#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
TAF4	6874	broad.mit.edu	37	20	60587922	60587923	+	Frame_Shift_Ins	INS	-	-	GCCT			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr20:60587922_60587923insGCCT	ENST00000252996.4	-	3	1588_1589	c.1589_1590insAGGC	c.(1588-1590)gccfs	p.-530fs	TAF4_ENST00000609045.1_5'UTR	NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa						DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CCGTTGTCTGGGCCTGAGACAC	0.589																																						ENST00000252996.4	1.000000	0.820000	1	9.300000e-01	0.990000	0.977506	0.990000	1.000000																										0				37						c.(1588-1590)gccfs		TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa																																				SO:0001589	frameshift_variant	6874	0	0					g.chr20:60587922_60587923insGCCT	Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.1586_1589dupAGGC	chr20.hg19:g.60587923_60587926dupGCCT	ENSP00000252996:p.Ala530fs	0					TAF4_ENST00000609045.1_5'UTR	p.-530fs	NM_003185.3	NP_003176.2	2	2	4	2.038962	O00268	TAF4_HUMAN	BRCA - Breast invasive adenocarcinoma(19;3.1e-07)	3	1588_1589	-	Breast(26;1e-08)		A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Frame_Shift_Ins	INS	ENST00000252996.4	0	1	hg19	c.1589_1590insAGGC	CCDS33500.1	1																																																																																								0.375000		TCGA-2J-AABO-01A-21D-A40W-08	0.589	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	1	0	1		2	2		0		0	0	111		111	104	1	3.570000	-3.017764	1	0.240000	NM_003185			64	80		553	548	0		1	0	0	0	0	111	0		1.000000	2.429332e-01	0	0	0	9	0	64	553
ABCC2	1244	broad.mit.edu	37	10	101594176	101594176	+	Missense_Mutation	SNP	C	C	T	rs142715085	byFrequency	TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr10:101594176C>T	ENST00000370449.4	+	24	3411	c.3298C>T	c.(3298-3300)Cgc>Tgc	p.R1100C		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	1100	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.R1100C(1)		NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	TCAGTCCTTGCGCAGCTGGAT	0.468																																						ENST00000370449.4	1.000000	0.750000	1	8.800000e-01	0.990000	0.957008	0.990000	1.000000																										1	Substitution - Missense(1)	p.R1100C(1)	large_intestine(1)	67						c.(3298-3300)Cgc>Tgc		ATP-binding cassette, sub-family C (CFTR/MRP), member 2	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)		CYS/ARG	0,4406		0,0,2203	274.0	206.0	229.0		3298	4.4	0.9	10	dbSNP_134	229	7,8593	5.7+/-21.5	0,7,4293	yes	missense	ABCC2	NM_000392.3	180	0,7,6496	TT,TC,CC		0.0814,0.0,0.0538	probably-damaging	1100/1546	101594176	7,12999	2203	4300	6503	SO:0001583	missense	1244	61	121412	52				g.chr10:101594176C>T	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.3298C>T	chr10.hg19:g.101594176C>T	ENSP00000359478:p.Arg1100Cys	1						p.R1100C	NM_000392.3	NP_000383	1	2	3	1.889254	Q92887	MRP2_HUMAN		24	3411	+		Colorectal(252;0.234)	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	0	1	hg19	c.3298C>T	CCDS7484.1	1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.058211	0.55325	0.0	8.14E-4	ENSG00000023839	ENST00000370449	D	0.89681	-2.55	5.28	4.38	0.52667	5.28	4.38	0.52667	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.95468	0.8528	M	0.92122	3.275	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96170	0.9122	10	0.87932	D	0	-10.2227	13.8333	0.63393	0.0:0.9261:0.0:0.0739	.	1100	Q92887	MRP2_HUMAN	C	1100	ENSP00000359478:R1100C	ENSP00000359478:R1100C	R	+	1	0	0	ABCC2	101584166	101584166	1.000000	0.71417	0.852000	0.33557	0.053000	0.15095	4.409000	0.59768	1.228000	0.43614	0.511000	0.50034	CGC	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.468	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	1	0	1		2	2	2	0		0	0	92		92	89	1	3.570000	-8.493167	1	0.240000	NM_000392			41	41		333	330	0		1	0		0	0	92	0		1.000000	0	0	0	0	1	0	41	333
ADARB2	105	broad.mit.edu	37	10	1406022	1406022	+	Missense_Mutation	SNP	G	G	A	rs368485422		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr10:1406022G>A	ENST00000381312.1	-	3	603	c.278C>T	c.(277-279)gCg>gTg	p.A93V	RP11-398B16.2_ENST00000432987.1_RNA	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	93					mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		cgcgccgggcgcgccgccccg	0.726																																						ENST00000381312.1	1.000000	0.990000	1	9.900000e-01	0.990000	0.999689	0.990000	1.000000																										0				41						c.(277-279)gCg>gTg		adenosine deaminase, RNA-specific, B2 (non-functional)			VAL/ALA	0,4140		0,0,2070	6.0	7.0	7.0		278	2.8	0.0	10		7	1,8301		0,1,4150	no	missense	ADARB2	NM_018702.3	64	0,1,6220	AA,AG,GG		0.012,0.0,0.0080	benign	93/740	1406022	1,12441	2070	4151	6221	SO:0001583	missense	105	1	115080	21				g.chr10:1406022G>A	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.278C>T	chr10.hg19:g.1406022G>A	ENSP00000370713:p.Ala93Val	1					RP11-398B16.2_ENST00000432987.1_RNA	p.A93V	NM_018702.3	NP_061172.1	1	2	3	1.893925	Q9NS39	RED2_HUMAN		3	603	-		all_epithelial(10;0.059)|Colorectal(49;0.0815)	B2RPJ5|Q5VUT6|Q5VW42	Missense_Mutation	SNP	ENST00000381312.1	1	1	hg19	c.278C>T	CCDS7058.1	1	.	.	.	.	.	.	.	.	.	.	g	5.998	0.367978	0.11352	0.0	1.2E-4	ENSG00000185736	ENST00000381312	T	0.24350	1.86	4.69	2.84	0.33178	4.69	2.84	0.33178	.	1.304660	0.04734	N	0.421667	T	0.19886	0.0478	N	0.19112	0.55	0.25308	N	0.989223	B	0.15141	0.012	B	0.09377	0.004	T	0.29640	-1.0005	10	0.38643	T	0.18	-0.0474	10.0945	0.42466	0.0756:0.1376:0.7868:0.0	.	93	Q9NS39	RED2_HUMAN	V	93	ENSP00000370713:A93V	ENSP00000370713:A93V	A	-	2	0	0	ADARB2	1396022	1396022	0.004000	0.15560	0.000000	0.03702	0.000000	0.00434	1.487000	0.35540	0.418000	0.25898	-0.375000	0.07067	GCG	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.726	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046426.1	1	0	1		2	2	2	0		0	0	13		13	12	1	3.570000	-20.000000	1	0.240000	NM_018702			13	12		43	37	0		1			0	0	13	0		0.999385	0	0	0	0	0	0	13	43
TAF3	83860	broad.mit.edu	37	10	8006929	8006929	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr10:8006929C>T	ENST00000344293.5	+	3	1662	c.1456C>T	c.(1456-1458)Ccc>Tcc	p.P486S		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	486					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						TTCAAATATGCCCCCCAACTT	0.488																																						ENST00000344293.5	0.190000	0.030000	1.400000e-01	5.000000e-02	0.090000	0.103379	0.090000	0.090000																										0				40						c.(1456-1458)Ccc>Tcc		TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa							104.0	103.0	103.0					10																	8006929		1926	4123	6049	SO:0001583	missense	83860	0	0					g.chr10:8006929C>T	AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.1456C>T	chr10.hg19:g.8006929C>T	ENSP00000340271:p.Pro486Ser	1						p.P486S	NM_031923.3	NP_114129.1	1	2	3	1.893925	Q5VWG9	TAF3_HUMAN		3	1662	+			Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Missense_Mutation	SNP	ENST00000344293.5	0	1	hg19	c.1456C>T	CCDS41487.1	0	.	.	.	.	.	.	.	.	.	.	C	13.39	2.223998	0.39300	.	.	ENSG00000165632	ENST00000344293	T	0.34859	1.34	5.62	4.72	0.59763	5.62	4.72	0.59763	.	0.000000	0.64402	D	0.000003	T	0.53594	0.1806	M	0.80183	2.485	0.80722	D	1	D	0.56746	0.977	P	0.54460	0.753	T	0.56836	-0.7913	10	0.33940	T	0.23	-14.7526	14.6258	0.68621	0.0:0.93:0.0:0.07	.	486	Q5VWG9	TAF3_HUMAN	S	486	ENSP00000340271:P486S	ENSP00000340271:P486S	P	+	1	0	0	TAF3	8046935	8046935	1.000000	0.71417	0.983000	0.44433	0.035000	0.12851	4.211000	0.58507	1.389000	0.46526	0.650000	0.86243	CCC	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.488	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1	0	0	1		2	2	2	0		0	0	109		109	107	1	3.570000	-1.763907	0	0.240000	NM_031923			6	6		622	621	0		1	0		0	0	109	0		0.964932	1.308925e-02	0	0	0	15	0	6	622
SEMA4G	57715	broad.mit.edu	37	10	102743445	102743445	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr10:102743445G>A	ENST00000370250.4	+	14	2447	c.2074G>A	c.(2074-2076)Gcc>Acc	p.A692T	SEMA4G_ENST00000210633.3_Missense_Mutation_p.A697T|SEMA4G_ENST00000517724.1_Intron|MRPL43_ENST00000370242.4_Intron|MRPL43_ENST00000370241.3_Intron|RP11-108L7.4_ENST00000447344.1_RNA|MRPL43_ENST00000299179.5_Intron|MRPL43_ENST00000318325.2_Intron|MRPL43_ENST00000493646.1_5'Flank|MRPL43_ENST00000342071.1_Intron	NM_017893.3	NP_060363.2	Q9NTN9	SEM4G_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G	692					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		CCTCATCCTGGCCTCCTCCCT	0.642																																						ENST00000370250.4	1.000000	0.870000	1	9.900000e-01	0.990000	0.992608	0.990000	1.000000																										0				25						c.(2074-2076)Gcc>Acc		sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G							59.0	54.0	56.0					10																	102743445		2203	4300	6503	SO:0001583	missense	57715	0	0					g.chr10:102743445G>A	AB046839	CCDS7501.1, CCDS55724.1	10q24.31	2013-01-11			ENSG00000095539	ENSG00000095539		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10735	protein-coding gene	gene with protein product							Standard	NM_017893		Approved	FLJ20590, KIAA1619	uc001krw.2	Q9NTN9	OTTHUMG00000018922	ENST00000370250.4:c.2074G>A	chr10.hg19:g.102743445G>A	ENSP00000359270:p.Ala692Thr	1					MRPL43_ENST00000299179.5_Intron|MRPL43_ENST00000318325.2_Intron|MRPL43_ENST00000493646.1_5'Flank|MRPL43_ENST00000370241.3_Intron|MRPL43_ENST00000342071.1_Intron|MRPL43_ENST00000370242.4_Intron|RP11-108L7.4_ENST00000447344.1_RNA|SEMA4G_ENST00000517724.1_Intron|SEMA4G_ENST00000210633.3_Missense_Mutation_p.A697T	p.A692T	NM_017893.3	NP_060363.2	1	2	3	1.889254	Q9NTN9	SEM4G_HUMAN		14	2447	+		Colorectal(252;0.234)	A1A5C6|A6NJY8|Q58EY1|Q9HCF3	Missense_Mutation	SNP	ENST00000370250.4	1	1	hg19	c.2074G>A		1	.	.	.	.	.	.	.	.	.	.	g	8.197	0.797197	0.16327	.	.	ENSG00000095539	ENST00000370250;ENST00000210633	T;T	0.17054	2.3;2.37	5.53	5.53	0.82687	5.53	5.53	0.82687	.	0.842932	0.11009	N	0.609640	T	0.07818	0.0196	N	0.04880	-0.145	0.30368	N	0.783125	B	0.25667	0.131	B	0.16289	0.015	T	0.16808	-1.0390	10	0.13108	T	0.6	.	8.7621	0.34680	0.0779:0.0:0.7717:0.1503	.	697	Q9NTN9-2	.	T	692;697	ENSP00000359270:A692T;ENSP00000210633:A697T	ENSP00000210633:A697T	A	+	1	0	0	SEMA4G	102733435	102733435	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.420000	0.59841	2.613000	0.88420	0.550000	0.68814	GCC	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.642	SEMA4G-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049920.2	1	0	1		2	2	2	0		0	0	21		21	20	1	3.570000	-19.999370	1	0.240000				13	13		68	66	1		1	1		0	0	21	0		0.999628	8.044379e-01	0	7	0	11	0	13	68
ABCG4	64137	broad.mit.edu	37	11	119030980	119030980	+	Missense_Mutation	SNP	C	C	T	rs201390504		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr11:119030980C>T	ENST00000449422.2	+	13	1669	c.1481C>T	c.(1480-1482)aCg>aTg	p.T494M	ABCG4_ENST00000307417.3_Missense_Mutation_p.T494M|ABCG4_ENST00000531739.1_Missense_Mutation_p.T494M	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	494	ABC transmembrane type-2.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.T494M(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		TACTGGATGACGGGCCAGCCC	0.647																																						ENST00000449422.2	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										1	Substitution - Missense(1)	p.T494M(1)	lung(1)	44						c.(1480-1482)aCg>aTg		ATP-binding cassette, sub-family G (WHITE), member 4		C	MET/THR,MET/THR	1,4399	2.1+/-5.4	0,1,2199	83.0	74.0	77.0		1481,1481	5.2	1.0	11		77	0,8590		0,0,4295	yes	missense,missense	ABCG4	NM_001142505.1,NM_022169.4	81,81	0,1,6494	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	494/647,494/647	119030980	1,12989	2200	4295	6495	SO:0001583	missense	64137	6	121412	41				g.chr11:119030980C>T	AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.1481C>T	chr11.hg19:g.119030980C>T	ENSP00000406874:p.Thr494Met	0					ABCG4_ENST00000307417.3_Missense_Mutation_p.T494M|ABCG4_ENST00000531739.1_Missense_Mutation_p.T494M	p.T494M	NM_001142505.1	NP_001135977.1	2	2	4	2.072671	Q9H172	ABCG4_HUMAN		13	1669	+	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Missense_Mutation	SNP	ENST00000449422.2	1	1	hg19	c.1481C>T	CCDS8415.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.223466	0.95139	2.27E-4	0.0	ENSG00000172350	ENST00000307417;ENST00000449422;ENST00000531739	T;T;T	0.73047	-0.71;-0.71;-0.71	5.2	5.2	0.72013	5.2	5.2	0.72013	ABC-2 type transporter (1);	0.000000	0.85682	D	0.000000	D	0.85452	0.5700	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86992	0.2111	10	0.87932	D	0	-9.1283	18.9923	0.92798	0.0:1.0:0.0:0.0	.	494	Q9H172	ABCG4_HUMAN	M	494	ENSP00000304111:T494M;ENSP00000406874:T494M;ENSP00000434318:T494M	ENSP00000304111:T494M	T	+	2	0	0	ABCG4	118536190	118536190	1.000000	0.71417	0.995000	0.50966	0.987000	0.75469	7.629000	0.83207	2.720000	0.93068	0.558000	0.71614	ACG	0.385908		TCGA-2J-AABO-01A-21D-A40W-08	0.647	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388215.1	1	0	1		2	2	2	0		0	0	78		78	74	1	3.570000	-3.879414	1	0.240000	NM_022169			89	89		321	316	1		1			0	0	78	0		1.000000	0	0	0	0	0	0	89	321
IRF7	3665	broad.mit.edu	37	11	613572	613572	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr11:613572C>T	ENST00000397574.2	-	9	1240	c.871G>A	c.(871-873)Gtg>Atg	p.V291M	IRF7_ENST00000397570.1_Missense_Mutation_p.V262M|IRF7_ENST00000397562.3_De_novo_Start_InFrame|IRF7_ENST00000525445.1_Missense_Mutation_p.V185M|IRF7_ENST00000348655.6_Missense_Mutation_p.V262M|IRF7_ENST00000397566.1_Missense_Mutation_p.V304M|IRF7_ENST00000330243.5_Missense_Mutation_p.V304M	NM_001572.3	NP_001563.2	Q92985	IRF7_HUMAN	interferon regulatory factor 7	291					cellular response to DNA damage stimulus (GO:0006974)|cytokine-mediated signaling pathway (GO:0019221)|establishment of viral latency (GO:0019043)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interferon-alpha production (GO:0032607)|interferon-beta production (GO:0032608)|interferon-gamma-mediated signaling pathway (GO:0060333)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of adaptive immune response (GO:0002819)|regulation of immune response (GO:0050776)|regulation of monocyte differentiation (GO:0045655)|regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124)|regulation of MyD88-independent toll-like receptor signaling pathway (GO:0034127)|regulation of type I interferon production (GO:0032479)|response to virus (GO:0009615)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;7.68e-28)|Epithelial(43;7.44e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;6.96e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ATGATGGTCACGTCCAGCGCC	0.682																																						ENST00000397574.2	1.000000	0.430000	1	6.300000e-01	0.880000	0.840073	0.880000	1.000000																										0				8						c.(871-873)Gtg>Atg		interferon regulatory factor 7							11.0	14.0	13.0					11																	613572		2069	4149	6218	SO:0001583	missense	3665	0	0					g.chr11:613572C>T	U53830	CCDS7703.1, CCDS7704.1, CCDS7705.1	11p15.5	2005-10-10			ENSG00000185507	ENSG00000185507			6122	protein-coding gene	gene with protein product		605047					Standard	XM_005252906		Approved		uc001lqh.3	Q92985	OTTHUMG00000132019	ENST00000397574.2:c.871G>A	chr11.hg19:g.613572C>T	ENSP00000380704:p.Val291Met	1					IRF7_ENST00000525445.1_Missense_Mutation_p.V185M|IRF7_ENST00000397570.1_Missense_Mutation_p.V262M|IRF7_ENST00000397562.3_De_novo_Start_InFrame|IRF7_ENST00000348655.6_Missense_Mutation_p.V262M|IRF7_ENST00000397566.1_Missense_Mutation_p.V304M|IRF7_ENST00000330243.5_Missense_Mutation_p.V304M	p.V291M	NM_001572.3	NP_001563.2	2	7	9	3.118716	Q92985	IRF7_HUMAN		9	1240	-		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)	B9EGL3|O00331|O00332|O00333|O75924|Q9UE79	Missense_Mutation	SNP	ENST00000397574.2	0	1	hg19	c.871G>A	CCDS7703.1	1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.491677	0.44249	.	.	ENSG00000185507	ENST00000525445;ENST00000348655;ENST00000397570;ENST00000397566;ENST00000397574;ENST00000330243	D;D;D;D;D;D	0.96619	-4.07;-4.07;-4.07;-4.07;-4.07;-4.07	4.0	3.06	0.35304	4.0	3.06	0.35304	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.599107	0.16746	N	0.201252	D	0.96513	0.8862	L	0.50333	1.59	0.80722	D	1	D;D;D;D	0.89917	1.0;0.991;0.997;0.997	D;P;P;P	0.71870	0.975;0.78;0.835;0.847	D	0.95215	0.8329	10	0.87932	D	0	-22.3084	7.8587	0.29497	0.1718:0.738:0.0:0.0902	.	185;262;291;304	E9PSE3;Q92985-2;Q92985;Q92985-4	.;.;IRF7_HUMAN;.	M	185;262;262;304;291;304	ENSP00000434009:V185M;ENSP00000331803:V262M;ENSP00000380700:V262M;ENSP00000380697:V304M;ENSP00000380704:V291M;ENSP00000329411:V304M	ENSP00000329411:V304M	V	-	1	0	0	IRF7	603572	603572	0.009000	0.17119	0.994000	0.49952	0.212000	0.24457	-0.038000	0.12144	0.984000	0.38629	0.491000	0.48974	GTG	0.586957		TCGA-2J-AABO-01A-21D-A40W-08	0.682	IRF7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255026.1	0	0	1		2	2	2	0		0	0	24		24	24	1	3.570000	-12.838720	1	0.240000	NM_001572			9	9		155	152	0		1	1		0	0	24	0		0.994147	9.228944e-01	0	8	0	72	0	9	155
NLRP14	338323	broad.mit.edu	37	11	7081264	7081264	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr11:7081264C>T	ENST00000299481.4	+	9	3119	c.2773C>T	c.(2773-2775)Cgg>Tgg	p.R925W		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	925					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TGATGTCTTTCGGCATCCAAG	0.428																																						ENST00000299481.4	0.170000	0.010000	1.200000e-01	4.000000e-02	0.070000	0.085504	0.070000	0.080000																										0				21						c.(2773-2775)Cgg>Tgg		NLR family, pyrin domain containing 14							220.0	208.0	212.0					11																	7081264		2201	4295	6496	SO:0001583	missense	338323	4	121412	39				g.chr11:7081264C>T	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.2773C>T	chr11.hg19:g.7081264C>T	ENSP00000299481:p.Arg925Trp	0						p.R925W	NM_176822.3	NP_789792.1	2	2	4	2.072671	Q86W24	NAL14_HUMAN		9	3119	+			Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	0	1	hg19	c.2773C>T	CCDS7776.1	0	.	.	.	.	.	.	.	.	.	.	C	11.86	1.764218	0.31228	.	.	ENSG00000158077	ENST00000299481	T	0.48522	0.81	4.5	0.00652	0.14067	4.5	0.00652	0.14067	.	0.764957	0.10829	N	0.629577	T	0.40979	0.1139	M	0.74546	2.27	0.09310	N	1	B	0.24721	0.11	B	0.12837	0.008	T	0.46317	-0.9200	10	0.72032	D	0.01	.	2.1725	0.03853	0.3529:0.3743:0.1721:0.1007	.	925	Q86W24	NAL14_HUMAN	W	925	ENSP00000299481:R925W	ENSP00000299481:R925W	R	+	1	2	2	NLRP14	7037840	7037840	0.000000	0.05858	0.002000	0.10522	0.987000	0.75469	-0.266000	0.08631	0.204000	0.20548	0.655000	0.94253	CGG	0.385908		TCGA-2J-AABO-01A-21D-A40W-08	0.428	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	0	0	1		2	2	2	0		0	0	137		137	131	1	3.570000	-2.130933	0	0.240000	NM_176822			6	6		831	821	0		1			0	0	137	0		0.963576	0	0	0	0	0	0	6	831
CD44	960	broad.mit.edu	37	11	35218362	35218362	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr11:35218362C>A	ENST00000428726.2	+	6	860	c.737C>A	c.(736-738)tCa>tAa	p.S246*	CD44_ENST00000433892.2_Intron|CD44_ENST00000415148.2_Intron|CD44_ENST00000526669.2_Intron|CD44_ENST00000360158.4_Intron|CD44_ENST00000278386.6_Intron|CD44_ENST00000449691.2_Nonsense_Mutation_p.S246*|CD44_ENST00000352818.4_Intron|CD44_ENST00000437706.2_Nonsense_Mutation_p.S246*|CD44_ENST00000434472.2_Intron|CD44_ENST00000433354.2_Nonsense_Mutation_p.S246*|CD44_ENST00000263398.6_Intron	NM_000610.3	NP_000601.3	P16070	CD44_HUMAN	CD44 molecule (Indian blood group)	246	Stem.				blood coagulation (GO:0007596)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|monocyte aggregation (GO:0070487)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|Wnt signaling pathway (GO:0016055)|wound healing involved in inflammatory response (GO:0002246)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|skin(1)	23	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronan(DB08818)	GATTGGTTTTCATGGTTGTTT	0.383																																						ENST00000428726.2	0.420000	0.070000	3.000000e-01	1.200000e-01	0.200000	0.217427	0.200000	0.200000																										0				23						c.(736-738)tCa>tAa		CD44 molecule (Indian blood group)	Hyaluronan(DB08818)						120.0	104.0	109.0					11																	35218362		2202	4298	6500	SO:0001587	stop_gained	960	0	0					g.chr11:35218362C>A	M59040	CCDS7897.1, CCDS31455.1, CCDS31456.1, CCDS31457.1, CCDS31458.1, CCDS55754.1, CCDS55755.1	11p13	2014-07-18	2006-03-28		ENSG00000026508	ENSG00000026508		"""CD molecules"", ""Blood group antigens"", ""Proteoglycans / Cell surface : Other"""	1681	protein-coding gene	gene with protein product	"""hematopoietic cell E- and L-selectin ligand"", ""chondroitin sulfate proteoglycan 8"""	107269	"""CD44 antigen (homing function and Indian blood group system)"""	MIC4, MDU2, MDU3		2454887	Standard	NM_001202555		Approved	IN, MC56, Pgp1, CD44R, HCELL, CSPG8	uc001mvu.3	P16070	OTTHUMG00000044388	ENST00000428726.2:c.737C>A	chr11.hg19:g.35218362C>A	ENSP00000398632:p.Ser246*	0					CD44_ENST00000433354.2_Nonsense_Mutation_p.S246*|CD44_ENST00000526669.2_Intron|CD44_ENST00000360158.4_Intron|CD44_ENST00000352818.4_Intron|CD44_ENST00000449691.2_Nonsense_Mutation_p.S246*|CD44_ENST00000434472.2_Intron|CD44_ENST00000437706.2_Nonsense_Mutation_p.S246*|CD44_ENST00000263398.6_Intron|CD44_ENST00000415148.2_Intron|CD44_ENST00000433892.2_Intron|CD44_ENST00000278386.6_Intron	p.S246*	NM_000610.3	NP_000601.3	2	2	4	2.072671	P16070	CD44_HUMAN	STAD - Stomach adenocarcinoma(6;0.00731)	6	860	+	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	A5YRN9|B6EAT9|D3DR12|D3DR13|O95370|P22511|Q04858|Q13419|Q13957|Q13958|Q13959|Q13960|Q13961|Q13967|Q13968|Q13980|Q15861|Q16064|Q16065|Q16066|Q16208|Q16522|Q86T72|Q86Z27|Q8N694|Q92493|Q96J24|Q9H5A5|Q9UC28|Q9UC29|Q9UC30|Q9UCB0|Q9UJ36	Nonsense_Mutation	SNP	ENST00000428726.2	0	1	hg19	c.737C>A	CCDS7897.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.7|21.7	4.188320|4.188320	0.78789|0.78789	.|.	.|.	ENSG00000026508|ENSG00000026508	ENST00000525685|ENST00000433354;ENST00000449691;ENST00000437706;ENST00000428726	.|.	.|.	.|.	4.74|4.74	2.86|2.86	0.33363|0.33363	4.74|4.74	2.86|2.86	0.33363|0.33363	.|.	.|0.325033	.|0.22362	.|N	.|0.061071	T|.	0.30510|.	0.0767|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.08411|.	-1.0723|.	4|.	.|0.05959	.|T	.|0.93	-0.231|-0.231	7.7276|7.7276	0.28769|0.28769	0.0:0.8031:0.0:0.1969|0.0:0.8031:0.0:0.1969	.|.	.|.	.|.	.|.	N|X	114|246	.|.	.|ENSP00000398632:S246X	H|S	+|+	1|2	0|0	0|0	CD44|CD44	35174938|35174938	35174938|35174938	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.137000|0.137000	0.21094|0.21094	2.006000|2.006000	0.40874|0.40874	0.518000|0.518000	0.28383|0.28383	0.655000|0.655000	0.94253|0.94253	CAT|TCA	0.385908		TCGA-2J-AABO-01A-21D-A40W-08	0.383	CD44-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388927.1	0	0	1		2	2	2	0		0	0	48		48	48	1	3.570000	-6.154872	1	0.240000	NM_000610			5	5		276	273	0		1	0		0	0	48	0		0.936318	3.019456e-03	0	0	0	4	0	5	276
RAG1	5896	broad.mit.edu	37	11	36597180	36597180	+	Missense_Mutation	SNP	C	C	T	rs121918572		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr11:36597180C>T	ENST00000299440.5	+	2	2438	c.2326C>T	c.(2326-2328)Cgg>Tgg	p.R776W		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	776					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R776R(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				GGAAGAACTGCGGGATCGGGT	0.483									Familial Hemophagocytic Lymphohistiocytosis																												Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	ENST00000299440.5	1.000000	0.750000	1	8.800000e-01	0.990000	0.957324	0.990000	1.000000																										1	Substitution - coding silent(1)	p.R776R(1)	lung(1)	65	GRCh37	CM090373	RAG1	M	rs121918572	c.(2326-2328)Cgg>Tgg		recombination activating gene 1							80.0	78.0	79.0					11																	36597180		2202	4298	6500	SO:0001583	missense	5896	0	0		Familial Hemophagocytic Lymphohistiocytosis	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	g.chr11:36597180C>T	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.2326C>T	chr11.hg19:g.36597180C>T	ENSP00000299440:p.Arg776Trp	0						p.R776W	NM_000448.2	NP_000439	2	2	4	2.072671	P15918	RAG1_HUMAN		2	2438	+	all_lung(20;0.226)	all_hematologic(20;0.107)	E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	ENST00000299440.5	1	1	hg19	c.2326C>T	CCDS7902.1	1	.	.	.	.	.	.	.	.	.	.	C	16.34	3.095241	0.56075	.	.	ENSG00000166349	ENST00000534663;ENST00000299440	D;D	0.88046	-2.33;-2.33	6.13	-0.167	0.13347	6.13	-0.167	0.13347	.	0.000000	0.85682	D	0.000000	D	0.95345	0.8489	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96683	0.9505	10	0.87932	D	0	.	18.3544	0.90352	0.5232:0.4768:0.0:0.0	.	776	P15918	RAG1_HUMAN	W	776	ENSP00000434610:R776W;ENSP00000299440:R776W	ENSP00000299440:R776W	R	+	1	2	2	RAG1	36553756	36553756	0.995000	0.38212	0.906000	0.35671	0.895000	0.52256	0.749000	0.26320	0.086000	0.17137	0.644000	0.83932	CGG	0.385908		TCGA-2J-AABO-01A-21D-A40W-08	0.483	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389535.1	1	0	1		2	2	2	0		0	0	75		75	73	1	3.570000	-13.737970	1	0.240000	NM_000448			42	42		382	378	0		1	0		0	0	75	0		1.000000	0	0	0	0	1	0	42	382
OR5M1	390168	broad.mit.edu	37	11	56380401	56380401	+	Missense_Mutation	SNP	C	C	T	rs553800236		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr11:56380401C>T	ENST00000526538.1	-	1	577	c.578G>A	c.(577-579)cGt>cAt	p.R193H		NM_001004740.1	NP_001004740.1	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M, member 1	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|upper_aerodigestive_tract(1)	12						CTTTTTGACACGGGTGTCAGA	0.433																																						ENST00000526538.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				12						c.(577-579)cGt>cAt		olfactory receptor, family 5, subfamily M, member 1							56.0	53.0	54.0					11																	56380401		1889	4106	5995	SO:0001583	missense	390168	2	120828	33				g.chr11:56380401C>T	AB065742	CCDS53631.1	11q11	2012-08-09				ENSG00000255012		"""GPCR / Class A : Olfactory receptors"""	8352	protein-coding gene	gene with protein product							Standard	NM_001004740		Approved	OST050	uc001nja.1	Q8NGP8		ENST00000526538.1:c.578G>A	chr11.hg19:g.56380401C>T	ENSP00000435416:p.Arg193His	0						p.R193H	NM_001004740.1	NP_001004740.1	2	2	4	2.072671	Q8NGP8	OR5M1_HUMAN		1	577	-			Q6IF60|Q96RB6	Missense_Mutation	SNP	ENST00000526538.1	1	1	hg19	c.578G>A	CCDS53631.1	1	.	.	.	.	.	.	.	.	.	.	C	0	-2.616311	0.00120	.	.	ENSG00000255012	ENST00000526538	T	0.00076	8.76	3.71	-2.03	0.07365	3.71	-2.03	0.07365	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	N	0.01742	-0.745	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.14337	-1.0476	9	0.02654	T	1	-10.5846	7.7176	0.28712	0.0:0.179:0.546:0.2751	.	193	Q8NGP8	OR5M1_HUMAN	H	193	ENSP00000435416:R193H	ENSP00000435416:R193H	R	-	2	0	0	OR5M1	56136977	56136977	0.000000	0.05858	0.020000	0.16555	0.104000	0.19210	-1.808000	0.01732	-0.719000	0.04942	-1.820000	0.00599	CGT	0.385908		TCGA-2J-AABO-01A-21D-A40W-08	0.433	OR5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391610.1	1	0	1		2	2	2	0		0	0	37		37	55	1	3.570000	-20.000000	1	0.240000	NM_001004740			62	58		230	215	0		1			0	0	37	0		1.000000	0	0	0	0	0	0	62	230
TNKS1BP1	85456	broad.mit.edu	37	11	57076887	57076887	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr11:57076887C>T	ENST00000532437.1	-	5	3609	c.3298G>A	c.(3298-3300)Gca>Aca	p.A1100T	TNKS1BP1_ENST00000530920.1_5'Flank|TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.A1100T			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	1100	Acidic.|Gly-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				CTAAATGCTGCCTCTCGCTGG	0.607																																						ENST00000532437.1	1.000000	0.600000	1	7.300000e-01	0.870000	0.866442	0.870000	1.000000																										0				64						c.(3298-3300)Gca>Aca		tankyrase 1 binding protein 1, 182kDa							80.0	70.0	74.0					11																	57076887		2201	4296	6497	SO:0001583	missense	85456	0	0					g.chr11:57076887C>T	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.3298G>A	chr11.hg19:g.57076887C>T	ENSP00000437271:p.Ala1100Thr	0					TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.A1100T|TNKS1BP1_ENST00000530920.1_5'Flank	p.A1100T			2	2	4	2.072671	Q9C0C2	TB182_HUMAN		5	3609	-		all_epithelial(135;0.21)	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	1	1	hg19	c.3298G>A	CCDS7951.1	1	.	.	.	.	.	.	.	.	.	.	C	8.741	0.918881	0.17982	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.31769	1.48;1.48	5.05	-0.935	0.10423	5.05	-0.935	0.10423	.	1.600840	0.03626	N	0.237178	T	0.24044	0.0582	L	0.44542	1.39	0.09310	N	1	B	0.23937	0.094	B	0.23419	0.046	T	0.15009	-1.0452	10	0.26408	T	0.33	0.0635	3.3819	0.07257	0.1927:0.3151:0.0:0.4922	.	1100	Q9C0C2	TB182_HUMAN	T	1100	ENSP00000350990:A1100T;ENSP00000437271:A1100T	ENSP00000350990:A1100T	A	-	1	0	0	TNKS1BP1	56833463	56833463	0.000000	0.05858	0.005000	0.12908	0.056000	0.15407	-1.427000	0.02441	-0.048000	0.13401	-0.379000	0.06801	GCA	0.385908		TCGA-2J-AABO-01A-21D-A40W-08	0.607	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	1	0	1		2	2	2	0		0	0	60		60	57	1	3.570000	-20.000000	1	0.240000	NM_033396			30	30		326	326	1		1	1		0	0	60	0		1.000000	9.999795e-01	0	25	0	158	0	30	326
HRASLS5	117245	broad.mit.edu	37	11	63233706	63233706	+	Missense_Mutation	SNP	G	G	A	rs80217781		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr11:63233706G>A	ENST00000301790.4	-	5	782	c.623C>T	c.(622-624)cCg>cTg	p.P208L	HRASLS5_ENST00000540857.1_Missense_Mutation_p.P198L|HRASLS5_ENST00000539221.1_Missense_Mutation_p.P208L			Q96KN8	HRSL5_HUMAN	HRAS-like suppressor family, member 5	208							transferase activity, transferring acyl groups (GO:0016746)			endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	14						CTTGTCCACCGGCAAGGGCAG	0.512													G|||	1	0.000199681	0.0	0.0	5008	,	,		20216	0.001		0.0	False		,,,				2504	0.0					ENST00000301790.4	0.950000	0.410000	8.000000e-01	5.200000e-01	0.650000	0.662595	0.650000	0.640000																										0				14						c.(622-624)cCg>cTg		HRAS-like suppressor family, member 5							222.0	168.0	186.0					11																	63233706		2201	4298	6499	SO:0001583	missense	117245	6	121412	40				g.chr11:63233706G>A	AJ416558	CCDS8044.1, CCDS53646.1, CCDS53647.1	11q13.2	2006-08-16			ENSG00000168004	ENSG00000168004			24978	protein-coding gene	gene with protein product		611474					Standard	NM_001146729		Approved	HRLP5	uc001nwy.2	Q96KN8	OTTHUMG00000167806	ENST00000301790.4:c.623C>T	chr11.hg19:g.63233706G>A	ENSP00000301790:p.Pro208Leu	0					HRASLS5_ENST00000540857.1_Missense_Mutation_p.P198L|HRASLS5_ENST00000539221.1_Missense_Mutation_p.P208L	p.P208L			2	2	4	2.072671	Q96KN8	HRSL5_HUMAN		5	782	-			B7X6T1|F5GZ87|F5H4Y9	Missense_Mutation	SNP	ENST00000301790.4	1	1	hg19	c.623C>T	CCDS8044.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	16.40	3.113436	0.56398	.	.	ENSG00000168004	ENST00000540857;ENST00000539221;ENST00000301790	T;T;T	0.23552	1.9;1.9;1.9	4.16	4.16	0.48862	4.16	4.16	0.48862	NC (1);	0.211175	0.39083	N	0.001474	T	0.51787	0.1695	M	0.82433	2.59	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.995;0.997	T	0.55405	-0.8146	10	0.59425	D	0.04	-17.8362	12.2645	0.54670	0.0:0.0:1.0:0.0	.	208;198;208	F5GZ87;F5H4Y9;Q96KN8	.;.;HRSL5_HUMAN	L	198;208;208	ENSP00000444809:P198L;ENSP00000443873:P208L;ENSP00000301790:P208L	ENSP00000301790:P208L	P	-	2	0	0	HRASLS5	62990282	62990282	1.000000	0.71417	0.966000	0.40874	0.106000	0.19336	4.885000	0.63142	2.618000	0.88619	0.650000	0.86243	CCG	0.385908		TCGA-2J-AABO-01A-21D-A40W-08	0.512	HRASLS5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396375.1	1	0	1		2	2	2	0		0	0	78		78	77	1	3.570000	-2.690179	1	0.240000	NM_054108			22	22		332	330	0		1	0		0	0	78	0		0.999999	1.242332e-02	0	0	0	3	0	22	332
