#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
CTNND1	1500	broad.mit.edu	37	11	57582920	57582920	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08			G	-	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr11:57582920delG	ENST00000399050.4	+	19	3292	c.2756delG	c.(2755-2757)cgafs	p.R919fs	CTNND1_ENST00000534579.1_Frame_Shift_Del_p.R859fs|CTNND1_ENST00000533667.1_Frame_Shift_Del_p.R569fs|CTNND1_ENST00000525902.1_Frame_Shift_Del_p.R596fs|CTNND1_ENST00000415361.2_Frame_Shift_Del_p.R818fs|CTNND1_ENST00000530094.1_Frame_Shift_Del_p.R812fs|CTNND1_ENST00000360682.6_Frame_Shift_Del_p.R898fs|CTNND1_ENST00000399039.4_Frame_Shift_Del_p.R919fs|CTNND1_ENST00000428599.2_Frame_Shift_Del_p.R913fs|CTNND1_ENST00000532649.1_Frame_Shift_Del_p.R859fs|CTNND1_ENST00000532844.1_Frame_Shift_Del_p.R865fs|CTNND1_ENST00000528232.1_Frame_Shift_Del_p.R818fs|CTNND1_ENST00000532787.1_Frame_Shift_Del_p.R791fs|CTNND1_ENST00000529873.1_Frame_Shift_Del_p.R838fs|CTNND1_ENST00000527467.1_Frame_Shift_Del_p.R596fs|CTNND1_ENST00000528621.1_Frame_Shift_Del_p.R859fs|CTNND1_ENST00000426142.2_Frame_Shift_Del_p.R812fs|CTNND1_ENST00000526357.1_Frame_Shift_Del_p.R859fs|CTNND1_ENST00000361332.4_Frame_Shift_Del_p.R913fs|CTNND1_ENST00000530748.1_Frame_Shift_Del_p.R865fs|CTNND1_ENST00000361391.6_Frame_Shift_Del_p.R892fs|CTNND1_ENST00000529526.1_Frame_Shift_Del_p.R859fs|CTNND1_ENST00000524630.1_Frame_Shift_Del_p.R913fs|CTNND1_ENST00000529919.1_Frame_Shift_Del_p.R919fs|CTNND1_ENST00000532245.1_Frame_Shift_Del_p.R812fs|CTNND1_ENST00000531014.1_Frame_Shift_Del_p.R590fs|CTNND1_ENST00000526938.1_Frame_Shift_Del_p.R898fs|CTNND1_ENST00000358694.6_Frame_Shift_Del_p.R913fs|CTNND1_ENST00000529986.1_Frame_Shift_Del_p.R812fs|CTNND1_ENST00000526772.1_Frame_Shift_Del_p.R590fs|CTNND1_ENST00000361796.4_Frame_Shift_Del_p.R913fs|CTNND1_ENST00000532463.1_Frame_Shift_Del_p.R812fs	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	919					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				ACACTGGATCGATCGGGGGAT	0.393																																						ENST00000399050.4	1.000000	0.390000	1.000000	0.560000	0.780000	0.779986	0.780000	1.000000																										0				45						c.(2755-2757)cgafs		catenin (cadherin-associated protein), delta 1							68.0	69.0	69.0					11																	57582920		1859	4099	5958	SO:0001589	frameshift_variant	1500	0	0					g.chr11:57582920delG	AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.2756delG	chr11.hg19:g.57582920delG	ENSP00000382004:p.Arg919fs	0					CTNND1_ENST00000534579.1_Frame_Shift_Del_p.R859fs|CTNND1_ENST00000361332.4_Frame_Shift_Del_p.R913fs|CTNND1_ENST00000529873.1_Frame_Shift_Del_p.R838fs|CTNND1_ENST00000426142.2_Frame_Shift_Del_p.R812fs|CTNND1_ENST00000526938.1_Frame_Shift_Del_p.R898fs|CTNND1_ENST00000530748.1_Frame_Shift_Del_p.R865fs|CTNND1_ENST00000532245.1_Frame_Shift_Del_p.R812fs|CTNND1_ENST00000533667.1_Frame_Shift_Del_p.R569fs|CTNND1_ENST00000532463.1_Frame_Shift_Del_p.R812fs|CTNND1_ENST00000525902.1_Frame_Shift_Del_p.R596fs|CTNND1_ENST00000532787.1_Frame_Shift_Del_p.R791fs|CTNND1_ENST00000415361.2_Frame_Shift_Del_p.R818fs|CTNND1_ENST00000528621.1_Frame_Shift_Del_p.R859fs|CTNND1_ENST00000361796.4_Frame_Shift_Del_p.R913fs|CTNND1_ENST00000428599.2_Frame_Shift_Del_p.R913fs|CTNND1_ENST00000527467.1_Frame_Shift_Del_p.R596fs|CTNND1_ENST00000532844.1_Frame_Shift_Del_p.R865fs|CTNND1_ENST00000358694.6_Frame_Shift_Del_p.R913fs|CTNND1_ENST00000530094.1_Frame_Shift_Del_p.R812fs|CTNND1_ENST00000529986.1_Frame_Shift_Del_p.R812fs|CTNND1_ENST00000361391.6_Frame_Shift_Del_p.R892fs|CTNND1_ENST00000524630.1_Frame_Shift_Del_p.R913fs|CTNND1_ENST00000360682.6_Frame_Shift_Del_p.R898fs|CTNND1_ENST00000399039.4_Frame_Shift_Del_p.R919fs|CTNND1_ENST00000529919.1_Frame_Shift_Del_p.R919fs|CTNND1_ENST00000528232.1_Frame_Shift_Del_p.R818fs|CTNND1_ENST00000526772.1_Frame_Shift_Del_p.R590fs|CTNND1_ENST00000531014.1_Frame_Shift_Del_p.R590fs|CTNND1_ENST00000526357.1_Frame_Shift_Del_p.R859fs|CTNND1_ENST00000529526.1_Frame_Shift_Del_p.R859fs|CTNND1_ENST00000532649.1_Frame_Shift_Del_p.R859fs	p.R919fs	NM_001085458.1	NP_001078927.1	0	0	0	1.944851	O60716	CTND1_HUMAN		19	3292	+		all_epithelial(135;0.155)	A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Frame_Shift_Del	DEL	ENST00000399050.4	0	1	hg19	c.2756delG	CCDS44604.1	0																																																																																								0.164927		TCGA-2J-AABK-01A-31D-A40W-08	0.393	CTNND1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393944.1	1	0	1		2	2		0		0	0	11		11	12	1	1.880000	-13.977320	1	0.200000	NM_001331			9	9		101	103	0		1	1	0	0	0	11	0		0.995277	9.999980e-01	0	44	0	341	0	9	101
SORCS1	114815	broad.mit.edu	37	10	108434807	108434807	+	Splice_Site	SNP	G	G	A	rs533738961		TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr10:108434807G>A	ENST00000263054.6	-	14	1947	c.1940C>T	c.(1939-1941)aCa>aTa	p.T647I	SORCS1_ENST00000344440.6_Splice_Site_p.T647I|SORCS1_ENST00000369698.1_Splice_Site_p.T182I	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	647					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		TTCAACTTACGTCATGATGAG	0.403																																						ENST00000263054.6	1.000000	0.730000	1.000000	0.860000	0.990000	0.949924	0.990000	1.000000																										0				127						c.(1939-1941)aCa>aTa		sortilin-related VPS10 domain containing receptor 1							124.0	117.0	119.0					10																	108434807		2203	4300	6503	SO:0001630	splice_region_variant	114815	1	121412	31				g.chr10:108434807G>A	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1940+1C>T	chr10.hg19:g.108434807G>A		0					SORCS1_ENST00000344440.6_Splice_Site_p.T647I|SORCS1_ENST00000369698.1_Splice_Site_p.T182I	p.T647I	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	1	2	3	2.048293	Q8WY21	SORC1_HUMAN		14	1947	-		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Splice_Site	SNP	ENST00000263054.6	1	0	hg19	c.1940C>T	CCDS7559.1	1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.787704	0.90367	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.38560	1.13;1.13;1.13	5.92	5.92	0.95590	5.92	5.92	0.95590	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.69043	0.3067	M	0.79805	2.47	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;0.999;1.0	T	0.68006	-0.5523	9	.	.	.	-13.2981	20.3206	0.98668	0.0:0.0:1.0:0.0	.	647;647;647;647;647	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	I	182;647;647	ENSP00000358712:T182I;ENSP00000263054:T647I;ENSP00000345964:T647I	.	T	-	2	0	0	SORCS1	108424797	108424797	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.628000	0.83189	2.809000	0.96659	0.655000	0.94253	ACA	0.207136		TCGA-2J-AABK-01A-31D-A40W-08	0.403	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	1	0	1		2	2	2	0		0	0	81		81	81	1	1.880000	-13.466610	1	0.200000	NM_052918	Missense_Mutation		38	38		344	344	1		1	0	1	0	0	81	633		1.000000	0	1	0	68	1	633	38	344
AHNAK	79026	broad.mit.edu	37	11	62293318	62293318	+	Silent	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr11:62293318G>A	ENST00000378024.4	-	5	8845	c.8571C>T	c.(8569-8571)ggC>ggT	p.G2857G	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2857					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CTACCTTAGGGCCTGTAACAT	0.453																																						ENST00000378024.4	0.550000	0.270000	0.480000	0.330000	0.400000	0.411049	0.400000	0.400000																										0				268						c.(8569-8571)ggC>ggT		AHNAK nucleoprotein							166.0	168.0	167.0					11																	62293318		2202	4299	6501	SO:0001819	synonymous_variant	79026	0	0					g.chr11:62293318G>A	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.8571C>T	chr11.hg19:g.62293318G>A		0					AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	p.G2857G	NM_001620.1	NP_001611.1	0	0	0	1.944851	Q09666	AHNK_HUMAN		5	8845	-		Melanoma(852;0.155)	A1A586	Silent	SNP	ENST00000378024.4	1	1	hg19	c.8571C>T	CCDS31584.1	0																																																																																								0.164927		TCGA-2J-AABK-01A-31D-A40W-08	0.453	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	1	0	1		2	2	2	0		0	0	231		231	226	1	1.880000	-4.473745	1	0.200000	NM_024060			32	32		730	722	0		1	1		0	0	231	0		1.000000	3.412846e-01	0	6	0	22	0	32	730
DCHS1	8642	broad.mit.edu	37	11	6653418	6653418	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr11:6653418G>A	ENST00000299441.3	-	6	3736	c.3325C>T	c.(3325-3327)Ccc>Tcc	p.P1109S	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1109	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGAAGGTGGGATCCTCAGAC	0.607																																						ENST00000299441.3	0.890000	0.180000	0.680000	0.290000	0.460000	0.492451	0.460000	0.430000																										0				103						c.(3325-3327)Ccc>Tcc		dachsous cadherin-related 1							93.0	86.0	88.0					11																	6653418		2201	4295	6496	SO:0001583	missense	8642	0	0					g.chr11:6653418G>A	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.3325C>T	chr11.hg19:g.6653418G>A	ENSP00000299441:p.Pro1109Ser	0					RP11-732A19.6_ENST00000526633.1_RNA	p.P1109S	NM_003737.2	NP_003728.1	0	0	0	1.944851	Q96JQ0	PCD16_HUMAN		6	3736	-		Medulloblastoma(188;0.00263)|all_neural(188;0.026)	O15098	Missense_Mutation	SNP	ENST00000299441.3	0	1	hg19	c.3325C>T	CCDS7771.1	0	.	.	.	.	.	.	.	.	.	.	G	12.06	1.825234	0.32237	.	.	ENSG00000166341	ENST00000299441	T	0.05258	3.47	4.66	4.66	0.58398	4.66	4.66	0.58398	Cadherin (3);Cadherin-like (1);	0.000000	0.46145	D	0.000310	T	0.07458	0.0188	N	0.03608	-0.345	0.32893	D	0.512082	D	0.69078	0.997	D	0.75484	0.986	T	0.38972	-0.9636	10	0.13108	T	0.6	.	12.2061	0.54353	0.0:0.0:0.8297:0.1703	.	1109	Q96JQ0	PCD16_HUMAN	S	1109	ENSP00000299441:P1109S	ENSP00000299441:P1109S	P	-	1	0	0	DCHS1	6609994	6609994	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.514000	0.60482	2.584000	0.87258	0.561000	0.74099	CCC	0.164927		TCGA-2J-AABK-01A-31D-A40W-08	0.607	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	1	0	1		2	2	2	0		0	0	16		16	16	1	1.880000	-8.424241	1	0.200000	NM_003737			5	5		104	103	0		1	0		0	0	16	0		0.937528	9.656781e-03	0	0	0	3	0	5	104
AHNAK	79026	broad.mit.edu	37	11	62296207	62296207	+	Silent	SNP	A	A	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr11:62296207A>T	ENST00000378024.4	-	5	5956	c.5682T>A	c.(5680-5682)ccT>ccA	p.P1894P	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1894					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GCTCAACATCAGGCACCTCCA	0.517																																						ENST00000378024.4	0.500000	0.250000	0.440000	0.300000	0.360000	0.376947	0.360000	0.370000																										0				268						c.(5680-5682)ccT>ccA		AHNAK nucleoprotein							143.0	157.0	152.0					11																	62296207		2202	4299	6501	SO:0001819	synonymous_variant	79026	0	0					g.chr11:62296207A>T	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.5682T>A	chr11.hg19:g.62296207A>T		0					AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	p.P1894P	NM_001620.1	NP_001611.1	0	0	0	1.944851	Q09666	AHNK_HUMAN		5	5956	-		Melanoma(852;0.155)	A1A586	Silent	SNP	ENST00000378024.4	1	1	hg19	c.5682T>A	CCDS31584.1	0																																																																																								0.164927		TCGA-2J-AABK-01A-31D-A40W-08	0.517	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	0	0	1		16	2	2	1		1	1	201		201	195	1	1.880000	-3.507129	1	0.200000	NM_024060			33	32		824	810	0		1	0		1	0	201	0		0.994892	3.183208e-01	0	1	0	28	0	33	824
KDM5A	5927	broad.mit.edu	37	12	498206	498206	+	Missense_Mutation	SNP	C	C	G			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr12:498206C>G	ENST00000399788.2	-	1	414	c.52G>C	c.(52-54)Gag>Cag	p.E18Q	CCDC77_ENST00000422000.1_5'Flank|KDM5A_ENST00000382815.4_Missense_Mutation_p.E18Q|CCDC77_ENST00000540180.1_5'Flank	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	18					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						ACGGGGCACTCTGGCGGTGGC	0.677			T	NUP98	AML																																	ENST00000399788.2	1.000000	0.460000	0.960000	0.600000	0.770000	0.776760	0.770000	1.000000				Dom	yes			Dom	yes		12	12p11	12p11	5927	T	"""lysine (K)-specific demethylase 5A, JARID1A"""				L	L	NUP98		AML		0				77						c.(52-54)Gag>Cag		lysine (K)-specific demethylase 5A							24.0	26.0	26.0					12																	498206		1849	4087	5936	SO:0001583	missense	5927	0	0					g.chr12:498206C>G		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.52G>C	chr12.hg19:g.498206C>G	ENSP00000382688:p.Glu18Gln	0					KDM5A_ENST00000382815.4_Missense_Mutation_p.E18Q|CCDC77_ENST00000540180.1_5'Flank|CCDC77_ENST00000422000.1_5'Flank	p.E18Q	NM_001042603.1	NP_001036068.1	0	0	0	1.999859	P29375	KDM5A_HUMAN		1	414	-			A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	ENST00000399788.2	1	1	hg19	c.52G>C	CCDS41736.1	0	.	.	.	.	.	.	.	.	.	.	C	20.6	4.014012	0.75161	.	.	ENSG00000073614	ENST00000261253;ENST00000399787;ENST00000399788;ENST00000382815;ENST00000544760;ENST00000535014;ENST00000543507	D;D;D;T;D	0.87334	-2.24;-2.05;-1.67;-1.33;-1.86	5.42	4.53	0.55603	5.42	4.53	0.55603	Transcription factor jumonji, JmjN (1);	0.000000	0.85682	D	0.000000	D	0.89588	0.6758	M	0.80847	2.515	0.53688	D	0.999971	B;B;B;B	0.33612	0.084;0.221;0.295;0.419	B;B;B;B	0.41036	0.034;0.244;0.188;0.346	D	0.89846	0.4006	10	0.87932	D	0	-16.9434	14.0654	0.64826	0.0:0.9272:0.0:0.0728	.	18;18;18;18	B4DVX3;F5H1F7;P29375;P29375-2	.;.;KDM5A_HUMAN;.	Q	18	ENSP00000382688:E18Q;ENSP00000372265:E18Q;ENSP00000440622:E18Q;ENSP00000443854:E18Q;ENSP00000444251:E18Q	ENSP00000261253:E18Q	E	-	1	0	0	KDM5A	368467	368467	1.000000	0.71417	0.862000	0.33874	0.120000	0.20174	7.364000	0.79526	1.288000	0.44600	0.491000	0.48974	GAG	0.186992		TCGA-2J-AABK-01A-31D-A40W-08	0.677	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397812.1	1	0	1		2	2	2	0		0	0	44		44	42	1	1.880000	-19.969460	1	0.200000	NM_005056			16	16		189	179	0		1	0		0	0	44	0		0.999917	3.765799e-02	0	0	0	4	0	16	189
CD163L1	283316	broad.mit.edu	37	12	7548911	7548911	+	Silent	SNP	G	G	A	rs140225151	byFrequency	TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr12:7548911G>A	ENST00000313599.3	-	8	1887	c.1830C>T	c.(1828-1830)gaC>gaT	p.D610D	CD163L1_ENST00000396630.1_Silent_p.D610D|CD163L1_ENST00000416109.2_Silent_p.D620D			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	610	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						TGTTCCAGCCGTCATCACACA	0.567																																						ENST00000313599.3	1.000000	0.460000	1.000000	0.620000	0.820000	0.814431	0.820000	1.000000																										0				96						c.(1828-1830)gaC>gaT		CD163 molecule-like 1		G		2,4404	4.2+/-10.8	0,2,2201	114.0	86.0	96.0		1830	-4.5	0.0	12	dbSNP_134	96	0,8600		0,0,4300	no	coding-synonymous	CD163L1	NM_174941.4		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		610/1454	7548911	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	283316	3	121410	38				g.chr12:7548911G>A	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.1830C>T	chr12.hg19:g.7548911G>A		0					CD163L1_ENST00000396630.1_Silent_p.D610D|CD163L1_ENST00000416109.2_Silent_p.D620D	p.D610D			0	0	0	1.999859	Q9NR16	C163B_HUMAN		8	1887	-			B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Silent	SNP	ENST00000313599.3	1	1	hg19	c.1830C>T	CCDS8577.1	0																																																																																								0.186992		TCGA-2J-AABK-01A-31D-A40W-08	0.567	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	1	0	1		2	2	2	0		0	0	32		32	31	1	1.880000	-6.597734	1	0.200000	NM_174941			13	13		143	139	0		1			0	0	32	0		0.999534	0	0	0	0	0	0	13	143
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.470000	1.000000	0.620000	0.800000	0.804655	0.800000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	0	0	0	2.002578	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.188641		TCGA-2J-AABK-01A-31D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	60		60	60	1	1.880000	-7.101348	1	0.200000	NM_033360			15	15		169	167	0		1	1	1	0	0	60	415		0.999884	3.380320e-01	9.999999e-01	2	26	12	378	15	169
KIF21A	55605	broad.mit.edu	37	12	39752115	39752115	+	Silent	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr12:39752115G>A	ENST00000361418.5	-	8	1095	c.1080C>T	c.(1078-1080)aaC>aaT	p.N360N	KIF21A_ENST00000541463.2_Silent_p.N360N|KIF21A_ENST00000361961.3_Silent_p.N360N|KIF21A_ENST00000544797.2_Silent_p.N360N|KIF21A_ENST00000395670.3_Silent_p.N360N			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	360	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				ATTTCAGGGTGTTTAACGTTT	0.388																																						ENST00000361418.5	0.240000	0.060000	0.190000	0.090000	0.130000	0.146108	0.130000	0.130000																										0				86						c.(1078-1080)aaC>aaT		kinesin family member 21A							306.0	271.0	283.0					12																	39752115		2203	4300	6503	SO:0001819	synonymous_variant	55605	0	0					g.chr12:39752115G>A	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.1080C>T	chr12.hg19:g.39752115G>A		0					KIF21A_ENST00000361961.3_Silent_p.N360N|KIF21A_ENST00000541463.2_Silent_p.N360N|KIF21A_ENST00000544797.2_Silent_p.N360N|KIF21A_ENST00000395670.3_Silent_p.N360N	p.N360N			0	0	0	2.002578	Q7Z4S6	KI21A_HUMAN		8	1095	-		Lung NSC(34;0.179)|all_lung(34;0.213)	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Silent	SNP	ENST00000361418.5	0	1	hg19	c.1080C>T	CCDS53776.1	0																																																																																								0.188641		TCGA-2J-AABK-01A-31D-A40W-08	0.388	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403581.1	0	0	1		2	2	2	0		0	0	153		153	151	1	1.880000	-7.263989	1	0.200000	NM_017641			10	10		726	721	0		1	0		0	0	153	0		0.996793	2.420322e-04	0	0	0	2	0	10	726
