#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
FBXW7	55294	broad.mit.edu	37	4	153249472	153249473	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr4:153249472_153249473insAA	ENST00000281708.4	-	9	2534_2535	c.1305_1306insTT	c.(1303-1308)attagtfs	p.S436fs	FBXW7_ENST00000603841.1_Frame_Shift_Ins_p.S436fs|FBXW7_ENST00000263981.5_Frame_Shift_Ins_p.S356fs|FBXW7_ENST00000603548.1_Frame_Shift_Ins_p.S436fs|FBXW7_ENST00000296555.5_Frame_Shift_Ins_p.S318fs|FBXW7_ENST00000393956.3_Frame_Shift_Ins_p.S260fs	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	436					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				GTAGATCCACTAATGATGATGT	0.416			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																	ENST00000281708.4	1.000000	0.690000	9.700000e-01	7.700000e-01	0.860000	0.870340	0.860000	1.000000				Rec	yes			Rec	yes		4	4q31.3	4q31.3	55294	Mis, N, D, F	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""				"""E, L"""	E, L			colorectal, endometrial, T-ALL		1	Unknown(1)	p.?(1)	haematopoietic_and_lymphoid_tissue(1)	462						c.(1303-1308)attagtfs		F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase																																				SO:0001589	frameshift_variant	55294	0	0					g.chr4:153249472_153249473insAA	AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1304_1305dupTT	chr4.hg19:g.153249473_153249474dupAA	ENSP00000281708:p.Ser436fs	0					FBXW7_ENST00000296555.5_Frame_Shift_Ins_p.S318fs|FBXW7_ENST00000263981.5_Frame_Shift_Ins_p.S356fs|FBXW7_ENST00000603841.1_Frame_Shift_Ins_p.S436fs|FBXW7_ENST00000393956.3_Frame_Shift_Ins_p.S260fs|FBXW7_ENST00000603548.1_Frame_Shift_Ins_p.S436fs	p.S436fs	NM_033632.3	NP_361014.1	1	2	3	2.019574	Q969H0	FBXW7_HUMAN		9	2534_2535	-	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Frame_Shift_Ins	INS	ENST00000281708.4	0	1	hg19	c.1305_1306insTT	CCDS3777.1	1																																																																																								0.256506		TCGA-2J-AABT-01A-11D-A40W-08	0.416	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1	0	0	1		2	2		0		0	0	382		382	379	1	2.020000	-20.000000	1	0.250000				88	90		737	729	0		1	0		0		382			1.000000	4.147544e-01		0		13		88	737
FOXI2	399823	broad.mit.edu	37	10	129536020	129536020	+	Missense_Mutation	SNP	G	G	C			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr10:129536020G>C	ENST00000388920.4	+	1	522	c.483G>C	c.(481-483)aaG>aaC	p.K161N		NM_207426.2	NP_997309.2	Q6ZQN5	FOXI2_HUMAN	forkhead box I2	161					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(3)	4		all_epithelial(44;0.0021)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)				ACTGCTTCAAGAAGGTGCCCC	0.662																																					Esophageal Squamous(54;1038 1280 2528 31583)	ENST00000388920.4	1.000000	0.920000	1	9.900000e-01	0.990000	0.995222	0.990000	1.000000																										0				4						c.(481-483)aaG>aaC		forkhead box I2							36.0	39.0	38.0					10																	129536020		692	1591	2283	SO:0001583	missense	399823	0	0					g.chr10:129536020G>C	AK128865	CCDS7655.2	10q26.2	2008-04-10			ENSG00000186766	ENSG00000186766		"""Forkhead boxes"""	32448	protein-coding gene	gene with protein product							Standard	NM_207426		Approved	FLJ46831	uc009yas.2	Q6ZQN5	OTTHUMG00000019250	ENST00000388920.4:c.483G>C	chr10.hg19:g.129536020G>C	ENSP00000373572:p.Lys161Asn	0						p.K161N	NM_207426.2	NP_997309.2	0	1	1	1.993395	Q6ZQN5	FOXI2_HUMAN		1	522	+		all_epithelial(44;0.0021)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)		Missense_Mutation	SNP	ENST00000388920.4	0	1	hg19	c.483G>C	CCDS7655.2	1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.973821	0.74246	.	.	ENSG00000186766	ENST00000388920	D	0.95482	-3.72	4.14	3.24	0.37175	4.14	3.24	0.37175	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.000000	0.85682	D	0.000000	D	0.96352	0.8810	L	0.59436	1.845	0.58432	D	0.999996	D	0.76494	0.999	D	0.72625	0.978	D	0.95775	0.8812	10	0.72032	D	0.01	.	10.503	0.44817	0.0964:0.0:0.9036:0.0	.	161	Q6ZQN5	FOXI2_HUMAN	N	161	ENSP00000373572:K161N	ENSP00000373572:K161N	K	+	3	2	2	FOXI2	129426010	129426010	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.971000	0.29396	0.954000	0.37851	0.462000	0.41574	AAG	0.248120		TCGA-2J-AABT-01A-11D-A40W-08	0.662	FOXI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050984.2	0	0	1		2	2		0		0	0	42		42	35	1	2.020000	-20.000000	1	0.250000	NM_207426			15	15		62	53	0		1			0		42			0.999814	0		0		0		15	62
ARMC3	219681	broad.mit.edu	37	10	23297251	23297251	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr10:23297251C>T	ENST00000298032.5	+	15	1960	c.1876C>T	c.(1876-1878)Cga>Tga	p.R626*	ARMC3_ENST00000409983.3_Nonsense_Mutation_p.R626*|ARMC3_ENST00000376528.4_Nonsense_Mutation_p.R363*|ARMC3_ENST00000409049.3_Nonsense_Mutation_p.R626*	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	626			R -> Q (in dbSNP:rs10828395). {ECO:0000269|PubMed:15489334}.			extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TGGTTATGGACGAAGTATTTC	0.279																																						ENST00000298032.5	0.790000	0.210000	6.200000e-01	3.200000e-01	0.450000	0.479376	0.450000	0.430000																										0				47						c.(1876-1878)Cga>Tga		armadillo repeat containing 3							35.0	32.0	33.0					10																	23297251		2191	4269	6460	SO:0001587	stop_gained	219681	1	119462	18				g.chr10:23297251C>T	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.1876C>T	chr10.hg19:g.23297251C>T	ENSP00000298032:p.Arg626*	0					ARMC3_ENST00000409983.3_Nonsense_Mutation_p.R626*|ARMC3_ENST00000376528.4_Nonsense_Mutation_p.R363*|ARMC3_ENST00000409049.3_Nonsense_Mutation_p.R626*	p.R626*	NM_173081.3	NP_775104.2	0	0	0	1.975541	Q5W041	ARMC3_HUMAN		15	1960	+			A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Nonsense_Mutation	SNP	ENST00000298032.5	0	1	hg19	c.1876C>T	CCDS7142.1	0	.	.	.	.	.	.	.	.	.	.	c	37	6.353931	0.97498	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000409049;ENST00000376528	.	.	.	5.56	3.7	0.42460	5.56	3.7	0.42460	.	1.341930	0.04522	N	0.384715	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-12.0527	7.0747	0.25197	0.1702:0.7422:0.0:0.0875	.	.	.	.	X	626;626;626;363	.	ENSP00000298032:R626X	R	+	1	2	2	ARMC3	23337257	23337257	0.922000	0.31269	0.988000	0.46212	0.855000	0.48748	0.118000	0.15605	0.688000	0.31529	0.563000	0.77884	CGA	0.240506		TCGA-2J-AABT-01A-11D-A40W-08	0.279	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	0	0	1		2	2		0		0	0	86		86	85	1	2.020000	-11.583020	1	0.250000	NM_173081			8	8		135	133	0		1	0		0		86			0.989424	0		0		1		8	135
TUBGCP2	10844	broad.mit.edu	37	10	135106041	135106041	+	Silent	SNP	C	C	T			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr10:135106041C>T	ENST00000252936.3	-	7	1215	c.1176G>A	c.(1174-1176)gaG>gaA	p.E392E	TUBGCP2_ENST00000543663.1_Silent_p.E420E|TUBGCP2_ENST00000368563.2_Silent_p.E392E|TUBGCP2_ENST00000368562.1_5'Flank|TUBGCP2_ENST00000417178.2_Silent_p.E262E|RP11-122K13.12_ENST00000424450.1_RNA			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	392					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		AGATCCACTTCTCCAGAACCT	0.627																																						ENST00000252936.3	1.000000	0.690000	1	8.500000e-01	0.990000	0.947727	0.990000	1.000000																										0				35						c.(1174-1176)gaG>gaA		tubulin, gamma complex associated protein 2							126.0	101.0	110.0					10																	135106041		2203	4300	6503	SO:0001819	synonymous_variant	10844	0	0					g.chr10:135106041C>T	AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.1176G>A	chr10.hg19:g.135106041C>T		0					TUBGCP2_ENST00000368562.1_5'Flank|TUBGCP2_ENST00000417178.2_Silent_p.E262E|TUBGCP2_ENST00000368563.2_Silent_p.E392E|TUBGCP2_ENST00000543663.1_Silent_p.E420E|RP11-122K13.12_ENST00000424450.1_RNA	p.E392E			0	1	1	1.993395	Q9BSJ2	GCP2_HUMAN		7	1215	-		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Silent	SNP	ENST00000252936.3	0	1	hg19	c.1176G>A	CCDS7676.1	1																																																																																								0.248120		TCGA-2J-AABT-01A-11D-A40W-08	0.627	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1	0	0	1		2	2		0		0	0	75		75	74	1	2.020000	-20.000000	1	0.250000				24	24		160	156	0		1	1		0		75			1.000000	9.999456e-01		20		89		24	160
OR6T1	219874	broad.mit.edu	37	11	123813765	123813765	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr11:123813765G>A	ENST00000321252.2	-	1	815	c.781C>T	c.(781-783)Cgt>Tgt	p.R261C		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		TCTGACATACGAATGTAGAGA	0.517																																						ENST00000321252.2	1.000000	0.170000	4.000000e-01	2.300000e-01	0.300000	0.349547	0.300000	0.290000																										0				40						c.(781-783)Cgt>Tgt		olfactory receptor, family 6, subfamily T, member 1							202.0	171.0	182.0					11																	123813765		2202	4299	6501	SO:0001583	missense	219874	0	0					g.chr11:123813765G>A	AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.781C>T	chr11.hg19:g.123813765G>A	ENSP00000325203:p.Arg261Cys	0						p.R261C	NM_001005187.1	NP_001005187.1	1	2	3	2.017628	Q8NGN1	OR6T1_HUMAN		1	815	-		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)	Q6IFE7	Missense_Mutation	SNP	ENST00000321252.2	0	1	hg19	c.781C>T	CCDS31700.1	0	.	.	.	.	.	.	.	.	.	.	G	9.236	1.036985	0.19669	.	.	ENSG00000181499	ENST00000321252	T	0.35789	1.29	3.39	0.418	0.16429	3.39	0.418	0.16429	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.51160	0.1658	M	0.71920	2.185	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.36696	-0.9737	9	0.87932	D	0	-19.2553	3.5334	0.07785	0.3556:0.1954:0.449:0.0	.	261	Q8NGN1	OR6T1_HUMAN	C	261	ENSP00000325203:R261C	ENSP00000325203:R261C	R	-	1	0	0	OR6T1	123318975	123318975	0.000000	0.05858	0.006000	0.13384	0.169000	0.22640	-0.190000	0.09615	-0.114000	0.11936	0.563000	0.77884	CGT	0.256506		TCGA-2J-AABT-01A-11D-A40W-08	0.517	OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387264.1	0	0	1		2	2		0		0	0	156		156	156	1	2.020000	-3.200955	1	0.250000	NM_001005187			16	16		420	417	0		1			0		156			0.999932	0		0		0		16	420
