935104	1.392864e-02	0	0	0	16	0	5	555
ARID1A	8289	broad.mit.edu	37	1	27101342	27101342	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr1:27101342G>T	ENST00000324856.7	+	18	4995	c.4624G>T	c.(4624-4626)Gaa>Taa	p.E1542*	ARID1A_ENST00000540690.1_Intron|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.E1159*|ARID1A_ENST00000457599.2_Intron	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1542					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.E1542*(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GGCCAACCACGAAGGCTCGTG	0.642			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	ENST00000324856.7	1.000000	6.500000e-01	0.960000	0.750000	0.860000	0.859098	0.860000	1.000000				Rec	yes			Rec	yes		1	1p35.3	1p35.3	8289	Mis, N, F, S, D	AT rich interactive domain 1A (SWI-like)				E	E			clear cell ovarian carcinoma, RCC	ARID1A/MAST2_ENST00000361297(2)	1	Substitution - Nonsense(1)	p.E1542*(1)	ovary(1)	411						c.(4624-4626)Gaa>Taa		AT rich interactive domain 1A (SWI-like)							60.0	63.0	62.0					1																	27101342		2203	4300	6503	SO:0001587	stop_gained	8289	0	0					g.chr1:27101342G>T	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4624G>T	chr1.hg19:g.27101342G>T	ENSP00000320485:p.Glu1542*	1					ARID1A_ENST00000374152.2_Nonsense_Mutation_p.E1159*|ARID1A_ENST00000540690.1_Intron|ARID1A_ENST00000457599.2_Intron	p.E1542*	NM_006015.4	NP_006006.3	0	1	1	1.733261	O14497	ARI1A_HUMAN		18	4995	+		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	0	1	hg19	c.4624G>T	CCDS285.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	10.343878|10.343878	0.99388|0.99388	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000374152|ENST00000430799	.|.	.|.	.|.	5.41|5.41	5.41|5.41	0.78517|0.78517	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	0.045702|.	0.85682|.	D|.	0.000000|.	.|T	.|0.75287	.|0.3829	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72743	.|-0.4201	.|4	0.42905|.	T|.	0.14|.	-7.5866|-7.5866	19.3941|19.3941	0.94598|0.94598	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	1542;1159|438	.|.	ENSP00000320485:E1542X|.	E|R	+|+	1|2	0|0	0|0	ARID1A|ARID1A	26973929|26973929	26973929|26973929	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.479000|0.479000	0.33129|0.33129	9.144000|9.144000	0.94629|0.94629	2.822000|2.822000	0.97130|0.97130	0.557000|0.557000	0.71058|0.71058	GAA|CGA	0.206445		TCGA-2J-AABA-01A-21D-A40W-08	0.642	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	1	0	1		2	2	2	0		0	0	68		68	64	1	1.830000	-20.000000	1	0.340000	NM_139135			41	40		181	166	1		1	1	1	0	0	68	338		1.000000	7.599884e-01	1	5	70	9	223	41	181
MFSD2A	84879	broad.mit.edu	37	1	40421012	40421012	+	Silent	SNP	A	A	G			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr1:40421012A>G	ENST00000372809.5	+	1	191	c.48A>G	c.(46-48)ctA>ctG	p.L16L	MFSD2A_ENST00000420632.2_5'UTR|MFSD2A_ENST00000372811.5_Silent_p.L16L	NM_001136493.1	NP_001129965.1	Q8NA29	NLS1_HUMAN	major facilitator superfamily domain containing 2A	16					establishment of blood-brain barrier (GO:0060856)|fatty acid transport (GO:0015908)|lipid transport across blood brain barrier (GO:1990379)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phospholipid transporter activity (GO:0005548)|symporter activity (GO:0015293)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						CGGGGCTGCTACCCACCAGCA	0.716																																						ENST00000372809.5	0.930000	1.400000e-01	0.630000	0.250000	0.410000	0.445072	0.410000	0.370000																										0				24						c.(46-48)ctA>ctG		major facilitator superfamily domain containing 2A							12.0	17.0	15.0					1																	40421012		2191	4284	6475	SO:0001819	synonymous_variant	84879	0	0					g.chr1:40421012A>G	AK093223	CCDS446.1, CCDS44118.1, CCDS72762.1	1p34.2	2009-09-08	2009-09-08	2009-09-08	ENSG00000168389	ENSG00000168389			25897	protein-coding gene	gene with protein product		614397	"""major facilitator superfamily domain containing 2"""	MFSD2		18694395	Standard	XM_005271285		Approved	FLJ14490	uc001cev.3	Q8NA29	OTTHUMG00000009293	ENST00000372809.5:c.48A>G	chr1.hg19:g.40421012A>G		0					MFSD2A_ENST00000372811.5_Silent_p.L16L|MFSD2A_ENST00000420632.2_5'UTR	p.L16L	NM_001136493.1	NP_001129965.1	1	2	3	2.071606	Q8NA29	NLS1_HUMAN		1	191	+			A8K675|Q6UWU5|Q96F59|Q9BRC8	Silent	SNP	ENST00000372809.5	0	1	hg19	c.48A>G	CCDS44118.1	0																																																																																								0.342236		TCGA-2J-AABA-01A-21D-A40W-08	0.716	MFSD2A-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025756.1	0	0	1		2	2	2	0		0	0	12		12	10	1	1.830000	-10.096200	1	0.340000	NM_032793			4	4		59	56	0		1	0		0	0	12	0		0.880764	7.068444e-01	0	0	0	36	0	4	59
KIF21B	23046	broad.mit.edu	37	1	200950209	200950209	+	Silent	SNP	C	C	T			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr1:200950209C>T	ENST00000422435.2	-	29	4174	c.3858G>A	c.(3856-3858)ccG>ccA	p.P1286P	KIF21B_ENST00000461742.2_Silent_p.P1286P|KIF21B_ENST00000360529.5_Silent_p.P1273P|KIF21B_ENST00000332129.2_Silent_p.P1273P	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1286					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						CTCCTCCAACCGGGGAGATGA	0.637																																						ENST00000422435.2	1.000000	5.800000e-01	0.980000	0.700000	0.830000	0.832285	0.830000	1.000000																										0				83						c.(3856-3858)ccG>ccA		kinesin family member 21B							70.0	61.0	64.0					1																	200950209		2203	4300	6503	SO:0001819	synonymous_variant	23046	6	121412	37				g.chr1:200950209C>T	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.3858G>A	chr1.hg19:g.200950209C>T		0					KIF21B_ENST00000332129.2_Silent_p.P1273P|KIF21B_ENST00000461742.2_Silent_p.P1286P|KIF21B_ENST00000360529.5_Silent_p.P1273P	p.P1286P	NM_001252100.1	NP_001239029.1	1	2	3	2.069687	O75037	KI21B_HUMAN		29	4174	-			B2RP62|B7ZMI0|Q5T4J3	Silent	SNP	ENST00000422435.2	1	1	hg19	c.3858G>A	CCDS58056.1	0																																																																																								0.342236		TCGA-2J-AABA-01A-21D-A40W-08	0.637	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	1	0	1		2	2	2	0		0	0	45		45	43	1	1.830000	-2.971653	1	0.340000	XM_371332			32	32		196	191	1		1	1		0	0	45	0		1.000000	1.026975e-01	0	2	0	2	0	32	196
SGSM1	129049	broad.mit.edu	37	22	25264736	25264736	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr22:25264736C>T	ENST00000400359.4	+	12	1212	c.1205C>T	c.(1204-1206)gCc>gTc	p.A402V	SGSM1_ENST00000400358.4_Missense_Mutation_p.A402V	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	402						Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						CAGGGTTCTGCCGAGTCCACA	0.512																																						ENST00000400359.4	0.170000	2.000000e-02	0.120000	0.040000	0.070000	0.093996	0.070000	0.080000																										0				41						c.(1204-1206)gCc>gTc		small G protein signaling modulator 1							116.0	112.0	113.0					22																	25264736		1955	4166	6121	SO:0001583	missense	129049	0	0					g.chr22:25264736C>T	AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.1205C>T	chr22.hg19:g.25264736C>T	ENSP00000383212:p.Ala402Val	0					SGSM1_ENST00000400358.4_Missense_Mutation_p.A402V	p.A402V	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	1	2	3	2.074349	Q2NKQ1	SGSM1_HUMAN		12	1212	+			A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	ENST00000400359.4	0	1	hg19	c.1205C>T	CCDS46674.1	0	.	.	.	.	.	.	.	.	.	.	C	0.043	-1.275275	0.01410	.	.	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.31510	1.49;1.49	4.97	2.9	0.33743	4.97	2.9	0.33743	.	1.043230	0.07422	N	0.894208	T	0.08935	0.0221	N	0.01729	-0.75	0.09310	N	1	B;B;P;B	0.39665	0.05;0.102;0.682;0.007	B;B;B;B	0.30572	0.017;0.047;0.117;0.011	T	0.07385	-1.0775	10	0.08179	T	0.78	-10.6163	5.5656	0.17168	0.1576:0.6761:0.0:0.1663	.	402;518;535;402	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1	.;.;.;SGSM1_HUMAN	V	518;402;402	ENSP00000383211:A402V;ENSP00000383212:A402V	ENSP00000383211:A402V	A	+	2	0	0	SGSM1	23594736	23594736	0.054000	0.20591	0.004000	0.12327	0.018000	0.09664	3.246000	0.51414	0.644000	0.30656	-0.218000	0.12543	GCC	0.342236		TCGA-2J-AABA-01A-21D-A40W-08	0.512	SGSM1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320282.1	0	0	1		2	2	2	0		0	0	99		99	98	1	1.830000	-2.104343	0	0.340000	XM_059318			6	6		476	467	0		1			0	0	99	0		0.962860	0	0	0	0	0	0	6	476
NCKAP5	344148	broad.mit.edu	37	2	133541374	133541374	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr2:133541374T>C	ENST00000409261.1	-	14	3383	c.3010A>G	c.(3010-3012)Atc>Gtc	p.I1004V	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000317721.6_Missense_Mutation_p.I1004V	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1004										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TGAGTGAAGATAGGCTTTTTG	0.537																																						ENST00000409261.1	1.000000	5.800000e-01	1.000000	0.720000	0.890000	0.874564	0.890000	1.000000																										0				118						c.(3010-3012)Atc>Gtc		NCK-associated protein 5							33.0	37.0	36.0					2																	133541374		1950	4139	6089	SO:0001583	missense	344148	1	120480	24				g.chr2:133541374T>C	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.3010A>G	chr2.hg19:g.133541374T>C	ENSP00000387128:p.Ile1004Val	0					NCKAP5_ENST00000317721.6_Missense_Mutation_p.I1004V|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000473859.1_5'Flank	p.I1004V	NM_207363.2	NP_997246.2	0	1	1	2.053808	O14513	NCKP5_HUMAN		14	3383	-			B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	1	1	hg19	c.3010A>G	CCDS46418.1	1	.	.	.	.	.	.	.	.	.	.	T	0.015	-1.544604	0.00934	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.08458	3.09;3.09	5.07	-8.15	0.01065	5.07	-8.15	0.01065	.	1.865620	0.03556	N	0.226266	T	0.04092	0.0114	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34304	-0.9834	10	0.22706	T	0.39	.	7.2862	0.26340	0.0:0.3572:0.1999:0.4429	.	1004	O14513	NCKP5_HUMAN	V	1004	ENSP00000387128:I1004V;ENSP00000380603:I1004V	ENSP00000380603:I1004V	I	-	1	0	0	NCKAP5	133257844	133257844	0.000000	0.05858	0.000000	0.03702	0.692000	0.40212	-2.258000	0.01179	-2.146000	0.00800	-0.798000	0.03219	ATC	0.338876		TCGA-2J-AABA-01A-21D-A40W-08	0.537	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	1	0	1		2	2	2	0		0	0	29		29	29	1	1.830000	-20.000000	1	0.340000	NM_207481			20	20		111	107	1		1	0		0	0	29	0		0.999996	2.592302e-02	0	0	0	2	0	20	111