TUBA1C	84790	broad.mit.edu	37	12	49666572	49666572	+	Silent	SNP	A	A	G			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr12:49666572A>G	ENST00000301072.6	+	4	1187	c.912A>G	c.(910-912)aaA>aaG	p.K304K	RP11-161H23.5_ENST00000550468.2_RNA|TUBA1C_ENST00000541364.1_Silent_p.K374K	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	304					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						AGATGGTGAAATGTGACCCTC	0.498																																						ENST00000301072.6	1.000000	0.730000	1.000000	0.850000	0.980000	0.944191	0.980000	1.000000																										0				13						c.(910-912)aaA>aaG		tubulin, alpha 1c							76.0	82.0	80.0					12																	49666572		2203	4298	6501	SO:0001819	synonymous_variant	84790	0	0					g.chr12:49666572A>G	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.912A>G	chr12.hg19:g.49666572A>G		0					TUBA1C_ENST00000541364.1_Silent_p.K374K|RP11-161H23.5_ENST00000550468.2_RNA	p.K304K	NM_032704.3	NP_116093.1	0	0	0	2.002578	Q9BQE3	TBA1C_HUMAN		4	1187	+				Silent	SNP	ENST00000301072.6	1	1	hg19	c.912A>G	CCDS8782.1	1																																																																																								0.188641		TCGA-2J-AABK-01A-31D-A40W-08	0.498	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	1	0	1		2	2	2	0		0	0	96		96	114	1	1.880000	-20.000000	1	0.200000	NM_032704			44	43		393	359	0		1	1		0	0	96	0		1.000000	1	0	133	0	371	0	44	393
SDR9C7	121214	broad.mit.edu	37	12	57323240	57323240	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr12:57323240G>A	ENST00000293502.1	-	3	801	c.658C>T	c.(658-660)Cga>Tga	p.R220*		NM_148897.2	NP_683695.1	Q8NEX9	DR9C7_HUMAN	short chain dehydrogenase/reductase family 9C, member 7	220					oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	retinol dehydrogenase activity (GO:0004745)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|pancreas(1)	7						CAAAGCTTTCGCATGCGTGAC	0.562																																						ENST00000293502.1	1.000000	0.720000	1.000000	0.830000	0.960000	0.933355	0.960000	1.000000																										0				7						c.(658-660)Cga>Tga		short chain dehydrogenase/reductase family 9C, member 7							116.0	102.0	107.0					12																	57323240		2203	4300	6503	SO:0001587	stop_gained	121214	3	121412	35				g.chr12:57323240G>A	AY044434	CCDS8926.1	12q13.3	2014-09-04			ENSG00000170426	ENSG00000170426	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	29958	protein-coding gene	gene with protein product		609769				12234675, 19027726	Standard	NM_148897		Approved	SDR-O, RDHS	uc010sqw.2	Q8NEX9	OTTHUMG00000171004	ENST00000293502.1:c.658C>T	chr12.hg19:g.57323240G>A	ENSP00000293502:p.Arg220*	0						p.R220*	NM_148897.2	NP_683695.1	0	0	0	2.002578	Q8NEX9	DR9C7_HUMAN		3	801	-			B3KVB4	Nonsense_Mutation	SNP	ENST00000293502.1	0	1	hg19	c.658C>T	CCDS8926.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.232819	0.95207	.	.	ENSG00000170426	ENST00000293502	.	.	.	5.45	3.51	0.40186	5.45	3.51	0.40186	.	0.624103	0.14118	N	0.340258	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	8.5096	0.33208	0.0:0.2657:0.4449:0.2895	.	.	.	.	X	220	.	ENSP00000293502:R220X	R	-	1	2	2	SDR9C7	55609507	55609507	0.000000	0.05858	0.165000	0.22776	0.353000	0.29299	-0.435000	0.06931	0.706000	0.31912	0.650000	0.86243	CGA	0.188641		TCGA-2J-AABK-01A-31D-A40W-08	0.562	SDR9C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411211.1	1	0	1		2	2	2	0		0	0	73		73	72	1	1.880000	-15.441740	1	0.200000	NM_148897			49	47		451	438	1		1	0		0	0	73	0		1.000000	0	0	0	0	1	0	49	451
C12orf66	144577	broad.mit.edu	37	12	64588215	64588215	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr12:64588215C>T	ENST00000398055.3	-	3	798	c.745G>A	c.(745-747)Gtg>Atg	p.V249M	C12orf66_ENST00000311915.8_Missense_Mutation_p.V249M|C12orf66_ENST00000544871.1_Missense_Mutation_p.V196M	NM_152440.4	NP_689653	Q96MD2	CL066_HUMAN	chromosome 12 open reading frame 66	249										central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)	5						GGAGGCTGCACGGCCTTCTGA	0.493																																						ENST00000398055.3	1.000000	0.620000	1.000000	0.750000	0.900000	0.887133	0.900000	1.000000																										0				5						c.(745-747)Gtg>Atg		chromosome 12 open reading frame 66							87.0	85.0	86.0					12																	64588215		1969	4133	6102	SO:0001583	missense	144577	7	120884	38				g.chr12:64588215C>T		CCDS41803.1, CCDS73490.1	12q14.2	2008-08-08			ENSG00000174206	ENSG00000174206			26517	protein-coding gene	gene with protein product						12477932	Standard	NM_152440		Approved	FLJ32549	uc001srw.4	Q96MD2	OTTHUMG00000168763	ENST00000398055.3:c.745G>A	chr12.hg19:g.64588215C>T	ENSP00000381132:p.Val249Met	0					C12orf66_ENST00000311915.8_Missense_Mutation_p.V249M|C12orf66_ENST00000544871.1_Missense_Mutation_p.V196M	p.V249M	NM_152440.4	NP_689653	0	0	0	2.002578	Q96MD2	CL066_HUMAN		3	798	-			C9JX54|Q8IYA0	Missense_Mutation	SNP	ENST00000398055.3	1	1	hg19	c.745G>A	CCDS41803.1	1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.247672	0.39697	.	.	ENSG00000174206	ENST00000311915;ENST00000544871;ENST00000398055	T;T;T	0.40756	1.02;1.02;1.02	5.94	5.05	0.67936	5.94	5.05	0.67936	.	0.117224	0.64402	D	0.000011	T	0.48484	0.1502	L	0.41236	1.265	0.53688	D	0.999976	D;D	0.65815	0.99;0.995	P;P	0.55260	0.747;0.772	T	0.40887	-0.9539	9	.	.	.	-14.3474	15.4147	0.74956	0.0:0.9333:0.0:0.0667	.	196;249	F5H2Q3;Q96MD2	.;CL066_HUMAN	M	249;196;249	ENSP00000311486:V249M;ENSP00000445481:V196M;ENSP00000381132:V249M	.	V	-	1	0	0	C12orf66	62874482	62874482	0.998000	0.40836	0.716000	0.30569	0.987000	0.75469	5.846000	0.69444	1.523000	0.49018	0.561000	0.74099	GTG	0.188641		TCGA-2J-AABK-01A-31D-A40W-08	0.493	C12orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400921.1	1	0	1		2	2	2	0		0	0	57		57	56	1	1.880000	-10.392120	1	0.200000	NM_152440			28	28		276	269	0		1	0		0	0	57	0		1.000000	2.445876e-01	0	1	0	9	0	28	276
WSCD2	9671	broad.mit.edu	37	12	108604027	108604027	+	Silent	SNP	C	C	T	rs569832300		TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr12:108604027C>T	ENST00000332082.4	+	5	1445	c.627C>T	c.(625-627)ggC>ggT	p.G209G	WSCD2_ENST00000547525.1_Silent_p.G209G|WSCD2_ENST00000261400.3_Silent_p.G209G|WSCD2_ENST00000549903.1_Silent_p.G209G			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	209	WSC 1. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						TGTGCGGCGGCGCCAACCGCC	0.682													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15029	0.0		0.0	False		,,,				2504	0.0					ENST00000332082.4	1.000000	0.300000	1.000000	0.490000	0.750000	0.748254	0.750000	1.000000																										0				57						c.(625-627)ggC>ggT		WSC domain containing 2							11.0	17.0	15.0					12																	108604027		2179	4265	6444	SO:0001819	synonymous_variant	9671	4	115198	32				g.chr12:108604027C>T		CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.627C>T	chr12.hg19:g.108604027C>T		0					WSCD2_ENST00000549903.1_Silent_p.G209G|WSCD2_ENST00000261400.3_Silent_p.G209G|WSCD2_ENST00000547525.1_Silent_p.G209G	p.G209G			0	0	0	2.002578	Q2TBF2	WSCD2_HUMAN		5	1445	+			B2RN48|B4DES1|Q8IY35|Q9Y4B7	Silent	SNP	ENST00000332082.4	0	1	hg19	c.627C>T	CCDS41828.1	0																																																																																								0.188641		TCGA-2J-AABK-01A-31D-A40W-08	0.682	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	0	0	1		2	2	2	0		0	0	14		14	13	1	1.880000	-10.123470	1	0.200000	NM_014653			5	4		62	57	0		1			0	0	14	0		0.923500	0	0	0	0	0	0	5	62
SOHLH2	54937	broad.mit.edu	37	13	36767849	36767849	+	Silent	SNP	C	C	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr13:36767849C>T	ENST00000379881.3	-	4	427	c.339G>A	c.(337-339)ggG>ggA	p.G113G	SOHLH2_ENST00000317764.6_Silent_p.G113G|CCDC169-SOHLH2_ENST00000511166.1_Silent_p.G190G|SOHLH2_ENST00000554962.1_Silent_p.G190G	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	113					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		CCATTCCATGCCCTGAAATAC	0.308																																						ENST00000379881.3	1.000000	0.180000	0.400000	0.230000	0.300000	0.348375	0.300000	0.290000																										0				26						c.(337-339)ggG>ggA		spermatogenesis and oogenesis specific basic helix-loop-helix 2							81.0	85.0	84.0					13																	36767849		2202	4297	6499	SO:0001819	synonymous_variant	54937	0	0					g.chr13:36767849C>T	AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.339G>A	chr13.hg19:g.36767849C>T		0					SOHLH2_ENST00000317764.6_Silent_p.G113G|SOHLH2_ENST00000554962.1_Silent_p.G190G|CCDC169-SOHLH2_ENST00000511166.1_Silent_p.G190G	p.G113G	NM_017826.2	NP_060296.2	1	2	3	2.041809	Q9NX45	SOLH2_HUMAN	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	4	427	-		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Silent	SNP	ENST00000379881.3	1	1	hg19	c.339G>A	CCDS9355.1	0																																																																																								0.205561		TCGA-2J-AABK-01A-31D-A40W-08	0.308	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044477.2	0	0	1		2	2	2	0		0	0	129		129	128	1	1.880000	-3.244149	1	0.200000	NM_017826			17	17		562	560	0		1			0	0	129	0		0.999965	0	0	0	0	0	0	17	562
EIF2B2	8892	broad.mit.edu	37	14	75469848	75469848	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr14:75469848G>A	ENST00000266126.5	+	1	235	c.155G>A	c.(154-156)aGc>aAc	p.S52N	RP11-950C14.3_ENST00000554430.1_RNA	NM_014239.3	NP_055054.1	P49770	EI2BB_HUMAN	eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa	52				S -> R (in Ref. 2; AAC42002). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|central nervous system development (GO:0007417)|gene expression (GO:0010467)|myelination (GO:0042552)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|translation initiation factor activity (GO:0003743)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(234;0.00661)		CACCGCTGGAGCAACGCGGGT	0.672																																						ENST00000266126.5	1.000000	0.340000	0.870000	0.470000	0.640000	0.665158	0.640000	1.000000																										0				11						c.(154-156)aGc>aAc		eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa							20.0	23.0	22.0					14																	75469848		2203	4298	6501	SO:0001583	missense	8892	2	121374	30				g.chr14:75469848G>A		CCDS9836.1	14q24.3	2008-08-11	2002-08-29			ENSG00000119718			3258	protein-coding gene	gene with protein product		606454	"""eukaryotic translation initiation factor 2B, subunit 2 (beta, 39kD)"""			8887689	Standard	NM_014239		Approved	EIF2B, EIF-2Bbeta	uc001xrc.2	P49770		ENST00000266126.5:c.155G>A	chr14.hg19:g.75469848G>A	ENSP00000266126:p.Ser52Asn	0					RP11-950C14.3_ENST00000554430.1_RNA	p.S52N	NM_014239.3	NP_055054.1	1	2	3	2.037781	P49770	EI2BB_HUMAN		1	235	+			O43201	Missense_Mutation	SNP	ENST00000266126.5	1	1	hg19	c.155G>A	CCDS9836.1	0	.	.	.	.	.	.	.	.	.	.	G	12.50	1.957275	0.34565	.	.	ENSG00000119718	ENST00000266126	D	0.92545	-3.06	5.73	4.83	0.62350	5.73	4.83	0.62350	.	0.163209	0.64402	N	0.000002	T	0.79747	0.4499	N	0.04686	-0.185	0.38742	D	0.953916	B	0.02656	0.0	B	0.10450	0.005	T	0.73538	-0.3951	10	0.06099	T	0.92	-15.1504	11.3171	0.49399	0.1477:0.0:0.8523:0.0	.	52	P49770	EI2BB_HUMAN	N	52	ENSP00000266126:S52N	ENSP00000266126:S52N	S	+	2	0	0	EIF2B2	74539601	74539601	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.131000	0.42074	1.535000	0.49220	0.555000	0.69702	AGC	0.204771		TCGA-2J-AABK-01A-31D-A40W-08	0.672	EIF2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414993.1	1	0	1		2	2	2	0		0	0	27		27	27	1	1.880000	-14.921970	1	0.200000	NM_014239			11	10		168	166	0		1	1		0	0	27	0		0.998347	7.907695e-01	0	8	0	39	0	11	168
VPS13C	54832	broad.mit.edu	37	15	62172889	62172889	+	Silent	SNP	T	T	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr15:62172889T>A	ENST00000261517.5	-	73	9994	c.9921A>T	c.(9919-9921)ctA>ctT	p.L3307L	VPS13C_ENST00000395896.4_Silent_p.L3307L|VPS13C_ENST00000558919.1_5'UTR|VPS13C_ENST00000395898.3_Silent_p.L3264L|VPS13C_ENST00000249837.3_Silent_p.L3264L	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						ATTCTGCATTTAGAGCATCAA	0.269																																						ENST00000261517.5	1.000000	0.520000	1.000000	0.700000	0.920000	0.874913	0.920000	1.000000																										0				117						c.(9919-9921)ctA>ctT		vacuolar protein sorting 13 homolog C (S. cerevisiae)							45.0	46.0	46.0					15																	62172889		2200	4288	6488	SO:0001819	synonymous_variant	54832	0	0					g.chr15:62172889T>A	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.9921A>T	chr15.hg19:g.62172889T>A		0					VPS13C_ENST00000395896.4_Silent_p.L3307L|VPS13C_ENST00000395898.3_Silent_p.L3264L|VPS13C_ENST00000249837.3_Silent_p.L3264L|VPS13C_ENST00000558919.1_5'UTR	p.L3307L	NM_020821.2	NP_065872.1	0	0	0	2.008378				73	9994	-				Silent	SNP	ENST00000261517.5	1	1	hg19	c.9921A>T	CCDS32257.1	1																																																																																								0.191919		TCGA-2J-AABK-01A-31D-A40W-08	0.269	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	1	0	1		2	2	2	0		0	0	24		24	24	1	1.880000	-19.610310	1	0.200000	NM_017684			13	13		127	127	0		1	1		0	0	24	0		0.999618	6.088365e-01	0	5	0	16	0	13	127
CSPG4	1464	broad.mit.edu	37	15	75974724	75974724	+	Silent	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr15:75974724G>A	ENST00000308508.5	-	8	4952	c.4860C>T	c.(4858-4860)taC>taT	p.Y1620Y		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1620	Cysteine-containing.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GCACCACACGGTAGAGCAGGA	0.667																																						ENST00000308508.5	0.400000	0.070000	0.300000	0.120000	0.200000	0.219759	0.200000	0.190000																										0				48						c.(4858-4860)taC>taT		chondroitin sulfate proteoglycan 4							39.0	43.0	41.0					15																	75974724		2197	4293	6490	SO:0001819	synonymous_variant	1464	0	0					g.chr15:75974724G>A	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.4860C>T	chr15.hg19:g.75974724G>A		0						p.Y1620Y	NM_001897.4	NP_001888.2	0	0	0	2.008378	Q6UVK1	CSPG4_HUMAN		8	4952	-			D3DW77|Q92675	Silent	SNP	ENST00000308508.5	0	1	hg19	c.4860C>T	CCDS10284.1	0																																																																																								0.191919		TCGA-2J-AABK-01A-31D-A40W-08	0.667	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	0	0	0		2	2	2	0		0	0	46		46	43	1	1.880000	-6.249720	1	0.200000	NM_001897			5	4		259	250	0		1	0		0	0	46	0		0.931603	3.383816e-03	0	0	0	4	0	5	259
IQGAP1	8826	broad.mit.edu	37	15	91017344	91017344	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr15:91017344C>T	ENST00000268182.5	+	22	2678	c.2554C>T	c.(2554-2556)Cgg>Tgg	p.R852W	IQGAP1_ENST00000560738.1_Missense_Mutation_p.R280W	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	852	IQ 4. {ECO:0000255|PROSITE- ProRule:PRU00116}.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			AAACAAAGCTCGGGATGACTA	0.423																																						ENST00000268182.5	1.000000	0.640000	1.000000	0.810000	0.990000	0.929861	0.990000	1.000000																										0				59						c.(2554-2556)Cgg>Tgg		IQ motif containing GTPase activating protein 1							57.0	56.0	56.0					15																	91017344		2198	4298	6496	SO:0001583	missense	8826	0	0					g.chr15:91017344C>T	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.2554C>T	chr15.hg19:g.91017344C>T	ENSP00000268182:p.Arg852Trp	0					IQGAP1_ENST00000560738.1_Missense_Mutation_p.R280W	p.R852W	NM_003870.3	NP_003861.1	0	0	0	2.008378	P46940	IQGA1_HUMAN	BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)	22	2678	+	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		A7MBM3	Missense_Mutation	SNP	ENST00000268182.5	1	1	hg19	c.2554C>T	CCDS10362.1	1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.195221	0.78902	.	.	ENSG00000140575	ENST00000268182	T	0.03496	3.91	5.49	4.57	0.56435	5.49	4.57	0.56435	.	0.063360	0.64402	D	0.000007	T	0.22551	0.0544	M	0.89785	3.06	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.04229	-1.0967	10	0.72032	D	0.01	-10.2579	13.4279	0.61037	0.0:0.9247:0.0:0.0752	.	852	P46940	IQGA1_HUMAN	W	852	ENSP00000268182:R852W	ENSP00000268182:R852W	R	+	1	2	2	IQGAP1	88818348	88818348	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.856000	0.55964	1.453000	0.47775	0.655000	0.94253	CGG	0.191919		TCGA-2J-AABK-01A-31D-A40W-08	0.423	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	1	0	1		2	2	2	0		0	0	37		37	35	1	1.880000	-3.017830	1	0.200000	NM_003870			20	20		176	174	1		1	1		0	0	37	0		0.999996	9.864188e-01	0	14	0	50	0	20	176
TPSD1	23430	broad.mit.edu	37	16	1306801	1306801	+	Silent	SNP	C	C	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr16:1306801C>T	ENST00000211076.3	+	3	406	c.258C>T	c.(256-258)gaC>gaT	p.D86D	TPSD1_ENST00000397534.2_Silent_p.D79D|RP11-616M22.5_ENST00000566997.1_RNA	NM_012217.2	NP_036349.1	Q9BZJ3	TRYD_HUMAN	tryptase delta 1	86	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	20		Hepatocellular(780;0.00369)				TGCCCAGGGACATCAAGGATC	0.682																																						ENST00000211076.3	1.000000	0.210000	0.770000	0.320000	0.490000	0.541415	0.490000	0.430000																										0				20						c.(256-258)gaC>gaT		tryptase delta 1							37.0	43.0	41.0					16																	1306801		2199	4300	6499	SO:0001819	synonymous_variant	23430	1	121404	19				g.chr16:1306801C>T	AF206664	CCDS10432.1	16p13.3	2008-07-29			ENSG00000095917	ENSG00000095917	3.4.21.59		14118	protein-coding gene	gene with protein product	"""mMCP-7-like II"", ""mMCP-7-like I"", ""MMCP-7-LIKE-2"""	609272				9920877	Standard	NM_012217		Approved		uc002clb.1	Q9BZJ3	OTTHUMG00000128511	ENST00000211076.3:c.258C>T	chr16.hg19:g.1306801C>T		0					RP11-616M22.5_ENST00000566997.1_RNA|TPSD1_ENST00000397534.2_Silent_p.D79D	p.D86D	NM_012217.2	NP_036349.1	1	2	3	2.066066	Q9BZJ3	TRYD_HUMAN		3	406	+		Hepatocellular(780;0.00369)	O95824|Q8TDI6|Q96L36|Q96RZ5|Q9H2Y6|Q9UQI8	Silent	SNP	ENST00000211076.3	0	1	hg19	c.258C>T	CCDS10432.1	0																																																																																								0.210267		TCGA-2J-AABK-01A-31D-A40W-08	0.682	TPSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250320.2	0	0	1		2	2	2	0		0	0	21		21	20	1	1.880000	-4.022665	1	0.200000				7	6		153	146	0		1			0	0	21	0		0.977586	0	0	0	0	0	0	7	153