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R|KRAS_ENST00000556131.1_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.650000	1	8.000000e-01	0.970000	0.921768	0.970000	1.000000	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	5144	Substitution - Missense(5142)|Insertion - In frame(2)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	25349	GRCh37	CM076251	KRAS	M	rs121913530	c.(34-36)Ggt>Cgt		Kirsten rat sarcoma viral oncogene homolog							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398285C>G	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	chr12.hg19:g.25398285C>G	ENSP00000256078:p.Gly12Arg	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	p.G12R	NM_033360.2	NP_203524.1	1	2	3	1.995188	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	97	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	0	1	hg19	c.34G>C	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	0	KRAS	25289552	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.250936		TCGA-2J-AABT-01A-11D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	0	0	1		2	2		0		0	0	128		128	127	1	2.020000	-11.944460	1	0.250000	NM_033360			24	24		173	170	0		1	1		0		128			1.000000	6.320314e-01		2		15		24	173
IKZF4	64375	broad.mit.edu	37	12	56420631	56420631	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr12:56420631G>A	ENST00000262032.5	+	8	720	c.353G>A	c.(352-354)cGg>cAg	p.R118Q	IKZF4_ENST00000547167.1_Missense_Mutation_p.R118Q|IKZF4_ENST00000548601.1_3'UTR|RP11-603J24.4_ENST00000551846.1_RNA|IKZF4_ENST00000431367.2_Missense_Mutation_p.R16Q|IKZF4_ENST00000547791.1_Missense_Mutation_p.R73Q			Q9H2S9	IKZF4_HUMAN	IKAROS family zinc finger 4 (Eos)	118					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|lung(3)|ovary(1)|prostate(1)	8			UCEC - Uterine corpus endometrioid carcinoma (6;0.025)|OV - Ovarian serous cystadenocarcinoma(18;0.123)			CCAGATGAGCGGCTCCTGGAA	0.572																																						ENST00000262032.5	0.590000	0.140000	4.500000e-01	2.100000e-01	0.310000	0.333663	0.310000	0.300000																										0				8						c.(352-354)cGg>cAg		IKAROS family zinc finger 4 (Eos)							48.0	53.0	52.0					12																	56420631		2123	4243	6366	SO:0001583	missense	64375	0	0					g.chr12:56420631G>A	AF230809	CCDS44917.1	12q13	2013-01-08	2006-08-25	2006-08-25		ENSG00000123411		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13179	protein-coding gene	gene with protein product		606239	"""zinc finger protein, subfamily 1A, 4 (Eos)"""	ZNFN1A4		10978333	Standard	NM_022465		Approved	Eos	uc001sjc.1	Q9H2S9		ENST00000262032.5:c.353G>A	chr12.hg19:g.56420631G>A	ENSP00000262032:p.Arg118Gln	0					IKZF4_ENST00000547791.1_Missense_Mutation_p.R73Q|IKZF4_ENST00000431367.2_Missense_Mutation_p.R16Q|IKZF4_ENST00000547167.1_Missense_Mutation_p.R118Q|RP11-603J24.4_ENST00000551846.1_RNA|IKZF4_ENST00000548601.1_3'UTR	p.R118Q			1	2	3	1.995188	Q9H2S9	IKZF4_HUMAN	UCEC - Uterine corpus endometrioid carcinoma (6;0.025)|OV - Ovarian serous cystadenocarcinoma(18;0.123)	8	720	+			Q96JP3	Missense_Mutation	SNP	ENST00000262032.5	0	1	hg19	c.353G>A	CCDS44917.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.513158	0.96402	.	.	ENSG00000123411	ENST00000262032;ENST00000431367;ENST00000547167;ENST00000547791	T;T;T;T	0.08282	3.13;3.14;3.13;3.11	5.08	5.08	0.68730	5.08	5.08	0.68730	.	0.000000	0.44688	D	0.000438	T	0.18635	0.0447	L	0.42245	1.32	0.58432	D	0.999998	P;D;P;D	0.76494	0.893;0.998;0.787;0.999	B;P;B;P	0.59761	0.148;0.863;0.103;0.733	T	0.00675	-1.1615	10	0.32370	T	0.25	-10.7923	17.3946	0.87441	0.0:0.0:1.0:0.0	.	16;73;77;118	G5E9S4;F8VPL6;Q9H2S9-2;Q9H2S9	.;.;.;IKZF4_HUMAN	Q	118;16;118;73	ENSP00000262032:R118Q;ENSP00000412101:R16Q;ENSP00000448419:R118Q;ENSP00000450020:R73Q	ENSP00000262032:R118Q	R	+	2	0	0	IKZF4	54706898	54706898	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.478000	0.73596	2.633000	0.89246	0.561000	0.74099	CGG	0.250936		TCGA-2J-AABT-01A-11D-A40W-08	0.572	IKZF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407590.1	0	0	1		2	2		0		0	0	85		85	85	1	2.020000	-9.357368	1	0.250000	NM_022465			7	7		180	176	0		1	0		0		85			0.979698	3.535799e-02		0		7		7	180
SRGAP1	57522	broad.mit.edu	37	12	64502748	64502748	+	Missense_Mutation	SNP	G	G	A	rs201404379		TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr12:64502748G>A	ENST00000355086.3	+	16	2374	c.1850G>A	c.(1849-1851)cGc>cAc	p.R617H	SRGAP1_ENST00000357825.3_Missense_Mutation_p.R594H|SRGAP1_ENST00000543397.1_Missense_Mutation_p.R554H|RP11-196H14.4_ENST00000535806.1_RNA	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	617	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CTTCACATCCGCAAACTCCTC	0.463																																						ENST00000355086.3	0.200000	0.030000	1.500000e-01	6.000000e-02	0.090000	0.108246	0.090000	0.100000																										0				65						c.(1849-1851)cGc>cAc		SLIT-ROBO Rho GTPase activating protein 1		G	HIS/ARG	0,4406		0,0,2203	150.0	131.0	137.0		1850	4.3	1.0	12		137	2,8598	2.2+/-6.3	0,2,4298	yes	missense	SRGAP1	NM_020762.2	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	617/1086	64502748	2,13004	2203	4300	6503	SO:0001583	missense	57522	11	121404	46				g.chr12:64502748G>A	AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.1850G>A	chr12.hg19:g.64502748G>A	ENSP00000347198:p.Arg617His	0					SRGAP1_ENST00000357825.3_Missense_Mutation_p.R594H|RP11-196H14.4_ENST00000535806.1_RNA|SRGAP1_ENST00000543397.1_Missense_Mutation_p.R554H	p.R617H	NM_020762.2	NP_065813.1	1	2	3	1.995188	Q7Z6B7	SRGP1_HUMAN	GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	16	2374	+			Q9H8A3|Q9P2P2	Missense_Mutation	SNP	ENST00000355086.3	0	1	hg19	c.1850G>A	CCDS8967.1	0	.	.	.	.	.	.	.	.	.	.	G	31	5.089520	0.94149	0.0	2.33E-4	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.20200	2.09;2.09;2.09	5.2	4.29	0.51040	5.2	4.29	0.51040	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.216473	0.22557	N	0.058512	T	0.39436	0.1078	L	0.52364	1.645	0.80722	D	1	D;B	0.89917	1.0;0.397	D;B	0.74023	0.982;0.119	T	0.10613	-1.0622	9	.	.	.	.	14.9023	0.70689	0.0708:0.0:0.9292:0.0	.	617;554	Q7Z6B7;G5EA48	SRGP1_HUMAN;.	H	617;594;554	ENSP00000347198:R617H;ENSP00000350480:R594H;ENSP00000437948:R554H	.	R	+	2	0	0	SRGAP1	62789015	62789015	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.722000	0.61958	1.496000	0.48567	0.650000	0.86243	CGC	0.250936		TCGA-2J-AABT-01A-11D-A40W-08	0.463	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1	0	0	1		10	2		1		1	1	223		223	222	1	2.020000	-1.692014	0	0.250000				6	6		507	498	0		0	0		1		223			0.213574	2.107323e-04		0		2		6	507
LTA4H	4048	broad.mit.edu	37	12	96412615	96412615	+	Missense_Mutation	SNP	A	A	C			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08			A	C	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr12:96412615A>C	ENST00000228740.2	-	8	919	c.778T>G	c.(778-780)Ttg>Gtg	p.L260V	LTA4H_ENST00000413268.2_Missense_Mutation_p.L236V|LTA4H_ENST00000552789.1_Missense_Mutation_p.L236V	NM_000895.2	NP_000886.1	P09960	LKHA4_HUMAN	leukotriene A4 hydrolase	260					arachidonic acid metabolic process (GO:0019369)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|peptide catabolic process (GO:0043171)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|leukotriene-A4 hydrolase activity (GO:0004463)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(3)|lung(4)|skin(2)|stomach(1)	12					Captopril(DB01197)	GGCAGGACCAATAGGTCATAC	0.403																																						ENST00000228740.2	1.000000	0.720000	1	8.600000e-01	0.990000	0.951988	0.990000	1.000000																										0				12						c.(778-780)Ttg>Gtg		leukotriene A4 hydrolase	Captopril(DB01197)						82.0	75.0	77.0					12																	96412615		2203	4300	6503	SO:0001583	missense	4048	0	0					g.chr12:96412615A>C	BC032528	CCDS9059.1, CCDS58266.1, CCDS58267.1	12q22	2005-10-06				ENSG00000111144	3.3.2.6		6710	protein-coding gene	gene with protein product		151570				7628486	Standard	NM_000895		Approved		uc001ten.2	P09960	OTTHUMG00000170355	ENST00000228740.2:c.778T>G	chr12.hg19:g.96412615A>C	ENSP00000228740:p.Leu260Val	0					LTA4H_ENST00000552789.1_Missense_Mutation_p.L236V|LTA4H_ENST00000413268.2_Missense_Mutation_p.L236V	p.L260V	NM_000895.2	NP_000886.1	1	2	3	1.995188	P09960	LKHA4_HUMAN		8	919	-			B4DNQ9|F8VV40|Q6IAT6|Q9UCT7	Missense_Mutation	SNP	ENST00000228740.2	0	1	hg19	c.778T>G	CCDS9059.1	1	.	.	.	.	.	.	.	.	.	.	A	15.89	2.966327	0.53507	.	.	ENSG00000111144	ENST00000228740;ENST00000552789;ENST00000413268	T;T;T	0.01933	4.55;4.55;4.55	5.29	-2.74	0.05932	5.29	-2.74	0.05932	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.04182	0.0116	L	0.49571	1.57	0.41510	D	0.988339	P;P;P	0.51933	0.788;0.949;0.935	P;P;P	0.50617	0.514;0.514;0.646	T	0.16512	-1.0400	10	0.33940	T	0.23	-11.7535	14.3716	0.66843	0.4175:0.0:0.5825:0.0	.	236;236;260	P09960-3;F8VV40;P09960	.;.;LKHA4_HUMAN	V	260;236;236	ENSP00000228740:L260V;ENSP00000449958:L236V;ENSP00000395051:L236V	ENSP00000228740:L260V	L	-	1	2	2	LTA4H	94936746	94936746	0.650000	0.27331	0.030000	0.17652	0.921000	0.55340	1.115000	0.31209	-0.393000	0.07739	-0.353000	0.07706	TTG	0.250936		TCGA-2J-AABT-01A-11D-A40W-08	0.403	LTA4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408655.1	0	0	1		2	2		0		0	0	114		114	114	1	2.020000	-20.000000	1	0.250000	NM_000895			32	32		217	215	0		1	1		0		114			1.000000	9.999988e-01		19		130		32	217
RIMBP2	23504	broad.mit.edu	37	12	130923012	130923012	+	Silent	SNP	G	G	A	rs144010117	byFrequency	TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr12:130923012G>A	ENST00000261655.4	-	9	1666	c.1503C>T	c.(1501-1503)ccC>ccT	p.P501P	RIMBP2_ENST00000536002.1_Silent_p.P409P|RIMBP2_ENST00000535703.1_Silent_p.P409P	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	501	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GGATGGTGGCGGGGGTCACCC	0.662																																						ENST00000261655.4	1.000000	0.540000	1	7.400000e-01	0.990000	0.902811	0.990000	1.000000																										0				96						c.(1501-1503)ccC>ccT		RIMS binding protein 2		G		1,4403	2.1+/-5.4	0,1,2201	32.0	30.0	31.0		1503	-10.0	0.0	12	dbSNP_134	31	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	RIMBP2	NM_015347.4		0,2,6499	AA,AG,GG		0.0116,0.0227,0.0154		501/1053	130923012	2,13000	2202	4299	6501	SO:0001819	synonymous_variant	23504	4	121388	35				g.chr12:130923012G>A	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1503C>T	chr12.hg19:g.130923012G>A		0					RIMBP2_ENST00000536002.1_Silent_p.P409P|RIMBP2_ENST00000535703.1_Silent_p.P409P	p.P501P	NM_015347.4	NP_056162.4	1	2	3	1.995188	O15034	RIMB2_HUMAN		9	1666	-	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)	Q96ID2	Silent	SNP	ENST00000261655.4	0	1	hg19	c.1503C>T	CCDS31925.1	1																																																																																								0.250936		TCGA-2J-AABT-01A-11D-A40W-08	0.662	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	0	0	1		2	2		0		0	0	42		42	41	1	2.020000	-18.191660	1	0.250000	NM_015347			11	11		78	75	0		1			0		42			0.998411	0		0		0		11	78