FAT3	120114	broad.mit.edu	37	11	92600211	92600211	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr11:92600211C>T	ENST00000298047.6	+	21	11980	c.11963C>T	c.(11962-11964)tCg>tTg	p.S3988L	FAT3_ENST00000525166.1_Missense_Mutation_p.S3838L|FAT3_ENST00000409404.2_Missense_Mutation_p.S3988L|FAT3_ENST00000533797.1_Missense_Mutation_p.S323L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3988	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S3988L(2)|p.S563L(1)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGCCTGGACTCGGTGATACTG	0.617										TCGA Ovarian(4;0.039)																												ENST00000298047.6	1.000000	0.750000	1	9.900000e-01	0.990000	0.984272	0.990000	1.000000																										3	Substitution - Missense(3)	p.S3988L(2)|p.S563L(1)	endometrium(3)	85						c.(11962-11964)tCg>tTg		FAT atypical cadherin 3							10.0	13.0	12.0					11																	92600211		2016	4174	6190	SO:0001583	missense	120114	1	120146	31				g.chr11:92600211C>T	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.11963C>T	chr11.hg19:g.92600211C>T	ENSP00000298047:p.Ser3988Leu	0	TCGA Ovarian(4;0.039)				FAT3_ENST00000525166.1_Missense_Mutation_p.S3838L|FAT3_ENST00000533797.1_Missense_Mutation_p.S323L|FAT3_ENST00000409404.2_Missense_Mutation_p.S3988L	p.S3988L			2	2	4	2.072671	Q8TDW7	FAT3_HUMAN		21	11980	+		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	1	1	hg19	c.11963C>T		1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.334571	0.81801	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44	5.94	5.94	0.96194	5.94	5.94	0.96194	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	D	0.82476	0.5045	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;0.957	D;P	0.87578	0.998;0.781	T	0.82220	-0.0565	9	0.62326	D	0.03	.	20.3633	0.98874	0.0:1.0:0.0:0.0	.	3988;3988	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	L	3988;3988;3838;323	ENSP00000298047:S3988L;ENSP00000387040:S3988L;ENSP00000432586:S3838L;ENSP00000436399:S323L	ENSP00000298047:S3988L	S	+	2	0	0	FAT3	92239859	92239859	1.000000	0.71417	0.980000	0.43619	0.553000	0.35397	5.694000	0.68272	2.826000	0.97356	0.561000	0.74099	TCG	0.385908		TCGA-2J-AABO-01A-21D-A40W-08	0.617	FAT3-201	KNOWN	basic	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	24		24	24	1	3.570000	-14.536770	1	0.240000	NM_001008781			7	7		39	38	1		1			0	0	24	0		0.982143	0	0	0	0	0	0	7	39
CBL	867	broad.mit.edu	37	11	119144654	119144654	+	Missense_Mutation	SNP	G	G	C			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr11:119144654G>C	ENST00000264033.4	+	4	1043	c.667G>C	c.(667-669)Gct>Cct	p.A223P		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	223	Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|EF-hand-like.|Sufficient for interaction with EPHB1.				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		GGAGGCCATGGCTCTGAAATC	0.473			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																													ENST00000264033.4	1.000000	0.750000	1	8.900000e-01	0.990000	0.963851	0.990000	1.000000				"""Dom, Rec"""	yes			Dom, Rec	yes		11	11q23.3	11q23.3	867	T, Mis S, O	Cas-Br-M (murine) ecotropic retroviral transforming				L	L	MLL		AML, JMML, MDS		0				251						c.(667-669)Gct>Cct		Cbl proto-oncogene, E3 ubiquitin protein ligase							107.0	103.0	104.0					11																	119144654		2199	4295	6494	SO:0001583	missense	867	0	0		Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	g.chr11:119144654G>C	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.667G>C	chr11.hg19:g.119144654G>C	ENSP00000264033:p.Ala223Pro	0						p.A223P	NM_005188.3	NP_005179.2	2	2	4	2.072671	P22681	CBL_HUMAN		4	1043	+		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)	A3KMP8	Missense_Mutation	SNP	ENST00000264033.4	1	1	hg19	c.667G>C	CCDS8418.1	1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337068	0.81801	.	.	ENSG00000110395	ENST00000264033	D	0.83250	-1.7	5.48	5.48	0.80851	5.48	5.48	0.80851	Adaptor protein Cbl, PTB domain (1);EF-hand-like domain (1);Adaptor protein Cbl, EF hand-like (1);	0.000000	0.85682	D	0.000000	D	0.92583	0.7644	M	0.86740	2.835	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93244	0.6629	10	0.66056	D	0.02	-36.3416	19.3601	0.94434	0.0:0.0:1.0:0.0	.	223	P22681	CBL_HUMAN	P	223	ENSP00000264033:A223P	ENSP00000264033:A223P	A	+	1	0	0	CBL	118649864	118649864	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.852000	0.99516	2.593000	0.87608	0.491000	0.48974	GCT	0.385908		TCGA-2J-AABO-01A-21D-A40W-08	0.473	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388219.4	1	0	1		2	2	2	0		0	0	64		64	64	1	3.570000	-12.791490	1	0.240000	NM_005188			34	34		298	294	1		1	0		0	0	64	0		1.000000	1.126106e-02	0	0	0	2	0	34	298
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	1	3	4	2.055815	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.387097		TCGA-2J-AABO-01A-21D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	59		59	59	1	3.570000	-20.000000	1	0.240000	NM_033360			66	66		169	168	1		1	1	1	0	0	59	212		1.000000	7.045758e-01	1	6	112	2	312	66	169
KRT83	3889	broad.mit.edu	37	12	52715017	52715017	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr12:52715017C>T	ENST00000293670.3	-	1	165	c.103G>A	c.(103-105)Gcc>Acc	p.A35T		NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	35	Head.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CGGTAGGGGGCGGCGGTGATG	0.697																																					GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)	ENST00000293670.3	1.000000	0.670000	1	8.200000e-01	0.990000	0.934424	0.990000	1.000000																										0				32						c.(103-105)Gcc>Acc		keratin 83							25.0	33.0	30.0					12																	52715017		2183	4272	6455	SO:0001583	missense	3889	0	0					g.chr12:52715017C>T	X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.103G>A	chr12.hg19:g.52715017C>T	ENSP00000293670:p.Ala35Thr	1						p.A35T	NM_002282.3	NP_002273.3	1	3	4	1.990121	P78385	KRT83_HUMAN		1	165	-	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)		A1A4S9|B2RC21|Q6NT21|Q9NSB3	Missense_Mutation	SNP	ENST00000293670.3	1	1	hg19	c.103G>A	CCDS8823.1	1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.379703	0.42207	.	.	ENSG00000170523	ENST00000293670	D	0.87412	-2.25	4.55	3.66	0.41972	4.55	3.66	0.41972	.	0.000000	0.34580	U	0.003842	T	0.82181	0.4981	M	0.69358	2.11	0.29299	N	0.868803	B	0.15719	0.014	B	0.12837	0.008	T	0.74051	-0.3789	10	0.44086	T	0.13	.	3.659	0.08232	0.1679:0.577:0.163:0.0922	.	35	P78385	KRT83_HUMAN	T	35	ENSP00000293670:A35T	ENSP00000293670:A35T	A	-	1	0	0	KRT83	51001284	51001284	0.004000	0.15560	1.000000	0.80357	0.942000	0.58702	0.668000	0.25127	1.270000	0.44297	-0.140000	0.14226	GCC	0.364973		TCGA-2J-AABO-01A-21D-A40W-08	0.697	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405182.1	0	0	1		2	2	2	1		1	0	65		65	60	1	3.570000	-3.075756	1	0.240000	NM_002282			29	26		271	249	1		1			1	0	65	0		1.000000	0	0	0	0	0	0	29	271
OR6C6	283365	broad.mit.edu	37	12	55688832	55688832	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr12:55688832C>T	ENST00000358433.2	-	1	184	c.185G>A	c.(184-186)cGt>cAt	p.R62H		NM_001005493.1	NP_001005493.1	A6NF89	OR6C6_HUMAN	olfactory receptor, family 6, subfamily C, member 6	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						GGAGAAATTACGGAGAAAGAA	0.388																																						ENST00000358433.2	1.000000	0.600000	1	7.400000e-01	0.920000	0.888341	0.920000	1.000000																										0				20						c.(184-186)cGt>cAt		olfactory receptor, family 6, subfamily C, member 6							64.0	67.0	66.0					12																	55688832		2203	4300	6503	SO:0001583	missense	283365	3	121400	39				g.chr12:55688832C>T		CCDS31817.1	12q13.13	2012-08-09			ENSG00000188324	ENSG00000188324		"""GPCR / Class A : Olfactory receptors"""	31293	protein-coding gene	gene with protein product							Standard	NM_001005493		Approved		uc010sph.2	A6NF89	OTTHUMG00000168101	ENST00000358433.2:c.185G>A	chr12.hg19:g.55688832C>T	ENSP00000351211:p.Arg62His	1						p.R62H	NM_001005493.1	NP_001005493.1	1	3	4	1.990121	A6NF89	OR6C6_HUMAN		1	184	-				Missense_Mutation	SNP	ENST00000358433.2	1	1	hg19	c.185G>A	CCDS31817.1	1	.	.	.	.	.	.	.	.	.	.	-	3.881	-0.025966	0.07589	.	.	ENSG00000188324	ENST00000358433	T	0.01084	5.36	4.24	0.321	0.15883	4.24	0.321	0.15883	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43919	D	0.000517	T	0.01800	0.0057	M	0.84219	2.685	0.09310	N	1	B	0.15719	0.014	B	0.12837	0.008	T	0.43065	-0.9414	10	0.66056	D	0.02	.	2.1956	0.03910	0.1224:0.4226:0.1199:0.335	.	62	A6NF89	OR6C6_HUMAN	H	62	ENSP00000351211:R62H	ENSP00000351211:R62H	R	-	2	0	0	OR6C6	53975099	53975099	0.000000	0.05858	0.001000	0.08648	0.063000	0.16089	-1.335000	0.02662	-0.046000	0.13446	-1.274000	0.01402	CGT	0.364973		TCGA-2J-AABO-01A-21D-A40W-08	0.388	OR6C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398151.1	1	0	1		2	2	2	0		0	0	45		45	42	1	3.570000	-3.318793	1	0.240000				25	25		259	259	0		1			0	0	45	0		1.000000	0	0	0	0	0	0	25	259
ITGA7	3679	broad.mit.edu	37	12	56082681	56082681	+	Missense_Mutation	SNP	G	G	A	rs17857368		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr12:56082681G>A	ENST00000555728.1	-	23	3065	c.3037C>T	c.(3037-3039)Cgc>Tgc	p.R1013C	ITGA7_ENST00000394230.2_Missense_Mutation_p.R973C|ITGA7_ENST00000452168.2_Missense_Mutation_p.R876C|ITGA7_ENST00000553804.1_Missense_Mutation_p.R973C|ITGA7_ENST00000394229.2_Missense_Mutation_p.R969C|ITGA7_ENST00000257879.6_Missense_Mutation_p.R969C|ITGA7_ENST00000347027.6_Missense_Mutation_p.R963C|ITGA7_ENST00000257880.7_Missense_Mutation_p.R1013C			Q13683	ITA7_HUMAN	integrin, alpha 7	1013				R -> H (in Ref. 8; AAH50280). {ECO:0000305}.	blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						ACAGCCGCGCGGTCAAAGCTG	0.587																																						ENST00000555728.1	1.000000	0.220000	6.900000e-01	3.100000e-01	0.430000	0.508979	0.430000	0.400000																										0				50						c.(3037-3039)Cgc>Tgc		integrin, alpha 7		G	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	71.0	73.0	72.0		2917,2626,2905	4.6	1.0	12	dbSNP_123	72	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	ITGA7	NM_001144996.1,NM_001144997.1,NM_002206.2	180,180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	973/1142,876/1045,969/1138	56082681	1,13005	2203	4300	6503	SO:0001583	missense	3679	2	121412	35				g.chr12:56082681G>A		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.3037C>T	chr12.hg19:g.56082681G>A	ENSP00000452387:p.Arg1013Cys	1					ITGA7_ENST00000452168.2_Missense_Mutation_p.R876C|ITGA7_ENST00000394229.2_Missense_Mutation_p.R969C|ITGA7_ENST00000553804.1_Missense_Mutation_p.R973C|ITGA7_ENST00000347027.6_Missense_Mutation_p.R963C|ITGA7_ENST00000257880.7_Missense_Mutation_p.R1013C|ITGA7_ENST00000257879.6_Missense_Mutation_p.R969C|ITGA7_ENST00000394230.2_Missense_Mutation_p.R973C	p.R1013C			1	3	4	1.990121	Q13683	ITA7_HUMAN		23	3065	-			B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Missense_Mutation	SNP	ENST00000555728.1	1	1	hg19	c.3037C>T		0	.	.	.	.	.	.	.	.	.	.	G	15.11	2.737426	0.49045	0.0	1.16E-4	ENSG00000135424	ENST00000553804;ENST00000257879;ENST00000347027;ENST00000452168;ENST00000257880;ENST00000394230;ENST00000394229;ENST00000353687;ENST00000555728	T;T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63	5.45	4.56	0.56223	5.45	4.56	0.56223	.	0.203366	0.42682	D	0.000663	T	0.52613	0.1745	L	0.50333	1.59	0.42430	D	0.992676	D;P;D;D	0.67145	0.959;0.843;0.984;0.996	P;P;P;P	0.51701	0.663;0.462;0.663;0.677	T	0.57365	-0.7824	10	0.62326	D	0.03	.	13.5445	0.61695	0.0:0.0:0.843:0.157	.	876;1013;973;1032	Q13683-13;Q13683;Q13683-3;Q4LE35	.;ITA7_HUMAN;.;.	C	973;969;963;876;1013;973;969;842;1013	ENSP00000452120:R973C;ENSP00000257879:R969C;ENSP00000343009:R963C;ENSP00000393844:R876C;ENSP00000257880:R1013C;ENSP00000377777:R973C;ENSP00000377776:R969C;ENSP00000452387:R1013C	ENSP00000257879:R969C	R	-	1	0	0	ITGA7	54368948	54368948	1.000000	0.71417	0.992000	0.48379	0.204000	0.24138	3.754000	0.55189	1.311000	0.45024	-0.164000	0.13417	CGC	0.364973		TCGA-2J-AABO-01A-21D-A40W-08	0.587	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	1	0	1		2	2	2	0		0	0	40		40	38	1	3.570000	-2.695214	1	0.240000	NM_002206			12	11		286	280	0		1	0		0	0	40	0		0.999036	4.626831e-02	0	0	0	8	0	12	286
ERBB3	2065	broad.mit.edu	37	12	56480377	56480377	+	Missense_Mutation	SNP	G	G	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr12:56480377G>T	ENST00000267101.3	+	4	924	c.484G>T	c.(484-486)Gac>Tac	p.D162Y	ERBB3_ENST00000450146.2_Intron|ERBB3_ENST00000415288.2_Missense_Mutation_p.D103Y	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	162					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			GGACACAATTGACTGGAGGGA	0.502																																						ENST00000267101.3	1.000000	0.050000	2.700000e-01	9.000000e-02	0.150000	0.268143	0.150000	0.140000																										0				8						c.(484-486)Gac>Tac		v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3							269.0	222.0	238.0					12																	56480377		2203	4300	6503	SO:0001583	missense	2065	0	0					g.chr12:56480377G>T	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.484G>T	chr12.hg19:g.56480377G>T	ENSP00000267101:p.Asp162Tyr	1					ERBB3_ENST00000450146.2_Intron|ERBB3_ENST00000415288.2_Missense_Mutation_p.D103Y	p.D162Y	NM_001982.3	NP_001973.2	1	3	4	1.990121	P21860	ERBB3_HUMAN	OV - Ovarian serous cystadenocarcinoma(18;0.112)	4	924	+			A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	0	1	hg19	c.484G>T	CCDS31833.1	0	.	.	.	.	.	.	.	.	.	.	G	6.957	0.546455	0.13312	.	.	ENSG00000065361	ENST00000549061;ENST00000267101;ENST00000394099;ENST00000549672;ENST00000415288	D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8	5.81	5.81	0.92471	5.81	5.81	0.92471	EGF receptor, L domain (1);	0.073073	0.56097	D	0.000028	T	0.80188	0.4577	M	0.66439	2.03	0.80722	D	1	P	0.38863	0.65	B	0.33392	0.163	T	0.78157	-0.2313	10	0.22706	T	0.39	.	17.0026	0.86384	0.0:0.0:1.0:0.0	.	162	P21860	ERBB3_HUMAN	Y	103;162;162;103;103	ENSP00000449138:D103Y;ENSP00000267101:D162Y;ENSP00000449713:D103Y;ENSP00000408340:D103Y	ENSP00000267101:D162Y	D	+	1	0	0	ERBB3	54766644	54766644	0.848000	0.29623	0.998000	0.56505	0.995000	0.86356	1.181000	0.32017	2.753000	0.94483	0.650000	0.86243	GAC	0.364973		TCGA-2J-AABO-01A-21D-A40W-08	0.502	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3	0	0	1		2	2	2	0		0	0	135		135	133	1	3.570000	-2.844475	1	0.240000				8	8		587	580	0		1	0		0	0	135	0		0.988919	6.569473e-02	0	0	0	27	0	8	587
GAS2L3	283431	broad.mit.edu	37	12	101005850	101005850	+	Missense_Mutation	SNP	G	G	A	rs143611209	byFrequency	TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr12:101005850G>A	ENST00000539410.1	+	5	762	c.376G>A	c.(376-378)Gca>Aca	p.A126T	GAS2L3_ENST00000266754.5_Missense_Mutation_p.A126T|GAS2L3_ENST00000537247.1_Missense_Mutation_p.A22T|GAS2L3_ENST00000547754.1_Missense_Mutation_p.A126T			Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	126	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton organization (GO:0030036)|cell cycle arrest (GO:0007050)|microtubule cytoskeleton organization (GO:0000226)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	actin binding (GO:0003779)|microtubule binding (GO:0008017)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35						GGACAATACCGCAAACTTCCT	0.378																																						ENST00000539410.1	1.000000	0.010000	1.800000e-01	5.000000e-02	0.080000	0.217280	0.080000	0.070000																										0				35						c.(376-378)Gca>Aca		growth arrest-specific 2 like 3							204.0	193.0	197.0					12																	101005850		2203	4300	6503	SO:0001583	missense	283431	0	0					g.chr12:101005850G>A	AK095594	CCDS9079.1	12q23.1	2014-09-11			ENSG00000139354	ENSG00000139354			27475	protein-coding gene	gene with protein product							Standard	NM_174942		Approved		uc001thu.3	Q86XJ1	OTTHUMG00000170439	ENST00000539410.1:c.376G>A	chr12.hg19:g.101005850G>A	ENSP00000439672:p.Ala126Thr	1					GAS2L3_ENST00000547754.1_Missense_Mutation_p.A126T|GAS2L3_ENST00000266754.5_Missense_Mutation_p.A126T|GAS2L3_ENST00000537247.1_Missense_Mutation_p.A22T	p.A126T			1	3	4	1.990121	Q86XJ1	GA2L3_HUMAN		5	762	+			B2RCN2	Missense_Mutation	SNP	ENST00000539410.1	0	1	hg19	c.376G>A	CCDS9079.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.579672	0.96565	.	.	ENSG00000139354	ENST00000266754;ENST00000547754;ENST00000537247;ENST00000539410	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.81	5.81	0.92471	5.81	5.81	0.92471	Calponin homology domain (5);	0.054165	0.85682	D	0.000000	T	0.62036	0.2395	M	0.78916	2.43	0.53005	D	0.999965	D	0.55172	0.97	P	0.54590	0.756	T	0.62426	-0.6857	10	0.49607	T	0.09	-10.3724	20.1345	0.98019	0.0:0.0:1.0:0.0	.	126	Q86XJ1	GA2L3_HUMAN	T	126;126;22;126	ENSP00000266754:A126T;ENSP00000448955:A126T;ENSP00000442406:A22T;ENSP00000439672:A126T	ENSP00000266754:A126T	A	+	1	0	0	GAS2L3	99529981	99529981	1.000000	0.71417	0.994000	0.49952	0.980000	0.70556	9.437000	0.97535	2.763000	0.94921	0.558000	0.71614	GCA	0.364973		TCGA-2J-AABO-01A-21D-A40W-08	0.378	GAS2L3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409143.1	0	0	1		2	2	2	0		0	0	100		100	96	1	3.570000	-1.860603	0	0.240000	NM_174942			5	5		648	639	0		1	0		0	0	100	0		0.935449	0	0	0	0	1	0	5	648
DGKH	160851	broad.mit.edu	37	13	42764629	42764629	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr13:42764629C>A	ENST00000337343.4	+	16	2024	c.2003C>A	c.(2002-2004)gCt>gAt	p.A668D	DGKH_ENST00000261491.5_Missense_Mutation_p.A668D|DGKH_ENST00000379274.2_Missense_Mutation_p.A532D|DGKH_ENST00000540693.1_Missense_Mutation_p.A668D|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000536612.1_Missense_Mutation_p.A532D|DGKH_ENST00000538674.1_Missense_Mutation_p.A423D	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	668					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		AAGGAGGAAGCTAAAGATGAT	0.373																																						ENST00000337343.4	1.000000	0.580000	9.700000e-01	6.800000e-01	0.810000	0.818850	0.810000	1.000000																										0				43						c.(2002-2004)gCt>gAt		diacylglycerol kinase, eta							107.0	102.0	104.0					13																	42764629		2203	4300	6503	SO:0001583	missense	160851	0	0					g.chr13:42764629C>A	AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.2003C>A	chr13.hg19:g.42764629C>A	ENSP00000337572:p.Ala668Asp	0					DGKH_ENST00000540693.1_Missense_Mutation_p.A668D|DGKH_ENST00000261491.5_Missense_Mutation_p.A668D|DGKH_ENST00000379274.2_Missense_Mutation_p.A532D|DGKH_ENST00000536612.1_Missense_Mutation_p.A532D|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000538674.1_Missense_Mutation_p.A423D	p.A668D	NM_178009.3	NP_821077.1	2	2	4	2.050496	Q86XP1	DGKH_HUMAN		16	2024	+		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	1	1	hg19	c.2003C>A	CCDS9381.1	0	.	.	.	.	.	.	.	.	.	.	C	0.116	-1.132353	0.01756	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	T;T;T;T;T;T	0.79749	-1.3;-1.13;-1.3;-1.3;-1.3;1.95	4.33	-1.13	0.09775	4.33	-1.13	0.09775	.	3.830580	0.00397	N	0.000049	T	0.56232	0.1971	N	0.03608	-0.345	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.001;0.002;0.002;0.001	T	0.45279	-0.9272	10	0.26408	T	0.33	.	0.5744	0.00701	0.2823:0.3223:0.1171:0.2784	.	423;532;668;668	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	D	668;668;668;532;532;423	ENSP00000440823:A668D;ENSP00000337572:A668D;ENSP00000261491:A668D;ENSP00000368576:A532D;ENSP00000445114:A532D;ENSP00000441308:A423D	ENSP00000261491:A668D	A	+	2	0	0	DGKH	41662629	41662629	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	0.070000	0.14573	-0.164000	0.10927	-0.482000	0.04802	GCT	0.378679		TCGA-2J-AABO-01A-21D-A40W-08	0.373	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	0	0	1		2	2	2	0		0	0	99		99	97	1	3.570000	-10.809240	1	0.240000	NM_178009			39	39		459	453	0		1	0		0	0	99	0		1.000000	6.546906e-03	0	0	0	2	0	39	459
LMO7	4008	broad.mit.edu	37	13	76379654	76379654	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr13:76379654G>A	ENST00000321797.8	+	7	976	c.255G>A	c.(253-255)tgG>tgA	p.W85*	LMO7_ENST00000377534.3_Nonsense_Mutation_p.W370*|LMO7_ENST00000341547.4_Intron|LMO7_ENST00000465261.2_Nonsense_Mutation_p.W85*|RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000526202.1_Intron|LMO7_ENST00000357063.3_Nonsense_Mutation_p.W370*			Q8WWI1	LMO7_HUMAN	LIM domain 7	370	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		TGGAGAACTGGCCAACTGTAC	0.408																																						ENST00000321797.8	1.000000	0.040000	2.200000e-01	8.000000e-02	0.130000	0.189220	0.130000	0.120000																										0				56						c.(253-255)tgG>tgA		LIM domain 7							138.0	127.0	130.0					13																	76379654		1568	3582	5150	SO:0001587	stop_gained	4008	0	0					g.chr13:76379654G>A	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.255G>A	chr13.hg19:g.76379654G>A	ENSP00000317802:p.Trp85*	0					LMO7_ENST00000357063.3_Nonsense_Mutation_p.W370*|LMO7_ENST00000526202.1_Intron|LMO7_ENST00000377534.3_Nonsense_Mutation_p.W370*|LMO7_ENST00000465261.2_Nonsense_Mutation_p.W85*|LMO7_ENST00000341547.4_Intron|RP11-29G8.3_ENST00000563635.1_RNA	p.W85*			2	2	4	2.050496	Q8WWI1	LMO7_HUMAN		7	976	+		Breast(118;0.0992)	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Nonsense_Mutation	SNP	ENST00000321797.8	0	1	hg19	c.255G>A		0	.	.	.	.	.	.	.	.	.	.	G	47	13.323881	0.99734	.	.	ENSG00000136153	ENST00000357063;ENST00000377534;ENST00000321797;ENST00000465261;ENST00000526371	.	.	.	5.93	5.08	0.68730	5.93	5.08	0.68730	.	0.736359	0.13017	N	0.420363	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-3.7943	7.9747	0.30149	0.1313:0.0:0.7356:0.1331	.	.	.	.	X	370;370;85;85;85	.	ENSP00000317802:W85X	W	+	3	0	0	LMO7	75277655	75277655	0.959000	0.32827	0.897000	0.35233	0.811000	0.45836	1.639000	0.37176	1.499000	0.48617	0.563000	0.77884	TGG	0.378679		TCGA-2J-AABO-01A-21D-A40W-08	0.408	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	0	0	1		2	2	2	0		0	0	57		57	55	1	3.570000	-2.618869	1	0.240000	NM_005358			5	5		424	418	0		1			0	0	57	0		0.935549	0	0	0	0	0	0	5	424
TINF2	26277	broad.mit.edu	37	14	24709046	24709046	+	Missense_Mutation	SNP	G	G	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08			G	T	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr14:24709046G>T	ENST00000267415.7	-	9	1654	c.1313C>A	c.(1312-1314)cCt>cAt	p.P438H	TINF2_ENST00000538777.1_3'UTR|TINF2_ENST00000399423.4_3'UTR|TINF2_ENST00000540705.1_Missense_Mutation_p.P403H|TINF2_ENST00000558566.1_3'UTR|TINF2_ENST00000558510.1_5'Flank	NM_001099274.1	NP_001092744.1	Q9BSI4	TINF2_HUMAN	TERF1 (TRF1)-interacting nuclear factor 2	438					negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of protein ADP-ribosylation (GO:0010836)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of telomere maintenance (GO:0032206)|protein localization to chromosome (GO:0034502)|protein localization to chromosome, telomeric region (GO:0070198)|telomere assembly (GO:0032202)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	chromosome, telomeric region (GO:0000781)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinucleolar chromocenter (GO:0010370)	telomeric DNA binding (GO:0042162)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|prostate(1)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(265;0.0185)		GGAAGAAACAGGTATGGCACC	0.458									Congenital Dyskeratosis;Ataxia Pancytopenia syndrome																													ENST00000267415.7	1.000000	0.990000	1	9.900000e-01	0.990000	0.998523	0.990000	1.000000																										0				7						c.(1312-1314)cCt>cAt		TERF1 (TRF1)-interacting nuclear factor 2							86.0	88.0	87.0					14																	24709046		1909	4124	6033	SO:0001583	missense	26277	0	0		Congenital Dyskeratosis;Ataxia Pancytopenia syndrome	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita;Myelocerebellar disorder	g.chr14:24709046G>T	AF195512	CCDS41936.1, CCDS41937.1	14q12	2008-07-29				ENSG00000092330			11824	protein-coding gene	gene with protein product		604319				10581025, 18252230	Standard	NM_012461		Approved	TIN2	uc001woa.4	Q9BSI4		ENST00000267415.7:c.1313C>A	chr14.hg19:g.24709046G>T	ENSP00000267415:p.Pro438His	1					TINF2_ENST00000540705.1_Missense_Mutation_p.P403H|TINF2_ENST00000558566.1_3'UTR|TINF2_ENST00000558510.1_5'Flank|TINF2_ENST00000538777.1_3'UTR|TINF2_ENST00000399423.4_3'UTR	p.P438H	NM_001099274.1	NP_001092744.1	0	4	4	2.068840	Q9BSI4	TINF2_HUMAN		9	1654	-			B3W5Q7|Q9H904|Q9UHC2	Missense_Mutation	SNP	ENST00000267415.7	1	1	hg19	c.1313C>A	CCDS41936.1	1	.	.	.	.	.	.	.	.	.	.	G	12.07	1.828471	0.32329	.	.	ENSG00000092330	ENST00000267415;ENST00000540705	D;D	0.84660	-1.88;-1.88	5.49	2.15	0.27550	5.49	2.15	0.27550	.	1.805250	0.04023	U	0.300076	T	0.79707	0.4492	N	0.19112	0.55	0.09310	N	1	D;D	0.58268	0.982;0.982	P;P	0.47376	0.545;0.545	T	0.69117	-0.5230	10	0.62326	D	0.03	1.8398	5.8468	0.18671	0.1971:0.1654:0.6375:0.0	.	403;438	B4DFJ1;Q9BSI4	.;TINF2_HUMAN	H	438;403	ENSP00000267415:P438H;ENSP00000442154:P403H	ENSP00000267415:P438H	P	-	2	0	0	TINF2	23778886	23778886	0.004000	0.15560	0.001000	0.08648	0.016000	0.09150	1.259000	0.32956	0.641000	0.30601	0.563000	0.77884	CCT	0.387097		TCGA-2J-AABO-01A-21D-A40W-08	0.458	TINF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415406.2	1	0	1		2	2	2	0		0	0	50		50	49	1	3.570000	-2.745157	1	0.240000				40	38		266	260	1		1	1		0	0	50	0		1.000000	9.999532e-01	0	14	0	88	0	40	266
SEC23A	10484	broad.mit.edu	37	14	39524367	39524367	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr14:39524367C>T	ENST00000307712.6	-	14	2156	c.1639G>A	c.(1639-1641)Gac>Aac	p.D547N	SEC23A_ENST00000536508.1_Missense_Mutation_p.D421N|SEC23A_ENST00000537403.1_Missense_Mutation_p.D345N|SEC23A_ENST00000545328.2_Missense_Mutation_p.D518N	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	547					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		AGCTGTCTGTCCAGCCACCTA	0.418																																						ENST00000307712.6	0.240000	0.040000	1.900000e-01	7.000000e-02	0.120000	0.135605	0.120000	0.120000																										0				23						c.(1639-1641)Gac>Aac		Sec23 homolog A (S. cerevisiae)							131.0	124.0	126.0					14																	39524367		2203	4300	6503	SO:0001583	missense	10484	0	0					g.chr14:39524367C>T	X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.1639G>A	chr14.hg19:g.39524367C>T	ENSP00000306881:p.Asp547Asn	1					SEC23A_ENST00000536508.1_Missense_Mutation_p.D421N|SEC23A_ENST00000537403.1_Missense_Mutation_p.D345N|SEC23A_ENST00000545328.2_Missense_Mutation_p.D518N	p.D547N	NM_006364.2	NP_006355.2	0	4	4	2.068840	Q15436	SC23A_HUMAN	Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	14	2156	-	Hepatocellular(127;0.213)		B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	ENST00000307712.6	0	1	hg19	c.1639G>A	CCDS9668.1	0	.	.	.	.	.	.	.	.	.	.	C	34	5.354537	0.95854	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328	D;D;D;D	0.97041	-4.22;-4.22;-4.22;-4.22	5.81	4.93	0.64822	5.81	4.93	0.64822	Sec23/Sec24, helical domain (2);	0.151418	0.64402	N	0.000016	D	0.99026	0.9667	H	0.97390	3.995	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.99120	1.0849	10	0.87932	D	0	-14.9158	14.8974	0.70654	0.0:0.9311:0.0:0.0689	.	518;421;547	F5H365;F5H6C4;Q15436	.;.;SC23A_HUMAN	N	345;547;421;518	ENSP00000444193:D345N;ENSP00000306881:D547N;ENSP00000437715:D421N;ENSP00000445393:D518N	ENSP00000306881:D547N	D	-	1	0	0	SEC23A	38594118	38594118	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.653000	0.83643	1.461000	0.47929	0.551000	0.68910	GAC	0.387097		TCGA-2J-AABO-01A-21D-A40W-08	0.418	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2	0	0	1		19	4	2	1		1	1	96		96	95	1	3.570000	-2.919573	1	0.240000				6	6		524	518	0		0	0		1	0	96	0		0.006153	5.623986e-03	0	0	0	47	0	6	524
DACT1	51339	broad.mit.edu	37	14	59113461	59113461	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr14:59113461C>T	ENST00000335867.4	+	4	2144	c.2120C>T	c.(2119-2121)gCg>gTg	p.A707V	DACT1_ENST00000556859.1_Missense_Mutation_p.A426V|DACT1_ENST00000541264.2_Missense_Mutation_p.A426V|DACT1_ENST00000395153.3_Missense_Mutation_p.A670V			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	707					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						CTGTACCCCGCGCCTGTGCCT	0.677																																						ENST00000335867.4	1.000000	0.370000	8.300000e-01	4.900000e-01	0.640000	0.665385	0.640000	1.000000																										0				53						c.(2119-2121)gCg>gTg		dishevelled-binding antagonist of beta-catenin 1							27.0	31.0	30.0					14																	59113461		2202	4299	6501	SO:0001583	missense	51339	0	0					g.chr14:59113461C>T	AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.2120C>T	chr14.hg19:g.59113461C>T	ENSP00000337439:p.Ala707Val	1					DACT1_ENST00000556859.1_Missense_Mutation_p.A426V|DACT1_ENST00000395153.3_Missense_Mutation_p.A670V|DACT1_ENST00000541264.2_Missense_Mutation_p.A426V	p.A707V			0	5	5	2.223129	Q9NYF0	DACT1_HUMAN		4	2144	+			A8MYJ2|Q86TY0	Missense_Mutation	SNP	ENST00000335867.4	1	1	hg19	c.2120C>T	CCDS9736.1	0	.	.	.	.	.	.	.	.	.	.	C	2.952	-0.216568	0.06101	.	.	ENSG00000165617	ENST00000556859;ENST00000395151;ENST00000395153;ENST00000335867;ENST00000541264	T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86	4.78	1.38	0.22167	4.78	1.38	0.22167	.	0.637842	0.14878	N	0.293151	T	0.36468	0.0968	L	0.41961	1.31	0.09310	N	1	B;B	0.13594	0.008;0.001	B;B	0.09377	0.004;0.002	T	0.22173	-1.0224	10	0.33940	T	0.23	-4.5278	9.1246	0.36807	0.0:0.7656:0.139:0.0955	.	670;707	A8MYJ2;Q9NYF0	.;DACT1_HUMAN	V	426;426;670;707;426	ENSP00000451598:A426V;ENSP00000378581:A426V;ENSP00000378582:A670V;ENSP00000337439:A707V;ENSP00000442850:A426V	ENSP00000337439:A707V	A	+	2	0	0	DACT1	58183214	58183214	0.000000	0.05858	0.001000	0.08648	0.024000	0.10985	0.296000	0.19083	0.157000	0.19338	-0.223000	0.12442	GCG	0.441176		TCGA-2J-AABO-01A-21D-A40W-08	0.677	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325515.1	1	0	1		2	2	2	0		0	0	60		60	56	1	3.570000	-17.218900	1	0.240000	NM_016651			14	14		237	230	0		1	0		0	0	60	0		0.999722	3.306226e-01	0	0	0	20	0	14	237