PRSS36	146547	broad.mit.edu	37	16	31161352	31161352	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr16:31161352G>A	ENST00000268281.4	-	1	63	c.5C>T	c.(4-6)gCc>gTc	p.A2V	PRSS36_ENST00000569305.1_Missense_Mutation_p.A2V|PRSS36_ENST00000418068.2_Missense_Mutation_p.A2V	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	2						cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)			kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						CAGGTGCCGGGCCATGGCGCT	0.652																																						ENST00000268281.4	1.000000	0.040000	0.190000	0.070000	0.120000	0.162168	0.120000	0.110000																										0				17						c.(4-6)gCc>gTc		protease, serine, 36							87.0	90.0	89.0					16																	31161352		2197	4300	6497	SO:0001583	missense	146547	1	121412	31				g.chr16:31161352G>A	AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.5C>T	chr16.hg19:g.31161352G>A	ENSP00000268281:p.Ala2Val	0					PRSS36_ENST00000418068.2_Missense_Mutation_p.A2V|PRSS36_ENST00000569305.1_Missense_Mutation_p.A2V	p.A2V	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	1	2	3	2.030792	Q5K4E3	POLS2_HUMAN		1	63	-			A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Missense_Mutation	SNP	ENST00000268281.4	0	1	hg19	c.5C>T	CCDS32436.1	0	.	.	.	.	.	.	.	.	.	.	G	10.32	1.318445	0.23994	.	.	ENSG00000178226	ENST00000268281;ENST00000418068	D;D	0.89485	-2.52;-2.5	4.97	3.95	0.45737	4.97	3.95	0.45737	.	.	.	.	.	T	0.77322	0.4113	N	0.08118	0	0.21355	N	0.999715	B;B;B	0.19817	0.039;0.039;0.039	B;B;B	0.17433	0.011;0.011;0.018	T	0.67181	-0.5735	9	0.51188	T	0.08	.	8.5374	0.33371	0.1204:0.0:0.8796:0.0	.	2;2;2	E7EX56;B7ZMK8;Q5K4E3	.;.;POLS2_HUMAN	V	2	ENSP00000268281:A2V;ENSP00000407160:A2V	ENSP00000268281:A2V	A	-	2	0	0	PRSS36	31068853	31068853	1.000000	0.71417	1.000000	0.80357	0.008000	0.06430	1.152000	0.31663	1.093000	0.41377	0.557000	0.71058	GCC	0.203980		TCGA-2J-AABK-01A-31D-A40W-08	0.652	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000433542.1	0	0	1		20	2	2	1		1	1	90		90	88	1	1.880000	-2.577514	1	0.200000	NM_173502			6	6		533	524	0		0			1	0	90	0		0.003709	0	0	0	0	0	0	6	533
CDH13	1012	broad.mit.edu	37	16	83704515	83704515	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr16:83704515G>A	ENST00000566620.1	+	9	1512	c.1222G>A	c.(1222-1224)Ggg>Agg	p.G408R	CDH13_ENST00000268613.10_Missense_Mutation_p.G455R|CDH13_ENST00000428848.3_Missense_Mutation_p.G369R	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	408	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		CGGAAACCCCGGGCAGAGCTT	0.498																																						ENST00000566620.1	1.000000	0.770000	1.000000	0.880000	0.990000	0.955253	0.990000	1.000000																										0				1						c.(1222-1224)Ggg>Agg		cadherin 13							138.0	135.0	136.0					16																	83704515		1939	4147	6086	SO:0001583	missense	1012	26	120882	48				g.chr16:83704515G>A	U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.1222G>A	chr16.hg19:g.83704515G>A	ENSP00000454435:p.Gly408Arg	0					CDH13_ENST00000268613.10_Missense_Mutation_p.G455R|CDH13_ENST00000428848.3_Missense_Mutation_p.G369R	p.G408R	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	1	2	3	2.030792	P55290	CAD13_HUMAN		9	1512	+		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)	A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Missense_Mutation	SNP	ENST00000566620.1	1	1	hg19	c.1222G>A	CCDS58486.1	1	.	.	.	.	.	.	.	.	.	.	G	18.80	3.701232	0.68501	.	.	ENSG00000140945	ENST00000268613;ENST00000428848;ENST00000536143;ENST00000538855;ENST00000540531	T	0.53423	0.62	5.75	5.75	0.90469	5.75	5.75	0.90469	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.54046	0.1834	L	0.29908	0.895	0.80722	D	1	D;P;D	0.76494	0.991;0.676;0.999	P;B;P	0.58970	0.739;0.283;0.849	T	0.44952	-0.9294	9	0.30854	T	0.27	.	18.9266	0.92548	0.0:0.0:1.0:0.0	.	369;455;408	B7Z590;B7Z9B1;P55290	.;.;CAD13_HUMAN	R	455;408;369;110;98	ENSP00000268613:G455R	ENSP00000268613:G455R	G	+	1	0	0	CDH13	82262016	82262016	1.000000	0.71417	0.954000	0.39281	0.452000	0.32318	5.494000	0.66905	2.717000	0.92951	0.585000	0.79938	GGG	0.203980		TCGA-2J-AABK-01A-31D-A40W-08	0.498	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432917.1	1	0	1		2	2	2	0		0	0	97		97	94	1	1.880000	-2.329789	0	0.200000	NM_001257			57	57		516	507	1		1	0		0	0	97	0		1.000000	2.884758e-02	0	0	0	3	0	57	516
TP53	7157	broad.mit.edu	37	17	7577123	7577123	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr17:7577123A>G	ENST00000269305.4	-	8	1004	c.815T>C	c.(814-816)gTg>gCg	p.V272A	TP53_ENST00000455263.2_Missense_Mutation_p.V272A|TP53_ENST00000359597.4_Missense_Mutation_p.V272A|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.V272A|TP53_ENST00000420246.2_Missense_Mutation_p.V272A	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	272	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		V -> A (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1737852}.|V -> M (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.V272E(8)|p.V272A(7)|p.V272G(6)|p.?(2)|p.F270fs*72(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.E271fs*73(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACAAACACGCACCTCAAAGCT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.610000	1.000000	0.780000	0.940000	0.904703	0.940000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		39	Substitution - Missense(21)|Whole gene deletion(8)|Deletion - In frame(4)|Deletion - Frameshift(4)|Unknown(2)	p.0?(8)|p.V272E(8)|p.V272A(7)|p.V272G(6)|p.?(2)|p.F270fs*72(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.E271fs*73(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)	haematopoietic_and_lymphoid_tissue(6)|upper_aerodigestive_tract(5)|lung(4)|bone(4)|stomach(3)|central_nervous_system(3)|breast(3)|skin(3)|endometrium(2)|large_intestine(1)|soft_tissue(1)|liver(1)|urinary_tract(1)|ovary(1)|pancreas(1)	24185	GRCh37	CM942122	TP53	M		c.(814-816)gTg>gCg	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						63.0	55.0	57.0					17																	7577123		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577123A>G	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.815T>C	chr17.hg19:g.7577123A>G	ENSP00000269305:p.Val272Ala	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.V272A|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.V272A|TP53_ENST00000420246.2_Missense_Mutation_p.V272A|TP53_ENST00000359597.4_Missense_Mutation_p.V272A|TP53_ENST00000413465.2_Intron	p.V272A	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.862315	P04637	P53_HUMAN		8	1004	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.815T>C	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	A	15.32	2.797806	0.50208	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99822	-6.94;-6.94;-6.94;-6.94;-6.94;-6.94	5.13	2.87	0.33458	5.13	2.87	0.33458	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.057604	0.64402	D	0.000002	D	0.99622	0.9862	M	0.75447	2.3	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;0.992	D;D;D;D	0.83275	0.996;0.996;0.996;0.99	D	0.99204	1.0874	10	0.28530	T	0.3	-27.8222	6.511	0.22222	0.7602:0.1564:0.0833:0.0	.	272;272;272;272	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	A	272;272;272;272;272;261;140	ENSP00000352610:V272A;ENSP00000269305:V272A;ENSP00000398846:V272A;ENSP00000391127:V272A;ENSP00000391478:V272A;ENSP00000425104:V140A	ENSP00000269305:V272A	V	-	2	0	0	TP53	7517848	7517848	0.032000	0.19561	0.353000	0.25747	0.798000	0.45092	0.523000	0.22925	0.396000	0.25283	0.379000	0.24179	GTG	0.120879		TCGA-2J-AABK-01A-31D-A40W-08	0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0		0	0	14		14	14	1	1.880000	-19.999920	1	0.200000	NM_000546			15	15		103	101	0		1	1	1	0	0	14	1108		0.999896	9.976036e-01	1	21	84	51	820	15	103
MYH4	4622	broad.mit.edu	37	17	10366281	10366281	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr17:10366281C>A	ENST00000255381.2	-	11	1019	c.909G>T	c.(907-909)atG>atT	p.M303I	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	303	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TGATCAGAAGCATTTCTGAAC	0.433																																						ENST00000255381.2	0.800000	0.310000	0.670000	0.410000	0.530000	0.546105	0.530000	0.520000																										0				149						c.(907-909)atG>atT		myosin, heavy chain 4, skeletal muscle							118.0	113.0	115.0					17																	10366281		2203	4300	6503	SO:0001583	missense	4622	0	0					g.chr17:10366281C>A		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.909G>T	chr17.hg19:g.10366281C>A	ENSP00000255381:p.Met303Ile	1					RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	p.M303I	NM_017533.2	NP_060003.2	0	1	1	1.862315	Q9Y623	MYH4_HUMAN		11	1019	-				Missense_Mutation	SNP	ENST00000255381.2	1	1	hg19	c.909G>T	CCDS11154.1	0	.	.	.	.	.	.	.	.	.	.	C	17.21	3.332814	0.60853	.	.	ENSG00000141048	ENST00000255381	D	0.87103	-2.21	5.38	5.38	0.77491	5.38	5.38	0.77491	Myosin head, motor domain (2);	0.000000	0.45361	U	0.000374	D	0.89361	0.6693	M	0.84683	2.71	0.53688	D	0.999972	B	0.02656	0.0	B	0.09377	0.004	D	0.86226	0.1634	10	0.52906	T	0.07	.	19.4872	0.95033	0.0:1.0:0.0:0.0	.	303	Q9Y623	MYH4_HUMAN	I	303	ENSP00000255381:M303I	ENSP00000255381:M303I	M	-	3	0	0	MYH4	10307006	10307006	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.183000	0.50918	2.671000	0.90904	0.655000	0.94253	ATG	0.120879		TCGA-2J-AABK-01A-31D-A40W-08	0.433	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	0	0	1		2	2	2	0		0	0	54		54	52	1	1.880000	-5.491055	1	0.200000	NM_017533			15	14		242	241	0		1			0	0	54	0		0.999878	0	0	0	0	0	0	15	242
RNF213	57674	broad.mit.edu	37	17	78337556	78337556	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr17:78337556G>A	ENST00000582970.1	+	41	11859	c.11716G>A	c.(11716-11718)Ggg>Agg	p.G3906R	RNF213_ENST00000336301.6_Missense_Mutation_p.G1979R|CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.G3955R|CTD-2047H16.4_ENST00000575034.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3906					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCAAGGCAGCGGGAGCCTGGC	0.617																																						ENST00000582970.1	1.000000	0.370000	0.930000	0.520000	0.720000	0.727711	0.720000	1.000000																										0				130						c.(11716-11718)Ggg>Agg		ring finger protein 213							46.0	35.0	39.0					17																	78337556		2203	4300	6503	SO:0001583	missense	57674	0	0					g.chr17:78337556G>A	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.11716G>A	chr17.hg19:g.78337556G>A	ENSP00000464087:p.Gly3906Arg	1					CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.G3955R|RNF213_ENST00000336301.6_Missense_Mutation_p.G1979R|CTD-2047H16.4_ENST00000572151.1_RNA	p.G3906R	NM_001256071.1	NP_001243000.1	0	1	1	1.867580	Q63HN8	RN213_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)	41	11859	+	all_neural(118;0.0538)		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	0	1	hg19	c.11716G>A	CCDS58606.1	0	.	.	.	.	.	.	.	.	.	.	G	16.25	3.070011	0.55539	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.23348	1.91	5.03	-0.504	0.11997	5.03	-0.504	0.11997	.	0.293863	0.37483	N	0.002079	T	0.45054	0.1323	M	0.77820	2.39	0.09310	N	1	P;D	0.89917	0.76;1.0	B;D	0.72625	0.147;0.978	T	0.32798	-0.9893	10	0.87932	D	0	.	9.053	0.36387	0.4393:0.0:0.5607:0.0	.	3955;1979	C9JCP4;Q63HN8	.;RN213_HUMAN	R	3906;3955;1979	ENSP00000338218:G1979R	ENSP00000338218:G1979R	G	+	1	0	0	RNF213	75952151	75952151	0.932000	0.31603	0.000000	0.03702	0.001000	0.01503	1.647000	0.37260	-0.314000	0.08716	-0.150000	0.13652	GGG	0.124726		TCGA-2J-AABK-01A-31D-A40W-08	0.617	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	1	0	1		2	2	6	0		0	0	19		19	18	1	1.880000	-2.921914	1	0.200000	NM_020914			9	9		101	101	0		1	1	1	0	1	19	493		0.994859	7.401726e-01	9.999423e-01	4	60	27	409	9	101
FAM129C	199786	broad.mit.edu	37	19	17653012	17653012	+	Missense_Mutation	SNP	G	G	A	rs149574830		TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr19:17653012G>A	ENST00000335393.4	+	11	1469	c.1331G>A	c.(1330-1332)cGg>cAg	p.R444Q	FAM129C_ENST00000600871.1_Missense_Mutation_p.R390Q|FAM129C_ENST00000599164.1_Missense_Mutation_p.R413Q|FAM129C_ENST00000352727.3_Missense_Mutation_p.R444Q|FAM129C_ENST00000300971.2_Missense_Mutation_p.R444Q|FAM129C_ENST00000595684.1_Missense_Mutation_p.R444Q|FAM129C_ENST00000601861.1_Missense_Mutation_p.R413Q|FAM129C_ENST00000332386.5_Missense_Mutation_p.R444Q|FAM129C_ENST00000599124.1_Missense_Mutation_p.R413Q|FAM129C_ENST00000449408.2_Missense_Mutation_p.R170Q	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C	444										autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						GAGGCCGAGCGGAGCCGGGGG	0.607																																						ENST00000335393.4	1.000000	0.330000	0.560000	0.390000	0.460000	0.493211	0.460000	0.460000																										0				33						c.(1330-1332)cGg>cAg		family with sequence similarity 129, member C			GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	108.0	122.0	117.0		1331,1331	1.3	0.0	19	dbSNP_134	117	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	FAM129C	NM_001098524.1,NM_173544.4	43,43	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	possibly-damaging,possibly-damaging	444/652,444/698	17653012	3,13003	2203	4300	6503	SO:0001583	missense	199786	4	121412	47				g.chr19:17653012G>A	AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.1331G>A	chr19.hg19:g.17653012G>A	ENSP00000335040:p.Arg444Gln	0					FAM129C_ENST00000595684.1_Missense_Mutation_p.R444Q|FAM129C_ENST00000332386.5_Missense_Mutation_p.R444Q|FAM129C_ENST00000599164.1_Missense_Mutation_p.R413Q|FAM129C_ENST00000601861.1_Missense_Mutation_p.R413Q|FAM129C_ENST00000600871.1_Missense_Mutation_p.R390Q|FAM129C_ENST00000352727.3_Missense_Mutation_p.R444Q|FAM129C_ENST00000300971.2_Missense_Mutation_p.R444Q|FAM129C_ENST00000599124.1_Missense_Mutation_p.R413Q|FAM129C_ENST00000449408.2_Missense_Mutation_p.R170Q	p.R444Q	NM_173544.4	NP_775815	1	2	3	2.034460	Q86XR2	NIBL2_HUMAN		11	1469	+			B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Missense_Mutation	SNP	ENST00000335393.4	1	1	hg19	c.1331G>A	CCDS12362.1	0	.	.	.	.	.	.	.	.	.	.	g	5.022	0.189829	0.09547	2.27E-4	2.33E-4	ENSG00000167483	ENST00000335393;ENST00000332386;ENST00000352727;ENST00000300971;ENST00000449408;ENST00000435646	T;T;T;T;T	0.22945	2.27;2.29;1.98;1.99;1.93	4.77	1.28	0.21552	4.77	1.28	0.21552	.	0.297213	0.23053	N	0.052468	T	0.10637	0.0260	L	0.28400	0.85	0.09310	N	1	P;P;P;P;B;P	0.39624	0.535;0.681;0.681;0.681;0.366;0.681	B;B;B;B;B;B	0.31016	0.049;0.123;0.071;0.071;0.05;0.071	T	0.16837	-1.0389	10	0.13108	T	0.6	-22.8782	3.1616	0.06522	0.2352:0.0:0.4981:0.2667	.	390;444;444;444;170;444	E7ENP6;Q86XR2;Q86XR2-3;Q86XR2-4;B4DNU3;Q86XR2-2	.;NIBL2_HUMAN;.;.;.;.	Q	444;444;444;444;170;390	ENSP00000335040:R444Q;ENSP00000333447:R444Q;ENSP00000341067:R444Q;ENSP00000300971:R444Q;ENSP00000394929:R170Q	ENSP00000300971:R444Q	R	+	2	0	0	FAM129C	17514012	17514012	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.160000	0.16462	0.455000	0.26910	0.586000	0.80456	CGG	0.204771		TCGA-2J-AABK-01A-31D-A40W-08	0.607	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464206.1	1	0	1		2	2	2	0		0	0	189		189	184	1	1.880000	-3.191299	1	0.200000	NM_173544			38	38		794	784	0		1			0	0	189	0		1.000000	0	0	0	0	0	0	38	794
PNMAL2	57469	broad.mit.edu	37	19	46998384	46998384	+	Silent	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr19:46998384G>A	ENST00000377655.2	-	1	338	c.339C>T	c.(337-339)gaC>gaT	p.D113D	AC011484.1_ENST00000377652.3_Silent_p.P165P|PNMAL2_ENST00000594749.1_Intron|PNMAL2_ENST00000599531.1_Silent_p.D113D			Q9ULN7	PNML2_HUMAN	paraneoplastic Ma antigen family-like 2	113										central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)	8		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.00233)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		GCGTGGGCCCGTCATCCAGCA	0.692																																						ENST00000377655.2	1.000000	0.750000	1.000000	0.860000	0.970000	0.944724	0.970000	1.000000																										0				8						c.(337-339)gaC>gaT		paraneoplastic Ma antigen family-like 2							75.0	81.0	79.0					19																	46998384		2203	4300	6503	SO:0001819	synonymous_variant	57469	0	0					g.chr19:46998384G>A	AB033009	CCDS59400.1	19q13.32	2014-02-12	2012-02-09		ENSG00000204851	ENSG00000204851		"""Paraneoplastic Ma antigens"""	29206	protein-coding gene	gene with protein product			"""PNMA-like 2"""			10574461	Standard	NM_020709		Approved	KIAA1183	uc002pes.2	Q9ULN7		ENST00000377655.2:c.339C>T	chr19.hg19:g.46998384G>A		0					PNMAL2_ENST00000594749.1_Intron|PNMAL2_ENST00000599531.1_Silent_p.D113D|AC011484.1_ENST00000377652.3_Silent_p.P165P	p.D113D			1	2	3	2.034460	Q9ULN7	PNML2_HUMAN		1	338	-		Ovarian(192;0.00965)|all_neural(266;0.0459)	C9JGD5|M0R374|Q08E79|Q0D2F9|Q6ZVD1	Silent	SNP	ENST00000377655.2	1	1	hg19	c.339C>T		1																																																																																								0.204771		TCGA-2J-AABK-01A-31D-A40W-08	0.692	PNMAL2-201	KNOWN	basic	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	114		114	111	1	1.880000	-17.054310	1	0.200000	NM_020709			59	55		550	539	0		1	0		0	0	114	0		1.000000	9.787876e-03	0	0	0	2	0	59	550
CCDC114	93233	broad.mit.edu	37	19	48800579	48800579	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr19:48800579G>A	ENST00000315396.7	-	14	2349	c.1667C>T	c.(1666-1668)tCt>tTt	p.S556F		NM_144577.3	NP_653178.3	Q96M63	CC114_HUMAN	coiled-coil domain containing 114	556					outer dynein arm assembly (GO:0036158)	cilium (GO:0005929)|outer dynein arm (GO:0036157)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)	24		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		GTGGCCAAGAGAGCCACGGTC	0.642																																						ENST00000315396.7	1.000000	0.480000	0.990000	0.610000	0.780000	0.785802	0.780000	1.000000																										0				24						c.(1666-1668)tCt>tTt		coiled-coil domain containing 114							51.0	53.0	52.0					19																	48800579		2203	4300	6503	SO:0001583	missense	93233	0	0					g.chr19:48800579G>A	BC025752	CCDS12714.2	19q13.32	2013-02-22			ENSG00000105479	ENSG00000105479			26560	protein-coding gene	gene with protein product		615038				23261302, 23261303	Standard	NM_144577		Approved	FLJ32926, CILD20	uc002pir.2	Q96M63	OTTHUMG00000156161	ENST00000315396.7:c.1667C>T	chr19.hg19:g.48800579G>A	ENSP00000318429:p.Ser556Phe	0						p.S556F	NM_144577.3	NP_653178.3	1	2	3	2.034460	Q96M63	CC114_HUMAN		14	2349	-		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)	Q6ZRL4|Q96M06|Q9UFG8	Missense_Mutation	SNP	ENST00000315396.7	0	1	hg19	c.1667C>T	CCDS12714.2	0	.	.	.	.	.	.	.	.	.	.	G	14.35	2.509077	0.44660	.	.	ENSG00000105479	ENST00000315396	T	0.32272	1.46	3.66	2.61	0.31194	3.66	2.61	0.31194	.	.	.	.	.	T	0.24236	0.0587	L	0.32530	0.975	0.09310	N	1	P	0.41784	0.762	B	0.41135	0.348	T	0.09707	-1.0662	9	0.66056	D	0.02	-8.5304	7.6387	0.28282	0.127:0.0:0.873:0.0	.	556	Q96M63	CC114_HUMAN	F	556	ENSP00000318429:S556F	ENSP00000318429:S556F	S	-	2	0	0	CCDC114	53492391	53492391	0.320000	0.24616	0.023000	0.16930	0.007000	0.05969	3.696000	0.54757	0.820000	0.34516	0.555000	0.69702	TCT	0.204771		TCGA-2J-AABK-01A-31D-A40W-08	0.642	CCDC114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343207.1	0	0	1		17	2	2	1		1	1	47		47	46	1	1.880000	-19.999540	1	0.200000	NM_144577			18	17		219	219	0		1	0		1	0	47	0		0.627231	6.624826e-03	0	0	0	2	0	18	219