TPTE2	93492	broad.mit.edu	37	13	19999089	19999089	+	Missense_Mutation	SNP	G	G	C			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr13:19999089G>C	ENST00000400230.2	-	19	1508	c.1464C>G	c.(1462-1464)aaC>aaG	p.N488K	TPTE2_ENST00000390680.2_Missense_Mutation_p.N411K|TPTE2_ENST00000382975.4_Missense_Mutation_p.N448K|TPTE2_ENST00000382977.4_Missense_Mutation_p.N488K|TPTE2_ENST00000382978.1_Missense_Mutation_p.N448K|TPTE2_ENST00000255310.6_Missense_Mutation_p.N411K|TPTE2_ENST00000400103.2_Missense_Mutation_p.N377K|TPTE2_ENST00000457266.2_Missense_Mutation_p.N377K			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	488	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		ATTCATACCTGTTATTTTGAA	0.284																																						ENST00000400230.2	1.000000	0.480000	1	7.000000e-01	0.990000	0.887913	0.990000	1.000000																										0				65						c.(1462-1464)aaC>aaG		transmembrane phosphoinositide 3-phosphatase and tensin homolog 2							50.0	50.0	50.0					13																	19999089		2156	4285	6441	SO:0001583	missense	93492	0	0					g.chr13:19999089G>C	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.1464C>G	chr13.hg19:g.19999089G>C	ENSP00000383089:p.Asn488Lys	1					TPTE2_ENST00000382977.4_Missense_Mutation_p.N488K|TPTE2_ENST00000382975.4_Missense_Mutation_p.N448K|TPTE2_ENST00000255310.6_Missense_Mutation_p.N411K|TPTE2_ENST00000382978.1_Missense_Mutation_p.N448K|TPTE2_ENST00000457266.2_Missense_Mutation_p.N377K|TPTE2_ENST00000400103.2_Missense_Mutation_p.N377K|TPTE2_ENST00000390680.2_Missense_Mutation_p.N411K	p.N488K			2	2	4	2.249953	Q6XPS3	TPTE2_HUMAN		19	1508	-		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	0	1	hg19	c.1464C>G	CCDS45014.1	1	.	.	.	.	.	.	.	.	.	.	g	4.566	0.105142	0.08731	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000255310;ENST00000390680;ENST00000382977;ENST00000382975;ENST00000457266	D;D;D;D;D;D;D;D	0.85556	-2.0;-2.0;-2.0;-2.0;-2.0;-2.0;-2.0;-2.0	2.17	1.31	0.21738	2.17	1.31	0.21738	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.174919	0.48286	U	0.000185	T	0.80065	0.4555	L	0.52266	1.64	0.38754	D	0.954181	B;B;B	0.32324	0.117;0.216;0.364	B;B;B	0.39465	0.145;0.155;0.3	T	0.72001	-0.4422	9	.	.	.	-8.723	6.8494	0.24006	0.1572:0.0:0.8428:0.0	.	377;411;488	A8MX64;Q6XPS3-3;Q6XPS3	.;.;TPTE2_HUMAN	K	448;377;488;411;411;488;448;377	ENSP00000372438:N448K;ENSP00000382974:N377K;ENSP00000383089:N488K;ENSP00000255310:N411K;ENSP00000375098:N411K;ENSP00000372437:N488K;ENSP00000372435:N448K;ENSP00000442218:N377K	.	N	-	3	2	2	TPTE2	18897089	18897089	1.000000	0.71417	0.646000	0.29493	0.352000	0.29268	4.366000	0.59492	0.469000	0.27268	0.194000	0.17425	AAC	0.339207		TCGA-2J-AABT-01A-11D-A40W-08	0.284	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		0	0	1		2	2		0		0	0	38		38	38	1	2.020000	-6.589031	1	0.250000	NM_199254			9	9		84	82	0		1			0		38			0.994452	0		0		0		9	84
AKAP6	9472	broad.mit.edu	37	14	33292241	33292241	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr14:33292241C>T	ENST00000280979.4	+	13	5392	c.5222C>T	c.(5221-5223)tCt>tTt	p.S1741F	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1741					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GTTAATGTCTCTTGCACCTCT	0.473																																					Melanoma(49;821 1200 7288 13647 42351)	ENST00000280979.4	1.000000	0.760000	1	8.800000e-01	0.990000	0.955614	0.990000	1.000000																										0				122						c.(5221-5223)tCt>tTt		A kinase (PRKA) anchor protein 6							185.0	154.0	165.0					14																	33292241		2203	4300	6503	SO:0001583	missense	9472	0	0					g.chr14:33292241C>T	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.5222C>T	chr14.hg19:g.33292241C>T	ENSP00000280979:p.Ser1741Phe	0					AKAP6_ENST00000557272.1_Intron	p.S1741F	NM_004274.4	NP_004265.3	1	2	3	2.006271	Q13023	AKAP6_HUMAN	LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	13	5392	+	Breast(36;0.0388)|Prostate(35;0.15)		A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	0	1	hg19	c.5222C>T	CCDS9644.1	1	.	.	.	.	.	.	.	.	.	.	C	18.01	3.528551	0.64860	.	.	ENSG00000151320	ENST00000280979	T	0.14516	2.5	5.78	5.78	0.91487	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.40570	0.1122	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.11060	-1.0603	10	0.87932	D	0	-9.7292	19.6071	0.95585	0.0:1.0:0.0:0.0	.	1741	Q13023	AKAP6_HUMAN	F	1741	ENSP00000280979:S1741F	ENSP00000280979:S1741F	S	+	2	0	0	AKAP6	32361992	32361992	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	7.062000	0.76706	2.728000	0.93425	0.650000	0.86243	TCT	0.253731		TCGA-2J-AABT-01A-11D-A40W-08	0.473	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	0	0	1		2	2		0		0	0	211		211	210	1	2.020000	-3.221898	1	0.250000	NM_004274			52	52		364	361	0		1	0		0		211			1.000000	8.653554e-01		0		27		52	364
PRC1	9055	broad.mit.edu	37	15	91517846	91517846	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr15:91517846C>T	ENST00000361188.5	-	10	2530	c.1319G>A	c.(1318-1320)cGa>cAa	p.R440Q	PRC1_ENST00000361919.3_Missense_Mutation_p.R440Q|PRC1-AS1_ENST00000554388.1_RNA|PRC1-AS1_ENST00000556200.1_RNA|PRC1_ENST00000394249.3_Missense_Mutation_p.R440Q|PRC1_ENST00000442656.2_Missense_Mutation_p.R399Q|Y_RNA_ENST00000363272.1_RNA					protein regulator of cytokinesis 1											endometrium(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(3)|prostate(1)|skin(2)	25	Lung NSC(78;0.0987)|all_lung(78;0.175)					TTTCTCCAATCGATGCATCTC	0.443																																						ENST00000361188.5	0.230000	0.080000	1.900000e-01	1.000000e-01	0.140000	0.151333	0.140000	0.140000																										0				25						c.(1318-1320)cGa>cAa		protein regulator of cytokinesis 1							372.0	335.0	347.0					15																	91517846		2198	4298	6496	SO:0001583	missense	9055	6	121412	44				g.chr15:91517846C>T	AF044588	CCDS32334.1, CCDS45352.1, CCDS45353.1, CCDS45353.2	15q26.1	2013-05-29		2006-07-07	ENSG00000198901	ENSG00000198901			9341	protein-coding gene	gene with protein product	"""anaphase spindle elongation 1 homolog (S. cerevisiae)"""	603484				9885575	Standard	NM_003981		Approved	ASE1	uc002bqm.4	O43663	OTTHUMG00000171685	ENST00000361188.5:c.1319G>A	chr15.hg19:g.91517846C>T	ENSP00000354679:p.Arg440Gln	1					PRC1-AS1_ENST00000554388.1_RNA|PRC1-AS1_ENST00000556200.1_RNA|Y_RNA_ENST00000363272.1_RNA|PRC1_ENST00000394249.3_Missense_Mutation_p.R440Q|PRC1_ENST00000361919.3_Missense_Mutation_p.R440Q|PRC1_ENST00000442656.2_Missense_Mutation_p.R399Q	p.R440Q			0	1	1	1.766972				10	2530	-	Lung NSC(78;0.0987)|all_lung(78;0.175)			Missense_Mutation	SNP	ENST00000361188.5	0	1	hg19	c.1319G>A	CCDS45352.1	0	.	.	.	.	.	.	.	.	.	.	C	15.30	2.792465	0.50102	.	.	ENSG00000198901	ENST00000394249;ENST00000361919;ENST00000361188;ENST00000555455;ENST00000442656	T;T;T;T	0.37915	1.17;1.17;1.17;1.17	5.64	2.79	0.32731	5.64	2.79	0.32731	.	0.323197	0.33477	N	0.004866	T	0.23766	0.0575	L	0.33485	1.01	0.32416	N	0.550029	B;B;B;B	0.20887	0.009;0.009;0.006;0.049	B;B;B;B	0.18561	0.007;0.007;0.022;0.013	T	0.17623	-1.0363	10	0.30854	T	0.27	.	7.2242	0.26005	0.0:0.5634:0.0:0.4366	.	399;440;410;440	O43663-3;F8W9B5;O43663-2;O43663	.;.;.;PRC1_HUMAN	Q	440;440;440;43;399	ENSP00000377793:R440Q;ENSP00000354618:R440Q;ENSP00000354679:R440Q;ENSP00000409549:R399Q	ENSP00000354679:R440Q	R	-	2	0	0	PRC1	89318850	89318850	0.010000	0.17322	0.163000	0.22734	0.980000	0.70556	0.194000	0.17135	0.495000	0.27882	0.650000	0.86243	CGA	0.164345		TCGA-2J-AABT-01A-11D-A40W-08	0.443	PRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414760.1	0	0	1		2	2		0		0	0	403		403	396	1	2.020000	-2.566806	1	0.250000	NM_003981			15	15		737	729	0		1	0		0		403			0.999860	1.884966e-02		0		10		15	737
ADCY9	115	broad.mit.edu	37	16	4016226	4016226	+	Silent	SNP	G	G	A			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr16:4016226G>A	ENST00000294016.3	-	11	4150	c.3612C>T	c.(3610-3612)tgC>tgT	p.C1204C		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	1204					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CCTGGATGCGGCACTCCACGC	0.602																																						ENST00000294016.3	1.000000	0.050000	2.100000e-01	8.000000e-02	0.130000	0.216036	0.130000	0.130000																										0				47						c.(3610-3612)tgC>tgT		adenylate cyclase 9							152.0	132.0	139.0					16																	4016226		2197	4300	6497	SO:0001819	synonymous_variant	115	0	0					g.chr16:4016226G>A	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.3612C>T	chr16.hg19:g.4016226G>A		0						p.C1204C	NM_001116.3	NP_001107.2	1	2	3	2.040737	O60503	ADCY9_HUMAN		11	4150	-			A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Silent	SNP	ENST00000294016.3	0	1	hg19	c.3612C>T	CCDS32382.1	0																																																																																								0.260173		TCGA-2J-AABT-01A-11D-A40W-08	0.602	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1	0	0	1		2	2		0		0	0	183		183	182	1	2.020000	-2.114804	0	0.250000				7	7		453	450	0		1	0		0		183			0.980316	1.216905e-01		0		34		7	453
VAT1L	57687	broad.mit.edu	37	16	77910292	77910292	+	Missense_Mutation	SNP	G	G	A	rs200966564		TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr16:77910292G>A	ENST00000302536.2	+	5	901	c.748G>A	c.(748-750)Gtt>Att	p.V250I	VAT1L_ENST00000563850.1_3'UTR	NM_020927.1	NP_065978.1	Q9HCJ6	VAT1L_HUMAN	vesicle amine transport 1-like	250							oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(10)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24						TGTGGACATCGTTTTGGATTG	0.473													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19110	0.0		0.0	False		,,,				2504	0.0					ENST00000302536.2	1.000000	0.060000	2.200000e-01	1.000000e-01	0.150000	0.211735	0.150000	0.140000																										0				24						c.(748-750)Gtt>Att		vesicle amine transport 1-like							214.0	191.0	199.0					16																	77910292		2198	4300	6498	SO:0001583	missense	57687	2	121412	38				g.chr16:77910292G>A	AB046796	CCDS32492.1	16q23.1	2014-09-09	2013-08-23		ENSG00000171724	ENSG00000171724			29315	protein-coding gene	gene with protein product			"""vesicle amine transport protein 1 homolog (T. californica)-like"""			10997877	Standard	NM_020927		Approved	KIAA1576	uc002ffg.1	Q9HCJ6	OTTHUMG00000176845	ENST00000302536.2:c.748G>A	chr16.hg19:g.77910292G>A	ENSP00000303129:p.Val250Ile	0					VAT1L_ENST00000563850.1_3'UTR	p.V250I	NM_020927.1	NP_065978.1	1	2	3	2.025672	Q9HCJ6	VAT1L_HUMAN		5	901	+			Q8IYW8	Missense_Mutation	SNP	ENST00000302536.2	0	1	hg19	c.748G>A	CCDS32492.1	0	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	24.2	4.508695	0.85282	.	.	ENSG00000171724	ENST00000302536	T	0.33865	1.39	5.4	5.4	0.78164	5.4	5.4	0.78164	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.31136	0.0787	L	0.48986	1.54	0.80722	D	1	P	0.52170	0.951	B	0.40134	0.32	T	0.25257	-1.0137	10	0.02654	T	1	-20.162	19.1297	0.93400	0.0:0.0:1.0:0.0	.	250	Q9HCJ6	VAT1L_HUMAN	I	250	ENSP00000303129:V250I	ENSP00000303129:V250I	V	+	1	0	0	VAT1L	76467793	76467793	1.000000	0.71417	0.999000	0.59377	0.951000	0.60555	9.407000	0.97325	2.675000	0.91044	0.655000	0.94253	GTT	0.257426		TCGA-2J-AABT-01A-11D-A40W-08	0.473	VAT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434010.1	0	0	1		2	2		0		0	0	190		190	188	1	2.020000	-2.867996	1	0.250000	NM_020927			9	9		499	490	0		1	0		0		190			0.993812	1.362456e-02		0		9		9	499