KIDINS220	57498	broad.mit.edu	37	2	8891668	8891668	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr2:8891668C>A	ENST00000256707.3	-	23	3299	c.3118G>T	c.(3118-3120)Gtg>Ttg	p.V1040L	KIDINS220_ENST00000427284.1_Missense_Mutation_p.V1040L|KIDINS220_ENST00000418530.1_Missense_Mutation_p.V998L|KIDINS220_ENST00000473731.1_Missense_Mutation_p.V1040L	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	1040					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TCTCGAGCCACAAGAACTGGG	0.353																																						ENST00000256707.3	1.000000	6.300000e-01	0.940000	0.720000	0.820000	0.836070	0.820000	1.000000																										0				60						c.(3118-3120)Gtg>Ttg		kinase D-interacting substrate, 220kDa							102.0	103.0	103.0					2																	8891668		1818	4062	5880	SO:0001583	missense	57498	0	0					g.chr2:8891668C>A	AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.3118G>T	chr2.hg19:g.8891668C>A	ENSP00000256707:p.Val1040Leu	0					KIDINS220_ENST00000418530.1_Missense_Mutation_p.V998L|KIDINS220_ENST00000427284.1_Missense_Mutation_p.V1040L|KIDINS220_ENST00000473731.1_Missense_Mutation_p.V1040L	p.V1040L	NM_020738.2	NP_065789.1	0	0	0	2.048860	Q9ULH0	KDIS_HUMAN		23	3299	-	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)		A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Missense_Mutation	SNP	ENST00000256707.3	1	1	hg19	c.3118G>T	CCDS42650.1	0	.	.	.	.	.	.	.	.	.	.	C	5.843	0.339815	0.11069	.	.	ENSG00000134313	ENST00000496383;ENST00000541927;ENST00000256707;ENST00000427284;ENST00000418530;ENST00000473731;ENST00000489024;ENST00000459813	T;T;T;T;T;T	0.64803	1.03;-0.12;-0.08;-0.02;-0.08;-0.06	5.07	5.07	0.68467	5.07	5.07	0.68467	.	0.215268	0.42821	D	0.000645	T	0.41880	0.1178	N	0.12887	0.27	0.39550	D	0.968969	B;B;B;B;B	0.29552	0.012;0.001;0.058;0.165;0.248	B;B;B;B;B	0.34931	0.01;0.003;0.094;0.192;0.064	T	0.36648	-0.9739	10	0.06494	T	0.89	.	12.2106	0.54377	0.0:0.9213:0.0:0.0787	.	1041;1041;724;998;1040	B4DK94;E9PH70;B4DGY1;Q9ULH0-2;Q9ULH0	.;.;.;.;KDIS_HUMAN	L	787;724;1040;1040;998;1040;1041;49	ENSP00000420364:V787L;ENSP00000256707:V1040L;ENSP00000411849:V1040L;ENSP00000414923:V998L;ENSP00000418974:V1040L;ENSP00000419964:V1041L	ENSP00000256707:V1040L	V	-	1	0	0	KIDINS220	8809119	8809119	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.970000	0.40520	2.509000	0.84616	0.563000	0.77884	GTG	0.337748		TCGA-2J-AABA-01A-21D-A40W-08	0.353	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2	1	0	1		2	2	2	0		0	0	70		70	60	1	1.830000	-19.999930	1	0.340000	NM_020738			53	52		320	284	1		1	1		0	0	70	0		1.000000	7.478136e-01	0	4	0	14	0	53	320
DNMT3A	1788	broad.mit.edu	37	2	25459873	25459873	+	Splice_Site	SNP	G	G	A	rs35824014		TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr2:25459873G>A	ENST00000264709.3	-	21	2747	c.2410C>T	c.(2410-2412)Ccg>Tcg	p.P804S	DNMT3A_ENST00000380746.4_Splice_Site_p.P615S|DNMT3A_ENST00000402667.1_Splice_Site_p.P581S|DNMT3A_ENST00000474887.1_Intron|DNMT3A_ENST00000321117.5_Splice_Site_p.P804S	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	804	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)	p.R803fs*5(3)|p.P804S(2)|p.P615S(2)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GATGCCAACGGCCTAGGAGGC	0.582			"""Mis, F, N, S"""		AML																																	ENST00000264709.3	1.000000	6.200000e-01	1.000000	0.780000	0.970000	0.916529	0.970000	1.000000				Rec	yes			Rec	yes		2	2p23	2p23	1788	Mis, F, N, S	DNA (cytosine-5-)-methyltransferase 3 alpha				L	L			AML		7	Substitution - Missense(4)|Deletion - Frameshift(3)	p.R803fs*5(3)|p.P804S(2)|p.P615S(2)	lung(4)|haematopoietic_and_lymphoid_tissue(3)	1021						c.(2410-2412)Ccg>Tcg		DNA (cytosine-5-)-methyltransferase 3 alpha							47.0	44.0	45.0					2																	25459873		2203	4300	6503	SO:0001630	splice_region_variant	1788	0	0					g.chr2:25459873G>A		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.2409-1C>T	chr2.hg19:g.25459873G>A		0					DNMT3A_ENST00000474887.1_Intron|DNMT3A_ENST00000380746.4_Splice_Site_p.P615S|DNMT3A_ENST00000402667.1_Splice_Site_p.P581S|DNMT3A_ENST00000321117.5_Splice_Site_p.P804S	p.P804S	NM_175629.2	NP_783328.1	0	0	0	2.048860	Q9Y6K1	DNM3A_HUMAN		21	2747	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Splice_Site	SNP	ENST00000264709.3	1	0	hg19	c.2410C>T	CCDS33157.1	1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.511478	0.85389	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	D;D;D;D	0.97232	-4.3;-4.3;-4.3;-4.3	5.62	4.72	0.59763	5.62	4.72	0.59763	.	0.047584	0.85682	D	0.000000	D	0.98391	0.9465	M	0.86651	2.83	0.80722	D	1	P;D	0.89917	0.729;1.0	B;D	0.75020	0.274;0.985	D	0.98630	1.0671	10	0.49607	T	0.09	-7.2591	14.0893	0.64980	0.0:0.1518:0.8482:0.0	.	804;615	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	S	615;804;804;581	ENSP00000370122:P615S;ENSP00000324375:P804S;ENSP00000264709:P804S;ENSP00000384237:P581S	ENSP00000264709:P804S	P	-	1	0	0	DNMT3A	25313377	25313377	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	9.624000	0.98398	1.325000	0.45301	0.655000	0.94253	CCG	0.337748		TCGA-2J-AABA-01A-21D-A40W-08	0.582	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	1	0	1		2	2	2	0		0	0	30		30	30	1	1.830000	-20.000000	1	0.340000	NM_022552	Missense_Mutation		19	18		95	93	1		1	1		0	0	30	0		0.999993	7.407874e-01	0	5	0	10	0	19	95
SLC8A1	6546	broad.mit.edu	37	2	40405540	40405540	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr2:40405540C>A	ENST00000403092.1	-	3	1935	c.1902G>T	c.(1900-1902)atG>atT	p.M634I	SLC8A1_ENST00000332839.4_Missense_Mutation_p.M634I|SLC8A1_ENST00000406391.2_Intron|SLC8A1-AS1_ENST00000444629.1_RNA|SLC8A1-AS1_ENST00000599268.1_RNA|SLC8A1_ENST00000542756.1_Missense_Mutation_p.M634I|SLC8A1-AS1_ENST00000593848.1_RNA|SLC8A1-AS1_ENST00000599740.1_RNA|SLC8A1_ENST00000402441.1_Intron|SLC8A1_ENST00000542024.1_Intron|SLC8A1-AS1_ENST00000598247.1_RNA|SLC8A1-AS1_ENST00000596532.1_RNA|SLC8A1-AS1_ENST00000435515.1_RNA|SLC8A1_ENST00000405269.1_Intron|SLC8A1_ENST00000406785.2_Intron|SLC8A1-AS1_ENST00000599956.1_RNA|SLC8A1_ENST00000408028.2_Intron|SLC8A1-AS1_ENST00000601679.1_RNA|SLC8A1-AS1_ENST00000597385.1_RNA|SLC8A1_ENST00000405901.3_Missense_Mutation_p.M634I|SLC8A1-AS1_ENST00000597170.1_RNA|SLC8A1-AS1_ENST00000593878.1_RNA			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	634					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TCTTCTCACTCATCTCCACCA	0.507																																						ENST00000403092.1	0.180000	5.000000e-02	0.150000	0.080000	0.110000	0.119468	0.110000	0.110000																										0				100						c.(1900-1902)atG>atT		solute carrier family 8 (sodium/calcium exchanger), member 1	Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)						156.0	162.0	160.0					2																	40405540		2203	4300	6503	SO:0001583	missense	6546	0	0					g.chr2:40405540C>A		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1902G>T	chr2.hg19:g.40405540C>A	ENSP00000384763:p.Met634Ile	0					SLC8A1-AS1_ENST00000599740.1_RNA|SLC8A1-AS1_ENST00000598247.1_RNA|SLC8A1_ENST00000542024.1_Intron|SLC8A1_ENST00000406391.2_Intron|SLC8A1-AS1_ENST00000593878.1_RNA|SLC8A1_ENST00000542756.1_Missense_Mutation_p.M634I|SLC8A1_ENST00000332839.4_Missense_Mutation_p.M634I|SLC8A1_ENST00000402441.1_Intron|SLC8A1-AS1_ENST00000444629.1_RNA|SLC8A1-AS1_ENST00000435515.1_RNA|SLC8A1-AS1_ENST00000599268.1_RNA|SLC8A1_ENST00000405269.1_Intron|SLC8A1-AS1_ENST00000596532.1_RNA|SLC8A1-AS1_ENST00000593848.1_RNA|SLC8A1-AS1_ENST00000601679.1_RNA|SLC8A1_ENST00000408028.2_Intron|SLC8A1-AS1_ENST00000599956.1_RNA|SLC8A1-AS1_ENST00000597170.1_RNA|SLC8A1-AS1_ENST00000597385.1_RNA|SLC8A1_ENST00000405901.3_Missense_Mutation_p.M634I|SLC8A1_ENST00000406785.2_Intron	p.M634I			0	0	0	2.048860	P32418	NAC1_HUMAN		3	1935	-			A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	0	1	hg19	c.1902G>T	CCDS1806.1	0	.	.	.	.	.	.	.	.	.	.	C	9.553	1.116372	0.20795	.	.	ENSG00000183023	ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000332839	T;T;T;T	0.25749	1.78;1.79;1.78;1.79	5.39	5.39	0.77823	5.39	5.39	0.77823	.	0.176546	0.50627	D	0.000106	T	0.24661	0.0598	L	0.40543	1.245	0.80722	D	1	B;B	0.13594	0.008;0.005	B;B	0.17979	0.02;0.007	T	0.02257	-1.1187	10	0.34782	T	0.22	.	16.6407	0.85098	0.0:1.0:0.0:0.0	.	634;634	F6VPY9;P32418	.;NAC1_HUMAN	I	634	ENSP00000440727:M634I;ENSP00000384763:M634I;ENSP00000385678:M634I;ENSP00000332931:M634I	ENSP00000332931:M634I	M	-	3	0	0	SLC8A1	40259044	40259044	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.616000	0.67709	2.506000	0.84524	0.591000	0.81541	ATG	0.337748		TCGA-2J-AABA-01A-21D-A40W-08	0.507	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	0	0	1		2	2	2	0		0	0	174		174	169	1	1.830000	-2.211063	0	0.340000	NM_021097			13	13		670	656	0		1			0	0	174	0		0.999467	0	0	0	0	0	0	13	670
