#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
TACR3	6870	broad.mit.edu	37	4	104577461	104577469	+	In_Frame_Del	DEL	ATGGGAAAC	ATGGGAAAC	-	rs200604292|rs377430416		TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr4:104577461_104577469delATGGGAAAC	ENST00000304883.2	-	3	910_918	c.770_778delGTTTCCCAT	c.(769-780)tgtttcccattg>ttg	p.CFP257del		NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	257					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		ATGATGAGCAATGGGAAACAGTACACCAG	0.392																																						ENST00000304883.2	1.000000	0.200000	1.000000	0.290000	0.430000	0.513428	0.430000	0.370000																										0				51						c.(769-780)tgtttcccattg>ttg		tachykinin receptor 3																																				SO:0001651	inframe_deletion	6870	0	0					g.chr4:104577461_104577469delATGGGAAAC	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.770_778delGTTTCCCAT	chr4.hg19:g.104577461_104577469delATGGGAAAC	ENSP00000303325:p.Cys257_Pro259del	0						p.CFP257del	NM_001059.2	NP_001050.1	1	2	3	2.014557	P29371	NK3R_HUMAN		3	910_918	-		Hepatocellular(203;0.217)	Q0P510	In_Frame_Del	DEL	ENST00000304883.2	1	1	hg19	c.770_778delGTTTCCCAT	CCDS3664.1	0																																																																																								0.098921		TCGA-2J-AABR-01A-11D-A40W-08	0.392	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	0	0	1		2			0		0	0	118		118	116	1	1.970000	-7.783322	1	0.090000	NM_001059			9	16		516	517	0		1	0	0	0	0	0	0		0.994679	0	0	0	0	0	0	9	516
CNNM2	54805	broad.mit.edu	37	10	104678687	104678687	+	Silent	SNP	C	C	T			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr10:104678687C>T	ENST00000369878.4	+	1	638	c.450C>T	c.(448-450)tgC>tgT	p.C150C	CNNM2_ENST00000369875.3_Silent_p.C150C|CNNM2_ENST00000433628.2_Silent_p.C150C	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	150					magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CCCAGCGATGCGGCATCCGCA	0.687																																						ENST00000369878.4	0.470000	0.120000	0.370000	0.180000	0.260000	0.281374	0.260000	0.250000																										0				19						c.(448-450)tgC>tgT		cyclin and CBS domain divalent metal cation transport mediator 2							72.0	81.0	78.0					10																	104678687		2197	4299	6496	SO:0001819	synonymous_variant	54805	0	0					g.chr10:104678687C>T	AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.450C>T	chr10.hg19:g.104678687C>T		0					CNNM2_ENST00000369875.3_Silent_p.C150C|CNNM2_ENST00000433628.2_Silent_p.C150C	p.C150C	NM_017649.4	NP_060119.3	0	0	0	1.941341	Q9H8M5	CNNM2_HUMAN		1	638	+		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Silent	SNP	ENST00000369878.4	0	1	hg19	c.450C>T	CCDS44474.1	0																																																																																								0.054251		TCGA-2J-AABR-01A-11D-A40W-08	0.687	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050113.3	0	0	1		2	2	2	0		0	0	144		144	143	1	1.970000	-2.095396	0	0.090000	NM_017649			8	9		656	649	0		1	0		0	0	144	0		0.989023	1.185577e-03	0	0	0	4	0	8	656
PDSS1	23590	broad.mit.edu	37	10	27024505	27024505	+	Silent	SNP	G	G	A			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr10:27024505G>A	ENST00000376215.5	+	10	1076	c.1023G>A	c.(1021-1023)caG>caA	p.Q341Q	PDSS1_ENST00000470978.1_3'UTR|PDSS1_ENST00000376203.5_Intron	NM_014317.3	NP_055132.2	Q5T2R2	DPS1_HUMAN	prenyl (decaprenyl) diphosphate synthase, subunit 1	341					isoprenoid biosynthetic process (GO:0008299)|protein heterotetramerization (GO:0051290)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial matrix (GO:0005759)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|trans-hexaprenyltranstransferase activity (GO:0000010)|trans-octaprenyltranstransferase activity (GO:0050347)			autonomic_ganglia(1)|endometrium(1)|kidney(7)|large_intestine(6)|lung(5)|prostate(1)	21						TTGCCTGTCAGCAGGTAGGTT	0.498																																						ENST00000376215.5	1.000000	0.380000	1.000000	0.600000	0.930000	0.841811	0.930000	1.000000																										0				21						c.(1021-1023)caG>caA		prenyl (decaprenyl) diphosphate synthase, subunit 1							104.0	92.0	96.0					10																	27024505		2203	4300	6503	SO:0001819	synonymous_variant	23590	0	0					g.chr10:27024505G>A	AF118395	CCDS31168.1	10p12.2	2006-04-12	2006-02-14	2006-02-14	ENSG00000148459	ENSG00000148459			17759	protein-coding gene	gene with protein product	"""coenzyme Q1 homolog (yeast)"""	607429	"""trans-prenyltransferase"""	TPRT		10972372	Standard	NM_014317		Approved	TPT, COQ1	uc001isv.3	Q5T2R2	OTTHUMG00000017844	ENST00000376215.5:c.1023G>A	chr10.hg19:g.27024505G>A		0					PDSS1_ENST00000376203.5_Intron|PDSS1_ENST00000470978.1_3'UTR	p.Q341Q	NM_014317.3	NP_055132.2	1	2	3	2.006452	Q5T2R2	DPS1_HUMAN		10	1076	+			Q53F75|Q6P473|Q86WQ8|Q9Y2W5	Silent	SNP	ENST00000376215.5	0	1	hg19	c.1023G>A	CCDS31168.1	1																																																																																								0.097312		TCGA-2J-AABR-01A-11D-A40W-08	0.498	PDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047276.1	0	0	1		2	2	2	0		0	0	36		36	36	1	1.970000	-8.575297	1	0.090000				6	6		154	151	0		1	0		0	0	36	0		0.963800	1.898360e-02	0	0	0	5	0	6	154
BCCIP	56647	broad.mit.edu	37	10	127520157	127520157	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr10:127520157C>T	ENST00000278100.6	+	5	592	c.580C>T	c.(580-582)Ccc>Tcc	p.P194S	BCCIP_ENST00000299130.3_Missense_Mutation_p.P194S|BCCIP_ENST00000429863.2_Missense_Mutation_p.P164S|BCCIP_ENST00000368759.5_Missense_Mutation_p.P194S	NM_078468.2	NP_510868.1	Q9P287	BCCIP_HUMAN	BRCA2 and CDKN1A interacting protein	194	Interaction with CDKN1A.				cell cycle (GO:0007049)|DNA repair (GO:0006281)|neuroendocrine cell differentiation (GO:0061101)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nucleus (GO:0005634)	kinase regulator activity (GO:0019207)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)	8		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				GATCGCTCTGCCCATGTACCA	0.383																																						ENST00000278100.6	0.750000	0.160000	0.570000	0.260000	0.400000	0.425568	0.400000	0.370000																										0				8						c.(580-582)Ccc>Tcc		BRCA2 and CDKN1A interacting protein							63.0	63.0	63.0					10																	127520157		2203	4300	6503	SO:0001583	missense	56647	1	121412	30				g.chr10:127520157C>T	AB040451	CCDS7649.1, CCDS7650.1, CCDS7651.1	10q26.2	2008-05-14	2001-11-29		ENSG00000107949	ENSG00000107949			978	protein-coding gene	gene with protein product		611883	"""BRCA2 and CDKN1A-interacting protein"""			11313963, 10878006	Standard	NM_016567		Approved	BCCIPalpha, TOK-1	uc001ljd.4	Q9P287	OTTHUMG00000019237	ENST00000278100.6:c.580C>T	chr10.hg19:g.127520157C>T	ENSP00000278100:p.Pro194Ser	0					BCCIP_ENST00000368759.5_Missense_Mutation_p.P194S|BCCIP_ENST00000429863.2_Missense_Mutation_p.P164S|BCCIP_ENST00000299130.3_Missense_Mutation_p.P194S	p.P194S	NM_078468.2	NP_510868.1	0	0	0	1.941341	Q9P287	BCCIP_HUMAN		5	592	+		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)	B3KP45|Q8ND15|Q96GC4|Q9P288	Missense_Mutation	SNP	ENST00000278100.6	0	1	hg19	c.580C>T	CCDS7651.1	0	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808990	0.90707	.	.	ENSG00000107949	ENST00000278100;ENST00000299130;ENST00000368759;ENST00000429863;ENST00000392718	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	5.24	5.24	0.73138	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.78616	0.4311	H	0.94734	3.575	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;1.0;1.0;0.999;1.0	D	0.85215	0.1023	10	0.87932	D	0	-2.8285	18.8517	0.92235	0.0:1.0:0.0:0.0	.	164;194;194;194;194	B4E318;B4DUS0;Q9P287-2;Q9P287-4;Q9P287	.;.;.;.;BCCIP_HUMAN	S	194;194;194;164;194	ENSP00000278100:P194S;ENSP00000299130:P194S;ENSP00000357748:P194S;ENSP00000394758:P164S	ENSP00000278100:P194S	P	+	1	0	0	BCCIP	127510147	127510147	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.470000	0.80973	2.444000	0.82710	0.650000	0.86243	CCC	0.054251		TCGA-2J-AABR-01A-11D-A40W-08	0.383	BCCIP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050941.1	0	0	1		2	2	2	0		0	0	52		52	52	1	1.970000	-2.939098	1	0.090000				6	6		325	323	0		1	1		0	0	52	0		0.964345	6.088257e-01	0	4	0	101	0	6	325
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.380000	1.000000	0.560000	0.790000	0.785590	0.790000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	0	1	1	1.988592	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.080483		TCGA-2J-AABR-01A-11D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	0	0	1		2	2	2	0		0	0	67		67	65	1	1.970000	-3.951907	1	0.090000	NM_033360			8	8		215	210	0		1	1	1	0	0	67	515		0.988752	4.051874e-02	9.986014e-01	2	5	6	339	8	215
EDNRB	1910	broad.mit.edu	37	13	78477390	78477390	+	Silent	SNP	G	G	T	rs112618428		TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr13:78477390G>T	ENST00000334286.5	-	3	938	c.702C>A	c.(700-702)gtC>gtA	p.V234V	EDNRB_ENST00000377211.4_Silent_p.V324V|EDNRB_ENST00000446573.1_Silent_p.V234V	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	234					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	TGGCTTCAGGGACAGCCAGAA	0.433																																						ENST00000334286.5	0.690000	0.240000	0.570000	0.330000	0.430000	0.455257	0.430000	0.430000																										0				42						c.(700-702)gtC>gtA		endothelin receptor type B	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)						157.0	165.0	162.0					13																	78477390		2203	4300	6503	SO:0001819	synonymous_variant	1910	0	0					g.chr13:78477390G>T	L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.702C>A	chr13.hg19:g.78477390G>T		0					EDNRB_ENST00000377211.4_Silent_p.V324V|EDNRB_ENST00000446573.1_Silent_p.V234V	p.V234V	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	0	0	0	1.952484	P24530	EDNRB_HUMAN		3	938	-		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Silent	SNP	ENST00000334286.5	0	1	hg19	c.702C>A	CCDS9461.1	0																																																																																								0.059529		TCGA-2J-AABR-01A-11D-A40W-08	0.433	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276505.1	0	0	1		2	2	2	0		0	0	121		121	120	1	1.970000	-2.597057	1	0.090000				13	13		630	622	0		1	0		0	0	121	0		0.999497	6.544281e-02	0	0	0	19	0	13	630
KLHDC2	23588	broad.mit.edu	37	14	50249311	50249311	+	Splice_Site	SNP	C	C	T			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr14:50249311C>T	ENST00000298307.5	+	12	1957	c.1096C>T	c.(1096-1098)Cgg>Tgg	p.R366W	KLHDC2_ENST00000557247.1_Intron|KLHDC2_ENST00000554589.1_Intron|NEMF_ENST00000556925.1_5'Flank	NM_014315.2	NP_055130.1	Q9Y2U9	KLDC2_HUMAN	kelch domain containing 2	366						nucleus (GO:0005634)				endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	all_epithelial(31;0.000959)|Breast(41;0.0117)					ATCTCTTGTACGGTAAGTAAC	0.308																																						ENST00000298307.5	1.000000	0.590000	1.000000	0.880000	0.990000	0.952268	0.990000	1.000000																										0				16						c.(1096-1098)Cgg>Tgg		kelch domain containing 2							51.0	51.0	51.0					14																	50249311		2203	4300	6503	SO:0001630	splice_region_variant	23588	7	121386	33				g.chr14:50249311C>T	AK001771	CCDS9693.1	14q21.3	2003-01-15			ENSG00000165516	ENSG00000165516			20231	protein-coding gene	gene with protein product		611280				11384994	Standard	NM_014315		Approved	HCLP-1, LCP	uc001wwx.3	Q9Y2U9	OTTHUMG00000140288	ENST00000298307.5:c.1097+1C>T	chr14.hg19:g.50249311C>T		0					NEMF_ENST00000556925.1_5'Flank|KLHDC2_ENST00000554589.1_Intron|KLHDC2_ENST00000557247.1_Intron	p.R366W	NM_014315.2	NP_055130.1	1	2	3	2.014109	Q9Y2U9	KLDC2_HUMAN		12	1957	+	all_epithelial(31;0.000959)|Breast(41;0.0117)		B3KPF9|Q6IAF0|Q86TY9	Splice_Site	SNP	ENST00000298307.5	1	0	hg19	c.1096C>T	CCDS9693.1	1	.	.	.	.	.	.	.	.	.	.	C	17.83	3.484982	0.63962	.	.	ENSG00000165516	ENST00000298307	T	0.05081	3.5	5.23	3.12	0.35913	5.23	3.12	0.35913	.	0.000000	0.85682	D	0.000000	T	0.22126	0.0533	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.00440	-1.1738	10	0.87932	D	0	-15.6679	11.6456	0.51259	0.5345:0.4655:0.0:0.0	.	366	Q9Y2U9	KLDC2_HUMAN	W	366	ENSP00000298307:R366W	ENSP00000298307:R366W	R	+	1	2	2	KLHDC2	49319061	49319061	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	0.984000	0.29565	0.629000	0.30376	0.655000	0.94253	CGG	0.098921		TCGA-2J-AABR-01A-11D-A40W-08	0.308	KLHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276869.1	1	0	1		2	2	2	0		0	0	44		44	43	1	1.970000	-4.409441	1	0.090000		Missense_Mutation		8	8		143	140	0		1	1		0	0	44	0		0.988815	9.617955e-01	0	5	0	101	0	8	143