SLC43A2	124935	broad.mit.edu	37	17	1489346	1489346	+	Splice_Site	SNP	C	C	T			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr17:1489346C>T	ENST00000301335.5	-	10	1167		c.e10-1		SLC43A2_ENST00000382147.4_Missense_Mutation_p.V364I|SLC43A2_ENST00000571650.1_Splice_Site|SLC43A2_ENST00000412517.3_Splice_Site	NM_001284498.1|NM_001284499.1	NP_001271427.1|NP_001271428.1	Q8N370	LAT4_HUMAN	solute carrier family 43 (amino acid system L transporter), member 2						amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-amino acid transmembrane transporter activity (GO:0015179)			endometrium(4)|large_intestine(4)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (25;0.0883)		TAGAGGCCAACTGTGGAGGAA	0.642																																						ENST00000301335.5	0.990000	0.270000	9.200000e-01	4.900000e-01	0.730000	0.712334	0.730000	0.990000																										0				12						c.e10-1		solute carrier family 43 (amino acid system L transporter), member 2							20.0	14.0	16.0					17																	1489346		2201	4294	6495	SO:0001630	splice_region_variant	124935	0	0					g.chr17:1489346C>T	BC027923	CCDS11006.1, CCDS67107.1, CCDS67108.1	17p13.3	2013-07-17	2013-07-17		ENSG00000167703	ENSG00000167703		"""Solute carriers"""	23087	protein-coding gene	gene with protein product		610791				23268354	Standard	NM_001284498		Approved	MGC34680	uc002fsv.3	Q8N370	OTTHUMG00000090345	ENST00000301335.5:c.1079-1G>A	chr17.hg19:g.1489346C>T		1					SLC43A2_ENST00000571650.1_Splice_Site|SLC43A2_ENST00000382147.4_Missense_Mutation_p.V364I|SLC43A2_ENST00000412517.3_Splice_Site		NM_001284498.1|NM_001284499.1	NP_001271427.1|NP_001271428.1	0	1	1	1.771318	Q8N370	LAT4_HUMAN		10	1167	-			B7Z6X9|C9JNU8|D3DTH9|Q5CD75|Q6IPM1|Q8NBX1|Q8NC21|Q8WZ00	Splice_Site	SNP	ENST00000301335.5	0	1	hg19		CCDS11006.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.160652|4.160652	0.78226|0.78226	.|.	.|.	ENSG00000167703|ENSG00000167703	ENST00000301335;ENST00000412517|ENST00000382147	.|T	.|0.80480	.|-1.38	5.71|5.71	5.71|5.71	0.89125|0.89125	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.87748	.|0.6255	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999997|0.999997	.|.	.|.	.|.	.|.	.|.	.|.	.|D	.|0.86025	.|0.1509	.|6	.|.	.|.	.|.	.|.	19.2052|19.2052	0.93728|0.93728	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	.|I	-1|364	.|ENSP00000371582:V364I	.|.	.|V	-|-	.|1	.|0	.|0	SLC43A2|SLC43A2	1436096|1436096	1436096|1436096	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.628000|0.628000	0.37860|0.37860	7.776000|7.776000	0.85560|0.85560	2.850000|2.850000	0.98022|0.98022	0.655000|0.655000	0.94253|0.94253	.|GTT	0.142857		TCGA-2J-AABT-01A-11D-A40W-08	0.642	SLC43A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206717.4	0	0	1		2	2		0		0	0	14		14	14	1	2.020000	-9.718824	1	0.250000	NM_152346	Intron		3	3		14	13	0		1	1		0		14			0.793255	5.263158e-02		2		0		3	14
TMEM132E	124842	broad.mit.edu	37	17	32953994	32953994	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr17:32953994G>A	ENST00000321639.5	+	3	974	c.646G>A	c.(646-648)Ggg>Agg	p.G216R		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	216						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		CCTCAAGCCCGGGGAAGTGCT	0.652																																						ENST00000321639.5	1.000000	0.790000	1	9.300000e-01	0.990000	0.974488	0.990000	1.000000																										0				57						c.(646-648)Ggg>Agg		transmembrane protein 132E							63.0	61.0	62.0					17																	32953994		2203	4300	6503	SO:0001583	missense	124842	0	0					g.chr17:32953994G>A	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.646G>A	chr17.hg19:g.32953994G>A	ENSP00000316532:p.Gly216Arg	0						p.G216R	NM_207313.1	NP_997196.1	1	2	3	2.037973	Q6IEE7	T132E_HUMAN		3	974	+			Q8WUF4|Q8WVA5	Missense_Mutation	SNP	ENST00000321639.5	0	1	hg19	c.646G>A	CCDS11283.1	1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.961826	0.74016	.	.	ENSG00000181291	ENST00000321639	T	0.24908	1.83	5.35	5.35	0.76521	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.31918	0.0812	M	0.64404	1.975	0.58432	D	0.999995	D	0.54772	0.968	B	0.42798	0.398	T	0.10753	-1.0616	10	0.42905	T	0.14	-38.6309	18.0519	0.89351	0.0:0.0:1.0:0.0	.	216	Q6IEE7	T132E_HUMAN	R	216	ENSP00000316532:G216R	ENSP00000316532:G216R	G	+	1	0	0	TMEM132E	29978107	29978107	1.000000	0.71417	0.925000	0.36789	0.992000	0.81027	7.804000	0.85993	2.484000	0.83849	0.442000	0.29010	GGG	0.260173		TCGA-2J-AABT-01A-11D-A40W-08	0.652	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	0	0	1		2	2		0		0	0	102		102	100	1	2.020000	-2.541042	1	0.250000	NM_207313			42	41		276	273	0		1			0		102			1.000000	0		0		0		42	276
RNF213	57674	broad.mit.edu	37	17	78321495	78321495	+	Silent	SNP	C	C	T	rs142096377		TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr17:78321495C>T	ENST00000582970.1	+	29	9503	c.9360C>T	c.(9358-9360)taC>taT	p.Y3120Y	RNF213_ENST00000336301.6_Silent_p.Y1193Y|RNF213_ENST00000508628.2_Silent_p.Y3169Y	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3120					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ACCAGTACTACGTCCACCTCG	0.547																																						ENST00000582970.1	1.000000	0.680000	1	8.000000e-01	0.940000	0.915862	0.940000	1.000000																										0				130						c.(9358-9360)taC>taT		ring finger protein 213		C		0,4406		0,0,2203	79.0	79.0	79.0		9507	-0.7	1.0	17	dbSNP_134	79	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	RNF213	NM_020914.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		3169/5257	78321495	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57674	3	121412	37				g.chr17:78321495C>T	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.9360C>T	chr17.hg19:g.78321495C>T		0					RNF213_ENST00000508628.2_Silent_p.Y3169Y|RNF213_ENST00000336301.6_Silent_p.Y1193Y	p.Y3120Y	NM_001256071.1	NP_001243000.1	1	2	3	2.027352	Q63HN8	RN213_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)	29	9503	+	all_neural(118;0.0538)		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	ENST00000582970.1	0	1	hg19	c.9360C>T	CCDS58606.1	1																																																																																								0.257426		TCGA-2J-AABT-01A-11D-A40W-08	0.547	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	0	0	1		2	2		0		0	0	112		112	109	1	2.020000	-20.000000	1	0.250000	NM_020914			38	38		291	283	0		1	1		0		112			1.000000	9.193734e-01		8		27		38	291
SNAPC2	6618	broad.mit.edu	37	19	7986996	7986996	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08			A	G	A	A		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr19:7986996A>G	ENST00000221573.6	+	4	500	c.449A>G	c.(448-450)aAg>aGg	p.K150R	SNAPC2_ENST00000597584.1_5'UTR|SNAPC2_ENST00000595035.1_3'UTR|CTD-3193O13.1_ENST00000564226.1_RNA	NM_003083.3	NP_003074.1	Q13487	SNPC2_HUMAN	small nuclear RNA activating complex, polypeptide 2, 45kDa	150					gene expression (GO:0010467)|snRNA transcription (GO:0009301)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|urinary_tract(1)	6						GCCCGTGGAAAGCCTTTGCTC	0.657																																						ENST00000221573.6	1.000000	0.610000	9.000000e-01	7.000000e-01	0.790000	0.807905	0.790000	0.800000																										0				6						c.(448-450)aAg>aGg		small nuclear RNA activating complex, polypeptide 2, 45kDa							96.0	108.0	104.0					19																	7986996		2203	4300	6503	SO:0001583	missense	6618	0	0					g.chr19:7986996A>G	U44898	CCDS12190.1	19p13	2008-07-22	2002-08-29			ENSG00000104976			11135	protein-coding gene	gene with protein product		605076	"""small nuclear RNA activating complex, polypeptide 2, 45kD"""			8633057	Standard	NM_003083		Approved	SNAP45, PTFdelta	uc002miw.2	Q13487		ENST00000221573.6:c.449A>G	chr19.hg19:g.7986996A>G	ENSP00000221573:p.Lys150Arg	0					SNAPC2_ENST00000595035.1_3'UTR|CTD-3193O13.1_ENST00000564226.1_RNA|SNAPC2_ENST00000597584.1_5'UTR	p.K150R	NM_003083.3	NP_003074.1	0	1	1	1.986460	Q13487	SNPC2_HUMAN		4	500	+			B2RBZ6|D6W663|Q13486	Missense_Mutation	SNP	ENST00000221573.6	0	1	hg19	c.449A>G	CCDS12190.1	0	.	.	.	.	.	.	.	.	.	.	a	10.51	1.370689	0.24771	.	.	ENSG00000104976	ENST00000221573	T	0.56275	0.47	4.33	-0.489	0.12052	4.33	-0.489	0.12052	.	0.299670	0.24150	N	0.041085	T	0.35885	0.0947	L	0.37561	1.115	0.09310	N	1	B	0.25235	0.121	B	0.26416	0.069	T	0.17992	-1.0351	10	0.29301	T	0.29	-17.8988	7.2806	0.26310	0.5075:0.0:0.4925:0.0	.	150	Q13487	SNPC2_HUMAN	R	150	ENSP00000221573:K150R	ENSP00000221573:K150R	K	+	2	0	0	SNAPC2	7892996	7892996	0.001000	0.12720	0.009000	0.14445	0.070000	0.16714	0.711000	0.25764	-0.049000	0.13379	0.449000	0.29647	AAG	0.246231		TCGA-2J-AABT-01A-11D-A40W-08	0.657	SNAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461358.1	0	0	1		2	2		0		0	0	239		239	236	1	2.020000	-20.000000	1	0.250000	NM_003083			59	59		526	519	0		1	1		0		239			1.000000	9.976347e-01		6		76		59	526
MUC16	94025	broad.mit.edu	37	19	9047851	9047851	+	Silent	SNP	C	C	T	rs149660691	byFrequency	TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr19:9047851C>T	ENST00000397910.4	-	5	33983	c.33780G>A	c.(33778-33780)ccG>ccA	p.P11260P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11262	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TATTTGTAAACGGCTCACCAG	0.478													C|||	2	0.000399361	0.0015	0.0	5008	,	,		22685	0.0		0.0	False		,,,				2504	0.0					ENST00000397910.4	0.710000	0.160000	5.500000e-01	2.500000e-01	0.380000	0.406172	0.380000	0.350000																										0				590						c.(33778-33780)ccG>ccA		mucin 16, cell surface associated				0,3880		0,0,1940	66.0	59.0	61.0		33780	0.8	0.0	19	dbSNP_134	61	1,8291		0,1,4145	no	coding-synonymous	MUC16	NM_024690.2		0,1,6085	TT,TC,CC		0.0121,0.0,0.0082		11260/14508	9047851	1,12171	1940	4146	6086	SO:0001819	synonymous_variant	94025	13	120870	39				g.chr19:9047851C>T	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.33780G>A	chr19.hg19:g.9047851C>T		0						p.P11260P	NM_024690.2	NP_078966.2	0	1	1	1.986460	Q8WXI7	MUC16_HUMAN		5	33983	-			Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	0	1	hg19	c.33780G>A	CCDS54212.1	0																																																																																								0.246231		TCGA-2J-AABT-01A-11D-A40W-08	0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	0	0	1		2	2		0		0	0	46		46	46	1	2.020000	-9.150232	1	0.250000	NM_024690			6	5		126	124	0		1			0		46			0.963575	0		0		0		6	126
