#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
SMAD4	4089	broad.mit.edu	37	18	48591861	48591861	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08			C	-	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr18:48591861delC	ENST00000342988.3	+	9	1562	c.1024delC	c.(1024-1026)cctfs	p.P342fs	SMAD4_ENST00000588745.1_Frame_Shift_Del_p.P246fs|SMAD4_ENST00000398417.2_Frame_Shift_Del_p.P342fs	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	342	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.F339_S343del(2)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		ATTTAAGGTTCCTTCAAGCTG	0.443																																						ENST00000342988.3	0.840000	5.700000e-01	0.780000	0.630000	0.700000	0.710130	0.700000	0.700000																										40	Whole gene deletion(36)|Deletion - In frame(2)|Unknown(2)	p.0?(36)|p.F339_S343del(2)|p.?(2)	pancreas(26)|large_intestine(5)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	454						c.(1024-1026)cctfs		SMAD family member 4							268.0	229.0	243.0					18																	48591861		2203	4300	6503	SO:0001589	frameshift_variant	4089	0	0					g.chr18:48591861delC	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1024delC	chr18.hg19:g.48591861delC	ENSP00000341551:p.Pro342fs	1					SMAD4_ENST00000588745.1_Frame_Shift_Del_p.P246fs|SMAD4_ENST00000398417.2_Frame_Shift_Del_p.P342fs	p.P342fs	NM_005359.5	NP_005350.1	0	1	1	1.634216	Q13485	SMAD4_HUMAN		9	1562	+		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)	A8K405	Frame_Shift_Del	DEL	ENST00000342988.3	1	1	hg19	c.1024delC	CCDS11950.1	0																																																																																								0.234568		TCGA-2J-AABE-01A-12D-A40W-08	0.443	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	1	0	1		2	2	2	0		0	0	99		99	96	1	1.990000	-3.154458	1	0.380000	NM_005359			88	99		441	438	0		1	0	1	0	0	99	886		1.000000	9.762759e-01	1	1	135	31	743	88	441
HIST1H1B	3009	broad.mit.edu	37	6	27835072	27835074	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr6:27835072_27835074delTTC	ENST00000331442.3	-	1	285_287	c.234_236delGAA	c.(232-237)aagaat>aat	p.K78del		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	78	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						GCGGCTGTTATTCTTCTCCACGT	0.557																																						ENST00000331442.3	0.760000	5.500000e-01	0.710000	0.600000	0.650000	0.663092	0.650000	0.660000																										0				24						c.(232-237)aagaat>aat		histone cluster 1, H1b																																				SO:0001651	inframe_deletion	3009	0	0					g.chr6:27835072_27835074delTTC	AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.234_236delGAA	chr6.hg19:g.27835075_27835077delTTC	ENSP00000330074:p.Lys78del	0						p.K78del	NM_005322.2	NP_005313.1	0	1	1	2.002036	P16401	H15_HUMAN		1	285_287	-			Q14529|Q3MJ42	In_Frame_Del	DEL	ENST00000331442.3	1	1	hg19	c.234_236delGAA	CCDS4635.1	0																																																																																								0.378820		TCGA-2J-AABE-01A-12D-A40W-08	0.557	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043371.1	1	0	0		58			0		0	5	172		172	169	1	1.990000	-20.000000	1	0.380000	NM_005322			145	229		1008	1035	0		1			0	0	172	0		1.000000			0	0	0	0	145	1008
MARCH8	220972	broad.mit.edu	37	10	45954652	45954652	+	Missense_Mutation	SNP	C	C	T	rs573798318		TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr10:45954652C>T	ENST00000319836.3	-	6	1236	c.487G>A	c.(487-489)Gtc>Atc	p.V163I	MARCH8_ENST00000395769.2_Missense_Mutation_p.V163I|MARCH8_ENST00000476962.1_5'UTR|MARCH8_ENST00000453424.2_Missense_Mutation_p.V445I|MARCH8_ENST00000395771.3_Missense_Mutation_p.V163I	NM_145021.4	NP_659458.2	Q5T0T0	MARH8_HUMAN	membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase	163					immune system process (GO:0002376)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(5)|lung(4)	12						ATGGCAATGACGTGGAATGTC	0.527													C|||	1	0.000199681	0.0	0.0	5008	,	,		22136	0.0		0.0	False		,,,				2504	0.001				NSCLC(102;658 1594 2173 16344 34808)	ENST00000319836.3	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.999978	0.990000	1.000000																										0				12						c.(487-489)Gtc>Atc		membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase							218.0	166.0	184.0					10																	45954652		2203	4300	6503	SO:0001583	missense	220972	1	121412	28				g.chr10:45954652C>T	AL833316	CCDS7213.1, CCDS60519.1	10q11.22	2013-01-09	2012-02-23	2005-01-27	ENSG00000165406	ENSG00000165406		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	23356	protein-coding gene	gene with protein product		613335	"""c-mir, cellular modulator of immune recognition"", ""membrane-associated ring finger (C3HC4) 8"""	MIR		12582153, 14722266	Standard	XM_005271804		Approved	c-MIR, MARCH-VIII, RNF178	uc001jch.2	Q5T0T0	OTTHUMG00000019345	ENST00000319836.3:c.487G>A	chr10.hg19:g.45954652C>T	ENSP00000317087:p.Val163Ile	0					MARCH8_ENST00000476962.1_5'UTR|MARCH8_ENST00000395769.2_Missense_Mutation_p.V163I|MARCH8_ENST00000453424.2_Missense_Mutation_p.V445I|MARCH8_ENST00000395771.3_Missense_Mutation_p.V163I	p.V163I	NM_145021.4	NP_659458.2	1	2	3	2.024446	Q5T0T0	MARH8_HUMAN		6	1236	-			B2R8E7|H0Y7C6|Q5T0S8|Q8TC72	Missense_Mutation	SNP	ENST00000319836.3	1	1	hg19	c.487G>A	CCDS7213.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.459|1.459	-0.562957|-0.562957	0.03939|0.03939	.|.	.|.	ENSG00000165406|ENSG00000165406	ENST00000453424|ENST00000395771;ENST00000319836;ENST00000395769	.|T;T;T	.|0.12774	.|2.65;2.65;2.65	5.9|5.9	-0.201|-0.201	0.13212|0.13212	5.9|5.9	-0.201|-0.201	0.13212|0.13212	.|.	.|0.420336	.|0.27932	.|N	.|0.017271	T|T	0.07593|0.07593	0.0191|0.0191	N|N	0.16790|0.16790	0.44|0.44	0.25795|0.25795	N|N	0.984575|0.984575	.|B;B	.|0.06786	.|0.001;0.001	.|B;B	.|0.08055	.|0.003;0.001	T|T	0.32402|0.32402	-0.9908|-0.9908	5|10	.|0.25751	.|T	.|0.34	-18.5993|-18.5993	11.5774|11.5774	0.50869|0.50869	0.0:0.5925:0.0:0.4075|0.0:0.5925:0.0:0.4075	.|.	.|163;327	.|Q5T0T0;Q5JQ16	.|MARH8_HUMAN;.	H|I	327|163	.|ENSP00000379118:V163I;ENSP00000317087:V163I;ENSP00000379116:V163I	.|ENSP00000317087:V163I	R|V	-|-	2|1	0|0	0|0	MARCH8|MARCH8	45274658|45274658	45274658|45274658	0.077000|0.077000	0.21312|0.21312	0.050000|0.050000	0.19076|0.19076	0.019000|0.019000	0.09904|0.09904	-0.500000|-0.500000	0.06405|0.06405	-0.280000|-0.280000	0.09154|0.09154	-1.814000|-1.814000	0.00607|0.00607	CGT|GTC	0.384676		TCGA-2J-AABE-01A-12D-A40W-08	0.527	MARCH8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051217.1	1	0	1		22	2	2	1		1	1	60		60	60	1	1.990000	-20.000000	1	0.380000	NM_145021			106	105		317	317	1		1	1		1	0	60	0		1.000000	4.695309e-01	0	3	0	3	0	106	317
PAH	5053	broad.mit.edu	37	12	103306580	103306580	+	Missense_Mutation	SNP	G	G	A	rs199475619		TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr12:103306580G>A	ENST00000553106.1	-	2	629	c.157C>T	c.(157-159)Cgc>Tgc	p.R53C	PAH_ENST00000307000.2_Missense_Mutation_p.R48C|PAH_ENST00000551988.1_5'UTR	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	53	ACT. {ECO:0000255|PROSITE- ProRule:PRU01007}.		R -> H (in PKU; dbSNP:rs118092776). {ECO:0000269|PubMed:9452061}.		catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)			endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	TCAAATAAGCGCAATACTTTG	0.383																																						ENST00000553106.1	0.240000	6.000000e-02	0.190000	0.090000	0.130000	0.143706	0.130000	0.130000																										0				27	GRCh37	CM010948	PAH	M		c.(157-159)Cgc>Tgc		phenylalanine hydroxylase	Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)						210.0	176.0	188.0					12																	103306580		2203	4300	6503	SO:0001583	missense	5053	4	121410	40				g.chr12:103306580G>A	U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.157C>T	chr12.hg19:g.103306580G>A	ENSP00000448059:p.Arg53Cys	0					PAH_ENST00000551988.1_5'UTR|PAH_ENST00000307000.2_Missense_Mutation_p.R48C	p.R53C	NM_000277.1	NP_000268.1	1	2	3	2.005348	P00439	PH4H_HUMAN		2	629	-			Q16717|Q8TC14	Missense_Mutation	SNP	ENST00000553106.1	0	1	hg19	c.157C>T	CCDS9092.1	0	.	.	.	.	.	.	.	.	.	.	G	14.17	2.455662	0.43634	.	.	ENSG00000171759	ENST00000553106;ENST00000307000;ENST00000551337;ENST00000546844	D;D;D;D	0.99186	-5.53;-5.53;-5.53;-5.53	5.46	4.57	0.56435	5.46	4.57	0.56435	Amino acid-binding ACT (1);	0.103551	0.64402	D	0.000008	D	0.97492	0.9179	M	0.62016	1.91	0.80722	D	1	B;B	0.25272	0.122;0.04	B;B	0.20577	0.03;0.013	D	0.96114	0.9079	10	0.87932	D	0	-18.3309	10.8105	0.46545	0.0883:0.0:0.9117:0.0	rs62650748	53;53	B4DPN2;P00439	.;PH4H_HUMAN	C	53;48;53;53	ENSP00000448059:R53C;ENSP00000303500:R48C;ENSP00000447620:R53C;ENSP00000446658:R53C	ENSP00000303500:R48C	R	-	1	0	0	PAH	101830710	101830710	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	2.568000	0.45965	2.549000	0.85964	0.655000	0.94253	CGC	0.381176		TCGA-2J-AABE-01A-12D-A40W-08	0.383	PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406692.1	0	0	1		2	2	2	0		0	0	72		72	72	1	1.990000	-2.925784	1	0.380000				10	10		390	386	0		1	0		0	0	72	0		0.996807	4.681680e-03	0	0	0	4	0	10	390
KCNA5	3741	broad.mit.edu	37	12	5154148	5154148	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr12:5154148C>A	ENST00000252321.3	+	1	1064	c.835C>A	c.(835-837)Cgt>Agt	p.R279S		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	279					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	CAGGGATGAACGTGAGCTGCT	0.687																																						ENST00000252321.3	0.950000	5.900000e-01	0.860000	0.670000	0.760000	0.770744	0.760000	0.760000																										0				52						c.(835-837)Cgt>Agt		potassium voltage-gated channel, shaker-related subfamily, member 5	Dalfampridine(DB06637)						69.0	71.0	70.0					12																	5154148		2203	4300	6503	SO:0001583	missense	3741	0	0					g.chr12:5154148C>A	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.835C>A	chr12.hg19:g.5154148C>A	ENSP00000252321:p.Arg279Ser	0						p.R279S	NM_002234.3	NP_002225.2	0	0	0	1.932215	P22460	KCNA5_HUMAN		1	1064	+			Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	ENST00000252321.3	1	1	hg19	c.835C>A	CCDS8536.1	0	.	.	.	.	.	.	.	.	.	.	C	10.07	1.249281	0.22880	.	.	ENSG00000130037	ENST00000252321	T	0.62639	0.01	4.77	3.87	0.44632	4.77	3.87	0.44632	.	.	.	.	.	T	0.51126	0.1656	L	0.35793	1.09	0.19300	N	0.999971	B	0.06786	0.001	B	0.15484	0.013	T	0.45833	-0.9234	9	0.52906	T	0.07	.	9.0243	0.36220	0.2765:0.5838:0.1397:0.0	.	279	P22460	KCNA5_HUMAN	S	279	ENSP00000252321:R279S	ENSP00000252321:R279S	R	+	1	0	0	KCNA5	5024409	5024409	0.000000	0.05858	0.874000	0.34290	0.974000	0.67602	-0.392000	0.07314	1.226000	0.43582	0.561000	0.74099	CGT	0.355509		TCGA-2J-AABE-01A-12D-A40W-08	0.687	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	1	0	1		2	2	2	0		0	0	36		36	35	1	1.990000	-20.000000	1	0.380000	NM_002234			57	56		320	315	0		1			0	0	36	0		1.000000	0	0	0	0	0	0	57	320
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	5.300000e-01	0.920000	0.640000	0.770000	0.781413	0.770000	1.000000	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	chr12.hg19:g.25398285C>G	ENSP00000256078:p.Gly12Arg	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12R	NM_033360.2	NP_203524.1	1	2	3	2.005348	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.34G>C	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	0	KRAS	25289552	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.381176		TCGA-2J-AABE-01A-12D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	57		57	57	1	1.990000	-15.160630	1	0.380000	NM_033360			28	28		163	163	1		1	1	1	0	0	57	334		1.000000	6.350969e-01	1	4	24	10	252	28	163
HVCN1	84329	broad.mit.edu	37	12	111121035	111121035	+	Missense_Mutation	SNP	C	C	T	rs147424254		TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr12:111121035C>T	ENST00000356742.5	-	2	769	c.16G>A	c.(16-18)Gaa>Aaa	p.E6K	HVCN1_ENST00000548312.1_Missense_Mutation_p.E6K|HVCN1_ENST00000439744.2_Intron|HVCN1_ENST00000242607.8_Missense_Mutation_p.E6K			Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1	6					cellular response to pH (GO:0071467)|cellular response to zinc ion (GO:0071294)|multicellular organism reproduction (GO:0032504)|proton transport (GO:0015992)|response to pH (GO:0009268)|response to zinc ion (GO:0010043)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	voltage-gated cation channel activity (GO:0022843)|voltage-gated proton channel activity (GO:0030171)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	19						ATTACCTTTTCGTCCCAGGTG	0.458																																						ENST00000356742.5	1.000000	8.200000e-01	1.000000	0.890000	0.960000	0.954276	0.960000	1.000000																										0				19						c.(16-18)Gaa>Aaa		hydrogen voltage-gated channel 1							231.0	213.0	219.0					12																	111121035		2203	4300	6503	SO:0001583	missense	84329	10	121412	46				g.chr12:111121035C>T	BC007277	CCDS31900.1, CCDS58278.1	12q24.11	2011-12-09	2006-03-24	2006-03-24	ENSG00000122986	ENSG00000122986		"""Voltage-gated ion channels / Hydrogen voltage-gated channel"""	28240	protein-coding gene	gene with protein product	"""voltage sensor domain-only protein"""	611227				20961760, 16556803, 18356202, 22020278	Standard	NM_032369		Approved	MGC15619, Hv1, VSOP	uc001trs.2	Q96D96		ENST00000356742.5:c.16G>A	chr12.hg19:g.111121035C>T	ENSP00000349181:p.Glu6Lys	0					HVCN1_ENST00000548312.1_Missense_Mutation_p.E6K|HVCN1_ENST00000439744.2_Intron|HVCN1_ENST00000242607.8_Missense_Mutation_p.E6K	p.E6K			1	2	3	2.005348	Q96D96	HVCN1_HUMAN		2	769	-			A8MQ37|B4DEB3|F8WCH5|Q6UW11|Q96IS5	Missense_Mutation	SNP	ENST00000356742.5	1	1	hg19	c.16G>A	CCDS31900.1	1	.	.	.	.	.	.	.	.	.	.	C	5.668	0.307807	0.10733	.	.	ENSG00000122986	ENST00000548312;ENST00000242607;ENST00000356742;ENST00000546713	T;T;T	0.42900	0.96;0.96;0.96	4.03	3.12	0.35913	4.03	3.12	0.35913	.	2.162620	0.01930	N	0.041205	T	0.32224	0.0822	N	0.22421	0.69	0.19775	N	0.999958	B;B	0.31413	0.216;0.322	B;B	0.25759	0.028;0.063	T	0.26121	-1.0112	10	0.39692	T	0.17	7.908	9.5178	0.39115	0.0:0.7734:0.2266:0.0	.	6;6	Q96D96;Q96D96-3	HVCN1_HUMAN;.	K	6	ENSP00000449601:E6K;ENSP00000242607:E6K;ENSP00000349181:E6K	ENSP00000242607:E6K	E	-	1	0	0	HVCN1	109605418	109605418	0.033000	0.19621	0.071000	0.20095	0.013000	0.08279	1.484000	0.35508	1.244000	0.43870	0.655000	0.94253	GAA	0.381176		TCGA-2J-AABE-01A-12D-A40W-08	0.458	HVCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404653.1	1	0	1		2	2	2	0		0	0	108		108	108	1	1.990000	-20.000000	1	0.380000	NM_032369			138	134		612	604	1		1	1		0	0	108	0		1.000000	9.905175e-01	0	4	0	30	0	138	612