SLC27A2	11001	broad.mit.edu	37	15	50519366	50519366	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr15:50519366A>G	ENST00000267842.5	+	7	1680	c.1448A>G	c.(1447-1449)gAt>gGt	p.D483G	SLC27A2_ENST00000544960.1_Missense_Mutation_p.D248G|SLC27A2_ENST00000380902.4_Missense_Mutation_p.D430G	NM_003645.3	NP_003636.2	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid transporter), member 2	483					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|fatty acid beta-oxidation (GO:0006635)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)|very long-chain fatty acid catabolic process (GO:0042760)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of peroxisomal membrane (GO:0005779)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|phytanate-CoA ligase activity (GO:0050197)|pristanate-CoA ligase activity (GO:0070251)|receptor binding (GO:0005102)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		AGAGTTGGAGATACATTCCGG	0.408																																						ENST00000267842.5	1.000000	0.320000	1.000000	0.460000	0.670000	0.699133	0.670000	1.000000																										0				25						c.(1447-1449)gAt>gGt		solute carrier family 27 (fatty acid transporter), member 2							92.0	93.0	93.0					15																	50519366		2196	4295	6491	SO:0001583	missense	11001	13	121412	41				g.chr15:50519366A>G	D88308	CCDS10133.1, CCDS53943.1	15q21.2	2013-05-22			ENSG00000140284	ENSG00000140284		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10996	protein-coding gene	gene with protein product		603247		FACVL1		9730624	Standard	NM_003645		Approved	FATP2, hFACVL1, VLACS, VLCS, HsT17226, ACSVL1	uc001zxw.3	O14975	OTTHUMG00000131643	ENST00000267842.5:c.1448A>G	chr15.hg19:g.50519366A>G	ENSP00000267842:p.Asp483Gly	0					SLC27A2_ENST00000544960.1_Missense_Mutation_p.D248G|SLC27A2_ENST00000380902.4_Missense_Mutation_p.D430G	p.D483G	NM_003645.3	NP_003636.2	1	2	3	2.007232	O14975	S27A2_HUMAN		7	1680	+		all_lung(180;0.00177)	A8K2J7|Q53FY6|Q6PF09	Missense_Mutation	SNP	ENST00000267842.5	0	1	hg19	c.1448A>G	CCDS10133.1	0	.	.	.	.	.	.	.	.	.	.	A	26.0	4.694762	0.88830	.	.	ENSG00000140284	ENST00000380902;ENST00000267842;ENST00000544960	T;T;T	0.59502	0.26;0.26;0.26	5.78	5.78	0.91487	5.78	5.78	0.91487	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	D	0.84620	0.5512	H	0.98111	4.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90026	0.4131	10	0.87932	D	0	.	14.0725	0.64868	1.0:0.0:0.0:0.0	.	430;483	Q6PF09;O14975	.;S27A2_HUMAN	G	430;483;248	ENSP00000370289:D430G;ENSP00000267842:D483G;ENSP00000444549:D248G	ENSP00000267842:D483G	D	+	2	0	0	SLC27A2	48306658	48306658	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.027000	0.93706	2.205000	0.71048	0.533000	0.62120	GAT	0.097312		TCGA-2J-AABR-01A-11D-A40W-08	0.408	SLC27A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254539.2	0	0	1		2	2	2	0		0	0	72		72	72	1	1.970000	-3.081625	1	0.090000	NM_003645			9	9		320	320	0		1	0		0	0	72	0		0.994384	3.047758e-02	0	0	0	9	0	9	320
SRRM2	23524	broad.mit.edu	37	16	2814969	2814969	+	Missense_Mutation	SNP	T	T	G			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr16:2814969T>G	ENST00000301740.8	+	11	4989	c.4440T>G	c.(4438-4440)tgT>tgG	p.C1480W		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1480	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						GAAGCGAATGTGATTCTTCCC	0.532																																						ENST00000301740.8	1.000000	0.360000	1.000000	0.480000	0.630000	0.689005	0.630000	0.570000																										0				105						c.(4438-4440)tgT>tgG		serine/arginine repetitive matrix 2							101.0	103.0	102.0					16																	2814969		2198	4300	6498	SO:0001583	missense	23524	0	0					g.chr16:2814969T>G	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.4440T>G	chr16.hg19:g.2814969T>G	ENSP00000301740:p.Cys1480Trp	0						p.C1480W	NM_016333.3	NP_057417.3	1	2	3	2.035123	Q9UQ35	SRRM2_HUMAN		11	4989	+			A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	1	1	hg19	c.4440T>G	CCDS32373.1	0	.	.	.	.	.	.	.	.	.	.	T	8.461	0.855301	0.17106	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.26660	1.72	6.06	2.44	0.29823	6.06	2.44	0.29823	.	0.089407	0.49916	D	0.000133	T	0.23688	0.0573	L	0.29908	0.895	0.46774	D	0.999198	D	0.63880	0.993	P	0.53006	0.715	T	0.02991	-1.1085	10	0.62326	D	0.03	-5.977	4.8712	0.13633	0.1664:0.167:0.0:0.6666	.	1480	Q9UQ35	SRRM2_HUMAN	W	1480;1480;732	ENSP00000301740:C1480W	ENSP00000301740:C1480W	C	+	3	2	2	SRRM2	2754970	2754970	0.997000	0.39634	1.000000	0.80357	0.925000	0.55904	0.114000	0.15520	0.530000	0.28619	0.533000	0.62120	TGT	0.103316		TCGA-2J-AABR-01A-11D-A40W-08	0.532	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1	0	0	1		2	2	2	0		0	0	127		127	121	1	1.970000	-13.990710	1	0.090000				17	17		643	640	0		1	1		0	0	127	0		0.999963	9.150515e-01	0	11	0	152	0	17	643
FAM86A	196483	broad.mit.edu	37	16	5140142	5140142	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr16:5140142C>T	ENST00000427587.4	-	6	753	c.685G>A	c.(685-687)Gac>Aac	p.D229N	FAM86A_ENST00000458008.4_Missense_Mutation_p.D195N|FAM86A_ENST00000587133.1_Missense_Mutation_p.D168N	NM_201400.2	NP_958802.1	Q96G04	FA86A_HUMAN	family with sequence similarity 86, member A	229						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	12						GTCGCGACGTCCCAGTCCAGC	0.602																																						ENST00000427587.4	1.000000	0.230000	1.000000	0.370000	0.590000	0.646253	0.590000	1.000000																										0				12						c.(685-687)Gac>Aac		family with sequence similarity 86, member A							48.0	53.0	51.0					16																	5140142		1425	2491	3916	SO:0001583	missense	196483	0	0					g.chr16:5140142C>T	BC010084	CCDS10529.1, CCDS10530.1, CCDS73823.1	16p13.3	2012-11-07			ENSG00000118894	ENSG00000118894			32221	protein-coding gene	gene with protein product		615263					Standard	NM_201400		Approved	SB153, MGC19636	uc002cyo.2	Q96G04	OTTHUMG00000129527	ENST00000427587.4:c.685G>A	chr16.hg19:g.5140142C>T	ENSP00000398502:p.Asp229Asn	0					FAM86A_ENST00000458008.4_Missense_Mutation_p.D195N|FAM86A_ENST00000587133.1_Missense_Mutation_p.D168N	p.D229N	NM_201400.2	NP_958802.1	1	2	3	2.035123	Q96G04	FA86A_HUMAN		6	753	-			D3DUF0|Q96S85	Missense_Mutation	SNP	ENST00000427587.4	0	1	hg19	c.685G>A	CCDS10529.1	0	.	.	.	.	.	.	.	.	.	.	c	15.70	2.911632	0.52439	.	.	ENSG00000118894	ENST00000458008;ENST00000427587	T;T	0.06687	3.27;3.27	5.02	5.02	0.67125	5.02	5.02	0.67125	.	0.452097	0.23549	N	0.046998	T	0.12220	0.0297	L	0.50333	1.59	0.49389	D	0.999781	P;B	0.36392	0.551;0.34	B;B	0.40982	0.345;0.14	T	0.15435	-1.0437	10	0.17832	T	0.49	.	17.1053	0.86660	0.0:1.0:0.0:0.0	.	195;229	Q96G04-2;Q96G04	.;FA86A_HUMAN	N	195;229	ENSP00000389710:D195N;ENSP00000398502:D229N	ENSP00000398502:D229N	D	-	1	0	0	FAM86A	5080143	5080143	1.000000	0.71417	0.997000	0.53966	0.066000	0.16364	3.106000	0.50322	2.620000	0.88729	0.450000	0.29827	GAC	0.103316		TCGA-2J-AABR-01A-11D-A40W-08	0.602	FAM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251713.1	0	0	0		13	3	2	1		1	1	71		71	71	1	1.970000	-7.145509	1	0.090000	NM_201400			6	0		268	246	0		0	0		1	0	71	0		0.048814	3.081356e-02	0	0	0	25	0	6	268
MMP2	4313	broad.mit.edu	37	16	55519538	55519538	+	Silent	SNP	C	C	T	rs558609366	byFrequency	TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr16:55519538C>T	ENST00000219070.4	+	5	1190	c.681C>T	c.(679-681)aaC>aaT	p.N227N	MMP2_ENST00000570308.1_Silent_p.N151N|MMP2_ENST00000437642.2_Silent_p.N177N|MMP2_ENST00000543485.1_Silent_p.N151N	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	227	Collagen-binding.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	AGTATGGGAACGCCGATGGGG	0.542													C|||	2	0.000399361	0.0008	0.0	5008	,	,		20495	0.0		0.001	False		,,,				2504	0.0					ENST00000219070.4	1.000000	0.490000	1.000000	0.620000	0.800000	0.810259	0.800000	1.000000																										0				58						c.(679-681)aaC>aaT		matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	Captopril(DB01197)|Marimastat(DB00786)						130.0	110.0	117.0					16																	55519538		2198	4300	6498	SO:0001819	synonymous_variant	4313	5	121412	40				g.chr16:55519538C>T		CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.681C>T	chr16.hg19:g.55519538C>T		0					MMP2_ENST00000543485.1_Silent_p.N151N|MMP2_ENST00000437642.2_Silent_p.N177N|MMP2_ENST00000570308.1_Silent_p.N151N	p.N227N	NM_004530.4	NP_004521.1	1	2	3	2.015526	P08253	MMP2_HUMAN		5	1190	+		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)	B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Silent	SNP	ENST00000219070.4	1	1	hg19	c.681C>T	CCDS10752.1	0																																																																																								0.099322		TCGA-2J-AABR-01A-11D-A40W-08	0.542	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256913.3	0	0	1		16	14	2	1		1	1	131		131	127	1	1.970000	-3.744623	1	0.090000				20	20		572	563	0		1	0		1	0	131	0		0.786320	7.571674e-01	0	0	0	497	0	20	572
MMP15	4324	broad.mit.edu	37	16	58074496	58074496	+	Silent	SNP	G	G	A			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr16:58074496G>A	ENST00000219271.3	+	5	1589	c.804G>A	c.(802-804)gaG>gaA	p.E268E		NM_002428.2	NP_002419.1	P51511	MMP15_HUMAN	matrix metallopeptidase 15 (membrane-inserted)	268					cellular protein modification process (GO:0006464)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)|response to estradiol (GO:0032355)	extracellular matrix (GO:0031012)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	18					Marimastat(DB00786)	TGGGGCTGGAGCACTCCAGCA	0.607																																						ENST00000219271.3	1.000000	0.310000	1.000000	0.460000	0.680000	0.708195	0.680000	1.000000																										0				18						c.(802-804)gaG>gaA		matrix metallopeptidase 15 (membrane-inserted)	Marimastat(DB00786)						94.0	77.0	83.0					16																	58074496		2198	4300	6498	SO:0001819	synonymous_variant	4324	0	0					g.chr16:58074496G>A	Z48482	CCDS10792.1	16q13	2008-05-14	2005-08-08		ENSG00000102996	ENSG00000102996			7161	protein-coding gene	gene with protein product		602261	"""matrix metalloproteinase 15 (membrane-inserted)"""			9070935, 9119382	Standard	NM_002428		Approved	MT2-MMP, MTMMP2, SMCP-2	uc002ena.3	P51511	OTTHUMG00000133466	ENST00000219271.3:c.804G>A	chr16.hg19:g.58074496G>A		0						p.E268E	NM_002428.2	NP_002419.1	1	2	3	2.009490	P51511	MMP15_HUMAN		5	1589	+			A0A2U6|Q14111	Silent	SNP	ENST00000219271.3	1	1	hg19	c.804G>A	CCDS10792.1	0																																																																																								0.097715		TCGA-2J-AABR-01A-11D-A40W-08	0.607	MMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257342.1	0	0	1		2	2	2	0		0	0	57		57	55	1	1.970000	-8.815554	1	0.090000	NM_002428			8	9		282	278	1		1	1		0	0	57	0		0.989183	7.320762e-01	0	13	0	78	0	8	282