NLRP9	338321	broad.mit.edu	37	19	56244155	56244155	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr19:56244155T>C	ENST00000332836.2	-	2	1069	c.1042A>G	c.(1042-1044)Aaa>Gaa	p.K348E		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	348	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		AGCCTCTGTTTCACACAAGTA	0.418																																						ENST00000332836.2	1.000000	0.650000	9.800000e-01	7.400000e-01	0.850000	0.858089	0.850000	1.000000																										0				74						c.(1042-1044)Aaa>Gaa		NLR family, pyrin domain containing 9							108.0	104.0	106.0					19																	56244155		2203	4300	6503	SO:0001583	missense	338321	0	0					g.chr19:56244155T>C	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1042A>G	chr19.hg19:g.56244155T>C	ENSP00000331857:p.Lys348Glu	0						p.K348E	NM_176820.2	NP_789790.2	1	2	3	2.000098	Q7RTR0	NALP9_HUMAN		2	1069	-		Colorectal(82;0.000133)|Ovarian(87;0.133)	B2RN12|Q86W27	Missense_Mutation	SNP	ENST00000332836.2	0	1	hg19	c.1042A>G	CCDS12934.1	1	.	.	.	.	.	.	.	.	.	.	T	13.86	2.363034	0.41902	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	D	0.83837	-1.77	2.56	2.56	0.30785	2.56	2.56	0.30785	.	.	.	.	.	D	0.88055	0.6334	M	0.67569	2.06	0.09310	N	1	D	0.71674	0.998	D	0.68765	0.96	T	0.76688	-0.2867	9	0.72032	D	0.01	.	9.0339	0.36275	0.0:0.0:0.0:1.0	.	348	Q7RTR0	NALP9_HUMAN	E	348	ENSP00000331857:K348E	ENSP00000331857:K348E	K	-	1	0	0	NLRP9	60935967	60935967	0.298000	0.24417	0.006000	0.13384	0.010000	0.07245	0.754000	0.26390	1.464000	0.47987	0.524000	0.50904	AAA	0.251870		TCGA-2J-AABT-01A-11D-A40W-08	0.418	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	0	0	1		2	2		0		0	0	253		253	248	1	2.020000	-20.000000	1	0.250000	NM_176820			54	53		452	447	0		1			0		253			1.000000	0		0		0		54	452
GPA33	10223	broad.mit.edu	37	1	167023589	167023589	+	Silent	SNP	C	C	T			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr1:167023589C>T	ENST00000367868.3	-	7	1285	c.942G>A	c.(940-942)ccG>ccA	p.P314P	GPA33_ENST00000527955.1_5'UTR|RP11-102C16.3_ENST00000417644.1_RNA	NM_005814.1	NP_005805.1	Q99795	GPA33_HUMAN	glycoprotein A33 (transmembrane)	314						extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						CGAGGTGGTCCGGGGATTCAC	0.597																																						ENST00000367868.3	1.000000	0.050000	2.400000e-01	9.000000e-02	0.140000	0.203268	0.140000	0.130000																										0				15						c.(940-942)ccG>ccA		glycoprotein A33 (transmembrane)							169.0	122.0	138.0					1																	167023589		2203	4300	6503	SO:0001819	synonymous_variant	10223	3	121412	36				g.chr1:167023589C>T	U79725	CCDS1258.1	1q24.1	2013-01-29			ENSG00000143167	ENSG00000143167		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	4445	protein-coding gene	gene with protein product		602171				9012807, 9245713	Standard	NM_005814		Approved	A33	uc001gea.1	Q99795	OTTHUMG00000034435	ENST00000367868.3:c.942G>A	chr1.hg19:g.167023589C>T		0					RP11-102C16.3_ENST00000417644.1_RNA|GPA33_ENST00000527955.1_5'UTR	p.P314P	NM_005814.1	NP_005805.1	1	2	3	2.020974	Q99795	GPA33_HUMAN		7	1285	-			Q5VZP6	Silent	SNP	ENST00000367868.3	0	1	hg19	c.942G>A	CCDS1258.1	0																																																																																								0.256506		TCGA-2J-AABT-01A-11D-A40W-08	0.597	GPA33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083245.1	0	0	1		2	2		0		0	0	115		115	112	1	2.020000	-2.502320	1	0.250000	NM_005814			5	5		300	296	0		1	0		0		115			0.935858	3.297064e-02		0		14		5	300
ADCY10	55811	broad.mit.edu	37	1	167870912	167870912	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr1:167870912G>A	ENST00000367851.4	-	5	608	c.424C>T	c.(424-426)Cga>Tga	p.R142*	ADCY10_ENST00000545172.1_Intron|ADCY10_ENST00000367848.1_Nonsense_Mutation_p.R50*	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	142	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						ATCTTGACTCGGATGTCTAGG	0.463																																						ENST00000367851.4	1.000000	0.720000	1	8.200000e-01	0.930000	0.922454	0.930000	1.000000																										0				63						c.(424-426)Cga>Tga		adenylate cyclase 10 (soluble)							170.0	164.0	166.0					1																	167870912		2203	4300	6503	SO:0001587	stop_gained	55811	1	121412	36				g.chr1:167870912G>A	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.424C>T	chr1.hg19:g.167870912G>A	ENSP00000356825:p.Arg142*	0					ADCY10_ENST00000367848.1_Nonsense_Mutation_p.R50*|ADCY10_ENST00000545172.1_Intron	p.R142*	NM_018417.4	NP_060887.2	1	2	3	2.020974	Q96PN6	ADCYA_HUMAN		5	608	-			B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Nonsense_Mutation	SNP	ENST00000367851.4	0	1	hg19	c.424C>T	CCDS1265.1	1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.613178	0.87359	.	.	ENSG00000143199	ENST00000367851;ENST00000367848	.	.	.	5.76	3.84	0.44239	5.76	3.84	0.44239	.	0.270367	0.26983	N	0.021504	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.6457	9.3555	0.38164	0.0:0.1576:0.6786:0.1638	.	.	.	.	X	142;50	.	ENSP00000356822:R50X	R	-	1	2	2	ADCY10	166137536	166137536	0.994000	0.37717	0.106000	0.21319	0.087000	0.18053	2.743000	0.47442	0.734000	0.32515	-0.323000	0.08544	CGA	0.256506		TCGA-2J-AABT-01A-11D-A40W-08	0.463	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	0	0	1		2	2		0		0	0	226		226	226	1	2.020000	-2.522914	1	0.250000	NM_018417			59	59		451	445	0		1			0		226			1.000000	0		0		0		59	451
WDR78	79819	broad.mit.edu	37	1	67279820	67279820	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr1:67279820G>A	ENST00000371026.3	-	17	2595	c.2540C>T	c.(2539-2541)tCa>tTa	p.S847L	WDR78_ENST00000431318.1_Missense_Mutation_p.S560L	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	847					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						GAATTATGCTGATTGGTTTGA	0.279																																						ENST00000371026.3	1.000000	0.500000	1	6.400000e-01	0.800000	0.807937	0.800000	1.000000																										0				32						c.(2539-2541)tCa>tTa		WD repeat domain 78							48.0	51.0	50.0					1																	67279820		2202	4280	6482	SO:0001583	missense	79819	0	0					g.chr1:67279820G>A	BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.2540C>T	chr1.hg19:g.67279820G>A	ENSP00000360065:p.Ser847Leu	0					WDR78_ENST00000431318.1_Missense_Mutation_p.S560L	p.S847L	NM_024763.4	NP_079039.4	1	2	3	2.036874	Q5VTH9	WDR78_HUMAN		17	2595	-			A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Missense_Mutation	SNP	ENST00000371026.3	0	1	hg19	c.2540C>T	CCDS635.1	0	.	.	.	.	.	.	.	.	.	.	G	4.759	0.141129	0.09083	.	.	ENSG00000152763	ENST00000371026;ENST00000431318;ENST00000464352	T;T;T	0.67171	0.32;-0.25;-0.25	3.71	0.529	0.17095	3.71	0.529	0.17095	.	2.548910	0.01224	N	0.008168	T	0.26159	0.0638	N	0.14661	0.345	0.09310	N	1	B;B	0.13594	0.004;0.008	B;B	0.11329	0.006;0.003	T	0.10989	-1.0606	10	0.42905	T	0.14	0.159	4.4702	0.11708	0.1105:0.0:0.5018:0.3877	.	560;847	Q5VTH9-3;Q5VTH9	.;WDR78_HUMAN	L	847;560;580	ENSP00000360065:S847L;ENSP00000393182:S560L;ENSP00000433682:S580L	ENSP00000360065:S847L	S	-	2	0	0	WDR78	67052408	67052408	0.165000	0.22948	0.158000	0.22627	0.038000	0.13279	0.455000	0.21843	0.126000	0.18424	0.643000	0.83706	TCA	0.259259		TCGA-2J-AABT-01A-11D-A40W-08	0.279	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025404.1	0	0	1		2	2		0		0	0	102		102	102	1	2.020000	-20.000000	1	0.250000	NM_024763			20	20		187	186	0		1			0		102			0.999996	0		0		0		20	187
KCNK2	3776	broad.mit.edu	37	1	215408265	215408265	+	Missense_Mutation	SNP	A	A	C			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr1:215408265A>C	ENST00000444842.2	+	7	1208	c.1058A>C	c.(1057-1059)gAc>gCc	p.D353A	KCNK2_ENST00000391895.2_Missense_Mutation_p.D349A|KCNK2_ENST00000391894.2_Missense_Mutation_p.D338A	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	353					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	GAGATTTATGACAAGTTCCAG	0.552																																						ENST00000444842.2	1.000000	0.830000	1	9.800000e-01	0.990000	0.985057	0.990000	1.000000																										0				30						c.(1057-1059)gAc>gCc		potassium channel, subfamily K, member 2	Dofetilide(DB00204)|Dronedarone(DB04855)						84.0	81.0	82.0					1																	215408265		2203	4300	6503	SO:0001583	missense	3776	0	0					g.chr1:215408265A>C	AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.1058A>C	chr1.hg19:g.215408265A>C	ENSP00000394033:p.Asp353Ala	0					KCNK2_ENST00000391894.2_Missense_Mutation_p.D338A|KCNK2_ENST00000391895.2_Missense_Mutation_p.D349A	p.D353A	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	1	2	3	2.020974	O95069	KCNK2_HUMAN		7	1208	+			A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	ENST00000444842.2	0	1	hg19	c.1058A>C	CCDS41467.1	1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.609139	0.87258	.	.	ENSG00000082482	ENST00000391895;ENST00000391894;ENST00000444842	T;T;T	0.26518	1.73;1.73;1.73	5.92	5.92	0.95590	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.42698	0.1214	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	0.996;0.987;1.0	D;P;D	0.91635	0.966;0.827;0.999	T	0.20207	-1.0282	10	0.49607	T	0.09	.	16.3634	0.83296	1.0:0.0:0.0:0.0	.	338;353;349	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	A	349;338;353	ENSP00000375765:D349A;ENSP00000375764:D338A;ENSP00000394033:D353A	ENSP00000375764:D338A	D	+	2	0	0	KCNK2	213474888	213474888	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.339000	0.96797	2.270000	0.75569	0.459000	0.35465	GAC	0.256506		TCGA-2J-AABT-01A-11D-A40W-08	0.552	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	0	0	1		2	2		0		0	0	116		116	111	1	2.020000	-3.323263	1	0.250000	NM_014217			36	36		217	215	0		1	0		0		116			1.000000	2.153799e-02		0		2		36	217