SNX6	58533	broad.mit.edu	37	14	35072604	35072604	+	Missense_Mutation	SNP	T	T	C	rs530960694		TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr14:35072604T>C	ENST00000362031.4	-	6	532	c.502A>G	c.(502-504)Att>Gtt	p.I168V	SNX6_ENST00000396534.3_Missense_Mutation_p.I40V|SNX6_ENST00000396526.3_Missense_Mutation_p.I40V|SNX6_ENST00000355110.5_Missense_Mutation_p.I44V	NM_152233.2	NP_689419.2	Q9UNH7	SNX6_HUMAN	sorting nexin 6	156	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|intracellular (GO:0005622)|nucleus (GO:0005634)	phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			endometrium(4)|lung(1)|ovary(1)	6	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)		CTTCTCAAAATAGGATGTGCT	0.338																																						ENST00000362031.4	1.000000	6.200000e-01	0.990000	0.720000	0.840000	0.850460	0.840000	1.000000																										0				6						c.(502-504)Att>Gtt		sorting nexin 6							73.0	70.0	71.0					14																	35072604		2203	4300	6503	SO:0001583	missense	58533	0	0					g.chr14:35072604T>C	AF121856	CCDS9648.1, CCDS41942.1	14q13	2010-08-05			ENSG00000129515	ENSG00000129515		"""Sorting nexins"""	14970	protein-coding gene	gene with protein product		606098				11279102	Standard	XM_006720224		Approved		uc001wsf.1	Q9UNH7	OTTHUMG00000140213	ENST00000362031.4:c.502A>G	chr14.hg19:g.35072604T>C	ENSP00000355217:p.Ile168Val	0					SNX6_ENST00000396534.3_Missense_Mutation_p.I40V|SNX6_ENST00000396526.3_Missense_Mutation_p.I40V|SNX6_ENST00000355110.5_Missense_Mutation_p.I44V	p.I168V	NM_152233.2	NP_689419.2	1	2	3	2.030804	Q9UNH7	SNX6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	6	532	-	Breast(36;0.0473)|Hepatocellular(127;0.158)		C0H5W9|Q9Y449	Missense_Mutation	SNP	ENST00000362031.4	1	1	hg19	c.502A>G	CCDS41942.1	0	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.624808	0.00820	.	.	ENSG00000129515	ENST00000396526;ENST00000396534;ENST00000362031;ENST00000355110;ENST00000557265	T;T;T;T;T	0.37411	2.07;2.07;1.2;2.06;1.2	5.66	3.27	0.37495	5.66	3.27	0.37495	Phox homologous domain (4);	0.053291	0.85682	D	0.000000	T	0.12689	0.0308	N	0.03209	-0.39	0.46185	D	0.998915	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.20438	-1.0275	10	0.02654	T	1	-14.025	8.1078	0.30896	0.1208:0.0657:0.0:0.8135	.	44;156	B4DJS7;Q9UNH7	.;SNX6_HUMAN	V	40;40;168;44;131	ENSP00000379779:I40V;ENSP00000379785:I40V;ENSP00000355217:I168V;ENSP00000347230:I44V;ENSP00000452577:I131V	ENSP00000347230:I44V	I	-	1	0	0	SNX6	34142355	34142355	1.000000	0.71417	0.931000	0.37212	0.094000	0.18550	3.258000	0.51507	0.490000	0.27771	-0.290000	0.09829	ATT	0.384676		TCGA-2J-AABE-01A-12D-A40W-08	0.338	SNX6-002	KNOWN	downstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276642.3	1	0	1		2	2	2	0		0	0	32		32	32	1	1.990000	-20.000000	1	0.380000				40	39		211	211	1		1	1		0	0	32	0		1.000000	9.997150e-01	0	20	0	48	0	40	211
AHNAK2	113146	broad.mit.edu	37	14	105416584	105416584	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr14:105416584G>A	ENST00000333244.5	-	7	5323	c.5204C>T	c.(5203-5205)gCc>gTc	p.A1735V	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1735						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TTTGAAGCCGGCTCCCTCGGG	0.632																																						ENST00000333244.5	1.000000	0	0.070000	0.020000	0.040000	0.073429	0.040000	0.040000																										0				33						c.(5203-5205)gCc>gTc		AHNAK nucleoprotein 2							85.0	97.0	93.0					14																	105416584		1813	4035	5848	SO:0001583	missense	113146	0	0					g.chr14:105416584G>A	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.5204C>T	chr14.hg19:g.105416584G>A	ENSP00000353114:p.Ala1735Val	0					AHNAK2_ENST00000557457.1_Intron	p.A1735V	NM_138420.2	NP_612429.2	1	2	3	2.030804	Q8IVF2	AHNK2_HUMAN	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)	7	5323	-		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	0	1	hg19	c.5204C>T	CCDS45177.1	0	.	.	.	.	.	.	.	.	.	.	g	5.329	0.245997	0.10077	.	.	ENSG00000185567	ENST00000333244	T	0.00784	5.7	4.8	-1.57	0.08506	4.8	-1.57	0.08506	.	.	.	.	.	T	0.01254	0.0041	L	0.39514	1.22	0.09310	N	1	P	0.48350	0.909	P	0.60012	0.867	T	0.47249	-0.9132	9	0.13853	T	0.58	-8.5045	1.8315	0.03131	0.2507:0.4053:0.2113:0.1327	.	1735	Q8IVF2	AHNK2_HUMAN	V	1735	ENSP00000353114:A1735V	ENSP00000353114:A1735V	A	-	2	0	0	AHNAK2	104487629	104487629	.	.	0.000000	0.03702	0.004000	0.04260	.	.	0.090000	0.17273	0.505000	0.49811	GCC	0.384676		TCGA-2J-AABE-01A-12D-A40W-08	0.632	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	0	0	1		2	2	2	0		0	0	156		156	152	1	1.990000	-2.112756	0	0.380000	NM_138420			7	7		913	885	0		1	0		0	0	156	0		0.978361	1.152207e-02	0	0	0	18	0	7	913
ABCC6	368	broad.mit.edu	37	16	16248786	16248786	+	Missense_Mutation	SNP	G	G	C			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr16:16248786G>C	ENST00000205557.7	-	28	4014	c.3985C>G	c.(3985-3987)Ccc>Gcc	p.P1329A		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	1329	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	TGGGCAATGGGGACCCCGTCG	0.677																																						ENST00000205557.7	1.000000	2.900000e-01	0.870000	0.430000	0.610000	0.640466	0.610000	1.000000																										0				43						c.(3985-3987)Ccc>Gcc		ATP-binding cassette, sub-family C (CFTR/MRP), member 6	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)						30.0	26.0	27.0					16																	16248786		2197	4299	6496	SO:0001583	missense	368	0	0					g.chr16:16248786G>C	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.3985C>G	chr16.hg19:g.16248786G>C	ENSP00000205557:p.Pro1329Ala	0						p.P1329A	NM_001171.5	NP_001162	1	2	3	2.060932	O95255	MRP6_HUMAN		28	4014	-			A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	ENST00000205557.7	0	1	hg19	c.3985C>G	CCDS10568.1	0	.	.	.	.	.	.	.	.	.	.	G	14.55	2.569435	0.45798	.	.	ENSG00000091262	ENST00000205557;ENST00000205558	D	0.90444	-2.67	4.53	0.927	0.19437	4.53	0.927	0.19437	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.674572	0.12392	U	0.472885	D	0.85609	0.5736	L	0.28694	0.88	0.80722	D	1	P;P	0.49961	0.93;0.93	P;P	0.50192	0.634;0.634	T	0.80381	-0.1406	10	0.66056	D	0.02	.	2.4178	0.04440	0.0966:0.1762:0.2948:0.4325	.	1329;1329	O95255;A8Y988	MRP6_HUMAN;.	A	1329;267	ENSP00000205557:P1329A	ENSP00000205557:P1329A	P	-	1	0	0	ABCC6	16156287	16156287	1.000000	0.71417	0.994000	0.49952	0.687000	0.40016	1.409000	0.34680	0.323000	0.23307	0.465000	0.42564	CCC	0.389283		TCGA-2J-AABE-01A-12D-A40W-08	0.677	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2	1	0	1		2	2	2	0		0	0	8		8	8	1	1.990000	-14.458880	1	0.380000				8	7		66	64	1		1	0		0	0	8	0		0.988986	1.537936e-02	0	0	0	2	0	8	66
ABCC6	368	broad.mit.edu	37	16	16284080	16284080	+	Missense_Mutation	SNP	G	G	A	rs72664217		TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr16:16284080G>A	ENST00000205557.7	-	12	1605	c.1576C>T	c.(1576-1578)Cgg>Tgg	p.R526W	ABCC6_ENST00000574094.1_5'UTR	NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	526	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	CCGGAGGTCCGCAAGGCGCCC	0.577																																						ENST00000205557.7	1.000000	3.000000e-02	0.140000	0.050000	0.080000	0.152807	0.080000	0.080000																										0				43	GRCh37	CI063637	ABCC6	I	rs72664217	c.(1576-1578)Cgg>Tgg		ATP-binding cassette, sub-family C (CFTR/MRP), member 6	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)						79.0	80.0	80.0					16																	16284080		2197	4300	6497	SO:0001583	missense	368	3	121412	38				g.chr16:16284080G>A	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.1576C>T	chr16.hg19:g.16284080G>A	ENSP00000205557:p.Arg526Trp	0					ABCC6_ENST00000574094.1_5'UTR	p.R526W	NM_001171.5	NP_001162	1	2	3	2.060932	O95255	MRP6_HUMAN		12	1605	-			A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	ENST00000205557.7	0	1	hg19	c.1576C>T	CCDS10568.1	0	.	.	.	.	.	.	.	.	.	.	G	13.87	2.366424	0.41902	.	.	ENSG00000091262	ENST00000205557;ENST00000456970;ENST00000546056	D;D	0.90004	-2.6;-2.6	4.9	1.34	0.21922	4.9	1.34	0.21922	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.413118	0.19564	U	0.111280	D	0.92315	0.7562	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.68483	0.929;0.958	D	0.91095	0.4910	10	0.87932	D	0	.	13.4957	0.61424	0.0:0.0:0.5684:0.4316	.	538;526	F5GWQ0;O95255	.;MRP6_HUMAN	W	526;526;538	ENSP00000205557:R526W;ENSP00000405002:R526W	ENSP00000205557:R526W	R	-	1	2	2	ABCC6	16191581	16191581	1.000000	0.71417	0.895000	0.35142	0.168000	0.22595	3.701000	0.54793	-0.029000	0.13827	-0.314000	0.08810	CGG	0.389283		TCGA-2J-AABE-01A-12D-A40W-08	0.577	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2	0	0	1		2	2	2	0		0	0	67		67	67	1	1.990000	-2.271318	0	0.380000				6	6		386	373	0		1	0		0	0	67	0		0.961448	3.598278e-04	0	0	0	2	0	6	386
KRT17	3872	broad.mit.edu	37	17	39780381	39780381	+	Silent	SNP	G	G	A			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr17:39780381G>A	ENST00000311208.8	-	1	448	c.381C>T	c.(379-381)ccC>ccT	p.P127P	KRT42P_ENST00000438131.1_RNA|JUP_ENST00000540235.1_Intron	NM_000422.2	NP_000413.1	Q04695	K1C17_HUMAN	keratin 17	127	Linker 1.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinization (GO:0031424)|morphogenesis of an epithelium (GO:0002009)|positive regulation of cell growth (GO:0030307)|positive regulation of hair follicle development (GO:0051798)|positive regulation of translation (GO:0045727)|signal transduction (GO:0007165)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	MHC class II protein binding (GO:0042289)|MHC class II receptor activity (GO:0032395)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12		Breast(137;0.000307)				AGTCACGGGCGGGCCCCGGGG	0.642																																					Pancreas(92;1242 2086 39193 50508)	ENST00000311208.8	1.000000	0	0.070000	0.010000	0.030000	0.120158	0.030000	0.040000																										0				12						c.(379-381)ccC>ccT		keratin 17							58.0	76.0	70.0					17																	39780381		2203	4300	6503	SO:0001819	synonymous_variant	3872	27	121376	41				g.chr17:39780381G>A	X62571	CCDS11402.1	17q21.2	2014-06-12			ENSG00000128422	ENSG00000128422		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6427	protein-coding gene	gene with protein product		148069		PCHC1		7539673, 1281771, 16831889	Standard	NM_000422		Approved		uc002hxh.2	Q04695	OTTHUMG00000133505	ENST00000311208.8:c.381C>T	chr17.hg19:g.39780381G>A		0					JUP_ENST00000540235.1_Intron|KRT42P_ENST00000438131.1_RNA	p.P127P	NM_000422.2	NP_000413.1	1	2	3	2.072248	Q04695	K1C17_HUMAN		1	448	-		Breast(137;0.000307)	A5Z1M9|A5Z1N0|A5Z1N1|A5Z1N2|A6NDV6|A6NKQ2|Q6IP98|Q8N1P6	Silent	SNP	ENST00000311208.8	0	1	hg19	c.381C>T	CCDS11402.1	0																																																																																								0.391560		TCGA-2J-AABE-01A-12D-A40W-08	0.642	KRT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257460.1	0	0	0		2	2	2	0		0	0	105		105	107	1	1.990000	-1.953259	0	0.380000	NM_000422			6	4		863	753	0		1	1		0	0	105	0		0.947210	7.566103e-01	0	2	0	381	0	6	863
RNF43	54894	broad.mit.edu	37	17	56492875	56492875	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr17:56492875G>A	ENST00000584437.1	-	1	2019	c.64C>T	c.(64-66)Cag>Tag	p.Q22*	RNF43_ENST00000580014.1_5'Flank|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000581868.1_Intron|RNF43_ENST00000500597.2_Nonsense_Mutation_p.Q22*|RNF43_ENST00000583753.1_Nonsense_Mutation_p.Q22*|RNF43_ENST00000577716.1_Nonsense_Mutation_p.Q22*|RNF43_ENST00000407977.2_Nonsense_Mutation_p.Q22*			Q68DV7	RNF43_HUMAN	ring finger protein 43	22					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q22*(1)		NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AAGCCTGCCTGCAGGGTAGCC	0.552																																						ENST00000584437.1	1.000000	7.000000e-01	0.970000	0.790000	0.890000	0.887685	0.890000	1.000000																										1	Substitution - Nonsense(1)	p.Q22*(1)	endometrium(1)	60						c.(64-66)Cag>Tag		ring finger protein 43							42.0	40.0	41.0					17																	56492875		2202	4299	6501	SO:0001587	stop_gained	54894	0	0					g.chr17:56492875G>A		CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.64C>T	chr17.hg19:g.56492875G>A	ENSP00000463069:p.Gln22*	1					RNF43_ENST00000583753.1_Nonsense_Mutation_p.Q22*|RNF43_ENST00000580014.1_5'Flank|RNF43_ENST00000577716.1_Nonsense_Mutation_p.Q22*|RNF43_ENST00000500597.2_Nonsense_Mutation_p.Q22*|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000407977.2_Nonsense_Mutation_p.Q22*|RNF43_ENST00000581868.1_Intron	p.Q22*			0	1	1	1.654203	Q68DV7	RNF43_HUMAN		1	2019	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Nonsense_Mutation	SNP	ENST00000584437.1	0	1	hg19	c.64C>T	CCDS11607.1	1	.	.	.	.	.	.	.	.	.	.	G	42	9.321529	0.99137	.	.	ENSG00000108375	ENST00000407977;ENST00000500597	.	.	.	5.69	5.69	0.88448	5.69	5.69	0.88448	.	0.231655	0.31290	N	0.007907	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-1.897	19.1688	0.93569	0.0:0.0:1.0:0.0	.	.	.	.	X	22	.	ENSP00000385328:Q22X	Q	-	1	0	0	RNF43	53847874	53847874	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.758000	0.91663	2.840000	0.97914	0.655000	0.94253	CAG	0.236359		TCGA-2J-AABE-01A-12D-A40W-08	0.552	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	1	0	1		2	2	2	0		0	0	52		52	51	1	1.990000	-20.000000	1	0.380000	NM_017763			48	47		169	162	0		1	1	1	0	0	52	476		1.000000	8.154947e-01	1	11	76	2	292	48	169