TP53	7157	broad.mit.edu	37	17	7578508	7578508	+	Missense_Mutation	SNP	C	C	T	rs587781288		TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr17:7578508C>T	ENST00000269305.4	-	5	611	c.422G>A	c.(421-423)tGc>tAc	p.C141Y	TP53_ENST00000413465.2_Missense_Mutation_p.C141Y|TP53_ENST00000359597.4_Missense_Mutation_p.C141Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.C141Y|TP53_ENST00000455263.2_Missense_Mutation_p.C141Y|TP53_ENST00000445888.2_Missense_Mutation_p.C141Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	141	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> A (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C141Y(79)|p.0?(8)|p.C9Y(5)|p.C48Y(5)|p.A138_P142delAKTCP(4)|p.C141F(4)|p.C141S(3)|p.N131fs*27(2)|p.C9S(1)|p.K139_C141>N(1)|p.L137_W146del10(1)|p.C141A(1)|p.A6_P10delAKTCP(1)|p.K139fs*4(1)|p.A45_P49delAKTCP(1)|p.T140fs*28(1)|p.A138_V143delAKTCPV(1)|p.C48S(1)|p.C141fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGCACAGGGCAGGTCTTGGC	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.400000	1.000000	0.600000	0.840000	0.816712	0.840000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		121	Substitution - Missense(99)|Whole gene deletion(8)|Deletion - In frame(8)|Deletion - Frameshift(5)|Complex - deletion inframe(1)	p.C141Y(79)|p.0?(8)|p.C9Y(5)|p.C48Y(5)|p.A138_P142delAKTCP(4)|p.C141F(4)|p.C141S(3)|p.N131fs*27(2)|p.C9S(1)|p.K139_C141>N(1)|p.L137_W146del10(1)|p.C141A(1)|p.A6_P10delAKTCP(1)|p.K139fs*4(1)|p.A45_P49delAKTCP(1)|p.T140fs*28(1)|p.A138_V143delAKTCPV(1)|p.C48S(1)|p.C141fs*5(1)	large_intestine(23)|breast(17)|ovary(12)|haematopoietic_and_lymphoid_tissue(7)|oesophagus(7)|liver(7)|upper_aerodigestive_tract(6)|central_nervous_system(6)|endometrium(6)|urinary_tract(6)|lung(5)|prostate(5)|bone(5)|stomach(4)|soft_tissue(2)|biliary_tract(1)|testis(1)|pancreas(1)	24185	GRCh37	CM993216	TP53	M		c.(421-423)tGc>tAc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						56.0	55.0	55.0					17																	7578508		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7578508C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.422G>A	chr17.hg19:g.7578508C>T	ENSP00000269305:p.Cys141Tyr	0	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.C141Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.C141Y|TP53_ENST00000420246.2_Missense_Mutation_p.C141Y|TP53_ENST00000359597.4_Missense_Mutation_p.C141Y|TP53_ENST00000413465.2_Missense_Mutation_p.C141Y	p.C141Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	0	0	1.979295	P04637	P53_HUMAN		5	611	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.422G>A	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720132	0.48728	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99822	-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94	5.48	4.5	0.54988	5.48	4.5	0.54988	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.046412	0.85682	D	0.000000	D	0.99832	0.9924	M	0.90309	3.105	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.987;1.0;0.999;1.0;1.0	D	0.96735	0.9542	10	0.87932	D	0	-26.1094	13.743	0.62860	0.1552:0.8448:0.0:0.0	.	102;141;141;48;141;141;141	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	141;141;141;141;141;141;130;48;9;48;9;141	ENSP00000410739:C141Y;ENSP00000352610:C141Y;ENSP00000269305:C141Y;ENSP00000398846:C141Y;ENSP00000391127:C141Y;ENSP00000391478:C141Y;ENSP00000425104:C9Y;ENSP00000423862:C48Y;ENSP00000424104:C141Y	ENSP00000269305:C141Y	C	-	2	0	0	TP53	7519233	7519233	1.000000	0.71417	0.996000	0.52242	0.022000	0.10575	6.016000	0.70798	1.427000	0.47276	-0.182000	0.12963	TGC	0.072470		TCGA-2J-AABR-01A-11D-A40W-08	0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	9	0		0	0	56		56	53	1	1.970000	-3.302200	1	0.090000	NM_000546			8	8		197	196	1		1	1	1	0	3	56	2018		0.989584	7.237210e-01	9.999863e-01	7	55	56	1722	8	197
TUBG2	27175	broad.mit.edu	37	17	40817827	40817827	+	Silent	SNP	G	G	A	rs375295846		TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr17:40817827G>A	ENST00000251412.7	+	8	1024	c.825G>A	c.(823-825)ccG>ccA	p.P275P	PLEKHH3_ENST00000456950.2_5'Flank	NM_016437.2	NP_057521.1	Q9NRH3	TBG2_HUMAN	tubulin, gamma 2	275					cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|gamma-tubulin complex (GO:0000930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|pericentriolar material (GO:0000242)|spindle microtubule (GO:0005876)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.141)		GCTACACCCCGCTCACTACAG	0.637																																						ENST00000251412.7	1.000000	0.720000	1.000000	0.880000	0.990000	0.958496	0.990000	1.000000																										0				15						c.(823-825)ccG>ccA		tubulin, gamma 2		G		1,4405	2.1+/-5.4	0,1,2202	145.0	131.0	136.0		825	1.4	1.0	17		136	0,8600		0,0,4300	no	coding-synonymous	TUBG2	NM_016437.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		275/452	40817827	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	27175	1	121412	40				g.chr17:40817827G>A	AF225971	CCDS32658.1	17q21.2	2014-09-04			ENSG00000037042	ENSG00000037042		"""Tubulins"""	12419	protein-coding gene	gene with protein product		605785					Standard	NM_016437		Approved		uc010wgr.2	Q9NRH3	OTTHUMG00000180640	ENST00000251412.7:c.825G>A	chr17.hg19:g.40817827G>A		0					PLEKHH3_ENST00000456950.2_5'Flank	p.P275P	NM_016437.2	NP_057521.1	1	2	3	2.005968	Q9NRH3	TBG2_HUMAN		8	1024	+		Breast(137;0.00116)	A6NDI4|Q32NB2	Silent	SNP	ENST00000251412.7	1	1	hg19	c.825G>A	CCDS32658.1	1																																																																																								0.096909		TCGA-2J-AABR-01A-11D-A40W-08	0.637	TUBG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452326.1	1	0	1		2	2	2	0		0	0	96		96	88	1	1.970000	-3.049135	1	0.090000	NM_016437			29	29		594	578	0		1	1		0	0	96	0		1.000000	4.543521e-01	0	2	0	30	0	29	594
PSG11	5680	broad.mit.edu	37	19	43528993	43528993	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr19:43528993C>T	ENST00000401740.1	-	2	383	c.280G>A	c.(280-282)Gca>Aca	p.A94T	PSG11_ENST00000320078.7_Missense_Mutation_p.A94T|PSG11_ENST00000306322.7_Intron|PSG11_ENST00000403486.1_Intron			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	94	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				CCACTGTATGCCGGTCCATAT	0.443																																						ENST00000401740.1	1.000000	0.070000	0.340000	0.110000	0.170000	0.298524	0.170000	0.160000																										0				26						c.(280-282)Gca>Aca		pregnancy specific beta-1-glycoprotein 11							247.0	230.0	236.0					19																	43528993		2199	4298	6497	SO:0001583	missense	5680	0	0					g.chr19:43528993C>T	U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.280G>A	chr19.hg19:g.43528993C>T	ENSP00000384995:p.Ala94Thr	0					PSG11_ENST00000320078.7_Missense_Mutation_p.A94T|PSG11_ENST00000403486.1_Intron|PSG11_ENST00000306322.7_Intron	p.A94T			1	2	3	2.011089	Q00887	PSG9_HUMAN		2	383	-		Prostate(69;0.00682)	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000401740.1	0	1	hg19	c.280G>A	CCDS12614.2	0	.	.	.	.	.	.	.	.	.	.	c	9.498	1.102465	0.20632	.	.	ENSG00000243130	ENST00000320078;ENST00000401740	T;T	0.66280	-0.2;-0.2	0.929	-1.86	0.07760	0.929	-1.86	0.07760	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.64023	0.2561	M	0.80746	2.51	0.09310	N	1	B	0.25563	0.129	B	0.39904	0.313	T	0.63812	-0.6552	9	0.62326	D	0.03	.	2.5413	0.04726	0.0:0.4411:0.3119:0.247	.	94	Q9UQ72	PSG11_HUMAN	T	94	ENSP00000319140:A94T;ENSP00000384995:A94T	ENSP00000319140:A94T	A	-	1	0	0	PSG11	48220833	48220833	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.352000	0.07701	-0.979000	0.03529	-1.140000	0.01884	GCA	0.098117		TCGA-2J-AABR-01A-11D-A40W-08	0.443	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323079.1	0	0	1		2	2	2	0		0	0	234		234	233	1	1.970000	-1.522631	0	0.090000	NM_002785			8	8		1146	1131	0		1			0	0	234	0		0.988769	0	0	0	0	0	0	8	1146
NLRP9	338321	broad.mit.edu	37	19	56244158	56244158	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr19:56244158C>T	ENST00000332836.2	-	2	1066	c.1039G>A	c.(1039-1041)Gtg>Atg	p.V347M		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	347	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CTCTGTTTCACACAAGTACAG	0.418																																						ENST00000332836.2	1.000000	0.450000	1.000000	0.580000	0.760000	0.776638	0.760000	1.000000																										0				74						c.(1039-1041)Gtg>Atg		NLR family, pyrin domain containing 9							108.0	104.0	105.0					19																	56244158		2203	4300	6503	SO:0001583	missense	338321	0	0					g.chr19:56244158C>T	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1039G>A	chr19.hg19:g.56244158C>T	ENSP00000331857:p.Val347Met	0						p.V347M	NM_176820.2	NP_789790.2	1	2	3	2.023719	Q7RTR0	NALP9_HUMAN		2	1066	-		Colorectal(82;0.000133)|Ovarian(87;0.133)	B2RN12|Q86W27	Missense_Mutation	SNP	ENST00000332836.2	1	1	hg19	c.1039G>A	CCDS12934.1	0	.	.	.	.	.	.	.	.	.	.	C	0.863	-0.734758	0.03111	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	D	0.84298	-1.83	2.56	-5.13	0.02884	2.56	-5.13	0.02884	.	.	.	.	.	T	0.57504	0.2058	N	0.01493	-0.835	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.46512	-0.9186	9	0.59425	D	0.04	.	2.9394	0.05825	0.192:0.1001:0.4605:0.2475	.	347	Q7RTR0	NALP9_HUMAN	M	347	ENSP00000331857:V347M	ENSP00000331857:V347M	V	-	1	0	0	NLRP9	60935970	60935970	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.639000	0.00865	-2.030000	0.00929	-0.313000	0.08912	GTG	0.100924		TCGA-2J-AABR-01A-11D-A40W-08	0.418	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	0	0	1		2	2	2	0		0	0	121		121	118	1	1.970000	-3.660984	1	0.090000	NM_176820			20	20		617	607	0		1			0	0	121	0		0.999994	0	0	0	0	0	0	20	617
NLRP5	126206	broad.mit.edu	37	19	56539375	56539375	+	Silent	SNP	C	C	T			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr19:56539375C>T	ENST00000390649.3	+	7	1776	c.1776C>T	c.(1774-1776)gcC>gcT	p.A592A		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	592	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		ACTTCTGTGCCGCCTTGTACT	0.532																																						ENST00000390649.3	1.000000	0.340000	1.000000	0.570000	0.930000	0.828862	0.930000	1.000000																										0				25						c.(1774-1776)gcC>gcT		NLR family, pyrin domain containing 5							64.0	64.0	64.0					19																	56539375		2025	4189	6214	SO:0001819	synonymous_variant	126206	5	120936	34				g.chr19:56539375C>T	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1776C>T	chr19.hg19:g.56539375C>T		0						p.A592A	NM_153447.4	NP_703148.4	1	2	3	2.023719	P59047	NALP5_HUMAN		7	1776	+		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)	A8MTY4|Q86W29	Silent	SNP	ENST00000390649.3	0	1	hg19	c.1776C>T	CCDS12938.1	1																																																																																								0.100924		TCGA-2J-AABR-01A-11D-A40W-08	0.532	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	0	0	1		2	2	2	0		0	0	42		42	39	1	1.970000	-3.273354	1	0.090000	NM_153447			5	5		137	136	0		1			0	0	42	0		0.937517	0	0	0	0	0	0	5	137
TPR	7175	broad.mit.edu	37	1	186328936	186328936	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr1:186328936T>C	ENST00000367478.4	-	12	1680	c.1384A>G	c.(1384-1386)Atg>Gtg	p.M462V	TPR_ENST00000474852.1_5'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	462	Necessary for association to the NPC.				carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CCAACCTTCATAGCTTGTTCA	0.368			T	NTRK1	papillary thyroid																																	ENST00000367478.4	1.000000	0.680000	1.000000	0.890000	0.990000	0.961146	0.990000	1.000000				Dom	yes			Dom	yes		1	1q25	1q25	7175	T	translocated promoter region				E	E	NTRK1		papillary thyroid		0				123						c.(1384-1386)Atg>Gtg		translocated promoter region, nuclear basket protein							122.0	106.0	111.0					1																	186328936		1841	4091	5932	SO:0001583	missense	7175	6	120804	35				g.chr1:186328936T>C	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.1384A>G	chr1.hg19:g.186328936T>C	ENSP00000356448:p.Met462Val	0					TPR_ENST00000474852.1_5'UTR	p.M462V	NM_003292.2	NP_003283.2	0	1	1	1.993890	P12270	TPR_HUMAN		12	1680	-		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	1	1	hg19	c.1384A>G	CCDS41446.1	1	.	.	.	.	.	.	.	.	.	.	T	10.51	1.369874	0.24771	.	.	ENSG00000047410	ENST00000367478	T	0.00940	5.52	5.76	5.76	0.90799	5.76	5.76	0.90799	.	0.176337	0.64402	D	0.000009	T	0.00906	0.0030	N	0.16656	0.425	0.45690	D	0.998602	B;B	0.21753	0.06;0.025	B;B	0.22386	0.039;0.008	T	0.61515	-0.7047	10	0.08381	T	0.77	.	16.0697	0.80914	0.0:0.0:0.0:1.0	.	462;462	Q15624;P12270	.;TPR_HUMAN	V	462	ENSP00000356448:M462V	ENSP00000356448:M462V	M	-	1	0	0	TPR	184595559	184595559	0.998000	0.40836	0.993000	0.49108	0.996000	0.88848	2.901000	0.48695	2.194000	0.70268	0.528000	0.53228	ATG	0.081736		TCGA-2J-AABR-01A-11D-A40W-08	0.368	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	0	0	1		2	2	2	0		0	0	67		67	66	1	1.970000	-18.044060	1	0.090000	NM_003292			15	15		267	266	0		1	1		0	0	67	0		0.999880	4.469519e-01	0	2	0	25	0	15	267