FOXS1	2307	broad.mit.edu	37	20	30432939	30432939	+	Missense_Mutation	SNP	G	G	A	rs370481154		TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr20:30432939G>A	ENST00000375978.3	-	1	481	c.407C>T	c.(406-408)gCg>gTg	p.A136V		NM_004118.3	NP_004109.1	O43638	FOXS1_HUMAN	forkhead box S1	136					blood vessel development (GO:0001568)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|positive regulation of multicellular organism growth (GO:0040018)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	9						CTGGCTGGTCGCCCTGAGGGG	0.706																																						ENST00000375978.3	1.000000	0.570000	1	7.900000e-01	0.990000	0.927177	0.990000	1.000000																										0				9						c.(406-408)gCg>gTg		forkhead box S1		G	VAL/ALA	0,4400		0,0,2200	13.0	14.0	14.0		407	-4.2	0.0	20		14	1,8583		0,1,4291	no	missense	FOXS1	NM_004118.3	64	0,1,6491	AA,AG,GG		0.0116,0.0,0.0077	benign	136/331	30432939	1,12983	2200	4292	6492	SO:0001583	missense	2307	3	121242	32				g.chr20:30432939G>A	AF042831	CCDS13192.1	20q11.1-q11.2	2008-04-10	2008-04-10	2008-04-10	ENSG00000179772	ENSG00000179772		"""Forkhead boxes"""	3735	protein-coding gene	gene with protein product		602939	"""forkhead (Drosophila)-like 18"", ""forkhead-like 18 (Drosophila)"""	FKHL18		9325056, 17062144	Standard	NM_004118		Approved	FREAC10	uc002wwt.1	O43638	OTTHUMG00000032183	ENST00000375978.3:c.407C>T	chr20.hg19:g.30432939G>A	ENSP00000365145:p.Ala136Val	0						p.A136V	NM_004118.3	NP_004109.1	1	2	3	2.054710	O43638	FOXS1_HUMAN		1	481	-			Q96D28	Missense_Mutation	SNP	ENST00000375978.3	0	1	hg19	c.407C>T	CCDS13192.1	1	.	.	.	.	.	.	.	.	.	.	G	8.545	0.874061	0.17395	0.0	1.16E-4	ENSG00000179772	ENST00000375978	D	0.93604	-3.25	4.47	-4.25	0.03766	4.47	-4.25	0.03766	.	0.753342	0.11194	N	0.589598	T	0.80874	0.4707	N	0.14661	0.345	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.67221	-0.5725	10	0.39692	T	0.17	.	0.731	0.00957	0.2316:0.2146:0.3362:0.2176	.	136	O43638	FOXS1_HUMAN	V	136	ENSP00000365145:A136V	ENSP00000365145:A136V	A	-	2	0	0	FOXS1	29896600	29896600	0.000000	0.05858	0.011000	0.14972	0.101000	0.19017	-0.227000	0.09126	-0.497000	0.06641	0.455000	0.32223	GCG	0.262899		TCGA-2J-AABT-01A-11D-A40W-08	0.706	FOXS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078560.2	0	0	1		2	2		0		0	0	24		24	23	1	2.020000	-18.613680	1	0.250000	NM_004118			11	11		76	73	0		1	0		0		24			0.998414	1.923269e-01		0		6		11	76
USP25	29761	broad.mit.edu	37	21	17205843	17205843	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr21:17205843G>T	ENST00000285679.6	+	17	2539	c.2170G>T	c.(2170-2172)Gag>Tag	p.E724*	USP25_ENST00000285681.2_Nonsense_Mutation_p.E724*|USP25_ENST00000351097.5_Intron|USP25_ENST00000400183.2_Nonsense_Mutation_p.E724*	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	724					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		GAAATTGAGAGAGTCAGAGAC	0.333																																						ENST00000285679.6	1.000000	0.750000	1	9.100000e-01	0.990000	0.968892	0.990000	1.000000																										0				52						c.(2170-2172)Gag>Tag		ubiquitin specific peptidase 25							44.0	46.0	45.0					21																	17205843		2203	4300	6503	SO:0001587	stop_gained	29761	0	0					g.chr21:17205843G>T	AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.2170G>T	chr21.hg19:g.17205843G>T	ENSP00000285679:p.Glu724*	0					USP25_ENST00000351097.5_Intron|USP25_ENST00000285681.2_Nonsense_Mutation_p.E724*|USP25_ENST00000400183.2_Nonsense_Mutation_p.E724*	p.E724*	NM_013396.3	NP_037528.3	0	0	0	1.918948	Q9UHP3	UBP25_HUMAN		17	2539	+			C0LSZ0|Q6DHZ9|Q9H9W1	Nonsense_Mutation	SNP	ENST00000285679.6	0	1	hg19	c.2170G>T	CCDS33515.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.346853	0.98228	.	.	ENSG00000155313	ENST00000285681;ENST00000285679;ENST00000400183	.	.	.	5.24	5.24	0.73138	5.24	5.24	0.73138	.	0.358668	0.31134	N	0.008185	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	14.7667	0.69646	0.0:0.1443:0.8557:0.0	.	.	.	.	X	724	.	ENSP00000285679:E724X	E	+	1	0	0	USP25	16127714	16127714	1.000000	0.71417	0.570000	0.28473	0.835000	0.47333	2.944000	0.49034	2.615000	0.88500	0.591000	0.81541	GAG	0.218750		TCGA-2J-AABT-01A-11D-A40W-08	0.333	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1	0	0	1		2	2		0		0	0	108		108	106	1	2.020000	-3.329622	1	0.250000				28	29		167	163	0		1	0		0		108			1.000000	9.895714e-01		1		45		28	167
TRIOBP	11078	broad.mit.edu	37	22	38130478	38130478	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr22:38130478C>T	ENST00000406386.3	+	9	4390	c.4135C>T	c.(4135-4137)Cct>Tct	p.P1379S		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1379					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					TCCTTGGAGTCCTGAGAAGAG	0.652																																						ENST00000406386.3			0	0																														0				12						c.(4135-4137)Cct>Tct		TRIO and F-actin binding protein							28.0	32.0	31.0					22																	38130478		1924	4120	6044	SO:0001583	missense	11078	0	0					g.chr22:38130478C>T	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.4135C>T	chr22.hg19:g.38130478C>T	ENSP00000384312:p.Pro1379Ser							p.P1379S	NM_001039141.2	NP_001034230.1					Q9H2D6	TARA_HUMAN		9	4390	+	Melanoma(58;0.0574)		B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	0	1	hg19	c.4135C>T	CCDS43015.1		.	.	.	.	.	.	.	.	.	.	C	10.50	1.366733	0.24771	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.29397	1.57	5.36	2.07	0.26955	5.36	2.07	0.26955	.	.	.	.	.	T	0.19327	0.0464	N	0.24115	0.695	0.21325	N	0.999724	B	0.19706	0.038	B	0.14023	0.01	T	0.21109	-1.0255	9	0.87932	D	0	.	6.1763	0.20444	0.1476:0.6905:0.0:0.1619	.	1379	Q9H2D6	TARA_HUMAN	S	1379;1340	ENSP00000384312:P1379S	ENSP00000384312:P1379S	P	+	1	0	0	TRIOBP	36460424	36460424	0.104000	0.21937	0.750000	0.31169	0.005000	0.04900	0.904000	0.28491	0.625000	0.30304	0.563000	0.77884	CCT			TCGA-2J-AABT-01A-11D-A40W-08	0.652	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2	0	0	0		2	2		0		0	0	42		42	42	1	2.020000	-15.182280	1	0.250000				9	8		81	80	0		1			0		42			0.994463	0		0		0		9	81
TRIOBP	11078	broad.mit.edu	37	22	38130531	38130531	+	Silent	SNP	C	C	T			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr22:38130531C>T	ENST00000406386.3	+	9	4443	c.4188C>T	c.(4186-4188)ccC>ccT	p.P1396P		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1396					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CGCTGCCCCCCAGGACATCAG	0.657																																						ENST00000406386.3			0	0																														0				12						c.(4186-4188)ccC>ccT		TRIO and F-actin binding protein							14.0	17.0	16.0					22																	38130531		1855	4075	5930	SO:0001819	synonymous_variant	11078	0	0					g.chr22:38130531C>T	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.4188C>T	chr22.hg19:g.38130531C>T								p.P1396P	NM_001039141.2	NP_001034230.1					Q9H2D6	TARA_HUMAN		9	4443	+	Melanoma(58;0.0574)		B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	ENST00000406386.3	0	1	hg19	c.4188C>T	CCDS43015.1																																																																																											TCGA-2J-AABT-01A-11D-A40W-08	0.657	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2	0	0	0		2	2		0		0	0	20		20	20	1	2.020000	-13.977350	1	0.250000				7	6		45	45	0		1			0		20			0.981935	0		0		0		7	45
POU3F3	5455	broad.mit.edu	37	2	105473188	105473188	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr2:105473188G>A	ENST00000361360.2	+	1	1220	c.1220G>A	c.(1219-1221)cGc>cAc	p.R407H	RP11-13J10.1_ENST00000598623.1_RNA	NM_006236.1	NP_006227.1	P20264	PO3F3_HUMAN	POU class 3 homeobox 3	407					central nervous system development (GO:0007417)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain ventricular zone progenitor cell division (GO:0021869)|metanephric ascending thin limb development (GO:0072218)|metanephric DCT cell differentiation (GO:0072240)|metanephric loop of Henle development (GO:0072236)|metanephric macula densa development (GO:0072227)|metanephric thick ascending limb development (GO:0072233)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12						GGCCGCAAGCGCAAGAAGCGG	0.647																																						ENST00000361360.2	1.000000	0.080000	3.900000e-01	1.400000e-01	0.240000	0.285608	0.240000	0.220000																										0				12						c.(1219-1221)cGc>cAc		POU class 3 homeobox 3							39.0	40.0	39.0					2																	105473188		2203	4300	6503	SO:0001583	missense	5455	0	0					g.chr2:105473188G>A		CCDS33265.1	2q12.1	2011-06-20	2007-07-13		ENSG00000198914	ENSG00000198914		"""Homeoboxes / POU class"""	9216	protein-coding gene	gene with protein product		602480	"""POU domain class 3, transcription factor 3"""				Standard	NM_006236		Approved	BRN1, OTF8	uc010ywg.2	P20264	OTTHUMG00000153067	ENST00000361360.2:c.1220G>A	chr2.hg19:g.105473188G>A	ENSP00000355001:p.Arg407His	0					RP11-13J10.1_ENST00000598623.1_RNA	p.R407H	NM_006236.1	NP_006227.1	1	2	3	2.006717	P20264	PO3F3_HUMAN		1	1220	+			P78379|Q4ZG25	Missense_Mutation	SNP	ENST00000361360.2	0	1	hg19	c.1220G>A	CCDS33265.1	0	.	.	.	.	.	.	.	.	.	.	G	22.9	4.353431	0.82243	.	.	ENSG00000198914	ENST00000361360	D	0.97303	-4.33	4.14	4.14	0.48551	4.14	4.14	0.48551	Homeodomain-related (1);Homeobox (3);POU (1);Homeodomain-like (1);	0.000000	0.64402	U	0.000017	D	0.99127	0.9699	H	0.99058	4.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98808	1.0742	10	0.87932	D	0	.	15.1857	0.72999	0.0:0.0:1.0:0.0	.	407	P20264	PO3F3_HUMAN	H	407	ENSP00000355001:R407H	ENSP00000355001:R407H	R	+	2	0	0	POU3F3	104839620	104839620	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.428000	0.80296	1.858000	0.53909	0.462000	0.41574	CGC	0.253731		TCGA-2J-AABT-01A-11D-A40W-08	0.647	POU3F3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329335.2	0	0	1		10	2		1		1	1	59		59	58	1	2.020000	-6.452658	1	0.250000				4	4		143	140	0		0			1		59			0.076583	0		0		0		4	143