ARHGAP28	79822	broad.mit.edu	37	18	6859874	6859874	+	Missense_Mutation	SNP	C	C	T	rs190733334	byFrequency	TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr18:6859874C>T	ENST00000383472.4	+	5	808	c.704C>T	c.(703-705)gCg>gTg	p.A235V	ARHGAP28_ENST00000418986.1_Missense_Mutation_p.A76V|ARHGAP28_ENST00000400091.2_Missense_Mutation_p.A235V|ARHGAP28_ENST00000531294.1_Missense_Mutation_p.A71V|ARHGAP28_ENST00000262227.3_Missense_Mutation_p.A183V|ARHGAP28_ENST00000314319.3_Missense_Mutation_p.A76V|ARHGAP28_ENST00000419673.2_Missense_Mutation_p.A76V|ARHGAP28_ENST00000532996.1_Missense_Mutation_p.A58V			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	235					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				GGGAGTTTTGCGGTTCCCAGG	0.433													C|||	3	0.000599042	0.0	0.0	5008	,	,		21764	0.003		0.0	False		,,,				2504	0.0					ENST00000383472.4	1.000000	1.000000e-02	0.090000	0.030000	0.050000	0.106413	0.050000	0.060000																										0				37						c.(703-705)gCg>gTg		Rho GTPase activating protein 28							224.0	213.0	217.0					18																	6859874		2203	4300	6503	SO:0001583	missense	79822	24	121412	48				g.chr18:6859874C>T	BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.704C>T	chr18.hg19:g.6859874C>T	ENSP00000372964:p.Ala235Val	0					ARHGAP28_ENST00000532996.1_Missense_Mutation_p.A58V|ARHGAP28_ENST00000419673.2_Missense_Mutation_p.A76V|ARHGAP28_ENST00000531294.1_Missense_Mutation_p.A71V|ARHGAP28_ENST00000400091.2_Missense_Mutation_p.A235V|ARHGAP28_ENST00000262227.3_Missense_Mutation_p.A183V|ARHGAP28_ENST00000314319.3_Missense_Mutation_p.A76V|ARHGAP28_ENST00000418986.1_Missense_Mutation_p.A76V	p.A235V			1	2	3	2.041017	Q9P2N2	RHG28_HUMAN		5	808	+		Colorectal(10;0.168)	A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Missense_Mutation	SNP	ENST00000383472.4	0	1	hg19	c.704C>T		0	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	C	8.061	0.768218	0.15983	.	.	ENSG00000088756	ENST00000400091;ENST00000262227;ENST00000419673;ENST00000531294;ENST00000314319;ENST00000418986;ENST00000532996;ENST00000383472	T;T;T;T;T;T	0.08102	3.3;3.25;3.2;3.2;3.2;3.13	4.44	0.19	0.15125	4.44	0.19	0.15125	.	1.318330	0.04466	N	0.375305	T	0.03136	0.0092	N	0.08118	0	0.09310	N	1	B;B;B;B	0.12630	0.001;0.003;0.006;0.004	B;B;B;B	0.08055	0.001;0.001;0.001;0.003	T	0.42015	-0.9476	10	0.25106	T	0.35	.	7.004	0.24826	0.0:0.5813:0.0:0.4187	.	235;67;76;183	Q9P2N2;E9PRP2;F6VKJ9;Q9P2N2-2	RHG28_HUMAN;.;.;.	V	235;183;76;71;76;76;67;58	ENSP00000382963:A235V;ENSP00000262227:A183V;ENSP00000392660:A76V;ENSP00000437262:A71V;ENSP00000313506:A76V;ENSP00000406907:A76V	ENSP00000262227:A183V	A	+	2	0	0	ARHGAP28	6849874	6849874	0.000000	0.05858	0.001000	0.08648	0.625000	0.37756	0.379000	0.20585	0.014000	0.14944	0.563000	0.77884	GCG	0.386988		TCGA-2J-AABE-01A-12D-A40W-08	0.433	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442123.3	0	0	1		20	2	2	1		1	1	98		98	98	1	1.990000	-1.516175	0	0.380000	XM_371108			6	6		588	580	0		0	0		1	0	98	0		0.003840	0	0	0	0	1	0	6	588
ZNF823	55552	broad.mit.edu	37	19	11833554	11833554	+	Silent	SNP	T	T	C			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr19:11833554T>C	ENST00000341191.6	-	4	948	c.795A>G	c.(793-795)agA>agG	p.R265R	ZNF823_ENST00000545749.1_Silent_p.R83R	NM_001080493.2	NP_001073962.1	P16415	ZN823_HUMAN	zinc finger protein 823	265					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)	26						TTCTCTCATGTCTTAGATAGG	0.418										HNSCC(68;0.2)																												ENST00000341191.6	1.000000	5.800000e-01	0.910000	0.680000	0.780000	0.794421	0.780000	0.780000																										0				26						c.(793-795)agA>agG		zinc finger protein 823							82.0	85.0	84.0					19																	11833554		2202	4295	6497	SO:0001819	synonymous_variant	55552	0	0					g.chr19:11833554T>C	X51760	CCDS45981.1	19p13.2	2013-01-08			ENSG00000197933	ENSG00000197933		"""Zinc fingers, C2H2-type"", ""-"""	30936	protein-coding gene	gene with protein product	"""ZFP 36 for a zinc finger protein"""						Standard	XM_006722789		Approved	HSZFP36	uc002msm.2	P16415	OTTHUMG00000156528	ENST00000341191.6:c.795A>G	chr19.hg19:g.11833554T>C		0	HNSCC(68;0.2)				ZNF823_ENST00000545749.1_Silent_p.R83R	p.R265R	NM_001080493.2	NP_001073962.1	1	2	3	2.029721	P16415	ZN823_HUMAN		4	948	-			A0PJL4|B7Z8D4|Q6P4A9	Silent	SNP	ENST00000341191.6	1	1	hg19	c.795A>G	CCDS45981.1	0																																																																																								0.384676		TCGA-2J-AABE-01A-12D-A40W-08	0.418	ZNF823-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344516.2	1	0	1		2	2	2	0		0	0	64		64	64	1	1.990000	-19.993030	1	0.380000	NM_001080493			46	46		266	262	0		1	1		0	0	64	0		1.000000	2.225771e-01	0	3	0	3	0	46	266
ZNF585B	92285	broad.mit.edu	37	19	37677113	37677113	+	Missense_Mutation	SNP	G	G	T			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr19:37677113G>T	ENST00000532828.2	-	5	1577	c.1326C>A	c.(1324-1326)caC>caA	p.H442Q	ZNF585B_ENST00000527838.1_3'UTR|CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000312908.5_Missense_Mutation_p.H30Q|ZNF585B_ENST00000531805.1_Missense_Mutation_p.H387Q	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	442					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATTTCCCACAGTGACCACATT	0.393																																					Melanoma(93;882 1454 18863 28917 48427)	ENST00000532828.2	1.000000	7.000000e-01	0.940000	0.770000	0.850000	0.859180	0.850000	0.850000																										0				29						c.(1324-1326)caC>caA		zinc finger protein 585B							109.0	109.0	109.0					19																	37677113		2203	4300	6503	SO:0001583	missense	92285	0	0					g.chr19:37677113G>T	AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.1326C>A	chr19.hg19:g.37677113G>T	ENSP00000433773:p.His442Gln	0					ZNF585B_ENST00000531805.1_Missense_Mutation_p.H387Q|ZNF585B_ENST00000312908.5_Missense_Mutation_p.H30Q|CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000527838.1_3'UTR	p.H442Q	NM_152279.3	NP_689492.3	1	2	3	2.029721	Q52M93	Z585B_HUMAN	COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)	5	1577	-			Q8IZD3|Q96JW6	Missense_Mutation	SNP	ENST00000532828.2	1	1	hg19	c.1326C>A	CCDS12500.1	1	.	.	.	.	.	.	.	.	.	.	G	3.430	-0.116359	0.06881	.	.	ENSG00000245680	ENST00000531805;ENST00000532828;ENST00000312908	T;T;T	0.35236	1.32;3.2;3.2	2.35	-0.522	0.11928	2.35	-0.522	0.11928	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.400480	0.18380	N	0.142995	T	0.08626	0.0214	N	0.01576	-0.805	0.21105	N	0.99978	B;B	0.33413	0.013;0.411	B;B	0.28011	0.034;0.085	T	0.28554	-1.0040	10	0.12430	T	0.62	.	3.4191	0.07386	0.1455:0.0:0.4286:0.4259	.	387;442	E9PQH3;Q52M93	.;Z585B_HUMAN	Q	387;442;30	ENSP00000436774:H387Q;ENSP00000433773:H442Q;ENSP00000442139:H30Q	ENSP00000442139:H30Q	H	-	3	2	2	ZNF585B	42368953	42368953	0.000000	0.05858	0.809000	0.32408	0.714000	0.41099	-5.979000	0.00087	-0.158000	0.11040	0.305000	0.20034	CAC	0.384676		TCGA-2J-AABE-01A-12D-A40W-08	0.393	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388272.2	0	0	1		2	2	2	0		0	0	136		136	136	1	1.990000	-20.000000	1	0.380000	NM_152279			105	105		548	543	0		1	0		0	0	136	0		1.000000	2.631603e-02	0	1	0	1	0	105	548
LRFN1	57622	broad.mit.edu	37	19	39805357	39805357	+	Missense_Mutation	SNP	A	A	T			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr19:39805357A>T	ENST00000248668.4	-	1	619	c.620T>A	c.(619-621)gTg>gAg	p.V207E	CTC-246B18.8_ENST00000601911.1_RNA	NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	207						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			GTGAAGCTGCACGAAGGTCCC	0.647																																						ENST00000248668.4	1.000000	9.900000e-01	1.000000	0.990000	0.990000	0.998431	0.990000	1.000000																										0				18						c.(619-621)gTg>gAg		leucine rich repeat and fibronectin type III domain containing 1							47.0	57.0	54.0					19																	39805357		2166	4272	6438	SO:0001583	missense	57622	0	0					g.chr19:39805357A>T	BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.620T>A	chr19.hg19:g.39805357A>T	ENSP00000248668:p.Val207Glu	0					CTC-246B18.8_ENST00000601911.1_RNA	p.V207E	NM_020862.1	NP_065913.1	1	2	3	2.029721	Q9P244	LRFN1_HUMAN	Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)	1	619	-	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Q8TBS9	Missense_Mutation	SNP	ENST00000248668.4	1	1	hg19	c.620T>A	CCDS46071.1	1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.596320	0.46318	.	.	ENSG00000128011	ENST00000248668	T	0.55760	0.5	4.62	3.61	0.41365	4.62	3.61	0.41365	.	0.000000	0.38720	N	0.001584	T	0.26376	0.0644	N	0.01257	-0.925	0.34603	D	0.716756	P	0.39060	0.657	P	0.45232	0.474	T	0.31280	-0.9949	10	0.33141	T	0.24	.	5.8513	0.18694	0.7936:0.0:0.2064:0.0	.	207	Q9P244	LRFN1_HUMAN	E	207	ENSP00000248668:V207E	ENSP00000248668:V207E	V	-	2	0	0	LRFN1	44497197	44497197	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.225000	0.72271	0.810000	0.34279	0.454000	0.30748	GTG	0.384676		TCGA-2J-AABE-01A-12D-A40W-08	0.647	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463835.1	1	0	1		2	2	2	0		0	0	19		19	19	1	1.990000	-20.000000	1	0.380000	NM_020862			27	27		73	72	1		1	0		0	0	19	0		1.000000	0	0	0	0	1	0	27	73
PRX	57716	broad.mit.edu	37	19	40901352	40901352	+	Silent	SNP	A	A	G			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr19:40901352A>G	ENST00000324001.7	-	7	3177	c.2907T>C	c.(2905-2907)gcT>gcC	p.A969A	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	969					axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CCCCCACCCGAGCCTTGGGGA	0.642																																						ENST00000324001.7	1.000000	1.500000e-01	0.320000	0.200000	0.250000	0.292309	0.250000	0.250000																										0				47						c.(2905-2907)gcT>gcC		periaxin							56.0	66.0	63.0					19																	40901352		2203	4300	6503	SO:0001819	synonymous_variant	57716	0	0					g.chr19:40901352A>G	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.2907T>C	chr19.hg19:g.40901352A>G		0					PRX_ENST00000291825.7_3'UTR	p.A969A	NM_181882.2	NP_870998.2	1	2	3	2.043321	Q9BXM0	PRAX_HUMAN	Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)	7	3177	-			Q9BXL9|Q9HCF2	Silent	SNP	ENST00000324001.7	1	1	hg19	c.2907T>C	CCDS33028.1	0																																																																																								0.386988		TCGA-2J-AABE-01A-12D-A40W-08	0.642	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	1	0	1		2	2	2	0		0	0	50		50	48	1	1.990000	-19.998100	1	0.380000	NM_020956			22	22		450	434	0		1	0		0	0	50	0		0.999998	8.346818e-02	0	0	0	10	0	22	450
SCAF1	58506	broad.mit.edu	37	19	50154632	50154632	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr19:50154632C>T	ENST00000360565.3	+	7	1110	c.986C>T	c.(985-987)cCg>cTg	p.P329L		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	329					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		CCCACACAGCCGACTCCCGCC	0.701																																						ENST00000360565.3	1.000000	8.800000e-01	1.000000	0.990000	0.990000	0.992223	0.990000	1.000000																										0				20						c.(985-987)cCg>cTg		SR-related CTD-associated factor 1							16.0	18.0	17.0					19																	50154632		2194	4294	6488	SO:0001583	missense	58506	1	120792	23				g.chr19:50154632C>T	AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.986C>T	chr19.hg19:g.50154632C>T	ENSP00000353769:p.Pro329Leu	0						p.P329L	NM_021228.2	NP_067051.2	1	2	3	2.038292	Q9H7N4	SFR19_HUMAN		7	1110	+		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)	Q7Z5V7|Q8WVA1|Q9NR59	Missense_Mutation	SNP	ENST00000360565.3	1	1	hg19	c.986C>T	CCDS33074.1	1	.	.	.	.	.	.	.	.	.	.	C	10.13	1.266252	0.23136	.	.	ENSG00000126461	ENST00000360565	T	0.29655	1.56	4.47	2.21	0.28008	4.47	2.21	0.28008	.	0.601209	0.13812	N	0.361016	T	0.13030	0.0316	N	0.08118	0	0.09310	N	1	B	0.17268	0.021	B	0.14578	0.011	T	0.19063	-1.0317	9	.	.	.	-5.2311	6.3384	0.21309	0.185:0.7119:0.0:0.1031	.	329	Q9H7N4	SFR19_HUMAN	L	329	ENSP00000353769:P329L	.	P	+	2	0	0	SCAF1	54846444	54846444	0.000000	0.05858	0.004000	0.12327	0.003000	0.03518	0.543000	0.23237	2.187000	0.69744	0.591000	0.81541	CCG	0.385835		TCGA-2J-AABE-01A-12D-A40W-08	0.701	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465764.1	1	0	1		2	2	2	0		0	0	19		19	18	1	1.990000	-4.039193	1	0.380000	NM_021228			28	25		91	88	0		1	1		0	0	19	0		1.000000	9.999995e-01	0	26	0	60	0	28	91