KCNH5	27133	broad.mit.edu	37	14	63174356	63174356	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr14:63174356C>T	ENST00000322893.7	-	11	3105	c.2837G>A	c.(2836-2838)aGc>aAc	p.S946N	KCNH5_ENST00000420622.2_3'UTR	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	946	CAD (involved in subunit assembly). {ECO:0000250}.				potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		CTGGGGTACGCTTTTTTCCGA	0.473																																						ENST00000322893.7	1.000000	0.780000	1	8.700000e-01	0.960000	0.945964	0.960000	1.000000																										0				99						c.(2836-2838)aGc>aAc		potassium voltage-gated channel, subfamily H (eag-related), member 5							132.0	142.0	139.0					14																	63174356		2203	4300	6503	SO:0001583	missense	27133	0	0					g.chr14:63174356C>T	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.2837G>A	chr14.hg19:g.63174356C>T	ENSP00000321427:p.Ser946Asn	1					KCNH5_ENST00000420622.2_3'UTR	p.S946N	NM_139318.3	NP_647479.2	0	5	5	2.223129	Q8NCM2	KCNH5_HUMAN		11	3105	-			C9JP98	Missense_Mutation	SNP	ENST00000322893.7	1	1	hg19	c.2837G>A	CCDS9756.1	1	.	.	.	.	.	.	.	.	.	.	C	0	-2.657147	0.00108	.	.	ENSG00000140015	ENST00000322893	D	0.98889	-5.21	5.66	3.73	0.42828	5.66	3.73	0.42828	.	0.225680	0.49916	D	0.000128	D	0.93354	0.7881	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	D	0.86737	0.1952	10	0.16896	T	0.51	.	3.934	0.09298	0.1606:0.5698:0.1557:0.1139	.	946	Q8NCM2	KCNH5_HUMAN	N	946	ENSP00000321427:S946N	ENSP00000321427:S946N	S	-	2	0	0	KCNH5	62244109	62244109	0.037000	0.19845	0.959000	0.39883	0.058000	0.15608	0.257000	0.18369	2.832000	0.97577	0.655000	0.94253	AGC	0.441176		TCGA-2J-AABO-01A-21D-A40W-08	0.473	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	1	0	1		2	2	2	1		1	0	132		132	130	1	3.570000	-19.913390	1	0.240000	NM_139318			93	91		998	990	0		1			1	0	132	0		1.000000	0	0	0	0	0	0	93	998
APBA2	321	broad.mit.edu	37	15	29346967	29346967	+	Missense_Mutation	SNP	G	G	A	rs375700005		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr15:29346967G>A	ENST00000558402.1	+	5	1479	c.880G>A	c.(880-882)Gga>Aga	p.G294R	APBA2_ENST00000558259.1_Missense_Mutation_p.G294R|APBA2_ENST00000558330.1_Missense_Mutation_p.G294R|APBA2_ENST00000561069.1_Missense_Mutation_p.G294R|APBA2_ENST00000411764.1_Missense_Mutation_p.G294R			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	294					in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		CAAGCACCCCGGAGACCCCCA	0.662																																						ENST00000558402.1	1.000000	0.350000	9.500000e-01	5.000000e-01	0.700000	0.719593	0.700000	1.000000																										0				59						c.(880-882)Gga>Aga		amyloid beta (A4) precursor protein-binding, family A, member 2		G	ARG/GLY,ARG/GLY	0,4400		0,0,2200	18.0	22.0	20.0		880,880	3.1	0.2	15		20	1,8571		0,1,4285	no	missense,missense	APBA2	NM_001130414.1,NM_005503.3	125,125	0,1,6485	AA,AG,GG		0.0117,0.0,0.0077	possibly-damaging,possibly-damaging	294/738,294/750	29346967	1,12971	2200	4286	6486	SO:0001583	missense	321	6	121178	36				g.chr15:29346967G>A	AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.880G>A	chr15.hg19:g.29346967G>A	ENSP00000453293:p.Gly294Arg	1					APBA2_ENST00000411764.1_Missense_Mutation_p.G294R|APBA2_ENST00000558259.1_Missense_Mutation_p.G294R|APBA2_ENST00000558330.1_Missense_Mutation_p.G294R|APBA2_ENST00000561069.1_Missense_Mutation_p.G294R	p.G294R			3	3	6	2.520175	Q99767	APBA2_HUMAN		5	1479	+		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)	E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	ENST00000558402.1	1	1	hg19	c.880G>A	CCDS10022.1	0	.	.	.	.	.	.	.	.	.	.	G	3.639	-0.073870	0.07184	0.0	1.17E-4	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.29655	1.56	4.96	3.08	0.35506	4.96	3.08	0.35506	.	0.685293	0.14091	N	0.342030	T	0.24122	0.0584	L	0.50333	1.59	0.09310	N	0.999998	P;P;P	0.49447	0.924;0.848;0.924	B;B;B	0.40940	0.344;0.271;0.344	T	0.07328	-1.0778	10	0.17369	T	0.5	.	7.6919	0.28573	0.2545:0.0:0.7455:0.0	.	294;294;294	Q5XKC0;E9PGI4;Q99767	.;.;APBA2_HUMAN	R	294	ENSP00000409312:G294R	ENSP00000219865:G294R	G	+	1	0	0	APBA2	27134259	27134259	0.997000	0.39634	0.217000	0.23759	0.186000	0.23388	3.084000	0.50143	1.075000	0.40932	-0.143000	0.13931	GGA	0.486486		TCGA-2J-AABO-01A-21D-A40W-08	0.662	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	1	0	1		2	2	2	0		0	0	24		24	21	1	3.570000	-12.114530	1	0.240000	NM_005503			9	9		155	152	0		1	0		0	0	24	0		0.994147	1.226170e-01	0	0	0	10	0	9	155
TMEM87A	25963	broad.mit.edu	37	15	42503943	42503943	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr15:42503943C>T	ENST00000389834.4	-	20	1895	c.1631G>A	c.(1630-1632)cGa>cAa	p.R544Q	RP11-546B15.1_ENST00000561800.1_RNA|TMEM87A_ENST00000448392.1_Missense_Mutation_p.R483Q|RP11-546B15.1_ENST00000563846.1_RNA	NM_015497.3	NP_056312.2	Q8NBN3	TM87A_HUMAN	transmembrane protein 87A	544						integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;1.03e-06)		TGTGATCATTCGTTCCTAGGG	0.368																																						ENST00000389834.4	1.000000	0.620000	9.100000e-01	7.100000e-01	0.800000	0.817080	0.800000	1.000000																										0				24						c.(1630-1632)cGa>cAa		transmembrane protein 87A							227.0	218.0	221.0					15																	42503943		2203	4299	6502	SO:0001583	missense	25963	0	0					g.chr15:42503943C>T	AF132733	CCDS32205.1, CCDS45243.1, CCDS66742.1	15q15.1	2005-10-30				ENSG00000103978			24522	protein-coding gene	gene with protein product						12477932	Standard	XM_005254287		Approved	DKFZP564G2022	uc021sjr.1	Q8NBN3		ENST00000389834.4:c.1631G>A	chr15.hg19:g.42503943C>T	ENSP00000374484:p.Arg544Gln	1					RP11-546B15.1_ENST00000563846.1_RNA|RP11-546B15.1_ENST00000561800.1_RNA|TMEM87A_ENST00000448392.1_Missense_Mutation_p.R483Q	p.R544Q	NM_015497.3	NP_056312.2	3	3	6	2.491455	Q8NBN3	TM87A_HUMAN		20	1895	-		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)	Q6NT77|Q8NCA4|Q9BS46|Q9P103|Q9Y3Y7	Missense_Mutation	SNP	ENST00000389834.4	1	1	hg19	c.1631G>A	CCDS32205.1	0	.	.	.	.	.	.	.	.	.	.	C	14.77	2.635366	0.47049	.	.	ENSG00000103978	ENST00000389834;ENST00000448392;ENST00000535305	.	.	.	5.37	4.46	0.54185	5.37	4.46	0.54185	.	0.085860	0.49305	D	0.000141	T	0.31796	0.0808	N	0.19112	0.55	0.33298	D	0.564466	D	0.64830	0.994	P	0.47102	0.537	T	0.36866	-0.9730	9	0.20519	T	0.43	-6.2906	12.5403	0.56165	0.0:0.9238:0.0:0.0762	.	544	Q8NBN3	TM87A_HUMAN	Q	544;483;520	.	ENSP00000374484:R544Q	R	-	2	0	0	TMEM87A	40291235	40291235	1.000000	0.71417	1.000000	0.80357	0.456000	0.32438	2.962000	0.49176	1.501000	0.48654	-0.145000	0.13849	CGA	0.486486		TCGA-2J-AABO-01A-21D-A40W-08	0.368	TMEM87A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420482.2	0	0	1		2	2	2	0		0	0	142		142	139	1	3.570000	-10.638730	1	0.240000	NM_015497			66	66		940	918	0		1	1		0	0	142	0		1.000000	9.996362e-01	0	12	0	150	0	66	940
VPS13C	54832	broad.mit.edu	37	15	62283987	62283987	+	Silent	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr15:62283987C>T	ENST00000261517.5	-	17	1441	c.1368G>A	c.(1366-1368)ggG>ggA	p.G456G	VPS13C_ENST00000249837.3_Silent_p.G413G|VPS13C_ENST00000395896.4_Silent_p.G456G|VPS13C_ENST00000395898.3_Silent_p.G413G	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)									p.G456G(1)		NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TTAATTTTTGCCCAGACCGAA	0.383																																						ENST00000261517.5	0.190000	0.010000	1.400000e-01	4.000000e-02	0.090000	0.101188	0.090000	0.120000																										1	Substitution - coding silent(1)	p.G456G(1)	prostate(1)	117						c.(1366-1368)ggG>ggA		vacuolar protein sorting 13 homolog C (S. cerevisiae)							125.0	131.0	129.0					15																	62283987		2203	4300	6503	SO:0001819	synonymous_variant	54832	10	121412	43				g.chr15:62283987C>T	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.1368G>A	chr15.hg19:g.62283987C>T		1					VPS13C_ENST00000395896.4_Silent_p.G456G|VPS13C_ENST00000395898.3_Silent_p.G413G|VPS13C_ENST00000249837.3_Silent_p.G413G	p.G456G	NM_020821.2	NP_065872.1	3	3	6	2.491455				17	1441	-				Silent	SNP	ENST00000261517.5	0	1	hg19	c.1368G>A	CCDS32257.1	0																																																																																								0.486486		TCGA-2J-AABO-01A-21D-A40W-08	0.383	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	0	0	1		2	2	2	0		0	0	120		120	119	1	3.570000	-1.757035	0	0.240000	NM_017684			7	7		945	934	0		1			0	0	120	0		0.979791	0	0	0	0	0	0	7	945
PPCDC	60490	broad.mit.edu	37	15	75340906	75340906	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr15:75340906C>T	ENST00000342932.3	+	5	517	c.373C>T	c.(373-375)Cgg>Tgg	p.R125W	PPCDC_ENST00000563393.1_Missense_Mutation_p.R2W|PPCDC_ENST00000567336.1_Missense_Mutation_p.R93W|PPCDC_ENST00000568649.1_Missense_Mutation_p.R82W|PPCDC_ENST00000564923.1_Missense_Mutation_p.R50W	NM_021823.3	NP_068595.3	Q96CD2	COAC_HUMAN	phosphopantothenoylcysteine decarboxylase	125					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	phosphopantothenoylcysteine decarboxylase activity (GO:0004633)			breast(1)|cervix(1)	2						CTGCGTCATGCGGGCCTGGGA	0.662																																						ENST00000342932.3	0.320000	0.040000	2.400000e-01	9.000000e-02	0.150000	0.172269	0.150000	0.130000																										0				2						c.(373-375)Cgg>Tgg		phosphopantothenoylcysteine decarboxylase							52.0	52.0	52.0					15																	75340906		2197	4295	6492	SO:0001583	missense	60490	1	121412	34				g.chr15:75340906C>T	AK027491	CCDS10275.1, CCDS73761.1, CCDS73759.1, CCDS73760.1	15q24.2	2005-08-16			ENSG00000138621	ENSG00000138621	4.1.1.36		28107	protein-coding gene	gene with protein product		609854				12975309, 11923312	Standard	XM_005254579		Approved	MDS018, FLJ14585	uc002azo.3	Q96CD2	OTTHUMG00000142824	ENST00000342932.3:c.373C>T	chr15.hg19:g.75340906C>T	ENSP00000343190:p.Arg125Trp	1					PPCDC_ENST00000563393.1_Missense_Mutation_p.R2W|PPCDC_ENST00000567336.1_Missense_Mutation_p.R93W|PPCDC_ENST00000564923.1_Missense_Mutation_p.R50W|PPCDC_ENST00000568649.1_Missense_Mutation_p.R82W	p.R125W	NM_021823.3	NP_068595.3	3	3	6	2.508076	Q96CD2	COAC_HUMAN		5	517	+			Q96SX0|Q9HC17	Missense_Mutation	SNP	ENST00000342932.3	0	1	hg19	c.373C>T	CCDS10275.1	0	.	.	.	.	.	.	.	.	.	.	C	25.0	4.593241	0.86953	.	.	ENSG00000138621	ENST00000342932	T	0.49720	0.77	5.49	5.49	0.81192	5.49	5.49	0.81192	Flavoprotein (3);	0.050133	0.85682	D	0.000000	T	0.80308	0.4599	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86798	0.1990	10	0.72032	D	0.01	-24.5121	18.3618	0.90377	0.0:1.0:0.0:0.0	.	125	Q96CD2	COAC_HUMAN	W	125	ENSP00000343190:R125W	ENSP00000343190:R125W	R	+	1	2	2	PPCDC	73127959	73127959	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.512000	0.60469	2.592000	0.87571	0.655000	0.94253	CGG	0.486486		TCGA-2J-AABO-01A-21D-A40W-08	0.662	PPCDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286416.1	0	0	1		21	3	2	1		1	1	62		62	61	1	3.570000	-2.386566	0	0.240000	NM_021823			5	5		421	413	0		0	0		1	0	62	0		0.000893	7.783681e-03	0	0	0	26	0	5	421
ZNF646	9726	broad.mit.edu	37	16	31091179	31091179	+	Silent	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr16:31091179G>A	ENST00000394979.2	+	1	3957	c.3534G>A	c.(3532-3534)aaG>aaA	p.K1178K	ZNF646_ENST00000300850.5_Silent_p.K1178K			O15015	ZN646_HUMAN	zinc finger protein 646	1178					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						CCACTGTGAAGGGGGAGGAGA	0.602																																						ENST00000394979.2	1.000000	0.570000	1	7.900000e-01	0.990000	0.925121	0.990000	1.000000																										0				49						c.(3532-3534)aaG>aaA		zinc finger protein 646							34.0	42.0	40.0					16																	31091179		2195	4299	6494	SO:0001819	synonymous_variant	9726	0	0					g.chr16:31091179G>A	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.3534G>A	chr16.hg19:g.31091179G>A		1					ZNF646_ENST00000300850.5_Silent_p.K1178K	p.K1178K			1	2	3	1.838746	O15015	ZN646_HUMAN		1	3957	+			Q8IVD8	Silent	SNP	ENST00000394979.2	0	1	hg19	c.3534G>A		1																																																																																								0.317774		TCGA-2J-AABO-01A-21D-A40W-08	0.602	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2	1	0	1		2	2	2	0		0	0	23		23	23	1	3.570000	-17.758920	1	0.240000	NM_014699			11	11		88	86	0		1	1		0	0	23	0		0.998489	2.466400e-01	0	2	0	6	0	11	88
CDH8	1006	broad.mit.edu	37	16	62055291	62055291	+	Missense_Mutation	SNP	G	G	A	rs369877864		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr16:62055291G>A	ENST00000577390.1	-	2	971	c.17C>T	c.(16-18)gCg>gTg	p.A6V	CDH8_ENST00000577730.1_Missense_Mutation_p.A6V|CDH8_ENST00000299345.6_Missense_Mutation_p.A6V|CDH8_ENST00000584337.1_Missense_Mutation_p.A6V	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	6					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GAGCATTTCCGCTAGCCGTTC	0.423																																						ENST00000577390.1	1.000000	0.640000	1	7.500000e-01	0.870000	0.874704	0.870000	1.000000																										0				112						c.(16-18)gCg>gTg		cadherin 8, type 2		G	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	56.0	60.0	58.0		17	3.2	1.0	16		58	0,8600		0,0,4300	no	missense	CDH8	NM_001796.4	64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	6/800	62055291	1,13005	2203	4300	6503	SO:0001583	missense	1006	12	121172	41				g.chr16:62055291G>A	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.17C>T	chr16.hg19:g.62055291G>A	ENSP00000462701:p.Ala6Val	0					CDH8_ENST00000577730.1_Missense_Mutation_p.A6V|CDH8_ENST00000299345.6_Missense_Mutation_p.A6V|CDH8_ENST00000584337.1_Missense_Mutation_p.A6V	p.A6V	NM_001796.4	NP_001787.2	2	2	4	2.042091	P55286	CADH8_HUMAN		2	971	-		Ovarian(137;0.0799)|Melanoma(118;0.16)	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	1	0	hg19	c.17C>T	CCDS10802.1	1	.	.	.	.	.	.	.	.	.	.	G	15.48	2.844972	0.51164	2.27E-4	0.0	ENSG00000150394	ENST00000299345	T	0.55234	0.53	6.17	3.2	0.36748	6.17	3.2	0.36748	.	0.270757	0.37393	N	0.002101	T	0.28134	0.0694	N	0.08118	0	0.27497	N	0.952113	B	0.02656	0.0	B	0.01281	0.0	T	0.12243	-1.0555	10	0.38643	T	0.18	.	6.8503	0.24010	0.2007:0.1268:0.6724:0.0	.	6	P55286	CADH8_HUMAN	V	6	ENSP00000299345:A6V	ENSP00000299345:A6V	A	-	2	0	0	CDH8	60612792	60612792	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.806000	0.38892	0.946000	0.37632	0.655000	0.94253	GCG	0.375000		TCGA-2J-AABO-01A-21D-A40W-08	0.423	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	1	0	1		2	2	2	0		0	0	120		120	116	1	3.570000	-1.422543	0	0.240000	NM_001796			45	45		484	476	0		1			0	0	120	0		1.000000	0	0	0	0	0	0	45	484
GFOD2	81577	broad.mit.edu	37	16	67709902	67709902	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr16:67709902C>T	ENST00000268797.7	-	3	659	c.314G>A	c.(313-315)cGg>cAg	p.R105Q	GFOD2_ENST00000602377.1_5'UTR	NM_030819.3	NP_110446.3	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain containing 2	105					extracellular matrix organization (GO:0030198)	proteinaceous extracellular matrix (GO:0005578)	oxidoreductase activity (GO:0016491)			breast(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)		TGTCACCATCCGGAAGGCATC	0.537																																						ENST00000268797.7	1.000000	0.500000	1	6.900000e-01	0.940000	0.876350	0.940000	1.000000																										0				19						c.(313-315)cGg>cAg		glucose-fructose oxidoreductase domain containing 2							70.0	51.0	58.0					16																	67709902		2198	4300	6498	SO:0001583	missense	81577	3	121410	29				g.chr16:67709902C>T	AK074382	CCDS10845.1, CCDS59268.1	16q22.1	2008-02-05			ENSG00000141098	ENSG00000141098			28159	protein-coding gene	gene with protein product						12975309	Standard	NM_030819		Approved	FLJ23802, MGC11335	uc002eub.3	Q3B7J2	OTTHUMG00000137537	ENST00000268797.7:c.314G>A	chr16.hg19:g.67709902C>T	ENSP00000268797:p.Arg105Gln	0					GFOD2_ENST00000602377.1_5'UTR	p.R105Q	NM_030819.3	NP_110446.3	2	2	4	2.042091	Q3B7J2	GFOD2_HUMAN		3	659	-		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)	Q69YL9|Q6UXX6|Q7L648|Q8TE86|Q9BQ07|R4GNG5	Missense_Mutation	SNP	ENST00000268797.7	0	1	hg19	c.314G>A	CCDS10845.1	1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.454598	0.84209	.	.	ENSG00000141098	ENST00000268797	T	0.23348	1.91	4.99	4.99	0.66335	4.99	4.99	0.66335	Oxidoreductase, N-terminal (1);NAD(P)-binding domain (1);	0.102199	0.64402	D	0.000004	T	0.24005	0.0581	L	0.51853	1.615	0.36424	D	0.864483	B	0.34103	0.437	B	0.33392	0.163	T	0.17561	-1.0365	10	0.22706	T	0.39	-34.9241	13.9291	0.63983	0.0:0.8474:0.1525:0.0	.	105	Q3B7J2	GFOD2_HUMAN	Q	105	ENSP00000268797:R105Q	ENSP00000268797:R105Q	R	-	2	0	0	GFOD2	66267403	66267403	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	2.401000	0.44513	2.468000	0.83385	0.563000	0.77884	CGG	0.375000		TCGA-2J-AABO-01A-21D-A40W-08	0.537	GFOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268868.2	1	0	1		2	2	2	0		0	0	18		18	17	1	3.570000	-16.565900	1	0.240000	NM_030819			11	11		114	114	0		1	1		0	0	18	0		0.998583	7.261357e-01	0	3	0	25	0	11	114
GPATCH8	23131	broad.mit.edu	37	17	42476539	42476539	+	Missense_Mutation	SNP	C	C	T	rs199963233		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr17:42476539C>T	ENST00000591680.1	-	8	2936	c.2906G>A	c.(2905-2907)cGa>cAa	p.R969Q	GPATCH8_ENST00000434000.1_Missense_Mutation_p.R891Q	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	969	Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		CCGCTTGCTTCGACTACGACT	0.642																																						ENST00000591680.1	1.000000	0.570000	1	6.900000e-01	0.840000	0.841535	0.840000	1.000000																										0				50						c.(2905-2907)cGa>cAa		G patch domain containing 8							39.0	39.0	39.0					17																	42476539		2203	4300	6503	SO:0001583	missense	23131	19	121408	45				g.chr17:42476539C>T	AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.2906G>A	chr17.hg19:g.42476539C>T	ENSP00000467556:p.Arg969Gln	1					GPATCH8_ENST00000434000.1_Missense_Mutation_p.R891Q	p.R969Q	NM_001002909.2	NP_001002909.1	2	3	5	2.278406	Q9UKJ3	GPTC8_HUMAN		8	2936	-		Prostate(33;0.0181)	B9EGP9|O60300|Q8TB99	Missense_Mutation	SNP	ENST00000591680.1	1	1	hg19	c.2906G>A	CCDS32666.1	0	.	.	.	.	.	.	.	.	.	.	C	16.08	3.020141	0.54576	.	.	ENSG00000186566	ENST00000335500;ENST00000434000	T	0.13538	2.58	5.2	5.2	0.72013	5.2	5.2	0.72013	.	0.064020	0.64402	D	0.000003	T	0.26738	0.0654	L	0.29908	0.895	0.58432	D	0.999998	D	0.89917	1.0	D	0.80764	0.994	T	0.01326	-1.1384	10	0.27785	T	0.31	-12.7963	18.9211	0.92525	0.0:1.0:0.0:0.0	.	969	Q9UKJ3	GPTC8_HUMAN	Q	969;891	ENSP00000395016:R891Q	ENSP00000335486:R969Q	R	-	2	0	0	GPATCH8	39832065	39832065	0.999000	0.42202	1.000000	0.80357	0.987000	0.75469	4.242000	0.58714	2.712000	0.92718	0.555000	0.69702	CGA	0.439693		TCGA-2J-AABO-01A-21D-A40W-08	0.642	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1	1	0	1		2	2	2	0		0	0	116		116	110	1	3.570000	-3.221887	1	0.240000	NM_001002909			27	26		338	323	0		1	1		0	0	116	0		1.000000	2.326852e-01	0	2	0	10	0	27	338
BZRAP1	9256	broad.mit.edu	37	17	56386380	56386380	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr17:56386380C>T	ENST00000343736.4	-	22	4416	c.4253G>A	c.(4252-4254)cGc>cAc	p.R1418H	BZRAP1_ENST00000355701.3_Missense_Mutation_p.R1418H|BZRAP1_ENST00000268893.6_Missense_Mutation_p.R1358H			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1418						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGGCCGCCTGCGGCTTGGGGG	0.662																																						ENST00000343736.4	1.000000	0.840000	1	9.500000e-01	0.990000	0.982853	0.990000	1.000000																										0				54						c.(4252-4254)cGc>cAc		benzodiazepine receptor (peripheral) associated protein 1							51.0	61.0	58.0					17																	56386380		2061	4106	6167	SO:0001583	missense	9256	3	119702	40				g.chr17:56386380C>T	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.4253G>A	chr17.hg19:g.56386380C>T	ENSP00000345824:p.Arg1418His	1					BZRAP1_ENST00000355701.3_Missense_Mutation_p.R1418H|BZRAP1_ENST00000268893.6_Missense_Mutation_p.R1358H	p.R1418H			2	3	5	2.291502	O95153	RIMB1_HUMAN		22	4416	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		O75111|Q8N5W3	Missense_Mutation	SNP	ENST00000343736.4	1	0	hg19	c.4253G>A	CCDS11605.1	1	.	.	.	.	.	.	.	.	.	.	c	11.12	1.545017	0.27652	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	T;T;T	0.04809	3.55;3.55;3.56	5.31	3.32	0.38043	5.31	3.32	0.38043	.	0.745690	0.13368	N	0.393144	T	0.04998	0.0134	L	0.32530	0.975	0.25701	N	0.98559	B;B;B	0.21821	0.042;0.061;0.036	B;B;B	0.16722	0.011;0.016;0.007	T	0.33394	-0.9870	10	0.87932	D	0	.	9.0355	0.36284	0.0:0.775:0.1461:0.0789	.	1418;1358;1418	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	H	1418;1418;1358	ENSP00000347929:R1418H;ENSP00000345824:R1418H;ENSP00000268893:R1358H	ENSP00000268893:R1358H	R	-	2	0	0	BZRAP1	53741379	53741379	0.997000	0.39634	0.935000	0.37517	0.512000	0.34134	1.834000	0.39171	0.637000	0.30526	-0.215000	0.12644	CGC	0.441176		TCGA-2J-AABO-01A-21D-A40W-08	0.662	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	1	0	1		2	2	2	0		0	0	124		124	72	1	3.570000	-19.218360	1	0.240000	NM_004758			70	40		668	371	0		1	0		0	0	124	0		1.000000	4.887261e-02	0	0	0	4	0	70	668
TEX14	56155	broad.mit.edu	37	17	56663333	56663333	+	Missense_Mutation	SNP	C	C	T	rs201086325		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr17:56663333C>T	ENST00000240361.8	-	18	3002	c.2917G>A	c.(2917-2919)Gcc>Acc	p.A973T	TEX14_ENST00000389934.3_Missense_Mutation_p.A967T|TEX14_ENST00000349033.5_Missense_Mutation_p.A967T			Q8IWB6	TEX14_HUMAN	testis expressed 14	973					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGCAGCAGGGCGTCGGGCTCA	0.507													C|||	1	0.000199681	0.0	0.0	5008	,	,		17724	0.001		0.0	False		,,,				2504	0.0					ENST00000240361.8	0.260000	0.060000	2.000000e-01	9.000000e-02	0.140000	0.153934	0.140000	0.150000																										0				81						c.(2917-2919)Gcc>Acc		testis expressed 14		C	THR/ALA,THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	140.0	140.0	140.0		2917,2899,2899	0.5	0.0	17		140	0,8600		0,0,4300	no	missense,missense,missense	TEX14	NM_001201457.1,NM_031272.4,NM_198393.3	58,58,58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	973/1498,967/1452,967/1492	56663333	1,13005	2203	4300	6503	SO:0001583	missense	56155	6	121412	42				g.chr17:56663333C>T	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.2917G>A	chr17.hg19:g.56663333C>T	ENSP00000240361:p.Ala973Thr	1					TEX14_ENST00000349033.5_Missense_Mutation_p.A967T|TEX14_ENST00000389934.3_Missense_Mutation_p.A967T	p.A973T			2	3	5	2.291502	Q8IWB6	TEX14_HUMAN		18	3002	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	0	1	hg19	c.2917G>A	CCDS56042.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	16.33	3.094030	0.56075	2.27E-4	0.0	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.81163	-1.46;-1.46;-1.42	5.38	0.501	0.16925	5.38	0.501	0.16925	.	0.525270	0.18903	N	0.128000	T	0.63283	0.2498	L	0.29908	0.895	0.09310	N	1	P;P;P	0.49185	0.87;0.92;0.92	B;B;B	0.40165	0.171;0.321;0.321	T	0.56872	-0.7907	10	0.40728	T	0.16	-1.9391	4.4542	0.11635	0.2296:0.3843:0.3861:0.0	.	973;967;967	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	T	973;967;967	ENSP00000240361:A973T;ENSP00000374584:A967T;ENSP00000268910:A967T	ENSP00000240361:A973T	A	-	1	0	0	TEX14	54018332	54018332	0.000000	0.05858	0.026000	0.17262	0.021000	0.10359	-0.221000	0.09202	0.601000	0.29879	-0.311000	0.09066	GCC	0.441176		TCGA-2J-AABO-01A-21D-A40W-08	0.507	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1	0	0	1		2	2	2	0		0	0	144		144	139	1	3.570000	-2.665977	1	0.240000				9	8		724	710	0		1			0	0	144	0		0.993680	0	0	0	0	0	0	9	724
TP53	7157	broad.mit.edu	37	17	7577141	7577141	+	Missense_Mutation	SNP	C	C	A	rs193920774		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr17:7577141C>A	ENST00000269305.4	-	8	986	c.797G>T	c.(796-798)gGa>gTa	p.G266V	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.G266V|TP53_ENST00000455263.2_Missense_Mutation_p.G266V|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.G266V|TP53_ENST00000420246.2_Missense_Mutation_p.G266V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	266	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G266E(50)|p.G266V(42)|p.0?(8)|p.?(3)|p.G266fs*79(3)|p.G262_F270delGNLLGRNSF(2)|p.G266A(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.G266T(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCTGTTCCGTCCCAGTAGATT	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		121	Substitution - Missense(95)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(6)|Unknown(3)	p.G266E(50)|p.G266V(42)|p.0?(8)|p.?(3)|p.G266fs*79(3)|p.G262_F270delGNLLGRNSF(2)|p.G266A(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.G266T(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)	lung(23)|oesophagus(10)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(9)|breast(9)|upper_aerodigestive_tract(8)|ovary(8)|urinary_tract(7)|pancreas(6)|skin(5)|central_nervous_system(4)|stomach(4)|bone(4)|liver(4)|endometrium(3)|vulva(1)|kidney(1)|thyroid(1)|cervix(1)|eye(1)|genital_tract(1)|biliary_tract(1)	24185						c.(796-798)gGa>gTa	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						50.0	44.0	46.0					17																	7577141		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577141C>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.797G>T	chr17.hg19:g.7577141C>A	ENSP00000269305:p.Gly266Val	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.G266V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.G266V|TP53_ENST00000420246.2_Missense_Mutation_p.G266V|TP53_ENST00000359597.4_Missense_Mutation_p.G266V|TP53_ENST00000413465.2_Intron	p.G266V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	2	2	1.661646	P04637	P53_HUMAN		8	986	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.797G>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388215	0.82902	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	5.13	5.13	0.70059	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99906	0.9955	M	0.92367	3.3	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.999	D	0.96190	0.9137	10	0.87932	D	0	-13.0798	16.1198	0.81342	0.0:1.0:0.0:0.0	.	266;266;266;266	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	V	266;266;266;266;266;255;134	ENSP00000352610:G266V;ENSP00000269305:G266V;ENSP00000398846:G266V;ENSP00000391127:G266V;ENSP00000391478:G266V;ENSP00000425104:G134V	ENSP00000269305:G266V	G	-	2	0	0	TP53	7517866	7517866	1.000000	0.71417	0.996000	0.52242	0.744000	0.42396	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	GGA	0.240000		TCGA-2J-AABO-01A-21D-A40W-08	0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	8	0		0	0	22		22	21	1	3.570000	-20.000000	1	0.240000	NM_000546			27	27		48	46	1		1	1	1	0	1	22	501		1.000000	9.998234e-01	1	15	208	15	578	27	48
UNC13D	201294	broad.mit.edu	37	17	73836181	73836181	+	Missense_Mutation	SNP	G	G	A	rs202020396		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr17:73836181G>A	ENST00000207549.4	-	11	1248	c.869C>T	c.(868-870)tCg>tTg	p.S290L	UNC13D_ENST00000587504.1_5'UTR|UNC13D_ENST00000412096.2_Missense_Mutation_p.S290L	NM_199242.2	NP_954712.1	Q70J99	UN13D_HUMAN	unc-13 homolog D (C. elegans)	290	Interaction with RAB27A.				defense response to virus (GO:0051607)|germinal center formation (GO:0002467)|granuloma formation (GO:0002432)|natural killer cell degranulation (GO:0043320)|phagocytosis (GO:0006909)|positive regulation of exocytosis (GO:0045921)|regulation of mast cell degranulation (GO:0043304)	endosome (GO:0005768)|exocytic vesicle (GO:0070382)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCGGCTGGCCGAAGTGGCTCT	0.667									Familial Hemophagocytic Lymphohistiocytosis				G|||	1	0.000199681	0.0	0.0	5008	,	,		13692	0.0		0.0	False		,,,				2504	0.001					ENST00000207549.4	1.000000	0.600000	1	8.700000e-01	0.990000	0.950712	0.990000	1.000000																										0				29	GRCh37	CM060506	UNC13D	M		c.(868-870)tCg>tTg		unc-13 homolog D (C. elegans)							25.0	29.0	28.0					17																	73836181		2203	4300	6503	SO:0001583	missense	201294	10	121296	39	Familial Hemophagocytic Lymphohistiocytosis	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	g.chr17:73836181G>A	AK024474	CCDS11730.1	17q25.3	2014-09-17				ENSG00000092929			23147	protein-coding gene	gene with protein product		608897					Standard	NM_199242		Approved	Munc13-4	uc002jpp.3	Q70J99		ENST00000207549.4:c.869C>T	chr17.hg19:g.73836181G>A	ENSP00000207549:p.Ser290Leu	1					UNC13D_ENST00000587504.1_5'UTR|UNC13D_ENST00000412096.2_Missense_Mutation_p.S290L	p.S290L	NM_199242.2	NP_954712.1	2	3	5	2.308995	Q70J99	UN13D_HUMAN	all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)	11	1248	-			B4DWG9|Q9H7K5	Missense_Mutation	SNP	ENST00000207549.4	0	1	hg19	c.869C>T	CCDS11730.1	1	.	.	.	.	.	.	.	.	.	.	G	5.902	0.350463	0.11182	.	.	ENSG00000092929	ENST00000207549;ENST00000412096;ENST00000448606	T;T	0.71341	-0.54;-0.56	4.35	-8.7	0.00851	4.35	-8.7	0.00851	.	2.024690	0.02792	N	0.122211	T	0.38878	0.1057	N	0.04203	-0.255	0.09310	N	1	B;B	0.25486	0.001;0.127	B;B	0.14023	0.001;0.01	T	0.39981	-0.9587	10	0.33940	T	0.23	0.942	1.8052	0.03079	0.4553:0.1975:0.1707:0.1765	.	290;290	B4DTQ6;Q70J99	.;UN13D_HUMAN	L	290	ENSP00000207549:S290L;ENSP00000388093:S290L	ENSP00000207549:S290L	S	-	2	0	0	UNC13D	71347776	71347776	0.000000	0.05858	0.000000	0.03702	0.353000	0.29299	-1.869000	0.01643	-3.304000	0.00192	-1.008000	0.02478	TCG	0.441176		TCGA-2J-AABO-01A-21D-A40W-08	0.667	UNC13D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448847.2	0	0	1		16	13	2	1		1	1	14		14	14	1	3.570000	-15.105500	1	0.240000	XM_113950			9	8		79	79	0		0	1		1	0	14	0		0.087055	6.255246e-02	0	13	0	51	0	9	79
LAMA1	284217	broad.mit.edu	37	18	7032156	7032156	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr18:7032156T>C	ENST00000389658.3	-	16	2276	c.2183A>G	c.(2182-2184)tAc>tGc	p.Y728C		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	728	Laminin EGF-like 5; second part. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ATCCACGCGGTAATAGCCAGA	0.478																																						ENST00000389658.3	1.000000	0.380000	1	5.400000e-01	0.760000	0.768660	0.760000	1.000000																										0				205						c.(2182-2184)tAc>tGc		laminin, alpha 1							89.0	71.0	77.0					18																	7032156		2203	4300	6503	SO:0001583	missense	284217	1	121412	27				g.chr18:7032156T>C	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2183A>G	chr18.hg19:g.7032156T>C	ENSP00000374309:p.Tyr728Cys	1						p.Y728C	NM_005559.3	NP_005550.2	1	4	5	2.180620	P25391	LAMA1_HUMAN		16	2276	-		Colorectal(10;0.172)		Missense_Mutation	SNP	ENST00000389658.3	1	1	hg19	c.2183A>G	CCDS32787.1	0	.	.	.	.	.	.	.	.	.	.	T	17.52	3.408948	0.62399	.	.	ENSG00000101680	ENST00000389658	T	0.64260	-0.09	5.51	5.51	0.81932	5.51	5.51	0.81932	EGF-like, laminin (2);	0.084479	0.48767	D	0.000165	T	0.82217	0.4989	M	0.89715	3.055	0.49130	D	0.999755	D	0.89917	1.0	D	0.87578	0.998	D	0.85319	0.1083	10	0.54805	T	0.06	.	14.1917	0.65641	0.0:0.0:0.0:1.0	.	728	P25391	LAMA1_HUMAN	C	728	ENSP00000374309:Y728C	ENSP00000374309:Y728C	Y	-	2	0	0	LAMA1	7022156	7022156	1.000000	0.71417	0.990000	0.47175	0.741000	0.42261	3.955000	0.56715	2.080000	0.62538	0.533000	0.62120	TAC	0.414844		TCGA-2J-AABO-01A-21D-A40W-08	0.478	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	1	0	1		2	2	2	0		0	0	23		23	22	1	3.570000	-14.117400	1	0.240000	NM_005559			10	10		145	143	0		1	0		0	0	23	0		0.996987	0	0	0	0	1	0	10	145