SLC3A1	6519	broad.mit.edu	37	2	44531289	44531289	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr2:44531289G>A	ENST00000260649.6	+	7	1220	c.1144G>A	c.(1144-1146)Ggg>Agg	p.G382R	SLC3A1_ENST00000409380.1_Missense_Mutation_p.G104R|SLC3A1_ENST00000409741.1_Missense_Mutation_p.G382R|SLC3A1_ENST00000409229.3_Missense_Mutation_p.G382R|SLC3A1_ENST00000409387.1_Missense_Mutation_p.G382R|SLC3A1_ENST00000409294.1_Missense_Mutation_p.G2R|SLC3A1_ENST00000409740.3_Missense_Mutation_p.G13R	NM_000341.3	NP_000332.2	Q07837	SLC31_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 1	382					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|basic amino acid transport (GO:0015802)|carbohydrate metabolic process (GO:0005975)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|vacuolar membrane (GO:0005774)	amino acid transmembrane transporter activity (GO:0015171)|basic amino acid transmembrane transporter activity (GO:0015174)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|L-cystine transmembrane transporter activity (GO:0015184)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(3)	26		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	TAGGTTCATGGGGACTGAAGC	0.458																																						ENST00000260649.6	0.250000	7.000000e-02	0.200000	0.110000	0.150000	0.161472	0.150000	0.150000																										0				26						c.(1144-1146)Ggg>Agg		solute carrier family 3 (amino acid transporter heavy chain), member 1	L-Cystine(DB00138)						153.0	137.0	143.0					2																	44531289		2203	4300	6503	SO:0001583	missense	6519	0	0					g.chr2:44531289G>A		CCDS1819.1	2p16.3	2013-07-19	2013-07-19		ENSG00000138079	ENSG00000138079		"""Solute carriers"""	11025	protein-coding gene	gene with protein product		104614	"""solute carrier family 3 (cystine, dibasic and neutral amino acid transporters, activator of cystine, dibasic and neutral amino acid transport), member 1"""			8486766, 9186880	Standard	NM_000341		Approved	CSNU1, D2H, RBAT, ATR1, NBAT	uc002ruc.4	Q07837	OTTHUMG00000128759	ENST00000260649.6:c.1144G>A	chr2.hg19:g.44531289G>A	ENSP00000260649:p.Gly382Arg	0					SLC3A1_ENST00000409740.3_Missense_Mutation_p.G13R|SLC3A1_ENST00000409387.1_Missense_Mutation_p.G382R|SLC3A1_ENST00000409294.1_Missense_Mutation_p.G2R|SLC3A1_ENST00000409741.1_Missense_Mutation_p.G382R|SLC3A1_ENST00000409380.1_Missense_Mutation_p.G104R|SLC3A1_ENST00000409229.3_Missense_Mutation_p.G382R	p.G382R	NM_000341.3	NP_000332.2	0	0	0	2.048860	Q07837	SLC31_HUMAN		7	1220	+		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	A8K0S1|O00658|Q15295|Q4J6B4|Q4J6B5|Q4J6B6|Q4J6B7|Q4J6B8|Q4J6B9|Q52M92|Q52M94	Missense_Mutation	SNP	ENST00000260649.6	0	1	hg19	c.1144G>A	CCDS1819.1	0	.	.	.	.	.	.	.	.	.	.	G	21.9	4.213359	0.79352	.	.	ENSG00000138079	ENST00000260649;ENST00000409387;ENST00000540334;ENST00000409741;ENST00000409229;ENST00000541289;ENST00000409380;ENST00000409294;ENST00000409740	D;D;D;D;D;D;D	0.99474	-5.97;-5.97;-5.97;-5.97;-5.97;-4.58;-5.97	5.14	5.14	0.70334	5.14	5.14	0.70334	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.054269	0.64402	D	0.000001	D	0.99336	0.9767	L	0.60455	1.87	0.80722	D	1	D;D;D;D	0.76494	0.996;0.991;0.999;0.999	D;D;D;D	0.77004	0.959;0.959;0.989;0.98	D	0.99346	1.0913	10	0.66056	D	0.02	-16.9982	17.398	0.87451	0.0:0.0:1.0:0.0	.	382;382;382;382	Q07837;B8ZZK1;Q4J6B5;Q4J6B6	SLC31_HUMAN;.;.;.	R	382;382;318;382;382;382;104;2;13	ENSP00000260649:G382R;ENSP00000387308:G382R;ENSP00000386954:G382R;ENSP00000386620:G382R;ENSP00000386709:G104R;ENSP00000386852:G2R;ENSP00000386677:G13R	ENSP00000260649:G382R	G	+	1	0	0	SLC3A1	44384793	44384793	1.000000	0.71417	0.997000	0.53966	0.595000	0.36748	8.753000	0.91637	2.393000	0.81446	0.455000	0.32223	GGG	0.337748		TCGA-2J-AABA-01A-21D-A40W-08	0.458	SLC3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250676.1	0	0	1		2	2	2	0		0	0	120		120	115	1	1.830000	-2.388793	0	0.340000	NM_000341			12	12		456	450	0		1	0		0	0	120	0		0.999067	4.596796e-01	0	1	0	56	0	12	456
MOGS	7841	broad.mit.edu	37	2	74688883	74688883	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr2:74688883C>T	ENST00000233616.4	-	4	2195	c.2033G>A	c.(2032-2034)cGg>cAg	p.R678Q	MOGS_ENST00000462443.1_5'Flank|MOGS_ENST00000409065.1_3'UTR|MOGS_ENST00000452063.2_Missense_Mutation_p.R572Q	NM_006302.2	NP_006293.2	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase	678					cellular protein metabolic process (GO:0044267)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosidase activity (GO:0015926)|mannosyl-oligosaccharide glucosidase activity (GO:0004573)			cervix(1)|endometrium(6)|large_intestine(3)|lung(10)|prostate(1)|urinary_tract(2)	23						AGGTTGGGGCCGACCCACCAC	0.597																																						ENST00000233616.4	1.000000	6.500000e-01	0.960000	0.740000	0.840000	0.850258	0.840000	1.000000																										0				23						c.(2032-2034)cGg>cAg		mannosyl-oligosaccharide glucosidase							65.0	77.0	73.0					2																	74688883		1993	4155	6148	SO:0001583	missense	7841	1	120878	35				g.chr2:74688883C>T	X87237	CCDS42700.1, CCDS54370.1	2p13.1	2012-01-31			ENSG00000115275	ENSG00000115275	3.2.1.106		24862	protein-coding gene	gene with protein product	"""glucosidase I"", ""processing A-glucosidase I"""	601336				7635146, 8786151	Standard	NM_006302		Approved	GCS1, CWH41, DER7	uc010ffj.3	Q13724	OTTHUMG00000152886	ENST00000233616.4:c.2033G>A	chr2.hg19:g.74688883C>T	ENSP00000233616:p.Arg678Gln	0					MOGS_ENST00000462443.1_5'Flank|MOGS_ENST00000409065.1_3'UTR|MOGS_ENST00000452063.2_Missense_Mutation_p.R572Q	p.R678Q	NM_006302.2	NP_006293.2	0	0	0	2.048860	Q13724	MOGS_HUMAN		4	2195	-			A8K938|F5H6D0|Q17RN9|Q8TCT5	Missense_Mutation	SNP	ENST00000233616.4	1	1	hg19	c.2033G>A	CCDS42700.1	0	.	.	.	.	.	.	.	.	.	.	C	6.851	0.526345	0.13066	.	.	ENSG00000115275	ENST00000233616;ENST00000452063	T;T	0.38240	1.15;1.15	5.01	5.01	0.66863	5.01	5.01	0.66863	Six-hairpin glycosidase-like (1);	0.118143	0.52532	D	0.000072	T	0.39937	0.1097	L	0.31420	0.93	0.80722	D	1	D	0.89917	1.0	D	0.68353	0.957	T	0.09250	-1.0683	10	0.12430	T	0.62	-11.998	9.2712	0.37673	0.0:0.9044:0.0:0.0956	.	678	Q13724	MOGS_HUMAN	Q	678;572	ENSP00000233616:R678Q;ENSP00000388201:R572Q	ENSP00000233616:R678Q	R	-	2	0	0	MOGS	74542391	74542391	0.992000	0.36948	0.983000	0.44433	0.156000	0.22039	1.923000	0.40055	2.618000	0.88619	0.462000	0.41574	CGG	0.337748		TCGA-2J-AABA-01A-21D-A40W-08	0.597	MOGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328382.1	1	0	1		2	2	2	0		0	0	84		84	83	1	1.830000	-19.999970	1	0.340000	NM_006302			54	53		319	311	1		1	1		0	0	84	0		1.000000	9.999990e-01	0	42	0	80	0	54	319
NCAPH	23397	broad.mit.edu	37	2	97019996	97019996	+	Missense_Mutation	SNP	G	G	T			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr2:97019996G>T	ENST00000240423.4	+	9	1121	c.1078G>T	c.(1078-1080)Gac>Tac	p.D360Y	NCAPH_ENST00000427946.1_Missense_Mutation_p.D224Y|NCAPH_ENST00000455200.1_Missense_Mutation_p.D349Y	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	360					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)				TGACGAGAGTGACTGTGGAGA	0.512																																						ENST00000240423.4	0.950000	6.500000e-01	0.880000	0.720000	0.790000	0.802945	0.790000	0.800000																										0				28						c.(1078-1080)Gac>Tac		non-SMC condensin I complex, subunit H							174.0	172.0	173.0					2																	97019996		2203	4300	6503	SO:0001583	missense	23397	0	0					g.chr2:97019996G>T	BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152			1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1		9417923	Standard	NM_015341		Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000240423.4:c.1078G>T	chr2.hg19:g.97019996G>T	ENSP00000240423:p.Asp360Tyr	0					NCAPH_ENST00000455200.1_Missense_Mutation_p.D349Y|NCAPH_ENST00000427946.1_Missense_Mutation_p.D224Y	p.D360Y	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	0	1	1	2.053808	Q15003	CND2_HUMAN		9	1121	+		Ovarian(717;0.0221)	B4E189|Q8TB87	Missense_Mutation	SNP	ENST00000240423.4	1	1	hg19	c.1078G>T	CCDS2021.1	0	.	.	.	.	.	.	.	.	.	.	G	10.56	1.384455	0.25031	.	.	ENSG00000121152	ENST00000240423;ENST00000427946;ENST00000435975;ENST00000455200	T;T;T;T	0.53857	0.67;0.68;0.6;0.67	5.38	4.48	0.54585	5.38	4.48	0.54585	.	0.274240	0.42053	N	0.000768	T	0.51346	0.1669	M	0.78049	2.395	0.21064	N	0.999798	B;B;P;B	0.38148	0.19;0.19;0.62;0.19	B;B;B;B	0.39617	0.172;0.172;0.305;0.172	T	0.49588	-0.8924	10	0.06625	T	0.88	-9.4799	12.9558	0.58427	0.0:0.0:0.8368:0.1632	.	336;349;349;360	B4DRG7;E9PHA2;C9J470;Q15003	.;.;.;CND2_HUMAN	Y	360;224;349;349	ENSP00000240423:D360Y;ENSP00000400774:D224Y;ENSP00000405237:D349Y;ENSP00000407308:D349Y	ENSP00000240423:D360Y	D	+	1	0	0	NCAPH	96383723	96383723	1.000000	0.71417	0.003000	0.11579	0.320000	0.28249	5.587000	0.67510	1.215000	0.43411	0.561000	0.74099	GAC	0.338876		TCGA-2J-AABA-01A-21D-A40W-08	0.512	NCAPH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252842.2	1	0	1		2	2	2	0		0	0	121		121	119	1	1.830000	-20.000000	1	0.340000	NM_015341			92	91		584	579	1		1	0		0	0	121	0		1.000000	9.358672e-02	0	1	0	3	0	92	584
TTN	7273	broad.mit.edu	37	2	179431867	179431867	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr2:179431867C>T	ENST00000591111.1	-	276	74293	c.74069G>A	c.(74068-74070)cGa>cAa	p.R24690Q	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R17266Q|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R26331Q|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R17391Q|TTN_ENST00000342992.6_Missense_Mutation_p.R23763Q|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R17458Q|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	24690	Fibronectin type-III 79. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCAGGCAAGTCGACTGGTTTC	0.413																																						ENST00000591111.1	1.000000	9.300000e-01	1.000000	0.990000	0.990000	0.996259	0.990000	1.000000																										0				1448						c.(74068-74070)cGa>cAa		titin							106.0	107.0	106.0					2																	179431867		1893	4112	6005	SO:0001583	missense	7273	5	120842	40				g.chr2:179431867C>T	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.74069G>A	chr2.hg19:g.179431867C>T	ENSP00000465570:p.Arg24690Gln	0					TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R23763Q|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R17266Q|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R26331Q|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R17458Q|TTN_ENST00000359218.5_Missense_Mutation_p.R17391Q|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592600.1_RNA	p.R24690Q			0	1	1	2.053808	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	276	74293	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	1	1	hg19	c.74069G>A		1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.045692	0.55110	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	5.52	5.52	0.82312	5.52	5.52	0.82312	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.74344	0.3704	M	0.76328	2.33	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.76844	-0.2809	9	0.87932	D	0	.	19.4392	0.94811	0.0:1.0:0.0:0.0	.	17266;17391;17458;24690	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	23763;17266;17458;17391;17264	ENSP00000343764:R23763Q;ENSP00000434586:R17266Q;ENSP00000340554:R17458Q;ENSP00000352154:R17391Q	ENSP00000340554:R17458Q	R	-	2	0	0	TTN	179140113	179140113	1.000000	0.71417	0.994000	0.49952	0.981000	0.71138	7.770000	0.85390	2.580000	0.87095	0.462000	0.41574	CGA	0.338876		TCGA-2J-AABA-01A-21D-A40W-08	0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	0	0	1		17	2	2	1		1	1	96		96	95	1	1.830000	-20.000000	1	0.340000	NM_133378			95	95		395	389	1		1			1	0	96	0		1.000000	0	0	0	0	0	0	95	395