HIVEP3	59269	broad.mit.edu	37	1	42046110	42046110	+	Silent	SNP	C	C	T			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr1:42046110C>T	ENST00000372583.1	-	4	5244	c.4359G>A	c.(4357-4359)gaG>gaA	p.E1453E	HIVEP3_ENST00000372584.1_Silent_p.E1453E|HIVEP3_ENST00000460604.1_5'Flank|HIVEP3_ENST00000247584.5_Silent_p.E1453E|HIVEP3_ENST00000429157.2_Silent_p.E1453E	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1453					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				TGGAAGCCTCCTCCTCCTTCA	0.512																																						ENST00000372583.1	0.880000	0.370000	0.740000	0.470000	0.590000	0.613537	0.590000	0.590000																										0				85						c.(4357-4359)gaG>gaA		human immunodeficiency virus type I enhancer binding protein 3							110.0	111.0	110.0					1																	42046110		2203	4300	6503	SO:0001819	synonymous_variant	59269	0	0					g.chr1:42046110C>T	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.4359G>A	chr1.hg19:g.42046110C>T		0					HIVEP3_ENST00000372584.1_Silent_p.E1453E|HIVEP3_ENST00000429157.2_Silent_p.E1453E|HIVEP3_ENST00000247584.5_Silent_p.E1453E|HIVEP3_ENST00000460604.1_5'Flank	p.E1453E	NM_024503.4	NP_078779.2	0	1	1	1.993890	Q5T1R4	ZEP3_HUMAN		4	5244	-	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	1	1	hg19	c.4359G>A	CCDS463.1	0																																																																																								0.081736		TCGA-2J-AABR-01A-11D-A40W-08	0.512	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	0	0	1		2	2	2	0		0	0	167		167	161	1	1.970000	-2.865752	1	0.090000	NM_024503			19	19		685	678	0		1	0		0	0	167	0		0.999989	0	0	0	0	1	0	19	685
ZSWIM5	57643	broad.mit.edu	37	1	45484833	45484833	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr1:45484833G>A	ENST00000359600.5	-	14	3056	c.2851C>T	c.(2851-2853)Cgc>Tgc	p.R951C		NM_020883.1	NP_065934.1	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM-type containing 5	951						extracellular space (GO:0005615)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|liver(1)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					GCCAGTGTGCGAGCACAGCTA	0.542											OREG0013450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000359600.5	0.920000	0.150000	0.670000	0.260000	0.440000	0.474505	0.440000	0.390000																										0				28						c.(2851-2853)Cgc>Tgc		zinc finger, SWIM-type containing 5							55.0	56.0	56.0					1																	45484833		2036	4192	6228	SO:0001583	missense	57643	2	120956	33				g.chr1:45484833G>A	AB040944	CCDS41319.1	1p34.1	2010-06-16			ENSG00000162415	ENSG00000162415		"""Zinc fingers, SWIM-type"""	29299	protein-coding gene	gene with protein product						10819331	Standard	NM_020883		Approved	KIAA1511	uc001cnd.2	Q9P217	OTTHUMG00000008950	ENST00000359600.5:c.2851C>T	chr1.hg19:g.45484833G>A	ENSP00000352614:p.Arg951Cys	0		OREG0013450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	932		p.R951C	NM_020883.1	NP_065934.1	0	1	1	1.993890	Q9P217	ZSWM5_HUMAN		14	3056	-	Acute lymphoblastic leukemia(166;0.155)		Q5SXQ9	Missense_Mutation	SNP	ENST00000359600.5	0	1	hg19	c.2851C>T	CCDS41319.1	0	.	.	.	.	.	.	.	.	.	.	G	15.57	2.871440	0.51695	.	.	ENSG00000162415	ENST00000359600	T	0.52295	0.67	4.74	4.74	0.60224	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.66096	0.2755	M	0.69823	2.125	0.80722	D	1	D	0.76494	0.999	P	0.61275	0.886	T	0.68693	-0.5341	10	0.52906	T	0.07	-7.752	18.6023	0.91253	0.0:0.0:1.0:0.0	.	951	Q9P217	ZSWM5_HUMAN	C	951	ENSP00000352614:R951C	ENSP00000352614:R951C	R	-	1	0	0	ZSWIM5	45257420	45257420	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	4.475000	0.60210	2.558000	0.86282	0.555000	0.69702	CGC	0.081736		TCGA-2J-AABR-01A-11D-A40W-08	0.542	ZSWIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024823.2	0	0	1		2	2	2	0		0	0	35		35	35	1	1.970000	-3.250930	1	0.090000	XM_046581			4	4		213	208	0		1	0		0	0	35	0		0.885619	1.828550e-03	0	0	0	3	0	4	213
AKR1A1	10327	broad.mit.edu	37	1	46032622	46032622	+	Missense_Mutation	SNP	C	C	T	rs201384732		TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr1:46032622C>T	ENST00000372070.3	+	5	1033	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W	AKR1A1_ENST00000351829.4_Missense_Mutation_p.R96W|AKR1A1_ENST00000471651.1_Missense_Mutation_p.R96W	NM_001202413.1|NM_001202414.1|NM_006066.3	NP_001189342.1|NP_001189343.1|NP_006057.1	P14550	AK1A1_HUMAN	aldo-keto reductase family 1, member A1 (aldehyde reductase)	96					aldehyde catabolic process (GO:0046185)|cellular aldehyde metabolic process (GO:0006081)|D-glucuronate catabolic process (GO:0042840)|glucose metabolic process (GO:0006006)|L-ascorbic acid biosynthetic process (GO:0019853)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|L-glucuronate reductase activity (GO:0047939)			lung(3)|prostate(1)|urinary_tract(1)	5	Acute lymphoblastic leukemia(166;0.155)				Doxorubicin(DB00997)	GCCTGCCCTCCGGAAGACTCT	0.607													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21815	0.0		0.0	False		,,,				2504	0.0					ENST00000372070.3	1.000000	0.560000	1.000000	0.760000	0.990000	0.912728	0.990000	1.000000																										0				5						c.(286-288)Cgg>Tgg		aldo-keto reductase family 1, member A1 (aldehyde reductase)	Doxorubicin(DB00997)						100.0	85.0	90.0					1																	46032622		2203	4300	6503	SO:0001583	missense	10327	4	121412	36				g.chr1:46032622C>T	J04794	CCDS523.1	1p33-p32	2010-04-08			ENSG00000117448	ENSG00000117448	1.1.1.2	"""Aldo-keto reductases"""	380	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 3"""	103830				2498333, 10393438	Standard	NM_001202414		Approved	ALR, DD3	uc001coe.3	P14550	OTTHUMG00000007740	ENST00000372070.3:c.286C>T	chr1.hg19:g.46032622C>T	ENSP00000361140:p.Arg96Trp	0					AKR1A1_ENST00000471651.1_Missense_Mutation_p.R96W|AKR1A1_ENST00000351829.4_Missense_Mutation_p.R96W	p.R96W	NM_001202413.1|NM_001202414.1|NM_006066.3	NP_001189342.1|NP_001189343.1|NP_006057.1	0	1	1	1.993890	P14550	AK1A1_HUMAN		5	1033	+	Acute lymphoblastic leukemia(166;0.155)		A8KAL8|D3DQ04|Q6IAZ4	Missense_Mutation	SNP	ENST00000372070.3	1	1	hg19	c.286C>T	CCDS523.1	1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	14.21	2.468661	0.43839	.	.	ENSG00000117448	ENST00000372070;ENST00000434299;ENST00000351829	T;T;T	0.31510	1.49;1.49;1.49	6.01	2.85	0.33270	6.01	2.85	0.33270	NADP-dependent oxidoreductase domain (3);	0.201358	0.43260	D	0.000588	T	0.44477	0.1295	L	0.56769	1.78	0.45272	D	0.998272	D	0.76494	0.999	D	0.64877	0.93	T	0.36383	-0.9750	10	0.87932	D	0	.	7.8215	0.29290	0.528:0.3896:0.0:0.0824	.	96	P14550	AK1A1_HUMAN	W	96	ENSP00000361140:R96W;ENSP00000398414:R96W;ENSP00000312606:R96W	ENSP00000312606:R96W	R	+	1	2	2	AKR1A1	45805209	45805209	0.997000	0.39634	0.988000	0.46212	0.032000	0.12392	3.428000	0.52792	0.863000	0.35553	-0.151000	0.13558	CGG	0.081736		TCGA-2J-AABR-01A-11D-A40W-08	0.607	AKR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020851.1	1	0	1		2	2	2	0		0	0	45		45	44	1	1.970000	-2.713547	1	0.090000	NM_006066			12	12		247	240	0		1	1		0	0	45	0		0.999006	9.995491e-01	0	26	0	260	0	12	247
NLRP3	114548	broad.mit.edu	37	1	247597507	247597507	+	Silent	SNP	C	C	T	rs147154764		TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr1:247597507C>T	ENST00000336119.3	+	5	3176	c.2430C>T	c.(2428-2430)ctC>ctT	p.L810L	NLRP3_ENST00000366497.2_Silent_p.L810L|NLRP3_ENST00000391827.2_Silent_p.L753L|NLRP3_ENST00000366496.2_Silent_p.L810L|NLRP3_ENST00000348069.2_Silent_p.L753L|NLRP3_ENST00000391828.3_Silent_p.L810L	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	810					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			ACAACGCCCTCGGTGACTTCG	0.567																																						ENST00000336119.3	0.600000	0.130000	0.460000	0.210000	0.310000	0.339876	0.310000	0.290000																										0				142						c.(2428-2430)ctC>ctT		NLR family, pyrin domain containing 3		C	,,,,	0,4406		0,0,2203	140.0	125.0	130.0		2430,2430,2259,2430,2259	1.5	0.8	1	dbSNP_134	130	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NLRP3	NM_001079821.2,NM_001127461.2,NM_001127462.2,NM_004895.4,NM_183395.2	,,,,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,,,,	810/1037,810/980,753/980,810/1037,753/923	247597507	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	114548	10	121412	46				g.chr1:247597507C>T	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2430C>T	chr1.hg19:g.247597507C>T		0					NLRP3_ENST00000391827.2_Silent_p.L753L|NLRP3_ENST00000348069.2_Silent_p.L753L|NLRP3_ENST00000391828.3_Silent_p.L810L|NLRP3_ENST00000366496.2_Silent_p.L810L|NLRP3_ENST00000366497.2_Silent_p.L810L	p.L810L	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	0	1	1	1.993890	Q96P20	NALP3_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0141)	5	3176	+	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Silent	SNP	ENST00000336119.3	0	1	hg19	c.2430C>T	CCDS1632.1	0																																																																																								0.081736		TCGA-2J-AABR-01A-11D-A40W-08	0.567	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	0	0	1		2	2	2	0		0	0	81		81	79	1	1.970000	-2.560650	1	0.090000	NM_004895			6	6		434	428	0		1	0		0	0	81	0		0.963701	2.848522e-02	0	0	0	16	0	6	434
CHD6	84181	broad.mit.edu	37	20	40052243	40052243	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr20:40052243G>A	ENST00000373233.3	-	30	4621	c.4444C>T	c.(4444-4446)Cgc>Tgc	p.R1482C		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1482	Myb-like.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GAAATGATGCGGAACTGTGTC	0.443																																						ENST00000373233.3	1.000000	0.060000	0.360000	0.110000	0.180000	0.301090	0.180000	0.160000																										0				129						c.(4444-4446)Cgc>Tgc		chromodomain helicase DNA binding protein 6							163.0	170.0	168.0					20																	40052243		2203	4300	6503	SO:0001583	missense	84181	0	0					g.chr20:40052243G>A	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.4444C>T	chr20.hg19:g.40052243G>A	ENSP00000362330:p.Arg1482Cys	0						p.R1482C	NM_032221.3	NP_115597.3	1	2	3	2.009716	Q8TD26	CHD6_HUMAN		30	4621	-		Myeloproliferative disorder(115;0.00425)	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	0	1	hg19	c.4444C>T	CCDS13317.1	0	.	.	.	.	.	.	.	.	.	.	G	28.5	4.928613	0.92389	.	.	ENSG00000124177	ENST00000373233	D	0.94793	-3.52	6.07	6.07	0.98685	6.07	6.07	0.98685	SANT domain, DNA binding (1);	0.000000	0.64402	D	0.000007	D	0.97876	0.9302	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97909	1.0307	10	0.87932	D	0	-12.954	20.6439	0.99570	0.0:0.0:1.0:0.0	.	1482	Q8TD26	CHD6_HUMAN	C	1482	ENSP00000362330:R1482C	ENSP00000362330:R1482C	R	-	1	0	0	CHD6	39485657	39485657	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.405000	0.73272	2.884000	0.98904	0.655000	0.94253	CGC	0.097715		TCGA-2J-AABR-01A-11D-A40W-08	0.443	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1	0	0	1		17	2	2	1		1	1	173		173	170	1	1.970000	-1.734834	0	0.090000				6	6		844	835	0		0	0		1	0	173	0		0.015487	4.731315e-03	0	0	0	12	0	6	844
PREX1	57580	broad.mit.edu	37	20	47309283	47309283	+	Silent	SNP	G	G	A	rs542577892		TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr20:47309283G>A	ENST00000371941.3	-	8	985	c.963C>T	c.(961-963)aaC>aaT	p.N321N	PREX1_ENST00000396220.1_Silent_p.N321N	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	321	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			AGAGGGAGCCGTTGATGGATT	0.552													G|||	1	0.000199681	0.0	0.0	5008	,	,		18094	0.0		0.0	False		,,,				2504	0.001					ENST00000371941.3	1.000000	0.320000	1.000000	0.450000	0.620000	0.665409	0.620000	1.000000																										0				110						c.(961-963)aaC>aaT		phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1							276.0	219.0	238.0					20																	47309283		2203	4300	6503	SO:0001819	synonymous_variant	57580	28	121412	46				g.chr20:47309283G>A	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.963C>T	chr20.hg19:g.47309283G>A		0					PREX1_ENST00000396220.1_Silent_p.N321N	p.N321N	NM_020820.3	NP_065871	1	2	3	2.009716	Q8TCU6	PREX1_HUMAN	BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)	8	985	-			E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Silent	SNP	ENST00000371941.3	0	1	hg19	c.963C>T	CCDS13410.1	0																																																																																								0.097715		TCGA-2J-AABR-01A-11D-A40W-08	0.552	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	0	0	1		2	2	2	0		0	0	77		77	77	1	1.970000	-3.035764	1	0.090000	NM_020820			11	11		418	410	0		1	0		0	0	77	0		0.998199	1.368641e-01	0	0	0	23	0	11	418