DSEL	92126	broad.mit.edu	37	18	65178609	65178609	+	Silent	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr18:65178609G>A	ENST00000310045.7	-	2	4740	c.3267C>T	c.(3265-3267)ttC>ttT	p.F1089F	CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	1079					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				GTTCATACTCGAAAGCATAAC	0.368																																						ENST00000310045.7	0.260000	0.050000	2.000000e-01	8.000000e-02	0.130000	0.146046	0.130000	0.130000																										0				74						c.(3265-3267)ttC>ttT		dermatan sulfate epimerase-like							69.0	66.0	67.0					18																	65178609		2203	4300	6503	SO:0001819	synonymous_variant	92126	3	121310	37				g.chr18:65178609G>A	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.3267C>T	chr18.hg19:g.65178609G>A		1					CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA	p.F1089F	NM_032160.2	NP_115536.1	0	1	1	1.481132	Q8IZU8	DSEL_HUMAN		2	4740	-		Esophageal squamous(42;0.129)	Q17RH1|Q6P5Z3	Silent	SNP	ENST00000310045.7	0	1	hg19	c.3267C>T	CCDS11995.1	0																																																																																								0.136364		TCGA-2J-AABO-01A-21D-A40W-08	0.368	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	0	0	1		2	2	2	0		0	0	92		92	92	1	3.570000	-4.185599	1	0.240000	NM_032160			6	6		337	332	0		1			0	0	92	0		0.963703	0	0	0	0	0	0	6	337
ATP8B3	148229	broad.mit.edu	37	19	1791840	1791840	+	Silent	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr19:1791840G>A	ENST00000310127.6	-	20	2449	c.2211C>T	c.(2209-2211)atC>atT	p.I737I	ATP8B3_ENST00000525591.1_Silent_p.I700I|ATP8B3_ENST00000539485.1_Silent_p.I747I	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	737					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCTGTCCTCGATGGCTGTGG	0.627																																						ENST00000310127.6	1.000000	0.070000	1	1.400000e-01	0.250000	0.416499	0.250000	0.190000																										0				23						c.(2209-2211)atC>atT		ATPase, aminophospholipid transporter, class I, type 8B, member 3							54.0	56.0	55.0					19																	1791840		2040	4180	6220	SO:0001819	synonymous_variant	148229	5	120282	36				g.chr19:1791840G>A	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.2211C>T	chr19.hg19:g.1791840G>A		1					ATP8B3_ENST00000539485.1_Silent_p.I747I|ATP8B3_ENST00000525591.1_Silent_p.I700I	p.I737I	NM_138813.3	NP_620168.1	2	2	4	1.898442	O60423	AT8B3_HUMAN		20	2449	-		Hepatocellular(1079;0.137)	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Silent	SNP	ENST00000310127.6	0	1	hg19	c.2211C>T	CCDS45901.1	0																																																																																								0.328622		TCGA-2J-AABO-01A-21D-A40W-08	0.627	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	0	0	1		2	2	2	0		0	0	65		65	62	1	3.570000	-5.622638	1	0.240000	NM_138813			4	4		195	191	0		1			0	0	65	0		0.886397	0	0	0	0	0	0	4	195
RAX2	84839	broad.mit.edu	37	19	3771573	3771573	+	Missense_Mutation	SNP	G	G	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr19:3771573G>T	ENST00000555633.1	-	2	508	c.168C>A	c.(166-168)agC>agA	p.S56R	RAX2_ENST00000555978.1_Missense_Mutation_p.S56R			Q96IS3	RAX2_HUMAN	retina and anterior neural fold homeobox 2	56					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00463)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTCCTCACGGCTGTACACAT	0.627																																						ENST00000555633.1	1.000000	0.380000	1	6.300000e-01	0.980000	0.860692	0.980000	1.000000																										0				1						c.(166-168)agC>agA		retina and anterior neural fold homeobox 2							60.0	48.0	52.0					19																	3771573		2197	4297	6494	SO:0001583	missense	84839	0	0					g.chr19:3771573G>T	AY211277	CCDS12112.1	19p13.3	2013-06-06	2007-08-28	2007-08-28				"""Homeoboxes / PRD class"""	18286	protein-coding gene	gene with protein product		610362	"""retina and anterior neural fold homeobox like 1"""	RAXL1			Standard	NM_032753		Approved	MGC15631, ARMD6, CORD11	uc002lys.3	Q96IS3		ENST00000555633.1:c.168C>A	chr19.hg19:g.3771573G>T	ENSP00000450456:p.Ser56Arg	1					RAX2_ENST00000555978.1_Missense_Mutation_p.S56R	p.S56R			1	2	3	1.851504	Q96IS3	RAX2_HUMAN		2	508	-		Hepatocellular(1079;0.137)		Missense_Mutation	SNP	ENST00000555633.1	0	1	hg19	c.168C>A	CCDS12112.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.87|17.87	3.496105|3.496105	0.64186|0.64186	.|.	.|.	ENSG00000173976|ENSG00000173976	ENST00000555978|ENST00000555633;ENST00000395106	.|D	.|0.95035	.|-3.59	3.52|3.52	1.26|1.26	0.21427|0.21427	3.52|3.52	1.26|1.26	0.21427|0.21427	.|Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	.|0.000000	.|0.37304	.|U	.|0.002147	D|D	0.90259|0.90259	0.6954|0.6954	N|N	0.03194|0.03194	-0.395|-0.395	0.51233|0.51233	D|D	0.999912|0.999912	.|D;D	.|0.61697	.|0.99;0.958	.|D;P	.|0.66979	.|0.948;0.824	D|D	0.87913|0.87913	0.2698|0.2698	5|10	.|0.72032	.|D	.|0.01	.|.	6.8196|6.8196	0.23849|0.23849	0.3119:0.0:0.688:0.0|0.3119:0.0:0.688:0.0	.|.	.|56;102	.|Q96IS3;G3V243	.|RAX2_HUMAN;.	T|R	76|102;56	.|ENSP00000450456:S102R	.|ENSP00000378538:S56R	P|S	-|-	1|3	0|2	0|2	RAX2|RAX2	3722573|3722573	3722573|3722573	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.894000|0.894000	0.52154|0.52154	2.372000|2.372000	0.44257|0.44257	0.468000|0.468000	0.27243|0.27243	0.561000|0.561000	0.74099|0.74099	CCG|AGC	0.315562		TCGA-2J-AABO-01A-21D-A40W-08	0.627	RAX2-001	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411919.2	0	0	1		2	2	2	0		0	0	16		16	16	1	3.570000	-10.305420	1	0.240000	NM_032753			5	5		46	45	1		1			0	0	16	0		0.937634	0	0	0	0	0	0	5	46
PLIN4	729359	broad.mit.edu	37	19	4511956	4511956	+	Silent	SNP	G	G	A	rs539563816		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr19:4511956G>A	ENST00000301286.3	-	3	1973	c.1974C>T	c.(1972-1974)acC>acT	p.T658T		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	658	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						TCACAGCACTGGTCACCCCAC	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		24918	0.0		0.0	False		,,,				2504	0.0					ENST00000301286.3	1.000000	0.770000	1	8.700000e-01	0.990000	0.953046	0.990000	1.000000																										0				41						c.(1972-1974)acC>acT		perilipin 4							95.0	104.0	101.0					19																	4511956		2048	4186	6234	SO:0001819	synonymous_variant	729359	5	120898	45				g.chr19:4511956G>A	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.1974C>T	chr19.hg19:g.4511956G>A		1						p.T658T	NM_001080400.1	NP_001073869.1	1	2	3	1.851504	Q96Q06	PLIN4_HUMAN		3	1973	-			A6NEI2	Silent	SNP	ENST00000301286.3	1	1	hg19	c.1974C>T	CCDS45927.1	1																																																																																								0.315562		TCGA-2J-AABO-01A-21D-A40W-08	0.582	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	1	0	1		2	2	2	0		0	0	223		223	208	1	3.570000	-2.806910	1	0.240000	XM_170901			70	69		590	541	1		1	0		0	0	223	0		1.000000	0	0	0	0	1	0	70	590
SAFB	6294	broad.mit.edu	37	19	5654163	5654163	+	Missense_Mutation	SNP	G	G	A	rs11542075|rs34855450		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr19:5654163G>A	ENST00000292123.5	+	12	1725	c.1618G>A	c.(1618-1620)Gat>Aat	p.D540N	SAFB_ENST00000433404.1_Missense_Mutation_p.D370N|SAFB_ENST00000592224.1_Missense_Mutation_p.D540N|SAFB_ENST00000454510.1_Missense_Mutation_p.D471N|SAFB_ENST00000588852.1_Missense_Mutation_p.D540N|SAFB_ENST00000538656.1_Missense_Mutation_p.D383N	NM_001201338.1|NM_001201339.1|NM_002967.3	NP_001188267.1|NP_001188268.1|NP_002958.2	Q15424	SAFB1_HUMAN	scaffold attachment factor B	540	Interaction with POLR2A.				chromatin organization (GO:0006325)|growth (GO:0040007)|hormone metabolic process (GO:0042445)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(1)	23				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		TAAGGACCAAGATGATCAGAA	0.463																																					Colon(88;338 1345 6184 8214 20897)	ENST00000292123.5	1.000000	0.630000	1	7.600000e-01	0.910000	0.893844	0.910000	1.000000																										0				23						c.(1618-1620)Gat>Aat		scaffold attachment factor B							113.0	105.0	107.0					19																	5654163		2203	4300	6503	SO:0001583	missense	6294	0	0					g.chr19:5654163G>A	L43631	CCDS12142.1, CCDS56077.1, CCDS59339.1, CCDS59340.1	19p13.3-p13.2	2013-02-12				ENSG00000160633		"""RNA binding motif (RRM) containing"""	10520	protein-coding gene	gene with protein product	"""Hsp27 ERE-TATA binding protein"""	602895				9605873, 8600450	Standard	NM_002967		Approved	HET, SAFB1	uc002mcg.3	Q15424		ENST00000292123.5:c.1618G>A	chr19.hg19:g.5654163G>A	ENSP00000292123:p.Asp540Asn	1					SAFB_ENST00000588852.1_Missense_Mutation_p.D540N|SAFB_ENST00000592224.1_Missense_Mutation_p.D540N|SAFB_ENST00000538656.1_Missense_Mutation_p.D383N|SAFB_ENST00000433404.1_Missense_Mutation_p.D370N|SAFB_ENST00000454510.1_Missense_Mutation_p.D471N	p.D540N	NM_001201338.1|NM_001201339.1|NM_002967.3	NP_001188267.1|NP_001188268.1|NP_002958.2	1	2	3	1.851504	Q15424	SAFB1_HUMAN		12	1725	+			A0AV56|B7Z5B6|B7ZLP6|F5H0H3|O60406|Q59HH8	Missense_Mutation	SNP	ENST00000292123.5	1	1	hg19	c.1618G>A	CCDS12142.1	1	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656306	0.67586	.	.	ENSG00000160633	ENST00000454510;ENST00000540206;ENST00000433404;ENST00000292123;ENST00000538656	T;T;T;T	0.12569	2.72;2.86;2.69;2.67	5.34	4.29	0.51040	5.34	4.29	0.51040	.	0.103415	0.42682	D	0.000680	T	0.16128	0.0388	L	0.57536	1.79	0.44036	D	0.996762	B;P;B;B;B;B;B	0.37824	0.321;0.609;0.449;0.11;0.11;0.11;0.11	B;B;B;B;B;B;B	0.36885	0.101;0.235;0.205;0.074;0.119;0.074;0.119	T	0.01909	-1.1249	10	0.59425	D	0.04	-27.4843	13.4452	0.61136	0.0766:0.0:0.9234:0.0	.	339;383;471;540;540;540;540	B7Z1C7;B7Z2F6;F5H0H3;B7ZLP5;A0AV56;Q15424;B7ZLP6	.;.;.;.;.;SAFB1_HUMAN;.	N	471;435;370;540;383	ENSP00000415895:D471N;ENSP00000404545:D370N;ENSP00000292123:D540N;ENSP00000438880:D383N	ENSP00000292123:D540N	D	+	1	0	0	SAFB	5605163	5605163	0.966000	0.33281	0.886000	0.34754	0.994000	0.84299	3.458000	0.53014	2.654000	0.90174	0.563000	0.77884	GAT	0.315562		TCGA-2J-AABO-01A-21D-A40W-08	0.463	SAFB-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000451641.2	1	0	1		2	2	2	0		0	0	56		56	56	1	3.570000	-11.677650	1	0.240000				31	29		288	283	0		1	1		0	0	56	0		1.000000	9.981368e-01	0	16	0	76	0	31	288
SLC8A2	6543	broad.mit.edu	37	19	47969356	47969356	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr19:47969356G>A	ENST00000236877.6	-	2	700	c.305C>T	c.(304-306)tCa>tTa	p.S102L	SLC8A2_ENST00000542837.1_Intron|SLC8A2_ENST00000539381.1_Intron	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	102					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		CTTCTCTTTTGACGTGATGAC	0.577																																						ENST00000236877.6	1.000000	0.640000	1	7.800000e-01	0.930000	0.905548	0.930000	1.000000																										0				31						c.(304-306)tCa>tTa		solute carrier family 8 (sodium/calcium exchanger), member 2							139.0	89.0	106.0					19																	47969356		2203	4300	6503	SO:0001583	missense	6543	0	0					g.chr19:47969356G>A	AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.305C>T	chr19.hg19:g.47969356G>A	ENSP00000236877:p.Ser102Leu	1					SLC8A2_ENST00000542837.1_Intron|SLC8A2_ENST00000539381.1_Intron	p.S102L	NM_015063.2	NP_055878.1	1	2	3	1.868588	Q9UPR5	NAC2_HUMAN		2	700	-		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)	B4DYQ9	Missense_Mutation	SNP	ENST00000236877.6	1	1	hg19	c.305C>T	CCDS33065.1	1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.048442	0.75846	.	.	ENSG00000118160	ENST00000236877	T	0.64438	-0.1	4.25	4.25	0.50352	4.25	4.25	0.50352	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	D	0.85191	0.5640	H	0.96080	3.765	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90331	0.4352	10	0.87932	D	0	.	15.6004	0.76620	0.0:0.0:1.0:0.0	.	102	Q9UPR5	NAC2_HUMAN	L	102	ENSP00000236877:S102L	ENSP00000236877:S102L	S	-	2	0	0	SLC8A2	52661168	52661168	1.000000	0.71417	0.828000	0.32881	0.520000	0.34377	9.587000	0.98229	2.210000	0.71456	0.462000	0.41574	TCA	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.577	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466997.1	1	0	1		2	2	2	0		0	0	128		128	126	1	3.570000	-20.000000	1	0.240000				30	29		271	264	1		1	0		0	0	128	0		1.000000	1.076950e-02	0	0	0	2	0	30	271
ZNF835	90485	broad.mit.edu	37	19	57175926	57175926	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr19:57175926C>T	ENST00000537055.2	-	2	872	c.641G>A	c.(640-642)cGc>cAc	p.R214H		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	214					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						CGTGTGCACGCGCCGGTGCTG	0.721																																						ENST00000537055.2	1.000000	0.260000	9.700000e-01	4.300000e-01	0.660000	0.679957	0.660000	1.000000																										0				47						c.(640-642)cGc>cAc		zinc finger protein 835							17.0	17.0	17.0					19																	57175926		2195	4262	6457	SO:0001583	missense	90485	0	0					g.chr19:57175926C>T	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.641G>A	chr19.hg19:g.57175926C>T	ENSP00000444747:p.Arg214His	1						p.R214H	NM_001005850.2	NP_001005850.2	1	2	3	1.895001	Q9Y2P0	ZN835_HUMAN		2	872	-			B7Z5Y0|G3V1S0	Missense_Mutation	SNP	ENST00000537055.2	0	1	hg19	c.641G>A	CCDS56105.1	0	.	.	.	.	.	.	.	.	.	.	C	19.11	3.763428	0.69763	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.25749	1.78	2.12	2.12	0.27331	2.12	2.12	0.27331	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.49253	0.1546	M	0.76838	2.35	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.21314	-1.0249	9	0.87932	D	0	.	10.2869	0.43573	0.0:1.0:0.0:0.0	.	236	Q9Y2P0	ZN835_HUMAN	H	236;214	ENSP00000444747:R214H	ENSP00000341756:R236H	R	-	2	0	0	ZNF835	61867738	61867738	0.000000	0.05858	0.049000	0.19019	0.502000	0.33828	-0.055000	0.11807	1.506000	0.48736	0.561000	0.74099	CGC	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.721	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	0	0	1		2	2	2	0		0	0	24		24	23	1	3.570000	-10.081120	1	0.240000	NM_001005850			5	5		70	70	0		1			0	0	24	0		0.939746	0	0	0	0	0	0	5	70
OR7D2	162998	broad.mit.edu	37	19	9296718	9296718	+	Silent	SNP	C	C	T	rs139213903		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr19:9296718C>T	ENST00000344248.2	+	1	440	c.261C>T	c.(259-261)acC>acT	p.T87T		NM_175883.2	NP_787079.1	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D, member 2	87					regulation of transcription, DNA-templated (GO:0006355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	20						ACATCCAGACCGAGAACAAAG	0.507																																						ENST00000344248.2	0.200000	0.020000	1.500000e-01	5.000000e-02	0.090000	0.107439	0.090000	0.090000																										0				20						c.(259-261)acC>acT		olfactory receptor, family 7, subfamily D, member 2		C		0,4406		0,0,2203	167.0	155.0	159.0		261	-0.1	0.0	19	dbSNP_134	159	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OR7D2	NM_175883.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		87/313	9296718	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	162998	2	121412	35				g.chr19:9296718C>T	AK095468	CCDS32900.1	19p13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8378	protein-coding gene	gene with protein product							Standard	NM_175883		Approved	OR19-4, HTPCRH03, FLJ38149	uc002mkz.1	Q96RA2		ENST00000344248.2:c.261C>T	chr19.hg19:g.9296718C>T		1						p.T87T	NM_175883.2	NP_787079.1	1	2	3	1.856169	Q96RA2	OR7D2_HUMAN		1	440	+			Q6IFJ7|Q8N133	Silent	SNP	ENST00000344248.2	0	1	hg19	c.261C>T	CCDS32900.1	0																																																																																								0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.507	OR7D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449002.1	0	0	1		2	2	2	0		0	0	117		117	117	1	3.570000	-2.027508	0	0.240000				5	5		512	504	0		1			0	0	117	0		0.935232	0	0	0	0	0	0	5	512
ZNF256	10172	broad.mit.edu	37	19	58453978	58453978	+	Silent	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr19:58453978C>T	ENST00000282308.3	-	3	394	c.198G>A	c.(196-198)caG>caA	p.Q66Q	ZNF256_ENST00000598928.1_Missense_Mutation_p.S24N	NM_005773.2	NP_005764.2	Q9Y2P7	ZN256_HUMAN	zinc finger protein 256	66	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)		AAGTGCTCTGCTGATAAGGTG	0.532																																					NSCLC(55;1313 1552 8040 11996)	ENST00000282308.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				19						c.(196-198)caG>caA		zinc finger protein 256							102.0	102.0	102.0					19																	58453978		2203	4298	6501	SO:0001819	synonymous_variant	10172	0	0					g.chr19:58453978C>T	AF067165	CCDS12966.1	19q13	2013-01-08				ENSG00000152454		"""Zinc fingers, C2H2-type"", ""-"""	13049	protein-coding gene	gene with protein product		606956					Standard	NM_005773		Approved	BMZF-3	uc002qqu.3	Q9Y2P7		ENST00000282308.3:c.198G>A	chr19.hg19:g.58453978C>T		1					ZNF256_ENST00000598928.1_Missense_Mutation_p.S24N	p.Q66Q	NM_005773.2	NP_005764.2	1	2	3	1.895001	Q9Y2P7	ZN256_HUMAN		3	394	-		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)	B2RA92|Q53Y85|Q9BV71	Silent	SNP	ENST00000282308.3	0	1	hg19	c.198G>A	CCDS12966.1	1																																																																																								0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.532	ZNF256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466702.1	0	0	1		17	2	2	1		1	1	120		120	117	1	3.570000	-20.000000	1	0.240000				151	150		432	427	1		1	0		1	0	120	0		1.000000	6.737823e-02	0	0	0	2	0	151	432
S1PR1	1901	broad.mit.edu	37	1	101705312	101705312	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr1:101705312G>A	ENST00000305352.6	+	2	1147	c.772G>A	c.(772-774)Gta>Ata	p.V258I		NM_001400.4	NP_001391.2	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	258					actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|brain development (GO:0007420)|cardiac muscle tissue growth involved in heart morphogenesis (GO:0003245)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|chemotaxis (GO:0006935)|endothelial cell differentiation (GO:0045446)|G-protein coupled receptor signaling pathway (GO:0007186)|heart trabecula morphogenesis (GO:0061384)|lamellipodium assembly (GO:0030032)|negative regulation of stress fiber assembly (GO:0051497)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bone mineralization (GO:0030500)|regulation of bone resorption (GO:0045124)|regulation of cell adhesion (GO:0030155)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell migration (GO:0072678)|transmission of nerve impulse (GO:0019226)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|sphingolipid binding (GO:0046625)|sphingosine-1-phosphate receptor activity (GO:0038036)			NS(1)|autonomic_ganglia(1)|breast(1)|large_intestine(7)|lung(23)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	43						GCTCAAGACCGTAATTATCGT	0.587																																						ENST00000305352.6	0.180000	0.020000	1.400000e-01	5.000000e-02	0.080000	0.098356	0.080000	0.090000																										0				43						c.(772-774)Gta>Ata		sphingosine-1-phosphate receptor 1							93.0	93.0	93.0					1																	101705312		2203	4300	6503	SO:0001583	missense	1901	0	0					g.chr1:101705312G>A	M31210	CCDS777.1	1p21	2012-08-08	2008-04-30	2008-04-30	ENSG00000170989	ENSG00000170989		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"", ""CD molecules"""	3165	protein-coding gene	gene with protein product		601974	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 1"""	EDG1		2160972, 9488656	Standard	NM_001400		Approved	edg-1, D1S3362, CD363	uc001dud.2	P21453	OTTHUMG00000010835	ENST00000305352.6:c.772G>A	chr1.hg19:g.101705312G>A	ENSP00000305416:p.Val258Ile	0						p.V258I	NM_001400.4	NP_001391.2	1	2	3	1.912430	P21453	S1PR1_HUMAN		2	1147	+			D3DT66|Q9BYY4|Q9NYN8	Missense_Mutation	SNP	ENST00000305352.6	0	1	hg19	c.772G>A	CCDS777.1	0	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632336	0.87660	.	.	ENSG00000170989	ENST00000305352;ENST00000424264	T	0.36878	1.23	5.22	5.22	0.72569	5.22	5.22	0.72569	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.51363	0.1670	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.55186	-0.8180	10	0.87932	D	0	.	18.848	0.92215	0.0:0.0:1.0:0.0	.	258	P21453	S1PR1_HUMAN	I	258	ENSP00000305416:V258I	ENSP00000305416:V258I	V	+	1	0	0	S1PR1	101477900	101477900	1.000000	0.71417	0.688000	0.30117	0.831000	0.47069	9.869000	0.99810	2.438000	0.82558	0.449000	0.29647	GTA	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.587	S1PR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029908.1	0	0	1		2	2	2	0		0	0	135		135	135	1	3.570000	-2.547949	1	0.240000	NM_001400			5	5		560	555	0		1	0		0	0	135	0		0.936324	2.506318e-02	0	0	0	22	0	5	560
KCND3	3752	broad.mit.edu	37	1	112525004	112525004	+	Silent	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr1:112525004G>A	ENST00000315987.2	-	2	824	c.345C>T	c.(343-345)gaC>gaT	p.D115D	KCND3_ENST00000302127.4_Silent_p.D115D|KCND3_ENST00000369697.1_Silent_p.D115D	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	115					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CCAGCTCGTCGTCGTAGGCAG	0.627																																						ENST00000315987.2	1.000000	0.640000	1	7.700000e-01	0.920000	0.898221	0.920000	1.000000																										0				49						c.(343-345)gaC>gaT		potassium voltage-gated channel, Shal-related subfamily, member 3	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)						98.0	86.0	90.0					1																	112525004		2203	4300	6503	SO:0001819	synonymous_variant	3752	0	0					g.chr1:112525004G>A	AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.345C>T	chr1.hg19:g.112525004G>A		0					KCND3_ENST00000302127.4_Silent_p.D115D|KCND3_ENST00000369697.1_Silent_p.D115D	p.D115D	NM_004980.4	NP_004971.2	1	2	3	1.912430	Q9UK17	KCND3_HUMAN		2	824	-		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Silent	SNP	ENST00000315987.2	1	1	hg19	c.345C>T	CCDS843.1	1																																																																																								0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.627	KCND3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000033144.1	1	0	1		2	2	2	0		0	0	67		67	67	1	3.570000	-20.000000	1	0.240000	NM_172198			30	29		275	269	0		1	0		0	0	67	0		1.000000	0	0	0	0	1	0	30	275
TRIM33	51592	broad.mit.edu	37	1	114968220	114968220	+	Missense_Mutation	SNP	G	G	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr1:114968220G>T	ENST00000358465.2	-	9	1629	c.1546C>A	c.(1546-1548)Ctc>Atc	p.L516I	TRIM33_ENST00000369543.2_Missense_Mutation_p.L516I|TRIM33_ENST00000450349.2_Missense_Mutation_p.L124I	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	516					gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATGTGCTGGAGTCGAAGCTGT	0.458			T	RET	papillary thyroid																																	ENST00000358465.2			0	0								Dom	yes			Dom	yes		1	1p13	1p13	51592	T	""" tripartite motif-containing 33 (PTC7,TIF1G)"""				E	E	RET		papillary thyroid		0				48						c.(1546-1548)Ctc>Atc		tripartite motif containing 33							356.0	312.0	327.0					1																	114968220		2203	4300	6503	SO:0001583	missense	51592	0	0					g.chr1:114968220G>T	AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.1546C>A	chr1.hg19:g.114968220G>T	ENSP00000351250:p.Leu516Ile						TRIM33_ENST00000369543.2_Missense_Mutation_p.L516I|TRIM33_ENST00000450349.2_Missense_Mutation_p.L124I	p.L516I	NM_015906.3	NP_056990.3					Q9UPN9	TRI33_HUMAN		9	1629	-	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)	O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Missense_Mutation	SNP	ENST00000358465.2	1	1	hg19	c.1546C>A	CCDS872.1		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.4|24.4	4.521938|4.521938	0.85600|0.85600	.|.	.|.	ENSG00000197323|ENSG00000197323	ENST00000448034|ENST00000358465;ENST00000369543;ENST00000450349	.|T;T;T	.|0.77358	.|-0.89;-0.8;-1.09	5.13|5.13	5.13|5.13	0.70059|0.70059	5.13|5.13	5.13|5.13	0.70059|0.70059	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.82861|0.82861	0.5129|0.5129	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	.|D;D;D;B	.|0.67145	.|0.982;0.982;0.996;0.434	.|D;D;D;B	.|0.75484	.|0.952;0.952;0.986;0.417	T|T	0.82466|0.82466	-0.0443|-0.0443	5|10	.|0.48119	.|T	.|0.1	-8.1052|-8.1052	18.9585|18.9585	0.92670|0.92670	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|124;124;516;516	.|E7EN20;B3KN30;Q9UPN9-2;Q9UPN9	.|.;.;.;TRI33_HUMAN	E|I	252|516;516;124	.|ENSP00000351250:L516I;ENSP00000358556:L516I;ENSP00000412077:L124I	.|ENSP00000351250:L516I	D|L	-|-	3|1	2|0	2|0	TRIM33|TRIM33	114769743|114769743	114769743|114769743	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	7.114000|7.114000	0.77103|0.77103	2.554000|2.554000	0.86153|0.86153	0.650000|0.650000	0.86243|0.86243	GAC|CTC			TCGA-2J-AABO-01A-21D-A40W-08	0.458	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032854.1	1	0	1		2	2	2	0		0	0	245		245	236	1	3.570000	-20.000000	1	0.240000	NM_015906			106	106		932	916	1		1	0		0	0	245	0		1.000000	5.546424e-02	0	0	0	4	0	106	932
PUSL1	126789	broad.mit.edu	37	1	1244928	1244928	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr1:1244928C>T	ENST00000379031.5	+	4	495	c.418C>T	c.(418-420)Cgg>Tgg	p.R140W	PUSL1_ENST00000470520.1_3'UTR|ACAP3_ENST00000353662.3_5'Flank|CPSF3L_ENST00000462432.1_5'Flank|ACAP3_ENST00000354700.5_5'Flank	NM_153339.1	NP_699170.1	Q8N0Z8	PUSL1_HUMAN	pseudouridylate synthase-like 1	140					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			lung(3)|skin(1)|urinary_tract(1)	5	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.95e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TGGCTGTCACCGGCGTGATGA	0.687																																						ENST00000379031.5	1.000000	0.760000	1	9.900000e-01	0.990000	0.980657	0.990000	1.000000																										0				5						c.(418-420)Cgg>Tgg		pseudouridylate synthase-like 1							24.0	24.0	24.0					1																	1244928		2179	4285	6464	SO:0001583	missense	126789	0	0					g.chr1:1244928C>T	AK027721	CCDS20.1	1p36.33	2008-02-05			ENSG00000169972	ENSG00000169972			26914	protein-coding gene	gene with protein product						12477932	Standard	NM_153339		Approved	FLJ90811	uc001aed.3	Q8N0Z8	OTTHUMG00000003361	ENST00000379031.5:c.418C>T	chr1.hg19:g.1244928C>T	ENSP00000368318:p.Arg140Trp	0					PUSL1_ENST00000470520.1_3'UTR|ACAP3_ENST00000354700.5_5'Flank|CPSF3L_ENST00000462432.1_5'Flank|ACAP3_ENST00000353662.3_5'Flank	p.R140W	NM_153339.1	NP_699170.1	1	2	3	1.938390	Q8N0Z8	PUSL1_HUMAN		4	495	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	B4DP76|Q5TA41	Missense_Mutation	SNP	ENST00000379031.5	1	1	hg19	c.418C>T	CCDS20.1	1	.	.	.	.	.	.	.	.	.	.	c	5.473	0.272323	0.10349	.	.	ENSG00000169972	ENST00000379031	T	0.58358	0.34	4.49	-8.47	0.00939	4.49	-8.47	0.00939	Pseudouridine synthase I, TruA, C-terminal (1);Pseudouridine synthase, catalytic domain (1);	1.673000	0.04521	U	0.384611	T	0.38585	0.1046	L	0.56769	1.78	0.09310	N	1	B	0.13594	0.008	B	0.04013	0.001	T	0.26849	-1.0091	10	0.46703	T	0.11	-0.6521	0.5893	0.00725	0.2258:0.1719:0.3063:0.296	.	140	Q8N0Z8	PUSL1_HUMAN	W	140	ENSP00000368318:R140W	ENSP00000368318:R140W	R	+	1	2	2	PUSL1	1234791	1234791	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.823000	0.01710	-1.684000	0.01443	-0.389000	0.06534	CGG	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.687	PUSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009438.1	1	0	1		2	2	2	0		0	0	23		23	23	1	3.570000	-19.993450	1	0.240000	NM_153339			13	13		80	77	0		1	1		0	0	23	0		0.999584	7.657000e-01	0	2	0	17	0	13	80
SYCP1	6847	broad.mit.edu	37	1	115417138	115417138	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr1:115417138C>T	ENST00000369522.3	+	9	850	c.610C>T	c.(610-612)Cgg>Tgg	p.R204W	SYCP1_ENST00000369518.1_Missense_Mutation_p.R204W	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	204					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)	p.R204W(1)	RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGAATATGAACGGGAAGAAAC	0.264																																						ENST00000369522.3			0	0																													RGS22/SYCP1(2)	1	Substitution - Missense(1)	p.R204W(1)	lung(1)	48						c.(610-612)Cgg>Tgg		synaptonemal complex protein 1							76.0	91.0	86.0					1																	115417138		2200	4292	6492	SO:0001583	missense	6847	0	0					g.chr1:115417138C>T	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.610C>T	chr1.hg19:g.115417138C>T	ENSP00000358535:p.Arg204Trp						SYCP1_ENST00000369518.1_Missense_Mutation_p.R204W	p.R204W	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2					Q15431	SYCP1_HUMAN		9	850	+	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)	O14963|Q5VXJ6	Missense_Mutation	SNP	ENST00000369522.3	1	1	hg19	c.610C>T	CCDS879.1		.	.	.	.	.	.	.	.	.	.	C	18.76	3.693727	0.68386	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.58060	0.36;0.36;0.36	5.13	4.09	0.47781	5.13	4.09	0.47781	.	0.000000	0.85682	D	0.000000	T	0.61590	0.2359	M	0.72894	2.215	0.46954	D	0.99926	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.64968	-0.6282	10	0.87932	D	0	-5.1042	9.5872	0.39524	0.2601:0.7399:0.0:0.0	.	204;204	B7ZLS9;Q15431	.;SYCP1_HUMAN	W	204	ENSP00000358535:R204W;ENSP00000410011:R204W;ENSP00000358531:R204W	ENSP00000358531:R204W	R	+	1	2	2	SYCP1	115218661	115218661	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	3.147000	0.50639	2.564000	0.86499	0.655000	0.94253	CGG			TCGA-2J-AABO-01A-21D-A40W-08	0.264	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	1	0	1		22	2	2	1		1	1	111		111	108	1	3.570000	-13.351380	1	0.240000	NM_003176			59	59		671	667	0		1			1	0	111	0		0.999994	0	0	0	0	0	0	59	671
RPTN	126638	broad.mit.edu	37	1	152127241	152127241	+	Silent	SNP	G	G	A	rs201916415		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr1:152127241G>A	ENST00000316073.3	-	3	2398	c.2334C>T	c.(2332-2334)gaC>gaT	p.D778D		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	778	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						GGTTCTGCTCGTCTTCATGGG	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		24402	0.001		0.0	False		,,,				2504	0.0					ENST00000316073.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				59						c.(2332-2334)gaC>gaT		repetin							761.0	606.0	653.0					1																	152127241		1568	3582	5150	SO:0001819	synonymous_variant	126638	18	120612	49				g.chr1:152127241G>A	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.2334C>T	chr1.hg19:g.152127241G>A		0						p.D778D	NM_001122965.1	NP_001116437.1	2	2	4	2.065498	Q6XPR3	RPTN_HUMAN		3	2398	-			B7ZBZ3	Silent	SNP	ENST00000316073.3	1	0	hg19	c.2334C>T	CCDS41397.1	1																																																																																								0.382315		TCGA-2J-AABO-01A-21D-A40W-08	0.463	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333867.1	1	0	1		2	2	2	1		1	0	321		321	312	1	3.570000	-20.000000	1	0.240000	XM_371312			348	340		1452	1427	1		1	0		1	0	321	0		1.000000	0	0	1	0	0	0	348	1452