ZBED2	79413	broad.mit.edu	37	3	111312977	111312977	+	Silent	SNP	C	C	T	rs145211272		TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr3:111312977C>T	ENST00000317012.4	-	2	1080	c.72G>A	c.(70-72)gaG>gaA	p.E24E	CD96_ENST00000352690.4_Intron|CD96_ENST00000438817.2_Intron|CD96_ENST00000283285.5_Intron	NM_024508.4	NP_078784.2	Q9BTP6	ZBED2_HUMAN	zinc finger, BED-type containing 2	24							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|lung(1)|skin(2)	6						TCTCTTCCTCCTCCTTCATCT	0.507																																						ENST00000317012.4	0.320000	8.000000e-02	0.250000	0.120000	0.170000	0.190721	0.170000	0.180000																										0				6						c.(70-72)gaG>gaA		zinc finger, BED-type containing 2		C	,,	0,4406		0,0,2203	269.0	222.0	238.0		,72,	0.7	1.0	3	dbSNP_134	238	3,8597	2.2+/-6.3	0,3,4297	no	intron,coding-synonymous,intron	CD96,ZBED2	NM_005816.4,NM_024508.4,NM_198196.2	,,	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	,,	,24/219,	111312977	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	79413	0	0					g.chr3:111312977C>T	BC003536	CCDS2960.2	3p13-q13.2	2013-05-03			ENSG00000177494	ENSG00000177494		"""Zinc fingers, BED-type"""	20710	protein-coding gene	gene with protein product		615246				23533661	Standard	NM_024508		Approved	MGC10796	uc003dxy.3	Q9BTP6	OTTHUMG00000074061	ENST00000317012.4:c.72G>A	chr3.hg19:g.111312977C>T		0					CD96_ENST00000438817.2_Intron|CD96_ENST00000352690.4_Intron|CD96_ENST00000283285.5_Intron	p.E24E	NM_024508.4	NP_078784.2	1	2	3	2.059806	Q9BTP6	ZBED2_HUMAN		2	1080	-			D3DN62	Silent	SNP	ENST00000317012.4	1	1	hg19	c.72G>A	CCDS2960.2	0																																																																																								0.341120		TCGA-2J-AABA-01A-21D-A40W-08	0.507	ZBED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157228.2	0	0	1		2	2	2	0		0	0	57		57	53	1	1.830000	-3.581752	1	0.340000	NM_024508			9	9		296	288	0		1	0		0	0	57	0		0.993678	2.447040e-01	0	1	0	28	0	9	296
ZNF35	7584	broad.mit.edu	37	3	44700479	44700479	+	Silent	SNP	C	C	T			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr3:44700479C>T	ENST00000396056.2	+	4	859	c.624C>T	c.(622-624)ggC>ggT	p.G208G	ZNF35_ENST00000542250.1_Silent_p.G48G|RP11-944L7.4_ENST00000457331.1_RNA|ZNF35_ENST00000296092.3_3'UTR	NM_003420.3	NP_003411.3	P13682	ZNF35_HUMAN	zinc finger protein 35	208	Globular domain.				cellular response to retinoic acid (GO:0071300)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cell (GO:0005623)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G208G(1)		large_intestine(3)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	12		Ovarian(412;0.0228)		OV - Ovarian serous cystadenocarcinoma(275;2.49e-27)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)		TTAATTCTGGCGCTGTTAAAA	0.413																																						ENST00000396056.2	0.120000	2.000000e-02	0.100000	0.040000	0.060000	0.070886	0.060000	0.060000																										1	Substitution - coding silent(1)	p.G208G(1)	lung(1)	12						c.(622-624)ggC>ggT		zinc finger protein 35							74.0	77.0	76.0					3																	44700479		2203	4300	6503	SO:0001819	synonymous_variant	7584	1	121412	36				g.chr3:44700479C>T	X07289	CCDS2718.2	3p21.32	2013-01-08	2006-05-11		ENSG00000169981	ENSG00000169981		"""Zinc fingers, C2H2-type"""	13099	protein-coding gene	gene with protein product		194533	"""zinc finger protein 35 (clone HF.10)"""			2108922, 1572646	Standard	NM_003420		Approved	HF.10, HF10, Zfp105	uc003cnq.3	P13682	OTTHUMG00000133091	ENST00000396056.2:c.624C>T	chr3.hg19:g.44700479C>T		0					ZNF35_ENST00000542250.1_Silent_p.G48G|ZNF35_ENST00000296092.3_3'UTR|RP11-944L7.4_ENST00000457331.1_RNA	p.G208G	NM_003420.3	NP_003411.3	0	1	1	2.059351	P13682	ZNF35_HUMAN		4	859	+		Ovarian(412;0.0228)	B2RBU6|Q53Y54|Q96D01	Silent	SNP	ENST00000396056.2	0	1	hg19	c.624C>T	CCDS2718.2	0																																																																																								0.338876		TCGA-2J-AABA-01A-21D-A40W-08	0.413	ZNF35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256749.4	0	0	1		2	2	2	0		0	0	116		116	113	1	1.830000	-2.149243	0	0.340000	NM_003420			7	7		652	648	0		1	0		0	0	116	0		0.980146	8.222551e-03	0	0	0	11	0	7	652
MYL3	4634	broad.mit.edu	37	3	46902285	46902285	+	Missense_Mutation	SNP	C	C	T	rs139354105		TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr3:46902285C>T	ENST00000395869.1	-	3	239	c.188G>A	c.(187-189)cGc>cAc	p.R63H	MYL3_ENST00000292327.4_Missense_Mutation_p.R63H			P08590	MYL3_HUMAN	myosin, light chain 3, alkali; ventricular, skeletal, slow	63	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cardiac muscle contraction (GO:0060048)|muscle filament sliding (GO:0030049)|positive regulation of ATPase activity (GO:0032781)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|skeletal muscle tissue development (GO:0007519)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|cytosol (GO:0005829)|I band (GO:0031674)|muscle myosin complex (GO:0005859)|sarcomere (GO:0030017)	actin monomer binding (GO:0003785)|calcium ion binding (GO:0005509)|motor activity (GO:0003774)|myosin II heavy chain binding (GO:0032038)|structural constituent of muscle (GO:0008307)			breast(1)|lung(2)	3				BRCA - Breast invasive adenocarcinoma(193;0.00116)|KIRC - Kidney renal clear cell carcinoma(197;0.00557)|Kidney(197;0.0063)		CTTGGGTGTGCGGTCGAACAG	0.622																																					Melanoma(166;130 1949 2249 18977 46142)	ENST00000395869.1	0.120000	1.000000e-02	0.090000	0.030000	0.050000	0.062225	0.050000	0.060000																										0				3						c.(187-189)cGc>cAc		myosin, light chain 3, alkali; ventricular, skeletal, slow		C	HIS/ARG	0,4406		0,0,2203	119.0	117.0	118.0		188	4.4	1.0	3	dbSNP_134	118	1,8599	1.2+/-3.3	0,1,4299	no	missense	MYL3	NM_000258.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	63/196	46902285	1,13005	2203	4300	6503	SO:0001583	missense	4634	3	121412	38				g.chr3:46902285C>T		CCDS2746.1	3p	2014-09-17	2006-09-29		ENSG00000160808	ENSG00000160808		"""Myosins / Light chain"", ""EF-hand domain containing"""	7584	protein-coding gene	gene with protein product		160790	"""myosin, light polypeptide 3, alkali; ventricular, skeletal, slow"""			1479618, 2784124	Standard	NM_000258		Approved	CMH8, VLC1, MLC1V, MLC1SB	uc003cql.1	P08590	OTTHUMG00000133516	ENST00000395869.1:c.188G>A	chr3.hg19:g.46902285C>T	ENSP00000379210:p.Arg63His	0					MYL3_ENST00000292327.4_Missense_Mutation_p.R63H	p.R63H			0	1	1	2.059351	P08590	MYL3_HUMAN		3	239	-			B2R534|Q9NRS8	Missense_Mutation	SNP	ENST00000395869.1	0	1	hg19	c.188G>A	CCDS2746.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.108683	0.94292	0.0	1.16E-4	ENSG00000160808	ENST00000395869;ENST00000292327	D;D	0.85861	-2.04;-2.04	4.36	4.36	0.52297	4.36	4.36	0.52297	EF-hand-like domain (1);	0.000000	0.64402	D	0.000002	D	0.91341	0.7269	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	P	0.60541	0.876	D	0.92718	0.6189	10	0.87932	D	0	-17.4592	14.7939	0.69863	0.0:1.0:0.0:0.0	.	63	P08590	MYL3_HUMAN	H	63	ENSP00000379210:R63H;ENSP00000292327:R63H	ENSP00000292327:R63H	R	-	2	0	0	MYL3	46877289	46877289	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.879000	0.69690	2.415000	0.81967	0.563000	0.77884	CGC	0.338876		TCGA-2J-AABA-01A-21D-A40W-08	0.622	MYL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259165.2	0	0	1		2	2	2	0		0	0	97		97	95	1	1.830000	-1.860039	0	0.340000	NM_000258			5	5		557	551	0		1	0		0	0	97	0		0.936018	7.759968e-04	0	0	0	4	0	5	557
IQCF2	389123	broad.mit.edu	37	3	51897313	51897313	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr3:51897313G>A	ENST00000333127.3	+	3	451	c.422G>A	c.(421-423)tGc>tAc	p.C141Y	IQCF2_ENST00000429548.1_3'UTR	NM_203424.1	NP_982248.1	Q8IXL9	IQCF2_HUMAN	IQ motif containing F2	141										endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TGCCAGACCTGCGCTCTCCTC	0.567																																						ENST00000333127.3	0.920000	5.700000e-01	0.830000	0.640000	0.730000	0.741010	0.730000	0.740000																										0				10						c.(421-423)tGc>tAc		IQ motif containing F2							113.0	107.0	109.0					3																	51897313		2203	4300	6503	SO:0001583	missense	389123	0	0					g.chr3:51897313G>A	AK128883	CCDS2835.1	3p21.31	2008-02-05			ENSG00000184345	ENSG00000184345			31815	protein-coding gene	gene with protein product							Standard	NM_203424		Approved		uc003dbt.1	Q8IXL9	OTTHUMG00000156914	ENST00000333127.3:c.422G>A	chr3.hg19:g.51897313G>A	ENSP00000329904:p.Cys141Tyr	0					IQCF2_ENST00000429548.1_3'UTR	p.C141Y	NM_203424.1	NP_982248.1	1	2	3	2.059806	Q8IXL9	IQCF2_HUMAN		3	451	+				Missense_Mutation	SNP	ENST00000333127.3	1	1	hg19	c.422G>A	CCDS2835.1	0	.	.	.	.	.	.	.	.	.	.	G	16.90	3.250045	0.59212	.	.	ENSG00000184345	ENST00000333127	T	0.30448	1.53	5.22	5.22	0.72569	5.22	5.22	0.72569	.	0.101398	0.44902	D	0.000401	T	0.44138	0.1279	L	0.36672	1.1	0.18873	N	0.999981	D	0.89917	1.0	D	0.68765	0.96	T	0.24119	-1.0169	10	0.54805	T	0.06	-19.2161	14.4799	0.67573	0.0:0.0:1.0:0.0	.	141	Q8IXL9	IQCF2_HUMAN	Y	141	ENSP00000329904:C141Y	ENSP00000329904:C141Y	C	+	2	0	0	IQCF2	51872353	51872353	0.948000	0.32251	0.293000	0.24932	0.943000	0.58893	2.580000	0.46068	2.866000	0.98385	0.650000	0.86243	TGC	0.341120		TCGA-2J-AABA-01A-21D-A40W-08	0.567	IQCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346594.1	1	0	1		2	2	2	0		0	0	74		74	73	1	1.830000	-19.999890	1	0.340000	NM_203424			61	61		428	425	1		1			0	0	74	0		1.000000	0	0	0	0	0	0	61	428
KLHL24	54800	broad.mit.edu	37	3	183368717	183368717	+	Silent	SNP	G	G	A			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr3:183368717G>A	ENST00000454652.2	+	4	959	c.573G>A	c.(571-573)gcG>gcA	p.A191A	KLHL24_ENST00000476808.1_Silent_p.A191A|KLHL24_ENST00000242810.6_Silent_p.A191A	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	191	BACK.					cell projection (GO:0042995)|cytoplasm (GO:0005737)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			AAAATTTTGCGTTACAGACTT	0.368																																						ENST00000454652.2	0.230000	5.000000e-02	0.170000	0.080000	0.120000	0.131609	0.120000	0.120000																										0				27						c.(571-573)gcG>gcA		kelch-like family member 24							100.0	102.0	101.0					3																	183368717		2203	4300	6503	SO:0001819	synonymous_variant	54800	0	0					g.chr3:183368717G>A		CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.573G>A	chr3.hg19:g.183368717G>A		0					KLHL24_ENST00000242810.6_Silent_p.A191A|KLHL24_ENST00000476808.1_Silent_p.A191A	p.A191A	NM_017644.3	NP_060114.2	1	2	3	2.059806	Q6TFL4	KLH24_HUMAN	all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)	4	959	+	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		A5PLN8|Q9H620|Q9NXT9	Silent	SNP	ENST00000454652.2	0	1	hg19	c.573G>A	CCDS3246.1	0																																																																																								0.341120		TCGA-2J-AABA-01A-21D-A40W-08	0.368	KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346586.2	0	0	1		17	2	2	1		1	1	84		84	83	1	1.830000	-2.787841	1	0.340000	NM_017644			8	9		391	387	0		0	0		1	0	84	0		0.048487	2.610030e-02	0	0	0	11	0	8	391