NLRP13	126204	broad.mit.edu	37	19	56424320	56424320	+	Missense_Mutation	SNP	T	T	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr19:56424320T>A	ENST00000342929.3	-	5	862	c.863A>T	c.(862-864)gAt>gTt	p.D288V	NLRP13_ENST00000588751.1_Missense_Mutation_p.D288V	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	288	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		ATCGGGCCAATCCAAAGAAAT	0.393																																						ENST00000342929.3	1.000000	0.620000	1.000000	0.750000	0.910000	0.890494	0.910000	1.000000																										0				109						c.(862-864)gAt>gTt		NLR family, pyrin domain containing 13							67.0	68.0	67.0					19																	56424320		2203	4300	6503	SO:0001583	missense	126204	0	0					g.chr19:56424320T>A	AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.863A>T	chr19.hg19:g.56424320T>A	ENSP00000343891:p.Asp288Val	0					NLRP13_ENST00000588751.1_Missense_Mutation_p.D288V	p.D288V	NM_176810.2	NP_789780.2	1	2	3	2.065882	Q86W25	NAL13_HUMAN		5	862	-		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)	Q7RTR5	Missense_Mutation	SNP	ENST00000342929.3	1	1	hg19	c.863A>T	CCDS33119.1	1	.	.	.	.	.	.	.	.	.	.	T	12.15	1.852815	0.32699	.	.	ENSG00000173572	ENST00000342929	D	0.83506	-1.73	2.7	1.66	0.24008	2.7	1.66	0.24008	NACHT nucleoside triphosphatase (1);	.	.	.	.	D	0.85995	0.5827	M	0.67397	2.05	0.09310	N	0.999993	D	0.65815	0.995	D	0.63381	0.914	T	0.73591	-0.3934	9	0.66056	D	0.02	.	3.7405	0.08528	0.0:0.1879:0.0:0.8121	.	288	Q86W25	NAL13_HUMAN	V	288	ENSP00000343891:D288V	ENSP00000343891:D288V	D	-	2	0	0	NLRP13	61116132	61116132	0.039000	0.19947	0.129000	0.21949	0.006000	0.05464	0.488000	0.22371	1.211000	0.43351	0.482000	0.46254	GAT	0.210267		TCGA-2J-AABK-01A-31D-A40W-08	0.393	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396560.1	1	0	1		2	2	2	0		0	0	68		68	65	1	1.880000	-10.539440	1	0.200000	NM_176810			31	31		322	318	0		1			0	0	68	0		1.000000	0	0	0	0	0	0	31	322
ZSCAN5B	342933	broad.mit.edu	37	19	56702324	56702324	+	Silent	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr19:56702324G>A	ENST00000586855.2	-	4	934	c.621C>T	c.(619-621)gaC>gaT	p.D207D	ZSCAN5B_ENST00000358992.3_Silent_p.D207D			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	207					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CACCTGTTACGTCAATACTCT	0.507																																						ENST00000586855.2	1.000000	0.530000	0.950000	0.640000	0.760000	0.781359	0.760000	0.740000																										0				37						c.(619-621)gaC>gaT		zinc finger and SCAN domain containing 5B							156.0	142.0	147.0					19																	56702324		2203	4300	6503	SO:0001819	synonymous_variant	342933	6	121412	42				g.chr19:56702324G>A		CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.621C>T	chr19.hg19:g.56702324G>A		0					ZSCAN5B_ENST00000358992.3_Silent_p.D207D	p.D207D			1	2	3	2.065882	A6NJL1	ZSA5B_HUMAN		4	934	-				Silent	SNP	ENST00000586855.2	1	1	hg19	c.621C>T	CCDS46203.1	0																																																																																								0.210267		TCGA-2J-AABK-01A-31D-A40W-08	0.507	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457834.2	0	0	1		14	2	2	1		1	1	131		131	129	1	1.880000	-9.229429	1	0.200000	NM_001080456			36	36		453	450	0		1	0		1	0	131	0		0.999618	0	0	0	0	1	0	36	453
GSTM5	2949	broad.mit.edu	37	1	110254908	110254908	+	De_novo_Start_OutOfFrame	SNP	T	T	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr1:110254908T>A	ENST00000256593.3	+	0	32				GSTM5_ENST00000369813.1_De_novo_Start_OutOfFrame|GSTM5_ENST00000369812.5_De_novo_Start_OutOfFrame	NM_000851.3	NP_000842.2	P46439	GSTM5_HUMAN	glutathione S-transferase mu 5						glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)			NS(1)|central_nervous_system(6)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	21		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Colorectal(144;0.0131)|all cancers(265;0.0252)|Epithelial(280;0.0265)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.0474)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)	CTGATGCCTGTCTGCAGAATC	0.682																																						ENST00000256593.3	1.000000	0.750000	1.000000	0.840000	0.930000	0.928076	0.930000	1.000000																										0				21								glutathione S-transferase mu 5	Glutathione(DB00143)						110.0	118.0	115.0					1																	110254908		2203	4300	6503			2949	0	0					g.chr1:110254908T>A	L02321	CCDS811.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134201	ENSG00000134201	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4637	protein-coding gene	gene with protein product		138385	"""glutathione S-transferase M5"""			8473333	Standard	NM_000851		Approved		uc001dyn.3	P46439	OTTHUMG00000011644	ENST00000256593.3:c.-27T>A	chr1.hg19:g.110254908T>A		1					GSTM5_ENST00000369812.5_De_novo_Start_OutOfFrame|GSTM5_ENST00000369813.1_De_novo_Start_OutOfFrame		NM_000851.3	NP_000842.2	0	1	1	1.860983	P46439	GSTM5_HUMAN		0	32	+		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)	A8K0V8|Q6PD78	Translation_Start_Site	SNP	ENST00000256593.3	0	1	hg19		CCDS811.1	1																																																																																								0.125683		TCGA-2J-AABK-01A-31D-A40W-08	0.682	GSTM5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032200.1	0	0	1		2	2	2	0		0	0	133		133	130	1	1.880000	-20.000000	1	0.200000	NM_000851			74	71		637	626	0		1	0		0	0	133	0		1.000000	1.113412e-02	0	0	0	2	0	74	637
MLLT11	10962	broad.mit.edu	37	1	151039879	151039879	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr1:151039879A>G	ENST00000368921.3	+	2	2981	c.179A>G	c.(178-180)aAc>aGc	p.N60S	CDC42SE1_ENST00000439374.2_Intron	NM_006818.3	NP_006809.1	Q13015	AF1Q_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11	60					extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway (GO:0097193)|positive regulation of apoptotic process (GO:0043065)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of transcription, DNA-templated (GO:0045893)	intracellular (GO:0005622)				upper_aerodigestive_tract(1)	1	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CAGGAGAAAAACCCTGAAGGT	0.532																																						ENST00000368921.3	1.000000	0.280000	1.000000	0.370000	0.470000	0.551637	0.470000	0.430000																										0				1						c.(178-180)aAc>aGc		myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11							126.0	125.0	125.0					1																	151039879		2203	4300	6503	SO:0001583	missense	10962	0	0					g.chr1:151039879A>G	BC006471	CCDS982.1	1q21	2008-02-05			ENSG00000213190	ENSG00000213190			16997	protein-coding gene	gene with protein product	"""ALL1 fused gene from chromosome 1q"""	604684				7833468	Standard	NM_006818		Approved	AF1Q	uc001ewq.3	Q13015	OTTHUMG00000035160	ENST00000368921.3:c.179A>G	chr1.hg19:g.151039879A>G	ENSP00000357917:p.Asn60Ser	1					CDC42SE1_ENST00000439374.2_Intron	p.N60S	NM_006818.3	NP_006809.1	2	2	4	2.331064	Q13015	AF1Q_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)	2	2981	+	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)			Missense_Mutation	SNP	ENST00000368921.3	1	1	hg19	c.179A>G	CCDS982.1	0	.	.	.	.	.	.	.	.	.	.	A	9.105	1.005000	0.19199	.	.	ENSG00000213190	ENST00000368921	.	.	.	6.06	-12.1	0.00011	6.06	-12.1	0.00011	.	1.158550	0.06646	N	0.761875	T	0.03263	0.0095	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.15350	-1.0440	8	0.10111	T	0.7	-3.2682	6.6906	0.23169	0.1975:0.4743:0.25:0.0781	.	60	Q13015	AF1Q_HUMAN	S	60	.	ENSP00000357917:N60S	N	+	2	0	0	MLLT11	149306503	149306503	0.000000	0.05858	0.065000	0.19835	0.750000	0.42670	-0.453000	0.06778	-2.338000	0.00627	-0.250000	0.11733	AAC	0.306759		TCGA-2J-AABK-01A-31D-A40W-08	0.532	MLLT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085103.1	0	0	1		2	2	2	0		0	0	68		68	66	1	1.880000	-3.498016	1	0.200000	NM_006818			21	21		526	522	0		1	0		0	0	68	0		0.999997	2.937825e-01	0	0	0	27	0	21	526
CRNN	49860	broad.mit.edu	37	1	152382385	152382385	+	Missense_Mutation	SNP	G	G	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr1:152382385G>T	ENST00000271835.3	-	3	1235	c.1173C>A	c.(1171-1173)agC>agA	p.S391R	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	391					response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTCAGGGTTGCTCACTTGCA	0.602																																						ENST00000271835.3	1.000000	0.650000	1.000000	0.760000	0.900000	0.892555	0.900000	1.000000																										0				35						c.(1171-1173)agC>agA		cornulin							123.0	103.0	110.0					1																	152382385		2203	4300	6503	SO:0001583	missense	49860	0	0					g.chr1:152382385G>T	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.1173C>A	chr1.hg19:g.152382385G>T	ENSP00000271835:p.Ser391Arg	1					RP1-91G5.3_ENST00000411804.1_RNA	p.S391R	NM_016190.2	NP_057274.1	2	2	4	2.331064	Q9UBG3	CRNN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	3	1235	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		B2RE60|Q8N613	Missense_Mutation	SNP	ENST00000271835.3	1	1	hg19	c.1173C>A	CCDS1010.1	1	.	.	.	.	.	.	.	.	.	.	G	11.93	1.785870	0.31593	.	.	ENSG00000143536	ENST00000271835	T	0.04970	3.52	4.5	1.36	0.22044	4.5	1.36	0.22044	.	0.199037	0.36066	N	0.002802	T	0.04588	0.0125	L	0.50333	1.59	0.09310	N	1	D	0.71674	0.998	P	0.58721	0.844	T	0.26430	-1.0103	10	0.72032	D	0.01	.	2.4183	0.04441	0.1093:0.2065:0.4987:0.1855	.	391	Q9UBG3	CRNN_HUMAN	R	391	ENSP00000271835:S391R	ENSP00000271835:S391R	S	-	3	2	2	CRNN	150649009	150649009	0.069000	0.21087	0.062000	0.19696	0.038000	0.13279	0.607000	0.24209	0.495000	0.27882	0.585000	0.79938	AGC	0.306759		TCGA-2J-AABK-01A-31D-A40W-08	0.602	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1	1	0	1		2	2	2	0		0	0	64		64	64	1	1.880000	-10.330540	1	0.200000	NM_016190			42	41		514	503	0		1			0	0	64	0		1.000000	0	0	0	0	0	0	42	514
HMCN1	83872	broad.mit.edu	37	1	186147896	186147896	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr1:186147896T>C	ENST00000271588.4	+	104	16521	c.16292T>C	c.(16291-16293)gTa>gCa	p.V5431A	GS1-174L6.4_ENST00000428391.1_RNA|HMCN1_ENST00000367492.2_Intron	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5431					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GACACATGTGTAGGTAAATGT	0.428																																						ENST00000271588.4	1.000000	0.310000	0.780000	0.420000	0.550000	0.598668	0.550000	0.520000																										0				308						c.(16291-16293)gTa>gCa		hemicentin 1							81.0	76.0	78.0					1																	186147896		2203	4300	6503	SO:0001583	missense	83872	0	0					g.chr1:186147896T>C	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.16292T>C	chr1.hg19:g.186147896T>C	ENSP00000271588:p.Val5431Ala	1					HMCN1_ENST00000367492.2_Intron|GS1-174L6.4_ENST00000428391.1_RNA	p.V5431A	NM_031935.2	NP_114141.2	2	2	4	2.362231	Q96RW7	HMCN1_HUMAN		104	16521	+			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	0	1	hg19	c.16292T>C	CCDS30956.1	0	.	.	.	.	.	.	.	.	.	.	T	13.38	2.221260	0.39201	.	.	ENSG00000143341	ENST00000271588	D	0.87966	-2.32	5.56	5.56	0.83823	5.56	5.56	0.83823	Growth factor, receptor (1);	0.187626	0.47455	D	0.000237	D	0.83101	0.5181	L	0.48174	1.505	0.80722	D	1	B	0.31625	0.332	B	0.27380	0.079	T	0.82808	-0.0274	10	0.56958	D	0.05	.	14.5915	0.68368	0.0:0.0:0.0:1.0	.	5431	Q96RW7	HMCN1_HUMAN	A	5431	ENSP00000271588:V5431A	ENSP00000271588:V5431A	V	+	2	0	0	HMCN1	184414519	184414519	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.614000	0.74197	2.240000	0.73641	0.533000	0.62120	GTA	0.316239		TCGA-2J-AABK-01A-31D-A40W-08	0.428	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	0	0	1		27	2	2	1		1	1	40		40	37	1	1.880000	-17.090710	1	0.200000	NM_031935			16	15		345	340	0		0	0		1	0	40	0		0.050196	2.084493e-02	0	0	0	5	0	16	345
EPHB2	2048	broad.mit.edu	37	1	23111370	23111370	+	Silent	SNP	C	C	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr1:23111370C>A	ENST00000400191.3	+	3	630	c.612C>A	c.(610-612)ggC>ggA	p.G204G	EPHB2_ENST00000544305.1_Silent_p.G204G|EPHB2_ENST00000374627.1_Silent_p.G198G|EPHB2_ENST00000374632.3_Silent_p.G204G|EPHB2_ENST00000374630.3_Silent_p.G204G	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	204	Cys-rich.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		TCCAGAATGGCGCCATCTTCC	0.627																																						ENST00000400191.3	1.000000	0.990000	1.000000	0.990000	0.990000	0.999237	0.990000	1.000000																										0				56						c.(610-612)ggC>ggA		EPH receptor B2							43.0	40.0	41.0					1																	23111370		2203	4300	6503	SO:0001819	synonymous_variant	2048	0	0					g.chr1:23111370C>A	AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.612C>A	chr1.hg19:g.23111370C>A		1					EPHB2_ENST00000374630.3_Silent_p.G204G|EPHB2_ENST00000374632.3_Silent_p.G204G|EPHB2_ENST00000544305.1_Silent_p.G204G|EPHB2_ENST00000374627.1_Silent_p.G198G	p.G204G	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	0	2	2	1.957755	P29323	EPHB2_HUMAN		3	630	+		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Silent	SNP	ENST00000400191.3	1	1	hg19	c.612C>A		1																																																																																								0.200000		TCGA-2J-AABK-01A-31D-A40W-08	0.627	EPHB2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000008060.2	1	0	1		2	2	2	0		0	0	39		39	39	1	1.880000	-20.000000	1	0.200000	NM_017449			27	26		149	146	1		1	1		0	0	39	0		1.000000	7.295226e-01	0	3	0	13	0	27	149
CACNA1S	779	broad.mit.edu	37	1	201079379	201079379	+	Missense_Mutation	SNP	G	G	C			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr1:201079379G>C	ENST00000362061.3	-	2	397	c.171C>G	c.(169-171)atC>atG	p.I57M	CACNA1S_ENST00000367338.3_Missense_Mutation_p.I57M	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	57					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGTGAGCAAGATGATCGTCT	0.577																																						ENST00000362061.3	1.000000	0.930000	1.000000	0.990000	0.990000	0.996158	0.990000	1.000000																										0				102						c.(169-171)atC>atG		calcium channel, voltage-dependent, L type, alpha 1S subunit	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)						157.0	120.0	133.0					1																	201079379		2203	4300	6503	SO:0001583	missense	779	0	0					g.chr1:201079379G>C	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.171C>G	chr1.hg19:g.201079379G>C	ENSP00000355192:p.Ile57Met	1					CACNA1S_ENST00000367338.3_Missense_Mutation_p.I57M	p.I57M	NM_000069.2	NP_000060.2	2	2	4	2.199606	Q13698	CAC1S_HUMAN		2	397	-			A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	1	1	hg19	c.171C>G	CCDS1407.1	1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614339	0.66672	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	T;T	0.71698	-0.59;-0.59	4.86	4.86	0.63082	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	D	0.86306	0.5901	M	0.92555	3.32	0.47862	D	0.999533	D	0.89917	1.0	D	0.91635	0.999	D	0.88364	0.2990	10	0.59425	D	0.04	.	11.4934	0.50394	0.0841:0.0:0.9159:0.0	.	57	Q13698	CAC1S_HUMAN	M	57	ENSP00000355192:I57M;ENSP00000356307:I57M	ENSP00000355192:I57M	I	-	3	3	3	CACNA1S	199346002	199346002	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.482000	0.60257	2.388000	0.81334	0.561000	0.74099	ATC	0.266055		TCGA-2J-AABK-01A-31D-A40W-08	0.577	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	1	0	1		2	2	2	0		0	0	40		40	39	1	1.880000	-20.000000	1	0.200000	NM_000069			38	38		292	290	1		1	1		0	0	40	0		1.000000	1.411050e-02	0	2	0	0	0	38	292
ZC3H12A	80149	broad.mit.edu	37	1	37948837	37948837	+	Silent	SNP	A	A	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08			A	T	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr1:37948837A>T	ENST00000373087.6	+	6	1541	c.1425A>T	c.(1423-1425)ggA>ggT	p.G475G		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GTCCCTATGGATCTGAGCTCC	0.677																																						ENST00000373087.6	1.000000	0.990000	1.000000	0.990000	0.990000	0.999458	0.990000	1.000000																										0				21						c.(1423-1425)ggA>ggT		zinc finger CCCH-type containing 12A							45.0	53.0	51.0					1																	37948837		2203	4300	6503	SO:0001819	synonymous_variant	80149	0	0					g.chr1:37948837A>T		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.1425A>T	chr1.hg19:g.37948837A>T		1						p.G475G	NM_025079.2	NP_079355.2	0	2	2	1.962099				6	1541	+		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)		Silent	SNP	ENST00000373087.6	1	1	hg19	c.1425A>T	CCDS417.1	1																																																																																								0.200000		TCGA-2J-AABK-01A-31D-A40W-08	0.677	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	1	0	1		2	2	2	0		0	0	61		61	60	1	1.880000	-20.000000	1	0.200000	NM_025079			52	51		333	325	1		1	1		0	0	61	0		1.000000	9.999934e-01	0	45	0	69	0	52	333