SMCP	4184	broad.mit.edu	37	1	152857174	152857174	+	Silent	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr1:152857174G>A	ENST00000368765.3	+	2	426	c.276G>A	c.(274-276)ccG>ccA	p.P92P		NM_030663.2	NP_109588.2	P49901	MCSP_HUMAN	sperm mitochondria-associated cysteine-rich protein	92					penetration of zona pellucida (GO:0007341)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)		p.P92P(1)		breast(1)|cervix(1)|endometrium(1)|lung(4)|urinary_tract(1)	8	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCAACTCACCGCAAACTCAGG	0.537																																						ENST00000368765.3	1.000000	0.040000	1.900000e-01	7.000000e-02	0.120000	0.158486	0.120000	0.120000																										1	Substitution - coding silent(1)	p.P92P(1)	urinary_tract(1)	8						c.(274-276)ccG>ccA		sperm mitochondria-associated cysteine-rich protein							116.0	108.0	110.0					1																	152857174		2203	4300	6503	SO:0001819	synonymous_variant	4184	0	0					g.chr1:152857174G>A	BC014593	CCDS1029.1	1q21.3	2009-03-19	2005-10-06	2005-10-06	ENSG00000163206	ENSG00000163206			6962	protein-coding gene	gene with protein product		601148	"""mitochondrial capsule selenoprotein"""	MCSP		8833144	Standard	NM_030663		Approved		uc001fat.3	P49901	OTTHUMG00000012452	ENST00000368765.3:c.276G>A	chr1.hg19:g.152857174G>A		0						p.P92P	NM_030663.2	NP_109588.2	2	2	4	2.065498	P49901	MCSP_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.171)	2	426	+	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		Q96A42	Silent	SNP	ENST00000368765.3	0	1	hg19	c.276G>A	CCDS1029.1	0																																																																																								0.382315		TCGA-2J-AABO-01A-21D-A40W-08	0.537	SMCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034665.1	0	0	1		2	2	2	0		0	0	65		65	64	1	3.570000	-1.868207	0	0.240000	NM_030663			6	6		528	525	0		1			0	0	65	0		0.964535	0	0	0	0	0	0	6	528
FCGR2B	2213	broad.mit.edu	37	1	161643018	161643018	+	Splice_Site	SNP	A	A	G			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr1:161643018A>G	ENST00000358671.5	+	4	726	c.645A>G	c.(643-645)caA>caG	p.Q215Q	FCGR2B_ENST00000367962.4_Splice_Site_p.Q215Q|FCGR2B_ENST00000367960.5_Splice_Site_p.Q208Q|RP11-25K21.1_ENST00000453111.1_RNA|FCGR2B_ENST00000428605.2_Splice_Site_p.Q215Q|FCGR2B_ENST00000236937.9_Splice_Site_p.Q215Q|FCGR2B_ENST00000403078.3_Splice_Site_p.Q215Q|FCGR2B_ENST00000367961.4_Splice_Site_p.Q208Q	NM_001002275.2|NM_004001.4	NP_001002275.1|NP_003992.3	P31994	FCG2B_HUMAN	Fc fragment of IgG, low affinity IIb, receptor (CD32)	215					immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)						all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Antithymocyte globulin(DB00098)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TCACTGTCCAAGGTATGCGGA	0.542			T	?	ALL																																	ENST00000358671.5	1.000000	0.890000	1	9.900000e-01	0.990000	0.993654	0.990000	1.000000				Dom	yes			Dom	yes		1	1q23	1q23	2213	T	"""Fc fragment of IgG, low affinity IIb, receptor for (CD32)"""				L	L	?		ALL		0										c.(643-645)caA>caG		Fc fragment of IgG, low affinity IIb, receptor (CD32)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Antithymocyte globulin(DB00098)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)						62.0	62.0	62.0					1																	161643018		2170	4292	6462	SO:0001630	splice_region_variant	2213	0	0					g.chr1:161643018A>G	BC031992	CCDS30924.1, CCDS30925.1, CCDS53414.1	1q23	2013-01-11	2005-02-02		ENSG00000072694	ENSG00000072694		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3618	protein-coding gene	gene with protein product		604590	"""Fc fragment of IgG, low affinity IIb, receptor for (CD32)"""	FCG2, FCGR2		2139735	Standard	NM_004001		Approved	CD32, CD32B	uc001gaz.2	P31994	OTTHUMG00000034470	ENST00000358671.5:c.646+1A>G	chr1.hg19:g.161643018A>G		0					RP11-25K21.1_ENST00000453111.1_RNA|FCGR2B_ENST00000403078.3_Splice_Site_p.Q215Q|FCGR2B_ENST00000367961.4_Splice_Site_p.Q208Q|FCGR2B_ENST00000236937.9_Splice_Site_p.Q215Q|FCGR2B_ENST00000367960.5_Splice_Site_p.Q208Q|FCGR2B_ENST00000367962.4_Splice_Site_p.Q215Q|FCGR2B_ENST00000428605.2_Splice_Site_p.Q215Q	p.Q215Q	NM_001002275.2|NM_004001.4	NP_001002275.1|NP_003992.3	2	2	4	2.065498	P31994	FCG2B_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.00376)	4	726	+	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		A6H8N3|O95649|Q53X85|Q5VXA9|Q8NIA1	Splice_Site	SNP	ENST00000358671.5	1	0	hg19	c.645A>G	CCDS30924.1	1																																																																																								0.382315		TCGA-2J-AABO-01A-21D-A40W-08	0.542	FCGR2B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000083337.4	0	0	1		2	2	2	0		0	0	36		36	50	1	3.570000	-11.862960	1	0.240000	NM_004001	Silent		22	21		146	133	1		1			0	0	36	0		0.999998	0	0	0	0	0	0	22	146
ZFYVE9	9372	broad.mit.edu	37	1	52747411	52747411	+	Missense_Mutation	SNP	A	A	C			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr1:52747411A>C	ENST00000371591.1	+	9	3079	c.2948A>C	c.(2947-2949)cAg>cCg	p.Q983P	ZFYVE9_ENST00000287727.3_Missense_Mutation_p.Q983P|ZFYVE9_ENST00000357206.2_Missense_Mutation_p.Q924P	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	983					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						ATTCTTCTACAGTGTTTACCG	0.418																																						ENST00000371591.1	0.200000	0.030000	1.500000e-01	6.000000e-02	0.090000	0.108705	0.090000	0.090000																										0				53						c.(2947-2949)cAg>cCg		zinc finger, FYVE domain containing 9							201.0	174.0	183.0					1																	52747411		2203	4300	6503	SO:0001583	missense	9372	0	0					g.chr1:52747411A>C	AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.2948A>C	chr1.hg19:g.52747411A>C	ENSP00000360647:p.Gln983Pro	0					ZFYVE9_ENST00000287727.3_Missense_Mutation_p.Q983P|ZFYVE9_ENST00000357206.2_Missense_Mutation_p.Q924P	p.Q983P	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	1	2	3	1.912430	O95405	ZFYV9_HUMAN		9	3079	+			Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Missense_Mutation	SNP	ENST00000371591.1	0	1	hg19	c.2948A>C	CCDS563.1	0	.	.	.	.	.	.	.	.	.	.	A	24.7	4.563599	0.86335	.	.	ENSG00000157077	ENST00000357206;ENST00000287727;ENST00000371591	T;T;T	0.58210	0.35;0.35;0.35	4.93	4.93	0.64822	4.93	4.93	0.64822	.	0.000000	0.64402	D	0.000001	T	0.65554	0.2702	L	0.55481	1.735	0.80722	D	1	D;D	0.71674	0.998;0.989	P;D	0.63957	0.849;0.92	T	0.67711	-0.5600	10	0.54805	T	0.06	.	14.7338	0.69402	1.0:0.0:0.0:0.0	.	924;983	O95405-2;O95405	.;ZFYV9_HUMAN	P	924;983;983	ENSP00000349737:Q924P;ENSP00000287727:Q983P;ENSP00000360647:Q983P	ENSP00000287727:Q983P	Q	+	2	0	0	ZFYVE9	52519999	52519999	1.000000	0.71417	0.969000	0.41365	0.977000	0.68977	9.009000	0.93606	2.062000	0.61559	0.482000	0.46254	CAG	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.418	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1	0	0	1		2	2	2	0		0	0	139		139	137	1	3.570000	-3.313857	1	0.240000	NM_007324			6	6		591	586	0		1	0		0	0	139	0		0.964008	4.612468e-04	0	0	0	3	0	6	591
ZNF496	84838	broad.mit.edu	37	1	247464376	247464376	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr1:247464376C>A	ENST00000294753.4	-	9	1673	c.1209G>T	c.(1207-1209)aaG>aaT	p.K403N	ZNF496_ENST00000462139.1_5'UTR|ZNF496_ENST00000366498.2_Missense_Mutation_p.K439N	NM_032752.1	NP_116141.1	Q96IT1	ZN496_HUMAN	zinc finger protein 496	403					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	36	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			CGTAGGACTTCTTGGAGGTCT	0.642																																						ENST00000294753.4	0.650000	0.190000	5.200000e-01	2.800000e-01	0.380000	0.406539	0.380000	0.360000																										0				36						c.(1207-1209)aaG>aaT		zinc finger protein 496							44.0	43.0	43.0					1																	247464376		2203	4300	6503	SO:0001583	missense	84838	0	0					g.chr1:247464376C>A	BC007263	CCDS1631.1	1q44	2013-01-09			ENSG00000162714	ENSG00000162714		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23713	protein-coding gene	gene with protein product		613911				12477932	Standard	NM_032752		Approved	ZKSCAN17, MGC15548, ZSCAN49	uc001ico.3	Q96IT1	OTTHUMG00000041164	ENST00000294753.4:c.1209G>T	chr1.hg19:g.247464376C>A	ENSP00000294753:p.Lys403Asn	0					ZNF496_ENST00000462139.1_5'UTR|ZNF496_ENST00000366498.2_Missense_Mutation_p.K439N	p.K403N	NM_032752.1	NP_116141.1	2	2	4	2.086598	Q96IT1	ZN496_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00703)	9	1673	-	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		Q8TBS2	Missense_Mutation	SNP	ENST00000294753.4	1	1	hg19	c.1209G>T	CCDS1631.1	0	.	.	.	.	.	.	.	.	.	.	C	14.20	2.465499	0.43839	.	.	ENSG00000162714	ENST00000294753;ENST00000366498	T;T	0.45276	0.9;0.9	4.65	-4.52	0.03472	4.65	-4.52	0.03472	Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.008270	0.07967	N	0.983345	T	0.24353	0.0590	N	0.19112	0.55	0.09310	N	0.999996	P;P	0.37276	0.589;0.454	B;B	0.36608	0.229;0.037	T	0.25012	-1.0144	10	0.59425	D	0.04	-7.8109	6.9593	0.24587	0.0:0.3763:0.1183:0.5054	.	439;403	Q96IT1-2;Q96IT1	.;ZN496_HUMAN	N	403;439	ENSP00000294753:K403N;ENSP00000355454:K439N	ENSP00000294753:K403N	K	-	3	2	2	ZNF496	245530999	245530999	0.001000	0.12720	0.003000	0.11579	0.217000	0.24651	-0.786000	0.04623	-1.039000	0.03275	-0.140000	0.14226	AAG	0.387097		TCGA-2J-AABO-01A-21D-A40W-08	0.642	ZNF496-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098655.2	0	0	1		2	2	2	0		0	0	53		53	51	1	3.570000	-11.555700	1	0.240000	NM_032752			10	11		266	262	0		1	0		0	0	53	0		0.996857	4.937993e-02	0	0	0	9	0	10	266
SIGLEC1	6614	broad.mit.edu	37	20	3674202	3674202	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr20:3674202T>C	ENST00000344754.4	-	13	3399	c.3400A>G	c.(3400-3402)Atc>Gtc	p.I1134V	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.I1134V	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1134	Ig-like C2-type 11.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						GGCAGGGGGATGGAGTGGGCA	0.657																																						ENST00000344754.4	1.000000	0.540000	1	7.400000e-01	0.990000	0.901161	0.990000	1.000000																										0				70						c.(3400-3402)Atc>Gtc		sialic acid binding Ig-like lectin 1, sialoadhesin							62.0	48.0	53.0					20																	3674202		2203	4300	6503	SO:0001583	missense	6614	4	121396	32				g.chr20:3674202T>C	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3400A>G	chr20.hg19:g.3674202T>C	ENSP00000341141:p.Ile1134Val	0					SIGLEC1_ENST00000202578.4_Missense_Mutation_p.I1134V	p.I1134V	NM_023068.3	NP_075556.1	2	2	4	2.038962	Q9BZZ2	SN_HUMAN		13	3399	-			Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	0	1	hg19	c.3400A>G	CCDS13060.1	1	.	.	.	.	.	.	.	.	.	.	T	5.206	0.223588	0.09863	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.11712	2.75;2.75	5.52	3.08	0.35506	5.52	3.08	0.35506	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.000000	0.42548	D	0.000692	T	0.09024	0.0223	L	0.35542	1.07	0.24899	N	0.992116	B;B	0.19935	0.04;0.014	B;B	0.24974	0.057;0.027	T	0.22695	-1.0209	10	0.45353	T	0.12	.	9.2318	0.37441	0.0:0.0:0.3576:0.6424	.	1134;1134	Q9BZZ2;Q9BZZ2-3	SN_HUMAN;.	V	1134	ENSP00000341141:I1134V;ENSP00000202578:I1134V	ENSP00000202578:I1134V	I	-	1	0	0	SIGLEC1	3622202	3622202	1.000000	0.71417	0.930000	0.37139	0.011000	0.07611	0.477000	0.22196	0.915000	0.36847	0.533000	0.62120	ATC	0.375000		TCGA-2J-AABO-01A-21D-A40W-08	0.657	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	1	0	1		2	2	2	0		0	0	23		23	23	1	3.570000	-18.524400	1	0.240000	NM_023068			12	12		117	117	1		1		0	0	0	23	0		0.999267	0	0	0	1	0	0	12	117
RALGAPA2	57186	broad.mit.edu	37	20	20563724	20563724	+	Missense_Mutation	SNP	G	G	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr20:20563724G>T	ENST00000202677.7	-	20	2684	c.2677C>A	c.(2677-2679)Ctg>Atg	p.L893M		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	893					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						GTGGGACTCAGTTGTAACCAA	0.468																																						ENST00000202677.7	1.000000	0.120000	4.600000e-01	2.000000e-01	0.300000	0.363467	0.300000	0.270000																										0				54						c.(2677-2679)Ctg>Atg		Ral GTPase activating protein, alpha subunit 2 (catalytic)							82.0	80.0	81.0					20																	20563724		1953	4159	6112	SO:0001583	missense	57186	0	0					g.chr20:20563724G>T	AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.2677C>A	chr20.hg19:g.20563724G>T	ENSP00000202677:p.Leu893Met	0						p.L893M	NM_020343.3	NP_065076.2	2	2	4	2.038962	Q2PPJ7	RGPA2_HUMAN		20	2684	-			Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	ENST00000202677.7	1	1	hg19	c.2677C>A	CCDS46584.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.96|14.96	2.691060|2.691060	0.48097|0.48097	.|.	.|.	ENSG00000188559|ENSG00000188559	ENST00000202677|ENST00000430436	T|.	0.70164|.	-0.46|.	6.07|6.07	4.13|4.13	0.48395|0.48395	6.07|6.07	4.13|4.13	0.48395|0.48395	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.67135|0.67135	0.2861|0.2861	M|M	0.76328|0.76328	2.33|2.33	0.36785|0.36785	D|D	0.884564|0.884564	D;D|.	0.89917|.	1.0;0.998|.	D;D|.	0.71184|.	0.972;0.931|.	T|T	0.73257|0.73257	-0.4040|-0.4040	10|5	0.40728|.	T|.	0.16|.	.|.	10.5141|10.5141	0.44879|0.44879	0.2044:0.0:0.7956:0.0|0.2044:0.0:0.7956:0.0	.|.	731;893|.	A8MSM5;Q2PPJ7|.	.;RGPA2_HUMAN|.	M|K	893|709	ENSP00000202677:L893M|.	ENSP00000202677:L893M|.	L|N	-|-	1|3	2|2	2|2	RALGAPA2|RALGAPA2	20511724|20511724	20511724|20511724	0.961000|0.961000	0.32948|0.32948	0.992000|0.992000	0.48379|0.48379	0.608000|0.608000	0.37181|0.37181	1.380000|1.380000	0.34351|0.34351	1.581000|1.581000	0.49865|0.49865	0.655000|0.655000	0.94253|0.94253	CTG|AAC	0.375000		TCGA-2J-AABO-01A-21D-A40W-08	0.468	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471941.1	0	0	1		2	2	2	0		0	0	53		53	53	1	3.570000	-8.237756	1	0.240000	NM_020343			7	7		253	250	0		1	0		0	0	53	0		0.980198	1.933877e-02	0	0	0	7	0	7	253
RIMS4	140730	broad.mit.edu	37	20	43384834	43384834	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr20:43384834G>A	ENST00000372851.3	-	6	817	c.751C>T	c.(751-753)Cgg>Tgg	p.R251W	RIMS4_ENST00000541604.2_Missense_Mutation_p.R252W	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4	251					exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)				central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				GATGCCTGCCGGAGCAGGGGG	0.662																																						ENST00000372851.3	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				29						c.(751-753)Cgg>Tgg		regulating synaptic membrane exocytosis 4							59.0	59.0	59.0					20																	43384834		2203	4300	6503	SO:0001583	missense	140730	0	0					g.chr20:43384834G>A		CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546	ENST00000372851.3:c.751C>T	chr20.hg19:g.43384834G>A	ENSP00000361942:p.Arg251Trp	0					RIMS4_ENST00000541604.2_Missense_Mutation_p.R252W	p.R251W	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	2	2	4	2.038962	Q9H426	RIMS4_HUMAN		6	817	-		Myeloproliferative disorder(115;0.0122)	A4FU94|E1P613|Q3MI44|Q5JWT7	Missense_Mutation	SNP	ENST00000372851.3	1	1	hg19	c.751C>T	CCDS13338.1	1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.044559	0.75732	.	.	ENSG00000101098	ENST00000372851;ENST00000541604	T;T	0.24151	1.87;1.87	4.95	4.95	0.65309	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.46521	0.1397	L	0.60067	1.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.44802	-0.9304	10	0.87932	D	0	.	13.2074	0.59805	0.0:0.0:0.8409:0.1591	.	252;251	E1P613;Q9H426	.;RIMS4_HUMAN	W	251;252	ENSP00000361942:R251W;ENSP00000439287:R252W	ENSP00000361942:R251W	R	-	1	2	2	RIMS4	42818248	42818248	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.563000	0.67352	2.285000	0.76669	0.563000	0.77884	CGG	0.375000		TCGA-2J-AABO-01A-21D-A40W-08	0.662	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101027.2	1	0	1		2	2	2	0		0	0	82		82	81	1	3.570000	-4.180830	1	0.240000	NM_182970			98	97		316	310	1		1			0	0	82	0		1.000000	0	0	0	0	0	0	98	316
DOPEY2	9980	broad.mit.edu	37	21	37661466	37661466	+	Silent	SNP	G	G	A	rs112991413	byFrequency	TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr21:37661466G>A	ENST00000399151.3	+	35	6562	c.6477G>A	c.(6475-6477)gcG>gcA	p.A2159A		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	2159					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TGGACACAGCGCTTTCTTTTC	0.413													G|||	21	0.00419329	0.0159	0.0	5008	,	,		18523	0.0		0.0	False		,,,				2504	0.0					ENST00000399151.3	1.000000	0.680000	1	7.900000e-01	0.920000	0.906684	0.920000	1.000000																										0				58						c.(6475-6477)gcG>gcA		dopey family member 2		G		70,4336	64.1+/-101.4	2,66,2135	100.0	93.0	95.0		6477	-11.5	0.0	21	dbSNP_132	95	0,8600		0,0,4300	no	coding-synonymous	DOPEY2	NM_005128.2		2,66,6435	AA,AG,GG		0.0,1.5887,0.5382		2159/2299	37661466	70,12936	2203	4300	6503	SO:0001819	synonymous_variant	9980	194	121412	55				g.chr21:37661466G>A	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.6477G>A	chr21.hg19:g.37661466G>A		1						p.A2159A	NM_005128.2	NP_005119.2	1	2	3	1.858815	Q9Y3R5	DOP2_HUMAN		35	6562	+			D3DSG5|Q6PJQ7|Q9UEZ3	Silent	SNP	ENST00000399151.3	1	0	hg19	c.6477G>A	CCDS13643.1	1																																																																																								0.316301		TCGA-2J-AABO-01A-21D-A40W-08	0.413	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	1	0	1		2	2	2	0		0	0	137		137	135	1	3.570000	-3.318794	1	0.240000	NM_005128			46	46		421	416	1		1	1		0	0	137	0		1.000000	7.772314e-01	0	9	0	19	0	46	421
DSCR4	10281	broad.mit.edu	37	21	39492431	39492431	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr21:39492431G>A	ENST00000328264.3	-	2	304	c.200C>T	c.(199-201)aCg>aTg	p.T67M	DSCR8_ENST00000400477.3_5'Flank|DSCR8_ENST00000357704.4_5'Flank|DSCR4_ENST00000398948.1_Missense_Mutation_p.T67M	NM_005867.2	NP_005858.1	P56555	DSCR4_HUMAN	Down syndrome critical region gene 4	67										large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	6						tccagaatccgtaggagaagc	0.363																																						ENST00000328264.3	1.000000	0.180000	4.800000e-01	2.500000e-01	0.350000	0.393051	0.350000	0.320000																										0				6						c.(199-201)aCg>aTg		Down syndrome critical region gene 4							48.0	55.0	53.0					21																	39492431		2203	4300	6503	SO:0001583	missense	10281	0	0					g.chr21:39492431G>A	AB000099	CCDS33554.1	21q22.2	2012-04-19			ENSG00000184029	ENSG00000184029			3045	protein-coding gene	gene with protein product		604829				9455479	Standard	NM_005867		Approved	DCRB	uc002ywp.3	P56555	OTTHUMG00000086673	ENST00000328264.3:c.200C>T	chr21.hg19:g.39492431G>A	ENSP00000328676:p.Thr67Met	1					DSCR4_ENST00000398948.1_Missense_Mutation_p.T67M|DSCR8_ENST00000400477.3_5'Flank|DSCR8_ENST00000357704.4_5'Flank	p.T67M	NM_005867.2	NP_005858.1	1	2	3	1.858815	P56555	DSCR4_HUMAN		2	304	-			Q4VB31	Missense_Mutation	SNP	ENST00000328264.3	1	1	hg19	c.200C>T	CCDS33554.1	0	.	.	.	.	.	.	.	.	.	.	G	7.406	0.633692	0.14322	.	.	ENSG00000184029	ENST00000398948;ENST00000328264	.	.	.	1.45	-2.03	0.07365	1.45	-2.03	0.07365	.	.	.	.	.	T	0.18882	0.0453	.	.	.	0.09310	N	1	D	0.63880	0.993	B	0.41860	0.368	T	0.13602	-1.0503	7	0.87932	D	0	.	0.4825	0.00550	0.1868:0.246:0.3187:0.2485	.	67	P56555	DSCR4_HUMAN	M	67	.	ENSP00000328676:T67M	T	-	2	0	0	DSCR4	38414301	38414301	0.000000	0.05858	0.000000	0.03702	0.270000	0.26580	0.033000	0.13754	-0.677000	0.05231	0.313000	0.20887	ACG	0.316301		TCGA-2J-AABO-01A-21D-A40W-08	0.363	DSCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000194834.1	0	0	1		2	2	2	0		0	0	51		51	50	1	3.570000	-3.804006	1	0.240000	NM_005867			11	11		296	294	0		1			0	0	51	0		0.998354	0	0	0	0	0	0	11	296
DSCAM	1826	broad.mit.edu	37	21	41447025	41447025	+	Silent	SNP	C	C	A	rs371238790		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr21:41447025C>A	ENST00000400454.1	-	27	5304	c.4827G>T	c.(4825-4827)ctG>ctT	p.L1609L		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1609					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GGAGCACAAACAGCAGCAAGA	0.592																																					Melanoma(134;970 1778 1785 21664 32388)	ENST00000400454.1	1.000000	0.340000	8.600000e-01	4.700000e-01	0.640000	0.663723	0.640000	1.000000																										0				142						c.(4825-4827)ctG>ctT		Down syndrome cell adhesion molecule							94.0	110.0	105.0					21																	41447025		2120	4232	6352	SO:0001819	synonymous_variant	1826	0	0					g.chr21:41447025C>A	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.4827G>T	chr21.hg19:g.41447025C>A		1						p.L1609L	NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	1	2	3	1.858815	O60469	DSCAM_HUMAN		27	5304	-		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)	O60468	Silent	SNP	ENST00000400454.1	1	1	hg19	c.4827G>T	CCDS42929.1	0																																																																																								0.316301		TCGA-2J-AABO-01A-21D-A40W-08	0.592	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	1	0	1		2	2	2	0		0	0	39		39	39	1	3.570000	-5.741892	1	0.240000	NM_001389			12	12		170	168	0		1	0		0	0	39	0		0.999161	0	0	0	0	1	0	12	170
MYO18B	84700	broad.mit.edu	37	22	26165019	26165019	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr22:26165019G>A	ENST00000407587.2	+	4	1305	c.1136G>A	c.(1135-1137)cGg>cAg	p.R379Q	MYO18B_ENST00000536101.1_Missense_Mutation_p.R379Q|MYO18B_ENST00000335473.7_Missense_Mutation_p.R379Q			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	379			R -> Q (in a lung small cell carcinoma sample; somatic mutation). {ECO:0000269|PubMed:12209013}.			cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GGTGAGCTTCGGAGCACGACT	0.577																																						ENST00000407587.2	1.000000	0.690000	1	9.500000e-01	0.990000	0.970008	0.990000	1.000000																										0				146						c.(1135-1137)cGg>cAg		myosin XVIIIB							37.0	41.0	40.0					22																	26165019		2091	4217	6308	SO:0001583	missense	84700	1	121076	21				g.chr22:26165019G>A	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.1136G>A	chr22.hg19:g.26165019G>A	ENSP00000386096:p.Arg379Gln	0					MYO18B_ENST00000335473.7_Missense_Mutation_p.R379Q|MYO18B_ENST00000536101.1_Missense_Mutation_p.R379Q	p.R379Q			1	2	3	1.904117	Q8IUG5	MY18B_HUMAN		4	1305	+			B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	0	1	hg19	c.1136G>A		1	.	.	.	.	.	.	.	.	.	.	g	0.011	-1.725392	0.00694	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.85955	-2.03;-2.03;-2.05	3.61	-7.22	0.01485	3.61	-7.22	0.01485	.	1.993940	0.02842	N	0.128040	T	0.58736	0.2143	N	0.02539	-0.55	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.57406	-0.7817	10	0.22109	T	0.4	.	0.8732	0.01218	0.2243:0.3074:0.2432:0.2251	.	379;379;379	Q8IUG5;F5GXR6;F5GYU7	MY18B_HUMAN;.;.	Q	379	ENSP00000441229:R379Q;ENSP00000334563:R379Q;ENSP00000386096:R379Q	ENSP00000334563:R379Q	R	+	2	0	0	MYO18B	24495019	24495019	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.457000	0.00231	-2.713000	0.00392	-2.582000	0.00168	CGG	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.577	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	1	0	1		2	2	2	0		0	0	18		18	17	1	3.570000	-18.763630	1	0.240000	NM_032608			11	11		71	71	1		1			0	0	18	0		0.998725	0	0	0	0	0	0	11	71
APOL5	80831	broad.mit.edu	37	22	36122258	36122258	+	Splice_Site	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr22:36122258C>T	ENST00000249044.2	+	3	143	c.143C>T	c.(142-144)cCc>cTc	p.P48L		NM_030642.1	NP_085145.1	Q9BWW9	APOL5_HUMAN	apolipoprotein L, 5	48					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|skin(2)|urinary_tract(1)	19						ATGTCTTTAGCCTCACTCGTG	0.443																																						ENST00000249044.2	1.000000	0.560000	1	6.900000e-01	0.850000	0.847716	0.850000	1.000000																										0				19						c.(142-144)cCc>cTc		apolipoprotein L, 5							101.0	94.0	96.0					22																	36122258		2203	4300	6503	SO:0001630	splice_region_variant	80831	0	0					g.chr22:36122258C>T	AY014878	CCDS13920.1	22q12.3	2013-01-24			ENSG00000128313	ENSG00000128313		"""Apolipoproteins"""	14869	protein-coding gene	gene with protein product		607255				11374903	Standard	NM_030642		Approved	APOLV	uc003aof.3	Q9BWW9	OTTHUMG00000150588	ENST00000249044.2:c.143-1C>T	chr22.hg19:g.36122258C>T		0						p.P48L	NM_030642.1	NP_085145.1	1	2	3	1.904117	Q9BWW9	APOL5_HUMAN		3	143	+			Q5TFL9|Q9UGW5	Splice_Site	SNP	ENST00000249044.2	1	0	hg19	c.143C>T	CCDS13920.1	1	.	.	.	.	.	.	.	.	.	.	C	11.99	1.803589	0.31869	.	.	ENSG00000128313	ENST00000249044	T	0.04049	3.72	2.15	-4.31	0.03698	2.15	-4.31	0.03698	.	4.487750	0.01131	U	0.005995	T	0.02455	0.0075	N	0.08118	0	0.09310	N	1	B	0.15473	0.013	B	0.06405	0.002	T	0.40534	-0.9558	9	.	.	.	.	4.0884	0.09958	0.0:0.2062:0.369:0.4248	.	48	Q9BWW9	APOL5_HUMAN	L	48	ENSP00000249044:P48L	.	P	+	2	0	0	APOL5	34452204	34452204	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.097000	0.03349	-1.277000	0.02411	-0.731000	0.03576	CCC	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.443	APOL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318979.1	1	0	1		2	2	2	0		0	0	48		48	45	1	3.570000	-3.318794	1	0.240000	NM_030642	Missense_Mutation		24	24		240	239	0		1			0	0	48	0		1.000000	0	0	0	0	0	0	24	240
EP300	2033	broad.mit.edu	37	22	41542773	41542773	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr22:41542773G>A	ENST00000263253.7	+	11	3303	c.2084G>A	c.(2083-2085)cGt>cAt	p.R695H		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	695					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						AGTATGATCCGTGGCAGTGTG	0.393			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																													ENST00000263253.7	1.000000	0.490000	9.400000e-01	6.100000e-01	0.750000	0.769527	0.750000	1.000000				Rec	yes			Rec	yes		22	22q13	22q13	2033	T,  N, F, Mis, O	300 kd E1A-Binding protein gene				"""L, E"""	L, E	MLL, RUNXBP2		colorectal, breast, pancreatic, AML, ALL, DLBCL		0				171						c.(2083-2085)cGt>cAt		E1A binding protein p300							97.0	94.0	95.0					22																	41542773		2203	4300	6503	SO:0001583	missense	2033	0	0		Rubinstein-Taybi syndrome	Familial Cancer Database	Broad Thumb-Hallux syndrome	g.chr22:41542773G>A	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.2084G>A	chr22.hg19:g.41542773G>A	ENSP00000263253:p.Arg695His	1						p.R695H	NM_001429.3	NP_001420.2	1	10	11	3.375024	Q09472	EP300_HUMAN		11	3303	+			B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	1	1	hg19	c.2084G>A	CCDS14010.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.538907	0.96474	.	.	ENSG00000100393	ENST00000263253	D	0.83914	-1.78	5.77	5.77	0.91146	5.77	5.77	0.91146	.	0.132950	0.34178	N	0.004196	D	0.85703	0.5758	N	0.24115	0.695	0.58432	D	0.999998	D	0.76494	0.999	D	0.71656	0.974	D	0.84199	0.0449	10	0.33141	T	0.24	-2.4217	19.9922	0.97370	0.0:0.0:1.0:0.0	.	695	Q09472	EP300_HUMAN	H	695	ENSP00000263253:R695H	ENSP00000263253:R695H	R	+	2	0	0	EP300	39872719	39872719	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.683000	0.91236	2.729000	0.93468	0.563000	0.77884	CGT	0.620834		TCGA-2J-AABO-01A-21D-A40W-08	0.393	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	1	0	1		2	2	2	0		0	0	67		67	65	1	3.570000	-3.313220	1	0.240000	NM_001429			29	29		628	621	0		1	0		0	0	67	0		1.000000	1.327913e-01	0	0	0	14	0	29	628
LCT	3938	broad.mit.edu	37	2	136567237	136567237	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr2:136567237C>T	ENST00000264162.2	-	8	2690	c.2680G>A	c.(2680-2682)Gaa>Aaa	p.E894K	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	894	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	AAATCTCTTTCGAACTTGGGT	0.517																																						ENST00000264162.2	1.000000	0.690000	1	8.000000e-01	0.920000	0.907788	0.920000	1.000000																										0				124						c.(2680-2682)Gaa>Aaa		lactase	Vitamin C(DB00126)						118.0	124.0	122.0					2																	136567237		2203	4300	6503	SO:0001583	missense	3938	0	0					g.chr2:136567237C>T	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2680G>A	chr2.hg19:g.136567237C>T	ENSP00000264162:p.Glu894Lys	1					Y_RNA_ENST00000363794.1_RNA	p.E894K	NM_002299.2	NP_002290.2	2	3	5	2.236140	P09848	LPH_HUMAN		8	2690	-			Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	1	1	hg19	c.2680G>A	CCDS2178.1	1	.	.	.	.	.	.	.	.	.	.	C	19.54	3.847176	0.71603	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.29917	1.55	5.78	5.78	0.91487	5.78	5.78	0.91487	.	0.148918	0.64402	D	0.000012	T	0.59032	0.2164	M	0.78049	2.395	0.51767	D	0.999935	D	0.67145	0.996	D	0.67231	0.95	T	0.61113	-0.7128	10	0.72032	D	0.01	-28.1342	20.0139	0.97470	0.0:1.0:0.0:0.0	.	894	P09848	LPH_HUMAN	K	894;326	ENSP00000264162:E894K	ENSP00000264162:E894K	E	-	1	0	0	LCT	136283707	136283707	0.995000	0.38212	1.000000	0.80357	0.647000	0.38526	1.529000	0.35996	2.724000	0.93272	0.563000	0.77884	GAA	0.427538		TCGA-2J-AABO-01A-21D-A40W-08	0.517	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	1	0	1		2	2	2	0		0	0	108		108	104	1	3.570000	-13.066960	1	0.240000	NM_002299			53	50		593	589	0		1			0	0	108	0		1.000000	0	0	0	0	0	0	53	593
LRP1B	53353	broad.mit.edu	37	2	141128374	141128374	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr2:141128374C>T	ENST00000389484.3	-	71	11884	c.10913G>A	c.(10912-10914)cGg>cAg	p.R3638Q		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3638	LDL-receptor class A 29. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATTTTTGCACCGAAACTGATC	0.388										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	ENST00000389484.3	1.000000	0.490000	8.500000e-01	5.900000e-01	0.700000	0.722438	0.700000	0.700000																										0				606						c.(10912-10914)cGg>cAg		low density lipoprotein receptor-related protein 1B							183.0	169.0	174.0					2																	141128374		2203	4300	6503	SO:0001583	missense	53353	7	121406	40				g.chr2:141128374C>T	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10913G>A	chr2.hg19:g.141128374C>T	ENSP00000374135:p.Arg3638Gln	1	TSP Lung(27;0.18)					p.R3638Q	NM_018557.2	NP_061027.2	2	3	5	2.236140	Q9NZR2	LRP1B_HUMAN		71	11884	-		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	1	1	hg19	c.10913G>A	CCDS2182.1	0	.	.	.	.	.	.	.	.	.	.	C	12.65	2.000256	0.35320	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	T	0.41400	1.0	5.12	4.23	0.50019	5.12	4.23	0.50019	.	0.218941	0.31335	N	0.007839	T	0.18173	0.0436	N	0.05608	-0.01	0.24759	N	0.992934	B	0.06786	0.001	B	0.04013	0.001	T	0.26087	-1.0113	10	0.02654	T	1	.	9.1573	0.37000	0.0:0.8316:0.0:0.1684	.	3638	Q9NZR2	LRP1B_HUMAN	Q	3638;3576	ENSP00000374135:R3638Q	ENSP00000374135:R3638Q	R	-	2	0	0	LRP1B	140844844	140844844	0.931000	0.31567	1.000000	0.80357	0.996000	0.88848	1.822000	0.39052	1.132000	0.42129	0.491000	0.48974	CGG	0.427538		TCGA-2J-AABO-01A-21D-A40W-08	0.388	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	1	0	1		23	2	2	1		1	1	87		87	83	1	3.570000	-2.458456	0	0.240000	NM_018557			39	39		589	582	0		1			1	0	87	0		0.985140	0	0	0	0	0	0	39	589