QRFPR	84109	broad.mit.edu	37	4	122258001	122258001	+	Silent	SNP	G	G	A			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr4:122258001G>A	ENST00000394427.2	-	3	933	c.522C>T	c.(520-522)gtC>gtT	p.V174V	QRFPR_ENST00000334383.5_Silent_p.V174V	NM_198179.2	NP_937822.2	Q96P65	QRFPR_HUMAN	pyroglutamylated RFamide peptide receptor	174					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(2)|skin(3)|stomach(1)	28						ATCCTACGATGACTGCCACCA	0.413																																						ENST00000394427.2	1.000000	8.700000e-01	1.000000	0.940000	0.990000	0.980720	0.990000	1.000000																										0				28						c.(520-522)gtC>gtT		pyroglutamylated RFamide peptide receptor							229.0	216.0	220.0					4																	122258001		2203	4300	6503	SO:0001819	synonymous_variant	84109	0	0					g.chr4:122258001G>A	AF411117	CCDS3719.1	4q27	2012-08-10	2008-12-18	2008-12-18	ENSG00000186867	ENSG00000186867		"""GPCR / Class A : RF amide peptide receptors"""	15565	protein-coding gene	gene with protein product		606925	"""G protein-coupled receptor 103"""	GPR103		11574155	Standard	NM_198179		Approved		uc010inj.1	Q96P65	OTTHUMG00000133036	ENST00000394427.2:c.522C>T	chr4.hg19:g.122258001G>A		0					QRFPR_ENST00000334383.5_Silent_p.V174V	p.V174V	NM_198179.2	NP_937822.2	1	2	3	2.063727	Q96P65	QRFPR_HUMAN		3	933	-				Silent	SNP	ENST00000394427.2	1	1	hg19	c.522C>T	CCDS3719.1	1																																																																																								0.341120		TCGA-2J-AABA-01A-21D-A40W-08	0.413	QRFPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256641.2	1	0	1		2	2	2	0		0	0	147		147	143	1	1.830000	-20.000000	1	0.340000	NM_198179			152	150		724	709	1		1			0	0	147	0		1.000000	0	0	0	0	0	0	152	724
JAKMIP1	152789	broad.mit.edu	37	4	6107417	6107417	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr4:6107417G>A	ENST00000282924.5	-	3	892	c.407C>T	c.(406-408)gCg>gTg	p.A136V	JAKMIP1_ENST00000409021.3_Missense_Mutation_p.A136V|JAKMIP1_ENST00000409831.1_Missense_Mutation_p.A136V|JAKMIP1_ENST00000409371.3_Intron|JAKMIP1_ENST00000410077.2_Intron|JAKMIP1_ENST00000457227.2_Intron	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	136	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTCCTCGCGCGCCTCGGTCAG	0.706																																						ENST00000282924.5	1.000000	6.900000e-01	1.000000	0.900000	0.990000	0.962237	0.990000	1.000000																										0				42						c.(406-408)gCg>gTg		janus kinase and microtubule interacting protein 1							15.0	14.0	14.0					4																	6107417		2197	4288	6485	SO:0001583	missense	152789	0	0					g.chr4:6107417G>A	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.407C>T	chr4.hg19:g.6107417G>A	ENSP00000282924:p.Ala136Val	0					JAKMIP1_ENST00000410077.2_Intron|JAKMIP1_ENST00000409831.1_Missense_Mutation_p.A136V|JAKMIP1_ENST00000409021.3_Missense_Mutation_p.A136V|JAKMIP1_ENST00000457227.2_Intron|JAKMIP1_ENST00000409371.3_Intron	p.A136V	NM_144720.3	NP_653321.1	1	2	3	2.063727	Q96N16	JKIP1_HUMAN		3	892	-			A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000282924.5	1	1	hg19	c.407C>T	CCDS3385.1	1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.438645	0.62955	.	.	ENSG00000152969	ENST00000409021;ENST00000418227;ENST00000425341;ENST00000282924;ENST00000409831	T;T;T	0.06687	3.27;3.27;3.27	4.6	3.74	0.42951	4.6	3.74	0.42951	.	0.081594	0.51477	D	0.000100	T	0.09598	0.0236	L	0.54323	1.7	0.80722	D	1	B;B;B	0.28850	0.225;0.01;0.225	B;B;B	0.20767	0.031;0.005;0.031	T	0.07731	-1.0757	10	0.72032	D	0.01	.	12.6579	0.56797	0.0865:0.0:0.9135:0.0	.	136;136;136	F2Z2K5;Q96N16-2;Q96N16	.;.;JKIP1_HUMAN	V	136	ENSP00000386711:A136V;ENSP00000282924:A136V;ENSP00000386925:A136V	ENSP00000282924:A136V	A	-	2	0	0	JAKMIP1	6158318	6158318	1.000000	0.71417	0.981000	0.43875	0.781000	0.44180	6.134000	0.71689	2.259000	0.74868	0.484000	0.47621	GCG	0.341120		TCGA-2J-AABA-01A-21D-A40W-08	0.706	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	1	0	1		2	2	2	0		0	0	14		14	13	1	1.830000	-20.000000	1	0.340000	NM_144720			15	15		62	59	1		1			0	0	14	0		0.999903	0	0	0	0	0	0	15	62
DMP1	1758	broad.mit.edu	37	4	88583927	88583927	+	Missense_Mutation	SNP	G	G	A	rs147275271	byFrequency	TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr4:88583927G>A	ENST00000339673.6	+	6	1096	c.997G>A	c.(997-999)Gta>Ata	p.V333I	DMP1_ENST00000282479.7_Missense_Mutation_p.V317I|RP11-742B18.1_ENST00000507894.1_RNA|RP11-742B18.1_ENST00000506480.1_RNA|RP11-742B18.1_ENST00000506814.1_RNA	NM_004407.3	NP_004398.1	Q13316	DMP1_HUMAN	dentin matrix acidic phosphoprotein 1	333					biomineral tissue development (GO:0031214)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|positive regulation of cell-substrate adhesion (GO:0010811)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(1)|stomach(1)	32		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)		OV - Ovarian serous cystadenocarcinoma(123;0.000516)		GAGCCAAAACGTAGATGGTCC	0.547													G|||	8	0.00159744	0.0053	0.0	5008	,	,		19645	0.0		0.0	False		,,,				2504	0.001					ENST00000339673.6	0.980000	5.100000e-01	0.850000	0.610000	0.720000	0.735711	0.720000	0.720000																										0				32						c.(997-999)Gta>Ata		dentin matrix acidic phosphoprotein 1		G	ILE/VAL,ILE/VAL	9,4397	16.8+/-37.8	0,9,2194	101.0	97.0	98.0		949,997	-4.4	0.0	4	dbSNP_134	98	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	DMP1	NM_001079911.2,NM_004407.3	29,29	0,10,6493	AA,AG,GG		0.0116,0.2043,0.0769	benign,benign	317/498,333/514	88583927	10,12996	2203	4300	6503	SO:0001583	missense	1758	31	121412	48				g.chr4:88583927G>A	U34037	CCDS3623.1, CCDS43249.1	4q21	2008-08-29	2008-08-29		ENSG00000152592	ENSG00000152592			2932	protein-coding gene	gene with protein product		600980	"""dentin matrix acidic phosphoprotein"""			8586437, 9177774	Standard	NM_001079911		Approved		uc003hqv.3	Q13316	OTTHUMG00000130598	ENST00000339673.6:c.997G>A	chr4.hg19:g.88583927G>A	ENSP00000340935:p.Val333Ile	0					RP11-742B18.1_ENST00000507894.1_RNA|DMP1_ENST00000282479.7_Missense_Mutation_p.V317I|RP11-742B18.1_ENST00000506814.1_RNA|RP11-742B18.1_ENST00000506480.1_RNA	p.V333I	NM_004407.3	NP_004398.1	1	2	3	2.063727	Q13316	DMP1_HUMAN		6	1096	+		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)	A1L4L3|O43265	Missense_Mutation	SNP	ENST00000339673.6	1	1	hg19	c.997G>A	CCDS3623.1	0	.	.	.	.	.	.	.	.	.	.	G	3.132	-0.178230	0.06380	0.002043	1.16E-4	ENSG00000152592	ENST00000339673;ENST00000282479	T;T	0.51325	0.71;0.71	5.11	-4.38	0.03622	5.11	-4.38	0.03622	.	2.186990	0.01837	N	0.035040	T	0.25791	0.0628	L	0.27053	0.805	0.09310	N	1	B;P	0.34662	0.407;0.462	B;B	0.29785	0.065;0.107	T	0.05954	-1.0854	10	0.21540	T	0.41	1.4837	0.1494	0.00091	0.3024:0.2321:0.2291:0.2365	.	317;333	Q13316-2;Q13316	.;DMP1_HUMAN	I	333;317	ENSP00000340935:V333I;ENSP00000282479:V317I	ENSP00000282479:V317I	V	+	1	0	0	DMP1	88802951	88802951	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.407000	0.07178	-0.887000	0.03961	-1.724000	0.00704	GTA	0.341120		TCGA-2J-AABA-01A-21D-A40W-08	0.547	DMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253047.1	1	0	1		2	2	2	0		0	0	38		38	38	1	1.830000	-6.470585	1	0.340000				33	33		235	234	1		1			0	0	38	0		1.000000	0	0	0	0	0	0	33	235
FBXW7	55294	broad.mit.edu	37	4	153244139	153244139	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr4:153244139C>T	ENST00000281708.4	-	12	3247	c.2018G>A	c.(2017-2019)tGg>tAg	p.W673*	RP11-461L13.3_ENST00000603766.1_lincRNA|FBXW7_ENST00000603548.1_Nonsense_Mutation_p.W673*|FBXW7_ENST00000393956.3_Nonsense_Mutation_p.W497*|FBXW7_ENST00000263981.5_Nonsense_Mutation_p.W593*|FBXW7_ENST00000603841.1_Nonsense_Mutation_p.W673*|FBXW7_ENST00000296555.5_Nonsense_Mutation_p.W555*	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	673					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TCTGATCCGCCACACAACTCC	0.498			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																	ENST00000281708.4	0.890000	5.900000e-01	0.810000	0.660000	0.730000	0.739678	0.730000	0.740000				Rec	yes			Rec	yes		4	4q31.3	4q31.3	55294	Mis, N, D, F	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""				"""E, L"""	E, L			colorectal, endometrial, T-ALL		1	Unknown(1)	p.?(1)	haematopoietic_and_lymphoid_tissue(1)	462						c.(2017-2019)tGg>tAg		F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase							186.0	183.0	184.0					4																	153244139		2203	4300	6503	SO:0001587	stop_gained	55294	0	0					g.chr4:153244139C>T	AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.2018G>A	chr4.hg19:g.153244139C>T	ENSP00000281708:p.Trp673*	0					FBXW7_ENST00000296555.5_Nonsense_Mutation_p.W555*|FBXW7_ENST00000263981.5_Nonsense_Mutation_p.W593*|FBXW7_ENST00000603841.1_Nonsense_Mutation_p.W673*|FBXW7_ENST00000393956.3_Nonsense_Mutation_p.W497*|FBXW7_ENST00000603548.1_Nonsense_Mutation_p.W673*|RP11-461L13.3_ENST00000603766.1_lincRNA	p.W673*	NM_033632.3	NP_361014.1	1	2	3	2.063727	Q969H0	FBXW7_HUMAN		12	3247	-	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Nonsense_Mutation	SNP	ENST00000281708.4	0	1	hg19	c.2018G>A	CCDS3777.1	0	.	.	.	.	.	.	.	.	.	.	C	27.4	4.827871	0.90955	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	.	.	.	5.67	5.67	0.87782	5.67	5.67	0.87782	.	0.119994	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.4663	19.7667	0.96346	0.0:1.0:0.0:0.0	.	.	.	.	X	673;555;593;497	.	ENSP00000263981:W593X	W	-	2	0	0	FBXW7	153463589	153463589	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.794000	0.85869	2.681000	0.91329	0.655000	0.94253	TGG	0.341120		TCGA-2J-AABA-01A-21D-A40W-08	0.498	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1	1	0	1		2	2	2	0		0	0	113		113	110	1	1.830000	-20.000000	1	0.340000				89	87		624	613	0		1	1	1	0	0	113	759		1.000000	6.466035e-01	1	4	129	13	584	89	624