NLRP8	126205	broad.mit.edu	37	19	56477724	56477724	+	Missense_Mutation	SNP	C	C	T	rs183661608	byFrequency	TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr19:56477724C>T	ENST00000291971.3	+	5	2430	c.2359C>T	c.(2359-2361)Cgg>Tgg	p.R787W	NLRP8_ENST00000590542.1_Missense_Mutation_p.R787W	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	787					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		GAGATCCCCCCGGTGCCGTCT	0.542													C|||	5	0.000998403	0.0038	0.0	5008	,	,		17702	0.0		0.0	False		,,,				2504	0.0					ENST00000291971.3	1.000000	6.500000e-01	1.000000	0.740000	0.860000	0.863171	0.860000	1.000000																										0				35						c.(2359-2361)Cgg>Tgg		NLR family, pyrin domain containing 8							92.0	90.0	91.0					19																	56477724		2203	4300	6503	SO:0001583	missense	126205	14	121412	41				g.chr19:56477724C>T	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.2359C>T	chr19.hg19:g.56477724C>T	ENSP00000291971:p.Arg787Trp	0					NLRP8_ENST00000590542.1_Missense_Mutation_p.R787W	p.R787W	NM_176811.2	NP_789781.2	1	2	3	2.060197	Q86W28	NALP8_HUMAN		5	2430	+		Colorectal(82;0.000147)|Ovarian(87;0.17)	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	1	1	hg19	c.2359C>T	CCDS12937.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	6.834	0.523138	0.13066	.	.	ENSG00000179709	ENST00000291971	T	0.54071	0.59	1.82	0.759	0.18438	1.82	0.759	0.18438	.	.	.	.	.	T	0.37293	0.0998	L	0.39898	1.24	0.09310	N	1	B;B	0.27140	0.031;0.169	B;B	0.18871	0.022;0.023	T	0.28933	-1.0028	9	0.56958	D	0.05	.	4.3325	0.11071	0.0:0.7918:0.0:0.2082	.	787;787	Q86W28-2;Q86W28	.;NALP8_HUMAN	W	787	ENSP00000291971:R787W	ENSP00000291971:R787W	R	+	1	2	2	NLRP8	61169536	61169536	0.001000	0.12720	0.008000	0.14137	0.025000	0.11179	-0.353000	0.07691	0.313000	0.23062	0.557000	0.71058	CGG	0.389283		TCGA-2J-AABE-01A-12D-A40W-08	0.542	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	1	0	1		2	2	2	0		0	0	44		44	44	1	1.990000	-2.419890	0	0.380000	NM_176811			49	49		258	255	1		1			0	0	44	0		1.000000	0	0	0	0	0	0	49	258
ZNF582	147948	broad.mit.edu	37	19	56901800	56901800	+	Missense_Mutation	SNP	T	T	G			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr19:56901800T>G	ENST00000301310.4	-	3	238	c.80A>C	c.(79-81)cAg>cCg	p.Q27P	AC006116.12_ENST00000589671.1_RNA|ZNF582_ENST00000586929.1_Missense_Mutation_p.Q27P	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	27	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		CAAATCCCTCTGAGCAGGTGC	0.483																																					Ovarian(183;1887 2032 4349 30507 51343)	ENST00000301310.4	1.000000	7.400000e-01	1.000000	0.820000	0.910000	0.911824	0.910000	1.000000																										0				26						c.(79-81)cAg>cCg		zinc finger protein 582							168.0	138.0	148.0					19																	56901800		2203	4300	6503	SO:0001583	missense	147948	0	0					g.chr19:56901800T>G	AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.80A>C	chr19.hg19:g.56901800T>G	ENSP00000301310:p.Gln27Pro	0					AC006116.12_ENST00000589671.1_RNA|ZNF582_ENST00000586929.1_Missense_Mutation_p.Q27P	p.Q27P	NM_144690.1	NP_653291.1	1	2	3	2.060197	Q96NG8	ZN582_HUMAN		3	238	-		Colorectal(82;0.000256)|Ovarian(87;0.243)	B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	ENST00000301310.4	1	1	hg19	c.80A>C	CCDS33121.1	1	.	.	.	.	.	.	.	.	.	.	T	19.14	3.770086	0.69992	.	.	ENSG00000018869	ENST00000301310	T	0.09538	2.97	4.6	4.6	0.57074	4.6	4.6	0.57074	Krueppel-associated box (4);	.	.	.	.	T	0.47691	0.1459	H	0.97564	4.03	0.34108	D	0.662673	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.999	T	0.74284	-0.3715	9	0.87932	D	0	.	13.4023	0.60889	0.0:0.0:0.0:1.0	.	27;58	Q96NG8;B4DQZ9	ZN582_HUMAN;.	P	27	ENSP00000301310:Q27P	ENSP00000301310:Q27P	Q	-	2	0	0	ZNF582	61593612	61593612	1.000000	0.71417	0.985000	0.45067	0.866000	0.49608	5.400000	0.66320	2.054000	0.61138	0.533000	0.62120	CAG	0.389283		TCGA-2J-AABE-01A-12D-A40W-08	0.483	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458387.2	1	0	1		2	2	2	0		0	0	62		62	60	1	1.990000	-20.000000	1	0.380000	NM_144690			83	83		404	400	1		1	0		0	0	62	0		1.000000	2.979842e-02	0	0	0	2	0	83	404
CD1D	912	broad.mit.edu	37	1	158151261	158151261	+	Silent	SNP	C	C	T			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr1:158151261C>T	ENST00000368171.3	+	3	577	c.78C>T	c.(76-78)ttC>ttT	p.F26F		NM_001766.3	NP_001757.1	P15813	CD1D_HUMAN	CD1d molecule	26					antigen processing and presentation, endogenous lipid antigen via MHC class Ib (GO:0048006)|detection of bacterium (GO:0016045)|heterotypic cell-cell adhesion (GO:0034113)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of T cell proliferation (GO:0042102)|T cell selection (GO:0045058)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	beta-2-microglobulin binding (GO:0030881)|cell adhesion molecule binding (GO:0050839)|exogenous lipid antigen binding (GO:0030884)|histone binding (GO:0042393)|lipid antigen binding (GO:0030882)|receptor activity (GO:0004872)			endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(1)|prostate(3)|urinary_tract(2)	30	all_hematologic(112;0.0378)					AAAGGCTTTTCCCCCTCCGCT	0.597																																						ENST00000368171.3	1.000000	9.300000e-01	1.000000	0.990000	0.990000	0.994905	0.990000	1.000000																										0				30						c.(76-78)ttC>ttT		CD1d molecule							196.0	219.0	211.0					1																	158151261		2203	4300	6503	SO:0001819	synonymous_variant	912	0	0					g.chr1:158151261C>T	BC027926	CCDS1173.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158473	ENSG00000158473		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1637	protein-coding gene	gene with protein product		188410	"""CD1D antigen, d polypeptide"", ""CD1d antigen"""			2463622	Standard	NM_001766		Approved		uc001frr.3	P15813	OTTHUMG00000022436	ENST00000368171.3:c.78C>T	chr1.hg19:g.158151261C>T		1						p.F26F	NM_001766.3	NP_001757.1	1	3	4	2.456500	P15813	CD1D_HUMAN		3	577	+	all_hematologic(112;0.0378)		D3DVD5|Q5W0J3|Q9UMM3|Q9Y5M4	Silent	SNP	ENST00000368171.3	1	0	hg19	c.78C>T	CCDS1173.1	1																																																																																								0.495114		TCGA-2J-AABE-01A-12D-A40W-08	0.597	CD1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058340.1	1	0	1		2	2	2	0		0	0	241		241	226	1	1.990000	-20.000000	1	0.380000	NM_001766			302	298		1569	1536	0		1	0		0	0	241	0		1.000000	1.252769e-01	0	0	0	4	0	302	1569
CENPF	1063	broad.mit.edu	37	1	214832306	214832306	+	Missense_Mutation	SNP	A	A	T			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr1:214832306A>T	ENST00000366955.3	+	19	9244	c.9076A>T	c.(9076-9078)Agt>Tgt	p.S3026C		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	3122	Sufficient for centromere localization.|Sufficient for nuclear localization.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		ATCCCCACTGAGTCTCGGCAA	0.517											OREG0014250	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(80;575 1284 11000 14801 43496)	ENST00000366955.3	1.000000	1.100000e-01	1.000000	0.150000	0.210000	0.392173	0.210000	0.190000																										0				126						c.(9076-9078)Agt>Tgt		centromere protein F, 350/400kDa							102.0	103.0	103.0					1																	214832306		2203	4300	6503	SO:0001583	missense	1063	0	0					g.chr1:214832306A>T	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.9076A>T	chr1.hg19:g.214832306A>T	ENSP00000355922:p.Ser3026Cys	1		OREG0014250	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2224		p.S3026C	NM_016343.3	NP_057427.3	1	3	4	2.426649	P49454	CENPF_HUMAN		19	9244	+			Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	1	1	hg19	c.9076A>T	CCDS31023.1	0	.	.	.	.	.	.	.	.	.	.	A	9.358	1.067311	0.20067	.	.	ENSG00000117724	ENST00000366955	T	0.03553	3.89	5.63	1.72	0.24424	5.63	1.72	0.24424	.	0.578740	0.14474	N	0.317357	T	0.03178	0.0093	L	0.39633	1.23	0.09310	N	1	B	0.18741	0.03	B	0.14578	0.011	T	0.42224	-0.9464	10	0.87932	D	0	.	1.4268	0.02324	0.5106:0.1236:0.1263:0.2395	.	3122	P49454	CENPF_HUMAN	C	3026	ENSP00000355922:S3026C	ENSP00000355922:S3026C	S	+	1	0	0	CENPF	212898929	212898929	0.000000	0.05858	0.001000	0.08648	0.156000	0.22039	0.552000	0.23376	0.931000	0.37242	0.533000	0.62120	AGT	0.488786		TCGA-2J-AABE-01A-12D-A40W-08	0.517	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	0	0	1		2	2	2	0		0	0	49		49	49	1	1.990000	-13.595710	1	0.380000	NM_016343			15	15		489	481	0		1	1		0	0	49	0		0.999858	3.367425e-01	0	2	0	36	0	15	489
MED18	54797	broad.mit.edu	37	1	28661125	28661125	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr1:28661125C>T	ENST00000373842.4	+	3	480	c.271C>T	c.(271-273)Cca>Tca	p.P91S	MED18_ENST00000398997.2_Missense_Mutation_p.P91S|MED18_ENST00000479574.1_3'UTR	NM_001127350.1|NM_017638.2	NP_001120822.1|NP_060108.2	Q9BUE0	MED18_HUMAN	mediator complex subunit 18	91						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7		Colorectal(325;0.000147)|Lung NSC(340;0.000818)|all_lung(284;0.000996)|Renal(390;0.00357)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0557)|Ovarian(437;0.113)		OV - Ovarian serous cystadenocarcinoma(117;2.36e-22)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0141)|READ - Rectum adenocarcinoma(331;0.0649)		CCTGGGACAGCCAGAAATGGG	0.582																																						ENST00000373842.4	1.000000	8.500000e-01	1.000000	0.930000	0.990000	0.975981	0.990000	1.000000																										0				7						c.(271-273)Cca>Tca		mediator complex subunit 18							120.0	132.0	128.0					1																	28661125		2203	4300	6503	SO:0001583	missense	54797	0	0					g.chr1:28661125C>T	BC002694	CCDS322.1	1p35.3	2007-07-30	2007-07-30		ENSG00000130772	ENSG00000130772			25944	protein-coding gene	gene with protein product		612384	"""mediator of RNA polymerase II transcription, subunit 18 homolog (S. cerevisiae)"""			15175163	Standard	NM_001127350		Approved	FLJ20045, p28b	uc009vtg.3	Q9BUE0	OTTHUMG00000003537	ENST00000373842.4:c.271C>T	chr1.hg19:g.28661125C>T	ENSP00000362948:p.Pro91Ser	0					MED18_ENST00000479574.1_3'UTR|MED18_ENST00000398997.2_Missense_Mutation_p.P91S	p.P91S	NM_001127350.1|NM_017638.2	NP_001120822.1|NP_060108.2	1	2	3	2.036992	Q9BUE0	MED18_HUMAN		3	480	+		Colorectal(325;0.000147)|Lung NSC(340;0.000818)|all_lung(284;0.000996)|Renal(390;0.00357)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0557)|Ovarian(437;0.113)	D3DPM1|Q9NXU9	Missense_Mutation	SNP	ENST00000373842.4	1	1	hg19	c.271C>T	CCDS322.1	1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.345319	0.61073	.	.	ENSG00000130772	ENST00000373842;ENST00000398997	.	.	.	5.75	5.75	0.90469	5.75	5.75	0.90469	Mediator complex, subunit Med18, metazoa/fungi (1);	0.000000	0.85682	D	0.000000	T	0.52789	0.1756	L	0.52126	1.63	0.33548	D	0.595697	B	0.14012	0.009	B	0.11329	0.006	T	0.56601	-0.7952	9	0.19147	T	0.46	-9.4996	17.4171	0.87504	0.0:1.0:0.0:0.0	.	91	Q9BUE0	MED18_HUMAN	S	91	.	ENSP00000362948:P91S	P	+	1	0	0	MED18	28533712	28533712	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.550000	0.60733	2.728000	0.93425	0.655000	0.94253	CCA	0.385835		TCGA-2J-AABE-01A-12D-A40W-08	0.582	MED18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009856.1	1	0	1		2	2	2	0		0	0	92		92	91	1	1.990000	-20.000000	1	0.380000	NM_017638			120	120		508	502	1		1	1		0	0	92	0		1.000000	9.639678e-01	0	10	0	15	0	120	508
INPP5B	3633	broad.mit.edu	37	1	38354008	38354008	+	Missense_Mutation	SNP	G	G	A	rs201051953		TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr1:38354008G>A	ENST00000373026.1	-	9	1046	c.1046C>T	c.(1045-1047)gCg>gTg	p.A349V	INPP5B_ENST00000373023.2_Missense_Mutation_p.A349V|INPP5B_ENST00000467066.1_5'UTR|INPP5B_ENST00000373027.1_Missense_Mutation_p.A105V|INPP5B_ENST00000458109.2_Missense_Mutation_p.A32V|INPP5B_ENST00000373024.3_Missense_Mutation_p.A269V			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	349	5-phosphatase. {ECO:0000250}.				in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)			breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GTATGTTCCCGCAAAAAACCT	0.458																																						ENST00000373026.1	1.000000	3.000000e-02	0.170000	0.060000	0.100000	0.151726	0.100000	0.100000																										0				15						c.(1045-1047)gCg>gTg		inositol polyphosphate-5-phosphatase, 75kDa		A	VAL/ALA	0,3766		0,0,1883	70.0	72.0	71.0		806	5.8	1.0	1		71	1,8221		0,1,4110	yes	missense	INPP5B	NM_005540.2	64	0,1,5993	AA,AG,GG		0.0122,0.0,0.0083	benign	269/914	38354008	1,11987	1883	4111	5994	SO:0001583	missense	3633	9	120794	40				g.chr1:38354008G>A	M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.1046C>T	chr1.hg19:g.38354008G>A	ENSP00000362117:p.Ala349Val	0					INPP5B_ENST00000467066.1_5'UTR|INPP5B_ENST00000373023.2_Missense_Mutation_p.A349V|INPP5B_ENST00000373027.1_Missense_Mutation_p.A105V|INPP5B_ENST00000458109.2_Missense_Mutation_p.A32V|INPP5B_ENST00000373024.3_Missense_Mutation_p.A269V	p.A349V			1	2	3	2.036992	P32019	I5P2_HUMAN		9	1046	-	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)	C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Missense_Mutation	SNP	ENST00000373026.1	0	1	hg19	c.1046C>T		0	.	.	.	.	.	.	.	.	.	.	A	10.30	1.311269	0.23821	0.0	1.22E-4	ENSG00000204084	ENST00000373027;ENST00000373023;ENST00000373029;ENST00000373026;ENST00000373024;ENST00000458109	D;D;D;D;D	0.92545	-3.06;-3.06;-3.06;-3.06;-3.06	5.85	5.85	0.93711	5.85	5.85	0.93711	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.062810	0.64402	N	0.000007	T	0.66607	0.2806	N	0.00082	-2.215	0.20975	N	0.999815	B;B	0.12013	0.002;0.005	B;B	0.01281	0.0;0.0	T	0.60332	-0.7284	10	0.02654	T	1	.	12.0299	0.53392	0.9329:0.0:0.0671:0.0	.	349;269	P32019;P32019-2	I5P2_HUMAN;.	V	105;349;349;349;269;32	ENSP00000362118:A105V;ENSP00000362114:A349V;ENSP00000362117:A349V;ENSP00000362115:A269V;ENSP00000397748:A32V	ENSP00000362114:A349V	A	-	2	0	0	INPP5B	38126595	38126595	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.160000	0.77495	1.035000	0.39972	-0.254000	0.11334	GCG	0.385835		TCGA-2J-AABE-01A-12D-A40W-08	0.458	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000012968.1	0	0	1		2	2	2	0		0	0	35		35	35	1	1.990000	-2.571393	1	0.380000	NM_005540			5	5		261	256	0		1	0		0	0	35	0		0.934326	3.143181e-02	0	0	0	12	0	5	261