NBEAL1	65065	broad.mit.edu	37	2	204009335	204009335	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr2:204009335G>A	ENST00000449802.1	+	31	5107	c.4774G>A	c.(4774-4776)Gca>Aca	p.A1592T		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1592										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						TTGTGCAATGGCATCAGCTAA	0.403																																						ENST00000449802.1	1.000000	0.040000	2.500000e-01	8.000000e-02	0.140000	0.217387	0.140000	0.140000																										0				37						c.(4774-4776)Gca>Aca		neurobeachin-like 1							107.0	95.0	99.0					2																	204009335		1890	4117	6007	SO:0001583	missense	65065	0	0					g.chr2:204009335G>A	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.4774G>A	chr2.hg19:g.204009335G>A	ENSP00000399903:p.Ala1592Thr	1						p.A1592T	NM_001114132.1	NP_001107604.1	2	3	5	2.236140	Q6ZS30	NBEL1_HUMAN		31	5107	+			A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	0	1	hg19	c.4774G>A	CCDS46495.1	0	.	.	.	.	.	.	.	.	.	.	G	33	5.198565	0.94997	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.74106	-0.81	5.8	5.8	0.92144	5.8	5.8	0.92144	.	0.798454	0.11851	N	0.523346	D	0.88074	0.6339	M	0.77313	2.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.86728	0.1946	10	0.87932	D	0	.	19.6495	0.95795	0.0:0.0:1.0:0.0	.	1592;1581	Q6ZS30;C9JGK5	NBEL1_HUMAN;.	T	1592	ENSP00000399903:A1592T	ENSP00000344985:A1592T	A	+	1	0	0	NBEAL1	203717580	203717580	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.444000	0.97578	2.748000	0.94277	0.655000	0.94253	GCA	0.427538		TCGA-2J-AABO-01A-21D-A40W-08	0.403	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4	0	0	1		2	2	2	0		0	0	76		76	75	1	3.570000	-2.542651	1	0.240000				5	5		417	410	0		1	0		0	0	76	0		0.935110	6.904691e-04	0	0	0	3	0	5	417
EPHA4	2043	broad.mit.edu	37	2	222307700	222307700	+	Missense_Mutation	SNP	T	T	G			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr2:222307700T>G	ENST00000281821.2	-	11	1964	c.1923A>C	c.(1921-1923)aaA>aaC	p.K641N	EPHA4_ENST00000392071.4_Missense_Mutation_p.K590N|EPHA4_ENST00000409854.1_Missense_Mutation_p.K641N|EPHA4_ENST00000409938.1_Missense_Mutation_p.K641N	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	641	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		TGCCAGGCACTTTGAGACGCC	0.448																																						ENST00000281821.2	1.000000	0.540000	9.400000e-01	6.500000e-01	0.770000	0.788240	0.770000	1.000000																										0				49						c.(1921-1923)aaA>aaC		EPH receptor A4							130.0	125.0	127.0					2																	222307700		2203	4300	6503	SO:0001583	missense	2043	0	0					g.chr2:222307700T>G	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.1923A>C	chr2.hg19:g.222307700T>G	ENSP00000281821:p.Lys641Asn	1					EPHA4_ENST00000409938.1_Missense_Mutation_p.K641N|EPHA4_ENST00000392071.4_Missense_Mutation_p.K590N|EPHA4_ENST00000409854.1_Missense_Mutation_p.K641N	p.K641N	NM_004438.3	NP_004429.1	2	3	5	2.236140	P54764	EPHA4_HUMAN		11	1964	-		Renal(207;0.0183)	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	1	1	hg19	c.1923A>C	CCDS2447.1	0	.	.	.	.	.	.	.	.	.	.	T	19.22	3.785330	0.70337	.	.	ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071	D;D;D;D	0.83335	-1.71;-1.71;-1.71;-1.71	6.06	4.91	0.64330	6.06	4.91	0.64330	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.84642	0.5517	L	0.47078	1.49	0.58432	D	0.999997	P	0.52463	0.953	P	0.58454	0.839	D	0.84672	0.0712	10	0.87932	D	0	.	8.1583	0.31183	0.0:0.2111:0.0:0.7889	.	641	P54764	EPHA4_HUMAN	N	641;641;641;590	ENSP00000281821:K641N;ENSP00000386276:K641N;ENSP00000386829:K641N;ENSP00000375923:K590N	ENSP00000281821:K641N	K	-	3	2	2	EPHA4	222015944	222015944	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.233000	0.32648	1.121000	0.41925	0.533000	0.62120	AAA	0.427538		TCGA-2J-AABO-01A-21D-A40W-08	0.448	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3	1	0	1		2	2	2	0		0	0	85		85	84	1	3.570000	-8.807678	1	0.240000				35	34		476	470	0		1	0		0	0	85	0		1.000000	1.535855e-01	0	0	0	10	0	35	476
GBX2	2637	broad.mit.edu	37	2	237074778	237074778	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr2:237074778C>T	ENST00000306318.4	-	2	1223	c.826G>A	c.(826-828)Gag>Aag	p.E276K	AC079135.1_ENST00000415226.1_RNA|GBX2_ENST00000551105.1_3'UTR|AC079135.1_ENST00000483218.1_RNA|GBX2_ENST00000465889.1_5'UTR	NM_001485.2	NP_001476.2	P52951	GBX2_HUMAN	gastrulation brain homeobox 2	276					autonomic nervous system development (GO:0048483)|axon guidance (GO:0007411)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellum development (GO:0021549)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|patterning of blood vessels (GO:0001569)|rhombomere 2 development (GO:0021568)|thalamus development (GO:0021794)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7		Breast(86;0.00235)|Renal(207;0.00339)|all_hematologic(139;0.00357)|all_lung(227;0.0616)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|Lung NSC(271;0.179)		Epithelial(121;4.5e-25)|OV - Ovarian serous cystadenocarcinoma(60;5.16e-11)|BRCA - Breast invasive adenocarcinoma(100;3.4e-05)|Lung(119;0.00195)|LUSC - Lung squamous cell carcinoma(224;0.00471)		TGCGAGCGCTCGGTCAAGGAG	0.602																																						ENST00000306318.4	1.000000	0.100000	3.300000e-01	1.500000e-01	0.220000	0.286707	0.220000	0.200000																										0				7						c.(826-828)Gag>Aag		gastrulation brain homeobox 2							75.0	79.0	78.0					2																	237074778		2203	4300	6503	SO:0001583	missense	2637	0	0					g.chr2:237074778C>T	AF118452	CCDS2515.1	2q37.2	2012-03-09	2005-12-22		ENSG00000168505	ENSG00000168505		"""Homeoboxes / ANTP class : HOXL subclass"""	4186	protein-coding gene	gene with protein product		601135	"""gastrulation brain homeo box 2"""			9346236, 8838315	Standard	XM_005246071		Approved		uc002vvw.1	P52951	OTTHUMG00000133294	ENST00000306318.4:c.826G>A	chr2.hg19:g.237074778C>T	ENSP00000302251:p.Glu276Lys	1					GBX2_ENST00000551105.1_3'UTR|AC079135.1_ENST00000415226.1_RNA|AC079135.1_ENST00000483218.1_RNA|GBX2_ENST00000465889.1_5'UTR	p.E276K	NM_001485.2	NP_001476.2	2	3	5	2.236140	P52951	GBX2_HUMAN		2	1223	-		Breast(86;0.00235)|Renal(207;0.00339)|all_hematologic(139;0.00357)|all_lung(227;0.0616)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|Lung NSC(271;0.179)	B2RPH7|O43833|Q53RX5|Q9Y5Y1	Missense_Mutation	SNP	ENST00000306318.4	0	1	hg19	c.826G>A	CCDS2515.1	0	.	.	.	.	.	.	.	.	.	.	C	31	5.081431	0.94050	.	.	ENSG00000168505	ENST00000306318	D	0.96300	-3.97	4.66	4.66	0.58398	4.66	4.66	0.58398	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.96482	0.8852	L	0.31578	0.945	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96285	0.9209	10	0.36615	T	0.2	-15.9796	17.5569	0.87894	0.0:1.0:0.0:0.0	.	276	P52951	GBX2_HUMAN	K	276	ENSP00000302251:E276K	ENSP00000302251:E276K	E	-	1	0	0	GBX2	236739517	236739517	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.990000	0.70595	2.133000	0.65898	0.561000	0.74099	GAG	0.427538		TCGA-2J-AABO-01A-21D-A40W-08	0.602	GBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257078.3	0	0	1		2	2	2	1		1	0	95		95	95	1	3.570000	-2.659535	1	0.240000	NM_001485			10	10		514	503	0		1			1	0	95	0		0.996585	0	0	0	0	0	0	10	514
GPR113	165082	broad.mit.edu	37	2	26534165	26534165	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr2:26534165C>T	ENST00000311519.1	-	11	2430	c.2431G>A	c.(2431-2433)Gcc>Acc	p.A811T	GPR113_ENST00000333478.6_Missense_Mutation_p.A612T|GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000541401.1_Missense_Mutation_p.A414T|GPR113_ENST00000421160.2_Missense_Mutation_p.A742T	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	811					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGAGCAGGGCGGCGTGGCGG	0.622																																						ENST00000311519.1	1.000000	0.590000	1	7.900000e-01	0.990000	0.926939	0.990000	1.000000																										0				24						c.(2431-2433)Gcc>Acc		G protein-coupled receptor 113							64.0	50.0	55.0					2																	26534165		2203	4300	6503	SO:0001583	missense	165082	0	0					g.chr2:26534165C>T	AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.2431G>A	chr2.hg19:g.26534165C>T	ENSP00000307831:p.Ala811Thr	0					GPR113_ENST00000333478.6_Missense_Mutation_p.A612T|GPR113_ENST00000541401.1_Missense_Mutation_p.A414T|GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000421160.2_Missense_Mutation_p.A742T	p.A811T	NM_001145168.1	NP_001138640.1	2	2	4	2.069894	Q8IZF5	GP113_HUMAN		11	2430	-	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)		B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	ENST00000311519.1	0	1	hg19	c.2431G>A	CCDS46239.1	1	.	.	.	.	.	.	.	.	.	.	C	6.411	0.443938	0.12164	.	.	ENSG00000173567	ENST00000541401;ENST00000333478;ENST00000421160;ENST00000311519	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	6.0	1.07	0.20283	6.0	1.07	0.20283	GPCR, family 2-like (1);	.	.	.	.	T	0.31389	0.0795	L	0.47016	1.485	0.45515	D	0.998478	P;P;B;P	0.42409	0.779;0.72;0.378;0.497	B;B;B;B	0.43680	0.427;0.209;0.427;0.169	T	0.12142	-1.0559	9	0.22109	T	0.4	-11.1476	2.2265	0.03985	0.1221:0.4838:0.1187:0.2754	.	742;612;811;414	E9PEV1;Q8IZF5-2;Q8IZF5;F5H1E4	.;.;GP113_HUMAN;.	T	414;612;742;811	ENSP00000445729:A414T;ENSP00000327396:A612T;ENSP00000388537:A742T;ENSP00000307831:A811T	ENSP00000307831:A811T	A	-	1	0	0	GPR113	26387669	26387669	0.001000	0.12720	0.052000	0.19188	0.087000	0.18053	-0.211000	0.09332	-0.077000	0.12752	-0.703000	0.03666	GCC	0.384715		TCGA-2J-AABO-01A-21D-A40W-08	0.622	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316892.1	1	0	1		2	2	2	0		0	0	22		22	21	1	3.570000	-7.644387	1	0.240000	NM_153835			13	13		118	115	0		1			0	0	22	0		0.999562	0	0	0	0	0	0	13	118
CRIM1	51232	broad.mit.edu	37	2	36726453	36726453	+	Silent	SNP	C	C	T	rs375356337		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr2:36726453C>T	ENST00000280527.2	+	8	1831	c.1464C>T	c.(1462-1464)cgC>cgT	p.R488R		NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	488	Antistasin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00582}.				insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				GTTTCAAACGCGATCACAATG	0.408																																						ENST00000280527.2	1.000000	0.860000	1	9.900000e-01	0.990000	0.988577	0.990000	1.000000																										0				45						c.(1462-1464)cgC>cgT		cysteine rich transmembrane BMP regulator 1 (chordin-like)							151.0	137.0	142.0					2																	36726453		2203	4300	6503	SO:0001819	synonymous_variant	51232	6	121412	44				g.chr2:36726453C>T	AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.1464C>T	chr2.hg19:g.36726453C>T		0						p.R488R	NM_016441.2	NP_057525.1	2	2	4	2.072110	Q9NZV1	CRIM1_HUMAN		8	1831	+		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)	Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Silent	SNP	ENST00000280527.2	1	1	hg19	c.1464C>T	CCDS1783.1	1																																																																																								0.385908		TCGA-2J-AABO-01A-21D-A40W-08	0.408	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216878.2	1	0	1		2	2	2	0		0	0	77		77	75	1	3.570000	-19.041460	1	0.240000	NM_016441			56	55		457	453	1		1	0		0	0	77	0		1.000000	6.328457e-01	0	1	0	18	0	56	457
QPCT	25797	broad.mit.edu	37	2	37571893	37571893	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr2:37571893C>T	ENST00000338415.3	+	1	177	c.19C>T	c.(19-21)Cgg>Tgg	p.R7W	QPCT_ENST00000537448.1_Missense_Mutation_p.R7W	NM_012413.3	NP_036545.1	Q16769	QPCT_HUMAN	glutaminyl-peptide cyclotransferase	7					cellular protein modification process (GO:0006464)|peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase (GO:0017186)	extracellular vesicular exosome (GO:0070062)	glutaminyl-peptide cyclotransferase activity (GO:0016603)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|stomach(2)	17		Ovarian(717;0.051)|all_hematologic(82;0.21)				CGGAAGACACCGGCGCGTCGT	0.711																																						ENST00000338415.3	1.000000	0.420000	1	6.600000e-01	0.990000	0.872975	0.990000	1.000000																										0				17						c.(19-21)Cgg>Tgg		glutaminyl-peptide cyclotransferase							14.0	18.0	17.0					2																	37571893		2188	4274	6462	SO:0001583	missense	25797	0	0					g.chr2:37571893C>T	X71125	CCDS1790.1	2p22	2008-07-31	2008-07-31		ENSG00000115828	ENSG00000115828	2.3.2.5		9753	protein-coding gene	gene with protein product	"""glutaminyl cyclase"""	607065				7999256	Standard	NM_012413		Approved	QC, GCT	uc002rqg.3	Q16769	OTTHUMG00000100963	ENST00000338415.3:c.19C>T	chr2.hg19:g.37571893C>T	ENSP00000344829:p.Arg7Trp	0					QPCT_ENST00000537448.1_Missense_Mutation_p.R7W	p.R7W	NM_012413.3	NP_036545.1	2	2	4	2.072110	Q16769	QPCT_HUMAN		1	177	+		Ovarian(717;0.051)|all_hematologic(82;0.21)	Q16770|Q3KRG6|Q53TR4	Missense_Mutation	SNP	ENST00000338415.3	0	1	hg19	c.19C>T	CCDS1790.1	1	.	.	.	.	.	.	.	.	.	.	C	10.80	1.451494	0.26074	.	.	ENSG00000115828	ENST00000338415;ENST00000404976;ENST00000537448	T;T;T	0.31510	1.49;1.49;1.49	4.57	1.6	0.23607	4.57	1.6	0.23607	.	1.023380	0.07800	N	0.956267	T	0.27594	0.0678	L	0.53249	1.67	0.09310	N	1	B;B	0.13145	0.007;0.004	B;B	0.04013	0.001;0.001	T	0.34104	-0.9842	10	0.66056	D	0.02	.	4.3052	0.10944	0.1911:0.5985:0.0:0.2104	.	7;7	Q16769-2;Q16769	.;QPCT_HUMAN	W	7	ENSP00000344829:R7W;ENSP00000385391:R7W;ENSP00000441606:R7W	ENSP00000344829:R7W	R	+	1	2	2	QPCT	37425397	37425397	0.000000	0.05858	0.028000	0.17463	0.209000	0.24338	-0.551000	0.06027	0.439000	0.26476	0.455000	0.32223	CGG	0.385908		TCGA-2J-AABO-01A-21D-A40W-08	0.711	QPCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218572.2	0	0	1		2	2	2	0		0	0	14		14	11	1	3.570000	-11.385630	1	0.240000				6	6		60	53	0		1	0		0	0	14	0		0.953953	3.849844e-01	0	0	0	13	0	6	60
ABCG8	64241	broad.mit.edu	37	2	44102330	44102330	+	Missense_Mutation	SNP	G	G	A	rs376069170		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr2:44102330G>A	ENST00000272286.2	+	11	1624	c.1534G>A	c.(1534-1536)Ggg>Agg	p.G512R		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	512	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)	p.G512W(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CATCATCTACGGGATGCCCAC	0.562																																						ENST00000272286.2	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										1	Substitution - Missense(1)	p.G512W(1)	lung(1)	45						c.(1534-1536)Ggg>Agg		ATP-binding cassette, sub-family G (WHITE), member 8	Ezetimibe(DB00973)	G	ARG/GLY	0,4406		0,0,2203	85.0	78.0	80.0		1534	3.7	0.7	2		80	1,8599	1.2+/-3.3	0,1,4299	no	missense	ABCG8	NM_022437.2	125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	512/674	44102330	1,13005	2203	4300	6503	SO:0001583	missense	64241	2	121412	35				g.chr2:44102330G>A	AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.1534G>A	chr2.hg19:g.44102330G>A	ENSP00000272286:p.Gly512Arg	0						p.G512R	NM_022437.2	NP_071882.1	2	2	4	2.072110	Q9H221	ABCG8_HUMAN		11	1624	+		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Q53QN8	Missense_Mutation	SNP	ENST00000272286.2	1	1	hg19	c.1534G>A	CCDS1815.1	1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.834015	0.50951	0.0	1.16E-4	ENSG00000143921	ENST00000272286	T	0.72394	-0.65	4.62	3.72	0.42706	4.62	3.72	0.42706	ABC-2 type transporter (1);	0.264244	0.42821	N	0.000659	T	0.65165	0.2665	M	0.63428	1.95	0.44388	D	0.997299	P;P	0.39665	0.631;0.682	B;B	0.35859	0.135;0.212	T	0.62501	-0.6841	10	0.23891	T	0.37	.	14.5487	0.68050	0.0:0.1475:0.8525:0.0	.	511;512	Q9H221-2;Q9H221	.;ABCG8_HUMAN	R	512	ENSP00000272286:G512R	ENSP00000272286:G512R	G	+	1	0	0	ABCG8	43955834	43955834	1.000000	0.71417	0.729000	0.30791	0.885000	0.51271	6.127000	0.71642	0.913000	0.36797	0.467000	0.42956	GGG	0.385908		TCGA-2J-AABO-01A-21D-A40W-08	0.562	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250671.1	1	0	1		2	2	2	0		0	0	86		86	85	1	3.570000	-2.224851	0	0.240000	NM_022437			69	67		329	324	1		1	1		0	0	86	0		1.000000	2.132015e-01	0	2	0	3	0	69	329
MAL	4118	broad.mit.edu	37	2	95715409	95715409	+	Silent	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr2:95715409C>T	ENST00000309988.4	+	3	454	c.345C>T	c.(343-345)gaC>gaT	p.D115D	MAL_ENST00000349807.3_Intron|MAL_ENST00000354078.3_Silent_p.D59D|MAL_ENST00000353004.3_Intron|AC103563.9_ENST00000442200.1_RNA	NM_002371.3	NP_002362.1	P21145	MAL_HUMAN	mal, T-cell differentiation protein	115	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|central nervous system development (GO:0007417)|membrane raft polarization (GO:0001766)|myelination (GO:0042552)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	channel activity (GO:0015267)|lipid binding (GO:0008289)|peptidase activator activity involved in apoptotic process (GO:0016505)|structural constituent of myelin sheath (GO:0019911)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(2)	10				STAD - Stomach adenocarcinoma(1183;0.18)		CGATGCAAGACGGCTTCACCT	0.647																																						ENST00000309988.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				10						c.(343-345)gaC>gaT		mal, T-cell differentiation protein							144.0	127.0	133.0					2																	95715409		2203	4300	6503	SO:0001819	synonymous_variant	4118	5	121412	39				g.chr2:95715409C>T		CCDS2006.1, CCDS2007.1, CCDS2008.1, CCDS2009.1	2q11.1	2008-07-29			ENSG00000172005	ENSG00000172005			6817	protein-coding gene	gene with protein product		188860					Standard	NM_002371		Approved		uc002stx.2	P21145	OTTHUMG00000132011	ENST00000309988.4:c.345C>T	chr2.hg19:g.95715409C>T		0					AC103563.9_ENST00000442200.1_RNA|MAL_ENST00000349807.3_Intron|MAL_ENST00000353004.3_Intron|MAL_ENST00000354078.3_Silent_p.D59D	p.D115D	NM_002371.3	NP_002362.1	2	2	4	2.072110	P21145	MAL_HUMAN		3	454	+			Q6FH77	Silent	SNP	ENST00000309988.4	1	1	hg19	c.345C>T	CCDS2006.1	1																																																																																								0.385908		TCGA-2J-AABO-01A-21D-A40W-08	0.647	MAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254982.3	1	0	1		2	2	2	0		0	0	74		74	73	1	3.570000	-20.000000	1	0.240000	NM_002371			97	96		410	405	0		1	0		0	0	74	0		1.000000	9.714192e-02	0	0	0	3	0	97	410
ESPNL	339768	broad.mit.edu	37	2	239037368	239037368	+	Silent	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr2:239037368G>A	ENST00000343063.3	+	8	1499	c.1236G>A	c.(1234-1236)gcG>gcA	p.A412A	ESPNL_ENST00000409169.1_Silent_p.A368A|ESPNL_ENST00000409506.1_Silent_p.A44A	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	412										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		CGGCGCTGGCGGGGGACACCT	0.701																																						ENST00000343063.3	1.000000	0.990000	1	9.900000e-01	0.990000	0.997630	0.990000	1.000000																										0				13						c.(1234-1236)gcG>gcA		espin-like							13.0	16.0	15.0					2																	239037368		2183	4282	6465	SO:0001819	synonymous_variant	339768	2	120072	19				g.chr2:239037368G>A	AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.1236G>A	chr2.hg19:g.239037368G>A		1					ESPNL_ENST00000409169.1_Silent_p.A368A|ESPNL_ENST00000409506.1_Silent_p.A44A	p.A412A	NM_194312.2	NP_919288.2	2	3	5	2.236140	Q6ZVH7	ESPNL_HUMAN		8	1499	+		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)	Q66K27|Q6ZVG1|Q8IVU2	Silent	SNP	ENST00000343063.3	0	1	hg19	c.1236G>A	CCDS2525.1	1																																																																																								0.427538		TCGA-2J-AABO-01A-21D-A40W-08	0.701	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257164.2	1	0	1		2	2	2	0		0	0	12		12	12	1	3.570000	-8.850166	1	0.240000	NM_194312			9	9		42	42	1		1			0	0	12	0		0.995652	0	0	0	0	0	0	9	42
CBLB	868	broad.mit.edu	37	3	105456084	105456084	+	Silent	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr3:105456084C>T	ENST00000264122.4	-	8	1323	c.1002G>A	c.(1000-1002)ggG>ggA	p.G334G	CBLB_ENST00000545639.1_3'UTR|CBLB_ENST00000403724.1_Silent_p.G334G|CBLB_ENST00000405772.1_Silent_p.G334G|CBLB_ENST00000394027.3_Silent_p.G356G	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	334	Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|SH2-like.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						TATAACTCCTCCCATCAGGAT	0.264			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)	ENST00000264122.4	1.000000	0.550000	9.200000e-01	6.600000e-01	0.780000	0.794561	0.780000	1.000000				Rec	yes			Rec	yes		3	3q13.11	3q13.11	868	Mis S	Cas-Br-M (murine) ecotropic retroviral transforming sequence b				L	L			AML		0				49						c.(1000-1002)ggG>ggA		Cbl proto-oncogene B, E3 ubiquitin protein ligase							95.0	97.0	96.0					3																	105456084		2201	4282	6483	SO:0001819	synonymous_variant	868	0	0					g.chr3:105456084C>T	U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.1002G>A	chr3.hg19:g.105456084C>T		1					CBLB_ENST00000394027.3_Silent_p.G356G|CBLB_ENST00000405772.1_Silent_p.G334G|CBLB_ENST00000403724.1_Silent_p.G334G|CBLB_ENST00000545639.1_3'UTR	p.G334G	NM_170662.3	NP_733762.2	4	6	10	3.317498	Q13191	CBLB_HUMAN		8	1323	-			A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Silent	SNP	ENST00000264122.4	1	1	hg19	c.1002G>A	CCDS2948.1	0																																																																																								0.612245		TCGA-2J-AABO-01A-21D-A40W-08	0.264	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	1	0	1		2	2	2	0		0	0	91		91	88	1	3.570000	-3.016297	1	0.240000	NM_170662			39	39		776	768	0		1	0		0	0	91	0		1.000000	4.338805e-02	0	1	0	6	0	39	776
TDGF1	6997	broad.mit.edu	37	3	46621337	46621337	+	Missense_Mutation	SNP	G	G	A	rs546750009		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr3:46621337G>A	ENST00000296145.5	+	4	1065	c.332G>A	c.(331-333)cGc>cAc	p.R111H	LRRC2_ENST00000296144.3_Intron|TDGF1_ENST00000542931.1_Missense_Mutation_p.R95H	NM_003212.3	NP_003203.1	P13385	TDGF1_HUMAN	teratocarcinoma-derived growth factor 1	111			R -> G (in dbSNP:rs34501971).		activation of MAPK activity (GO:0000187)|anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle cell differentiation (GO:0055007)|cell differentiation (GO:0030154)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to interferon-gamma (GO:0071346)|cellular response to interleukin-6 (GO:0071354)|cellular response to tumor necrosis factor (GO:0071356)|embryo development (GO:0009790)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of signal transduction (GO:0009966)|vasculogenesis (GO:0001570)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	growth factor activity (GO:0008083)|receptor binding (GO:0005102)			cervix(2)|endometrium(1)|kidney(1)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		CACGATGTGCGCAAAGAGTAA	0.547																																						ENST00000296145.5	0.300000	0.060000	2.300000e-01	1.000000e-01	0.150000	0.171389	0.150000	0.150000																										0				8						c.(331-333)cGc>cAc		teratocarcinoma-derived growth factor 1							69.0	72.0	71.0					3																	46621337		2203	4300	6503	SO:0001583	missense	6997	6	121412	42				g.chr3:46621337G>A	M96955	CCDS2742.1, CCDS54575.1	3p21.31	2012-10-03			ENSG00000241186	ENSG00000241186			11701	protein-coding gene	gene with protein product		187395				1882841, 10393436	Standard	NM_003212		Approved	CRIPTO, CR, Cripto-1	uc021wxd.1	P13385	OTTHUMG00000133482	ENST00000296145.5:c.332G>A	chr3.hg19:g.46621337G>A	ENSP00000296145:p.Arg111His	0					TDGF1_ENST00000542931.1_Missense_Mutation_p.R95H|LRRC2_ENST00000296144.3_Intron	p.R111H	NM_003212.3	NP_003203.1	0	0	0	1.662334	P13385	TDGF1_HUMAN		4	1065	+			Q8TCC1	Missense_Mutation	SNP	ENST00000296145.5	0	1	hg19	c.332G>A	CCDS2742.1	0	.	.	.	.	.	.	.	.	.	.	G	12.93	2.084278	0.36758	.	.	ENSG00000241186	ENST00000542931;ENST00000296145	T;T	0.66280	-0.19;-0.2	4.44	2.64	0.31445	4.44	2.64	0.31445	.	0.126759	0.53938	N	0.000042	T	0.57344	0.2047	M	0.74881	2.28	0.30445	N	0.77578	B	0.11235	0.004	B	0.04013	0.001	T	0.57051	-0.7877	10	0.46703	T	0.11	.	7.3485	0.26676	0.1779:0.0:0.8221:0.0	.	111	P13385	TDGF1_HUMAN	H	95;111	ENSP00000446375:R95H;ENSP00000296145:R111H	ENSP00000296145:R111H	R	+	2	0	0	AC104304.1	46596341	46596341	0.891000	0.30450	0.005000	0.12908	0.061000	0.15899	2.995000	0.49441	0.625000	0.30304	0.655000	0.94253	CGC	0.227014		TCGA-2J-AABO-01A-21D-A40W-08	0.547	TDGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257378.2	0	0	1		2	2	2	0		0	0	79		79	78	1	3.570000	-2.396585	0	0.240000	NM_003212			7	7		370	363	0		1	0		0	0	79	0		0.979509	0	0	0	0	1	0	7	370
FAM107A	11170	broad.mit.edu	37	3	58555463	58555463	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr3:58555463C>T	ENST00000394481.1	-	3	683	c.125G>A	c.(124-126)cGg>cAg	p.R42Q	FAM107A_ENST00000464064.1_Missense_Mutation_p.R42Q|FAM107A_ENST00000474531.1_Missense_Mutation_p.R73Q|FAM107A_ENST00000447756.2_Missense_Mutation_p.R70Q|FAM107A_ENST00000360997.2_Missense_Mutation_p.R42Q	NM_001282713.1|NM_007177.2	NP_001269642.1|NP_009108.1	O95990	F107A_HUMAN	family with sequence similarity 107, member A	42					regulation of cell growth (GO:0001558)	neuron projection (GO:0043005)|nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				BRCA - Breast invasive adenocarcinoma(55;0.000189)|Kidney(10;0.000536)|KIRC - Kidney renal clear cell carcinoma(10;0.000716)|OV - Ovarian serous cystadenocarcinoma(275;0.154)		CTGGTGACTCCGAGAGGCCTT	0.632																																						ENST00000394481.1	0.960000	0.480000	8.400000e-01	5.800000e-01	0.700000	0.715744	0.700000	0.690000																										0				13						c.(124-126)cGg>cAg		family with sequence similarity 107, member A							63.0	66.0	65.0					3																	58555463		2203	4300	6503	SO:0001583	missense	11170	1	121412	33				g.chr3:58555463C>T	AF089854	CCDS2892.1, CCDS63672.1, CCDS63673.1	3p14.2	2006-02-03			ENSG00000168309	ENSG00000168309			30827	protein-coding gene	gene with protein product		608295				10564580, 10702698	Standard	XM_005264835		Approved	DRR1, TU3A	uc003dkn.3	O95990	OTTHUMG00000159159	ENST00000394481.1:c.125G>A	chr3.hg19:g.58555463C>T	ENSP00000377991:p.Arg42Gln	0					FAM107A_ENST00000474531.1_Missense_Mutation_p.R73Q|FAM107A_ENST00000447756.2_Missense_Mutation_p.R70Q|FAM107A_ENST00000464064.1_Missense_Mutation_p.R42Q|FAM107A_ENST00000360997.2_Missense_Mutation_p.R42Q	p.R42Q	NM_001282713.1|NM_007177.2	NP_001269642.1|NP_009108.1	0	0	0	1.662334	O95990	F107A_HUMAN		3	683	-			B3KNQ4|B7ZAY5|J3KR61|Q96NH4	Missense_Mutation	SNP	ENST00000394481.1	1	1	hg19	c.125G>A	CCDS2892.1	0	.	.	.	.	.	.	.	.	.	.	C	20.9	4.065072	0.76187	.	.	ENSG00000168309	ENST00000360997;ENST00000394481;ENST00000464064;ENST00000474531;ENST00000447756;ENST00000465970	T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89	4.48	3.59	0.41128	4.48	3.59	0.41128	.	0.241877	0.39274	N	0.001412	T	0.44582	0.1300	M	0.73598	2.24	0.31818	N	0.626326	P;D;P;P	0.55800	0.727;0.973;0.898;0.898	B;P;B;B	0.47346	0.259;0.544;0.284;0.284	T	0.55515	-0.8129	10	0.36615	T	0.2	-30.2881	7.6386	0.28280	0.0:0.7936:0.0:0.2064	.	70;42;73;42	B7ZAY5;O95990-2;B3KNQ4;O95990	.;.;.;F107A_HUMAN	Q	42;42;42;73;70;42	ENSP00000354270:R42Q;ENSP00000377991:R42Q;ENSP00000419529:R42Q;ENSP00000419124:R73Q;ENSP00000400858:R70Q;ENSP00000418038:R42Q	ENSP00000354270:R42Q	R	-	2	0	0	FAM107A	58530503	58530503	0.001000	0.12720	0.984000	0.44739	0.807000	0.45602	0.874000	0.28065	2.217000	0.71921	0.655000	0.94253	CGG	0.227014		TCGA-2J-AABO-01A-21D-A40W-08	0.632	FAM107A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353585.1	1	0	1		2	2	2	0		0	0	74		74	72	1	3.570000	-2.774726	1	0.240000	NM_007177			28	28		298	292	0		1	0		0	0	74	0		1.000000	2.205496e-01	0	0	0	10	0	28	298
KNG1	3827	broad.mit.edu	37	3	186443035	186443035	+	Missense_Mutation	SNP	C	C	T	rs562438530	byFrequency	TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr3:186443035C>T	ENST00000265023.4	+	4	762	c.550C>T	c.(550-552)Cgg>Tgg	p.R184W	KNG1_ENST00000287611.2_Missense_Mutation_p.R184W|RP11-573D15.8_ENST00000599314.1_RNA|KNG1_ENST00000447445.1_Missense_Mutation_p.R184W	NM_001102416.2	NP_001095886.1	P01042	KNG1_HUMAN	kininogen 1	184	Cystatin kininogen-type 2. {ECO:0000255|PROSITE-ProRule:PRU00979}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|inflammatory response (GO:0006954)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|smooth muscle contraction (GO:0006939)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			endometrium(1)|lung(15)|prostate(1)|skin(2)|stomach(2)	21	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)		TGAAGTAAAACGGGCCCAAAG	0.398													C|||	3	0.000599042	0.0	0.0	5008	,	,		17984	0.0		0.0	False		,,,				2504	0.0031					ENST00000265023.4	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				21						c.(550-552)Cgg>Tgg		kininogen 1							100.0	90.0	93.0					3																	186443035		2203	4300	6503	SO:0001583	missense	3827	58	121412	47				g.chr3:186443035C>T		CCDS3281.1, CCDS43183.1, CCDS54695.1	3q27.3	2014-05-15	2004-05-21	2004-05-26	ENSG00000113889	ENSG00000113889		"""Endogenous ligands"""	6383	protein-coding gene	gene with protein product	"""alpha-2-thiol proteinase inhibitor"", ""bradykinin"""	612358	"""kininogen"""	KNG, BDK		1733668	Standard	NM_000893		Approved	BK	uc011bsa.2	P01042	OTTHUMG00000150348	ENST00000265023.4:c.550C>T	chr3.hg19:g.186443035C>T	ENSP00000265023:p.Arg184Trp	1					KNG1_ENST00000447445.1_Missense_Mutation_p.R184W|RP11-573D15.8_ENST00000599314.1_RNA|KNG1_ENST00000287611.2_Missense_Mutation_p.R184W	p.R184W	NM_001102416.2	NP_001095886.1	1	3	4	2.098732	P01042	KNG1_HUMAN	OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	4	762	+	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		A8K474|B2RCR2|C9JEX1|P01043|Q53EQ0|Q6PAU9|Q7M4P1	Missense_Mutation	SNP	ENST00000265023.4	1	1	hg19	c.550C>T	CCDS43183.1	1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.170951	0.78452	.	.	ENSG00000113889	ENST00000287611;ENST00000265023;ENST00000447445;ENST00000432028	T;T;T	0.30182	2.38;2.38;1.54	4.92	-1.75	0.08031	4.92	-1.75	0.08031	Proteinase inhibitor I25, cystatin (2);	1.061570	0.07280	N	0.870615	T	0.43033	0.1229	M	0.61703	1.905	0.09310	N	1	D;D	0.71674	0.998;0.998	D;D	0.66979	0.948;0.928	T	0.34477	-0.9827	10	0.72032	D	0.01	2.3875	1.214	0.01910	0.3907:0.174:0.2979:0.1373	.	184;184	P01042;P01042-2	KNG1_HUMAN;.	W	184;184;184;172	ENSP00000287611:R184W;ENSP00000265023:R184W;ENSP00000396025:R184W	ENSP00000265023:R184W	R	+	1	2	2	KNG1	187925729	187925729	0.000000	0.05858	0.000000	0.03702	0.980000	0.70556	-0.332000	0.07904	-0.388000	0.07797	0.561000	0.74099	CGG	0.387097		TCGA-2J-AABO-01A-21D-A40W-08	0.398	KNG1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317738.1	1	0	1		2	2	2	0		0	0	101		101	96	1	3.570000	-20.000000	1	0.240000	NM_001102416			80	80		358	352	1		1			0	0	101	0		1.000000	0	0	0	0	0	0	80	358