CMYA5	202333	broad.mit.edu	37	5	79029066	79029066	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr5:79029066A>G	ENST00000446378.2	+	2	4509	c.4478A>G	c.(4477-4479)gAc>gGc	p.D1493G		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1493					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AGGGTAGAAGACAAACAAGAT	0.398																																						ENST00000446378.2	1.000000	6.200000e-01	0.900000	0.690000	0.780000	0.799112	0.780000	0.780000																										0				128						c.(4477-4479)gAc>gGc		cardiomyopathy associated 5							121.0	116.0	118.0					5																	79029066		1854	4098	5952	SO:0001583	missense	202333	0	0					g.chr5:79029066A>G	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.4478A>G	chr5.hg19:g.79029066A>G	ENSP00000394770:p.Asp1493Gly	0						p.D1493G	NM_153610.3	NP_705838.3	1	2	3	2.127722	Q8N3K9	CMYA5_HUMAN		2	4509	+		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	1	1	hg19	c.4478A>G	CCDS47238.1	0	.	.	.	.	.	.	.	.	.	.	A	0.115	-1.132640	0.01756	.	.	ENSG00000164309	ENST00000446378	T	0.44881	0.91	5.32	2.9	0.33743	5.32	2.9	0.33743	.	0.493610	0.17051	N	0.188919	T	0.21347	0.0514	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.17592	-1.0364	10	0.15952	T	0.53	.	6.9254	0.24412	0.8161:0.0:0.1839:0.0	.	1493	Q8N3K9	CMYA5_HUMAN	G	1493	ENSP00000394770:D1493G	ENSP00000394770:D1493G	D	+	2	0	0	CMYA5	79064822	79064822	0.000000	0.05858	0.042000	0.18584	0.034000	0.12701	0.586000	0.23894	1.058000	0.40530	0.533000	0.62120	GAC	0.352115		TCGA-2J-AABA-01A-21D-A40W-08	0.398	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	1	0	1		2	2	2	0		0	0	128		128	125	1	1.830000	-20.000000	1	0.340000	NM_153610			79	79		532	526	1		1			0	0	128	0		1.000000	0	0	0	0	0	0	79	532
SQSTM1	8878	broad.mit.edu	37	5	179247944	179247944	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr5:179247944C>T	ENST00000389805.4	+	1	186	c.8C>T	c.(7-9)tCg>tTg	p.S3L	SQSTM1_ENST00000510187.1_Missense_Mutation_p.S3L|SQSTM1_ENST00000376929.3_Intron|SQSTM1_ENST00000360718.5_5'Flank|SQSTM1_ENST00000402874.3_5'UTR	NM_003900.4	NP_003891.1	Q13501	SQSTM_HUMAN	sequestosome 1	3	Interaction with LCK.				apoptotic signaling pathway (GO:0097190)|autophagy (GO:0006914)|cell differentiation (GO:0030154)|endosomal transport (GO:0016197)|immune system process (GO:0002376)|intracellular signal transduction (GO:0035556)|macroautophagy (GO:0016236)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein heterooligomerization (GO:0051291)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of Ras protein signal transduction (GO:0046578)|response to stress (GO:0006950)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|lysosome (GO:0005764)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)		SQSTM1/ALK(2)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(5)|ovary(1)	13	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCTATGGCGTCGCTCACCGTG	0.711																																						ENST00000389805.4	1.000000	2.200000e-01	0.770000	0.340000	0.500000	0.553409	0.500000	0.460000																									SQSTM1/ALK(2)	0				13						c.(7-9)tCg>tTg		sequestosome 1							9.0	10.0	10.0					5																	179247944		2069	4078	6147	SO:0001583	missense	8878	2	118576	29				g.chr5:179247944C>T	U46751	CCDS34317.1, CCDS47355.1	5q35	2008-02-05	2004-04-15		ENSG00000161011	ENSG00000161011			11280	protein-coding gene	gene with protein product		601530	"""Paget disease of bone 3"", ""oxidative stress induced like"""	PDB3, OSIL		8650207, 8551575	Standard	NM_003900		Approved	p62, p60, p62B, A170	uc003mkw.4	Q13501	OTTHUMG00000150643	ENST00000389805.4:c.8C>T	chr5.hg19:g.179247944C>T	ENSP00000374455:p.Ser3Leu	0					SQSTM1_ENST00000360718.5_5'Flank|SQSTM1_ENST00000402874.3_5'UTR|SQSTM1_ENST00000376929.3_Intron|SQSTM1_ENST00000510187.1_Missense_Mutation_p.S3L	p.S3L	NM_003900.4	NP_003891.1	1	2	3	2.127722	Q13501	SQSTM_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	1	186	+	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	A6NFN7|B2R661|B3KUW5|Q13446|Q9BUV7|Q9BVS6|Q9UEU1	Missense_Mutation	SNP	ENST00000389805.4	1	1	hg19	c.8C>T	CCDS34317.1	0	.	.	.	.	.	.	.	.	.	.	C	19.75	3.885955	0.72410	.	.	ENSG00000161011	ENST00000389805;ENST00000504627;ENST00000510187	D;T;T	0.84944	-1.92;1.3;2.08	4.57	0.299	0.15771	4.57	0.299	0.15771	Phox/Bem1p (1);	0.320727	0.25402	U	0.030926	T	0.72479	0.3465	L	0.58101	1.795	0.80722	D	1	P;B	0.51351	0.944;0.065	B;B	0.30179	0.112;0.004	T	0.68078	-0.5504	10	0.72032	D	0.01	-10.7097	4.5537	0.12126	0.1172:0.5961:0.1275:0.1592	.	3;3	Q13501;E7EMC7	SQSTM_HUMAN;.	L	3	ENSP00000374455:S3L;ENSP00000425957:S3L;ENSP00000424477:S3L	ENSP00000374455:S3L	S	+	2	0	0	SQSTM1	179180550	179180550	1.000000	0.71417	0.428000	0.26697	0.461000	0.32589	2.655000	0.46707	0.309000	0.22966	0.462000	0.41574	TCG	0.352115		TCGA-2J-AABA-01A-21D-A40W-08	0.711	SQSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319344.1	1	0	1		2	2	2	0		0	0	23		23	22	1	1.830000	-12.156160	1	0.340000				7	6		83	83	0		1	1		0	0	23	0		0.981287	9.999971e-01	0	171	0	298	0	7	83
RNF8	9025	broad.mit.edu	37	6	37349011	37349011	+	Missense_Mutation	SNP	G	G	A	rs553505501		TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr6:37349011G>A	ENST00000373479.4	+	7	1515	c.1322G>A	c.(1321-1323)cGg>cAg	p.R441Q	RNF8_ENST00000469731.1_Intron	NM_003958.3|NM_183078.2	NP_003949.1|NP_898901.1	O76064	RNF8_HUMAN	ring finger protein 8, E3 ubiquitin protein ligase	441					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|histone exchange (GO:0043486)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A ubiquitination (GO:0033522)|histone H2B ubiquitination (GO:0033523)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|mitotic nuclear division (GO:0007067)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|response to ionizing radiation (GO:0010212)|spermatid development (GO:0007286)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome, telomeric region (GO:0000781)|nucleolus (GO:0005730)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	13						CCCATTTGTCGGAAGGACATT	0.413																																						ENST00000373479.4	0.140000	2.000000e-02	0.110000	0.040000	0.060000	0.077150	0.060000	0.070000																										0				13						c.(1321-1323)cGg>cAg		ring finger protein 8, E3 ubiquitin protein ligase							156.0	136.0	143.0					6																	37349011		2203	4300	6503	SO:0001583	missense	9025	1	121412	39				g.chr6:37349011G>A	AB012770	CCDS4833.1, CCDS4834.1	6p21.3	2013-01-09	2012-02-23		ENSG00000112130	ENSG00000112130		"""RING-type (C3HC4) zinc fingers"""	10071	protein-coding gene	gene with protein product		611685	"""ring finger protein (C3HC4 type) 8"", ""ring finger protein 8"""			9734811, 9852682	Standard	NM_003958		Approved	KIAA0646	uc003onq.4	O76064	OTTHUMG00000014620	ENST00000373479.4:c.1322G>A	chr6.hg19:g.37349011G>A	ENSP00000362578:p.Arg441Gln	0					RNF8_ENST00000469731.1_Intron	p.R441Q	NM_003958.3|NM_183078.2	NP_003949.1|NP_898901.1	0	0	0	1.970790	O76064	RNF8_HUMAN		7	1515	+			A6NN24|A8MYC0|B4DPG0|Q53H16|Q5NKW5	Missense_Mutation	SNP	ENST00000373479.4	0	1	hg19	c.1322G>A	CCDS4834.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.473197	0.96274	.	.	ENSG00000112130	ENST00000373479	T	0.60797	0.16	6.08	6.08	0.98989	6.08	6.08	0.98989	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);	0.068846	0.64402	D	0.000015	T	0.78136	0.4236	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.79631	-0.1723	10	0.66056	D	0.02	-13.1243	19.6603	0.95864	0.0:0.0:1.0:0.0	.	441	O76064	RNF8_HUMAN	Q	441	ENSP00000362578:R441Q	ENSP00000362578:R441Q	R	+	2	0	0	RNF8	37456989	37456989	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	9.869000	0.99810	2.894000	0.99253	0.591000	0.81541	CGG	0.309479		TCGA-2J-AABA-01A-21D-A40W-08	0.413	RNF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040403.2	0	0	1		16	3	2	1		1	1	95		95	92	1	1.830000	-2.516899	1	0.340000				5	5		428	427	0		0	0		1	0	95	0		0.012078	1.003162e-02	0	0	0	29	0	5	428
LY86	9450	broad.mit.edu	37	6	6589102	6589102	+	Splice_Site	SNP	C	C	T	rs201912095		TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr6:6589102C>T	ENST00000379953.2	+	2	487	c.135C>T	c.(133-135)tgC>tgT	p.C45C	LY86-AS1_ENST00000435641.1_RNA|LY86-AS1_ENST00000447858.1_RNA|LY86-AS1_ENST00000429345.1_RNA|LY86_ENST00000230568.4_Splice_Site_p.C45C			O95711	LY86_HUMAN	lymphocyte antigen 86	45					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				large_intestine(2)|lung(6)	8	Ovarian(93;0.0377)					ACCAGAGTTGCGGTAAGCCCT	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		13745	0.001		0.0	False		,,,				2504	0.0					ENST00000379953.2	1.000000	7.500000e-01	0.980000	0.840000	0.920000	0.916664	0.920000	0.990000																										0				8						c.(133-135)tgC>tgT		lymphocyte antigen 86		C		0,4406		0,0,2203	78.0	73.0	75.0		135	-5.1	0.9	6		75	2,8598	2.2+/-6.3	0,2,4298	yes	coding-synonymous-near-splice	LY86	NM_004271.3		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		45/163	6589102	2,13004	2203	4300	6503	SO:0001630	splice_region_variant	9450	55	121412	47				g.chr6:6589102C>T	AF057178	CCDS4498.1	6p24.3	2010-07-08			ENSG00000112799	ENSG00000112799			16837	protein-coding gene	gene with protein product		605241				9763566	Standard	NM_004271		Approved	MD-1, dJ80N2.1	uc003mwy.1	O95711	OTTHUMG00000014190	ENST00000379953.2:c.136+1C>T	chr6.hg19:g.6589102C>T		1					LY86-AS1_ENST00000429345.1_RNA|LY86_ENST00000230568.4_Splice_Site_p.C45C|LY86-AS1_ENST00000447858.1_RNA|LY86-AS1_ENST00000435641.1_RNA	p.C45C			0	1	1	1.713140	O95711	LY86_HUMAN		2	487	+	Ovarian(93;0.0377)		Q9UQC4	Splice_Site	SNP	ENST00000379953.2	1	0	hg19	c.135C>T	CCDS4498.1	1																																																																																								0.204819		TCGA-2J-AABA-01A-21D-A40W-08	0.587	LY86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039762.2	1	0	1		2	2	2	0		0	0	56		56	54	1	1.830000	-3.627983	1	0.340000		Silent		50	50		184	179	1		1	0		0	0	56	0		1.000000	5.399564e-01	0	0	0	8	0	50	184