RYR2	6262	broad.mit.edu	37	1	237948081	237948081	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr1:237948081G>A	ENST00000366574.2	+	90	13386	c.13069G>A	c.(13069-13071)Gcc>Acc	p.A4357T	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.A4363T|RYR2_ENST00000542537.1_Missense_Mutation_p.A4341T	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4357					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.A4355T(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CCTGGAAGCCGCCCTGCCCTC	0.532																																						ENST00000366574.2	1.000000	0.950000	1.000000	0.990000	0.990000	0.997632	0.990000	1.000000																										1	Substitution - Missense(1)	p.A4355T(1)	skin(1)	586						c.(13069-13071)Gcc>Acc		ryanodine receptor 2 (cardiac)							53.0	53.0	53.0					1																	237948081		1919	4119	6038	SO:0001583	missense	6262	27	120864	42				g.chr1:237948081G>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.13069G>A	chr1.hg19:g.237948081G>A	ENSP00000355533:p.Ala4357Thr	1					RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.A4341T|RYR2_ENST00000360064.6_Missense_Mutation_p.A4363T	p.A4357T	NM_001035.2	NP_001026.2	0	1	1	2.005712	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)	90	13386	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	1	1	hg19	c.13069G>A	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	6.908	0.537143	0.13188	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.93659	-3.26;-3.26;-3.26	5.32	1.05	0.20165	5.32	1.05	0.20165	Ryanodine Receptor TM 4-6 (1);	0.568755	0.15572	N	0.255407	T	0.80613	0.4656	N	0.08118	0	0.36787	D	0.884646	B;B	0.32071	0.102;0.355	B;B	0.26614	0.028;0.071	T	0.71310	-0.4631	10	0.14252	T	0.57	-1.744	7.2896	0.26358	0.1498:0.2567:0.5934:0.0	.	1331;4357	B4DGV4;Q92736	.;RYR2_HUMAN	T	4357;4363;4341;1331	ENSP00000355533:A4357T;ENSP00000353174:A4363T;ENSP00000443798:A4341T	ENSP00000353174:A4363T	A	+	1	0	0	RYR2	236014704	236014704	0.000000	0.05858	0.096000	0.21009	0.123000	0.20343	0.422000	0.21296	0.032000	0.15435	-0.143000	0.13931	GCC	0.121844		TCGA-2J-AABK-01A-31D-A40W-08	0.532	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	1	0	1		2	2	2	0		0	0	37		37	37	1	1.880000	-3.501750	1	0.200000	NM_001035			50	49		204	198	1		1	1		0	0	37	0		1.000000	4.030885e-02	0	2	0	0	0	50	204
TIAM1	7074	broad.mit.edu	37	21	32499427	32499427	+	Silent	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr21:32499427G>A	ENST00000286827.3	-	27	4560	c.4089C>T	c.(4087-4089)tcC>tcT	p.S1363S	TIAM1_ENST00000541036.1_Silent_p.S1303S	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1363	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CTTCAGACTCGGATTTTACAT	0.453																																						ENST00000286827.3	1.000000	0.580000	1.000000	0.710000	0.860000	0.855636	0.860000	1.000000																										0				115						c.(4087-4089)tcC>tcT		T-cell lymphoma invasion and metastasis 1							140.0	128.0	132.0					21																	32499427		2203	4300	6503	SO:0001819	synonymous_variant	7074	9	121412	42				g.chr21:32499427G>A		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.4089C>T	chr21.hg19:g.32499427G>A		1					TIAM1_ENST00000541036.1_Silent_p.S1303S	p.S1363S	NM_003253.2	NP_003244.2	0	1	1	1.867336	Q13009	TIAM1_HUMAN		27	4560	-			B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	ENST00000286827.3	1	1	hg19	c.4089C>T	CCDS13609.1	1	.	.	.	.	.	.	.	.	.	.	G	1.678	-0.507137	0.04231	.	.	ENSG00000156299	ENST00000423206	.	.	.	6.17	-12.3	0.00002	6.17	-12.3	0.00002	.	.	.	.	.	T	0.30262	0.0759	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46652	-0.9176	4	.	.	.	.	1.7358	0.02941	0.3065:0.0798:0.2498:0.3639	.	.	.	.	L	18	.	.	P	-	2	0	0	TIAM1	31421298	31421298	0.000000	0.05858	0.009000	0.14445	0.276000	0.26787	-4.277000	0.00261	-3.566000	0.00140	-1.869000	0.00555	CCG	0.137001		TCGA-2J-AABK-01A-31D-A40W-08	0.453	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	1	0	1		2	2	2	0		0	0	52		52	52	1	1.880000	-2.966611	1	0.200000	NM_003253			27	27		260	255	0		1	0		0	0	52	0		1.000000	6.081076e-01	0	0	0	21	0	27	260
DSCR4	10281	broad.mit.edu	37	21	39493319	39493319	+	Missense_Mutation	SNP	C	C	T	rs374848395		TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr21:39493319C>T	ENST00000328264.3	-	1	135	c.31G>A	c.(31-33)Gaa>Aaa	p.E11K	DSCR8_ENST00000400477.3_5'Flank|DSCR8_ENST00000357704.4_5'Flank|DSCR4_ENST00000398948.1_Missense_Mutation_p.E11K	NM_005867.2	NP_005858.1	P56555	DSCR4_HUMAN	Down syndrome critical region gene 4	11										large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	6						atccggggttcatcatctctc	0.498																																						ENST00000328264.3	1.000000	0.550000	1.000000	0.720000	0.930000	0.882951	0.930000	1.000000																										0				6						c.(31-33)Gaa>Aaa		Down syndrome critical region gene 4		C		0,4406		0,0,2203	122.0	108.0	113.0			0.2	0.1	21		113	1,8599	1.2+/-3.3	0,1,4299	no	intergenic				0,1,6502	TT,TC,CC		0.0116,0.0,0.0077			39493319	1,13005	2203	4300	6503	SO:0001583	missense	10281	2	121412	34				g.chr21:39493319C>T	AB000099	CCDS33554.1	21q22.2	2012-04-19			ENSG00000184029	ENSG00000184029			3045	protein-coding gene	gene with protein product		604829				9455479	Standard	NM_005867		Approved	DCRB	uc002ywp.3	P56555	OTTHUMG00000086673	ENST00000328264.3:c.31G>A	chr21.hg19:g.39493319C>T	ENSP00000328676:p.Glu11Lys	0					DSCR4_ENST00000398948.1_Missense_Mutation_p.E11K|DSCR8_ENST00000400477.3_5'Flank|DSCR8_ENST00000357704.4_5'Flank	p.E11K	NM_005867.2	NP_005858.1	1	2	3	2.074021	P56555	DSCR4_HUMAN		1	135	-			Q4VB31	Missense_Mutation	SNP	ENST00000328264.3	1	1	hg19	c.31G>A	CCDS33554.1	1	.	.	.	.	.	.	.	.	.	.	C	9.190	1.025771	0.19512	0.0	1.16E-4	ENSG00000184029	ENST00000398948;ENST00000328264	.	.	.	0.235	0.235	0.15431	0.235	0.235	0.15431	.	.	.	.	.	T	0.50786	0.1636	.	.	.	0.09310	N	1	P	0.49696	0.927	P	0.56563	0.801	T	0.40021	-0.9585	6	0.87932	D	0	.	.	.	.	.	11	P56555	DSCR4_HUMAN	K	11	.	ENSP00000328676:E11K	E	-	1	0	0	DSCR4	38415189	38415189	0.016000	0.18221	0.053000	0.19242	0.053000	0.15095	0.305000	0.19254	0.308000	0.22923	0.313000	0.20887	GAA	0.211823		TCGA-2J-AABK-01A-31D-A40W-08	0.498	DSCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000194834.1	1	0	1		2	2	2	0		0	0	26		26	26	1	1.880000	-19.995100	1	0.200000	NM_005867			16	16		166	165	0		1			0	0	26	0		0.999944	0	0	0	0	0	0	16	166
TRAPPC10	7109	broad.mit.edu	37	21	45502791	45502791	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr21:45502791A>G	ENST00000291574.4	+	14	2021	c.1846A>G	c.(1846-1848)Atg>Gtg	p.M616V		NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	616					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						GTACAGCCAGATGCCTGTGCC	0.517																																						ENST00000291574.4	0.210000	0.040000	0.160000	0.070000	0.100000	0.119651	0.100000	0.100000																										0				41						c.(1846-1848)Atg>Gtg		trafficking protein particle complex 10							200.0	167.0	178.0					21																	45502791		2203	4300	6503	SO:0001583	missense	7109	1	121412	33				g.chr21:45502791A>G	U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.1846A>G	chr21.hg19:g.45502791A>G	ENSP00000291574:p.Met616Val	1						p.M616V	NM_003274.4	NP_003265.3	0	1	1	1.851892	P48553	TPC10_HUMAN		14	2021	+			Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Missense_Mutation	SNP	ENST00000291574.4	0	1	hg19	c.1846A>G	CCDS13704.1	0	.	.	.	.	.	.	.	.	.	.	A	15.54	2.864973	0.51482	.	.	ENSG00000160218	ENST00000291574	T	0.41400	1.0	5.58	4.39	0.52855	5.58	4.39	0.52855	.	0.036580	0.85682	D	0.000000	T	0.31827	0.0809	L	0.29908	0.895	0.43069	D	0.994707	P	0.40431	0.717	B	0.38755	0.281	T	0.06643	-1.0815	10	0.44086	T	0.13	.	12.1873	0.54247	0.8569:0.1431:0.0:0.0	.	616	P48553	TPC10_HUMAN	V	616	ENSP00000291574:M616V	ENSP00000291574:M616V	M	+	1	0	0	TRAPPC10	44327219	44327219	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	5.282000	0.65615	0.894000	0.36317	0.533000	0.62120	ATG	0.120879		TCGA-2J-AABK-01A-31D-A40W-08	0.517	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195737.1	0	0	1		2	2	2	0		0	0	118		118	116	1	1.880000	-3.076553	1	0.200000	NM_003274			6	6		517	505	0		1	0		0	0	118	0		0.962561	1.007299e-02	0	0	0	11	0	6	517
COL18A1	80781	broad.mit.edu	37	21	46902721	46902721	+	Missense_Mutation	SNP	G	G	A	rs201476017	byFrequency	TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr21:46902721G>A	ENST00000359759.4	+	14	2953	c.2932G>A	c.(2932-2934)Gcc>Acc	p.A978T	COL18A1_ENST00000400337.2_Missense_Mutation_p.A563T|COL18A1_ENST00000355480.5_Missense_Mutation_p.A743T			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	978	Triple-helical region 3 (COL3).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		TGAAGCAGGCGCCCCAGGACA	0.592													G|||	2	0.000399361	0.0	0.0	5008	,	,		18322	0.0		0.001	False		,,,				2504	0.001					ENST00000359759.4	1.000000	0.490000	0.940000	0.620000	0.770000	0.780327	0.770000	1.000000																										0				25						c.(2932-2934)Gcc>Acc		collagen, type XVIII, alpha 1		G	THR/ALA,THR/ALA	0,4088		0,0,2044	121.0	128.0	126.0		2227,1687	-1.6	0.1	21		126	6,8364		0,6,4179	yes	missense,missense	COL18A1	NM_030582.3,NM_130445.2	58,58	0,6,6223	AA,AG,GG		0.0717,0.0,0.0482	probably-damaging,probably-damaging	743/1520,563/1340	46902721	6,12452	2044	4185	6229	SO:0001583	missense	80781	43	120984	47				g.chr21:46902721G>A		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.2932G>A	chr21.hg19:g.46902721G>A	ENSP00000352798:p.Ala978Thr	1					COL18A1_ENST00000355480.5_Missense_Mutation_p.A743T|COL18A1_ENST00000400337.2_Missense_Mutation_p.A563T	p.A978T			0	1	1	1.851892	P39060	COIA1_HUMAN		14	2953	+			A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	1	1	hg19	c.2932G>A		0	.	.	.	.	.	.	.	.	.	.	G	11.05	1.524339	0.27299	0.0	7.17E-4	ENSG00000182871	ENST00000400337;ENST00000355480;ENST00000359759	D;D;D	0.94232	-3.23;-3.38;-3.38	2.62	-1.63	0.08345	2.62	-1.63	0.08345	.	.	.	.	.	D	0.84483	0.5482	L	0.37850	1.14	0.21386	N	0.999707	B;B;B	0.24576	0.106;0.086;0.086	B;B;B	0.13407	0.009;0.005;0.005	T	0.69007	-0.5259	9	0.12766	T	0.61	.	3.4304	0.07426	0.4039:0.205:0.3911:0.0	.	978;743;563	P39060;P39060-1;P39060-2	COIA1_HUMAN;.;.	T	563;743;978	ENSP00000383191:A563T;ENSP00000347665:A743T;ENSP00000352798:A978T	ENSP00000347665:A743T	A	+	1	0	0	COL18A1	45727149	45727149	0.002000	0.14202	0.122000	0.21767	0.049000	0.14656	0.305000	0.19254	-0.414000	0.07495	0.549000	0.68633	GCC	0.120879		TCGA-2J-AABK-01A-31D-A40W-08	0.592	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1	0	0	1		2	2	2	0		0	0	32		32	32	1	1.880000	-3.221877	1	0.200000				19	19		198	194	0		1	1		0	0	32	0		0.999991	9.989867e-01	0	5	0	114	0	19	198
PICK1	9463	broad.mit.edu	37	22	38470363	38470363	+	Missense_Mutation	SNP	G	G	C			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr22:38470363G>C	ENST00000404072.3	+	12	1231	c.884G>C	c.(883-885)cGc>cCc	p.R295P	RP5-1039K5.13_ENST00000445483.1_RNA|PICK1_ENST00000356976.3_Missense_Mutation_p.R295P	NM_001039583.1|NM_001039584.1	NP_001034672.1|NP_001034673.1	Q9NRD5	PICK1_HUMAN	protein interacting with PRKCA 1	295	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				ATP catabolic process (GO:0006200)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|dendritic spine maintenance (GO:0097062)|dendritic spine organization (GO:0097061)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|glial cell development (GO:0021782)|long term synaptic depression (GO:0060292)|monoamine transport (GO:0015844)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|neuronal ion channel clustering (GO:0045161)|positive regulation of receptor internalization (GO:0002092)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|protein targeting (GO:0006605)|receptor clustering (GO:0043113)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endocytic vesicle membrane (GO:0030666)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein kinase C binding (GO:0005080)|receptor binding (GO:0005102)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	Melanoma(58;0.045)					TATGAGTACCGCCTGATCCTG	0.682											OREG0026555	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000404072.3	0.560000	0.100000	0.420000	0.170000	0.280000	0.302552	0.280000	0.250000																										0				13						c.(883-885)cGc>cCc		protein interacting with PRKCA 1							30.0	33.0	32.0					22																	38470363		2202	4298	6500	SO:0001583	missense	9463	0	0					g.chr22:38470363G>C	AL049654	CCDS13965.1	22q13.1	2006-02-14	2006-02-14	2006-02-14	ENSG00000100151	ENSG00000100151			9394	protein-coding gene	gene with protein product		605926	"""protein kinase C, alpha binding protein"", ""protein interacting with PRKCA"""	PRKCABP		10340301, 10591208	Standard	XM_006724377		Approved	dJ1039K5, MGC15204	uc003aus.3	Q9NRD5	OTTHUMG00000151159	ENST00000404072.3:c.884G>C	chr22.hg19:g.38470363G>C	ENSP00000385205:p.Arg295Pro	0		OREG0026555	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	878	PICK1_ENST00000356976.3_Missense_Mutation_p.R295P|RP5-1039K5.13_ENST00000445483.1_RNA	p.R295P	NM_001039583.1|NM_001039584.1	NP_001034672.1|NP_001034673.1	0	0	0	2.011383	Q9NRD5	PICK1_HUMAN		12	1231	+	Melanoma(58;0.045)		B3KS52|O95906	Missense_Mutation	SNP	ENST00000404072.3	0	1	hg19	c.884G>C	CCDS13965.1	0	.	.	.	.	.	.	.	.	.	.	G	32	5.137385	0.94517	.	.	ENSG00000100151	ENST00000404072;ENST00000356976	T;T	0.80393	-1.37;-1.37	4.57	4.57	0.56435	4.57	4.57	0.56435	Arfaptin-like (3);	0.000000	0.85682	D	0.000000	D	0.90669	0.7073	M	0.85299	2.745	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92404	0.5932	10	0.72032	D	0.01	-16.2978	17.7234	0.88358	0.0:0.0:1.0:0.0	.	295	Q9NRD5	PICK1_HUMAN	P	295	ENSP00000385205:R295P;ENSP00000349465:R295P	ENSP00000349465:R295P	R	+	2	0	0	PICK1	36800309	36800309	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.159000	0.77483	2.251000	0.74343	0.563000	0.77884	CGC	0.191919		TCGA-2J-AABK-01A-31D-A40W-08	0.682	PICK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321569.2	0	0	1		2	2	2	0		0	0	38		38	38	1	1.880000	-6.904693	1	0.200000	NM_012407			5	5		185	176	0		1	1		0	0	38	0		0.930082	7.879793e-01	0	2	0	106	0	5	185
BIRC6	57448	broad.mit.edu	37	2	32774494	32774494	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr2:32774494C>T	ENST00000421745.2	+	65	13224	c.13090C>T	c.(13090-13092)Ctc>Ttc	p.L4364F		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4364					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TCTCGAGCTTCTCAGTCAGTC	0.433																																					Pancreas(94;175 1509 16028 18060 45422)	ENST00000421745.2	1.000000	0.690000	1.000000	0.800000	0.930000	0.913968	0.930000	1.000000																										0				172						c.(13090-13092)Ctc>Ttc		baculoviral IAP repeat containing 6							141.0	129.0	133.0					2																	32774494		2203	4300	6503	SO:0001583	missense	57448	0	0					g.chr2:32774494C>T	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.13090C>T	chr2.hg19:g.32774494C>T	ENSP00000393596:p.Leu4364Phe	0						p.L4364F	NM_016252.3	NP_057336	1	2	3	2.028219	Q9NR09	BIRC6_HUMAN		65	13224	+	Acute lymphoblastic leukemia(172;0.155)		Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	1	1	hg19	c.13090C>T	CCDS33175.2	1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.288897	0.80914	.	.	ENSG00000115760	ENST00000421745	D	0.84730	-1.89	5.67	5.67	0.87782	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.92231	0.7536	M	0.71581	2.175	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	D	0.92385	0.5916	10	0.72032	D	0.01	.	19.7806	0.96414	0.0:1.0:0.0:0.0	.	4364	Q9NR09	BIRC6_HUMAN	F	4364	ENSP00000393596:L4364F	ENSP00000393596:L4364F	L	+	1	0	0	BIRC6	32627998	32627998	1.000000	0.71417	0.998000	0.56505	0.524000	0.34500	7.818000	0.86416	2.669000	0.90835	0.650000	0.86243	CTC	0.203187		TCGA-2J-AABK-01A-31D-A40W-08	0.433	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	1	0	1		2	2	2	0		0	0	74		74	71	1	1.880000	-3.318794	1	0.200000	NM_016252			43	42		420	412	1		1	1		0	0	74	0		1.000000	9.821971e-01	0	15	0	49	0	43	420
CEBPZ	10153	broad.mit.edu	37	2	37455921	37455921	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr2:37455921C>T	ENST00000234170.5	-	2	560	c.415G>A	c.(415-417)Gtg>Atg	p.V139M	NDUFAF7_ENST00000002125.4_5'Flank|NDUFAF7_ENST00000336237.6_5'Flank	NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	139					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				TTATTTTTCACCTTATTAACT	0.313																																						ENST00000234170.5	1.000000	0.540000	0.890000	0.640000	0.750000	0.768619	0.750000	0.750000																										0				28						c.(415-417)Gtg>Atg		CCAAT/enhancer binding protein (C/EBP), zeta							129.0	128.0	128.0					2																	37455921		2203	4299	6502	SO:0001583	missense	10153	0	0					g.chr2:37455921C>T	M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.415G>A	chr2.hg19:g.37455921C>T	ENSP00000234170:p.Val139Met	0					NDUFAF7_ENST00000336237.6_5'Flank|NDUFAF7_ENST00000002125.4_5'Flank	p.V139M	NM_005760.2	NP_005751.2	1	2	3	2.028219	Q03701	CEBPZ_HUMAN		2	560	-		all_hematologic(82;0.21)	Q8NE75	Missense_Mutation	SNP	ENST00000234170.5	1	1	hg19	c.415G>A	CCDS1787.1	0	.	.	.	.	.	.	.	.	.	.	C	0.436	-0.901015	0.02472	.	.	ENSG00000115816	ENST00000234170;ENST00000545744;ENST00000446769	T;T	0.02498	4.27;4.27	5.32	2.46	0.29980	5.32	2.46	0.29980	.	1.732560	0.02990	N	0.146738	T	0.04679	0.0127	L	0.54323	1.7	0.09310	N	1	B	0.33073	0.396	B	0.25987	0.065	T	0.42531	-0.9446	10	0.87932	D	0	.	7.308	0.26459	0.0:0.5701:0.0:0.4299	.	139	Q03701	CEBPZ_HUMAN	M	139;139;90	ENSP00000234170:V139M;ENSP00000391881:V90M	ENSP00000234170:V139M	V	-	1	0	0	CEBPZ	37309425	37309425	0.000000	0.05858	0.220000	0.23810	0.024000	0.10985	0.321000	0.19558	0.208000	0.20626	0.655000	0.94253	GTG	0.203187		TCGA-2J-AABK-01A-31D-A40W-08	0.313	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218569.2	1	0	1		2	2	2	0		0	0	121		121	119	1	1.880000	-9.910969	1	0.200000	NM_005760			38	37		469	465	0		1	1		0	0	121	0		1.000000	5.066188e-01	0	2	0	20	0	38	469