TTN	7273	broad.mit.edu	37	2	179640850	179640850	+	Missense_Mutation	SNP	G	G	A	rs374203813		TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr2:179640850G>A	ENST00000591111.1	-	28	5965	c.5741C>T	c.(5740-5742)gCg>gTg	p.A1914V	TTN_ENST00000589042.1_Missense_Mutation_p.A1914V|TTN_ENST00000359218.5_Missense_Mutation_p.A1868V|TTN_ENST00000460472.2_Missense_Mutation_p.A1868V|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A1868V|TTN_ENST00000342992.6_Missense_Mutation_p.A1914V|RP11-88L24.4_ENST00000582038.2_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.A1914V			Q8WZ42	TITIN_HUMAN	titin	12751	Ig-like 9.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.A1868V(4)|p.A1914V(4)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGATTTTCCGCGGTGACCTT	0.458													G|||	1	0.000199681	0.0	0.0	5008	,	,		22651	0.0		0.001	False		,,,				2504	0.0					ENST00000591111.1	1.000000	0.990000	1	9.900000e-01	0.990000	0.999308	0.990000	1.000000																										8	Substitution - Missense(8)	p.A1868V(4)|p.A1914V(4)	prostate(5)|pancreas(3)	1448						c.(5740-5742)gCg>gTg		titin							216.0	214.0	215.0					2																	179640850		2203	4300	6503	SO:0001583	missense	7273	3	121410	40				g.chr2:179640850G>A	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.5741C>T	chr2.hg19:g.179640850G>A	ENSP00000465570:p.Ala1914Val	0					TTN_ENST00000360870.5_Missense_Mutation_p.A1914V|RP11-88L24.4_ENST00000582038.2_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A1914V|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.A1868V|TTN_ENST00000589042.1_Missense_Mutation_p.A1914V|TTN_ENST00000342175.6_Missense_Mutation_p.A1868V|TTN_ENST00000359218.5_Missense_Mutation_p.A1868V|TTN-AS1_ENST00000584485.1_RNA	p.A1914V			1	2	3	2.005369	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)	28	5965	-			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	0	1	hg19	c.5741C>T		1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.350863	0.41599	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66	5.1	5.1	0.69264	5.1	5.1	0.69264	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84884	0.5571	M	0.77616	2.38	0.43729	D	0.996215	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.998	D	0.86984	0.2106	9	0.87932	D	0	.	18.5142	0.90930	0.0:0.0:1.0:0.0	.	1868;1868;1868;1914;1914	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	V	1914;1868;1868;1868;1868;1914	ENSP00000343764:A1914V;ENSP00000434586:A1868V;ENSP00000340554:A1868V;ENSP00000352154:A1868V;ENSP00000354117:A1914V	ENSP00000340554:A1868V	A	-	2	0	0	TTN	179349095	179349095	1.000000	0.71417	0.948000	0.38648	0.995000	0.86356	9.817000	0.99352	2.385000	0.81259	0.609000	0.83330	GCG	0.253731		TCGA-2J-AABT-01A-11D-A40W-08	0.458	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	0	0	1		10	2		1		1	1	358		358	355	1	2.020000	-20.000000	1	0.250000	NM_133378			119	119		682	674	0		1			1		358			1.000000	0		0		0		119	682
HECW2	57520	broad.mit.edu	37	2	197189711	197189711	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr2:197189711T>C	ENST00000260983.3	-	6	916	c.734A>G	c.(733-735)cAc>cGc	p.H245R	HECW2_ENST00000409111.1_5'UTR	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	245	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						TACCTCTCGGTGCCAAATTGG	0.512																																						ENST00000260983.3	1.000000	0.710000	1	8.000000e-01	0.900000	0.903124	0.900000	1.000000																										0				113						c.(733-735)cAc>cGc		HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2							219.0	197.0	205.0					2																	197189711		2203	4300	6503	SO:0001583	missense	57520	0	0					g.chr2:197189711T>C	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.734A>G	chr2.hg19:g.197189711T>C	ENSP00000260983:p.His245Arg	0					HECW2_ENST00000409111.1_5'UTR	p.H245R	NM_020760.1	NP_065811.1	1	2	3	2.005369	Q9P2P5	HECW2_HUMAN		6	916	-			B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	0	1	hg19	c.734A>G	CCDS33354.1	1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.484512	0.84854	.	.	ENSG00000138411	ENST00000260983	T	0.40756	1.02	5.2	5.2	0.72013	5.2	5.2	0.72013	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.104523	0.64402	D	0.000004	T	0.36166	0.0957	L	0.41236	1.265	0.58432	D	0.999991	P	0.45176	0.852	B	0.39217	0.294	T	0.31752	-0.9932	10	0.59425	D	0.04	.	15.2329	0.73404	0.0:0.0:0.0:1.0	.	245	Q9P2P5	HECW2_HUMAN	R	245	ENSP00000260983:H245R	ENSP00000260983:H245R	H	-	2	0	0	HECW2	196897956	196897956	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.733000	0.68571	2.180000	0.69256	0.533000	0.62120	CAC	0.253731		TCGA-2J-AABT-01A-11D-A40W-08	0.512	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	0	0	1		2	2		0		0	0	289		289	288	1	2.020000	-19.999430	1	0.250000	NM_020760			67	66		527	519	0		1	0		0		289			1.000000	1.309875e-02		0		2		67	527
ADAM23	8745	broad.mit.edu	37	2	207345998	207345998	+	Missense_Mutation	SNP	G	G	A	rs146209053	byFrequency	TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr2:207345998G>A	ENST00000264377.3	+	3	803	c.475G>A	c.(475-477)Ggc>Agc	p.G159S	ADAM23_ENST00000374416.1_Missense_Mutation_p.G159S|ADAM23_ENST00000374415.3_Missense_Mutation_p.G159S	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	159					cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		TGAAGCCTTCGGCTCCAAATT	0.383													G|||	2	0.000399361	0.0015	0.0	5008	,	,		16245	0.0		0.0	False		,,,				2504	0.0				Melanoma(194;1127 2130 19620 24042 27855)	ENST00000264377.3	1.000000	0.930000	1	9.900000e-01	0.990000	0.996485	0.990000	1.000000																										0				51						c.(475-477)Ggc>Agc		ADAM metallopeptidase domain 23		G	SER/GLY	17,4389	24.3+/-50.5	0,17,2186	60.0	61.0	61.0		475	5.0	1.0	2	dbSNP_134	61	0,8600		0,0,4300	yes	missense	ADAM23	NM_003812.2	56	0,17,6486	AA,AG,GG		0.0,0.3858,0.1307	benign	159/833	207345998	17,12989	2203	4300	6503	SO:0001583	missense	8745	40	121384	46				g.chr2:207345998G>A	AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.475G>A	chr2.hg19:g.207345998G>A	ENSP00000264377:p.Gly159Ser	0					ADAM23_ENST00000374416.1_Missense_Mutation_p.G159S|ADAM23_ENST00000374415.3_Missense_Mutation_p.G159S	p.G159S	NM_003812.2	NP_003803.1	1	2	3	2.005369	O75077	ADA23_HUMAN		3	803	+			A2RU59	Missense_Mutation	SNP	ENST00000264377.3	0	1	hg19	c.475G>A	CCDS2369.1	1	.	.	.	.	.	.	.	.	.	.	G	19.76	3.887047	0.72410	0.003858	0.0	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	T;T;T	0.16324	2.35;2.35;2.35	5.04	5.04	0.67666	5.04	5.04	0.67666	Peptidase M12B, propeptide (1);	0.000000	0.56097	D	0.000038	T	0.34135	0.0887	M	0.78916	2.43	0.58432	D	0.999999	P	0.50156	0.932	P	0.49953	0.627	T	0.14337	-1.0476	10	0.51188	T	0.08	.	17.5095	0.87756	0.0:0.0:1.0:0.0	.	159	O75077	ADA23_HUMAN	S	159;159;53;159	ENSP00000264377:G159S;ENSP00000363537:G159S;ENSP00000363536:G159S	ENSP00000264377:G159S	G	+	1	0	0	ADAM23	207054243	207054243	1.000000	0.71417	0.980000	0.43619	0.898000	0.52572	4.933000	0.63484	2.492000	0.84095	0.650000	0.86243	GGC	0.253731		TCGA-2J-AABT-01A-11D-A40W-08	0.383	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	0	0	1		2	2		0		0	0	110		110	110	1	2.020000	-2.819802	1	0.250000	NM_003812			38	38		200	200	0		1	0		0		110			1.000000	4.412380e-01		0		9		38	200
RPP14	11102	broad.mit.edu	37	3	58302276	58302276	+	Missense_Mutation	SNP	A	A	C			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr3:58302276A>C	ENST00000445193.3	+	4	608	c.197A>C	c.(196-198)tAt>tCt	p.Y66S	RPP14_ENST00000295959.5_Missense_Mutation_p.Y66S|RPP14_ENST00000466547.1_Missense_Mutation_p.Y66S|RPP14_ENST00000477305.1_3'UTR|RPP14_ENST00000528153.1_5'Flank	NM_001098783.2	NP_001092253.1	O95059	RPP14_HUMAN	ribonuclease P/MRP 14kDa subunit	66					tRNA processing (GO:0008033)	nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)|RNA binding (GO:0003723)			large_intestine(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(55;0.000187)|KIRC - Kidney renal clear cell carcinoma(10;0.0102)|Kidney(10;0.0118)|OV - Ovarian serous cystadenocarcinoma(275;0.191)		ATCCTAACCTATGAAGAGAAG	0.418																																						ENST00000445193.3	1.000000	0.830000	1	9.400000e-01	0.990000	0.979692	0.990000	1.000000																										0				3						c.(196-198)tAt>tCt		ribonuclease P/MRP 14kDa subunit							171.0	158.0	162.0					3																	58302276		2203	4300	6503	SO:0001583	missense	11102	0	0					g.chr3:58302276A>C	AF001175	CCDS2888.1	3p21.2	2012-05-21	2007-06-26		ENSG00000163684	ENSG00000163684			30327	protein-coding gene	gene with protein product		606112	"""ribonuclease P 14kDa subunit"""			10024167, 11929972	Standard	NM_001098783		Approved	P14	uc031sah.1	O95059	OTTHUMG00000159152	ENST00000445193.3:c.197A>C	chr3.hg19:g.58302276A>C	ENSP00000412894:p.Tyr66Ser	0					RPP14_ENST00000295959.5_Missense_Mutation_p.Y66S|RPP14_ENST00000528153.1_5'Flank|RPP14_ENST00000477305.1_3'UTR|RPP14_ENST00000466547.1_Missense_Mutation_p.Y66S	p.Y66S	NM_001098783.2	NP_001092253.1	1	2	3	2.013508	O95059	RPP14_HUMAN		4	608	+			Q53X97	Missense_Mutation	SNP	ENST00000445193.3	0	1	hg19	c.197A>C	CCDS2888.1	1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.167997	0.78339	.	.	ENSG00000163684	ENST00000445193;ENST00000295959;ENST00000466547	.	.	.	5.81	4.63	0.57726	5.81	4.63	0.57726	.	0.222920	0.48286	D	0.000193	T	0.71970	0.3403	M	0.70275	2.135	0.42354	D	0.992384	D	0.69078	0.997	D	0.68621	0.959	T	0.74460	-0.3658	9	0.87932	D	0	-16.2431	10.9368	0.47249	0.8603:0.0:0.0:0.1397	.	66	O95059	RPP14_HUMAN	S	66	.	ENSP00000295959:Y66S	Y	+	2	0	0	RPP14	58277316	58277316	0.999000	0.42202	0.844000	0.33320	0.913000	0.54294	3.766000	0.55280	0.980000	0.38523	0.533000	0.62120	TAT	0.255583		TCGA-2J-AABT-01A-11D-A40W-08	0.418	RPP14-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353527.2	0	0	1		2	2		0		0	0	188		188	186	1	2.020000	-20.000000	1	0.250000	NM_007042			65	64		428	423	0		1	1		0		188			1.000000	8.853714e-01		4		23		65	428
LYSMD3	116068	broad.mit.edu	37	5	89814997	89814997	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr5:89814997G>A	ENST00000315948.6	-	3	704	c.560C>T	c.(559-561)tCg>tTg	p.S187L	LYSMD3_ENST00000509384.1_3'UTR|LYSMD3_ENST00000500869.2_Intron	NM_198273.1	NP_938014.1	Q7Z3D4	LYSM3_HUMAN	LysM, putative peptidoglycan-binding, domain containing 3	187						integral component of membrane (GO:0016021)				breast(2)|large_intestine(1)|lung(2)|prostate(1)|urinary_tract(1)	7		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;1.94e-31)|Epithelial(54;5.22e-26)|all cancers(79;2.42e-22)		TGTTAAGGCCGATACTACCTC	0.413																																						ENST00000315948.6	1.000000	0.770000	1	8.800000e-01	0.990000	0.957352	0.990000	1.000000																										0				7						c.(559-561)tCg>tTg		LysM, putative peptidoglycan-binding, domain containing 3							213.0	203.0	206.0					5																	89814997		1884	4116	6000	SO:0001583	missense	116068	2	120830	31				g.chr5:89814997G>A	BX537972	CCDS43338.1, CCDS68911.1	5q14.3	2010-12-09			ENSG00000176018	ENSG00000176018			26969	protein-coding gene	gene with protein product							Standard	NM_001286812		Approved	FLJ13542	uc003kjr.3	Q7Z3D4	OTTHUMG00000162667	ENST00000315948.6:c.560C>T	chr5.hg19:g.89814997G>A	ENSP00000314518:p.Ser187Leu	0					LYSMD3_ENST00000509384.1_3'UTR|LYSMD3_ENST00000500869.2_Intron	p.S187L	NM_198273.1	NP_938014.1	0	1	1	1.991856	Q7Z3D4	LYSM3_HUMAN		3	704	-		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)	Q5H9U0|Q6PEK0|Q9NTE9	Missense_Mutation	SNP	ENST00000315948.6	0	1	hg19	c.560C>T	CCDS43338.1	1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.273371	0.80580	.	.	ENSG00000176018;ENSG00000259141	ENST00000315948;ENST00000554351	T	0.16597	2.33	5.73	5.73	0.89815	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.42966	0.1226	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.04737	-1.0930	10	0.27082	T	0.32	-9.2471	19.8807	0.96899	0.0:0.0:1.0:0.0	.	187	Q7Z3D4	LYSM3_HUMAN	L	187	ENSP00000314518:S187L	ENSP00000314518:S187L	S	-	2	0	0	AC027323.1;LYSMD3	89850753	89850753	1.000000	0.71417	0.999000	0.59377	0.622000	0.37654	9.444000	0.97578	2.692000	0.91855	0.591000	0.81541	TCG	0.248120		TCGA-2J-AABT-01A-11D-A40W-08	0.413	LYSMD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369987.2	0	0	1		2	2		0		0	0	263		263	260	1	2.020000	-3.142709	1	0.250000	XM_371760			59	59		409	408	0		1	1		0		263			1.000000	8.033354e-01		4		19		59	409