RREB1	6239	broad.mit.edu	37	6	7230223	7230223	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr6:7230223G>A	ENST00000349384.6	+	10	2205	c.1891G>A	c.(1891-1893)Ggc>Agc	p.G631S	RREB1_ENST00000334984.6_Missense_Mutation_p.G631S|RREB1_ENST00000379938.2_Missense_Mutation_p.G631S|RREB1_ENST00000379933.3_Missense_Mutation_p.G631S	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	631					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				GACAGCGCCCGGCGGCAAGAA	0.637																																						ENST00000349384.6	0.390000	6.000000e-02	0.290000	0.110000	0.180000	0.203336	0.180000	0.170000																										0				58						c.(1891-1893)Ggc>Agc		ras responsive element binding protein 1							21.0	23.0	23.0					6																	7230223		2201	4297	6498	SO:0001583	missense	6239	0	0					g.chr6:7230223G>A	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.1891G>A	chr6.hg19:g.7230223G>A	ENSP00000305560:p.Gly631Ser	1					RREB1_ENST00000379938.2_Missense_Mutation_p.G631S|RREB1_ENST00000334984.6_Missense_Mutation_p.G631S|RREB1_ENST00000379933.3_Missense_Mutation_p.G631S	p.G631S	NM_001003698.3	NP_001003698.1	0	1	1	1.713140	Q92766	RREB1_HUMAN		10	2205	+	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	0	1	hg19	c.1891G>A	CCDS34336.1	0	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.475359	0.00167	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984;ENST00000483150	T;T;T;T;T	0.11604	2.97;2.94;2.97;2.76;2.86	5.13	0.216	0.15258	5.13	0.216	0.15258	.	0.747822	0.12041	N	0.505003	T	0.01800	0.0057	N	0.16478	0.41	0.09310	N	1	B;B;B	0.29188	0.236;0.039;0.007	B;B;B	0.19148	0.024;0.005;0.006	T	0.42515	-0.9447	10	0.33141	T	0.24	-14.9214	10.9984	0.47591	0.4186:0.0:0.5814:0.0	.	631;631;631	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	S	631	ENSP00000369265:G631S;ENSP00000369270:G631S;ENSP00000305560:G631S;ENSP00000335574:G631S;ENSP00000419511:G631S	ENSP00000335574:G631S	G	+	1	0	0	RREB1	7175222	7175222	0.000000	0.05858	0.002000	0.10522	0.012000	0.07955	-0.002000	0.12924	-0.418000	0.07450	-0.977000	0.02584	GGC	0.204819		TCGA-2J-AABA-01A-21D-A40W-08	0.637	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1	0	0	1		2	2	2	0		0	0	15		15	13	1	1.830000	-7.045847	1	0.340000				4	4		110	109	0		1	0		0	0	15	0		0.889606	1.961137e-02	0	0	0	5	0	4	110
GUCA1B	2979	broad.mit.edu	37	6	42152645	42152645	+	Missense_Mutation	SNP	G	G	T	rs370510441		TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr6:42152645G>T	ENST00000230361.3	-	4	606	c.511C>A	c.(511-513)Cgt>Agt	p.R171S		NM_002098.5	NP_002089.4	Q9UMX6	GUC1B_HUMAN	guanylate cyclase activator 1B (retina)	171	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				body fluid secretion (GO:0007589)|cell-cell signaling (GO:0007267)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			large_intestine(3)|lung(3)|skin(2)	8	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00154)|STAD - Stomach adenocarcinoma(11;0.00177)			TTGTCCCGACGGGCACCTTCA	0.577																																						ENST00000230361.3	0.200000	3.000000e-02	0.150000	0.060000	0.090000	0.108731	0.090000	0.090000																										0				8						c.(511-513)Cgt>Agt		guanylate cyclase activator 1B (retina)							107.0	97.0	101.0					6																	42152645		2203	4300	6503	SO:0001583	missense	2979	0	0					g.chr6:42152645G>T	AF173227	CCDS4865.1	6p21.1	2013-02-14			ENSG00000112599	ENSG00000112599		"""EF-hand domain containing"""	4679	protein-coding gene	gene with protein product		602275				9119368	Standard	NM_002098		Approved	GCAP2, RP48	uc003orz.3	Q9UMX6	OTTHUMG00000014697	ENST00000230361.3:c.511C>A	chr6.hg19:g.42152645G>T	ENSP00000230361:p.Arg171Ser	0						p.R171S	NM_002098.5	NP_002089.4	0	0	0	1.970790	Q9UMX6	GUC1B_HUMAN	Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00154)|STAD - Stomach adenocarcinoma(11;0.00177)	4	606	-	Colorectal(47;0.196)		Q9NU15	Missense_Mutation	SNP	ENST00000230361.3	0	1	hg19	c.511C>A	CCDS4865.1	0	.	.	.	.	.	.	.	.	.	.	G	23.5	4.425131	0.83667	.	.	ENSG00000112599	ENST00000230361;ENST00000372949	T	0.54866	0.55	4.12	4.12	0.48240	4.12	4.12	0.48240	EF-hand-like domain (1);	0.052845	0.85682	D	0.000000	T	0.38026	0.1025	L	0.46157	1.445	0.80722	D	1	P	0.50369	0.934	B	0.43194	0.411	T	0.48958	-0.8988	10	0.87932	D	0	.	14.6554	0.68828	0.0:0.0:1.0:0.0	.	171	Q9UMX6	GUC1B_HUMAN	S	171;163	ENSP00000230361:R171S	ENSP00000230361:R171S	R	-	1	0	0	GUCA1B	42260623	42260623	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	4.425000	0.59875	2.243000	0.73865	0.655000	0.94253	CGT	0.309479		TCGA-2J-AABA-01A-21D-A40W-08	0.577	GUCA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040550.1	0	0	1		2	2	2	0		0	0	58		58	58	1	1.830000	-2.782677	1	0.340000	NM_002098			5	5		301	293	0		1	0		0	0	58	0		0.933599	2.557718e-03	0	0	0	4	0	5	301
EPHA7	2045	broad.mit.edu	37	6	93967819	93967819	+	Missense_Mutation	SNP	C	C	T	rs370400794		TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr6:93967819C>T	ENST00000369303.4	-	11	2292	c.2108G>A	c.(2107-2109)aGa>aAa	p.R703K		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	703	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		ATATCTACCTCTTGTAACAAC	0.343																																						ENST00000369303.4	1.000000	6.800000e-01	0.960000	0.780000	0.880000	0.878528	0.880000	0.930000																										0				112						c.(2107-2109)aGa>aAa		EPH receptor A7							86.0	86.0	86.0					6																	93967819		2203	4300	6503	SO:0001583	missense	2045	0	0					g.chr6:93967819C>T	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2108G>A	chr6.hg19:g.93967819C>T	ENSP00000358309:p.Arg703Lys	1						p.R703K	NM_004440.3	NP_004431.1	0	1	1	1.714906	Q15375	EPHA7_HUMAN		11	2292	-		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	1	1	hg19	c.2108G>A	CCDS5031.1	1	.	.	.	.	.	.	.	.	.	.	C	13.52	2.260255	0.39995	.	.	ENSG00000135333	ENST00000369303	D	0.81659	-1.52	6.06	6.06	0.98353	6.06	6.06	0.98353	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.72503	0.3468	N	0.17723	0.515	0.80722	D	1	P;D;D	0.62365	0.747;0.989;0.991	P;P;P	0.62089	0.778;0.837;0.898	T	0.68172	-0.5479	10	0.02654	T	1	.	20.6314	0.99525	0.0:1.0:0.0:0.0	.	699;698;703	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	K	703	ENSP00000358309:R703K	ENSP00000358309:R703K	R	-	2	0	0	EPHA7	94024540	94024540	1.000000	0.71417	1.000000	0.80357	0.580000	0.36256	6.063000	0.71162	2.885000	0.99019	0.579000	0.79373	AGA	0.204819		TCGA-2J-AABA-01A-21D-A40W-08	0.343	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1	1	0	1		2	2	2	0		0	0	59		59	57	1	1.830000	-3.323014	1	0.340000				44	43		183	178	1		1	1		0	0	59	0		1.000000	1.019112e-01	0	3	0	0	0	44	183
INTS1	26173	broad.mit.edu	37	7	1522220	1522220	+	Missense_Mutation	SNP	C	C	T	rs370023670		TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr7:1522220C>T	ENST00000404767.3	-	27	3750	c.3665G>A	c.(3664-3666)cGc>cAc	p.R1222H	INTS1_ENST00000389470.4_Missense_Mutation_p.R1384H	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	1222					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		ACGGATCATGCGCAGCTTCAG	0.667																																						ENST00000404767.3	1.000000	9.800000e-01	1.000000	0.990000	0.990000	0.998649	0.990000	1.000000																										0				62						c.(3664-3666)cGc>cAc		integrator complex subunit 1			HIS/ARG	1,4245		0,1,2122	45.0	55.0	52.0		3665	4.7	1.0	7		52	0,8476		0,0,4238	no	missense	INTS1	NM_001080453.2	29	0,1,6360	TT,TC,CC		0.0,0.0236,0.0079	probably-damaging	1222/2191	1522220	1,12721	2123	4238	6361	SO:0001583	missense	26173	2	121046	32				g.chr7:1522220C>T	AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.3665G>A	chr7.hg19:g.1522220C>T	ENSP00000385722:p.Arg1222His	0					INTS1_ENST00000389470.4_Missense_Mutation_p.R1384H	p.R1222H	NM_001080453.2	NP_001073922.2	1	2	3	2.088232	Q8N201	INT1_HUMAN		27	3750	-		Ovarian(82;0.0253)	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	ENST00000404767.3	1	1	hg19	c.3665G>A	CCDS47526.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.597216	0.96602	2.36E-4	0.0	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.59502	0.26;0.39	4.67	4.67	0.58626	4.67	4.67	0.58626	.	0.000000	0.45606	U	0.000346	T	0.70824	0.3268	M	0.69823	2.125	0.58432	D	0.999999	D	0.69078	0.997	P	0.56042	0.79	T	0.76599	-0.2900	10	0.87932	D	0	.	17.5786	0.87958	0.0:1.0:0.0:0.0	.	1222	Q8N201	INT1_HUMAN	H	1222;1384	ENSP00000385722:R1222H;ENSP00000374121:R1384H	ENSP00000374121:R1384H	R	-	2	0	0	INTS1	1488746	1488746	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	7.540000	0.82074	2.154000	0.67381	0.561000	0.74099	CGC	0.345563		TCGA-2J-AABA-01A-21D-A40W-08	0.667	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323683.1	1	0	1		21	5	2	1		1	1	44		44	42	1	1.830000	-20.000000	1	0.340000				64	63		241	235	0		1	1		1	0	44	0		1.000000	9.258303e-01	0	12	0	27	0	64	241
HOXA4	3201	broad.mit.edu	37	7	27169037	27169037	+	Missense_Mutation	SNP	C	C	T	rs200302499		TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr7:27169037C>T	ENST00000360046.5	-	2	835	c.770G>A	c.(769-771)cGc>cAc	p.R257H	HOXA-AS3_ENST00000518848.1_RNA|HOXA4_ENST00000428284.2_Missense_Mutation_p.R257H|HOXA3_ENST00000521401.1_Intron|RP1-170O19.22_ENST00000467897.2_RNA|HOXA3_ENST00000317201.2_5'Flank|HOXA-AS2_ENST00000521687.1_RNA|HOXA-AS2_ENST00000521159.1_RNA|HOXA-AS2_ENST00000517550.1_RNA	NM_002141.4	NP_002132.3	Q00056	HXA4_HUMAN	homeobox A4	257					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)	12						CTTGACCTGGCGCTCAGACAA	0.572																																						ENST00000360046.5	1.000000	8.000000e-01	1.000000	0.880000	0.980000	0.957452	0.980000	1.000000																										0				12						c.(769-771)cGc>cAc		homeobox A4		C	HIS/ARG	0,4406		0,0,2203	220.0	183.0	195.0		770	5.3	1.0	7		195	1,8599	1.2+/-3.3	0,1,4299	no	missense	HOXA4	NM_002141.4	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	257/321	27169037	1,13005	2203	4300	6503	SO:0001583	missense	3201	16	121412	46				g.chr7:27169037C>T		CCDS5405.1	7p15.2	2011-06-20	2005-12-22		ENSG00000197576	ENSG00000197576		"""Homeoboxes / ANTP class : HOXL subclass"""	5105	protein-coding gene	gene with protein product		142953	"""homeo box A4"""	HOX1D, HOX1		1973146, 1358459	Standard	NM_002141		Approved		uc003sym.4	Q00056	OTTHUMG00000023213	ENST00000360046.5:c.770G>A	chr7.hg19:g.27169037C>T	ENSP00000353151:p.Arg257His	0					HOXA3_ENST00000317201.2_5'Flank|HOXA4_ENST00000428284.2_Missense_Mutation_p.R257H|HOXA-AS2_ENST00000521687.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS2_ENST00000521159.1_RNA|HOXA3_ENST00000521401.1_Intron|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS2_ENST00000517550.1_RNA	p.R257H	NM_002141.4	NP_002132.3	1	2	3	2.088232	Q00056	HXA4_HUMAN		2	835	-			A4D180|O43366	Missense_Mutation	SNP	ENST00000360046.5	1	1	hg19	c.770G>A	CCDS5405.1	1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.837480	0.91117	0.0	1.16E-4	ENSG00000197576	ENST00000360046;ENST00000428284	D;D	0.96802	-4.13;-4.13	5.29	5.29	0.74685	5.29	5.29	0.74685	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.64402	D	0.000011	D	0.98438	0.9480	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99494	1.0951	10	0.87932	D	0	.	18.9816	0.92757	0.0:1.0:0.0:0.0	.	257	Q00056	HXA4_HUMAN	H	257	ENSP00000353151:R257H;ENSP00000408845:R257H	ENSP00000353151:R257H	R	-	2	0	0	HOXA4	27135562	27135562	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.728000	0.84847	2.485000	0.83878	0.555000	0.69702	CGC	0.345563		TCGA-2J-AABA-01A-21D-A40W-08	0.572	HOXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059534.4	1	0	1		2	2	2	0		0	0	110		110	107	1	1.830000	-3.156128	1	0.340000				83	83		416	413	1		1	0		0	0	110	0		1.000000	7.997745e-01	0	1	0	16	0	83	416