USP39	10713	broad.mit.edu	37	2	85857980	85857980	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr2:85857980C>T	ENST00000323701.6	+	6	870	c.860C>T	c.(859-861)cCt>cTt	p.P287L	USP39_ENST00000409470.1_Missense_Mutation_p.P287L|USP39_ENST00000409766.3_Missense_Mutation_p.P287L|USP39_ENST00000450066.2_Missense_Mutation_p.P184L|USP39_ENST00000409025.1_Missense_Mutation_p.P287L|USP39_ENST00000459775.1_3'UTR	NM_006590.3	NP_006581.2	Q53GS9	SNUT2_HUMAN	ubiquitin specific peptidase 39	287	USP.				cell cycle (GO:0007049)|cell division (GO:0051301)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|ubiquitin-dependent protein catabolic process (GO:0006511)	spliceosomal complex (GO:0005681)	ubiquitinyl hydrolase activity (GO:0036459)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	19						CTCTGGAACCCTCGAAATTTC	0.438																																						ENST00000323701.6	1.000000	0.500000	0.820000	0.590000	0.690000	0.708958	0.690000	0.690000																										0				19						c.(859-861)cCt>cTt		ubiquitin specific peptidase 39							154.0	155.0	154.0					2																	85857980		2203	4300	6503	SO:0001583	missense	10713	0	0					g.chr2:85857980C>T	AF132955	CCDS33234.1, CCDS58716.1, CCDS58717.1, CCDS74534.1	2p11.2	2009-01-06	2005-08-08		ENSG00000168883	ENSG00000168883		"""Ubiquitin-specific peptidases"""	20071	protein-coding gene	gene with protein product	"""snRNP assembly defective 1 homolog (S.cerevisiae)"", ""small nuclear ribonucleoprotein 65kDa (U4/U6.U5)"""	611594	"""ubiquitin specific protease 39"""			12838346	Standard	NM_006590		Approved	SAD1, CGI-21, SNRNP65	uc002sqg.4	Q53GS9	OTTHUMG00000153090	ENST00000323701.6:c.860C>T	chr2.hg19:g.85857980C>T	ENSP00000312981:p.Pro287Leu	0					USP39_ENST00000409766.3_Missense_Mutation_p.P287L|USP39_ENST00000450066.2_Missense_Mutation_p.P184L|USP39_ENST00000409470.1_Missense_Mutation_p.P287L|USP39_ENST00000409025.1_Missense_Mutation_p.P287L|USP39_ENST00000459775.1_3'UTR	p.P287L	NM_006590.3	NP_006581.2	1	2	3	2.028219	Q53GS9	SNUT2_HUMAN		6	870	+			A8K086|B3KM40|B4DHT4|D6W5L4|G5E9H0|Q6NX47|Q96RK9|Q9BV89|Q9H381|Q9P050|Q9Y310	Missense_Mutation	SNP	ENST00000323701.6	1	1	hg19	c.860C>T	CCDS33234.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.190236	0.94923	.	.	ENSG00000168883	ENST00000450066;ENST00000409268;ENST00000409025;ENST00000409470;ENST00000323701;ENST00000409766	T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54	5.97	5.97	0.96955	5.97	5.97	0.96955	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.68100	0.2964	H	0.94734	3.575	0.80722	D	1	D;P;D;D;D;D	0.89917	0.986;0.954;0.998;0.999;1.0;0.993	P;D;D;D;D;D	0.79784	0.898;0.934;0.971;0.991;0.993;0.943	T	0.76337	-0.2996	10	0.72032	D	0.01	-7.7009	17.9074	0.88923	0.0:1.0:0.0:0.0	.	184;209;287;287;287;287	B4DHT4;B7Z7L9;G5E9H0;B3KM40;B9A018;Q53GS9	.;.;.;.;.;SNUT2_HUMAN	L	184;287;287;287;287;287	ENSP00000396133:P184L;ENSP00000386572:P287L;ENSP00000386864:P287L;ENSP00000312981:P287L;ENSP00000386803:P287L	ENSP00000312981:P287L	P	+	2	0	0	USP39	85711491	85711491	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.390000	0.79816	2.835000	0.97688	0.591000	0.81541	CCT	0.203187		TCGA-2J-AABK-01A-31D-A40W-08	0.438	USP39-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329892.1	1	0	1		2	2	2	0		0	0	137		137	137	1	1.880000	-2.920851	1	0.200000	NM_006590			41	41		555	550	1		1	1		0	0	137	0		1.000000	9.807415e-01	0	18	0	68	0	41	555
NBEAL2	23218	broad.mit.edu	37	3	47041634	47041634	+	Missense_Mutation	SNP	C	C	G			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr3:47041634C>G	ENST00000450053.3	+	27	4224	c.4045C>G	c.(4045-4047)Ctc>Gtc	p.L1349V	NBEAL2_ENST00000292309.5_Intron|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1349					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		TTACCATGCTCTCTCCCCATT	0.607																																						ENST00000450053.3	0.580000	0.270000	0.500000	0.330000	0.400000	0.419112	0.400000	0.410000																										0				51						c.(4045-4047)Ctc>Gtc		neurobeachin-like 2							141.0	149.0	146.0					3																	47041634		2093	4221	6314	SO:0001583	missense	23218	1	121090	33				g.chr3:47041634C>G	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.4045C>G	chr3.hg19:g.47041634C>G	ENSP00000415034:p.Leu1349Val	0					NBEAL2_ENST00000383740.2_5'UTR|NBEAL2_ENST00000292309.5_Intron	p.L1349V	NM_015175.2	NP_055990.1	0	0	0	1.918343	Q6ZNJ1	NBEL2_HUMAN		27	4224	+		Acute lymphoblastic leukemia(5;0.0534)	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	1	1	hg19	c.4045C>G	CCDS46817.1	0	.	.	.	.	.	.	.	.	.	.	C	21.4	4.150562	0.78001	.	.	ENSG00000160796	ENST00000450053	T	0.57436	0.4	5.48	4.61	0.57282	5.48	4.61	0.57282	.	.	.	.	.	T	0.44393	0.1291	L	0.55481	1.735	0.80722	D	1	P	0.48764	0.915	B	0.36959	0.237	T	0.46317	-0.9200	9	0.46703	T	0.11	.	11.9191	0.52781	0.0:0.9153:0.0:0.0847	.	1349	Q6ZNJ1	NBEL2_HUMAN	V	1349	ENSP00000415034:L1349V	ENSP00000415034:L1349V	L	+	1	0	0	NBEAL2	47016638	47016638	0.957000	0.32711	0.784000	0.31847	0.955000	0.61496	2.363000	0.44178	1.320000	0.45209	0.561000	0.74099	CTC	0.152542		TCGA-2J-AABK-01A-31D-A40W-08	0.607	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	1	0	1		2	2	2	0		0	0	120		120	117	1	1.880000	-3.234949	1	0.200000	XM_291064			25	25		553	543	1		1	1		0	0	120	0		1.000000	8.044325e-01	0	9	0	60	0	25	553
WDR6	11180	broad.mit.edu	37	3	49049685	49049685	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr3:49049685G>A	ENST00000608424.1	+	2	757	c.718G>A	c.(718-720)Gac>Aac	p.D240N	WDR6_ENST00000448293.1_Missense_Mutation_p.D189N|WDR6_ENST00000489684.1_3'UTR|WDR6_ENST00000395474.3_Missense_Mutation_p.D270N|WDR6_ENST00000415265.2_Intron			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	240					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		GAAGGTGGGCGACCTGCGAGT	0.552																																						ENST00000608424.1	1.000000	0.780000	1.000000	0.890000	0.990000	0.963261	0.990000	1.000000																										0				26						c.(718-720)Gac>Aac		WD repeat domain 6							89.0	92.0	91.0					3																	49049685		2203	4300	6503	SO:0001583	missense	11180	0	0					g.chr3:49049685G>A	AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.718G>A	chr3.hg19:g.49049685G>A	ENSP00000477389:p.Asp240Asn	0					WDR6_ENST00000415265.2_Intron|WDR6_ENST00000489684.1_3'UTR|WDR6_ENST00000395474.3_Missense_Mutation_p.D270N|WDR6_ENST00000448293.1_Missense_Mutation_p.D189N	p.D240N			0	0	0	1.918343	Q9NNW5	WDR6_HUMAN		2	757	+			B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	ENST00000608424.1	1	1	hg19	c.718G>A		1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.491437	0.44249	.	.	ENSG00000178252	ENST00000395474;ENST00000448293	T;D	0.93953	-0.13;-3.32	5.32	5.32	0.75619	5.32	5.32	0.75619	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.190971	0.47455	D	0.000227	D	0.85279	0.5660	L	0.38531	1.155	0.35719	D	0.817028	P;P;B	0.40107	0.703;0.703;0.266	B;B;B	0.20384	0.029;0.029;0.019	D	0.86499	0.1802	10	0.17369	T	0.5	-34.5279	12.2959	0.54847	0.0827:0.0:0.9173:0.0	.	111;240;189	B4DK45;Q9NNW5;E9PDU5	.;WDR6_HUMAN;.	N	270;189	ENSP00000378857:D270N;ENSP00000413432:D189N	ENSP00000378857:D270N	D	+	1	0	0	WDR6	49024689	49024689	0.998000	0.40836	0.997000	0.53966	0.973000	0.67179	3.303000	0.51858	2.650000	0.89964	0.561000	0.74099	GAC	0.152542		TCGA-2J-AABK-01A-31D-A40W-08	0.552	WDR6-024	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471652.1	1	0	1		2	2	2	0		0	0	78		78	74	1	1.880000	-18.181600	1	0.200000				53	52		432	430	1		1	1		0	0	78	0		1.000000	9.999159e-01	0	6	0	107	0	53	432
WNT5A	7474	broad.mit.edu	37	3	55508430	55508430	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr3:55508430C>T	ENST00000474267.1	-	5	1140	c.619G>A	c.(619-621)Gcc>Acc	p.A207T	WNT5A_ENST00000264634.4_Missense_Mutation_p.A207T|WNT5A_ENST00000497027.1_Missense_Mutation_p.A192T			P41221	WNT5A_HUMAN	wingless-type MMTV integration site family, member 5A	207					activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|ameboidal cell migration (GO:0001667)|anterior/posterior axis specification, embryo (GO:0008595)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular protein localization (GO:0034613)|cellular response to calcium ion (GO:0071277)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cervix development (GO:0060067)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|dopaminergic neuron differentiation (GO:0071542)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system development (GO:0048706)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity (GO:0001736)|face development (GO:0060324)|genitalia development (GO:0048806)|heart looping (GO:0001947)|hematopoietic stem cell proliferation (GO:0071425)|hindgut morphogenesis (GO:0007442)|hypophysis morphogenesis (GO:0048850)|keratinocyte differentiation (GO:0030216)|lateral sprouting involved in mammary gland duct morphogenesis (GO:0060599)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|male gonad development (GO:0008584)|mammary gland branching involved in thelarche (GO:0060744)|mesenchymal-epithelial cell signaling (GO:0060638)|midgut development (GO:0007494)|negative chemotaxis (GO:0050919)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of synapse assembly (GO:0051964)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|olfactory bulb interneuron development (GO:0021891)|optic cup formation involved in camera-type eye development (GO:0003408)|palate development (GO:0060021)|planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:0061350)|planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:0061349)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar cell polarity pathway involved in outflow tract morphogenesis (GO:0061347)|planar cell polarity pathway involved in pericardium morphogenesis (GO:0061354)|planar cell polarity pathway involved in ventricular septum morphogenesis (GO:0061348)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of meiosis (GO:0045836)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ossification (GO:0045778)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of response to cytokine stimulus (GO:0060760)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|protein phosphorylation (GO:0006468)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|response to organic substance (GO:0010033)|somitogenesis (GO:0001756)|type B pancreatic cell development (GO:0003323)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vagina development (GO:0060068)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|wound healing (GO:0042060)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor tyrosine kinase-like orphan receptor binding (GO:0005115)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(1)|large_intestine(4)|lung(3)|prostate(2)|urinary_tract(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.00377)|Kidney(284;0.00408)|OV - Ovarian serous cystadenocarcinoma(275;0.204)		GAGCCCTTGGCGTGGATGCGC	0.682																																						ENST00000474267.1	0.660000	0.100000	0.490000	0.190000	0.310000	0.347378	0.310000	0.280000																										0				13						c.(619-621)Gcc>Acc		wingless-type MMTV integration site family, member 5A							20.0	27.0	25.0					3																	55508430		2170	4286	6456	SO:0001583	missense	7474	0	0					g.chr3:55508430C>T	L20861	CCDS46850.1, CCDS58835.1	3p21-p14	2013-02-28			ENSG00000114251	ENSG00000114251		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12784	protein-coding gene	gene with protein product	"""WNT-5A protein"""	164975				8288227	Standard	NM_001256105		Approved	hWNT5A	uc010hmw.4	P41221	OTTHUMG00000158361	ENST00000474267.1:c.619G>A	chr3.hg19:g.55508430C>T	ENSP00000417310:p.Ala207Thr	0					WNT5A_ENST00000264634.4_Missense_Mutation_p.A207T|WNT5A_ENST00000497027.1_Missense_Mutation_p.A192T	p.A207T			0	0	0	1.918343	P41221	WNT5A_HUMAN		5	1140	-			A8K4A4|Q6P278	Missense_Mutation	SNP	ENST00000474267.1	0	1	hg19	c.619G>A	CCDS46850.1	0	.	.	.	.	.	.	.	.	.	.	C	16.77	3.216001	0.58452	.	.	ENSG00000114251	ENST00000474267;ENST00000264634;ENST00000536765;ENST00000497027;ENST00000482079	T;T;T;D	0.84660	-1.03;-1.03;-1.02;-1.88	4.84	3.82	0.43975	4.84	3.82	0.43975	.	0.329686	0.32987	N	0.005409	T	0.74053	0.3666	L	0.38838	1.175	0.31722	N	0.6382	B	0.06786	0.001	B	0.06405	0.002	T	0.66097	-0.6008	10	0.18710	T	0.47	.	7.1809	0.25772	0.203:0.4728:0.3242:0.0	.	207	P41221	WNT5A_HUMAN	T	207;207;118;192;192	ENSP00000417310:A207T;ENSP00000264634:A207T;ENSP00000420104:A192T;ENSP00000418184:A192T	ENSP00000264634:A207T	A	-	1	0	0	WNT5A	55483470	55483470	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.044000	0.49830	2.387000	0.81309	0.557000	0.71058	GCC	0.152542		TCGA-2J-AABK-01A-31D-A40W-08	0.682	WNT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350793.3	0	0	1		2	2	2	0		0	0	16		16	15	1	1.880000	-6.866657	1	0.200000	NM_003392			4	4		124	122	0		1	0		0	0	16	0		0.887835	5.097955e-03	0	0	0	3	0	4	124
COL6A6	131873	broad.mit.edu	37	3	130354557	130354557	+	Silent	SNP	C	C	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr3:130354557C>T	ENST00000358511.6	+	27	5074	c.5043C>T	c.(5041-5043)gaC>gaT	p.D1681D	COL6A6_ENST00000453409.2_Silent_p.D1681D	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1681	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						AGATTGGGGACCCTGGTGGTC	0.373																																						ENST00000358511.6	1.000000	0.290000	0.800000	0.420000	0.590000	0.617686	0.590000	1.000000																										0				134						c.(5041-5043)gaC>gaT		collagen, type VI, alpha 6							79.0	81.0	80.0					3																	130354557		1851	4083	5934	SO:0001819	synonymous_variant	131873	0	0					g.chr3:130354557C>T	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.5043C>T	chr3.hg19:g.130354557C>T		0					COL6A6_ENST00000453409.2_Silent_p.D1681D	p.D1681D	NM_001102608.1	NP_001096078.1	0	0	0	1.976050	A6NMZ7	CO6A6_HUMAN		27	5074	+			A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Silent	SNP	ENST00000358511.6	0	1	hg19	c.5043C>T	CCDS46911.1	0																																																																																								0.178645		TCGA-2J-AABK-01A-31D-A40W-08	0.373	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	1	0	1		2	2	2	0		0	0	17		17	17	1	1.880000	-12.771620	1	0.200000	NM_001102608			9	9		141	140	0		1			0	0	17	0		0.994502	0	0	0	0	0	0	9	141
CRMP1	1400	broad.mit.edu	37	4	5837708	5837708	+	Silent	SNP	C	C	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr4:5837708C>T	ENST00000397890.2	-	11	1429	c.1215G>A	c.(1213-1215)tcG>tcA	p.S405S	CRMP1_ENST00000324989.7_Silent_p.S519S|CRMP1_ENST00000512574.1_Silent_p.S403S|CRMP1_ENST00000511535.1_5'UTR	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	405					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.S519S(1)		NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CGTCGGCATCCGAGCCCACGG	0.522																																						ENST00000397890.2	0.200000	0.030000	0.150000	0.050000	0.090000	0.107454	0.090000	0.090000																										1	Substitution - coding silent(1)	p.S519S(1)	stomach(1)	36						c.(1213-1215)tcG>tcA		collapsin response mediator protein 1							149.0	135.0	140.0					4																	5837708		2203	4300	6503	SO:0001819	synonymous_variant	1400	0	0					g.chr4:5837708C>T	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.1215G>A	chr4.hg19:g.5837708C>T		0					CRMP1_ENST00000512574.1_Silent_p.S403S|CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000324989.7_Silent_p.S519S	p.S405S	NM_001313.3	NP_001304.1	0	0	0	1.949948	Q14194	DPYL1_HUMAN		11	1429	-			A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	ENST00000397890.2	0	1	hg19	c.1215G>A	CCDS43207.1	0																																																																																								0.166667		TCGA-2J-AABK-01A-31D-A40W-08	0.522	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358871.1	0	0	1		2	2	2	0		0	0	110		110	105	1	1.880000	-2.496906	0	0.200000	NM_001313			5	6		524	506	0		1	0		0	0	110	0		0.932291	4.643201e-02	0	0	0	29	0	5	524
KIAA1211	57482	broad.mit.edu	37	4	57193838	57193838	+	Silent	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr4:57193838G>A	ENST00000504228.1	+	9	3675	c.3570G>A	c.(3568-3570)gcG>gcA	p.A1190A	KIAA1211_ENST00000541073.1_Silent_p.A1183A|KIAA1211_ENST00000264229.6_Silent_p.A1190A			Q6ZU35	K1211_HUMAN	KIAA1211	1190										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CTCCCCCAGCGCCGCTGGTAA	0.483																																						ENST00000504228.1	0.200000	0.050000	0.160000	0.080000	0.110000	0.123867	0.110000	0.110000																										0				65						c.(3568-3570)gcG>gcA		KIAA1211							89.0	94.0	92.0					4																	57193838		1821	4085	5906	SO:0001819	synonymous_variant	57482	2	120800	35				g.chr4:57193838G>A	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.3570G>A	chr4.hg19:g.57193838G>A		0					KIAA1211_ENST00000264229.6_Silent_p.A1190A|KIAA1211_ENST00000541073.1_Silent_p.A1183A	p.A1190A			0	0	0	1.949948	Q6ZU35	K1211_HUMAN		9	3675	+	Glioma(25;0.08)|all_neural(26;0.101)		Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	ENST00000504228.1	0	1	hg19	c.3570G>A	CCDS43230.1	0																																																																																								0.166667		TCGA-2J-AABK-01A-31D-A40W-08	0.483	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	0	0	1		2	2	2	0		0	0	99		99	99	1	1.880000	-2.598773	1	0.200000	NM_020722			9	9		759	743	0		1	0		0	0	99	0		0.993665	2.400753e-02	0	0	0	18	0	9	759
PCDHGA8	9708	broad.mit.edu	37	5	140773115	140773115	+	Silent	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr5:140773115G>A	ENST00000398604.2	+	1	735	c.735G>A	c.(733-735)ccG>ccA	p.P245P	PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	245	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCCTCACCCGATTTACCGAG	0.567																																						ENST00000398604.2	0.280000	0.080000	0.230000	0.110000	0.160000	0.176282	0.160000	0.160000																										0				51						c.(733-735)ccG>ccA		protocadherin gamma subfamily A, 8							80.0	85.0	83.0					5																	140773115		2032	4199	6231	SO:0001819	synonymous_variant	9708	0	0					g.chr5:140773115G>A	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.735G>A	chr5.hg19:g.140773115G>A		0					PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron	p.P245P	NM_032088.1	NP_114477.1	0	0	0	1.949583	Q9Y5G5	PCDG8_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	735	+			A7MCZ4|O15039	Silent	SNP	ENST00000398604.2	0	1	hg19	c.735G>A	CCDS47291.1	0																																																																																								0.166667		TCGA-2J-AABK-01A-31D-A40W-08	0.567	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	0	0	1		2	2	2	0		0	0	116		116	112	1	1.880000	-2.500870	1	0.200000	NM_032088			10	10		582	573	0		1			0	0	116	0		0.996672	0	0	0	0	0	0	10	582