AKT3	10000	broad.mit.edu	37	1	243778456	243778456	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr1:243778456A>G	ENST00000366539.1	-	7	769	c.569T>C	c.(568-570)gTg>gCg	p.V190A	AKT3_ENST00000366540.1_Missense_Mutation_p.V190A|AKT3_ENST00000263826.5_Missense_Mutation_p.V190A|AKT3_ENST00000492957.1_5'Flank|AKT3_ENST00000336199.5_Missense_Mutation_p.V190A			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3	190	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			AGTGTGTGCCACTTCATCCTA	0.328																																						ENST00000366539.1	1.000000	1.400000e-01	1.000000	0.210000	0.300000	0.454752	0.300000	0.270000																										0				26						c.(568-570)gTg>gCg		v-akt murine thymoma viral oncogene homolog 3							125.0	120.0	121.0					1																	243778456		2201	4299	6500	SO:0001583	missense	10000	0	0					g.chr1:243778456A>G	AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.569T>C	chr1.hg19:g.243778456A>G	ENSP00000355497:p.Val190Ala	1					AKT3_ENST00000492957.1_5'Flank|AKT3_ENST00000366540.1_Missense_Mutation_p.V190A|AKT3_ENST00000336199.5_Missense_Mutation_p.V190A|AKT3_ENST00000263826.5_Missense_Mutation_p.V190A	p.V190A			1	3	4	2.426649	Q9Y243	AKT3_HUMAN	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)	7	769	-	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Missense_Mutation	SNP	ENST00000366539.1	1	1	hg19	c.569T>C	CCDS31077.1	0	.	.	.	.	.	.	.	.	.	.	A	23.7	4.450253	0.84101	.	.	ENSG00000117020	ENST00000336199;ENST00000366540;ENST00000366539;ENST00000263826	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	5.58	5.58	0.84498	5.58	5.58	0.84498	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.68054	0.2959	L	0.37850	1.14	0.80722	D	1	P;P	0.49358	0.862;0.923	P;P	0.59889	0.593;0.865	T	0.69491	-0.5131	10	0.52906	T	0.07	.	13.9981	0.64414	1.0:0.0:0.0:0.0	.	190;190	Q9Y243;Q9Y243-2	AKT3_HUMAN;.	A	190	ENSP00000336943:V190A;ENSP00000355498:V190A;ENSP00000355497:V190A;ENSP00000263826:V190A	ENSP00000263826:V190A	V	-	2	0	0	AKT3	241845079	241845079	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.054000	0.71096	2.122000	0.65172	0.459000	0.35465	GTG	0.488786		TCGA-2J-AABE-01A-12D-A40W-08	0.328	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096479.1	0	0	1		2	2	2	0		0	0	37		37	37	1	1.990000	-12.811840	1	0.380000	NM_181690			11	11		256	255	0		1	0		0	0	37	0		0.998397	3.795127e-02	0	0	0	7	0	11	256
HLCS	3141	broad.mit.edu	37	21	38269242	38269242	+	Missense_Mutation	SNP	G	G	A	rs547391411		TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr21:38269242G>A	ENST00000399120.1	-	7	2599	c.1369C>T	c.(1369-1371)Cgc>Tgc	p.R457C	HLCS_ENST00000336648.4_Missense_Mutation_p.R457C|HLCS_ENST00000482273.1_5'UTR	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	457					biotin metabolic process (GO:0006768)|cell proliferation (GO:0008283)|histone biotinylation (GO:0071110)|histone modification (GO:0016570)|protein biotinylation (GO:0009305)|response to biotin (GO:0070781)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin-[acetyl-CoA-carboxylase] ligase activity (GO:0004077)|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity (GO:0004078)|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity (GO:0004079)|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity (GO:0004080)|biotin-protein ligase activity (GO:0018271)|enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	AGATTTTGGCGATAGATCTCT	0.468													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20624	0.0		0.0	False		,,,				2504	0.0					ENST00000399120.1	1.000000	7.400000e-01	1.000000	0.830000	0.930000	0.926563	0.930000	1.000000																										0				24						c.(1369-1371)Cgc>Tgc		holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	Biotin(DB00121)						112.0	98.0	103.0					21																	38269242		2203	4300	6503	SO:0001583	missense	3141	1	121412	31				g.chr21:38269242G>A		CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267	6.3.4.9, 6.3.4.10, 6.3.4.11, 6.3.4.15		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""			7842009	Standard	NM_000411		Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.1369C>T	chr21.hg19:g.38269242G>A	ENSP00000382071:p.Arg457Cys	0					HLCS_ENST00000482273.1_5'UTR|HLCS_ENST00000336648.4_Missense_Mutation_p.R457C	p.R457C	NM_001242784.1	NP_001229713.1	0	0	0	1.943492	P50747	BPL1_HUMAN		7	2599	-		Myeloproliferative disorder(46;0.0422)	B2RAH1|D3DSG6|Q99451	Missense_Mutation	SNP	ENST00000399120.1	1	1	hg19	c.1369C>T	CCDS13647.1	1	.	.	.	.	.	.	.	.	.	.	G	9.174	1.021978	0.19433	.	.	ENSG00000159267	ENST00000399120;ENST00000336648	D;D	0.97066	-4.23;-4.23	5.12	5.12	0.69794	5.12	5.12	0.69794	.	0.306610	0.33959	N	0.004385	D	0.94175	0.8131	L	0.49350	1.555	0.29287	N	0.869631	B	0.28713	0.22	B	0.15052	0.012	D	0.90047	0.4146	10	0.38643	T	0.18	.	12.3631	0.55215	0.0:0.0:0.7107:0.2892	.	457	P50747	BPL1_HUMAN	C	457	ENSP00000382071:R457C;ENSP00000338387:R457C	ENSP00000338387:R457C	R	-	1	0	0	HLCS	37191112	37191112	0.984000	0.35163	0.331000	0.25455	0.251000	0.25915	1.925000	0.40074	2.551000	0.86045	0.563000	0.77884	CGC	0.360561		TCGA-2J-AABE-01A-12D-A40W-08	0.468	HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194687.2	1	0	1		2	2	2	0		0	0	62		62	61	1	1.990000	-3.445200	1	0.380000				66	66		291	288	1		1	1		0	0	62	0		1.000000	3.843096e-01	0	3	0	4	0	66	291
EWSR1	2130	broad.mit.edu	37	22	29694822	29694822	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr22:29694822G>A	ENST00000397938.2	+	14	1836	c.1517G>A	c.(1516-1518)cGa>cAa	p.R506Q	EWSR1_ENST00000414183.2_Missense_Mutation_p.R511Q|EWSR1_ENST00000331029.7_Missense_Mutation_p.R468Q|EWSR1_ENST00000332050.6_Missense_Mutation_p.R433Q|EWSR1_ENST00000406548.1_Missense_Mutation_p.R505Q|EWSR1_ENST00000332035.6_Missense_Mutation_p.R450Q	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1	506	Arg/Gly/Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						CGGGGTTCCCGAGGGAACCCC	0.617			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																	ENST00000397938.2	1.000000	1.200000e-01	0.270000	0.160000	0.210000	0.239673	0.210000	0.210000				Dom	yes			Dom	yes		22	22q12	22q12	2130	T	Ewing sarcoma breakpoint region 1 (EWS)				"""L, M"""	L, M	FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1		Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma	EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	0				26						c.(1516-1518)cGa>cAa		EWS RNA-binding protein 1							56.0	64.0	61.0					22																	29694822		2203	4299	6502	SO:0001583	missense	2130	1	121406	35				g.chr22:29694822G>A		CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.1517G>A	chr22.hg19:g.29694822G>A	ENSP00000381031:p.Arg506Gln	0					EWSR1_ENST00000331029.7_Missense_Mutation_p.R468Q|EWSR1_ENST00000414183.2_Missense_Mutation_p.R511Q|EWSR1_ENST00000332050.6_Missense_Mutation_p.R433Q|EWSR1_ENST00000332035.6_Missense_Mutation_p.R450Q|EWSR1_ENST00000406548.1_Missense_Mutation_p.R505Q	p.R506Q	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	1	2	3	2.031200	Q01844	EWS_HUMAN		14	1836	+			B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Missense_Mutation	SNP	ENST00000397938.2	1	0	hg19	c.1517G>A	CCDS13851.1	0	.	.	.	.	.	.	.	.	.	.	G	15.95	2.984297	0.53934	.	.	ENSG00000182944	ENST00000332050;ENST00000397938;ENST00000406548;ENST00000331029;ENST00000414183;ENST00000332035	D;D;D;D;D;D	0.97041	-4.15;-3.62;-3.74;-4.22;-3.76;-3.64	5.52	3.41	0.39046	5.52	3.41	0.39046	.	0.000000	0.64402	U	0.000001	D	0.92688	0.7676	L	0.29908	0.895	0.45634	D	0.998569	B;B;B;B;B	0.17852	0.024;0.024;0.024;0.024;0.024	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001	D	0.87313	0.2313	10	0.29301	T	0.29	.	10.1963	0.43056	0.0757:0.1375:0.7868:0.0	.	450;505;450;511;506	Q96MN4;Q96FE8;B0QYK1;Q96MX4;Q01844	.;.;.;.;EWS_HUMAN	Q	433;506;505;468;511;450	ENSP00000330896:R433Q;ENSP00000381031:R506Q;ENSP00000385726:R505Q;ENSP00000330516:R468Q;ENSP00000400142:R511Q;ENSP00000331699:R450Q	ENSP00000330516:R468Q	R	+	2	0	0	EWSR1	28024822	28024822	1.000000	0.71417	0.987000	0.45799	0.499000	0.33736	6.759000	0.74934	0.679000	0.31345	0.462000	0.41574	CGA	0.384676		TCGA-2J-AABE-01A-12D-A40W-08	0.617	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321345.1	0	0	1		2	2	2	0		0	0	42		42	41	1	1.990000	-2.698535	1	0.380000	NM_005243			17	17		419	393	1		1	1		0	0	42	0		0.999944	9.998409e-01	0	42	0	318	0	17	419
SEMA4C	54910	broad.mit.edu	37	2	97527143	97527143	+	Silent	SNP	C	C	T			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr2:97527143C>T	ENST00000305476.5	-	15	1854	c.1722G>A	c.(1720-1722)gtG>gtA	p.V574V		NM_017789.4	NP_060259.4	Q9C0C4	SEM4C_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C	574	Ig-like C2-type.				cell migration in hindbrain (GO:0021535)|cerebellum development (GO:0021549)|muscle cell differentiation (GO:0042692)|neural tube closure (GO:0001843)|positive regulation of stress-activated MAPK cascade (GO:0032874)|semaphorin-plexin signaling pathway (GO:0071526)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle membrane (GO:0030672)	receptor activity (GO:0004872)			NS(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	17						GGCAGGGCAGCACCAGGTCTG	0.627																																						ENST00000305476.5	1.000000	5.600000e-01	0.980000	0.680000	0.820000	0.830098	0.820000	1.000000																										0				17						c.(1720-1722)gtG>gtA		sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C							20.0	25.0	23.0					2																	97527143		2203	4298	6501	SO:0001819	synonymous_variant	54910	0	0					g.chr2:97527143C>T	AB051526	CCDS2029.1	2q11.2	2013-01-11			ENSG00000168758	ENSG00000168758		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10731	protein-coding gene	gene with protein product	"""M-Sema F"""	604462		SEMAI		7656991	Standard	NM_017789		Approved	Semacl1, Semaf	uc002sxh.4	Q9C0C4	OTTHUMG00000130535	ENST00000305476.5:c.1722G>A	chr2.hg19:g.97527143C>T		1						p.V574V	NM_017789.4	NP_060259.4	1	2	3	2.403738	Q9C0C4	SEM4C_HUMAN		15	1854	-			Q32MJ3|Q7Z5X0	Silent	SNP	ENST00000305476.5	1	1	hg19	c.1722G>A	CCDS2029.1	0																																																																																								0.478992		TCGA-2J-AABE-01A-12D-A40W-08	0.627	SEMA4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252957.1	1	0	1		2	2	2	0		0	0	23		23	21	1	1.990000	-20.000000	1	0.380000	NM_017789			27	24		178	174	1		1	1		0	0	23	0		1.000000	9.999869e-01	0	33	0	89	0	27	178
LCT	3938	broad.mit.edu	37	2	136567449	136567449	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr2:136567449C>T	ENST00000264162.2	-	8	2478	c.2468G>A	c.(2467-2469)aGc>aAc	p.S823N	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	823	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GCTGCTGTCGCTGAAGTTGAC	0.502																																						ENST00000264162.2	0.320000	1.400000e-01	0.280000	0.170000	0.220000	0.230906	0.220000	0.220000																										0				124						c.(2467-2469)aGc>aAc		lactase	Vitamin C(DB00126)						122.0	122.0	122.0					2																	136567449		2203	4300	6503	SO:0001583	missense	3938	0	0					g.chr2:136567449C>T	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2468G>A	chr2.hg19:g.136567449C>T	ENSP00000264162:p.Ser823Asn	1					Y_RNA_ENST00000363794.1_RNA	p.S823N	NM_002299.2	NP_002290.2	1	2	3	2.403738	P09848	LPH_HUMAN		8	2478	-			Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	1	1	hg19	c.2468G>A	CCDS2178.1	0	.	.	.	.	.	.	.	.	.	.	C	0.034	-1.319345	0.01320	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.50277	0.75	6.03	-6.67	0.01783	6.03	-6.67	0.01783	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.930568	0.09260	N	0.826760	T	0.10337	0.0253	N	0.00894	-1.105	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33033	-0.9884	10	0.02654	T	1	-7.8485	2.3501	0.04281	0.1009:0.2986:0.2085:0.3921	.	823	P09848	LPH_HUMAN	N	823;255	ENSP00000264162:S823N	ENSP00000264162:S823N	S	-	2	0	0	LCT	136283919	136283919	0.000000	0.05858	0.002000	0.10522	0.411000	0.31082	-0.207000	0.09384	-0.575000	0.05982	-1.193000	0.01689	AGC	0.478992		TCGA-2J-AABE-01A-12D-A40W-08	0.502	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	0	0	1		2	2	2	0		0	0	75		75	73	1	1.990000	-19.940430	1	0.380000	NM_002299			24	24		651	644	0		1			0	0	75	0		1.000000	0	0	0	0	0	0	24	651
NUP210	23225	broad.mit.edu	37	3	13401880	13401880	+	Missense_Mutation	SNP	C	C	T	rs149471357		TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr3:13401880C>T	ENST00000254508.5	-	15	2126	c.2044G>A	c.(2044-2046)Gtc>Atc	p.V682I		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	682					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					TCAGCGGTGACGTTCTGGAAG	0.557																																						ENST00000254508.5	0.390000	5.000000e-02	0.260000	0.090000	0.160000	0.188163	0.160000	0.140000																										0				66						c.(2044-2046)Gtc>Atc		nucleoporin 210kDa		C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	104.0	88.0	93.0		2044	-3.0	0.6	3	dbSNP_134	93	0,8600		0,0,4300	no	missense	NUP210	NM_024923.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	682/1888	13401880	1,13005	2203	4300	6503	SO:0001583	missense	23225	9	121412	41				g.chr3:13401880C>T	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.2044G>A	chr3.hg19:g.13401880C>T	ENSP00000254508:p.Val682Ile	0						p.V682I	NM_024923.2	NP_079199.2	1	2	3	2.014550	Q8TEM1	PO210_HUMAN		15	2126	-	all_neural(104;0.187)		A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	0	1	hg19	c.2044G>A	CCDS33704.1	0	.	.	.	.	.	.	.	.	.	.	C	7.511	0.654690	0.14580	2.27E-4	0.0	ENSG00000132182	ENST00000254508	T	0.21932	1.98	5.66	-3.03	0.05429	5.66	-3.03	0.05429	.	0.463730	0.22067	N	0.065098	T	0.08670	0.0215	N	0.04746	-0.17	0.23391	N	0.997774	B;B	0.18310	0.027;0.009	B;B	0.13407	0.009;0.004	T	0.29882	-0.9997	10	0.20519	T	0.43	-17.3968	13.8756	0.63651	0.0:0.4301:0.0:0.5699	.	682;682	Q8TEM1-2;Q8TEM1	.;PO210_HUMAN	I	682	ENSP00000254508:V682I	ENSP00000254508:V682I	V	-	1	0	0	NUP210	13376880	13376880	0.001000	0.12720	0.601000	0.28877	0.003000	0.03518	-0.370000	0.07523	-0.380000	0.07894	-0.150000	0.13652	GTC	0.382347		TCGA-2J-AABE-01A-12D-A40W-08	0.557	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	0	0	0		2	2	2	0		0	0	21		21	21	1	1.990000	-6.538714	1	0.380000	NM_024923			4	3		139	137	0		1	0		0	0	21	0		0.886422	1.110614e-01	0	0	0	16	0	4	139