FAM65C	140876	broad.mit.edu	37	20	49218732	49218732	+	Silent	SNP	C	C	A			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr20:49218732C>A	ENST00000327979.2	-	13	1935	c.1524G>T	c.(1522-1524)ggG>ggT	p.G508G	FAM65C_ENST00000535356.1_Silent_p.G512G|FAM65C_ENST00000045083.2_Silent_p.G508G			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	508										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CCACGCCAGGCCCGTCCTCTC	0.697																																						ENST00000327979.2	1.000000	0.270000	1.000000	0.460000	0.740000	0.735669	0.740000	1.000000																										0				29						c.(1522-1524)ggG>ggT		family with sequence similarity 65, member C							27.0	28.0	28.0					20																	49218732		2203	4300	6503	SO:0001819	synonymous_variant	140876	0	0					g.chr20:49218732C>A	AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.1524G>T	chr20.hg19:g.49218732C>A		0					FAM65C_ENST00000535356.1_Silent_p.G512G|FAM65C_ENST00000045083.2_Silent_p.G508G	p.G508G			1	2	3	2.009716	Q96MK2	FA65C_HUMAN		13	1935	-			Q5QPB6|Q9NQQ2	Silent	SNP	ENST00000327979.2	0	1	hg19	c.1524G>T	CCDS13431.2	0																																																																																								0.097715		TCGA-2J-AABR-01A-11D-A40W-08	0.697	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257962.1	0	0	1		2	2	2	0		0	0	34		34	31	1	1.970000	-7.333112	1	0.090000				5	5		169	164	0		1	0		0	0	34	0		0.933571	1.348228e-03	0	0	0	2	0	5	169
CRYBB1	1414	broad.mit.edu	37	22	27008105	27008105	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr22:27008105G>A	ENST00000215939.2	-	3	360	c.230C>T	c.(229-231)tCg>tTg	p.S77L		NM_001887.3	NP_001878.1	P53674	CRBB1_HUMAN	crystallin, beta B1	77	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)	p.S77L(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(3)|skin(2)|urinary_tract(4)	31						GCACTCCCCCGAGAATTCTGC	0.612																																						ENST00000215939.2	1.000000	0.650000	1.000000	0.830000	0.990000	0.940938	0.990000	1.000000																										1	Substitution - Missense(1)	p.S77L(1)	large_intestine(1)	31						c.(229-231)tCg>tTg		crystallin, beta B1							88.0	78.0	81.0					22																	27008105		2203	4300	6503	SO:0001583	missense	1414	1	121412	36				g.chr22:27008105G>A		CCDS13840.1	22q12.1	2008-06-10			ENSG00000100122	ENSG00000100122			2397	protein-coding gene	gene with protein product		600929				8575764, 12360425	Standard	NM_001887		Approved		uc003acy.1	P53674	OTTHUMG00000150980	ENST00000215939.2:c.230C>T	chr22.hg19:g.27008105G>A	ENSP00000215939:p.Ser77Leu	0						p.S77L	NM_001887.3	NP_001878.1	0	1	1	1.990456	P53674	CRBB1_HUMAN		3	360	-				Missense_Mutation	SNP	ENST00000215939.2	1	1	hg19	c.230C>T	CCDS13840.1	1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.312232	0.23908	.	.	ENSG00000100122	ENST00000215939	T	0.77489	-1.1	3.85	3.85	0.44370	3.85	3.85	0.44370	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.811995	0.11262	N	0.582484	T	0.71213	0.3313	L	0.54863	1.705	0.33899	D	0.638222	B	0.31209	0.313	B	0.27887	0.084	T	0.76088	-0.3087	10	0.51188	T	0.08	.	8.8646	0.35278	0.1045:0.0:0.8955:0.0	.	77	P53674	CRBB1_HUMAN	L	77	ENSP00000215939:S77L	ENSP00000215939:S77L	S	-	2	0	0	CRYBB1	25338105	25338105	0.935000	0.31712	0.999000	0.59377	0.438000	0.31896	1.500000	0.35682	1.961000	0.56991	0.491000	0.48974	TCG	0.080901		TCGA-2J-AABR-01A-11D-A40W-08	0.612	CRYBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320767.1	1	0	1		2	2	2	0		0	0	74		74	72	1	1.970000	-2.774725	1	0.090000	NM_001887			19	14		378	364	0		1	0		0	0	74	0		0.999986	3.405871e-02	0	0	0	6	0	19	378
MICALL1	85377	broad.mit.edu	37	22	38323617	38323617	+	Silent	SNP	T	T	A			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr22:38323617T>A	ENST00000215957.6	+	9	1791	c.1665T>A	c.(1663-1665)tcT>tcA	p.S555S	MICALL1_ENST00000402631.1_3'UTR	NM_033386.3	NP_203744.1	Q8N3F8	MILK1_HUMAN	MICAL-like 1	555	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|neuron projection development (GO:0031175)|protein localization to endosome (GO:0036010)|protein targeting to membrane (GO:0006612)|receptor-mediated endocytosis (GO:0006898)|retrograde transport, endosome to plasma membrane (GO:1990126)|slow endocytic recycling (GO:0032458)	extrinsic component of membrane (GO:0019898)|late endosome (GO:0005770)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	24	Melanoma(58;0.045)					TCAGCCTCTCTACCAACTCCT	0.632																																						ENST00000215957.6	0.800000	0.320000	0.670000	0.410000	0.530000	0.550302	0.530000	0.520000																										0				24						c.(1663-1665)tcT>tcA		MICAL-like 1							166.0	152.0	157.0					22																	38323617		2203	4300	6503	SO:0001819	synonymous_variant	85377	0	0					g.chr22:38323617T>A	BK000466	CCDS13961.1	22q13.1	2006-11-24			ENSG00000100139	ENSG00000100139			29804	protein-coding gene	gene with protein product	"""molecule interacting with Rab13"""					11258795, 12110185	Standard	NM_033386		Approved	MIRAB13, KIAA1668, MICAL-L1	uc003aui.3	Q8N3F8	OTTHUMG00000150670	ENST00000215957.6:c.1665T>A	chr22.hg19:g.38323617T>A		0					MICALL1_ENST00000402631.1_3'UTR	p.S555S	NM_033386.3	NP_203744.1	0	1	1	1.990456	Q8N3F8	MILK1_HUMAN		9	1791	+	Melanoma(58;0.045)		Q5TI16|Q7RTP5|Q8N3N8|Q9BVL9|Q9BY92|Q9UH43|Q9UH44|Q9UH45	Silent	SNP	ENST00000215957.6	0	1	hg19	c.1665T>A	CCDS13961.1	0	.	.	.	.	.	.	.	.	.	.	T	0.550	-0.849771	0.02651	.	.	ENSG00000100139	ENST00000454685	.	.	.	5.14	-10.3	0.00346	5.14	-10.3	0.00346	.	.	.	.	.	T	0.46229	0.1382	.	.	.	0.53688	D	0.999975	.	.	.	.	.	.	T	0.57394	-0.7819	4	.	.	.	.	8.7087	0.34371	0.1652:0.5937:0.0749:0.1661	.	.	.	.	N	133	.	.	Y	+	1	0	0	MICALL1	36653563	36653563	0.000000	0.05858	0.020000	0.16555	0.047000	0.14425	-3.105000	0.00602	-2.558000	0.00475	0.454000	0.30748	TAC	0.080901		TCGA-2J-AABR-01A-11D-A40W-08	0.632	MICALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319545.4	0	0	1		2	2	2	0		0	0	132		132	130	1	1.970000	-3.178041	1	0.090000	NM_033386			17	17		689	666	0		1	1		0	0	132	0		0.999954	1.514673e-01	0	3	0	24	0	17	689
L3MBTL2	83746	broad.mit.edu	37	22	41609955	41609955	+	Silent	SNP	G	G	A			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr22:41609955G>A	ENST00000216237.5	+	3	479	c.321G>A	c.(319-321)aaG>aaA	p.K107K	RP4-756G23.5_ENST00000441316.1_RNA|RP4-756G23.5_ENST00000451176.1_RNA|L3MBTL2_ENST00000489136.1_3'UTR	NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	107					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.K107N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CCAAGACCAAGAGGTTCTGCA	0.512																																						ENST00000216237.5	1.000000	0.430000	1.000000	0.580000	0.770000	0.776363	0.770000	1.000000																										1	Substitution - Missense(1)	p.K107N(1)	lung(1)	24						c.(319-321)aaG>aaA		l(3)mbt-like 2 (Drosophila)							155.0	140.0	145.0					22																	41609955		2203	4300	6503	SO:0001819	synonymous_variant	83746	0	0					g.chr22:41609955G>A	AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.321G>A	chr22.hg19:g.41609955G>A		1					RP4-756G23.5_ENST00000451176.1_RNA|RP4-756G23.5_ENST00000441316.1_RNA|L3MBTL2_ENST00000489136.1_3'UTR	p.K107K	NM_031488.4	NP_113676.2	1	5	6	2.261650	Q969R5	LMBL2_HUMAN		3	479	+			Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Silent	SNP	ENST00000216237.5	1	1	hg19	c.321G>A	CCDS14011.1	0																																																																																								0.210755		TCGA-2J-AABR-01A-11D-A40W-08	0.512	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320613.1	0	0	1		2	2	2	0		0	0	83		83	83	1	1.970000	-3.584154	1	0.090000	NM_031488			15	15		520	512	0		1	0		0	0	83	0		0.999859	2.151038e-01	0	1	0	28	0	15	520
PKDREJ	10343	broad.mit.edu	37	22	46653425	46653425	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr22:46653425G>A	ENST00000253255.5	-	1	5794	c.5795C>T	c.(5794-5796)tCg>tTg	p.S1932L		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1932					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		AAATATGACCGAAATGCTACA	0.373																																						ENST00000253255.5	0.720000	0.180000	0.600000	0.290000	0.430000	0.449980	0.430000	0.410000																										0				73						c.(5794-5796)tCg>tTg		polycystin (PKD) family receptor for egg jelly							80.0	84.0	83.0					22																	46653425		2203	4300	6503	SO:0001583	missense	10343	2	121412	33				g.chr22:46653425G>A	AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.5795C>T	chr22.hg19:g.46653425G>A	ENSP00000253255:p.Ser1932Leu	0						p.S1932L	NM_006071.1	NP_006062.1	0	0	0	1.906408	Q9NTG1	PKDRE_HUMAN		1	5794	-		Ovarian(80;0.00965)|all_neural(38;0.0416)	B1AJY3|O95850	Missense_Mutation	SNP	ENST00000253255.5	0	1	hg19	c.5795C>T	CCDS14073.1	0	.	.	.	.	.	.	.	.	.	.	G	11.51	1.660688	0.29515	.	.	ENSG00000130943	ENST00000253255	T	0.71461	-0.57	5.55	4.52	0.55395	5.55	4.52	0.55395	Polycystin cation channel, PKD1/PKD2 (1);	0.000000	0.53938	D	0.000059	T	0.77916	0.4202	L	0.47716	1.5	0.20563	N	0.99989	D	0.89917	1.0	D	0.91635	0.999	T	0.68236	-0.5462	10	0.59425	D	0.04	-21.0782	11.7598	0.51896	0.084:0.0:0.916:0.0	.	1932	Q9NTG1	PKDRE_HUMAN	L	1932	ENSP00000253255:S1932L	ENSP00000253255:S1932L	S	-	2	0	0	PKDREJ	45032089	45032089	0.914000	0.31030	0.108000	0.21378	0.096000	0.18686	2.674000	0.46867	2.618000	0.88619	0.455000	0.32223	TCG	0.037139		TCGA-2J-AABR-01A-11D-A40W-08	0.373	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	0	0	1		2	2	2	0		0	0	36		36	35	1	1.970000	-3.091551	1	0.090000	NM_006071			6	5		276	275	0		1			0	0	36	0		0.964652	0	0	0	0	0	0	6	276
IL18RAP	8807	broad.mit.edu	37	2	103063588	103063588	+	Silent	SNP	G	G	C			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr2:103063588G>C	ENST00000264260.2	+	10	1720	c.1131G>C	c.(1129-1131)gcG>gcC	p.A377A	IL18RAP_ENST00000409369.1_Silent_p.A235A	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	377					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						TGCTGGCGGCGAGTGCCCTCC	0.582																																						ENST00000264260.2	1.000000	0.060000	0.350000	0.100000	0.170000	0.295668	0.170000	0.150000																										0				37						c.(1129-1131)gcG>gcC		interleukin 18 receptor accessory protein							143.0	145.0	145.0					2																	103063588		2203	4300	6503	SO:0001819	synonymous_variant	8807	0	0					g.chr2:103063588G>C	AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.1131G>C	chr2.hg19:g.103063588G>C		0					IL18RAP_ENST00000409369.1_Silent_p.A235A	p.A377A	NM_003853.2	NP_003844.1	1	2	3	2.011385	O95256	I18RA_HUMAN		10	1720	+			B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Silent	SNP	ENST00000264260.2	0	1	hg19	c.1131G>C	CCDS2061.1	0																																																																																								0.098117		TCGA-2J-AABR-01A-11D-A40W-08	0.582	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253291.2	0	0	1		19	2	2	1		1	1	169		169	165	1	1.970000	-2.200819	0	0.090000	NM_003853			6	6		907	893	0		0	0		1	0	169	0		0.006225	6.681461e-05	0	0	0	2	0	6	907
NEB	4703	broad.mit.edu	37	2	152552104	152552104	+	Silent	SNP	A	A	G			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr2:152552104A>G	ENST00000172853.10	-	18	1809	c.1662T>C	c.(1660-1662)taT>taC	p.Y554Y	NEB_ENST00000409198.1_Silent_p.Y554Y|NEB_ENST00000603639.1_Silent_p.Y554Y|NEB_ENST00000427231.2_Silent_p.Y554Y|NEB_ENST00000397345.3_Silent_p.Y554Y|NEB_ENST00000604864.1_Silent_p.Y554Y			P20929	NEBU_HUMAN	nebulin	554					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CACTCAAGTTATAGGCATTGA	0.373																																						ENST00000172853.10	1.000000	0.420000	1.000000	0.710000	0.990000	0.898829	0.990000	1.000000																										0				301						c.(1660-1662)taT>taC		nebulin							109.0	106.0	107.0					2																	152552104		1938	4126	6064	SO:0001819	synonymous_variant	4703	0	0					g.chr2:152552104A>G	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.1662T>C	chr2.hg19:g.152552104A>G		0					NEB_ENST00000603639.1_Silent_p.Y554Y|NEB_ENST00000409198.1_Silent_p.Y554Y|NEB_ENST00000427231.2_Silent_p.Y554Y|NEB_ENST00000604864.1_Silent_p.Y554Y|NEB_ENST00000397345.3_Silent_p.Y554Y	p.Y554Y			1	2	3	2.011385	P20929	NEBU_HUMAN		18	1809	-			F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	1	1	hg19	c.1662T>C		1																																																																																								0.098117		TCGA-2J-AABR-01A-11D-A40W-08	0.373	NEB-201	KNOWN	basic	protein_coding	protein_coding		0	0	1		2	2	2	0		0	0	25		25	25	1	1.970000	-8.516195	1	0.090000	NM_004543			5	5		105	105	0		1			0	0	25	0		0.939019	0	0	0	0	0	0	5	105