ANKRD34B	340120	broad.mit.edu	37	5	79854551	79854551	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr5:79854551G>A	ENST00000338682.3	-	5	1960	c.1288C>T	c.(1288-1290)Cga>Tga	p.R430*		NM_001004441.2	NP_001004441.2	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	430						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	28		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		CCTGAACCTCGCCTTTCTAAA	0.468																																						ENST00000338682.3	0.540000	0.200000	0.450000	0.270000	0.350000	0.365047	0.350000	0.340000																										0				28						c.(1288-1290)Cga>Tga		ankyrin repeat domain 34B							109.0	115.0	113.0					5																	79854551		2203	4300	6503	SO:0001587	stop_gained	340120	0	0					g.chr5:79854551G>A		CCDS34194.1	5q14.1	2014-08-12			ENSG00000189127	ENSG00000189127		"""Ankyrin repeat domain containing"""	33736	protein-coding gene	gene with protein product							Standard	NM_001004441		Approved	DP58	uc003kgw.3	A5PLL1	OTTHUMG00000162541	ENST00000338682.3:c.1288C>T	chr5.hg19:g.79854551G>A	ENSP00000339802:p.Arg430*	0						p.R430*	NM_001004441.2	NP_001004441.2	0	0	0	1.949583	A5PLL1	AN34B_HUMAN		5	1960	-		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)	B2RPH1|Q68D79	Nonsense_Mutation	SNP	ENST00000338682.3	0	1	hg19	c.1288C>T	CCDS34194.1	0	.	.	.	.	.	.	.	.	.	.	G	40	8.135039	0.98670	.	.	ENSG00000189127	ENST00000338682	.	.	.	6.04	6.04	0.98038	6.04	6.04	0.98038	.	0.000000	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.0151	15.5464	0.76104	0.0:0.1383:0.8617:0.0	.	.	.	.	X	430	.	ENSP00000339802:R430X	R	-	1	2	2	ANKRD34B	79890307	79890307	1.000000	0.71417	0.998000	0.56505	0.154000	0.21943	2.812000	0.47994	2.873000	0.98535	0.563000	0.77884	CGA	0.166667		TCGA-2J-AABK-01A-31D-A40W-08	0.468	ANKRD34B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369475.1	0	0	1		2	2	2	0		0	0	97		97	93	1	1.880000	-3.132744	1	0.200000	NM_001004441			16	16		424	418	0		1			0	0	97	0		0.999927	0	0	0	0	0	0	16	424
PROP1	5626	broad.mit.edu	37	5	177421284	177421284	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr5:177421284C>A	ENST00000308304.2	-	2	473	c.165G>T	c.(163-165)agG>agT	p.R55S		NM_006261.4	NP_006252	O75360	PROP1_HUMAN	PROP paired-like homeobox 1	55					blood vessel development (GO:0001568)|canonical Wnt signaling pathway (GO:0060070)|cell migration (GO:0016477)|central nervous system development (GO:0007417)|dorsal/ventral pattern formation (GO:0009953)|hypophysis morphogenesis (GO:0048850)|hypothalamus cell differentiation (GO:0021979)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatotropin secreting cell differentiation (GO:0060126)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(9)|stomach(1)	13	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCGGGGAGAACCTTGATCTCC	0.662																																						ENST00000308304.2	1.000000	0.610000	1.000000	0.820000	0.990000	0.939087	0.990000	1.000000																										0				13						c.(163-165)agG>agT		PROP paired-like homeobox 1							23.0	24.0	24.0					5																	177421284		2199	4299	6498	SO:0001583	missense	5626	0	0					g.chr5:177421284C>A	AF076215	CCDS4430.1	5q35.3	2011-06-20	2007-07-12		ENSG00000175325	ENSG00000175325		"""Homeoboxes / PRD class"""	9455	protein-coding gene	gene with protein product		601538	"""prophet of Pit1, paired-like homeodomain transcription factor"""			9462743	Standard	NM_006261		Approved		uc003mif.1	O75360	OTTHUMG00000130887	ENST00000308304.2:c.165G>T	chr5.hg19:g.177421284C>A	ENSP00000311290:p.Arg55Ser	0						p.R55S	NM_006261.4	NP_006252	0	0	0	1.949583	O75360	PROP1_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	2	473	-	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)		Missense_Mutation	SNP	ENST00000308304.2	0	1	hg19	c.165G>T	CCDS4430.1	1	.	.	.	.	.	.	.	.	.	.	.	7.946	0.743725	0.15642	.	.	ENSG00000175325	ENST00000308304	D	0.89123	-2.47	2.49	-1.51	0.08664	2.49	-1.51	0.08664	Homeodomain-related (1);	0.319443	0.22765	N	0.055904	T	0.69860	0.3158	L	0.29908	0.895	0.09310	N	1	P	0.39480	0.675	B	0.28553	0.091	T	0.66380	-0.5938	10	0.10377	T	0.69	-4.9502	2.364	0.04314	0.2286:0.369:0.0:0.4024	.	55	O75360	PROP1_HUMAN	S	55	ENSP00000311290:R55S	ENSP00000311290:R55S	R	-	3	2	2	PROP1	177353890	177353890	0.000000	0.05858	0.001000	0.08648	0.209000	0.24338	0.413000	0.21148	-0.354000	0.08212	0.306000	0.20318	AGG	0.166667		TCGA-2J-AABK-01A-31D-A40W-08	0.662	PROP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253472.1	1	0	1		2	2	2	0		0	0	14		14	14	1	1.880000	-19.550380	1	0.200000	NM_006261			12	11		91	90	0		1			0	0	14	0		0.999220	0	0	0	0	0	0	12	91
VARS	7407	broad.mit.edu	37	6	31752372	31752372	+	Splice_Site	SNP	C	C	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr6:31752372C>T	ENST00000375663.3	-	11	1907	c.1467G>A	c.(1465-1467)gaG>gaA	p.E489E	VARS_ENST00000444930.2_Splice_Site_p.E194E|VARS_ENST00000482996.1_5'Flank	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	489					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	GGGGGCGCACCTCAATGTCAG	0.582																																						ENST00000375663.3	0.700000	0.250000	0.580000	0.330000	0.440000	0.462719	0.440000	0.440000																										0				30						c.(1465-1467)gaG>gaA		valyl-tRNA synthetase	L-Valine(DB00161)						89.0	76.0	80.0					6																	31752372		1511	2709	4220	SO:0001630	splice_region_variant	7407	1	121292	33				g.chr6:31752372C>T	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.1467+1G>A	chr6.hg19:g.31752372C>T		0					VARS_ENST00000482996.1_5'Flank|VARS_ENST00000444930.2_Splice_Site_p.E194E	p.E489E	NM_006295.2	NP_006286.1	0	0	0	1.941004	P26640	SYVC_HUMAN		11	1907	-			B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Splice_Site	SNP	ENST00000375663.3	1	0	hg19	c.1467G>A	CCDS34412.1	0																																																																																								0.163180		TCGA-2J-AABK-01A-31D-A40W-08	0.582	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	1	0	1		2	2	2	0		0	0	46		46	46	1	1.880000	-3.705078	1	0.200000	NM_006295	Silent		13	13		269	261	0		1	1		0	0	46	0		0.999464	8.789927e-01	0	5	0	75	0	13	269
PBX2	5089	broad.mit.edu	37	6	32157563	32157563	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr6:32157563C>A	ENST00000375050.4	-	1	400	c.130G>T	c.(130-132)Gtc>Ttc	p.V44F		NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	44					embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.V44F(2)		endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						CCTCCCGGGACCCCCCCGCTA	0.711																																						ENST00000375050.4	0.680000	0.130000	0.510000	0.220000	0.340000	0.373986	0.340000	0.310000																										2	Substitution - Missense(2)	p.V44F(2)	prostate(1)|lung(1)	14						c.(130-132)Gtc>Ttc		pre-B-cell leukemia homeobox 2							29.0	31.0	30.0					6																	32157563		1509	2708	4217	SO:0001583	missense	5089	10	118800	33				g.chr6:32157563C>A		CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.130G>T	chr6.hg19:g.32157563C>A	ENSP00000364190:p.Val44Phe	0						p.V44F	NM_002586.4	NP_002577.2	0	0	0	1.941004	P40425	PBX2_HUMAN		1	400	-			A2BFJ2	Missense_Mutation	SNP	ENST00000375050.4	0	1	hg19	c.130G>T	CCDS4748.1	0	.	.	.	.	.	.	.	.	.	.	C	18.17	3.564390	0.65651	.	.	ENSG00000204304	ENST00000375050	T	0.80653	-1.4	4.56	4.56	0.56223	4.56	4.56	0.56223	.	0.219742	0.22684	N	0.056918	T	0.49098	0.1537	N	0.14661	0.345	0.37506	D	0.916978	B;B	0.30542	0.284;0.176	B;B	0.15052	0.012;0.012	T	0.58999	-0.7536	10	0.52906	T	0.07	-5.1027	10.8156	0.46573	0.0:0.8072:0.1928:0.0	.	44;44	Q7KZE5;P40425	.;PBX2_HUMAN	F	44	ENSP00000364190:V44F	ENSP00000364190:V44F	V	-	1	0	0	PBX2	32265541	32265541	0.974000	0.33945	1.000000	0.80357	0.971000	0.66376	1.692000	0.37731	2.062000	0.61559	0.542000	0.68232	GTC	0.163180		TCGA-2J-AABK-01A-31D-A40W-08	0.711	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076194.4	0	0	1		2	2	2	0		0	0	24		24	23	1	1.880000	-2.326668	0	0.200000				5	5		141	137	0		1	0		0	0	24	0		0.934002	1.698378e-01	0	0	0	18	0	5	141
DOPEY1	23033	broad.mit.edu	37	6	83847927	83847927	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr6:83847927A>G	ENST00000349129.2	+	21	4426	c.4166A>G	c.(4165-4167)aAa>aGa	p.K1389R	DOPEY1_ENST00000484282.1_3'UTR|DOPEY1_ENST00000369739.3_Missense_Mutation_p.K1380R|DOPEY1_ENST00000237163.5_Missense_Mutation_p.K1370R	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	1389					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		TCTGCCATCAAAGCCATCTTG	0.373																																						ENST00000349129.2	0.660000	0.320000	0.570000	0.390000	0.470000	0.485377	0.470000	0.470000																										0				67						c.(4165-4167)aAa>aGa		dopey family member 1							131.0	138.0	136.0					6																	83847927		2203	4300	6503	SO:0001583	missense	23033	0	0					g.chr6:83847927A>G	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.4166A>G	chr6.hg19:g.83847927A>G	ENSP00000195654:p.Lys1389Arg	0					DOPEY1_ENST00000369739.3_Missense_Mutation_p.K1380R|DOPEY1_ENST00000484282.1_3'UTR|DOPEY1_ENST00000237163.5_Missense_Mutation_p.K1370R	p.K1389R	NM_015018.3	NP_055833.2	0	0	0	1.941004	Q5JWR5	DOP1_HUMAN		21	4426	+		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	1	1	hg19	c.4166A>G	CCDS4996.1	0	.	.	.	.	.	.	.	.	.	.	A	10.18	1.278737	0.23307	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.42900	0.96;0.96	6.16	6.16	0.99307	6.16	6.16	0.99307	.	0.140329	0.64402	D	0.000004	T	0.20455	0.0492	N	0.25201	0.72	0.80722	D	1	P;P;P	0.50156	0.932;0.791;0.791	P;B;B	0.45310	0.476;0.196;0.196	T	0.03829	-1.1000	10	0.12430	T	0.62	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	1280;1380;1389	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	R	1389;1370;1370	ENSP00000195654:K1389R;ENSP00000237163:K1370R	ENSP00000237163:K1370R	K	+	2	0	0	DOPEY1	83904646	83904646	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.770000	0.55310	2.367000	0.80283	0.528000	0.53228	AAA	0.163180		TCGA-2J-AABK-01A-31D-A40W-08	0.373	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	1	0	1		2	2	2	0		0	0	92		92	91	1	1.880000	-20.000000	1	0.200000	NM_015018			28	28		536	532	0		1	0		0	0	92	0		1.000000	2.355436e-01	0	0	0	18	0	28	536
CCL26	10344	broad.mit.edu	37	7	75401253	75401253	+	Nonsense_Mutation	SNP	G	G	A	rs200686147		TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr7:75401253G>A	ENST00000394905.2	-	3	399	c.142C>T	c.(142-144)Cga>Tga	p.R48*	CCL26_ENST00000005180.4_Nonsense_Mutation_p.R48*	NM_006072.4	NP_006063.1	Q9Y258	CCL26_HUMAN	chemokine (C-C motif) ligand 26	48					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of Rac GTPase activity (GO:0032855)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemokine activity (GO:0008009)			lung(3)	3						TCATAGCTTCGCACCCAGGTC	0.527													G|||	1	0.000199681	0.0	0.0	5008	,	,		18958	0.0		0.001	False		,,,				2504	0.0					ENST00000394905.2	1.000000	0.760000	1.000000	0.910000	0.990000	0.968199	0.990000	1.000000																										0				3						c.(142-144)Cga>Tga		chemokine (C-C motif) ligand 26							103.0	98.0	100.0					7																	75401253		2203	4300	6503	SO:0001587	stop_gained	10344	1	121412	29				g.chr7:75401253G>A	AF124601	CCDS5578.1	7q11.2	2013-02-25	2002-08-22	2002-08-23	ENSG00000006606	ENSG00000006606		"""Chemokine ligands"", ""Endogenous ligands"""	10625	protein-coding gene	gene with protein product	"""macrophage inflammatory protein 4-alpha"", ""small inducible cytokine A26"", ""CC chemokine IMAC"", ""chemokine N1"", ""thymic stroma chemokine-1"", ""eotaxin-3"""	604697	"""small inducible cytokine subfamily A (Cys-Cys), member 26"""	SCYA26		10373330	Standard	NM_006072		Approved	MIP-4alpha, eotaxin-3, IMAC, MIP-4a, TSC-1	uc003udt.1	Q9Y258	OTTHUMG00000130403	ENST00000394905.2:c.142C>T	chr7.hg19:g.75401253G>A	ENSP00000378365:p.Arg48*	0					CCL26_ENST00000005180.4_Nonsense_Mutation_p.R48*	p.R48*	NM_006072.4	NP_006063.1	1	2	3	2.085085	Q9Y258	CCL26_HUMAN		3	399	-			A0N0Q5|Q52LV8	Nonsense_Mutation	SNP	ENST00000394905.2	0	1	hg19	c.142C>T	CCDS5578.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	22.9	4.355434	0.82243	.	.	ENSG00000006606	ENST00000005180;ENST00000394905	.	.	.	3.61	0.592	0.17471	3.61	0.592	0.17471	.	2.078680	0.02083	N	0.052554	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	4.5482	0.12092	0.1229:0.0:0.5932:0.2838	.	.	.	.	X	48	.	ENSP00000005180:R48X	R	-	1	2	2	CCL26	75239189	75239189	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.693000	0.05121	0.010000	0.14839	0.400000	0.26472	CGA	0.214145		TCGA-2J-AABK-01A-31D-A40W-08	0.527	CCL26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344900.1	1	0	1		2	2	2	0		0	0	38		38	36	1	1.880000	-13.416930	1	0.200000	NM_006072			37	37		321	312	1		1	1		0	0	38	0		1.000000	5.876756e-02	0	2	0	2	0	37	321
BRAF	673	broad.mit.edu	37	7	140481423	140481423	+	Missense_Mutation	SNP	C	C	G	rs180177032		TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr7:140481423C>G	ENST00000288602.6	-	11	1445	c.1385G>C	c.(1384-1386)aGa>aCa	p.R462T		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	462	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> I (in CRC). {ECO:0000269|PubMed:12198537}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R462I(2)|p.R462K(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	AGATCCAATTCTTTGTCCCAC	0.393		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)	ENST00000288602.6	1.000000	0.990000	1.000000	0.990000	0.990000	0.999246	0.990000	1.000000		61		Dom	yes			Dom	yes		7	7q34	7q34	673	Mis, T, O	v-raf murine sarcoma viral oncogene homolog B1	yes	yes	Cardio-facio-cutaneous syndrome	E	E	AKAP9, KIAA1549		melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	3	Substitution - Missense(3)	p.R462I(2)|p.R462K(1)	endometrium(2)|large_intestine(1)	27380						c.(1384-1386)aGa>aCa		B-Raf proto-oncogene, serine/threonine kinase	Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)						171.0	146.0	155.0					7																	140481423		2203	4298	6501	SO:0001583	missense	673	0	0		Cardiofaciocutaneous syndrome	Familial Cancer Database	CFC, CFCS	g.chr7:140481423C>G	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1385G>C	chr7.hg19:g.140481423C>G	ENSP00000288602:p.Arg462Thr	0						p.R462T	NM_004333.4	NP_004324.2	1	2	3	2.032002	P15056	BRAF_HUMAN		11	1445	-	Melanoma(164;0.00956)		A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	1	1	hg19	c.1385G>C	CCDS5863.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.6|22.6	4.309763|4.309763	0.81247|0.81247	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000496384|ENST00000288602	.|D	.|0.82167	.|-1.58	5.62|5.62	5.62|5.62	0.85841|0.85841	5.62|5.62	5.62|5.62	0.85841|0.85841	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.043720	.|0.85682	.|D	.|0.000000	T|T	0.78470|0.78470	0.4288|0.4288	L|L	0.39085|0.39085	1.19|1.19	0.80722|0.80722	D|D	1|1	.|B	.|0.28026	.|0.198	.|B	.|0.26094	.|0.066	T|T	0.77070|0.77070	-0.2724|-0.2724	5|10	.|0.87932	.|D	.|0	.|.	17.8428|17.8428	0.88720|0.88720	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|462	.|P15056	.|BRAF_HUMAN	Q|T	70|462	.|ENSP00000288602:R462T	.|ENSP00000288602:R462T	E|R	-|-	1|2	0|0	0|0	BRAF|BRAF	140127892|140127892	140127892|140127892	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	6.072000|6.072000	0.71238|0.71238	2.637000|2.637000	0.89404|0.89404	0.585000|0.585000	0.79938|0.79938	GAA|AGA	0.227799		TCGA-2J-AABK-01A-31D-A40W-08	0.393	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	1	0	1		2	2	2	0		0	0	67		67	66	1	1.880000	-19.996730	1	0.200000	NM_004333			55	55		379	373	1		1	1		0	0	67	0		1.000000	5.077965e-01	0	4	0	9	0	55	379
CLU	1191	broad.mit.edu	37	8	27462692	27462692	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08			T	C	T	T		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr8:27462692T>C	ENST00000316403.10	-	5	983	c.578A>G	c.(577-579)gAc>gGc	p.D193G	CLU_ENST00000560366.1_Missense_Mutation_p.D245G|CLU_ENST00000546343.1_Missense_Mutation_p.D204G|CLU_ENST00000523500.1_Missense_Mutation_p.D193G|CLU_ENST00000405140.3_Missense_Mutation_p.D193G			P10909	CLUS_HUMAN	clusterin	193					blood coagulation (GO:0007596)|cell morphogenesis (GO:0000902)|central nervous system myelin maintenance (GO:0032286)|chaperone-mediated protein complex assembly (GO:0051131)|chaperone-mediated protein folding (GO:0061077)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|lipid metabolic process (GO:0006629)|microglial cell activation (GO:0001774)|microglial cell proliferation (GO:0061518)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of protein homooligomerization (GO:0032463)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of tau-protein kinase activity (GO:1902949)|positive regulation of tumor necrosis factor production (GO:0032760)|protein import (GO:0017038)|protein stabilization (GO:0050821)|regulation of beta-amyloid clearance (GO:1900221)|regulation of neuron death (GO:1901214)|regulation of neuronal signal transduction (GO:1902847)|release of cytochrome c from mitochondria (GO:0001836)|response to misfolded protein (GO:0051788)|response to virus (GO:0009615)|reverse cholesterol transport (GO:0043691)	apical dendrite (GO:0097440)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|spherical high-density lipoprotein particle (GO:0034366)	misfolded protein binding (GO:0051787)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)	21		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)		GAAGAACCTGTCCTGGAAGAG	0.612																																						ENST00000316403.10	1.000000	0.160000	0.580000	0.250000	0.370000	0.436662	0.370000	0.340000																										0				21						c.(577-579)gAc>gGc		clusterin							89.0	81.0	84.0					8																	27462692		2203	4300	6503	SO:0001583	missense	1191	0	0					g.chr8:27462692T>C	M64722	CCDS47832.1	8p21-p12	2012-11-30	2006-02-10		ENSG00000120885	ENSG00000120885			2095	protein-coding gene	gene with protein product	"""complement lysis inhibitor"", ""sulfated glycoprotein 2"", ""testosterone-repressed prostate message 2"", ""apolipoprotein J"""	185430	"""clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)"""	CLI, APOJ		1585460	Standard	NR_038335		Approved	SGP-2, SP-40, TRPM-2, KUB1, CLU1, CLU2	uc003xfz.2	P10909	OTTHUMG00000102114	ENST00000316403.10:c.578A>G	chr8.hg19:g.27462692T>C	ENSP00000315130:p.Asp193Gly	0					CLU_ENST00000546343.1_Missense_Mutation_p.D204G|CLU_ENST00000405140.3_Missense_Mutation_p.D193G|CLU_ENST00000523500.1_Missense_Mutation_p.D193G|CLU_ENST00000560366.1_Missense_Mutation_p.D245G	p.D193G			1	2	3	2.057049	P10909	CLUS_HUMAN		5	983	-		Ovarian(32;2.61e-05)	B2R9Q1|B3KSE6|P11380|P11381|Q2TU75|Q5HYC1|Q7Z5B9	Missense_Mutation	SNP	ENST00000316403.10	0	1	hg19	c.578A>G	CCDS47832.1	0	.	.	.	.	.	.	.	.	.	.	T	11.83	1.754978	0.31046	.	.	ENSG00000120885	ENST00000316403;ENST00000546343;ENST00000405140;ENST00000523500;ENST00000380446;ENST00000520012;ENST00000523589;ENST00000520796	T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82	4.96	1.18	0.20946	4.96	1.18	0.20946	Clusterin, N-terminal (1);	0.271710	0.40385	N	0.001116	T	0.29126	0.0724	M	0.79475	2.455	0.39868	D	0.973464	P;P;P;P	0.52316	0.916;0.952;0.873;0.625	B;B;B;B	0.43155	0.41;0.337;0.225;0.192	T	0.21586	-1.0241	10	0.66056	D	0.02	-18.8233	8.6897	0.34260	0.0:0.2008:0.0:0.7992	.	58;245;204;193	E7ETA7;P10909-2;P10909-5;P10909	.;.;.;CLUS_HUMAN	G	245;204;193;193;18;58;193;193	ENSP00000446413:D204G;ENSP00000385419:D193G;ENSP00000429620:D193G;ENSP00000431070:D193G;ENSP00000429336:D193G	ENSP00000315130:D245G	D	-	2	0	0	CLU	27518609	27518609	1.000000	0.71417	0.556000	0.28293	0.320000	0.28249	1.512000	0.35812	0.263000	0.21812	0.460000	0.39030	GAC	0.208704		TCGA-2J-AABK-01A-31D-A40W-08	0.612	CLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219953.3	0	0	1		2	2	2	0		0	0	27		27	26	1	1.880000	-9.191678	1	0.200000	NM_001831			7	7		199	198	0		1	1		0	0	27	0		0.980817	1	0	64	0	5061	0	7	199