CISH	1154	broad.mit.edu	37	3	50645400	50645400	+	Missense_Mutation	SNP	G	G	C			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr3:50645400G>C	ENST00000348721.3	-	3	595	c.415C>G	c.(415-417)Cgt>Ggt	p.R139G	CISH_ENST00000443053.2_Missense_Mutation_p.R156G	NM_145071.2	NP_659508.1	Q9NSE2	CISH_HUMAN	cytokine inducible SH2-containing protein	139	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of signal transduction (GO:0009968)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				breast(2)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		GAGTCCAGACGGAAGCTGGAG	0.582																																						ENST00000348721.3	1.000000	6.200000e-01	1.000000	0.740000	0.870000	0.867694	0.870000	1.000000																										0				5						c.(415-417)Cgt>Ggt		cytokine inducible SH2-containing protein							70.0	65.0	67.0					3																	50645400		2203	4300	6503	SO:0001583	missense	1154	0	0					g.chr3:50645400G>C	Z77852	CCDS2831.1, CCDS46834.1	3p21.3	2013-02-14			ENSG00000114737	ENSG00000114737		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	1984	protein-coding gene	gene with protein product		602441				9465889, 7796808	Standard	NM_013324		Approved	CIS, G18, CIS-1, SOCS	uc003dax.3	Q9NSE2	OTTHUMG00000156853	ENST00000348721.3:c.415C>G	chr3.hg19:g.50645400G>C	ENSP00000294173:p.Arg139Gly	0					CISH_ENST00000443053.2_Missense_Mutation_p.R156G	p.R139G	NM_145071.2	NP_659508.1	1	2	3	2.014550	Q9NSE2	CISH_HUMAN		3	595	-			B2R9N1|G5E9R1|Q9NS38|Q9Y5R1	Missense_Mutation	SNP	ENST00000348721.3	1	1	hg19	c.415C>G	CCDS2831.1	1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803142	0.70682	.	.	ENSG00000114737	ENST00000443053;ENST00000348721	T;T	0.45276	0.9;0.91	5.64	4.72	0.59763	5.64	4.72	0.59763	SH2 motif (4);	0.118165	0.64402	D	0.000014	T	0.52273	0.1724	L	0.38649	1.16	0.46849	D	0.999222	D;D	0.65815	0.994;0.995	D;D	0.69307	0.931;0.963	T	0.43893	-0.9363	10	0.36615	T	0.2	-0.3525	15.0278	0.71682	0.0:0.0:0.8569:0.1431	.	156;139	G5E9R1;Q9NSE2	.;CISH_HUMAN	G	156;139	ENSP00000409346:R156G;ENSP00000294173:R139G	ENSP00000294173:R139G	R	-	1	0	0	CISH	50620404	50620404	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.623000	0.46435	2.648000	0.89879	0.563000	0.77884	CGT	0.382347		TCGA-2J-AABE-01A-12D-A40W-08	0.582	CISH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346245.1	1	0	0		2	2	2	0		0	0	21		21	20	1	1.990000	-3.070117	1	0.380000	NM_145071			34	33		172	170	1		1	1		0	0	21	0		1.000000	9.928694e-01	0	8	0	34	0	34	172
DNAH1	25981	broad.mit.edu	37	3	52388864	52388864	+	Silent	SNP	G	G	A			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr3:52388864G>A	ENST00000420323.2	+	21	3747	c.3486G>A	c.(3484-3486)ctG>ctA	p.L1162L		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1162	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CCCAGGCACTGGACAAGATGG	0.612																																						ENST00000420323.2	1.000000	6.600000e-01	1.000000	0.800000	0.950000	0.918015	0.950000	1.000000																										0				62						c.(3484-3486)ctG>ctA		dynein, axonemal, heavy chain 1							47.0	50.0	49.0					3																	52388864		2025	4178	6203	SO:0001819	synonymous_variant	25981	0	0					g.chr3:52388864G>A	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.3486G>A	chr3.hg19:g.52388864G>A		0						p.L1162L	NM_015512.4	NP_056327	1	2	3	2.014550	Q9P2D7	DYH1_HUMAN		21	3747	+			B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Silent	SNP	ENST00000420323.2	0	1	hg19	c.3486G>A	CCDS46842.1	1																																																																																								0.382347		TCGA-2J-AABE-01A-12D-A40W-08	0.612	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	1	0	1		2	2	2	0		0	0	12		12	11	1	1.990000	-20.000000	1	0.380000	NM_015512			27	27		122	119	1		1			0	0	12	0		1.000000	0	0	0	0	0	0	27	122
GNL3	26354	broad.mit.edu	37	3	52728222	52728222	+	Silent	SNP	A	A	G			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr3:52728222A>G	ENST00000418458.1	+	15	1754	c.1581A>G	c.(1579-1581)acA>acG	p.T527T	SNORD19_ENST00000410413.1_RNA|GLT8D1_ENST00000463827.1_5'Flank|SNORD69_ENST00000391150.1_RNA|GNL3_ENST00000394799.2_Silent_p.T515T	NM_014366.4|NM_206826.1	NP_055181.3|NP_996562.1	Q9BVP2	GNL3_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)	527	Acidic. {ECO:0000250}.				cell proliferation (GO:0008283)|GTP catabolic process (GO:0006184)|regulation of cell proliferation (GO:0042127)|ribosome biogenesis (GO:0042254)	extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|large_intestine(3)|lung(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.75e-05)|Kidney(197;0.000611)|KIRC - Kidney renal clear cell carcinoma(197;0.000773)|OV - Ovarian serous cystadenocarcinoma(275;0.048)		AACAGTCTACAAGGTCTTTTA	0.333																																						ENST00000418458.1	1.000000	6.000000e-01	0.940000	0.700000	0.810000	0.821955	0.810000	1.000000																										0				12						c.(1579-1581)acA>acG		guanine nucleotide binding protein-like 3 (nucleolar)							60.0	68.0	65.0					3																	52728222		2203	4300	6503	SO:0001819	synonymous_variant	26354	0	0					g.chr3:52728222A>G	AK027514	CCDS2861.1, CCDS43100.1	3p21.1	2005-01-10			ENSG00000163938	ENSG00000163938			29931	protein-coding gene	gene with protein product		608011				11085516, 12464630	Standard	NM_014366		Approved	C77032, E2IG3, MGC800, NS, nucleostemin	uc003dfd.3	Q9BVP2	OTTHUMG00000158752	ENST00000418458.1:c.1581A>G	chr3.hg19:g.52728222A>G		0					SNORD19_ENST00000410413.1_RNA|SNORD69_ENST00000391150.1_RNA|GNL3_ENST00000394799.2_Silent_p.T515T|GLT8D1_ENST00000463827.1_5'Flank	p.T527T	NM_014366.4|NM_206826.1	NP_055181.3|NP_996562.1	1	2	3	2.014550	Q9BVP2	GNL3_HUMAN		15	1754	+			B2RDC1|Q5PU80|Q96SV6|Q96SV7|Q9UJY0	Silent	SNP	ENST00000418458.1	1	1	hg19	c.1581A>G	CCDS2861.1	0																																																																																								0.382347		TCGA-2J-AABE-01A-12D-A40W-08	0.333	GNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352032.1	0	0	1		2	2	2	0		0	0	57		57	56	1	1.990000	-19.974340	1	0.380000	NM_014366			42	42		230	227	1		1	1		0	0	57	0		1.000000	1	0	49	0	117	0	42	230
NEK4	6787	broad.mit.edu	37	3	52778267	52778267	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr3:52778267T>C	ENST00000233027.5	-	11	2084	c.1882A>G	c.(1882-1884)Atg>Gtg	p.M628V	NEK4_ENST00000535191.1_Missense_Mutation_p.M539V|NEK4_ENST00000383721.4_Missense_Mutation_p.M582V	NM_001193533.1|NM_003157.4	NP_001180462.1|NP_003148.2	P51957	NEK4_HUMAN	NIMA-related kinase 4	628					mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(10)	26				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)		GAAGAGGACATTTCTTCCTGT	0.418																																						ENST00000233027.5	1.000000	8.700000e-01	1.000000	0.940000	0.990000	0.979395	0.990000	1.000000																										0				26						c.(1882-1884)Atg>Gtg		NIMA-related kinase 4							231.0	225.0	227.0					3																	52778267		2203	4300	6503	SO:0001583	missense	6787	0	0					g.chr3:52778267T>C	L20321	CCDS2863.1, CCDS54593.1	3p21.1	2012-11-15	2012-11-15	2002-05-10	ENSG00000114904	ENSG00000114904	2.7.11.1		11399	protein-coding gene	gene with protein product	"""serine/threonine protein kinase-2"""	601959	"""serine/threonine kinase 2"", ""NIMA (never in mitosis gene a)-related kinase 4"""	STK2		8208544	Standard	NM_001193533		Approved	NRK2, pp12301	uc003dfq.4	P51957	OTTHUMG00000158836	ENST00000233027.5:c.1882A>G	chr3.hg19:g.52778267T>C	ENSP00000233027:p.Met628Val	0					NEK4_ENST00000535191.1_Missense_Mutation_p.M539V|NEK4_ENST00000383721.4_Missense_Mutation_p.M582V	p.M628V	NM_001193533.1|NM_003157.4	NP_001180462.1|NP_003148.2	1	2	3	2.014550	P51957	NEK4_HUMAN		11	2084	-			A5YM70|B2R633|B7Z200|Q6P576	Missense_Mutation	SNP	ENST00000233027.5	1	1	hg19	c.1882A>G	CCDS2863.1	1	.	.	.	.	.	.	.	.	.	.	T	8.038	0.763137	0.15914	.	.	ENSG00000114904	ENST00000233027;ENST00000535191;ENST00000383721;ENST00000461689	T;T;T;T	0.71103	2.32;2.32;-0.54;2.32	6.17	-0.564	0.11774	6.17	-0.564	0.11774	.	1.039550	0.07482	N	0.904039	T	0.47691	0.1459	N	0.19112	0.55	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.002;0.002;0.001	T	0.28459	-1.0043	10	0.06891	T	0.86	.	5.4975	0.16811	0.0:0.3227:0.141:0.5363	.	539;582;628	B7Z200;P51957-2;P51957	.;.;NEK4_HUMAN	V	628;539;582;539	ENSP00000233027:M628V;ENSP00000437703:M539V;ENSP00000373227:M582V;ENSP00000419666:M539V	ENSP00000233027:M628V	M	-	1	0	0	NEK4	52753307	52753307	0.000000	0.05858	0.033000	0.17914	0.775000	0.43874	-0.347000	0.07750	-0.024000	0.13941	0.533000	0.62120	ATG	0.382347		TCGA-2J-AABE-01A-12D-A40W-08	0.418	NEK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352386.2	1	0	1		2	2	2	0		0	0	130		130	127	1	1.990000	-20.000000	1	0.380000	NM_003157			170	170		716	706	1		1	1		0	0	130	0		1.000000	9.792972e-01	0	13	0	15	0	170	716
ABHD6	57406	broad.mit.edu	37	3	58270837	58270837	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr3:58270837G>A	ENST00000478253.1	+	8	1208	c.707G>A	c.(706-708)cGc>cAc	p.R236H	ABHD6_ENST00000295962.4_Missense_Mutation_p.R236H			Q9BV23	ABHD6_HUMAN	abhydrolase domain containing 6	236					long term synaptic depression (GO:0060292)|negative regulation of cell migration (GO:0030336)|regulation of endocannabinoid signaling pathway (GO:2000124)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acylglycerol lipase activity (GO:0047372)	p.R236H(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	16				BRCA - Breast invasive adenocarcinoma(55;0.000225)|KIRC - Kidney renal clear cell carcinoma(284;0.0471)|Kidney(284;0.0589)|OV - Ovarian serous cystadenocarcinoma(275;0.209)		GTCGATGTCCGCATCCCTCAT	0.443																																						ENST00000478253.1	0.130000	1.000000e-02	0.090000	0.030000	0.050000	0.070632	0.050000	0.060000																										1	Substitution - Missense(1)	p.R236H(1)	kidney(1)	16						c.(706-708)cGc>cAc		abhydrolase domain containing 6							137.0	117.0	124.0					3																	58270837		2203	4300	6503	SO:0001583	missense	57406	2	121412	31				g.chr3:58270837G>A	AF225418	CCDS2887.1	3p21.2	2006-03-10			ENSG00000163686	ENSG00000163686		"""Abhydrolase domain containing"""	21398	protein-coding gene	gene with protein product							Standard	NM_020676		Approved		uc003djs.4	Q9BV23	OTTHUMG00000159150	ENST00000478253.1:c.707G>A	chr3.hg19:g.58270837G>A	ENSP00000420315:p.Arg236His	0					ABHD6_ENST00000295962.4_Missense_Mutation_p.R236H	p.R236H			1	2	3	2.014550	Q9BV23	ABHD6_HUMAN		8	1208	+			B2R7Y9|Q6ZMF7	Missense_Mutation	SNP	ENST00000478253.1	0	1	hg19	c.707G>A	CCDS2887.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.435491	0.96150	.	.	ENSG00000163686	ENST00000478253;ENST00000295962;ENST00000511761	T;T	0.76709	-1.04;-1.04	5.66	5.66	0.87406	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.88142	0.6357	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.987	D	0.86578	0.1852	10	0.39692	T	0.17	-11.2637	19.3704	0.94481	0.0:0.0:1.0:0.0	.	236;236	Q9BV23;F5H7L1	ABHD6_HUMAN;.	H	236	ENSP00000420315:R236H;ENSP00000295962:R236H	ENSP00000295962:R236H	R	+	2	0	0	ABHD6	58245877	58245877	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	8.134000	0.89606	2.666000	0.90696	0.655000	0.94253	CGC	0.382347		TCGA-2J-AABE-01A-12D-A40W-08	0.443	ABHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353511.1	0	0	1		2	2	2	0		0	0	93		93	91	1	1.990000	-1.992894	0	0.380000	NM_020676			5	5		507	501	0		1	0		0	0	93	0		0.935871	7.955667e-03	0	0	0	11	0	5	507
PLS1	5357	broad.mit.edu	37	3	142396872	142396872	+	Splice_Site	SNP	A	A	T			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr3:142396872A>T	ENST00000337777.3	+	6	710		c.e6-1		PLS1_ENST00000497002.1_Splice_Site|PLS1_ENST00000457734.2_Splice_Site	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						TTTTCTCTTTAGCAAAATGAT	0.274																																						ENST00000337777.3	1.000000	6.500000e-01	1.000000	0.760000	0.880000	0.881262	0.880000	1.000000																										0				27						c.e6-1		plastin 1							76.0	76.0	76.0					3																	142396872		2203	4297	6500	SO:0001630	splice_region_variant	5357	0	0					g.chr3:142396872A>T	L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.498-1A>T	chr3.hg19:g.142396872A>T		0					PLS1_ENST00000457734.2_Splice_Site|PLS1_ENST00000497002.1_Splice_Site		NM_002670.2	NP_002661.2	1	2	3	2.014550	Q14651	PLSI_HUMAN		6	710	+			A8K2Q1|D3DNG3|Q8NEG6	Splice_Site	SNP	ENST00000337777.3	1	1	hg19		CCDS3125.1	1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.194080	0.78902	.	.	ENSG00000120756	ENST00000457734;ENST00000476044;ENST00000337777;ENST00000497002	.	.	.	4.97	4.97	0.65823	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6515	0.68800	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	PLS1	143879562	143879562	1.000000	0.71417	0.993000	0.49108	0.914000	0.54420	8.858000	0.92256	1.864000	0.54056	0.533000	0.62120	.	0.382347		TCGA-2J-AABE-01A-12D-A40W-08	0.274	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354435.1	1	0	1		2	2	2	0		0	0	43		43	41	1	1.990000	-20.000000	1	0.380000	NM_002670	Intron		38	38		188	186	1		1			0	0	43	0		1.000000	0	0	0	0	0	0	38	188