EGF	1950	broad.mit.edu	37	4	110880564	110880564	+	Missense_Mutation	SNP	C	C	G			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr4:110880564C>G	ENST00000265171.5	+	6	1482	c.1037C>G	c.(1036-1038)gCc>gGc	p.A346G	EGF_ENST00000503392.1_Missense_Mutation_p.A346G|EGF_ENST00000509793.1_Intron	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	346	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	GAGGGATACGCCCTAAGTCGA	0.498																																						ENST00000265171.5	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				50						c.(1036-1038)gCc>gGc		epidermal growth factor	Sucralfate(DB00364)						146.0	115.0	125.0					4																	110880564		2203	4300	6503	SO:0001583	missense	1950	1	121410	31				g.chr4:110880564C>G	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1037C>G	chr4.hg19:g.110880564C>G	ENSP00000265171:p.Ala346Gly	0					EGF_ENST00000503392.1_Missense_Mutation_p.A346G|EGF_ENST00000509793.1_Intron	p.A346G	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	1	3	4	1.949936	P01133	EGF_HUMAN		6	1482	+		Hepatocellular(203;0.0893)	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	ENST00000265171.5	1	1	hg19	c.1037C>G	CCDS3689.1	1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.853597	0.32791	.	.	ENSG00000138798	ENST00000265171;ENST00000503392	D;D	0.87491	-2.26;-2.26	5.18	4.33	0.51752	5.18	4.33	0.51752	Epidermal growth factor-like (1);EGF-like region, conserved site (1);	0.628717	0.18234	N	0.147478	T	0.69797	0.3151	N	0.14661	0.345	0.09310	N	1	P;P	0.41041	0.554;0.736	B;B	0.33196	0.159;0.159	T	0.60347	-0.7281	10	0.15952	T	0.53	.	7.5645	0.27870	0.0:0.7657:0.0:0.2343	.	346;346	E7EVD2;P01133	.;EGF_HUMAN	G	346	ENSP00000265171:A346G;ENSP00000421384:A346G	ENSP00000265171:A346G	A	+	2	0	0	EGF	111100013	111100013	0.000000	0.05858	0.004000	0.12327	0.002000	0.02628	0.849000	0.27723	2.426000	0.82243	0.655000	0.94253	GCC	0.338440		TCGA-2J-AABO-01A-21D-A40W-08	0.498	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1	1	0	1		2	2	2	0		0	0	63		63	61	1	3.570000	-20.000000	1	0.240000				67	67		272	268	1		1	0		0	0	63	0		1.000000	4.023255e-02	0	1	0	1	0	67	272
ANK2	287	broad.mit.edu	37	4	114275125	114275125	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr4:114275125G>A	ENST00000357077.4	+	38	5404	c.5351G>A	c.(5350-5352)cGa>cAa	p.R1784Q	ANK2_ENST00000264366.6_Missense_Mutation_p.R1751Q|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1784					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CAGAAAGGTCGAAGCAAGTTG	0.498																																						ENST00000357077.4	1.000000	0.920000	1	9.900000e-01	0.990000	0.994710	0.990000	1.000000																										0				248						c.(5350-5352)cGa>cAa		ankyrin 2, neuronal							138.0	148.0	144.0					4																	114275125		2203	4300	6503	SO:0001583	missense	287	2	121406	40				g.chr4:114275125G>A	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.5351G>A	chr4.hg19:g.114275125G>A	ENSP00000349588:p.Arg1784Gln	0					ANK2_ENST00000264366.6_Missense_Mutation_p.R1751Q|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000510275.2_Intron	p.R1784Q	NM_001148.4	NP_001139.3	1	3	4	1.949936	Q01484	ANK2_HUMAN		38	5404	+		Ovarian(17;0.0448)|Hepatocellular(203;0.218)	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	1	1	hg19	c.5351G>A	CCDS3702.1	1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.124084	0.77436	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.69435	-0.4;-0.36	5.7	5.7	0.88788	5.7	5.7	0.88788	.	0.000000	0.50627	D	0.000101	T	0.76076	0.3937	L	0.54323	1.7	0.80722	D	1	D;D	0.71674	0.994;0.998	P;P	0.59595	0.716;0.86	T	0.74054	-0.3788	9	.	.	.	.	18.0216	0.89257	0.0:0.0:1.0:0.0	.	1751;1784	Q01484;Q01484-4	ANK2_HUMAN;.	Q	1784;1751	ENSP00000349588:R1784Q;ENSP00000264366:R1751Q	.	R	+	2	0	0	ANK2	114494574	114494574	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	3.512000	0.53407	2.683000	0.91414	0.655000	0.94253	CGA	0.338440		TCGA-2J-AABO-01A-21D-A40W-08	0.498	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	1	0	1		2	2	2	0		0	0	100		100	99	1	3.570000	-20.000000	1	0.240000	NM_001148			93	92		707	700	1		1			0	0	100	0		1.000000	0	0	0	0	0	0	93	707
IL21	59067	broad.mit.edu	37	4	123542066	123542066	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr4:123542066C>T	ENST00000264497.3	-	1	158	c.101G>A	c.(100-102)cGc>cAc	p.R34H	IL21-AS1_ENST00000417927.1_RNA	NM_001207006.2|NM_021803.3	NP_001193935.1|NP_068575.1	Q9HBE4	IL21_HUMAN	interleukin 21	27					cell maturation (GO:0048469)|immune response (GO:0006955)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of natural killer cell cytokine production (GO:0002729)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	cytokine receptor binding (GO:0005126)|interleukin-2 receptor binding (GO:0005134)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(3)	8						AATCATGTGGCGATCTTGACC	0.398																																						ENST00000264497.3	1.000000	0.680000	1	8.000000e-01	0.960000	0.922103	0.960000	1.000000																										0				8						c.(100-102)cGc>cAc		interleukin 21							139.0	133.0	135.0					4																	123542066		2203	4300	6503	SO:0001583	missense	59067	1	121412	30				g.chr4:123542066C>T	AF254069	CCDS3727.1, CCDS75189.1	4q26-q27	2011-07-15			ENSG00000138684	ENSG00000138684		"""Interleukins and interleukin receptors"""	6005	protein-coding gene	gene with protein product		605384				11081504, 17947662	Standard	NM_001207006		Approved	Za11, IL-21	uc003ies.3	Q9HBE4	OTTHUMG00000133073	ENST00000264497.3:c.101G>A	chr4.hg19:g.123542066C>T	ENSP00000264497:p.Arg34His	0					IL21-AS1_ENST00000417927.1_RNA	p.R34H	NM_001207006.2|NM_021803.3	NP_001193935.1|NP_068575.1	1	3	4	1.949936	Q9HBE4	IL21_HUMAN		1	158	-			A5J0L4	Missense_Mutation	SNP	ENST00000264497.3	1	1	hg19	c.101G>A	CCDS3727.1	1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.025754	0.35701	.	.	ENSG00000138684	ENST00000264497	.	.	.	5.1	3.33	0.38152	5.1	3.33	0.38152	.	0.278577	0.26092	N	0.026394	T	0.42988	0.1227	L	0.47716	1.5	0.32156	N	0.583601	B;B	0.14438	0.008;0.01	B;B	0.16289	0.009;0.015	T	0.48854	-0.8998	9	0.51188	T	0.08	-2.2109	8.1174	0.30950	0.1657:0.7506:0.0:0.0838	.	27;27	Q9HBE4-2;Q9HBE4	.;IL21_HUMAN	H	34	.	ENSP00000264497:R34H	R	-	2	0	0	IL21	123761516	123761516	0.000000	0.05858	0.925000	0.36789	0.899000	0.52679	0.295000	0.19065	0.683000	0.31428	0.655000	0.94253	CGC	0.338440		TCGA-2J-AABO-01A-21D-A40W-08	0.398	IL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256713.1	1	0	1		2	2	2	0		0	0	85		85	83	1	3.570000	-3.318794	1	0.240000	NM_021803			40	40		380	378	1		1			0	0	85	0		1.000000	0	0	0	0	0	0	40	380
TBC1D9	23158	broad.mit.edu	37	4	141543566	141543566	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr4:141543566C>A	ENST00000442267.2	-	21	3658	c.3584G>T	c.(3583-3585)gGc>gTc	p.G1195V		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	1195							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				TGCCGCCGTGCCCTGGCCGCT	0.662																																						ENST00000442267.2	1.000000	0.410000	1	6.000000e-01	0.850000	0.819014	0.850000	1.000000																										0				31						c.(3583-3585)gGc>gTc		TBC1 domain family, member 9 (with GRAM domain)							30.0	35.0	33.0					4																	141543566		2099	4197	6296	SO:0001583	missense	23158	0	0					g.chr4:141543566C>A	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.3584G>T	chr4.hg19:g.141543566C>A	ENSP00000411197:p.Gly1195Val	0						p.G1195V	NM_015130.2	NP_055945.2	1	2	3	1.746792	Q6ZT07	TBCD9_HUMAN		21	3658	-	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)	A6H8U8|D3DNZ1|O94958	Missense_Mutation	SNP	ENST00000442267.2	0	1	hg19	c.3584G>T	CCDS47136.1	1	.	.	.	.	.	.	.	.	.	.	C	13.02	2.113280	0.37339	.	.	ENSG00000109436	ENST00000442267	T	0.26957	1.7	5.01	5.01	0.66863	5.01	5.01	0.66863	.	0.419120	0.26951	N	0.021662	T	0.21509	0.0518	L	0.53249	1.67	0.58432	D	0.999999	B	0.30763	0.294	B	0.24974	0.057	T	0.03739	-1.1008	10	0.23302	T	0.38	.	9.4508	0.38725	0.0:0.9038:0.0:0.0962	.	1195	Q6ZT07	TBCD9_HUMAN	V	1195	ENSP00000411197:G1195V	ENSP00000411197:G1195V	G	-	2	0	0	TBC1D9	141763016	141763016	0.014000	0.17966	0.914000	0.36105	0.931000	0.56810	0.503000	0.22610	2.319000	0.78375	0.655000	0.94253	GGC	0.256942		TCGA-2J-AABO-01A-21D-A40W-08	0.662	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	1	0	1		2	2	2	0		0	0	21		21	20	1	3.570000	-14.948450	1	0.240000	NM_015130			9	9		89	87	1		1	1		0	0	21	0		0.994435	4.080231e-01	0	8	0	6	0	9	89
FAM193A	8603	broad.mit.edu	37	4	2702034	2702034	+	Missense_Mutation	SNP	G	G	A	rs139214563	byFrequency	TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr4:2702034G>A	ENST00000324666.5	+	17	3613	c.3262G>A	c.(3262-3264)Gac>Aac	p.D1088N	FAM193A_ENST00000502458.1_Missense_Mutation_p.D1110N|FAM193A_ENST00000545951.1_Missense_Mutation_p.D1088N|FAM193A_ENST00000505311.1_Missense_Mutation_p.D1088N|FAM193A_ENST00000382839.3_Missense_Mutation_p.D1088N	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	1088										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						TAAGGTGGTCGACCTCATGTC	0.542													G|||	9	0.00179712	0.0068	0.0	5008	,	,		16812	0.0		0.0	False		,,,				2504	0.0					ENST00000324666.5	1.000000	0.520000	1	7.000000e-01	0.930000	0.878628	0.930000	1.000000																										0				40						c.(3262-3264)Gac>Aac		family with sequence similarity 193, member A		G	ASN/ASP	27,4379	33.5+/-64.1	0,27,2176	49.0	47.0	48.0		3262	4.9	0.0	4	dbSNP_134	48	0,8600		0,0,4300	yes	missense	FAM193A	NM_003704.3	23	0,27,6476	AA,AG,GG		0.0,0.6128,0.2076	possibly-damaging	1088/1225	2702034	27,12979	2203	4300	6503	SO:0001583	missense	8603	75	121412	48				g.chr4:2702034G>A	AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.3262G>A	chr4.hg19:g.2702034G>A	ENSP00000324587:p.Asp1088Asn	0					FAM193A_ENST00000545951.1_Missense_Mutation_p.D1088N|FAM193A_ENST00000382839.3_Missense_Mutation_p.D1088N|FAM193A_ENST00000505311.1_Missense_Mutation_p.D1088N|FAM193A_ENST00000502458.1_Missense_Mutation_p.D1110N	p.D1088N	NM_001256666.1	NP_001243595.1	1	2	3	1.900906	P78312	F193A_HUMAN		17	3613	+			B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	ENST00000324666.5	1	1	hg19	c.3262G>A	CCDS58875.1	1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	9.038	0.988898	0.18966	0.006128	0.0	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;1.43	5.7	4.86	0.63082	5.7	4.86	0.63082	.	0.487155	0.22559	N	0.058494	T	0.22360	0.0539	L	0.36672	1.1	0.09310	N	1	B;B;P;B;B	0.49253	0.012;0.012;0.921;0.012;0.012	B;B;B;B;B	0.35971	0.005;0.005;0.215;0.005;0.005	T	0.08411	-1.0723	10	0.28530	T	0.3	-8.008	13.732	0.62794	0.0736:0.0:0.9264:0.0	.	1088;1110;1088;1110;1088	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	N	1088;1088;1088;1110;942	ENSP00000372290:D1088N;ENSP00000324587:D1088N;ENSP00000443617:D1088N;ENSP00000427505:D1110N;ENSP00000427260:D942N	ENSP00000324587:D1088N	D	+	1	0	0	FAM193A	2671832	2671832	1.000000	0.71417	0.024000	0.17045	0.022000	0.10575	5.299000	0.65716	1.425000	0.47237	0.655000	0.94253	GAC	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.542	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	1	0	1		2	2	2	0		0	0	35		35	34	1	3.570000	-6.053187	1	0.240000	NM_003704			12	12		110	108	0		1	1		0	0	35	0		0.999199	5.886069e-01	0	3	0	16	0	12	110
POLR2B	5431	broad.mit.edu	37	4	57871882	57871882	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr4:57871882G>A	ENST00000381227.1	+	10	1627	c.1214G>A	c.(1213-1215)aGa>aAa	p.R405K	RNU6-998P_ENST00000515894.1_RNA|POLR2B_ENST00000431623.2_Missense_Mutation_p.R330K|POLR2B_ENST00000441246.2_Missense_Mutation_p.R398K|POLR2B_ENST00000314595.5_Missense_Mutation_p.R405K			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	405					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					TTCTTATTTAGAGGGTAAGGA	0.413																																						ENST00000381227.1	1.000000	0.910000	1	9.900000e-01	0.990000	0.994670	0.990000	1.000000																										0				52						c.(1213-1215)aGa>aAa		polymerase (RNA) II (DNA directed) polypeptide B, 140kDa							88.0	88.0	88.0					4																	57871882		2203	4300	6503	SO:0001583	missense	5431	0	0					g.chr4:57871882G>A		CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.1214G>A	chr4.hg19:g.57871882G>A	ENSP00000370625:p.Arg405Lys	0					RNU6-998P_ENST00000515894.1_RNA|POLR2B_ENST00000431623.2_Missense_Mutation_p.R330K|POLR2B_ENST00000441246.2_Missense_Mutation_p.R398K|POLR2B_ENST00000314595.5_Missense_Mutation_p.R405K	p.R405K			1	2	3	1.900906	P30876	RPB2_HUMAN		10	1627	+	Glioma(25;0.08)|all_neural(26;0.181)		A8K1A8|Q8IZ61	Missense_Mutation	SNP	ENST00000381227.1	1	1	hg19	c.1214G>A	CCDS3511.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.444758	0.96187	.	.	ENSG00000047315	ENST00000381227;ENST00000431623;ENST00000441246;ENST00000314595	T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11	5.46	5.46	0.80206	5.46	5.46	0.80206	RNA polymerase, beta subunit, protrusion (1);	0.000000	0.85682	D	0.000000	D	0.89083	0.6614	M	0.80982	2.52	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	D	0.89062	0.3463	10	0.54805	T	0.06	.	19.6697	0.95907	0.0:0.0:1.0:0.0	.	330;405	C9J4M6;P30876	.;RPB2_HUMAN	K	405;330;398;405	ENSP00000370625:R405K;ENSP00000391096:R330K;ENSP00000391452:R398K;ENSP00000312735:R405K	ENSP00000312735:R405K	R	+	2	0	0	POLR2B	57566639	57566639	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.779000	0.85648	2.724000	0.93272	0.650000	0.86243	AGA	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.413	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	1	0	1		2	2	2	0		0	0	58		58	58	1	3.570000	-2.842039	1	0.240000	NM_000938			42	42		277	275	1		1	0		0	0	58	0		1.000000	7.077944e-01	0	1	0	17	0	42	277
LIN54	132660	broad.mit.edu	37	4	83905426	83905426	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr4:83905426C>A	ENST00000340417.3	-	2	949	c.572G>T	c.(571-573)aGg>aTg	p.R191M	LIN54_ENST00000395283.2_Missense_Mutation_p.R191M|LIN54_ENST00000446851.2_Intron|LIN54_ENST00000505397.1_Missense_Mutation_p.R191M|LIN54_ENST00000442461.2_Intron|LIN54_ENST00000506560.1_Missense_Mutation_p.R191M|LIN54_ENST00000395282.2_Missense_Mutation_p.R191M|LIN54_ENST00000510557.1_Intron	NM_194282.2	NP_919258.2	Q6MZP7	LIN54_HUMAN	lin-54 DREAM MuvB core complex component	191					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(5)	14		Hepatocellular(203;0.114)				CACCTCTGGCCTCCCTCCAAT	0.478																																						ENST00000340417.3	1.000000	0.910000	1	9.900000e-01	0.990000	0.994834	0.990000	1.000000																										0				14						c.(571-573)aGg>aTg		lin-54 DREAM MuvB core complex component							121.0	117.0	119.0					4																	83905426		2203	4300	6503	SO:0001583	missense	132660	0	0					g.chr4:83905426C>A	BX537919	CCDS3599.1, CCDS47089.1, CCDS75157.1	4q21.22	2014-07-17	2014-07-17		ENSG00000189308	ENSG00000189308			25397	protein-coding gene	gene with protein product	"""CXC domain containing 1"""	613367	"""lin-54 homolog (C. elegans)"""			21498570	Standard	XM_005262749		Approved	MIP120, DKFZp686L1814, JC8.6, CXCDC1	uc003hnx.3	Q6MZP7	OTTHUMG00000130287	ENST00000340417.3:c.572G>T	chr4.hg19:g.83905426C>A	ENSP00000341947:p.Arg191Met	0					LIN54_ENST00000395283.2_Missense_Mutation_p.R191M|LIN54_ENST00000442461.2_Intron|LIN54_ENST00000505397.1_Missense_Mutation_p.R191M|LIN54_ENST00000446851.2_Intron|LIN54_ENST00000395282.2_Missense_Mutation_p.R191M|LIN54_ENST00000506560.1_Missense_Mutation_p.R191M|LIN54_ENST00000510557.1_Intron	p.R191M	NM_194282.2	NP_919258.2	1	3	4	1.949936	Q6MZP7	LIN54_HUMAN		2	949	-		Hepatocellular(203;0.114)	Q32M68|Q32M69|Q6N071|Q76B60	Missense_Mutation	SNP	ENST00000340417.3	1	1	hg19	c.572G>T	CCDS3599.1	1	.	.	.	.	.	.	.	.	.	.	C	18.90	3.720858	0.68959	.	.	ENSG00000189308	ENST00000340417;ENST00000395283;ENST00000395282;ENST00000506560;ENST00000505397	.	.	.	5.62	4.78	0.61160	5.62	4.78	0.61160	.	0.149254	0.56097	D	0.000025	T	0.50034	0.1592	L	0.27053	0.805	0.58432	D	0.999993	D;P	0.54207	0.965;0.94	P;B	0.50192	0.634;0.431	T	0.55891	-0.8069	9	0.72032	D	0.01	-14.2655	14.7713	0.69681	0.0:0.9303:0.0:0.0697	.	191;191	Q6MZP7-2;Q6MZP7	.;LIN54_HUMAN	M	191	.	ENSP00000341947:R191M	R	-	2	0	0	LIN54	84124450	84124450	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.707000	0.74654	1.507000	0.48752	0.655000	0.94253	AGG	0.338440		TCGA-2J-AABO-01A-21D-A40W-08	0.478	LIN54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252626.2	1	0	1		2	2	2	0		0	0	118		118	113	1	3.570000	-20.000000	1	0.240000	NM_194282			55	55		395	385	1		1	0		0	0	118	0		1.000000	0	0	0	0	1	0	55	395
ADAM29	11086	broad.mit.edu	37	4	175897289	175897289	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr4:175897289G>A	ENST00000359240.3	+	5	1283	c.613G>A	c.(613-615)Gtc>Atc	p.V205I	ADAM29_ENST00000404450.4_Missense_Mutation_p.V205I|ADAM29_ENST00000514159.1_Missense_Mutation_p.V205I|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000445694.1_Missense_Mutation_p.V205I	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	205	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.		V -> I (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V205I(2)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		AATTGTAGTCGTCATTGATAA	0.348																																					Ovarian(140;1727 1835 21805 25838 41440)	ENST00000359240.3	1.000000	0.090000	4.200000e-01	1.400000e-01	0.220000	0.337793	0.220000	0.200000																										2	Substitution - Missense(2)	p.V205I(2)	large_intestine(2)	93						c.(613-615)Gtc>Atc		ADAM metallopeptidase domain 29							86.0	87.0	87.0					4																	175897289		2203	4300	6503	SO:0001583	missense	11086	3	121412	37				g.chr4:175897289G>A	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.613G>A	chr4.hg19:g.175897289G>A	ENSP00000352177:p.Val205Ile	0					ADAM29_ENST00000404450.4_Missense_Mutation_p.V205I|ADAM29_ENST00000514159.1_Missense_Mutation_p.V205I|ADAM29_ENST00000445694.1_Missense_Mutation_p.V205I|RP13-577H12.2_ENST00000507525.1_RNA	p.V205I	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	1	2	3	1.746792	Q9UKF5	ADA29_HUMAN		5	1283	+		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	0	1	hg19	c.613G>A	CCDS3823.1	0	.	.	.	.	.	.	.	.	.	.	G	14.34	2.504909	0.44558	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5	3.74	2.9	0.33743	3.74	2.9	0.33743	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.330976	0.16461	N	0.213409	T	0.75627	0.3875	M	0.64080	1.96	0.09310	N	1	D	0.59357	0.985	P	0.58970	0.849	T	0.63435	-0.6638	9	.	.	.	.	7.3233	0.26540	0.1206:0.0:0.8794:0.0	.	205	Q9UKF5	ADA29_HUMAN	I	205	ENSP00000352177:V205I;ENSP00000414544:V205I;ENSP00000384229:V205I;ENSP00000423517:V205I	.	V	+	1	0	0	ADAM29	176133864	176133864	0.714000	0.27936	0.004000	0.12327	0.001000	0.01503	1.522000	0.35921	1.155000	0.42497	0.643000	0.83706	GTC	0.256942		TCGA-2J-AABO-01A-21D-A40W-08	0.348	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		0	0	1		2	2	2	0		0	0	71		71	69	1	3.570000	-3.194611	1	0.240000				7	7		291	290	0		1			0	0	71	0		0.980708	0	0	0	0	0	0	7	291
DCP2	167227	broad.mit.edu	37	5	112337346	112337346	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr5:112337346G>A	ENST00000389063.2	+	7	979	c.781G>A	c.(781-783)Gct>Act	p.A261T	DCP2_ENST00000543319.1_Missense_Mutation_p.A50T|DCP2_ENST00000515408.1_Missense_Mutation_p.A261T	NM_152624.5	NP_689837	Q8IU60	DCP2_HUMAN	decapping mRNA 2	261					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)|RISC complex (GO:0016442)	exoribonuclease activity, producing 5'-phosphomonoesters (GO:0016896)|m7G(5')pppN diphosphatase activity (GO:0050072)|manganese ion binding (GO:0030145)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(6)|lung(1)	10		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		OV - Ovarian serous cystadenocarcinoma(64;6.98e-08)|Epithelial(69;7.87e-08)|all cancers(49;1.06e-05)|COAD - Colon adenocarcinoma(37;0.0123)|Colorectal(14;0.0171)		TAGCACGCCGGCTAAACCCAC	0.373																																						ENST00000389063.2	0.170000	0.030000	1.300000e-01	5.000000e-02	0.080000	0.094675	0.080000	0.090000																										0				10						c.(781-783)Gct>Act		decapping mRNA 2							132.0	143.0	139.0					5																	112337346		2202	4300	6502	SO:0001583	missense	167227	0	0					g.chr5:112337346G>A	AY135173	CCDS34210.1, CCDS56377.1	5q22	2013-05-02	2013-05-02		ENSG00000172795	ENSG00000172795	3.6.1.62	"""Nudix motif containing"""	24452	protein-coding gene	gene with protein product	"""nudix (nucleoside diphosphate linked moiety X)-type motif 20"", ""M(7)GpppN-mRNA hydrolase"""	609844	"""DCP2 decapping enzyme homolog (S. cerevisiae)"""			12218187, 12417715	Standard	NM_152624		Approved	NUDT20	uc003kqh.3	Q8IU60	OTTHUMG00000162853	ENST00000389063.2:c.781G>A	chr5.hg19:g.112337346G>A	ENSP00000373715:p.Ala261Thr	1					DCP2_ENST00000543319.1_Missense_Mutation_p.A50T|DCP2_ENST00000515408.1_Missense_Mutation_p.A261T	p.A261T	NM_152624.5	NP_689837	1	2	3	1.864899	Q8IU60	DCP2_HUMAN		7	979	+		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)	C9J778|Q6P2D4|Q7Z5W5|Q8NBG5	Missense_Mutation	SNP	ENST00000389063.2	0	1	hg19	c.781G>A	CCDS34210.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.59|15.59	2.879558|2.879558	0.51801|0.51801	.|.	.|.	ENSG00000172795|ENSG00000172795	ENST00000515408;ENST00000389063;ENST00000543319|ENST00000513585	T;T|.	0.44881|.	0.92;0.91|.	5.79|5.79	5.79|5.79	0.91817|0.91817	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	0.344652|.	0.32736|.	N|.	0.005702|.	T|T	0.42245|0.42245	0.1194|0.1194	N|N	0.19112|0.19112	0.55|0.55	0.36717|0.36717	D|D	0.88097|0.88097	B;B|.	0.23442|.	0.082;0.085|.	B;B|.	0.25140|.	0.058;0.026|.	T|T	0.45948|0.45948	-0.9226|-0.9226	10|5	0.22109|.	T|.	0.4|.	-9.3311|-9.3311	9.7626|9.7626	0.40541|0.40541	0.0:0.1224:0.6305:0.2471|0.0:0.1224:0.6305:0.2471	.|.	261;261|.	Q8IU60-2;Q8IU60|.	.;DCP2_HUMAN|.	T|D	261;261;50|242	ENSP00000425770:A261T;ENSP00000373715:A261T|.	ENSP00000373715:A261T|.	A|G	+|+	1|2	0|0	0|0	DCP2|DCP2	112365245|112365245	112365245|112365245	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	1.265000|1.265000	0.33027|0.33027	2.727000|2.727000	0.93392|0.93392	0.643000|0.643000	0.83706|0.83706	GCT|GGC	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.373	DCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370765.3	0	0	1		18	2	2	1		1	1	154		154	150	1	3.570000	-1.990900	0	0.240000	NM_152624			7	6		778	763	0		0	0		1	0	154	0		0.018220	6.831672e-04	0	0	0	4	0	7	778
FTMT	94033	broad.mit.edu	37	5	121188321	121188321	+	Silent	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr5:121188321G>A	ENST00000321339.1	+	1	672	c.663G>A	c.(661-663)ccG>ccA	p.P221P		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	221					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		TGGGGGCCCCGGATGCTGGCC	0.502																																						ENST00000321339.1	0.210000	0.040000	1.700000e-01	7.000000e-02	0.110000	0.125531	0.110000	0.120000																										0				33						c.(661-663)ccG>ccA		ferritin mitochondrial							103.0	116.0	112.0					5																	121188321		2203	4300	6503	SO:0001819	synonymous_variant	94033	0	0					g.chr5:121188321G>A	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.663G>A	chr5.hg19:g.121188321G>A		1						p.P221P	NM_177478.1	NP_803431.1	1	2	3	1.864899	Q8N4E7	FTMT_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.206)	1	672	+		all_cancers(142;0.0124)|Prostate(80;0.0322)		Silent	SNP	ENST00000321339.1	0	1	hg19	c.663G>A	CCDS4128.1	0																																																																																								0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.502	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	0	0	1		2	2	2	0		0	0	101		101	97	1	3.570000	-2.002557	0	0.240000	NM_177478			8	7		657	646	0		1			0	0	101	0		0.988607	0	0	0	0	0	0	8	657
CSNK1G3	1456	broad.mit.edu	37	5	122923840	122923840	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr5:122923840G>A	ENST00000361991.2	+	6	782	c.752G>A	c.(751-753)gGc>gAc	p.G251D	CSNK1G3_ENST00000395411.1_Missense_Mutation_p.G251D|CSNK1G3_ENST00000521364.1_Missense_Mutation_p.G251D|CSNK1G3_ENST00000345990.4_Missense_Mutation_p.G251D|CSNK1G3_ENST00000512718.3_Missense_Mutation_p.G176D|CSNK1G3_ENST00000360683.2_Missense_Mutation_p.G251D|CSNK1G3_ENST00000511130.2_Missense_Mutation_p.G138D|CSNK1G3_ENST00000395412.1_Missense_Mutation_p.G251D|CSNK1G3_ENST00000510842.2_Missense_Mutation_p.G251D			Q9Y6M4	KC1G3_HUMAN	casein kinase 1, gamma 3	251	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein modification process (GO:0006464)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(1)	15		all_cancers(142;0.0156)|Prostate(80;0.0322)|Lung NSC(810;0.245)	KIRC - Kidney renal clear cell carcinoma(527;0.165)|Kidney(363;0.229)	OV - Ovarian serous cystadenocarcinoma(64;0.000121)|Epithelial(69;0.000227)|all cancers(49;0.00176)		CCTTGGCAAGGCTTAAAGGTA	0.284																																					Pancreas(187;2868 2964 4353 6297)	ENST00000361991.2	1.000000	0.690000	1	8.100000e-01	0.940000	0.917617	0.940000	1.000000																										0				15						c.(751-753)gGc>gAc		casein kinase 1, gamma 3							133.0	135.0	134.0					5																	122923840		2203	4300	6503	SO:0001583	missense	1456	0	0					g.chr5:122923840G>A	AF049090	CCDS4135.1, CCDS34218.1, CCDS43355.1, CCDS59491.1, CCDS59492.1, CCDS59493.1	5q23	2013-01-17			ENSG00000151292	ENSG00000151292			2456	protein-coding gene	gene with protein product		604253				9925945	Standard	NM_004384		Approved		uc031skv.1	Q9Y6M4	OTTHUMG00000128923	ENST00000361991.2:c.752G>A	chr5.hg19:g.122923840G>A	ENSP00000354942:p.Gly251Asp	1					CSNK1G3_ENST00000521364.1_Missense_Mutation_p.G251D|CSNK1G3_ENST00000345990.4_Missense_Mutation_p.G251D|CSNK1G3_ENST00000510842.2_Missense_Mutation_p.G251D|CSNK1G3_ENST00000512718.3_Missense_Mutation_p.G176D|CSNK1G3_ENST00000511130.2_Missense_Mutation_p.G138D|CSNK1G3_ENST00000395411.1_Missense_Mutation_p.G251D|CSNK1G3_ENST00000395412.1_Missense_Mutation_p.G251D|CSNK1G3_ENST00000360683.2_Missense_Mutation_p.G251D	p.G251D			1	2	3	1.864899	Q9Y6M4	KC1G3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.165)|Kidney(363;0.229)	6	782	+		all_cancers(142;0.0156)|Prostate(80;0.0322)|Lung NSC(810;0.245)	A8K040|B4DSH2|B7Z9Q4|E7EVD0|Q86WZ7|Q9Y6M3	Missense_Mutation	SNP	ENST00000361991.2	1	1	hg19	c.752G>A	CCDS4135.1	1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.363004	0.82353	.	.	ENSG00000151292	ENST00000395412;ENST00000395411;ENST00000345990;ENST00000511130;ENST00000512718;ENST00000521364;ENST00000510842;ENST00000361991;ENST00000360683	T;T;T;T;T;T;T;T;T	0.10573	2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86	5.15	4.27	0.50696	5.15	4.27	0.50696	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	T	0.37433	0.1003	M	0.86097	2.795	0.80722	D	1	D;D;D;D;D;D	0.71674	0.994;0.994;0.994;0.992;0.998;0.997	D;D;D;D;D;D	0.80764	0.976;0.99;0.976;0.945;0.994;0.976	T	0.45644	-0.9247	10	0.87932	D	0	.	15.5399	0.76035	0.0:0.0:0.8604:0.1396	.	176;251;138;251;251;251	B4DSH2;A8K040;E7EVD0;Q9Y6M4-3;Q9Y6M4;Q9Y6M4-2	.;.;.;.;KC1G3_HUMAN;.	D	251;251;251;138;176;251;251;251;251	ENSP00000378807:G251D;ENSP00000378806:G251D;ENSP00000334735:G251D;ENSP00000421385:G138D;ENSP00000421998:G176D;ENSP00000429412:G251D;ENSP00000423838:G251D;ENSP00000354942:G251D;ENSP00000353904:G251D	ENSP00000334735:G251D	G	+	2	0	0	CSNK1G3	122951739	122951739	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.626000	0.83164	1.468000	0.48064	0.650000	0.86243	GGC	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.284	CSNK1G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250900.1	1	0	1		2	2	2	0		0	0	50		50	49	1	3.570000	-14.196790	1	0.240000	NM_004384			42	42		375	369	1		1	1		0	0	50	0		1.000000	4.948669e-01	0	2	0	14	0	42	375
MCTP1	79772	broad.mit.edu	37	5	94114845	94114845	+	Silent	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr5:94114845G>A	ENST00000515393.1	-	19	2579	c.2580C>T	c.(2578-2580)gaC>gaT	p.D860D	MCTP1_ENST00000514040.1_5'UTR|MCTP1_ENST00000429576.2_Silent_p.D553D|MCTP1_ENST00000505078.1_Silent_p.D376D|MCTP1_ENST00000312216.8_Silent_p.D639D	NM_024717.4	NP_078993.4	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1	860					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(13)|liver(2)|lung(13)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	41		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		CTTCTTCCTCGTCCTCTAGCA	0.423																																						ENST00000515393.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				41						c.(2578-2580)gaC>gaT		multiple C2 domains, transmembrane 1							178.0	143.0	155.0					5																	94114845		2203	4300	6503	SO:0001819	synonymous_variant	79772	11	121412	42				g.chr5:94114845G>A		CCDS34203.1, CCDS47247.1, CCDS75275.1	5q15	2008-02-05			ENSG00000175471	ENSG00000175471			26183	protein-coding gene	gene with protein product						15528213	Standard	XM_005272082		Approved	FLJ22344	uc003kkx.2	Q6DN14	OTTHUMG00000162742	ENST00000515393.1:c.2580C>T	chr5.hg19:g.94114845G>A		1					MCTP1_ENST00000505078.1_Silent_p.D376D|MCTP1_ENST00000429576.2_Silent_p.D553D|MCTP1_ENST00000514040.1_5'UTR|MCTP1_ENST00000312216.8_Silent_p.D639D	p.D860D	NM_024717.4	NP_078993.4	1	2	3	1.864899	Q6DN14	MCTP1_HUMAN		19	2579	-		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)	Q6DN13|Q8N2W1|Q8NBA2|Q96LX0|Q9H6E8	Silent	SNP	ENST00000515393.1	1	1	hg19	c.2580C>T	CCDS34203.1	1																																																																																								0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.423	MCTP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370280.3	1	0	1		2	2	2	0		0	0	58		58	55	1	3.570000	-20.000000	1	0.240000	NM_024717			75	75		275	270	1		1	0		0	0	58	0		1.000000	8.609950e-01	0	1	0	14	0	75	275
FSTL4	23105	broad.mit.edu	37	5	132559896	132559896	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr5:132559896A>G	ENST00000265342.7	-	11	1574	c.1325T>C	c.(1324-1326)cTg>cCg	p.L442P	CTB-49A3.2_ENST00000502776.1_RNA|FSTL4_ENST00000507112.1_Intron|CTB-49A3.2_ENST00000509051.1_RNA	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	442						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTCTCGCCACAGGATGTTTGC	0.483																																						ENST00000265342.7	1.000000	0.360000	9.200000e-01	5.100000e-01	0.690000	0.709615	0.690000	1.000000																										0				23						c.(1324-1326)cTg>cCg		follistatin-like 4							163.0	126.0	138.0					5																	132559896		2203	4300	6503	SO:0001583	missense	23105	0	0					g.chr5:132559896A>G	AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.1325T>C	chr5.hg19:g.132559896A>G	ENSP00000265342:p.Leu442Pro	1					CTB-49A3.2_ENST00000502776.1_RNA|FSTL4_ENST00000507112.1_Intron|CTB-49A3.2_ENST00000509051.1_RNA	p.L442P	NM_015082.1	NP_055897.1	1	2	3	1.864899	Q6MZW2	FSTL4_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	11	1574	-		all_cancers(142;0.244)	Q8TBU0|Q9UPU1	Missense_Mutation	SNP	ENST00000265342.7	1	1	hg19	c.1325T>C	CCDS34238.1	0	.	.	.	.	.	.	.	.	.	.	A	25.3	4.623789	0.87460	.	.	ENSG00000053108	ENST00000265342;ENST00000360575	T	0.62498	0.02	5.77	5.77	0.91146	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.76018	0.3929	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.76313	-0.3005	10	0.49607	T	0.09	-21.8211	15.5635	0.76269	1.0:0.0:0.0:0.0	.	442	Q6MZW2	FSTL4_HUMAN	P	442;273	ENSP00000265342:L442P	ENSP00000265342:L442P	L	-	2	0	0	FSTL4	132587795	132587795	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.800000	0.91900	2.326000	0.78906	0.533000	0.62120	CTG	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.483	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370212.1	1	0	1		2	2	2	0		0	0	36		36	34	1	3.570000	-5.227649	1	0.240000	XM_048786			10	10		128	127	0		1	0		0	0	36	0		0.997118	3.540391e-02	0	0	0	4	0	10	128