IRS1	3667	broad.mit.edu	37	2	227660111	227660111	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr2:227660111T>C	ENST00000305123.5	-	1	4364	c.3344A>G	c.(3343-3345)aAc>aGc	p.N1115S	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	1115					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GGGCACTGTGTTGCCCACCCG	0.617																																						ENST00000305123.5	1.000000	0.420000	1.000000	0.580000	0.790000	0.792332	0.790000	1.000000																										0				69						c.(3343-3345)aAc>aGc		insulin receptor substrate 1							46.0	45.0	45.0					2																	227660111		2203	4300	6503	SO:0001583	missense	3667	0	0					g.chr2:227660111T>C		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.3344A>G	chr2.hg19:g.227660111T>C	ENSP00000304895:p.Asn1115Ser	0					IRS1_ENST00000498335.1_5'Flank	p.N1115S	NM_005544.2	NP_005535.1	1	2	3	2.010203	P35568	IRS1_HUMAN		1	4364	-		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Missense_Mutation	SNP	ENST00000305123.5	1	1	hg19	c.3344A>G	CCDS2463.1	0	.	.	.	.	.	.	.	.	.	.	T	5.525	0.281845	0.10458	.	.	ENSG00000169047	ENST00000305123	T	0.56275	0.47	5.81	5.81	0.92471	5.81	5.81	0.92471	.	0.174974	0.34268	N	0.004120	T	0.25382	0.0617	N	0.11064	0.09	0.27707	N	0.945585	B	0.31581	0.329	B	0.28849	0.095	T	0.32613	-0.9900	10	0.05436	T	0.98	-25.738	6.918	0.24371	0.0:0.1629:0.0:0.8371	.	1115	P35568	IRS1_HUMAN	S	1115	ENSP00000304895:N1115S	ENSP00000304895:N1115S	N	-	2	0	0	IRS1	227368355	227368355	0.000000	0.05858	0.965000	0.40720	0.245000	0.25701	-0.476000	0.06591	2.206000	0.71126	0.533000	0.62120	AAC	0.098117		TCGA-2J-AABR-01A-11D-A40W-08	0.617	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	0	0	1		2	2	2	0		0	0	82		82	81	1	1.970000	-12.531370	1	0.090000	NM_005544			12	12		353	346	0		1	1		0	0	82	0		0.999046	3.860067e-01	0	4	0	33	0	12	353
PER2	8864	broad.mit.edu	37	2	239185809	239185809	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr2:239185809C>T	ENST00000254657.3	-	3	535	c.256G>A	c.(256-258)Gca>Aca	p.A86T	PER2_ENST00000440245.1_Missense_Mutation_p.A86T|PER2_ENST00000355768.2_Missense_Mutation_p.A86T|PER2_ENST00000254658.3_Missense_Mutation_p.A86T	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	86					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)	p.A86T(1)		NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TCAGATTTTGCCATCATCAGG	0.383																																						ENST00000254657.3	1.000000	0.040000	0.260000	0.080000	0.120000	0.260129	0.120000	0.110000																										1	Substitution - Missense(1)	p.A86T(1)	urinary_tract(1)	37						c.(256-258)Gca>Aca		period circadian clock 2							227.0	239.0	235.0					2																	239185809		2203	4300	6503	SO:0001583	missense	8864	0	0					g.chr2:239185809C>T	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.256G>A	chr2.hg19:g.239185809C>T	ENSP00000254657:p.Ala86Thr	0					PER2_ENST00000254658.3_Missense_Mutation_p.A86T|PER2_ENST00000440245.1_Missense_Mutation_p.A86T|PER2_ENST00000355768.2_Missense_Mutation_p.A86T	p.A86T	NM_022817.2	NP_073728.1	1	2	3	2.010203	O15055	PER2_HUMAN		3	535	-		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	ENST00000254657.3	0	1	hg19	c.256G>A	CCDS2528.1	0	.	.	.	.	.	.	.	.	.	.	C	0.421	-0.908299	0.02434	.	.	ENSG00000132326	ENST00000254657;ENST00000254658;ENST00000440245;ENST00000355768;ENST00000431832	T;T;T;T;T	0.53423	2.72;0.68;1.71;0.68;0.62	4.96	2.12	0.27331	4.96	2.12	0.27331	.	0.345872	0.34110	N	0.004259	T	0.34308	0.0893	L	0.34521	1.04	0.20074	N	0.999938	B;B;B;B	0.10296	0.003;0.0;0.001;0.0	B;B;B;B	0.12837	0.008;0.001;0.005;0.001	T	0.18053	-1.0349	10	0.31617	T	0.26	-1.2378	11.0032	0.47618	0.0:0.7639:0.0:0.2361	.	86;86;86;86	F5GYD5;B4DH14;O15055-2;O15055	.;.;.;PER2_HUMAN	T	86	ENSP00000254657:A86T;ENSP00000254658:A86T;ENSP00000397516:A86T;ENSP00000348013:A86T;ENSP00000405891:A86T	ENSP00000254657:A86T	A	-	1	0	0	PER2	238850548	238850548	0.693000	0.27728	0.002000	0.10522	0.041000	0.13682	0.717000	0.25851	-0.004000	0.14419	-0.797000	0.03246	GCA	0.098117		TCGA-2J-AABR-01A-11D-A40W-08	0.383	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	0	0	1		16	2	2	1		1	1	321		321	318	1	1.970000	-1.735477	0	0.090000	NM_022817			7	7		1384	1369	0		0	0		1	0	321	0		0.043278	8.469510e-03	0	0	0	23	0	7	1384
ARAP2	116984	broad.mit.edu	37	4	36189102	36189102	+	Missense_Mutation	SNP	C	C	A	rs187371781		TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr4:36189102C>A	ENST00000303965.4	-	8	2138	c.1649G>T	c.(1648-1650)aGa>aTa	p.R550I		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	550	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						AACAAAAGTTCTTTGTGTTGT	0.299													C|||	1	0.000199681	0.0	0.0	5008	,	,		15678	0.001		0.0	False		,,,				2504	0.0					ENST00000303965.4	1.000000	0.440000	1.000000	0.620000	0.860000	0.829332	0.860000	1.000000																										0				82						c.(1648-1650)aGa>aTa		ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2		C	ILE/ARG	0,4400		0,0,2200	59.0	59.0	59.0		1649	5.9	1.0	4		59	1,8587	1.2+/-3.3	0,1,4293	no	missense	ARAP2	NM_015230.3	97	0,1,6493	AA,AC,CC		0.0116,0.0,0.0077	probably-damaging	550/1705	36189102	1,12987	2200	4294	6494	SO:0001583	missense	116984	0	0					g.chr4:36189102C>A	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.1649G>T	chr4.hg19:g.36189102C>A	ENSP00000302895:p.Arg550Ile	0						p.R550I	NM_015230.3	NP_056045.2	1	2	3	2.014557	Q8WZ64	ARAP2_HUMAN		8	2138	-			Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	ENST00000303965.4	0	1	hg19	c.1649G>T	CCDS3441.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	28.9	4.962860	0.92791	0.0	1.16E-4	ENSG00000047365	ENST00000303965	T	0.18338	2.22	5.91	5.91	0.95273	5.91	5.91	0.95273	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.54127	0.1839	M	0.91090	3.175	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.998	T	0.62492	-0.6843	10	0.87932	D	0	.	19.8836	0.96906	0.0:1.0:0.0:0.0	.	480;550	A7E2A5;Q8WZ64	.;ARAP2_HUMAN	I	550	ENSP00000302895:R550I	ENSP00000302895:R550I	R	-	2	0	0	ARAP2	35865497	35865497	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.860000	0.69546	2.791000	0.96007	0.650000	0.86243	AGA	0.098921		TCGA-2J-AABR-01A-11D-A40W-08	0.299	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	0	0	1		2	2	2	0		0	0	48		48	48	1	1.970000	-11.968510	1	0.090000	NM_015230			11	11		301	297	0		1	0		0	0	48	0		0.998292	6.667203e-02	0	1	0	10	0	11	301
TSPAN5	10098	broad.mit.edu	37	4	99407920	99407920	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr4:99407920G>A	ENST00000305798.3	-	3	650	c.248C>T	c.(247-249)gCg>gTg	p.A83V	TSPAN5_ENST00000509168.1_5'UTR|TSPAN5_ENST00000505184.1_Missense_Mutation_p.A12V	NM_005723.3	NP_005714.2	P62079	TSN5_HUMAN	tetraspanin 5	83					establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of Notch signaling pathway (GO:0045747)|protein maturation (GO:0051604)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)			kidney(2)|large_intestine(6)|lung(5)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(123;1.89e-07)		TTCCCGTAGCGCTCCAATGCA	0.478																																						ENST00000305798.3	1.000000	0.420000	1.000000	0.550000	0.720000	0.745266	0.720000	1.000000																										0				14						c.(247-249)gCg>gTg		tetraspanin 5							160.0	147.0	152.0					4																	99407920		2203	4300	6503	SO:0001583	missense	10098	0	0					g.chr4:99407920G>A		CCDS3646.1	4q22.3	2013-02-14	2005-03-21	2005-03-21	ENSG00000168785	ENSG00000168785		"""Tetraspanins"""	17753	protein-coding gene	gene with protein product		613136	"""transmembrane 4 superfamily member 9"""	TM4SF9			Standard	NM_005723		Approved	Tspan-5, NET-4	uc003hub.3	P62079	OTTHUMG00000131008	ENST00000305798.3:c.248C>T	chr4.hg19:g.99407920G>A	ENSP00000307701:p.Ala83Val	0					TSPAN5_ENST00000509168.1_5'UTR|TSPAN5_ENST00000505184.1_Missense_Mutation_p.A12V	p.A83V	NM_005723.3	NP_005714.2	1	2	3	2.014557	P62079	TSN5_HUMAN		3	650	-			B2RDY2|O60628|O60746|Q6FHE5|Q9JLY1	Missense_Mutation	SNP	ENST00000305798.3	1	1	hg19	c.248C>T	CCDS3646.1	0	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584361	0.65992	.	.	ENSG00000168785	ENST00000305798;ENST00000505184;ENST00000515287;ENST00000511651	D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77	5.51	5.51	0.81932	5.51	5.51	0.81932	Tetraspanin, conserved site (1);	0.096844	0.64402	D	0.000001	D	0.93203	0.7835	M	0.92026	3.265	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	D	0.93958	0.7238	10	0.87932	D	0	.	19.614	0.95622	0.0:0.0:1.0:0.0	.	83	P62079	TSN5_HUMAN	V	83;12;12;12	ENSP00000307701:A83V;ENSP00000423916:A12V;ENSP00000423504:A12V;ENSP00000426248:A12V	ENSP00000307701:A83V	A	-	2	0	0	TSPAN5	99626943	99626943	1.000000	0.71417	0.973000	0.42090	0.986000	0.74619	9.454000	0.97621	2.873000	0.98535	0.561000	0.74099	GCG	0.098921		TCGA-2J-AABR-01A-11D-A40W-08	0.478	TSPAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253641.2	0	0	1		2	2	2	0		0	0	102		102	100	1	1.970000	-3.238237	1	0.090000	NM_005723			18	16		581	575	0		1	1		0	0	102	0		0.999980	2.558038e-02	0	3	0	5	0	18	581
CHSY3	337876	broad.mit.edu	37	5	129519959	129519959	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr5:129519959G>A	ENST00000305031.4	+	3	1482	c.1124G>A	c.(1123-1125)cGg>cAg	p.R375Q	CHSY3_ENST00000507545.1_3'UTR	NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	375					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		GAACACAATCGGAAGGGTTAC	0.343																																						ENST00000305031.4	1.000000	0.530000	1.000000	0.700000	0.920000	0.875938	0.920000	1.000000																										0				28						c.(1123-1125)cGg>cAg		chondroitin sulfate synthase 3							80.0	77.0	78.0					5																	129519959		2203	4300	6503	SO:0001583	missense	337876	0	0					g.chr5:129519959G>A	AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.1124G>A	chr5.hg19:g.129519959G>A	ENSP00000302629:p.Arg375Gln	0					CHSY3_ENST00000507545.1_3'UTR	p.R375Q	NM_175856.4	NP_787052.3	1	2	3	2.010253	Q70JA7	CHSS3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	3	1482	+		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	ENST00000305031.4	1	1	hg19	c.1124G>A	CCDS34223.1	1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.168044	0.78339	.	.	ENSG00000198108	ENST00000305031	T	0.16196	2.36	4.46	3.59	0.41128	4.46	3.59	0.41128	.	0.455483	0.18240	N	0.147272	T	0.19644	0.0472	L	0.43152	1.355	0.36257	D	0.854274	D	0.54047	0.964	P	0.46796	0.527	T	0.19582	-1.0301	9	.	.	.	0.1414	13.2683	0.60146	0.0779:0.0:0.9221:0.0	.	375	Q70JA7	CHSS3_HUMAN	Q	375	ENSP00000302629:R375Q	.	R	+	2	0	0	CHSY3	129547858	129547858	0.973000	0.33851	0.789000	0.31954	0.998000	0.95712	3.393000	0.52544	1.477000	0.48234	0.644000	0.83932	CGG	0.098117		TCGA-2J-AABR-01A-11D-A40W-08	0.343	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371453.1	0	0	1		2	2	2	0		0	0	59		59	56	1	1.970000	-2.494159	0	0.090000	NM_175856			16	17		396	391	0		1	0		0	0	59	0		0.999931	1.004716e-02	0	0	0	4	0	16	396
NUP155	9631	broad.mit.edu	37	5	37370977	37370977	+	Missense_Mutation	SNP	G	G	C			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr5:37370977G>C	ENST00000231498.3	-	1	306	c.103C>G	c.(103-105)Caa>Gaa	p.Q35E	NUP155_ENST00000513532.1_Missense_Mutation_p.Q35E|NUP155_ENST00000381843.2_5'Flank	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	35					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CGGTCCTCTTGCAACTGACGG	0.582																																						ENST00000231498.3	1.000000	0.450000	1.000000	0.590000	0.770000	0.785584	0.770000	1.000000																										0				62						c.(103-105)Caa>Gaa		nucleoporin 155kDa							107.0	103.0	105.0					5																	37370977		2203	4300	6503	SO:0001583	missense	9631	0	0					g.chr5:37370977G>C	AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.103C>G	chr5.hg19:g.37370977G>C	ENSP00000231498:p.Gln35Glu	0					NUP155_ENST00000381843.2_5'Flank|NUP155_ENST00000513532.1_Missense_Mutation_p.Q35E	p.Q35E	NM_153485.1	NP_705618.1	1	2	3	2.018212	O75694	NU155_HUMAN	COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)	1	306	-	all_lung(31;0.000137)		Q9UBE9|Q9UFL5	Missense_Mutation	SNP	ENST00000231498.3	1	1	hg19	c.103C>G	CCDS3921.1	0	.	.	.	.	.	.	.	.	.	.	G	13.87	2.366755	0.41902	.	.	ENSG00000113569	ENST00000231498;ENST00000513532	T;T	0.77877	-1.12;-1.13	4.28	3.38	0.38709	4.28	3.38	0.38709	.	0.056570	0.64402	N	0.000001	T	0.69975	0.3171	L	0.57536	1.79	0.50039	D	0.999841	B;B	0.30146	0.0;0.27	B;B	0.31442	0.0;0.13	T	0.63959	-0.6519	10	0.02654	T	1	.	14.0155	0.64521	0.0:0.1524:0.8476:0.0	.	35;35	E9PF10;O75694	.;NU155_HUMAN	E	35	ENSP00000231498:Q35E;ENSP00000422019:Q35E	ENSP00000231498:Q35E	Q	-	1	0	0	NUP155	37406734	37406734	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	5.782000	0.68973	0.985000	0.38656	0.650000	0.86243	CAA	0.099723		TCGA-2J-AABR-01A-11D-A40W-08	0.582	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207593.2	0	0	1		2	2	2	0		0	0	84		84	81	1	1.970000	-3.703665	1	0.090000	NM_153485, NM_004298			17	17		512	504	0		1	0		0	0	84	0		0.999961	6.905859e-03	0	0	0	4	0	17	512