TBC1D19	55296	broad.mit.edu	37	4	26756566	26756566	+	Silent	SNP	C	C	G			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr4:26756566C>G	ENST00000264866.4	+	21	1856	c.1578C>G	c.(1576-1578)acC>acG	p.T526T	TBC1D19_ENST00000511789.1_Silent_p.T461T	NM_018317.2	NP_060787.2	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19	526							Rab GTPase activator activity (GO:0005097)			breast(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	17		Breast(46;0.0503)				CTACTGTCACCTGATCTTCTT	0.323																																						ENST00000264866.4	1.000000	6.000000e-01	0.920000	0.690000	0.790000	0.804632	0.790000	1.000000																										0				17						c.(1576-1578)acC>acG		TBC1 domain family, member 19							159.0	150.0	153.0					4																	26756566		2203	4299	6502	SO:0001819	synonymous_variant	55296	0	0					g.chr4:26756566C>G	AK001944	CCDS3439.1, CCDS75115.1	4p15.2	2008-02-05			ENSG00000109680	ENSG00000109680			25624	protein-coding gene	gene with protein product							Standard	XM_006713967		Approved	FLJ11082	uc003gsf.4	Q8N5T2	OTTHUMG00000097797	ENST00000264866.4:c.1578C>G	chr4.hg19:g.26756566C>G		0					TBC1D19_ENST00000511789.1_Silent_p.T461T	p.T526T	NM_018317.2	NP_060787.2	1	2	3	2.025601	Q8N5T2	TBC19_HUMAN		21	1856	+		Breast(46;0.0503)	B9A6M0|Q9NUX1	Silent	SNP	ENST00000264866.4	1	1	hg19	c.1578C>G	CCDS3439.1	0																																																																																								0.384676		TCGA-2J-AABE-01A-12D-A40W-08	0.323	TBC1D19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215052.2	1	0	1		2	2	2	0		0	0	54		54	52	1	1.990000	-2.749728	1	0.380000	NM_018317			48	48		273	269	1		1	0		0	0	54	0		1.000000	7.136405e-01	0	1	0	15	0	48	273
KIAA1211	57482	broad.mit.edu	37	4	57182165	57182165	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr4:57182165C>T	ENST00000504228.1	+	6	2602	c.2497C>T	c.(2497-2499)Cct>Tct	p.P833S	KIAA1211_ENST00000541073.1_Missense_Mutation_p.P826S|KIAA1211_ENST00000264229.6_Missense_Mutation_p.P833S			Q6ZU35	K1211_HUMAN	KIAA1211	833										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					AAAGCCAGACCCTGTGATGCC	0.532																																						ENST00000504228.1	1.000000	7.500000e-01	1.000000	0.850000	0.970000	0.942110	0.970000	1.000000																										0				65						c.(2497-2499)Cct>Tct		KIAA1211							79.0	85.0	83.0					4																	57182165		2080	4235	6315	SO:0001583	missense	57482	0	0					g.chr4:57182165C>T	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.2497C>T	chr4.hg19:g.57182165C>T	ENSP00000423366:p.Pro833Ser	0					KIAA1211_ENST00000264229.6_Missense_Mutation_p.P833S|KIAA1211_ENST00000541073.1_Missense_Mutation_p.P826S	p.P833S			1	2	3	2.025601	Q6ZU35	K1211_HUMAN		6	2602	+	Glioma(25;0.08)|all_neural(26;0.101)		Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	ENST00000504228.1	1	1	hg19	c.2497C>T	CCDS43230.1	1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.403520	0.42613	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073;ENST00000546221	T;T;T	0.11277	2.8;2.8;2.79	4.77	1.86	0.25419	4.77	1.86	0.25419	.	.	.	.	.	T	0.13329	0.0323	L	0.56769	1.78	0.09310	N	1	P;P;B	0.42248	0.774;0.774;0.228	B;B;B	0.41723	0.365;0.365;0.083	T	0.10917	-1.0609	9	0.56958	D	0.05	-4.1736	9.2456	0.37523	0.2097:0.4454:0.3449:0.0	.	826;826;833	B7ZVZ4;F5H1N7;Q6ZU35	.;.;K1211_HUMAN	S	833;833;826;743	ENSP00000264229:P833S;ENSP00000423366:P833S;ENSP00000444006:P826S	ENSP00000264229:P833S	P	+	1	0	0	KIAA1211	56876922	56876922	0.000000	0.05858	0.043000	0.18650	0.354000	0.29330	-0.069000	0.11542	0.568000	0.29311	0.561000	0.74099	CCT	0.384676		TCGA-2J-AABE-01A-12D-A40W-08	0.532	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	1	0	1		2	2	2	0		0	0	22		22	20	1	1.990000	-3.146851	1	0.380000	NM_020722			53	53		236	234	1		1	1		0	0	22	0		1.000000	3.809426e-01	0	2	0	5	0	53	236
SPINK2	6691	broad.mit.edu	37	4	57676313	57676313	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr4:57676313G>A	ENST00000248701.4	-	4	326	c.247C>T	c.(247-249)Ccc>Tcc	p.P83S	SPINK2_ENST00000504762.1_Missense_Mutation_p.P118S|SPINK2_ENST00000506738.1_Missense_Mutation_p.P133S	NM_021114.2	NP_066937.1	P20155	ISK2_HUMAN	serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)	83	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(1)|lung(2)	4	Glioma(25;0.08)|all_neural(26;0.181)					CATCAGCAGGGTCCATTTCGA	0.368																																						ENST00000248701.4	1.000000	6.500000e-01	1.000000	0.790000	0.940000	0.910764	0.940000	1.000000																										0				4						c.(247-249)Ccc>Tcc		serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)							92.0	89.0	90.0					4																	57676313		2203	4300	6503	SO:0001583	missense	6691	0	0					g.chr4:57676313G>A	BC022514	CCDS3508.1, CCDS63971.1, CCDS63972.1, CCDS75128.1	4q12	2011-08-31	2005-08-17		ENSG00000128040	ENSG00000128040		"""Serine peptidase inhibitors, Kazal type"""	11245	protein-coding gene	gene with protein product		605753	"""serine protease inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)"""			8428671	Standard	NM_001271718		Approved	HUSI-II	uc031sep.1	P20155	OTTHUMG00000128769	ENST00000248701.4:c.247C>T	chr4.hg19:g.57676313G>A	ENSP00000248701:p.Pro83Ser	0					SPINK2_ENST00000506738.1_Missense_Mutation_p.P133S|SPINK2_ENST00000504762.1_Missense_Mutation_p.P118S	p.P83S	NM_021114.2	NP_066937.1	1	2	3	2.025601	P20155	ISK2_HUMAN		4	326	-	Glioma(25;0.08)|all_neural(26;0.181)		Q6FGH2	Missense_Mutation	SNP	ENST00000248701.4	1	1	hg19	c.247C>T	CCDS3508.1	1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.564566	0.45694	.	.	ENSG00000128040	ENST00000248701;ENST00000506738;ENST00000504762	T;T;T	0.75260	-0.92;-0.92;-0.92	5.16	4.3	0.51218	5.16	4.3	0.51218	Proteinase inhibitor I1, Kazal (2);	0.478828	0.19574	N	0.111039	T	0.81564	0.4849	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.80764	0.994	T	0.70051	-0.4978	9	0.36615	T	0.2	-14.0426	9.7317	0.40366	0.0954:0.0:0.9046:0.0	.	83	P20155	ISK2_HUMAN	S	83;133;118	ENSP00000248701:P83S;ENSP00000425961:P133S;ENSP00000423858:P118S	ENSP00000248701:P83S	P	-	1	0	0	SPINK2	57371070	57371070	0.051000	0.20477	0.147000	0.22382	0.019000	0.09904	1.709000	0.37909	2.683000	0.91414	0.563000	0.77884	CCC	0.384676		TCGA-2J-AABE-01A-12D-A40W-08	0.368	SPINK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250690.2	0	0	1		14	2	2	1		1	1	39		39	38	1	1.990000	-20.000000	1	0.380000	NM_021114			29	29		135	134	1		1			1	0	39	0		0.995318	0	0	0	0	0	0	29	135
UGT2B15	7366	broad.mit.edu	37	4	69533868	69533868	+	Missense_Mutation	SNP	C	C	G			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr4:69533868C>G	ENST00000338206.5	-	2	772	c.763G>C	c.(763-765)Gaa>Caa	p.E255Q		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	255					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)									Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	AGCCACATTTCAGCTTTCCCC	0.378																																						ENST00000338206.5	1.000000	1.000000e-02	0.090000	0.030000	0.050000	0.091441	0.050000	0.060000																										0										c.(763-765)Gaa>Caa		UDP glucuronosyltransferase 2 family, polypeptide B15	Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)						80.0	87.0	85.0					4																	69533868		2202	4280	6482	SO:0001583	missense	7366	0	0					g.chr4:69533868C>G	AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.763G>C	chr4.hg19:g.69533868C>G	ENSP00000341045:p.Glu255Gln	0						p.E255Q	NM_001076.3	NP_001067.2	1	2	3	2.025601	P54855	UDB15_HUMAN		2	772	-			A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Missense_Mutation	SNP	ENST00000338206.5	0	1	hg19	c.763G>C	CCDS3524.1	0	.	.	.	.	.	.	.	.	.	.	c	12.33	1.905894	0.33628	.	.	ENSG00000196620	ENST00000338206	T	0.61742	0.08	2.44	2.44	0.29823	2.44	2.44	0.29823	.	0.138014	0.47093	U	0.000252	T	0.58177	0.2104	M	0.83312	2.635	0.31256	N	0.69353	B	0.31153	0.31	B	0.31337	0.128	T	0.67090	-0.5758	10	0.56958	D	0.05	.	10.5504	0.45085	0.0:1.0:0.0:0.0	.	255	P54855	UDB15_HUMAN	Q	255	ENSP00000341045:E255Q	ENSP00000341045:E255Q	E	-	1	0	0	UGT2B15	69216463	69216463	0.999000	0.42202	0.344000	0.25628	0.679000	0.39708	2.545000	0.45769	1.352000	0.45808	0.305000	0.20034	GAA	0.384676		TCGA-2J-AABE-01A-12D-A40W-08	0.378	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365172.1	0	0	1		14	2	2	0		0	1	103		103	142	1	1.990000	-3.311900	1	0.380000	NM_001076			6	5		566	510	0		0	0		0	0	103	0		0.033548	1.762759e-02	0	0	0	16	0	6	566
PCDHB7	56129	broad.mit.edu	37	5	140554541	140554541	+	Missense_Mutation	SNP	G	G	T			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr5:140554541G>T	ENST00000231137.3	+	1	2299	c.2125G>T	c.(2125-2127)Gtg>Ttg	p.V709L	PCDHB8_ENST00000239444.2_5'Flank	NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	709					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTTCGTGGCGGTGCGGCTGTG	0.697																																						ENST00000231137.3	0.890000	5.800000e-01	0.800000	0.640000	0.710000	0.726625	0.710000	0.710000																										0				119						c.(2125-2127)Gtg>Ttg		protocadherin beta 7							75.0	125.0	108.0					5																	140554541		2196	4276	6472	SO:0001583	missense	56129	0	0					g.chr5:140554541G>T	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.2125G>T	chr5.hg19:g.140554541G>T	ENSP00000231137:p.Val709Leu	0					PCDHB8_ENST00000239444.2_5'Flank	p.V709L	NM_018940.2	NP_061763.1	1	2	3	2.018320	Q9Y5E2	PCDB7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)	1	2299	+			A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	1	1	hg19	c.2125G>T	CCDS4249.1	0	.	.	.	.	.	.	.	.	.	.	G	17.13	3.312041	0.60414	.	.	ENSG00000113212	ENST00000231137	T	0.11385	2.78	3.98	1.93	0.25924	3.98	1.93	0.25924	.	.	.	.	.	T	0.10809	0.0264	M	0.63208	1.945	0.09310	N	1	B	0.24651	0.108	B	0.26614	0.071	T	0.37686	-0.9695	9	0.15066	T	0.55	.	6.341	0.21322	0.1747:0.4309:0.3944:0.0	.	709	Q9Y5E2	PCDB7_HUMAN	L	709	ENSP00000231137:V709L	ENSP00000231137:V709L	V	+	1	0	0	PCDHB7	140534725	140534725	0.000000	0.05858	0.400000	0.26346	0.981000	0.71138	-0.438000	0.06905	0.740000	0.32651	0.449000	0.29647	GTG	0.382347		TCGA-2J-AABE-01A-12D-A40W-08	0.697	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	1	0	0		2	2	2	0		0	0	97		97	100	1	1.990000	-20.000000	1	0.380000	NM_018940			85	84		539	516	0		1	0		0	0	97	2		1.000000	0	0	0	0	1	0	85	539
PCDHGA1	56114	broad.mit.edu	37	5	140711696	140711696	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr5:140711696A>G	ENST00000517417.1	+	1	1445	c.1445A>G	c.(1444-1446)aAt>aGt	p.N482S	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.N482S|AC005618.6_ENST00000606901.1_lincRNA	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	482	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGGACAGCAATGAGAATGCA	0.532																																						ENST00000517417.1	0.150000	2.000000e-02	0.100000	0.040000	0.060000	0.084462	0.060000	0.060000																										0				78						c.(1444-1446)aAt>aGt		protocadherin gamma subfamily A, 1							114.0	122.0	119.0					5																	140711696		2203	4300	6503	SO:0001583	missense	56114	0	0					g.chr5:140711696A>G	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1445A>G	chr5.hg19:g.140711696A>G	ENSP00000431083:p.Asn482Ser	0					AC005618.6_ENST00000606901.1_lincRNA|PCDHGA1_ENST00000378105.3_Missense_Mutation_p.N482S	p.N482S	NM_018912.2	NP_061735.1	1	2	3	2.018320	Q9Y5H4	PCDG1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1445	+			Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	0	1	hg19	c.1445A>G	CCDS54922.1	0	.	.	.	.	.	.	.	.	.	.	A	1.687	-0.504958	0.04261	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.01725	4.67;4.67	3.82	1.3	0.21679	3.82	1.3	0.21679	Cadherin (4);Cadherin-like (1);	0.601272	0.14799	N	0.297753	T	0.01661	0.0053	L	0.46157	1.445	0.09310	N	1	B;B	0.17465	0.005;0.022	B;B	0.18263	0.008;0.021	T	0.48670	-0.9015	10	0.18710	T	0.47	.	2.5653	0.04782	0.3725:0.0:0.278:0.3495	.	482;482	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	S	482	ENSP00000431083:N482S;ENSP00000367345:N482S	ENSP00000367345:N482S	N	+	2	0	0	PCDHGA1	140691880	140691880	0.000000	0.05858	0.021000	0.16686	0.509000	0.34042	0.572000	0.23684	0.154000	0.19237	0.455000	0.32223	AAT	0.382347		TCGA-2J-AABE-01A-12D-A40W-08	0.532	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	0	0	1		2	2	2	0		0	0	86		86	85	1	1.990000	-6.088479	1	0.380000	NM_018912			7	6		550	541	0		1			0	0	86	0		0.979427	0	0	0	0	0	0	7	550
PKHD1	5314	broad.mit.edu	37	6	51921495	51921495	+	Splice_Site	SNP	C	C	T			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr6:51921495C>T	ENST00000371117.3	-	18	1969		c.e18+1		PKHD1_ENST00000340994.4_Splice_Site	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)						cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					ACGGACAGCACCTCGTTCAAA	0.403																																						ENST00000371117.3	1.000000	6.400000e-01	0.920000	0.720000	0.810000	0.824714	0.810000	0.820000																										0				304						c.e18+1		polycystic kidney and hepatic disease 1 (autosomal recessive)							127.0	132.0	130.0					6																	51921495		2203	4300	6503	SO:0001630	splice_region_variant	5314	0	0					g.chr6:51921495C>T	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.1693+1G>A	chr6.hg19:g.51921495C>T		0					PKHD1_ENST00000340994.4_Splice_Site		NM_138694.3	NP_619639.3	1	2	3	2.006828	P08F94	PKHD1_HUMAN		18	1969	-	Lung NSC(77;0.0605)		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Splice_Site	SNP	ENST00000371117.3	1	1	hg19		CCDS4935.1	0	.	.	.	.	.	.	.	.	.	.	C	8.374	0.835970	0.16891	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	.	.	.	5.4	4.53	0.55603	5.4	4.53	0.55603	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6228	0.51128	0.1778:0.8222:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	.	PKHD1	52029454	52029454	1.000000	0.71417	0.966000	0.40874	0.011000	0.07611	2.724000	0.47285	1.272000	0.44329	-0.475000	0.04921	.	0.381176		TCGA-2J-AABE-01A-12D-A40W-08	0.403	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	1	0	1		2	2	2	0		0	0	34		34	33	1	1.990000	-20.000000	1	0.380000	NM_138694	Intron		66	66		358	355	1		1			0	0	34	0		1.000000	0	0	0	0	0	0	66	358