CPSF1	29894	broad.mit.edu	37	8	145620538	145620538	+	Silent	SNP	C	C	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr8:145620538C>T	ENST00000349769.3	-	28	3223	c.3129G>A	c.(3127-3129)ccG>ccA	p.P1043P	CPSF1_ENST00000531727.1_5'Flank|MIR939_ENST00000401314.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	1043					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			TGCGGGCACACGGCGTGTTGG	0.632																																					NSCLC(133;1088 1848 27708 34777 35269)	ENST00000349769.3	1.000000	0.550000	1.000000	0.750000	0.990000	0.905056	0.990000	1.000000																										0				38						c.(3127-3129)ccG>ccA		cleavage and polyadenylation specific factor 1, 160kDa							57.0	57.0	57.0					8																	145620538		2203	4300	6503	SO:0001819	synonymous_variant	29894	25	121370	40				g.chr8:145620538C>T	U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.3129G>A	chr8.hg19:g.145620538C>T		0					MIR939_ENST00000401314.1_RNA|CPSF1_ENST00000531727.1_5'Flank	p.P1043P	NM_013291.2	NP_037423.2	1	2	3	2.057049	Q10570	CPSF1_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)	28	3223	-	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Q96AF0	Silent	SNP	ENST00000349769.3	0	1	hg19	c.3129G>A	CCDS34966.1	1																																																																																								0.208704		TCGA-2J-AABK-01A-31D-A40W-08	0.632	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382422.2	1	0	1		2	2	2	0		0	0	17		17	16	1	1.880000	-19.156050	1	0.200000	NM_013291			13	13		124	122	1		1	1		0	0	17	0		0.999581	9.999949e-01	0	48	0	191	0	13	124
DENND1A	57706	broad.mit.edu	37	9	126202749	126202749	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr9:126202749C>T	ENST00000373624.2	-	19	1579	c.1378G>A	c.(1378-1380)Gcc>Acc	p.A460T	DENND1A_ENST00000394215.2_Missense_Mutation_p.A430T|DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000373620.3_Missense_Mutation_p.A460T|DENND1A_ENST00000394219.3_Missense_Mutation_p.A428T|DENND1A_ENST00000373618.1_Missense_Mutation_p.A428T|DENND1A_ENST00000542603.1_Missense_Mutation_p.A202T	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	460					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						GGGGTGGGGGCGCAGCCATTC	0.622																																						ENST00000373624.2	1.000000	0.430000	0.880000	0.550000	0.700000	0.717160	0.700000	1.000000																										0				43						c.(1378-1380)Gcc>Acc		DENN/MADD domain containing 1A							53.0	48.0	49.0					9																	126202749		2203	4300	6503	SO:0001583	missense	57706	1	121412	34				g.chr9:126202749C>T	AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.1378G>A	chr9.hg19:g.126202749C>T	ENSP00000362727:p.Ala460Thr	0					DENND1A_ENST00000542603.1_Missense_Mutation_p.A202T|DENND1A_ENST00000373620.3_Missense_Mutation_p.A460T|DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000373618.1_Missense_Mutation_p.A428T|DENND1A_ENST00000394219.3_Missense_Mutation_p.A428T|DENND1A_ENST00000394215.2_Missense_Mutation_p.A430T	p.A460T	NM_020946.1	NP_065997.1	1	2	3	2.025733	Q8TEH3	DEN1A_HUMAN		19	1579	-			A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Missense_Mutation	SNP	ENST00000373624.2	1	1	hg19	c.1378G>A	CCDS35133.1	0	.	.	.	.	.	.	.	.	.	.	C	11.98	1.802047	0.31869	.	.	ENSG00000119522	ENST00000373624;ENST00000542603;ENST00000394219;ENST00000373620;ENST00000394215;ENST00000373618	T;T;T;T;T;T	0.22945	3.39;1.93;3.26;3.38;3.24;3.25	5.58	2.27	0.28462	5.58	2.27	0.28462	.	0.627020	0.17144	N	0.185346	T	0.12305	0.0299	N	0.25647	0.755	0.09310	N	1	B;B;B;B;B;B;B	0.20052	0.02;0.007;0.002;0.014;0.017;0.003;0.041	B;B;B;B;B;B;B	0.12156	0.007;0.006;0.002;0.003;0.004;0.002;0.007	T	0.32666	-0.9898	10	0.07030	T	0.85	-2.3994	4.3489	0.11146	0.1645:0.4533:0.0:0.3822	.	428;418;428;430;460;460;280	Q8TEH3-6;Q8TEH3-7;Q8TEH3-4;Q8TEH3-5;Q8TEH3-2;Q8TEH3;Q9HCG4	.;.;.;.;.;DEN1A_HUMAN;.	T	460;202;428;460;430;428	ENSP00000362727:A460T;ENSP00000437457:A202T;ENSP00000377766:A428T;ENSP00000362722:A460T;ENSP00000377763:A430T;ENSP00000362720:A428T	ENSP00000362720:A428T	A	-	1	0	0	DENND1A	125242570	125242570	0.049000	0.20398	0.571000	0.28486	0.558000	0.35554	0.343000	0.19944	0.670000	0.31165	0.655000	0.94253	GCC	0.201597		TCGA-2J-AABK-01A-31D-A40W-08	0.622	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	0	0	1		2	5	2	1		1	0	33		33	33	1	1.880000	-19.996590	1	0.200000	NM_024820			18	17		241	240	0		1	1		1	0	33	0		0.999984	5.128095e-02	0	5	0	22	0	18	241
CDKN2A	1029	broad.mit.edu	37	9	21971120	21971120	+	Nonsense_Mutation	SNP	G	G	A	rs121913388		TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr9:21971120G>A	ENST00000304494.5	-	2	508	c.238C>T	c.(238-240)Cga>Tga	p.R80*	CDKN2A_ENST00000361570.3_Missense_Mutation_p.P135L|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000530628.2_Missense_Mutation_p.P94L|CDKN2A_ENST00000578845.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000494262.1_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000497750.1_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000579755.1_Missense_Mutation_p.P94L|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000479692.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000498628.2_Nonsense_Mutation_p.R29*	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	80			R -> L (in a head and neck tumor).|R -> P (in CMM2; loss of CDK4 binding). {ECO:0000269|PubMed:19260062}.		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.R80*(100)|p.?(44)|p.P135L(7)|p.L65fs*38(1)|p.T79fs*37(1)|p.0(1)|p.A76fs*64(1)|p.T79fs*65(1)|p.E61_L94del(1)|p.A68fs*3(1)|p.R80fs*34(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		TGCACGGGTCGGGTGAGAGTG	0.726	R80*(HSC4_UPPER_AERODIGESTIVE_TRACT)|R80*(MEWO_SKIN)	17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																												ENST00000304494.5	1.000000	0.650000	1.000000	0.860000	0.990000	0.952556	0.990000	1.000000	R80*(HSC4_UPPER_AERODIGESTIVE_TRACT)|R80*(MEWO_SKIN)	17																								1474	Whole gene deletion(1316)|Substitution - Nonsense(100)|Unknown(44)|Substitution - Missense(7)|Deletion - Frameshift(6)|Deletion - In frame(1)	p.0?(1315)|p.R80*(100)|p.?(44)|p.P135L(7)|p.L65fs*38(1)|p.T79fs*37(1)|p.0(1)|p.A76fs*64(1)|p.T79fs*65(1)|p.E61_L94del(1)|p.A68fs*3(1)|p.R80fs*34(1)	haematopoietic_and_lymphoid_tissue(298)|skin(206)|central_nervous_system(168)|lung(150)|urinary_tract(91)|bone(76)|oesophagus(72)|upper_aerodigestive_tract(63)|soft_tissue(60)|pleura(51)|pancreas(37)|ovary(36)|kidney(32)|breast(32)|biliary_tract(16)|thyroid(15)|NS(14)|stomach(14)|large_intestine(7)|autonomic_ganglia(7)|meninges(7)|liver(6)|salivary_gland(4)|thymus(4)|vulva(3)|endometrium(3)|prostate(2)	4199	GRCh37	CM014695	CDKN2A	M	rs121913388	c.(238-240)Cga>Tga		cyclin-dependent kinase inhibitor 2A							11.0	14.0	13.0					9																	21971120		2172	4246	6418	SO:0001587	stop_gained	1029	0	0					g.chr9:21971120G>A	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.238C>T	chr9.hg19:g.21971120G>A	ENSP00000307101:p.Arg80*	0	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)				CDKN2A_ENST00000530628.2_Missense_Mutation_p.P94L|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000579755.1_Missense_Mutation_p.P94L|CDKN2A_ENST00000494262.1_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000497750.1_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000578845.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000361570.3_Missense_Mutation_p.P135L|CDKN2A_ENST00000498628.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.R80*|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000479692.2_Nonsense_Mutation_p.R29*	p.R80*	NM_000077.4	NP_000068.1	0	1	1	2.022665	P42771	CD2A1_HUMAN		2	508	-		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Nonsense_Mutation	SNP	ENST00000304494.5	0	1	hg19	c.238C>T	CCDS6510.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.328457|7.328457	0.98214|0.98214	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000361570;ENST00000530628|ENST00000304494;ENST00000446177	D;D|.	0.86497|.	-2.13;-2.02|.	5.93|5.93	5.01|5.01	0.66863|0.66863	5.93|5.93	5.01|5.01	0.66863|0.66863	.|.	0.000000|.	0.37136|.	N|.	0.002233|.	T|.	0.44561|.	0.1299|.	L|L	0.36672|0.36672	1.1|1.1	0.47511|0.47511	D|D	0.999443|0.999443	D|.	0.59357|.	0.985|.	B|.	0.40602|.	0.334|.	T|.	0.34825|.	-0.9813|.	10|.	0.13108|0.02654	T|T	0.6|1	-2.989|-2.989	8.7197|8.7197	0.34434|0.34434	0.0759:0.0:0.7715:0.1526|0.0759:0.0:0.7715:0.1526	.|.	135|.	Q8N726|.	CD2A2_HUMAN|.	L|X	135;94|80	ENSP00000355153:P135L;ENSP00000432664:P94L|.	ENSP00000355153:P135L|ENSP00000307101:R80X	P|R	-|-	2|1	0|2	0|2	CDKN2A|CDKN2A	21961120|21961120	21961120|21961120	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.899000|0.899000	0.52679|0.52679	2.363000|2.363000	0.44178|0.44178	1.464000|1.464000	0.47987|0.47987	0.650000|0.650000	0.86243|0.86243	CCG|CGA	0.198397		TCGA-2J-AABK-01A-31D-A40W-08	0.726	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	1	0	1		2	2	2	0		0	0	13		13	12	1	1.880000	-2.749059	1	0.200000	NM_000077			13	13		101	86	0		1	1	1	0	0	13	149		0.999100	9.966490e-01	9.999658e-01	10	14	69	143	13	101
LINGO2	158038	broad.mit.edu	37	9	27949709	27949709	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr9:27949709G>A	ENST00000379992.2	-	6	1410	c.961C>T	c.(961-963)Cgc>Tgc	p.R321C	LINGO2_ENST00000308675.3_Missense_Mutation_p.R321C	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	321						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		CGTAGGAAGCGGAGCCCTTGG	0.527																																						ENST00000379992.2	1.000000	0.520000	0.930000	0.630000	0.770000	0.783530	0.770000	1.000000																										0				44						c.(961-963)Cgc>Tgc		leucine rich repeat and Ig domain containing 2							84.0	87.0	86.0					9																	27949709		2203	4300	6503	SO:0001583	missense	158038	12	121412	44				g.chr9:27949709G>A	AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.961C>T	chr9.hg19:g.27949709G>A	ENSP00000369328:p.Arg321Cys	0					LINGO2_ENST00000308675.3_Missense_Mutation_p.R321C	p.R321C	NM_152570.2	NP_689783.1	0	1	1	2.022665	Q7L985	LIGO2_HUMAN		6	1410	-	Melanoma(11;0.242)	all_neural(11;2.78e-09)	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	ENST00000379992.2	1	1	hg19	c.961C>T	CCDS6524.1	0	.	.	.	.	.	.	.	.	.	.	G	14.99	2.699273	0.48307	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	T;T	0.57907	0.37;0.37	5.95	5.95	0.96441	5.95	5.95	0.96441	.	0.116612	0.64402	D	0.000016	T	0.71039	0.3293	M	0.63428	1.95	0.80722	D	1	D	0.89917	1.0	D	0.68621	0.959	T	0.67043	-0.5770	9	.	.	.	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	321	Q7L985	LIGO2_HUMAN	C	321	ENSP00000369328:R321C;ENSP00000310126:R321C	.	R	-	1	0	0	LINGO2	27939709	27939709	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	3.357000	0.52277	2.824000	0.97209	0.655000	0.94253	CGC	0.198397		TCGA-2J-AABK-01A-31D-A40W-08	0.527	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051978.2	0	0	1		2	2	2	0		0	0	55		55	54	1	1.880000	-2.540642	1	0.200000	NM_152570			26	25		309	307	0		1	0		0	0	55	0		1.000000	7.899213e-02	0	0	0	6	0	26	309
CACNA1B	774	broad.mit.edu	37	9	141012490	141012490	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chr9:141012490G>A	ENST00000371372.1	+	43	6015	c.5870G>A	c.(5869-5871)cGt>cAt	p.R1957H	CACNA1B_ENST00000371355.4_Missense_Mutation_p.R1958H|CACNA1B_ENST00000277551.2_Missense_Mutation_p.R1957H|CACNA1B_ENST00000371357.1_Missense_Mutation_p.R1956H|CACNA1B_ENST00000371363.1_Missense_Mutation_p.R1955H|CACNA1B_ENST00000277549.5_Missense_Mutation_p.R1151H	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1957					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CCCCTGGAGCGTGGCCACTCC	0.617																																						ENST00000371372.1	1.000000	0.410000	1.000000	0.630000	0.940000	0.855197	0.940000	1.000000																										0				80						c.(5869-5871)cGt>cAt		calcium channel, voltage-dependent, N type, alpha 1B subunit	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)						19.0	23.0	22.0					9																	141012490		1906	4124	6030	SO:0001583	missense	774	6	120776	30				g.chr9:141012490G>A	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.5870G>A	chr9.hg19:g.141012490G>A	ENSP00000360423:p.Arg1957His	0					CACNA1B_ENST00000277551.2_Missense_Mutation_p.R1957H|CACNA1B_ENST00000277549.5_Missense_Mutation_p.R1151H|CACNA1B_ENST00000371355.4_Missense_Mutation_p.R1958H|CACNA1B_ENST00000371363.1_Missense_Mutation_p.R1955H|CACNA1B_ENST00000371357.1_Missense_Mutation_p.R1956H	p.R1957H	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	1	2	3	2.025733	Q00975	CAC1B_HUMAN		43	6015	+	all_cancers(76;0.166)		B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	0	1	hg19	c.5870G>A	CCDS59522.1	1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.019883	0.75275	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D;D	0.97328	-4.07;-4.1;-4.34;-4.08;-4.06;-4.06	4.47	4.47	0.54385	4.47	4.47	0.54385	.	1.579960	0.03633	N	0.238175	D	0.96632	0.8901	M	0.73962	2.25	0.80722	D	1	P;P	0.38922	0.651;0.651	B;B	0.35073	0.195;0.139	D	0.86427	0.1758	10	0.21540	T	0.41	.	16.756	0.85499	0.0:0.0:1.0:0.0	.	1956;1955	B1AQK7;B1AQK6	.;.	H	1957;1957;1151;1955;1956;1958	ENSP00000360423:R1957H;ENSP00000277551:R1957H;ENSP00000277549:R1151H;ENSP00000360414:R1955H;ENSP00000360408:R1956H;ENSP00000360406:R1958H	ENSP00000277549:R1151H	R	+	2	0	0	CACNA1B	140132311	140132311	0.993000	0.37304	1.000000	0.80357	0.958000	0.62258	0.082000	0.14847	2.036000	0.60181	0.561000	0.74099	CGT	0.201597		TCGA-2J-AABK-01A-31D-A40W-08	0.617	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	1	0	1		2	2	2	0		0	0	13		13	12	1	1.880000	-11.394230	1	0.200000	NM_000718			6	6		59	56	0		1			0	0	13	0		0.962210	0	0	0	0	0	0	6	59
GPR112	139378	broad.mit.edu	37	X	135426583	135426583	+	Missense_Mutation	SNP	A	A	T			TCGA-2J-AABK-01A-31D-A40W-08	TCGA-2J-AABK-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	10fe2e36-6d45-4c97-b4b4-468985c589cd	e8152b10-7ebb-4153-9837-dcc6185632c2	g.chrX:135426583A>T	ENST00000394143.1	+	6	1009	c.718A>T	c.(718-720)Agt>Tgt	p.S240C	GPR112_ENST00000394141.1_Missense_Mutation_p.S35C|GPR112_ENST00000287534.4_Missense_Mutation_p.S177C|GPR112_ENST00000370652.1_Missense_Mutation_p.S240C|GPR112_ENST00000412101.1_Missense_Mutation_p.S35C	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	240					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TCAAGAAAAAAGTACAACTGT	0.333																																						ENST00000394143.1	1.000000	0.770000	0.990000	0.860000	0.940000	0.930663	0.940000	0.990000																										0				199						c.(718-720)Agt>Tgt		G protein-coupled receptor 112							80.0	62.0	68.0					X																	135426583		2203	4300	6503	SO:0001583	missense	139378	0	0					g.chrX:135426583A>T	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.718A>T	chrX.hg19:g.135426583A>T	ENSP00000377699:p.Ser240Cys						GPR112_ENST00000412101.1_Missense_Mutation_p.S35C|GPR112_ENST00000370652.1_Missense_Mutation_p.S240C|GPR112_ENST00000394141.1_Missense_Mutation_p.S35C|GPR112_ENST00000287534.4_Missense_Mutation_p.S177C	p.S240C	NM_153834.3	NP_722576.3	0	1	1		Q8IZF6	GP112_HUMAN		6	1009	+	Acute lymphoblastic leukemia(192;0.000127)		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	1	1	hg19	c.718A>T	CCDS35409.1	1	.	.	.	.	.	.	.	.	.	.	a	12.04	1.818484	0.32145	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.41065	1.19;1.19;1.01;1.01;1.01	4.3	4.3	0.51218	4.3	4.3	0.51218	.	.	.	.	.	T	0.48447	0.1500	L	0.27053	0.805	0.09310	N	0.999997	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.71414	0.973;0.957;0.907	T	0.30937	-0.9961	9	0.72032	D	0.01	.	9.3376	0.38060	1.0:0.0:0.0:0.0	.	177;35;240	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	C	240;240;35;177;35	ENSP00000377699:S240C;ENSP00000359686:S240C;ENSP00000416526:S35C;ENSP00000287534:S177C;ENSP00000377697:S35C	ENSP00000287534:S177C	S	+	1	0	0	GPR112	135254249	135254249	0.461000	0.25783	0.255000	0.24374	0.024000	0.10985	3.803000	0.55560	1.661000	0.50771	0.414000	0.27820	AGT	0.200000		TCGA-2J-AABK-01A-31D-A40W-08	0.333	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1	1	0	1		2	2	2	0		0	0	28		28	28	1	1.880000	-20.000000	1	0.200000				36	36		111	108	1		1			0	0	28	0		1.000000	0	0	0	0	0	0	36	111