HECW1	23072	broad.mit.edu	37	7	43590047	43590047	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr7:43590047A>G	ENST00000395891.2	+	27	4857	c.4252A>G	c.(4252-4254)Acg>Gcg	p.T1418A	HECW1_ENST00000453890.1_Missense_Mutation_p.T1384A	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1418	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CTACAAGGTCACGGAAAGGGA	0.507																																						ENST00000395891.2	1.000000	1.100000e-01	0.460000	0.180000	0.290000	0.338492	0.290000	0.270000																										0				125						c.(4252-4254)Acg>Gcg		HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1							74.0	83.0	80.0					7																	43590047		2144	4263	6407	SO:0001583	missense	23072	0	0					g.chr7:43590047A>G	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.4252A>G	chr7.hg19:g.43590047A>G	ENSP00000379228:p.Thr1418Ala	0					HECW1_ENST00000453890.1_Missense_Mutation_p.T1384A	p.T1418A	NM_015052.3	NP_055867.3	1	2	3	2.088232	Q76N89	HECW1_HUMAN		27	4857	+			A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	0	1	hg19	c.4252A>G	CCDS5469.2	0	.	.	.	.	.	.	.	.	.	.	A	24.0	4.487153	0.84854	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.57273	0.41;0.41	5.62	5.62	0.85841	5.62	5.62	0.85841	HECT (4);	0.000000	0.85682	D	0.000000	T	0.60715	0.2290	L	0.31926	0.97	0.80722	D	1	D;B	0.55605	0.972;0.048	D;B	0.67231	0.95;0.027	T	0.56432	-0.7980	10	0.25751	T	0.34	.	15.8276	0.78727	1.0:0.0:0.0:0.0	.	1384;1418	B4DH42;Q76N89	.;HECW1_HUMAN	A	1418;1384;1418	ENSP00000379228:T1418A;ENSP00000407774:T1384A	ENSP00000265522:T1418A	T	+	1	0	0	HECW1	43556572	43556572	1.000000	0.71417	0.986000	0.45419	0.929000	0.56500	8.962000	0.93254	2.122000	0.65172	0.533000	0.62120	ACG	0.345563		TCGA-2J-AABA-01A-21D-A40W-08	0.507	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	0	0	1		2	2	2	0		0	0	19		19	19	1	1.830000	-8.669340	1	0.340000	NM_015052			5	5		105	105	0		1	0		0	0	19	0		0.939019	2.879528e-02	0	0	0	5	0	5	105
BLVRA	644	broad.mit.edu	37	7	43810766	43810766	+	Silent	SNP	A	A	T			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr7:43810766A>T	ENST00000402924.1	+	3	172	c.9A>T	c.(7-9)gcA>gcT	p.A3A	BLVRA_ENST00000265523.4_Silent_p.A3A	NM_001253823.1	NP_001240752.1	P53004	BIEA_HUMAN	biliverdin reductase A	3			A -> T (in dbSNP:rs699512). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8950184, ECO:0000269|Ref.4}.		heme catabolic process (GO:0042167)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	biliverdin reductase activity (GO:0004074)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(2)	12						AGATGAATGCAGAGGTGAGTT	0.463																																						ENST00000402924.1	1.000000	7.900000e-01	1.000000	0.910000	0.990000	0.969903	0.990000	1.000000																										0				12						c.(7-9)gcA>gcT		biliverdin reductase A							168.0	166.0	167.0					7																	43810766		2203	4300	6503	SO:0001819	synonymous_variant	644	0	0					g.chr7:43810766A>T	BC008456	CCDS5472.1	7p13	2012-10-02			ENSG00000106605	ENSG00000106605	1.3.1.24		1062	protein-coding gene	gene with protein product		109750		BLVR			Standard	NM_001253823		Approved		uc003tir.3	P53004	OTTHUMG00000128953	ENST00000402924.1:c.9A>T	chr7.hg19:g.43810766A>T		0					BLVRA_ENST00000265523.4_Silent_p.A3A	p.A3A	NM_001253823.1	NP_001240752.1	1	2	3	2.088232	P53004	BIEA_HUMAN		3	172	+			A8K747|O95019|Q86UX0|Q96QL4|Q9BRW8	Silent	SNP	ENST00000402924.1	1	1	hg19	c.9A>T	CCDS5472.1	1																																																																																								0.345563		TCGA-2J-AABA-01A-21D-A40W-08	0.463	BLVRA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339006.1	1	0	1		2	2	2	0		0	0	61		61	61	1	1.830000	-19.999950	1	0.340000	NM_000712			43	42		199	196	1		1	1		0	0	61	0		1.000000	9.997526e-01	0	14	0	47	0	43	199
WRN	7486	broad.mit.edu	37	8	30924630	30924630	+	Missense_Mutation	SNP	C	C	T	rs375762379		TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr8:30924630C>T	ENST00000298139.5	+	6	835	c.586C>T	c.(586-588)Cgc>Tgc	p.R196C		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	196	3'-5' exonuclease.|Interaction with WRNIP1. {ECO:0000250}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		CAAGTCTATCCGCTGTAGCAA	0.413			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	ENST00000298139.5	1.000000	6.600000e-01	0.990000	0.760000	0.870000	0.872277	0.870000	1.000000			yes	Rec		Werner Syndrome	yes	Rec		Werner Syndrome	8	8p12-p11.2	8p12-p11.2	7486	Mis, N, F, S	Werner syndrome (RECQL2)				"""L, E, M, O"""	L, E, M, O		osteosarcoma, meningioma, others			0				60						c.(586-588)Cgc>Tgc	Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome, RecQ helicase-like		C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	93.0	81.0	85.0		586	5.8	1.0	8		85	0,8600		0,0,4300	no	missense	WRN	NM_000553.4	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	196/1433	30924630	1,13005	2203	4300	6503	SO:0001583	missense	7486	1	121412	29	Werner syndrome	Familial Cancer Database	WS, Adult Progeria	g.chr8:30924630C>T		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.586C>T	chr8.hg19:g.30924630C>T	ENSP00000298139:p.Arg196Cys	0						p.R196C	NM_000553.4	NP_000544.2	0	1	1	2.053834	Q14191	WRN_HUMAN		6	835	+		Breast(100;0.195)	A1KYY9	Missense_Mutation	SNP	ENST00000298139.5	1	1	hg19	c.586C>T	CCDS6082.1	1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.886939	0.91814	2.27E-4	0.0	ENSG00000165392	ENST00000298139	T	0.63913	-0.07	5.82	5.82	0.92795	5.82	5.82	0.92795	-5&apos (2);Ribonuclease H-like (1); exonuclease (2);3&apos (2);	0.056461	0.64402	N	0.000001	D	0.85444	0.5698	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88398	0.3013	10	0.87932	D	0	-10.7416	19.6956	0.96023	0.0:1.0:0.0:0.0	.	196	Q14191	WRN_HUMAN	C	196	ENSP00000298139:R196C	ENSP00000298139:R196C	R	+	1	0	0	WRN	31044172	31044172	1.000000	0.71417	0.992000	0.48379	0.966000	0.64601	6.162000	0.71874	2.757000	0.94681	0.561000	0.74099	CGC	0.338876		TCGA-2J-AABA-01A-21D-A40W-08	0.413	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1	1	0	1		2	2	2	0		0	0	66		66	66	1	1.830000	-2.527547	1	0.340000				48	48		274	272	1		1	0		0	0	66	0		1.000000	2.326686e-02	0	1	0	1	0	48	274
RIMS2	9699	broad.mit.edu	37	8	105263381	105263381	+	Missense_Mutation	SNP	A	A	C			TCGA-2J-AABA-01A-21D-A40W-08	TCGA-2J-AABA-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	61e9c5f2-e782-404f-92f1-ecc78d28b285	702e85b0-5c6e-4945-a20a-37568587f243	g.chr8:105263381A>C	ENST00000436393.2	+	27	4116	c.3875A>C	c.(3874-3876)aAa>aCa	p.K1292T	RIMS2_ENST00000339750.2_Missense_Mutation_p.K210T|RIMS2_ENST00000262231.10_Missense_Mutation_p.K1113T|RIMS2_ENST00000406091.3_Missense_Mutation_p.K1274T|RIMS2_ENST00000507740.1_Missense_Mutation_p.K1088T			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1336	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CCACAAGGAAAAGTTTTACAG	0.368										HNSCC(12;0.0054)																												ENST00000436393.2	1.000000	5.500000e-01	1.000000	0.730000	0.950000	0.894287	0.950000	1.000000																										0				144						c.(3874-3876)aAa>aCa		regulating synaptic membrane exocytosis 2							62.0	53.0	55.0					8																	105263381		1803	4073	5876	SO:0001583	missense	9699	0	0					g.chr8:105263381A>C	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3875A>C	chr8.hg19:g.105263381A>C	ENSP00000390665:p.Lys1292Thr	0	HNSCC(12;0.0054)				RIMS2_ENST00000507740.1_Missense_Mutation_p.K1088T|RIMS2_ENST00000406091.3_Missense_Mutation_p.K1274T|RIMS2_ENST00000339750.2_Missense_Mutation_p.K210T|RIMS2_ENST00000262231.10_Missense_Mutation_p.K1113T	p.K1292T			0	1	1	2.053834	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)	27	4116	+			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	0	1	hg19	c.3875A>C		1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.951323	0.73787	.	.	ENSG00000176406	ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000436393;ENST00000523362;ENST00000339750	T;T;T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36;-0.36;-0.36	5.24	4.03	0.46877	5.24	4.03	0.46877	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.79143	0.4396	M	0.72624	2.21	0.58432	D	0.999998	D;P;P;D;D	0.76494	0.994;0.787;0.933;0.999;0.999	D;P;D;D;D	0.85130	0.994;0.69;0.963;0.997;0.997	T	0.79811	-0.1646	9	0.66056	D	0.02	.	11.4916	0.50383	0.9278:0.0:0.0722:0.0	.	1336;1292;1113;1088;1274	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	T	1311;1274;1336;1113;1088;1292;210;210	ENSP00000384892:K1274T;ENSP00000262231:K1113T;ENSP00000423559:K1088T;ENSP00000390665:K1292T;ENSP00000428478:K210T;ENSP00000342051:K210T	ENSP00000262231:K1113T	K	+	2	0	0	RIMS2	105332557	105332557	1.000000	0.71417	0.904000	0.35570	0.985000	0.73830	7.451000	0.80668	0.889000	0.36185	0.477000	0.44152	AAA	0.338876		TCGA-2J-AABA-01A-21D-A40W-08	0.368	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	1	0	1		2	2	2	0		0	0	12		12	12	1	1.830000	-19.999850	1	0.340000	NM_001100117			13	13		67	67	1		1			0	0	12	0		0.999688	0	0	0	0	0	0	13	67