PHIP	55023	broad.mit.edu	37	6	79655783	79655783	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr6:79655783G>A	ENST00000275034.4	-	38	4732	c.4565C>T	c.(4564-4566)tCt>tTt	p.S1522F	PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1522					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TGAAGAAGTAGATGGTTGCTC	0.388																																						ENST00000275034.4	1.000000	7.400000e-01	0.980000	0.820000	0.910000	0.904323	0.910000	0.960000																										0				68						c.(4564-4566)tCt>tTt		pleckstrin homology domain interacting protein							136.0	122.0	127.0					6																	79655783		2203	4300	6503	SO:0001583	missense	55023	0	0					g.chr6:79655783G>A	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.4565C>T	chr6.hg19:g.79655783G>A	ENSP00000275034:p.Ser1522Phe	1					PHIP_ENST00000479165.1_5'UTR	p.S1522F	NM_017934.5	NP_060404	0	1	1	1.632494	Q8WWQ0	PHIP_HUMAN		38	4732	-		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000275034.4	1	1	hg19	c.4565C>T	CCDS4987.1	1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.550555	0.65311	.	.	ENSG00000146247	ENST00000275034;ENST00000355098	T	0.47528	0.84	6.17	6.17	0.99709	6.17	6.17	0.99709	.	0.073633	0.64402	D	0.000017	T	0.46600	0.1401	L	0.27053	0.805	0.51767	D	0.999936	D;D	0.67145	0.996;0.996	P;P	0.61940	0.896;0.896	T	0.18618	-1.0331	9	.	.	.	-18.2928	19.8676	0.96824	0.0:0.0:1.0:0.0	.	1522;1522	A7J992;Q8WWQ0	.;PHIP_HUMAN	F	1522;248	ENSP00000275034:S1522F	.	S	-	2	0	0	PHIP	79712502	79712502	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	5.084000	0.64462	2.941000	0.99782	0.655000	0.94253	TCT	0.234568		TCGA-2J-AABE-01A-12D-A40W-08	0.388	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2	1	0	1		2	2	2	0		0	0	50		50	50	1	1.990000	-20.000000	1	0.380000				59	59		199	198	1		1	1	0	0	0	50	5		1.000000	2.306743e-01	0	2	0	2	1	59	199
RARS2	57038	broad.mit.edu	37	6	88299660	88299660	+	Missense_Mutation	SNP	G	G	A	rs201899366	byFrequency	TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr6:88299660G>A	ENST00000369536.5	-	1	61	c.16C>T	c.(16-18)Cgc>Tgc	p.R6C	ORC3_ENST00000257789.4_5'Flank|ORC3_ENST00000417380.2_5'Flank|ORC3_ENST00000392844.3_5'Flank|ORC3_ENST00000546266.1_5'Flank	NM_020320.3	NP_064716.2	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial	6					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.R6C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		ATAGCGCGGCGAAAGCCGCAC	0.672											OREG0031911	type=REGULATORY REGION|TFbs=RELA|Dataset=RELA (p65) ChIP-PET Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with paired-end diTag sequencing (ChIP-PET)	G|||	2	0.000399361	0.0	0.0014	5008	,	,		12638	0.001		0.0	False		,,,				2504	0.0					ENST00000369536.5	0.940000	4.800000e-01	0.840000	0.590000	0.710000	0.719844	0.710000	0.710000																										1	Substitution - Missense(1)	p.R6C(1)	breast(1)	22						c.(16-18)Cgc>Tgc		arginyl-tRNA synthetase 2, mitochondrial							26.0	32.0	30.0					6																	88299660		2202	4300	6502	SO:0001583	missense	57038	4	121402	35				g.chr6:88299660G>A	AK093934	CCDS5011.1	6q16.1	2011-07-01	2007-09-27	2007-02-23	ENSG00000146282	ENSG00000146282	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	21406	protein-coding gene	gene with protein product	"""arginine tRNA ligase 2, mitochondrial (putative)"""	611524	"""arginyl-tRNA synthetase-like"""	RARSL		17847012	Standard	NM_020320		Approved	MGC14993, MGC23778, PRO1992, dJ382I10.6, DALRD2	uc003pme.3	Q5T160	OTTHUMG00000015178	ENST00000369536.5:c.16C>T	chr6.hg19:g.88299660G>A	ENSP00000358549:p.Arg6Cys	1		OREG0031911	type=REGULATORY REGION|TFbs=RELA|Dataset=RELA (p65) ChIP-PET Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with paired-end diTag sequencing (ChIP-PET)	1258	ORC3_ENST00000257789.4_5'Flank|ORC3_ENST00000546266.1_5'Flank|ORC3_ENST00000417380.2_5'Flank|ORC3_ENST00000392844.3_5'Flank	p.R6C	NM_020320.3	NP_064716.2	0	1	1	1.632494	Q5T160	SYRM_HUMAN		1	61	-		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)	B2RDT7|Q96FU5|Q9H8K8	Missense_Mutation	SNP	ENST00000369536.5	1	1	hg19	c.16C>T	CCDS5011.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	17.34	3.364729	0.61513	.	.	ENSG00000146282	ENST00000369536	T	0.73897	-0.79	5.11	5.11	0.69529	5.11	5.11	0.69529	Arginyl tRNA synthetase, class Ia, N-terminal (2);	0.101495	0.64402	D	0.000003	T	0.70753	0.3260	L	0.55481	1.735	0.80722	D	1	D	0.69078	0.997	P	0.50231	0.635	T	0.75277	-0.3374	10	0.87932	D	0	.	14.2251	0.65853	0.0:0.0:1.0:0.0	.	6	Q5T160	SYRM_HUMAN	C	6	ENSP00000358549:R6C	ENSP00000358549:R6C	R	-	1	0	0	RARS2	88356379	88356379	1.000000	0.71417	0.978000	0.43139	0.031000	0.12232	2.529000	0.45632	2.826000	0.97356	0.655000	0.94253	CGC	0.234568		TCGA-2J-AABE-01A-12D-A40W-08	0.672	RARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041448.1	1	0	1		2	2	2	0		0	0	28		28	27	1	1.990000	-2.763252	1	0.380000	NM_020320			25	25		122	114	1		1	1		0	0	28	0		1.000000	7.509594e-01	0	2	0	13	0	25	122
UTRN	7402	broad.mit.edu	37	6	144780435	144780435	+	Silent	SNP	C	C	T			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr6:144780435C>T	ENST00000367545.3	+	20	2652	c.2652C>T	c.(2650-2652)ggC>ggT	p.G884G		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	884	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GCTTTCTGGGCCGCTACCAAG	0.483																																						ENST00000367545.3	0.370000	1.200000e-01	0.300000	0.170000	0.230000	0.242722	0.230000	0.230000																										0				148						c.(2650-2652)ggC>ggT		utrophin							68.0	67.0	67.0					6																	144780435		2203	4300	6503	SO:0001819	synonymous_variant	7402	0	0					g.chr6:144780435C>T	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.2652C>T	chr6.hg19:g.144780435C>T		1						p.G884G	NM_007124.2	NP_009055.2	0	1	1	1.632494	P46939	UTRO_HUMAN		20	2652	+		Ovarian(120;0.218)	Q5SYY1|Q5SZ57|Q9UJ40	Silent	SNP	ENST00000367545.3	1	1	hg19	c.2652C>T	CCDS34547.1	0																																																																																								0.234568		TCGA-2J-AABE-01A-12D-A40W-08	0.483	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1	1	0	1		2	2	2	0		0	0	36		36	36	1	1.990000	-3.083932	1	0.380000				12	12		211	209	0		1	0		0	0	36	0		0.999147	1.963265e-02	0	0	0	4	0	12	211
ACTB	60	broad.mit.edu	37	7	5567750	5567750	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr7:5567750C>T	ENST00000331789.5	-	5	1060	c.869G>A	c.(868-870)cGc>cAc	p.R290H	ACTB_ENST00000464611.1_5'Flank|AC006483.1_ENST00000579427.1_RNA	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	290					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		CAGGTCTTTGCGGATGTCCAC	0.562																																						ENST00000331789.5	1.000000	0	0.070000	0.020000	0.040000	0.094546	0.040000	0.040000																										0				8						c.(868-870)cGc>cAc		actin, beta							161.0	156.0	158.0					7																	5567750		2203	4299	6502	SO:0001583	missense	60	0	0					g.chr7:5567750C>T	M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.869G>A	chr7.hg19:g.5567750C>T	ENSP00000349960:p.Arg290His	0					ACTB_ENST00000464611.1_5'Flank|AC006483.1_ENST00000579427.1_RNA	p.R290H	NM_001101.3	NP_001092.1	1	2	3	2.043563	P63261	ACTG_HUMAN		5	1060	-		Ovarian(82;0.0606)	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000331789.5	0	1	hg19	c.869G>A	CCDS5341.1	0	.	.	.	.	.	.	.	.	.	.	C	13.44	2.237064	0.39498	.	.	ENSG00000075624	ENST00000331789;ENST00000445914;ENST00000400179;ENST00000320713	D	0.95885	-3.84	5.41	4.53	0.55603	5.41	4.53	0.55603	.	0.000000	0.64402	D	0.000018	D	0.97551	0.9198	M	0.92367	3.3	0.45899	D	0.99874	P	0.36354	0.549	P	0.50378	0.639	D	0.98041	1.0382	10	0.87932	D	0	.	13.0524	0.58962	0.0:0.9212:0.0:0.0788	.	290	P60709	ACTB_HUMAN	H	290;266;262;209	ENSP00000349960:R290H	ENSP00000440549:R209H	R	-	2	0	0	ACTB	5534276	5534276	1.000000	0.71417	0.875000	0.34327	0.902000	0.53008	7.533000	0.81994	1.294000	0.44707	0.556000	0.70494	CGC	0.386988		TCGA-2J-AABE-01A-12D-A40W-08	0.562	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059589.4	0	0	0		2	2	2	0		0	0	124		124	123	1	1.990000	-1.855971	0	0.380000	NM_001101			6	5		736	722	0		1	1		0	0	124	0		0.962629	9.999995e-01	0	2	0	7069	0	6	736
DYNC1I1	1780	broad.mit.edu	37	7	95442629	95442629	+	Silent	SNP	C	C	T	rs145885345		TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr7:95442629C>T	ENST00000324972.6	+	4	538	c.345C>T	c.(343-345)ggC>ggT	p.G115G	DYNC1I1_ENST00000537881.1_Silent_p.G98G|DYNC1I1_ENST00000447467.2_Silent_p.G98G|DYNC1I1_ENST00000359388.4_Silent_p.G98G|DYNC1I1_ENST00000413338.1_Silent_p.G98G|DYNC1I1_ENST00000437599.1_Silent_p.G115G|DYNC1I1_ENST00000457059.1_Silent_p.G98G	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	115	Interaction with DCTN1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			AAGACTCAGGCGATCTGGGGC	0.423																																						ENST00000324972.6	1.000000	7.400000e-01	1.000000	0.850000	0.970000	0.939434	0.970000	1.000000																										0				54						c.(343-345)ggC>ggT		dynein, cytoplasmic 1, intermediate chain 1		C	,,	0,4406		0,0,2203	72.0	70.0	70.0		294,294,345	0.6	1.0	7	dbSNP_134	70	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous,coding-synonymous	DYNC1I1	NM_001135556.1,NM_001135557.1,NM_004411.4	,,	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	,,	98/629,98/609,115/646	95442629	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	1780	28	121390	46				g.chr7:95442629C>T	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.345C>T	chr7.hg19:g.95442629C>T		0					DYNC1I1_ENST00000537881.1_Silent_p.G98G|DYNC1I1_ENST00000437599.1_Silent_p.G115G|DYNC1I1_ENST00000413338.1_Silent_p.G98G|DYNC1I1_ENST00000457059.1_Silent_p.G98G|DYNC1I1_ENST00000447467.2_Silent_p.G98G|DYNC1I1_ENST00000359388.4_Silent_p.G98G	p.G115G	NM_004411.4	NP_004402.1	1	2	3	2.034391	O14576	DC1I1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0957)	4	538	+	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Silent	SNP	ENST00000324972.6	1	1	hg19	c.345C>T	CCDS5644.1	1																																																																																								0.385835		TCGA-2J-AABE-01A-12D-A40W-08	0.423	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	1	0	1		2	2	2	0		0	0	62		62	62	1	1.990000	-3.318794	1	0.380000	NM_004411			51	51		229	223	0		1	0		0	0	62	0		1.000000	9.046868e-02	0	0	0	3	0	51	229
RIMS2	9699	broad.mit.edu	37	8	105160951	105160951	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chr8:105160951C>T	ENST00000436393.2	+	23	3504	c.3263C>T	c.(3262-3264)tCt>tTt	p.S1088F	RIMS2_ENST00000406091.3_Intron|RIMS2_ENST00000507740.1_Intron|RIMS2_ENST00000262231.10_Intron			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	0					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GGCAGCCAGTCTGACACTGCA	0.517										HNSCC(12;0.0054)																												ENST00000436393.2	1.000000	6.300000e-01	1.000000	0.740000	0.860000	0.863100	0.860000	1.000000																										0				144						c.(3262-3264)tCt>tTt		regulating synaptic membrane exocytosis 2							92.0	85.0	87.0					8																	105160951		876	1991	2867	SO:0001583	missense	9699	0	0					g.chr8:105160951C>T	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3263C>T	chr8.hg19:g.105160951C>T	ENSP00000390665:p.Ser1088Phe	0	HNSCC(12;0.0054)				RIMS2_ENST00000507740.1_Intron|RIMS2_ENST00000406091.3_Intron|RIMS2_ENST00000262231.10_Intron	p.S1088F			1	2	3	2.019871	Q9UQ26	RIMS2_HUMAN	OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)	23	3504	+			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	1	1	hg19	c.3263C>T		1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.505487	0.85282	.	.	ENSG00000176406	ENST00000408894;ENST00000436393	T;T	0.25579	1.79;2.34	5.65	5.65	0.86999	5.65	5.65	0.86999	.	.	.	.	.	T	0.55289	0.1911	.	.	.	0.80722	D	1	D	0.67145	0.996	D	0.74023	0.982	T	0.58042	-0.7706	8	0.87932	D	0	.	19.8067	0.96534	0.0:1.0:0.0:0.0	.	1088	D6RA03	.	F	1077;1088	ENSP00000386228:S1077F;ENSP00000390665:S1088F	ENSP00000386228:S1077F	S	+	2	0	0	RIMS2	105230127	105230127	1.000000	0.71417	0.974000	0.42286	0.999000	0.98932	7.789000	0.85783	2.672000	0.90937	0.650000	0.86243	TCT	0.382347		TCGA-2J-AABE-01A-12D-A40W-08	0.517	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	0	0	1		2	2	2	0		0	0	27		27	26	1	1.990000	-20.000000	1	0.380000	NM_001100117			37	36		189	180	1		1			0	0	27	0		1.000000	0	0	0	0	0	0	37	189
ACTRT1	139741	broad.mit.edu	37	X	127185142	127185142	+	Silent	SNP	G	G	T			TCGA-2J-AABE-01A-12D-A40W-08	TCGA-2J-AABE-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	380e7781-277f-4143-bd2d-0245a20a970f	b0c12efc-9a63-411b-8c7b-7e693ecbaf7a	g.chrX:127185142G>T	ENST00000371124.3	-	1	1240	c.1044C>A	c.(1042-1044)acC>acA	p.T348T		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	348						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						TGCTCATAGAGGTCATGATGG	0.473																																						ENST00000371124.3	0.100000	1.000000e-02	0.070000	0.020000	0.040000	0.051652	0.040000	0.040000																										0				34						c.(1042-1044)acC>acA		actin-related protein T1							170.0	136.0	148.0					X																	127185142		2203	4300	6503	SO:0001819	synonymous_variant	139741	0	0					g.chrX:127185142G>T	AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.1044C>A	chrX.hg19:g.127185142G>T								p.T348T	NM_138289.3	NP_612146.1	0	1	1		Q8TDG2	ACTT1_HUMAN		1	1240	-			Q6X7C1|Q96L10	Silent	SNP	ENST00000371124.3	0	1	hg19	c.1044C>A	CCDS14611.1	0																																																																																								0.380000		TCGA-2J-AABE-01A-12D-A40W-08	0.473	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058192.1	0	0	1		2	2	2	0		0	0	52		52	51	1	1.990000	-2.835725	1	0.380000	NM_138289			5	5		297	295	0		1			0	0	52	0		0.936955	0	0	0	0	0	0	5	297