ABCC10	89845	broad.mit.edu	37	6	43406443	43406443	+	Silent	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr6:43406443C>T	ENST00000372530.4	+	8	2252	c.2037C>T	c.(2035-2037)acC>acT	p.T679T	ABCC10_ENST00000244533.3_Silent_p.T651T	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	679	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	AGTTTGCCACCATCCGAGACA	0.592																																						ENST00000372530.4	1.000000	0.680000	1	8.100000e-01	0.950000	0.922917	0.950000	1.000000																										0				56						c.(2035-2037)acC>acT		ATP-binding cassette, sub-family C (CFTR/MRP), member 10	Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)						122.0	112.0	115.0					6																	43406443		2203	4300	6503	SO:0001819	synonymous_variant	89845	0	0					g.chr6:43406443C>T	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.2037C>T	chr6.hg19:g.43406443C>T		1					ABCC10_ENST00000244533.3_Silent_p.T651T	p.T679T	NM_001198934.1	NP_001185863.1	1	2	3	1.842370	Q5T3U5	MRP7_HUMAN	Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)	8	2252	+	all_lung(25;0.00536)		Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Silent	SNP	ENST00000372530.4	1	1	hg19	c.2037C>T	CCDS56430.1	1																																																																																								0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.592	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	1	0	1		2	2	2	0		0	0	68		68	65	1	3.570000	-3.142702	1	0.240000	NM_033450			36	36		316	310	0		1	0		0	0	68	0		1.000000	2.015547e-01	0	0	0	8	0	36	316
BCLAF1	9774	broad.mit.edu	37	6	136590607	136590607	+	Silent	SNP	A	A	G			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr6:136590607A>G	ENST00000531224.1	-	9	2439	c.2187T>C	c.(2185-2187)gaT>gaC	p.D729D	BCLAF1_ENST00000031135.9_5'Flank|BCLAF1_ENST00000527536.1_Silent_p.D729D|BCLAF1_ENST00000529917.1_5'UTR|BCLAF1_ENST00000530767.1_Silent_p.D556D|BCLAF1_ENST00000353331.4_Silent_p.D727D|BCLAF1_ENST00000527759.1_Silent_p.D727D|BCLAF1_ENST00000392348.2_Silent_p.D727D	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	729					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		ATTCCTTGTAATCTTTTGGAG	0.363																																					Colon(142;1534 1789 5427 7063 28491)	ENST00000531224.1	0.560000	0.210000	4.700000e-01	2.800000e-01	0.360000	0.379633	0.360000	0.360000																										0				9						c.(2185-2187)gaT>gaC		BCL2-associated transcription factor 1							110.0	105.0	106.0					6																	136590607		2203	4299	6502	SO:0001819	synonymous_variant	9774	0	0					g.chr6:136590607A>G	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.2187T>C	chr6.hg19:g.136590607A>G		1					BCLAF1_ENST00000527536.1_Silent_p.D729D|BCLAF1_ENST00000353331.4_Silent_p.D727D|BCLAF1_ENST00000527759.1_Silent_p.D727D|BCLAF1_ENST00000530767.1_Silent_p.D556D|BCLAF1_ENST00000392348.2_Silent_p.D727D|BCLAF1_ENST00000031135.9_5'Flank|BCLAF1_ENST00000529917.1_5'UTR	p.D729D	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	0	2	2	1.650164	Q9NYF8	BCLF1_HUMAN		9	2439	-	Colorectal(23;0.24)		A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Silent	SNP	ENST00000531224.1	0	1	hg19	c.2187T>C	CCDS5177.1	0																																																																																								0.240000		TCGA-2J-AABO-01A-21D-A40W-08	0.363	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	1	0	1		2	2	2	0		0	0	78		78	76	1	3.570000	-16.617250	1	0.240000	NM_014739			15	10		331	316	0		1	0		0	0	78	0		0.999812	3.340204e-01	0	0	0	26	0	15	331
NOS3	4846	broad.mit.edu	37	7	150698985	150698985	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr7:150698985G>A	ENST00000484524.1	+	12	1579	c.1579G>A	c.(1579-1581)Gag>Aag	p.E527K	NOS3_ENST00000297494.3_Missense_Mutation_p.E527K|NOS3_ENST00000461406.1_Missense_Mutation_p.E321K|NOS3_ENST00000467517.1_Missense_Mutation_p.E527K	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTATGGCTCCGAGACCGGCCG	0.652																																						ENST00000484524.1	1.000000	0.990000	1	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				50						c.(1579-1581)Gag>Aag		nitric oxide synthase 3 (endothelial cell)							46.0	48.0	48.0					7																	150698985		2203	4300	6503	SO:0001583	missense	4846	3	121394	34				g.chr7:150698985G>A		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.1579G>A	chr7.hg19:g.150698985G>A	ENSP00000420215:p.Glu527Lys	0					NOS3_ENST00000297494.3_Missense_Mutation_p.E527K|NOS3_ENST00000467517.1_Missense_Mutation_p.E527K|NOS3_ENST00000461406.1_Missense_Mutation_p.E321K	p.E527K	NM_001160111.1	NP_001153583.1	2	2	4	2.083680	P60323	NANO3_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	12	1579	+	all_neural(206;0.219)		Q495E5	Missense_Mutation	SNP	ENST00000484524.1	1	1	hg19	c.1579G>A	CCDS55182.1	1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.388389	0.82902	.	.	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88	4.8	4.8	0.61643	4.8	4.8	0.61643	Flavodoxin/nitric oxide synthase (2);	0.000000	0.56097	D	0.000038	D	0.89434	0.6714	M	0.93898	3.47	0.54753	D	0.999983	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.987;0.987;0.994;1.0;0.998	D	0.92206	0.5772	10	0.87932	D	0	-6.0588	15.7394	0.77876	0.0:0.0:1.0:0.0	.	527;527;527;321;527	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	K	527;321;527;527	ENSP00000297494:E527K;ENSP00000417143:E321K;ENSP00000420215:E527K;ENSP00000420551:E527K	ENSP00000297494:E527K	E	+	1	0	0	NOS3	150329918	150329918	1.000000	0.71417	0.940000	0.37924	0.308000	0.27856	9.261000	0.95576	2.376000	0.81061	0.655000	0.94253	GAG	0.387097		TCGA-2J-AABO-01A-21D-A40W-08	0.652	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1	1	0	1		2	2	2	0		0	0	85		85	84	1	3.570000	-20.000000	1	0.240000	NM_000603			69	66		246	240	1		1	0		0	0	85	0		1.000000	1.256521e-01	0	0	0	3	0	69	246
CSMD1	64478	broad.mit.edu	37	8	2813124	2813124	+	Silent	SNP	C	C	T	rs147768119	byFrequency	TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr8:2813124C>T	ENST00000520002.1	-	65	10539	c.9984G>A	c.(9982-9984)tcG>tcA	p.S3328S	CSMD1_ENST00000537824.1_Silent_p.S3327S|CSMD1_ENST00000602723.1_Silent_p.S3151S|CSMD1_ENST00000400186.3_Silent_p.S3151S|CSMD1_ENST00000542608.1_Silent_p.S3150S|CSMD1_ENST00000602557.1_Silent_p.S3328S			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3328	Sushi 28. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TACACACAGGCGACTTTCCTG	0.488													C|||	14	0.00279553	0.0091	0.0029	5008	,	,		17918	0.0		0.0	False		,,,				2504	0.0					ENST00000520002.1	1.000000	0.570000	1	7.200000e-01	0.900000	0.878260	0.900000	1.000000																										0				25						c.(9982-9984)tcG>tcA		CUB and Sushi multiple domains 1		C		11,4059		0,11,2024	139.0	132.0	134.0		9981	-6.1	0.8	8	dbSNP_134	134	0,8368		0,0,4184	no	coding-synonymous	CSMD1	NM_033225.5		0,11,6208	TT,TC,CC		0.0,0.2703,0.0884		3327/3565	2813124	11,12427	2035	4184	6219	SO:0001819	synonymous_variant	64478	55	120966	49				g.chr8:2813124C>T			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9984G>A	chr8.hg19:g.2813124C>T		0					CSMD1_ENST00000542608.1_Silent_p.S3150S|CSMD1_ENST00000602557.1_Silent_p.S3328S|CSMD1_ENST00000537824.1_Silent_p.S3327S|CSMD1_ENST00000400186.3_Silent_p.S3151S|CSMD1_ENST00000602723.1_Silent_p.S3151S	p.S3328S			1	2	3	1.922277	Q96PZ7	CSMD1_HUMAN		65	10539	-		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	1	0	hg19	c.9984G>A		1	7	0.003205128205128205	5	0.01016260162601626	2	0.0055248618784530384	0	0.0	0	0.0	C	3.359	-0.130848	0.06753	0.002703	0.0	ENSG00000183117	ENST00000335551	.	.	.	5.64	-6.09	0.02145	5.64	-6.09	0.02145	.	.	.	.	.	T	0.28001	0.0690	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35351	-0.9792	4	.	.	.	.	1.9357	0.03336	0.1018:0.2364:0.2112:0.4506	.	.	.	.	T	2745	.	.	A	-	1	0	0	CSMD1	2800531	2800531	0.007000	0.16637	0.831000	0.32960	0.381000	0.30169	-1.266000	0.02842	-1.299000	0.02344	-0.691000	0.03719	GCC	0.321429		TCGA-2J-AABO-01A-21D-A40W-08	0.488	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	1	0	1		2	2	2	0		0	0	46		46	44	1	3.570000	-7.426567	1	0.240000	NM_033225			20	20		188	185	0		1			0	0	46	0		0.999996	0	0	0	0	0	0	20	188
MOS	4342	broad.mit.edu	37	8	57026538	57026538	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr8:57026538G>A	ENST00000311923.1	-	1	3	c.4C>T	c.(4-6)Ccc>Tcc	p.P2S		NM_005372.1	NP_005363.1	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene homolog	2					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|chromatin organization (GO:0006325)|establishment of meiotic spindle orientation (GO:0051296)|MAPK cascade (GO:0000165)|meiotic spindle organization (GO:0000212)|negative regulation of metaphase/anaphase transition of meiotic cell cycle (GO:1902103)|protein autophosphorylation (GO:0046777)|regulation of meiosis (GO:0040020)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(12)|ovary(1)|urinary_tract(2)	22			Epithelial(17;0.00117)|all cancers(17;0.00879)			AGGGGCGAGGGCATCGCACTT	0.632																																					Esophageal Squamous(124;373 2870 4778)	ENST00000311923.1	1.000000	0.270000	9.800000e-01	4.200000e-01	0.640000	0.669987	0.640000	1.000000																										0				22						c.(4-6)Ccc>Tcc		v-mos Moloney murine sarcoma viral oncogene homolog							12.0	15.0	14.0					8																	57026538		2171	4250	6421	SO:0001583	missense	4342	1	120526	25				g.chr8:57026538G>A		CCDS6164.1	8q11	2012-10-02			ENSG00000172680	ENSG00000172680			7199	protein-coding gene	gene with protein product		190060				9552420	Standard	NM_005372		Approved		uc011leb.2	P00540	OTTHUMG00000164299	ENST00000311923.1:c.4C>T	chr8.hg19:g.57026538G>A	ENSP00000310722:p.Pro2Ser	0						p.P2S	NM_005372.1	NP_005363.1	2	2	4	2.047432	P00540	MOS_HUMAN	Epithelial(17;0.00117)|all cancers(17;0.00879)	1	3	-			Q3KPG9|Q3KPH0	Missense_Mutation	SNP	ENST00000311923.1	0	1	hg19	c.4C>T	CCDS6164.1	0	.	.	.	.	.	.	.	.	.	.	G	19.53	3.845672	0.71603	.	.	ENSG00000172680	ENST00000311923	D	0.82081	-1.57	5.14	5.14	0.70334	5.14	5.14	0.70334	.	0.000000	0.64402	U	0.000001	D	0.90940	0.7152	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.92023	0.5627	10	0.87932	D	0	.	18.222	0.89904	0.0:0.0:1.0:0.0	.	2	P00540	MOS_HUMAN	S	2	ENSP00000310722:P2S	ENSP00000310722:P2S	P	-	1	0	0	MOS	57189092	57189092	1.000000	0.71417	0.998000	0.56505	0.094000	0.18550	9.169000	0.94788	2.387000	0.81309	0.557000	0.71058	CCC	0.377457		TCGA-2J-AABO-01A-21D-A40W-08	0.632	MOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378174.1	1	0	1		2	2	2	0		0	0	20		20	19	1	3.570000	-10.078070	1	0.240000	NM_005372			6	6		98	97	0		1			0	0	20	0		0.965404	0	0	0	0	0	0	6	98
GABBR2	9568	broad.mit.edu	37	9	101216358	101216358	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr9:101216358G>A	ENST00000259455.2	-	7	1600	c.1141C>T	c.(1141-1143)Cgg>Tgg	p.R381W		NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	381					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)	p.R381W(1)	NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	CGCTGGTGCCGGCTGCTGGCA	0.607																																						ENST00000259455.2	1.000000	0.900000	1	9.900000e-01	0.990000	0.994600	0.990000	1.000000																									NOTCH1_ENST00000277541/GABBR2(2)	1	Substitution - Missense(1)	p.R381W(1)	breast(1)	49						c.(1141-1143)Cgg>Tgg		gamma-aminobutyric acid (GABA) B receptor, 2	Baclofen(DB00181)						159.0	133.0	142.0					9																	101216358		2203	4300	6503	SO:0001583	missense	9568	1	121412	30				g.chr9:101216358G>A	AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.1141C>T	chr9.hg19:g.101216358G>A	ENSP00000259455:p.Arg381Trp	1						p.R381W	NM_005458.7	NP_005449.5	1	2	3	1.846996	O75899	GABR2_HUMAN		7	1600	-		Acute lymphoblastic leukemia(62;0.0527)	O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Missense_Mutation	SNP	ENST00000259455.2	1	1	hg19	c.1141C>T	CCDS6736.1	1	.	.	.	.	.	.	.	.	.	.	G	19.75	3.886305	0.72410	.	.	ENSG00000136928	ENST00000259455	D	0.83914	-1.78	5.79	3.75	0.43078	5.79	3.75	0.43078	Extracellular ligand-binding receptor (1);	0.196584	0.45361	D	0.000367	D	0.84977	0.5592	L	0.46157	1.445	0.53005	D	0.99996	D	0.69078	0.997	P	0.58077	0.832	D	0.86335	0.1701	10	0.87932	D	0	.	12.3524	0.55155	0.0:0.0:0.6388:0.3612	.	381	O75899	GABR2_HUMAN	W	381	ENSP00000259455:R381W	ENSP00000259455:R381W	R	-	1	2	2	GABBR2	100256179	100256179	0.998000	0.40836	1.000000	0.80357	0.993000	0.82548	1.287000	0.33284	1.400000	0.46741	0.650000	0.86243	CGG	0.317774		TCGA-2J-AABO-01A-21D-A40W-08	0.607	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053373.1	1	0	1		2	2	2	0		0	0	55		55	53	1	3.570000	-15.326930	1	0.240000				32	32		201	200	1		1			0	0	55	0		1.000000	0	0	0	0	0	0	32	201
DDX31	64794	broad.mit.edu	37	9	135523898	135523898	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr9:135523898G>A	ENST00000372159.3	-	10	1247	c.1096C>T	c.(1096-1098)Cgc>Tgc	p.R366C	DDX31_ENST00000372153.1_Missense_Mutation_p.R366C|DDX31_ENST00000310532.2_Missense_Mutation_p.R366C|DDX31_ENST00000438527.3_Missense_Mutation_p.R237C	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	366	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		TCCACCAGGCGTCCAGGAGTT	0.413																																						ENST00000372159.3	0.290000	0.070000	2.200000e-01	1.100000e-01	0.160000	0.177437	0.160000	0.150000																										0				27						c.(1096-1098)Cgc>Tgc		DEAD (Asp-Glu-Ala-Asp) box polypeptide 31							109.0	115.0	113.0					9																	135523898		2203	4300	6503	SO:0001583	missense	64794	5	121412	37				g.chr9:135523898G>A	AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.1096C>T	chr9.hg19:g.135523898G>A	ENSP00000361232:p.Arg366Cys	1					DDX31_ENST00000438527.3_Missense_Mutation_p.R237C|DDX31_ENST00000372153.1_Missense_Mutation_p.R366C|DDX31_ENST00000310532.2_Missense_Mutation_p.R366C	p.R366C	NM_022779.7	NP_073616.6	1	2	3	1.835172	Q9H8H2	DDX31_HUMAN		10	1247	-			Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Missense_Mutation	SNP	ENST00000372159.3	0	1	hg19	c.1096C>T	CCDS6951.1	0	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672307	0.88348	.	.	ENSG00000125485	ENST00000372159;ENST00000372155;ENST00000372153;ENST00000438527;ENST00000310532	T;T;T;T	0.54479	2.09;0.57;2.09;0.57	6.17	6.17	0.99709	6.17	6.17	0.99709	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.82664	0.5086	H	0.97940	4.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87906	0.2694	10	0.87932	D	0	-15.9721	14.6754	0.68975	0.0:0.0:0.8551:0.1449	.	366;366	Q9H8H2-2;Q9H8H2	.;DDX31_HUMAN	C	366;366;366;237;366	ENSP00000361232:R366C;ENSP00000361226:R366C;ENSP00000387730:R237C;ENSP00000310539:R366C	ENSP00000310539:R366C	R	-	1	0	0	DDX31	134513719	134513719	1.000000	0.71417	0.537000	0.28052	0.995000	0.86356	7.100000	0.76989	2.941000	0.99782	0.655000	0.94253	CGC	0.319971		TCGA-2J-AABO-01A-21D-A40W-08	0.413	DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054794.1	0	0	1		2	2	2	0		0	0	138		138	137	1	3.570000	-2.889608	1	0.240000	NM_138620			11	11		645	634	0		1	0		0	0	138	0		0.998185	7.038613e-03	0	0	0	7	0	11	645
OLFM1	10439	broad.mit.edu	37	9	138011686	138011686	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr9:138011686G>A	ENST00000371793.3	+	6	1371	c.1120G>A	c.(1120-1122)Gct>Act	p.A374T	OLFM1_ENST00000371796.3_Missense_Mutation_p.A347T|OLFM1_ENST00000252854.4_Missense_Mutation_p.A356T	NM_001282611.1	NP_001269540.1	Q99784	NOE1_HUMAN	olfactomedin 1	374	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of neuron migration (GO:2001223)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)	21		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		CAACCAGAACGCTGGCAACAT	0.627																																						ENST00000371793.3	1.000000	0.900000	1	9.900000e-01	0.990000	0.994459	0.990000	1.000000																										0				21						c.(1120-1122)Gct>Act		olfactomedin 1							76.0	58.0	64.0					9																	138011686		2203	4300	6503	SO:0001583	missense	10439	0	0					g.chr9:138011686G>A	AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558			17187	protein-coding gene	gene with protein product	"""pancortin"""	605366				9039501	Standard	NM_006334		Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	ENST00000371793.3:c.1120G>A	chr9.hg19:g.138011686G>A	ENSP00000360858:p.Ala374Thr	1					OLFM1_ENST00000371796.3_Missense_Mutation_p.A347T|OLFM1_ENST00000252854.4_Missense_Mutation_p.A356T	p.A374T	NM_001282611.1	NP_001269540.1	1	2	3	1.835172	Q99784	NOE1_HUMAN		6	1371	+		Myeloproliferative disorder(178;0.0333)	Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	Missense_Mutation	SNP	ENST00000371793.3	1	1	hg19	c.1120G>A		1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.567026	0.86439	.	.	ENSG00000130558	ENST00000252854;ENST00000371796;ENST00000371793	D;D;D	0.88896	-2.44;-2.44;-2.44	4.79	4.79	0.61399	4.79	4.79	0.61399	Olfactomedin-like (3);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	D	0.92348	0.7572	L	0.42686	1.345	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.93259	0.6641	10	0.66056	D	0.02	.	17.8435	0.88722	0.0:0.0:1.0:0.0	.	374;356	Q99784;Q6IMJ8	NOE1_HUMAN;.	T	356;347;374	ENSP00000252854:A356T;ENSP00000360861:A347T;ENSP00000360858:A374T	ENSP00000252854:A356T	A	+	1	0	0	OLFM1	137151507	137151507	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	9.571000	0.98176	2.214000	0.71695	0.561000	0.74099	GCT	0.319971		TCGA-2J-AABO-01A-21D-A40W-08	0.627	OLFM1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000054974.1	1	0	1		2	2	2	0		0	0	45		45	44	1	3.570000	-20.000000	1	0.240000	NM_014279			22	21		128	123	1		1	0		0	0	45	0		0.999999	4.027173e-01	0	0	0	9	0	22	128
KCNT1	57582	broad.mit.edu	37	9	138670646	138670646	+	Missense_Mutation	SNP	G	G	A	rs372824034		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chr9:138670646G>A	ENST00000263604.3	+	23	2650	c.2650G>A	c.(2650-2652)Gtc>Atc	p.V884I	KCNT1_ENST00000298480.5_Missense_Mutation_p.V903I|KCNT1_ENST00000371757.2_Missense_Mutation_p.V903I|KCNT1_ENST00000486577.2_Missense_Mutation_p.V862I|KCNT1_ENST00000490355.2_Missense_Mutation_p.V882I|KCNT1_ENST00000491806.2_Missense_Mutation_p.V870I|KCNT1_ENST00000487664.1_Missense_Mutation_p.V858I|KCNT1_ENST00000488444.2_Missense_Mutation_p.V884I			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	884					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		CAAGACCATCGTCAACGTGCA	0.637																																						ENST00000263604.3	1.000000	0.610000	1	7.800000e-01	0.980000	0.914142	0.980000	1.000000																										0				50						c.(2650-2652)Gtc>Atc		potassium channel, subfamily T, member 1		G	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	165.0	121.0	136.0		2707	4.5	1.0	9		136	0,8600		0,0,4300	no	missense	KCNT1	NM_020822.2	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	903/1236	138670646	1,13005	2203	4300	6503	SO:0001583	missense	57582	1	121408	30				g.chr9:138670646G>A	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.2650G>A	chr9.hg19:g.138670646G>A	ENSP00000263604:p.Val884Ile	1					KCNT1_ENST00000486577.2_Missense_Mutation_p.V862I|KCNT1_ENST00000488444.2_Missense_Mutation_p.V884I|KCNT1_ENST00000298480.5_Missense_Mutation_p.V903I|KCNT1_ENST00000371757.2_Missense_Mutation_p.V903I|KCNT1_ENST00000491806.2_Missense_Mutation_p.V870I|KCNT1_ENST00000487664.1_Missense_Mutation_p.V858I|KCNT1_ENST00000490355.2_Missense_Mutation_p.V882I	p.V884I			1	2	3	1.856712	Q5JUK3	KCNT1_HUMAN		23	2650	+		Myeloproliferative disorder(178;0.0821)	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	ENST00000263604.3	1	1	hg19	c.2650G>A		1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.471882	0.84533	2.27E-4	0.0	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13	4.5	4.5	0.54988	4.5	4.5	0.54988	.	0.000000	0.64402	U	0.000001	D	0.84243	0.5429	L	0.45581	1.43	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.989;0.994;0.989	D;P;P;P	0.85130	0.997;0.652;0.677;0.578	D	0.83797	0.0234	10	0.37606	T	0.19	-40.5009	17.1945	0.86888	0.0:0.0:1.0:0.0	.	870;903;858;884	C9JYL2;B9EGP2;G5E9V0;Q5JUK3	.;.;.;KCNT1_HUMAN	I	858;903;903;862;870;884;882;884	ENSP00000417851:V858I;ENSP00000298480:V903I;ENSP00000360822:V903I;ENSP00000263604:V884I	ENSP00000263604:V884I	V	+	1	0	0	KCNT1	137810467	137810467	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.563000	0.98148	2.024000	0.59613	0.557000	0.71058	GTC	0.311095		TCGA-2J-AABO-01A-21D-A40W-08	0.637	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		1	0	1		2	2	2	0		0	0	37		37	36	1	3.570000	-9.246055	1	0.240000	NM_020822			20	20		175	169	1		1			0	0	37	0		0.999995	0	0	0	0	0	0	20	175
TLR8	51311	broad.mit.edu	37	X	12939864	12939864	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chrX:12939864G>A	ENST00000218032.6	+	2	2792	c.2705G>A	c.(2704-2706)cGc>cAc	p.R902H	TLR8_ENST00000311912.5_Missense_Mutation_p.R920H	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	902	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	AATGAGCTGCGCTACCACCTT	0.478																																						ENST00000218032.6	0.890000	0.580000	8.200000e-01	6.500000e-01	0.730000	0.739008	0.730000	0.730000																										0				50						c.(2704-2706)cGc>cAc		toll-like receptor 8	Imiquimod(DB00724)						123.0	120.0	121.0					X																	12939864		2203	4300	6503	SO:0001583	missense	51311	0	0					g.chrX:12939864G>A	AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.2705G>A	chrX.hg19:g.12939864G>A	ENSP00000218032:p.Arg902His						TLR8_ENST00000311912.5_Missense_Mutation_p.R920H	p.R902H	NM_138636.4	NP_619542.1	0	1	1		Q9NR97	TLR8_HUMAN		2	2792	+			B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	ENST00000218032.6	1	1	hg19	c.2705G>A	CCDS14152.1	0	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604067	0.66445	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	T;T	0.08102	3.13;3.13	5.97	5.1	0.69264	5.97	5.1	0.69264	Toll/interleukin-1 receptor homology (TIR) domain (3);	0.000000	0.38959	N	0.001508	T	0.26702	0.0653	M	0.78637	2.42	0.44595	D	0.997569	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.01215	-1.1416	10	0.66056	D	0.02	.	8.7627	0.34685	0.08:0.0:0.7253:0.1947	.	902;920	Q9NR97;D1CS70	TLR8_HUMAN;.	H	902;920	ENSP00000218032:R902H;ENSP00000312082:R920H	ENSP00000218032:R902H	R	+	2	0	0	TLR8	12849785	12849785	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.451000	0.80668	1.282000	0.44496	0.600000	0.82982	CGC	0.240000		TCGA-2J-AABO-01A-21D-A40W-08	0.478	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2	1	0	1		2	2	2	0		0	0	93		93	92	1	3.570000	-20.000000	1	0.240000	NM_016610			67	67		311	307	1		1			0	0	93	0		1.000000	0	0	0	0	0	0	67	311
MAGEB2	4113	broad.mit.edu	37	X	30236753	30236753	+	Missense_Mutation	SNP	G	G	A	rs199746320		TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chrX:30236753G>A	ENST00000378988.4	+	2	157	c.56G>A	c.(55-57)cGa>cAa	p.R19Q		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	19										breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						CGCAAGGCCCGAGATGAGACC	0.552													G|||	1	0.000264901	0.0008	0.0	3775	,	,		13433	0.0		0.0	False		,,,				2504	0.0					ENST00000378988.4	0.530000	0.080000	3.900000e-01	1.500000e-01	0.250000	0.280140	0.250000	0.230000																										0				23						c.(55-57)cGa>cAa		melanoma antigen family B, 2							37.0	36.0	37.0					X																	30236753		2202	4300	6502	SO:0001583	missense	4113	2	121406	35				g.chrX:30236753G>A	AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.56G>A	chrX.hg19:g.30236753G>A	ENSP00000368273:p.Arg19Gln							p.R19Q	NM_002364.4	NP_002355.2	0	1	1		O15479	MAGB2_HUMAN		2	157	+			O75860	Missense_Mutation	SNP	ENST00000378988.4	0	1	hg19	c.56G>A	CCDS14219.1	0	1	6.027727546714888E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	10.12	1.263218	0.23051	.	.	ENSG00000099399	ENST00000378988	T	0.04015	3.73	3.43	-0.481	0.12082	3.43	-0.481	0.12082	Melanoma associated antigen, MAGE, N-terminal (1);	1.269310	0.05610	N	0.577923	T	0.03348	0.0097	L	0.38733	1.17	0.09310	N	1	P	0.46277	0.875	B	0.33960	0.173	T	0.45906	-0.9229	10	0.14656	T	0.56	.	6.2626	0.20910	0.528:0.0:0.472:0.0	.	19	O15479	MAGB2_HUMAN	Q	19	ENSP00000368273:R19Q	ENSP00000368273:R19Q	R	+	2	0	0	MAGEB2	30146674	30146674	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.141000	0.16076	-0.251000	0.09542	0.513000	0.50165	CGA	0.240000		TCGA-2J-AABO-01A-21D-A40W-08	0.552	MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056157.1	0	0	1		2	2	2	0		0	0	9		9	8	1	3.570000	-4.369902	1	0.240000	NM_002364			4	4		65	63	0		1			0	0	9	0		0.885455	0	0	0	0	0	0	4	65
PCDH11X	27328	broad.mit.edu	37	X	91090535	91090535	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chrX:91090535C>T	ENST00000373094.1	+	1	877	c.32C>T	c.(31-33)gCg>gTg	p.A11V	PCDH11X_ENST00000361655.2_Missense_Mutation_p.A11V|PCDH11X_ENST00000373097.1_Missense_Mutation_p.A11V|PCDH11X_ENST00000395337.2_Missense_Mutation_p.A11V|PCDH11X_ENST00000361724.1_Missense_Mutation_p.A11V|PCDH11X_ENST00000504220.2_Missense_Mutation_p.A11V|PCDH11X_ENST00000406881.1_Missense_Mutation_p.A11V|PCDH11X_ENST00000373088.1_Missense_Mutation_p.A11V|PCDH11X_ENST00000298274.8_Missense_Mutation_p.A11V	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	11					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						TACATTTTCGCGGTCCTGCTA	0.493																																					NSCLC(38;925 1092 2571 38200 45895)	ENST00000373094.1	0.700000	0.340000	6.100000e-01	4.100000e-01	0.500000	0.517762	0.500000	0.500000																										0				159						c.(31-33)gCg>gTg		protocadherin 11 X-linked							132.0	105.0	114.0					X																	91090535		2203	4300	6503	SO:0001583	missense	27328	0	0					g.chrX:91090535C>T	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.32C>T	chrX.hg19:g.91090535C>T	ENSP00000362186:p.Ala11Val						PCDH11X_ENST00000298274.8_Missense_Mutation_p.A11V|PCDH11X_ENST00000361724.1_Missense_Mutation_p.A11V|PCDH11X_ENST00000373088.1_Missense_Mutation_p.A11V|PCDH11X_ENST00000395337.2_Missense_Mutation_p.A11V|PCDH11X_ENST00000504220.2_Missense_Mutation_p.A11V|PCDH11X_ENST00000361655.2_Missense_Mutation_p.A11V|PCDH11X_ENST00000406881.1_Missense_Mutation_p.A11V|PCDH11X_ENST00000373097.1_Missense_Mutation_p.A11V	p.A11V	NM_032968.3	NP_116750.1	0	1	1		Q9BZA7	PC11X_HUMAN		1	877	+			A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	1	1	hg19	c.32C>T	CCDS14461.1	0	.	.	.	.	.	.	.	.	.	.	C	10.57	1.387562	0.25031	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.51071	0.73;0.76;0.77;0.72;0.78;0.77;0.75;0.78;0.78	3.93	3.93	0.45458	3.93	3.93	0.45458	.	0.251193	0.32769	N	0.005671	T	0.38134	0.1029	L	0.29908	0.895	0.30046	N	0.812228	P;B;P;P;P;P;B;P	0.44139	0.703;0.296;0.827;0.827;0.827;0.735;0.28;0.526	B;B;B;B;B;B;B;B	0.43155	0.168;0.055;0.41;0.41;0.41;0.233;0.047;0.047	T	0.30621	-0.9972	10	0.23891	T	0.37	.	14.4725	0.67526	0.0:1.0:0.0:0.0	.	11;11;11;11;11;11;11;11	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	V	11	ENSP00000378746:A11V;ENSP00000362186:A11V;ENSP00000362189:A11V;ENSP00000355040:A11V;ENSP00000362180:A11V;ENSP00000423762:A11V;ENSP00000355105:A11V;ENSP00000384758:A11V;ENSP00000298274:A11V	ENSP00000298274:A11V	A	+	2	0	0	PCDH11X	90977191	90977191	1.000000	0.71417	1.000000	0.80357	0.369000	0.29798	3.861000	0.56002	1.935000	0.56089	0.415000	0.27848	GCG	0.240000		TCGA-2J-AABO-01A-21D-A40W-08	0.493	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	1	0	1		2	2	2	0		0	0	56		56	54	1	3.570000	-3.143671	1	0.240000	NM_032969			25	25		179	178	1		1			0	0	56	0		1.000000	0	0	0	0	0	0	25	179
MAP7D3	79649	broad.mit.edu	37	X	135314079	135314079	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABO-01A-21D-A40W-08	TCGA-2J-AABO-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	16470dac-103c-4ecc-8407-af967f95b1a8	f915639e-4fa7-4f9e-a5ab-73747b07fae2	g.chrX:135314079G>A	ENST00000316077.9	-	8	1257	c.1037C>T	c.(1036-1038)tCg>tTg	p.S346L	MAP7D3_ENST00000370663.5_Missense_Mutation_p.S328L|MAP7D3_ENST00000370661.1_Missense_Mutation_p.S311L|MAP7D3_ENST00000495432.1_5'Flank	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	346					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					CACCACAGGCGACACGTCCAC	0.572																																						ENST00000316077.9	1.000000	0.950000	1	9.700000e-01	0.990000	0.992381	0.990000	0.990000																										0				44						c.(1036-1038)tCg>tTg		MAP7 domain containing 3							98.0	101.0	100.0					X																	135314079		2186	4251	6437	SO:0001583	missense	79649	0	0					g.chrX:135314079G>A	AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.1037C>T	chrX.hg19:g.135314079G>A	ENSP00000318086:p.Ser346Leu						MAP7D3_ENST00000370663.5_Missense_Mutation_p.S328L|MAP7D3_ENST00000495432.1_5'Flank|MAP7D3_ENST00000370661.1_Missense_Mutation_p.S311L	p.S346L	NM_024597.3	NP_078873.2	0	1	1		Q8IWC1	MA7D3_HUMAN		8	1257	-	Acute lymphoblastic leukemia(192;0.000127)		A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	ENST00000316077.9	1	1	hg19	c.1037C>T	CCDS44004.1	1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.341803	0.24339	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.08102	3.13;3.13;3.13;3.13	4.0	-2.91	0.05631	4.0	-2.91	0.05631	.	.	.	.	.	T	0.04452	0.0122	L	0.28192	0.835	0.09310	N	1	B;B;B;B	0.30033	0.266;0.02;0.069;0.208	B;B;B;B	0.17979	0.011;0.011;0.004;0.02	T	0.32981	-0.9886	9	0.42905	T	0.14	2.4003	4.2005	0.10464	0.4556:0.0:0.2903:0.254	.	328;305;346;311	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	L	311;346;328;305	ENSP00000359695:S311L;ENSP00000318086:S346L;ENSP00000359697:S328L;ENSP00000359694:S305L	ENSP00000318086:S346L	S	-	2	0	0	MAP7D3	135141745	135141745	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.456000	0.21859	-1.115000	0.02973	-0.268000	0.10319	TCG	0.240000		TCGA-2J-AABO-01A-21D-A40W-08	0.572	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2	1	0	1		2	2	2	0		0	0	67		67	66	1	3.570000	-20.000000	1	0.240000				134	134		146	145	1		1	0		0	0	67	0		1.000000	8.649807e-01	0	0	0	6	0	134	146