FAT2	2196	broad.mit.edu	37	5	150911532	150911532	+	Splice_Site	SNP	C	C	T			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr5:150911532C>T	ENST00000261800.5	-	13	9440		c.e13-1			NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2						epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCATTGGCGCCTGGCAGGGAG	0.652																																						ENST00000261800.5	1.000000	0.750000	1.000000	0.960000	0.990000	0.976844	0.990000	1.000000																										0				196						c.e13-1		FAT atypical cadherin 2							41.0	46.0	44.0					5																	150911532		2165	4252	6417	SO:0001630	splice_region_variant	2196	0	0					g.chr5:150911532C>T	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.9428-1G>A	chr5.hg19:g.150911532C>T		0							NM_001447.2	NP_001438.1	1	2	3	2.010253	Q9NYQ8	FAT2_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	13	9440	-		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	O75091|Q9NSR7	Splice_Site	SNP	ENST00000261800.5	1	1	hg19		CCDS4317.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.87|12.87	2.067656|2.067656	0.36470|0.36470	.|.	.|.	ENSG00000086570|ENSG00000086570	ENST00000261800|ENST00000520200	.|.	.|.	.|.	5.43|5.43	5.43|5.43	0.79202|0.79202	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73760	.|0.3628	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72337	.|-0.4324	.|4	.|.	.|.	.|.	.|.	17.4335|17.4335	0.87545|0.87545	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	.|K	-1|1	.|.	.|.	.|R	-|-	.|2	.|0	.|0	FAT2|FAT2	150891725|150891725	150891725|150891725	1.000000|1.000000	0.71417|0.71417	0.897000|0.897000	0.35233|0.35233	0.240000|0.240000	0.25518|0.25518	5.591000|5.591000	0.67536|0.67536	2.557000|2.557000	0.86248|0.86248	0.557000|0.557000	0.71058|0.71058	.|AGG	0.098117		TCGA-2J-AABR-01A-11D-A40W-08	0.652	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	1	0	1		2	2	2	0		0	0	63		63	60	1	1.970000	-5.402922	1	0.090000	NM_001447	Intron		20	20		362	361	0		1			0	0	63	0		0.999996	0	0	0	0	0	0	20	362
BVES	11149	broad.mit.edu	37	6	105573335	105573335	+	Missense_Mutation	SNP	T	T	C	rs369142492		TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr6:105573335T>C	ENST00000314641.5	-	4	686	c.470A>G	c.(469-471)aAg>aGg	p.K157R	BVES_ENST00000446408.2_Missense_Mutation_p.K157R|BVES_ENST00000336775.5_Missense_Mutation_p.K157R	NM_001199563.1	NP_001186492.1	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance	157					epithelial cell-cell adhesion (GO:0090136)|hematopoietic progenitor cell differentiation (GO:0002244)|muscle organ development (GO:0007517)|positive regulation of locomotion (GO:0040017)|positive regulation of receptor recycling (GO:0001921)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|regulation of Rac GTPase activity (GO:0032314)|sinoatrial node cell development (GO:0060931)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cAMP binding (GO:0030552)|structural molecule activity (GO:0005198)	p.K157R(1)		NS(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|urinary_tract(1)	21		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				AGTTTGGCCCTTTTTCAAGGT	0.438																																						ENST00000314641.5	1.000000	0.060000	0.360000	0.110000	0.180000	0.301090	0.180000	0.160000																										1	Substitution - Missense(1)	p.K157R(1)	prostate(1)	21						c.(469-471)aAg>aGg		blood vessel epicardial substance		T	ARG/LYS,ARG/LYS,ARG/LYS	0,4406		0,0,2203	160.0	160.0	160.0		470,470,470	3.3	1.0	6		160	1,8599		0,1,4299	no	missense,missense,missense	BVES	NM_147147.3,NM_007073.4,NM_001199563.1	26,26,26	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign,benign,benign	157/361,157/361,157/361	105573335	1,13005	2203	4300	6503	SO:0001583	missense	11149	4	121412	44				g.chr6:105573335T>C	AF124512	CCDS5051.1	6q21	2008-11-25			ENSG00000112276	ENSG00000112276			1152	protein-coding gene	gene with protein product	"""popeye domain containing 1"""	604577				10441744, 10882522	Standard	NM_147147		Approved	HBVES, POP1, POPDC1	uc003pqx.3	Q8NE79	OTTHUMG00000015291	ENST00000314641.5:c.470A>G	chr6.hg19:g.105573335T>C	ENSP00000313172:p.Lys157Arg	0					BVES_ENST00000446408.2_Missense_Mutation_p.K157R|BVES_ENST00000336775.5_Missense_Mutation_p.K157R	p.K157R	NM_001199563.1	NP_001186492.1	1	2	3	2.009004	Q8NE79	POPD1_HUMAN		4	686	-		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)	A8K1R4|E1P5D8|Q5T550|Q5T551|Q8IWC6|Q9HBV0|Q9UNG6	Missense_Mutation	SNP	ENST00000314641.5	0	1	hg19	c.470A>G	CCDS5051.1	0	.	.	.	.	.	.	.	.	.	.	T	11.10	1.540510	0.27563	0.0	1.16E-4	ENSG00000112276	ENST00000314641;ENST00000336775;ENST00000446408	T;T;T	0.31510	1.49;1.49;1.49	5.76	3.34	0.38264	5.76	3.34	0.38264	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	0.130282	0.64402	N	0.000002	T	0.07638	0.0192	L	0.31845	0.965	0.39124	D	0.961725	B	0.14438	0.01	B	0.13407	0.009	T	0.12528	-1.0544	10	0.13470	T	0.59	-15.0112	6.8871	0.24208	0.0:0.148:0.1607:0.6914	.	157	Q8NE79	POPD1_HUMAN	R	157	ENSP00000313172:K157R;ENSP00000337259:K157R;ENSP00000397310:K157R	ENSP00000313172:K157R	K	-	2	0	0	BVES	105680028	105680028	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.676000	0.46883	1.016000	0.39470	0.533000	0.62120	AAG	0.097715		TCGA-2J-AABR-01A-11D-A40W-08	0.438	BVES-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406075.1	0	0	1		25	2	2	1		1	2	159		159	155	1	1.970000	-1.630380	0	0.090000	NM_147147			6	6		844	831	0		0	0		1	0	159	0		0.000334	4.558606e-04	0	0	0	4	0	6	844
TAF6	6878	broad.mit.edu	37	7	99707631	99707631	+	Silent	SNP	G	G	A	rs148894017		TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr7:99707631G>A	ENST00000344095.4	-	12	1749	c.1224C>T	c.(1222-1224)gaC>gaT	p.D408D	TAF6_ENST00000418432.2_Silent_p.D332D|TAF6_ENST00000472509.1_Silent_p.D465D|TAF6_ENST00000453269.2_Silent_p.D408D|TAF6_ENST00000452041.1_Silent_p.D408D|AP4M1_ENST00000421755.1_Intron|TAF6_ENST00000437822.2_Silent_p.D445D	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	408					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCACAGGGCCGTCCAGCACAC	0.587																																						ENST00000344095.4	1.000000	0.130000	1.000000	0.230000	0.380000	0.475282	0.380000	0.320000																										0				26						c.(1222-1224)gaC>gaT		TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa		G	,,	0,4406		0,0,2203	110.0	97.0	101.0		1335,1224,1224	-6.5	0.9	7	dbSNP_134	101	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	TAF6	NM_001190415.1,NM_005641.3,NM_139315.2	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	445/715,408/678,408/678	99707631	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6878	2	121412	39				g.chr7:99707631G>A		CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.1224C>T	chr7.hg19:g.99707631G>A		0					TAF6_ENST00000437822.2_Silent_p.D445D|AP4M1_ENST00000421755.1_Intron|TAF6_ENST00000453269.2_Silent_p.D408D|TAF6_ENST00000472509.1_Silent_p.D465D|TAF6_ENST00000452041.1_Silent_p.D408D|TAF6_ENST00000418432.2_Silent_p.D332D	p.D408D	NM_005641.3	NP_005632.1	1	2	3	2.016796	P49848	TAF6_HUMAN		12	1749	-	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Silent	SNP	ENST00000344095.4	0	1	hg19	c.1224C>T	CCDS5686.1	0																																																																																								0.099322		TCGA-2J-AABR-01A-11D-A40W-08	0.587	TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2	0	0	1		2	2	2	0		0	0	40		40	40	1	1.970000	-2.651826	1	0.090000	NM_005641			5	5		349	342	0		1	0		0	0	40	0		0.934638	5.510637e-01	0	0	0	117	0	5	349
KCNH2	3757	broad.mit.edu	37	7	150656780	150656780	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr7:150656780C>A	ENST00000262186.5	-	3	753	c.352G>T	c.(352-354)Gag>Tag	p.E118*	KCNH2_ENST00000392968.2_Nonsense_Mutation_p.E22*|KCNH2_ENST00000430723.3_Nonsense_Mutation_p.E118*	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	118	PAC. {ECO:0000255|PROSITE- ProRule:PRU00141}.				cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GCCCCATCCTCGTTCTTCACG	0.597																																					GBM(137;110 1844 13671 20123 45161)	ENST00000262186.5	1.000000	0.130000	1.000000	0.240000	0.420000	0.508372	0.420000	0.320000																										0				42						c.(352-354)Gag>Tag		potassium voltage-gated channel, subfamily H (eag-related), member 2	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)						169.0	124.0	139.0					7																	150656780		2203	4300	6503	SO:0001587	stop_gained	3757	0	0					g.chr7:150656780C>A	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.352G>T	chr7.hg19:g.150656780C>A	ENSP00000262186:p.Glu118*	0					KCNH2_ENST00000392968.2_Nonsense_Mutation_p.E22*|KCNH2_ENST00000430723.3_Nonsense_Mutation_p.E118*	p.E118*	NM_000238.3	NP_000229.1	1	2	3	2.016032	Q12809	KCNH2_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	3	753	-	all_neural(206;0.219)		A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Nonsense_Mutation	SNP	ENST00000262186.5	0	1	hg19	c.352G>T	CCDS5910.1	0	.	.	.	.	.	.	.	.	.	.	c	42	9.256142	0.99117	.	.	ENSG00000055118	ENST00000392968;ENST00000262186;ENST00000430723	.	.	.	4.71	4.71	0.59529	4.71	4.71	0.59529	.	0.000000	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	15.2258	0.73352	0.0:1.0:0.0:0.0	.	.	.	.	X	22;118;118	.	ENSP00000262186:E118X	E	-	1	0	0	KCNH2	150287713	150287713	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	7.258000	0.78371	2.183000	0.69458	0.436000	0.28706	GAG	0.099322		TCGA-2J-AABR-01A-11D-A40W-08	0.597	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	0	0	1		2	2	2	0		0	0	42		42	40	1	1.970000	-4.063491	1	0.090000	NM_000238			4	4		259	257	0		1	0		0	0	42	0		0.889278	0	0	0	0	1	0	4	259
SPATC1	375686	broad.mit.edu	37	8	145094826	145094826	+	Silent	SNP	G	G	A	rs377548022		TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr8:145094826G>A	ENST00000377470.3	+	2	330	c.228G>A	c.(226-228)ccG>ccA	p.P76P	SPATC1_ENST00000447830.2_Silent_p.P76P	NM_198572.2	NP_940974.2	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	76	Necessary for targeting centrosomes. {ECO:0000250}.					centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCCTGCCCCCGTCCCCAGCAG	0.632																																						ENST00000377470.3	1.000000	0.270000	1.000000	0.390000	0.550000	0.615312	0.550000	0.500000																										0				15						c.(226-228)ccG>ccA		spermatogenesis and centriole associated 1		G	,	0,4406		0,0,2203	69.0	75.0	73.0		228,228	-4.9	0.0	8		73	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SPATC1	NM_001134374.1,NM_198572.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	76/442,76/592	145094826	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	375686	5	121412	39				g.chr8:145094826G>A	BC053547	CCDS6413.2, CCDS47937.1	8q24.3	2005-01-11			ENSG00000186583	ENSG00000186583			30510	protein-coding gene	gene with protein product		610874				15280373	Standard	NM_198572		Approved	MGC61633, SPATA15, SPERIOLIN	uc011lkw.2	Q76KD6	OTTHUMG00000156976	ENST00000377470.3:c.228G>A	chr8.hg19:g.145094826G>A		0					SPATC1_ENST00000447830.2_Silent_p.P76P	p.P76P	NM_198572.2	NP_940974.2	1	2	3	2.017190	Q76KD6	SPERI_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)	2	330	+	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		B4DWW9|Q5U5I8|Q7Z6L7	Silent	SNP	ENST00000377470.3	0	1	hg19	c.228G>A	CCDS6413.2	0																																																																																								0.099322		TCGA-2J-AABR-01A-11D-A40W-08	0.632	SPATC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346926.1	0	0	1		2	2	2	0		0	0	79		79	77	1	1.970000	-3.022936	1	0.090000	NM_198572			10	10		438	431	0		1	0		0	0	79	0		0.996697	6.504065e-04	0	0	0	2	0	10	438
RNF20	56254	broad.mit.edu	37	9	104324559	104324559	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr9:104324559G>A	ENST00000389120.3	+	20	2873	c.2783G>A	c.(2782-2784)cGt>cAt	p.R928H		NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	928					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		TGTAACATGCGTAAAAAGGAT	0.418																																						ENST00000389120.3	0.480000	0.090000	0.360000	0.150000	0.230000	0.259197	0.230000	0.220000																										0				54						c.(2782-2784)cGt>cAt		ring finger protein 20, E3 ubiquitin protein ligase							173.0	155.0	161.0					9																	104324559		2203	4300	6503	SO:0001583	missense	56254	0	0					g.chr9:104324559G>A	AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.2783G>A	chr9.hg19:g.104324559G>A	ENSP00000373772:p.Arg928His	0						p.R928H	NM_019592.5	NP_062538.5	0	1	1	2.002265	Q5VTR2	BRE1A_HUMAN		20	2873	+		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)	A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Missense_Mutation	SNP	ENST00000389120.3	0	1	hg19	c.2783G>A	CCDS35084.1	0	.	.	.	.	.	.	.	.	.	.	G	20.7	4.027440	0.75390	.	.	ENSG00000155827	ENST00000389120	D	0.86297	-2.1	5.87	4.98	0.66077	5.87	4.98	0.66077	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	D	0.90249	0.6951	L	0.56340	1.77	0.80722	D	1	D	0.62365	0.991	P	0.58620	0.842	D	0.91247	0.5026	10	0.72032	D	0.01	-9.7351	15.166	0.72825	0.0684:0.0:0.9316:0.0	.	928	Q5VTR2	BRE1A_HUMAN	H	928	ENSP00000373772:R928H	ENSP00000373772:R928H	R	+	2	0	0	RNF20	103364380	103364380	1.000000	0.71417	1.000000	0.80357	0.583000	0.36354	7.601000	0.82783	1.628000	0.50416	-0.150000	0.13652	CGT	0.055576		TCGA-2J-AABR-01A-11D-A40W-08	0.418	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356402.1	0	0	1		2	2	2	0		0	0	85		85	82	1	1.970000	-2.554803	1	0.090000	NM_019592			5	5		471	467	0		1	0		0	0	85	0		0.936454	8.045950e-02	0	0	0	36	0	5	471
ANAPC2	29882	broad.mit.edu	37	9	140080689	140080689	+	Missense_Mutation	SNP	C	C	T	rs371252788		TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chr9:140080689C>T	ENST00000323927.2	-	3	864	c.860G>A	c.(859-861)cGt>cAt	p.R287H	SSNA1_ENST00000322310.5_5'Flank	NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	287					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		GTGGAACTCACGCAGGAAGGA	0.642													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18278	0.0		0.0	False		,,,				2504	0.0					ENST00000323927.2	1.000000	0.190000	0.880000	0.340000	0.560000	0.592863	0.560000	1.000000																										0				15						c.(859-861)cGt>cAt		anaphase promoting complex subunit 2		C	HIS/ARG	0,4406		0,0,2203	48.0	48.0	48.0		860	2.7	1.0	9		48	1,8599	1.2+/-3.3	0,1,4299	no	missense	ANAPC2	NM_013366.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	287/823	140080689	1,13005	2203	4300	6503	SO:0001583	missense	29882	17	121340	41				g.chr9:140080689C>T	AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.860G>A	chr9.hg19:g.140080689C>T	ENSP00000314004:p.Arg287His	0					SSNA1_ENST00000322310.5_5'Flank	p.R287H	NM_013366.3	NP_037498.1	1	2	3	2.005350	Q9UJX6	ANC2_HUMAN	STAD - Stomach adenocarcinoma(284;0.0698)	3	864	-	all_cancers(76;0.0926)		Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Missense_Mutation	SNP	ENST00000323927.2	0	1	hg19	c.860G>A	CCDS7033.1	0	.	.	.	.	.	.	.	.	.	.	C	11.01	1.512989	0.27123	0.0	1.16E-4	ENSG00000176248	ENST00000323927	T	0.03181	4.02	3.7	2.7	0.31948	3.7	2.7	0.31948	.	0.867499	0.10426	N	0.676110	T	0.02807	0.0084	N	0.12182	0.205	0.09310	N	1	B;B	0.22851	0.046;0.076	B;B	0.17433	0.008;0.018	T	0.38564	-0.9655	10	0.48119	T	0.1	-16.0898	10.9309	0.47217	0.0:0.8075:0.1925:0.0	.	287;287	Q9UJX6;Q9UJX6-2	ANC2_HUMAN;.	H	287	ENSP00000314004:R287H	ENSP00000314004:R287H	R	-	2	0	0	ANAPC2	139200510	139200510	0.002000	0.14202	0.973000	0.42090	0.917000	0.54804	0.301000	0.19174	2.059000	0.61396	0.555000	0.69702	CGT	0.127684		TCGA-2J-AABR-01A-11D-A40W-08	0.642	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055315.1	0	0	1		2	2	2	0		0	0	32		32	31	1	1.970000	-3.317274	1	0.090000	NM_013366			4	4		182	180	0		1	0		0	0	32	0		0.888714	1.762531e-01	0	0	0	28	0	4	182
BEX2	84707	broad.mit.edu	37	X	102564580	102564580	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chrX:102564580G>A	ENST00000372677.3	-	3	592	c.325C>T	c.(325-327)Cgg>Tgg	p.R109W	BEX2_ENST00000536889.1_Missense_Mutation_p.R141W|BEX2_ENST00000372674.1_Missense_Mutation_p.R109W	NM_032621.3	NP_116010.1	Q9BXY8	BEX2_HUMAN	brain expressed X-linked 2	109					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|lung(1)|ovary(1)	3						CTGACTGCCCGCAAACTATGA	0.507																																						ENST00000372677.3	0.430000	0.120000	0.340000	0.170000	0.240000	0.264143	0.240000	0.240000																										0				3						c.(325-327)Cgg>Tgg		brain expressed X-linked 2							222.0	182.0	196.0					X																	102564580		2203	4300	6503	SO:0001583	missense	84707	0	0					g.chrX:102564580G>A	BC015522	CCDS14505.1, CCDS55467.1	Xq22	2014-03-21			ENSG00000133134	ENSG00000133134			30933	protein-coding gene	gene with protein product		300691				16221301	Standard	NM_001168399		Approved	DJ79P11.1	uc004eka.3	Q9BXY8	OTTHUMG00000022095	ENST00000372677.3:c.325C>T	chrX.hg19:g.102564580G>A	ENSP00000361762:p.Arg109Trp						BEX2_ENST00000372674.1_Missense_Mutation_p.R109W|BEX2_ENST00000536889.1_Missense_Mutation_p.R141W	p.R109W	NM_032621.3	NP_116010.1	0	1	1		Q9BXY8	BEX2_HUMAN		3	592	-			B2R574|D3DXA2|F5H7H5|Q5JVV9	Missense_Mutation	SNP	ENST00000372677.3	0	1	hg19	c.325C>T	CCDS14505.1	0	.	.	.	.	.	.	.	.	.	.	G	14.93	2.681005	0.47886	.	.	ENSG00000133134	ENST00000372677;ENST00000536889;ENST00000372674	T;T;T	0.15952	2.42;2.38;2.42	4.29	2.44	0.29823	4.29	2.44	0.29823	.	0.162857	0.29253	N	0.012700	T	0.38161	0.1030	M	0.83953	2.67	0.28106	N	0.931193	D;D	0.89917	0.999;1.0	D;D	0.68483	0.91;0.958	T	0.15780	-1.0425	10	0.44086	T	0.13	.	8.329	0.32175	0.0:0.0:0.5702:0.4298	.	109;141	Q9BXY8;F5H7H5	BEX2_HUMAN;.	W	109;141;109	ENSP00000361762:R109W;ENSP00000442521:R141W;ENSP00000361759:R109W	ENSP00000361759:R109W	R	-	1	2	2	BEX2	102451236	102451236	0.638000	0.27225	0.551000	0.28230	0.784000	0.44337	0.741000	0.26202	0.518000	0.28383	0.600000	0.82982	CGG	0.090000		TCGA-2J-AABR-01A-11D-A40W-08	0.507	BEX2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057702.1	0	0	1		2	2	2	0		0	0	161		161	155	1	1.970000	-1.947661	0	0.090000	NM_032621			9	9		820	805	0		1	0		0	0	161	0		0.993736	1.374317e-01	0	0	0	53	0	9	820
IGSF1	3547	broad.mit.edu	37	X	130416639	130416639	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chrX:130416639C>T	ENST00000361420.3	-	7	1104	c.1025G>A	c.(1024-1026)cGg>cAg	p.R342Q	IGSF1_ENST00000370903.3_Missense_Mutation_p.R342Q|IGSF1_ENST00000370910.1_Missense_Mutation_p.R333Q|IGSF1_ENST00000370904.1_Missense_Mutation_p.R333Q			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	342	Ig-like C2-type 4.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						TCCTCGACACCGTAGGCTCAC	0.498																																						ENST00000361420.3	1.000000	0.410000	0.950000	0.560000	0.740000	0.750082	0.740000	1.000000																										0				78						c.(1024-1026)cGg>cAg		immunoglobulin superfamily, member 1							134.0	112.0	120.0					X																	130416639		2203	4300	6503	SO:0001583	missense	3547	5	121410	38				g.chrX:130416639C>T	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.1025G>A	chrX.hg19:g.130416639C>T	ENSP00000355010:p.Arg342Gln						IGSF1_ENST00000370903.3_Missense_Mutation_p.R342Q|IGSF1_ENST00000370904.1_Missense_Mutation_p.R333Q|IGSF1_ENST00000370910.1_Missense_Mutation_p.R333Q	p.R342Q			0	1	1		Q8N6C5	IGSF1_HUMAN		7	1104	-			B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	ENST00000361420.3	1	1	hg19	c.1025G>A	CCDS14629.1	0	.	.	.	.	.	.	.	.	.	.	C	1.457	-0.563461	0.03939	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.12774	2.65;2.65;2.65;2.65	4.78	-0.153	0.13403	4.78	-0.153	0.13403	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	1.769840	0.02967	N	0.143897	T	0.07954	0.0199	N	0.17872	0.535	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.26985	-1.0087	10	0.21014	T	0.42	.	0.7403	0.00972	0.1686:0.3668:0.1618:0.3028	.	333;342	Q8N6C5-2;Q8N6C5	.;IGSF1_HUMAN	Q	333;342;333;342	ENSP00000359947:R333Q;ENSP00000355010:R342Q;ENSP00000359941:R333Q;ENSP00000359940:R342Q	ENSP00000355010:R342Q	R	-	2	0	0	IGSF1	130244320	130244320	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	-0.077000	0.11394	-0.295000	0.08960	0.594000	0.82650	CGG	0.090000		TCGA-2J-AABR-01A-11D-A40W-08	0.498	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1	0	0	1		2	2	2	0		0	0	71		71	67	1	1.970000	-2.555299	1	0.090000				13	13		381	376	0		1	0		0	0	71	0		0.999512	0	0	0	0	1	0	13	381
PGAM4	441531	broad.mit.edu	37	X	77224488	77224488	+	Silent	SNP	G	G	A			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chrX:77224488G>A	ENST00000458128.1	-	1	647	c.648C>T	c.(646-648)atC>atT	p.I216I	ATP7A_ENST00000343533.5_Intron|ATP7A_ENST00000350425.4_Intron|ATP7A_ENST00000341514.6_Intron	NM_001029891.2	NP_001025062.1	Q8N0Y7	PGAM4_HUMAN	phosphoglycerate mutase family member 4	216					glycolytic process (GO:0006096)|positive regulation of sperm motility (GO:1902093)	extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	bisphosphoglycerate 2-phosphatase activity (GO:0004083)|bisphosphoglycerate mutase activity (GO:0004082)|phosphoglycerate mutase activity (GO:0004619)			endometrium(2)|lung(4)	6						ATTCATAGACGATGGGAATAC	0.537																																						ENST00000458128.1	0.400000	0.090000	0.310000	0.140000	0.210000	0.232598	0.210000	0.200000																										0				6						c.(646-648)atC>atT		phosphoglycerate mutase family member 4							98.0	92.0	94.0					X																	77224488		2203	4293	6496	SO:0001819	synonymous_variant	441531	0	0					g.chrX:77224488G>A	AF465731	CCDS35338.1	Xq21.1	2011-02-09	2006-02-09		ENSG00000226784	ENSG00000226784			21731	protein-coding gene	gene with protein product		300567	"""phosphoglycerate mutase family 4"""			11961099, 9370262	Standard	NM_001029891		Approved	dJ1000K24.1, PGAM3, PGAM-B, PGAM1	uc004ecy.1	Q8N0Y7	OTTHUMG00000057865	ENST00000458128.1:c.648C>T	chrX.hg19:g.77224488G>A							ATP7A_ENST00000350425.4_Intron|ATP7A_ENST00000343533.5_Intron|ATP7A_ENST00000341514.6_Intron	p.I216I	NM_001029891.2	NP_001025062.1	0	1	1		Q8N0Y7	PGAM4_HUMAN		1	647	-			Q5JPN2|Q8NI24|Q8NI25|Q8NI26	Silent	SNP	ENST00000458128.1	0	1	hg19	c.648C>T	CCDS35338.1	0																																																																																								0.090000		TCGA-2J-AABR-01A-11D-A40W-08	0.537	PGAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128371.2	0	0	1		2	2	2	0		0	0	176		176	177	1	1.970000	-2.114288	0	0.090000	NM_001029891			7	7		745	688	0		1			0	0	176	0		0.974229	0	0	0	0	0	0	7	745
PLXNB3	5365	broad.mit.edu	37	X	153036266	153036266	+	Silent	SNP	A	A	T			TCGA-2J-AABR-01A-11D-A40W-08	TCGA-2J-AABR-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	534d051f-0b40-486a-8f77-646bf003d3d0	4c28dd95-5359-4c03-b338-7038de30008f	g.chrX:153036266A>T	ENST00000361971.5	+	11	2178	c.2064A>T	c.(2062-2064)gcA>gcT	p.A688A	PLXNB3_ENST00000538543.1_Intron|PLXNB3_ENST00000538776.1_Silent_p.A341A|PLXNB3_ENST00000538966.1_Silent_p.A711A|PLXNB3_ENST00000538282.1_Silent_p.A298A	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	688					axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					AAGGCCTGGCAGGTCCCCACC	0.622																																						ENST00000361971.5	0.950000	0.210000	0.720000	0.330000	0.500000	0.534601	0.500000	1.000000																										0				32						c.(2062-2064)gcA>gcT		plexin B3							51.0	52.0	51.0					X																	153036266		2198	4299	6497	SO:0001819	synonymous_variant	5365	0	0					g.chrX:153036266A>T	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.2064A>T	chrX.hg19:g.153036266A>T							PLXNB3_ENST00000538282.1_Silent_p.A298A|PLXNB3_ENST00000538776.1_Silent_p.A341A|PLXNB3_ENST00000538543.1_Intron|PLXNB3_ENST00000538966.1_Silent_p.A711A	p.A688A	NM_005393.2	NP_005384.2	0	1	1		Q9ULL4	PLXB3_HUMAN		11	2178	+	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)		B7Z3E6|F5H773|Q9HDA4	Silent	SNP	ENST00000361971.5	0	1	hg19	c.2064A>T	CCDS14729.1	0																																																																																								0.090000		TCGA-2J-AABR-01A-11D-A40W-08	0.622	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1	0	0	1		2	2	2	0		0	0	44		44	43	1	1.970000	-7.081947	1	0.090000				6	6		271	262	0		1	1		0	0	44	0		0.961730	9.802928e-03	0	4	0	2	0	6	271