ITPR3	3710	broad.mit.edu	37	6	33639826	33639826	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr6:33639826A>G	ENST00000374316.5	+	23	3809	c.2749A>G	c.(2749-2751)Atc>Gtc	p.I917V	ITPR3_ENST00000605930.1_Missense_Mutation_p.I917V			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	917					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	GCGGCGGTCCATCCAGGGCGT	0.637																																						ENST00000374316.5	1.000000	0.600000	1	7.300000e-01	0.890000	0.879634	0.890000	1.000000																										0				85						c.(2749-2751)Atc>Gtc		inositol 1,4,5-trisphosphate receptor, type 3	Caffeine(DB00201)						79.0	72.0	75.0					6																	33639826		2203	4300	6503	SO:0001583	missense	3710	1	121410	29				g.chr6:33639826A>G	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.2749A>G	chr6.hg19:g.33639826A>G	ENSP00000363435:p.Ile917Val	0					ITPR3_ENST00000605930.1_Missense_Mutation_p.I917V	p.I917V			0	0	0	1.970494	Q14573	ITPR3_HUMAN		23	3809	+			Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	0	1	hg19	c.2749A>G	CCDS4783.1	1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.012952	0.75161	.	.	ENSG00000096433	ENST00000374316	D	0.91631	-2.88	5.46	5.46	0.80206	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.88134	0.6355	M	0.61703	1.905	0.58432	D	0.999996	P	0.39326	0.668	B	0.40228	0.323	D	0.88114	0.2827	10	0.36615	T	0.2	-37.5928	15.5417	0.76057	1.0:0.0:0.0:0.0	.	917	Q14573	ITPR3_HUMAN	V	917	ENSP00000363435:I917V	ENSP00000363435:I917V	I	+	1	0	0	ITPR3	33747804	33747804	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.962000	0.93254	2.072000	0.62099	0.533000	0.62120	ATC	0.238579		TCGA-2J-AABT-01A-11D-A40W-08	0.637	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	0	0	1		2	2		0		0	0	73		73	73	1	2.020000	-20.000000	1	0.250000	NM_002224			24	24		186	184	0		1	1		0		73			1.000000	9.837154e-01		26		28		24	186
PPARD	5467	broad.mit.edu	37	6	35391924	35391924	+	Splice_Site	SNP	C	C	A			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr6:35391924C>A	ENST00000311565.4	+	7	975	c.626C>A	c.(625-627)gCg>gAg	p.A209E	PPARD_ENST00000540939.1_Splice_Site_p.A106E|PPARD_ENST00000444397.1_Splice_Site_p.A209E|PPARD_ENST00000448077.2_Splice_Site_p.A170E|PPARD_ENST00000360694.3_Splice_Site_p.A209E|PPARD_ENST00000418635.2_Splice_Site_p.A111E|PPARD_ENST00000337400.2_Splice_Site_p.A209E	NM_001171818.1	NP_001165289.1	Q03181	PPARD_HUMAN	peroxisome proliferator-activated receptor delta	209					adipose tissue development (GO:0060612)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|axon ensheathment (GO:0008366)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular response to hypoxia (GO:0071456)|cholesterol metabolic process (GO:0008203)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|fatty acid beta-oxidation (GO:0006635)|fatty acid catabolic process (GO:0009062)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)|lipid metabolic process (GO:0006629)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of inflammatory response (GO:0050728)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid biosynthetic process (GO:0008654)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epidermis development (GO:0045684)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|proteoglycan metabolic process (GO:0006029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to vitamin A (GO:0033189)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin A metabolic process (GO:0006776)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|linoleic acid binding (GO:0070539)|lipid binding (GO:0008289)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(4)|liver(2)|lung(9)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23					Bezafibrate(DB01393)|Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	AGCCACACGGCGGTGAGTGTT	0.597																																						ENST00000311565.4	0.500000	0.070000	3.700000e-01	1.400000e-01	0.230000	0.260434	0.230000	0.210000																										0				23						c.(625-627)gCg>gAg		peroxisome proliferator-activated receptor delta	Bezafibrate(DB01393)|Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)						35.0	34.0	35.0					6																	35391924		2203	4300	6503	SO:0001630	splice_region_variant	5467	0	0					g.chr6:35391924C>A	L07592	CCDS4803.1, CCDS4804.1, CCDS54994.1, CCDS54995.1	6p21.2	2013-01-16	2006-10-17		ENSG00000112033	ENSG00000112033		"""Nuclear hormone receptors"""	9235	protein-coding gene	gene with protein product		600409	"""peroxisome proliferative activated receptor, delta"""			1333051	Standard	NM_177435		Approved	NUC1, NUCII, FAAR, NR1C2	uc003okm.3	Q03181	OTTHUMG00000014567	ENST00000311565.4:c.627+1C>A	chr6.hg19:g.35391924C>A		0					PPARD_ENST00000418635.2_Splice_Site_p.A111E|PPARD_ENST00000360694.3_Splice_Site_p.A209E|PPARD_ENST00000448077.2_Splice_Site_p.A170E|PPARD_ENST00000540939.1_Splice_Site_p.A106E|PPARD_ENST00000337400.2_Splice_Site_p.A209E|PPARD_ENST00000444397.1_Splice_Site_p.A209E	p.A209E	NM_001171818.1	NP_001165289.1	0	0	0	1.970494	Q03181	PPARD_HUMAN		7	975	+			A8K6J6|B4E3V3|B6ZGS1|B7Z3W1|E9PE18|Q5D1P0|Q7Z5K0|Q9BUD4	Splice_Site	SNP	ENST00000311565.4	0	1	hg19	c.626C>A	CCDS4803.1	0	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704184	0.68615	.	.	ENSG00000112033	ENST00000448077;ENST00000360694;ENST00000418635;ENST00000444397;ENST00000311565;ENST00000337400;ENST00000540939	T;T;T;T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45	5.58	5.58	0.84498	5.58	5.58	0.84498	Nuclear hormone receptor, ligand-binding (1);	0.359711	0.29987	N	0.010699	T	0.33673	0.0871	L	0.27053	0.805	0.58432	D	0.999995	P;P;P;P	0.39311	0.667;0.53;0.667;0.573	B;B;B;B	0.26693	0.072;0.032;0.072;0.051	T	0.43376	-0.9395	10	0.10377	T	0.69	.	19.5633	0.95382	0.0:1.0:0.0:0.0	.	111;170;209;209	E9PE18;B7Z3W1;Q03181;F1D8S7	.;.;PPARD_HUMAN;.	E	170;209;111;209;209;209;106	ENSP00000414372:A170E;ENSP00000353916:A209E;ENSP00000413314:A111E;ENSP00000410837:A209E;ENSP00000310928:A209E;ENSP00000337063:A209E;ENSP00000443759:A106E	ENSP00000310928:A209E	A	+	2	0	0	PPARD	35499902	35499902	1.000000	0.71417	0.990000	0.47175	0.826000	0.46750	6.967000	0.76079	2.650000	0.89964	0.591000	0.81541	GCG	0.238579		TCGA-2J-AABT-01A-11D-A40W-08	0.597	PPARD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040288.1	0	0	1		2	2		0		0	0	66		66	64	1	2.020000	-6.394409	1	0.250000	NM_006238	Missense_Mutation		4	4		142	138	0		1	0		0		66			0.884808	7.326798e-01		0		89		4	142
WRN	7486	broad.mit.edu	37	8	30999101	30999101	+	Silent	SNP	C	C	T			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr8:30999101C>T	ENST00000298139.5	+	25	3372	c.3123C>T	c.(3121-3123)tgC>tgT	p.C1041C		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	1041					aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)	p.C1041C(1)		central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		TGAAGATTTGCGCCCTTACGA	0.403			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	ENST00000298139.5	0.210000	0.020000	1.400000e-01	5.000000e-02	0.090000	0.108653	0.090000	0.080000			yes	Rec		Werner Syndrome	yes	Rec		Werner Syndrome	8	8p12-p11.2	8p12-p11.2	7486	Mis, N, F, S	Werner syndrome (RECQL2)				"""L, E, M, O"""	L, E, M, O		osteosarcoma, meningioma, others			1	Substitution - coding silent(1)	p.C1041C(1)	endometrium(1)	60						c.(3121-3123)tgC>tgT	Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome, RecQ helicase-like							103.0	101.0	102.0					8																	30999101		2203	4300	6503	SO:0001819	synonymous_variant	7486	5	121412	39	Werner syndrome	Familial Cancer Database	WS, Adult Progeria	g.chr8:30999101C>T		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.3123C>T	chr8.hg19:g.30999101C>T		0						p.C1041C	NM_000553.4	NP_000544.2	1	2	3	2.000711	Q14191	WRN_HUMAN		25	3372	+		Breast(100;0.195)	A1KYY9	Silent	SNP	ENST00000298139.5	0	1	hg19	c.3123C>T	CCDS6082.1	0																																																																																								0.251870		TCGA-2J-AABT-01A-11D-A40W-08	0.403	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1	0	0	1		2	2		0		0	0	250		250	247	1	2.020000	-2.131783	0	0.250000				5	5		472	468	0		1	0		0		250			0.936459	3.614626e-03		0		7		5	472
PLEC	5339	broad.mit.edu	37	8	144992109	144992109	+	Silent	SNP	G	G	A			TCGA-2J-AABT-01A-11D-A40W-08	TCGA-2J-AABT-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	af1eac7d-1a66-417f-af21-9118d666f77e	79a263d5-26dd-4f6d-b97d-14c14f0bbce5	g.chr8:144992109G>A	ENST00000322810.4	-	32	12460	c.12291C>T	c.(12289-12291)ccC>ccT	p.P4097P	PLEC_ENST00000354958.2_Silent_p.P3938P|PLEC_ENST00000345136.3_Silent_p.P3960P|PLEC_ENST00000436759.2_Silent_p.P3987P|PLEC_ENST00000527096.1_Silent_p.P3983P|PLEC_ENST00000356346.3_Silent_p.P3946P|PLEC_ENST00000354589.3_Silent_p.P3960P|PLEC_ENST00000398774.2_Silent_p.P3928P|PLEC_ENST00000357649.2_Silent_p.P3964P	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4097	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						AGGCTGTGCCGGGGCGGATGA	0.627																																						ENST00000322810.4	1.000000	0.420000	1	5.800000e-01	0.770000	0.771725	0.770000	1.000000																										0				137						c.(12289-12291)ccC>ccT		plectin							28.0	34.0	32.0					8																	144992109		2110	4223	6333	SO:0001819	synonymous_variant	5339	0	0					g.chr8:144992109G>A	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.12291C>T	chr8.hg19:g.144992109G>A		0					PLEC_ENST00000436759.2_Silent_p.P3987P|PLEC_ENST00000354589.3_Silent_p.P3960P|PLEC_ENST00000527096.1_Silent_p.P3983P|PLEC_ENST00000357649.2_Silent_p.P3964P|PLEC_ENST00000354958.2_Silent_p.P3938P|PLEC_ENST00000345136.3_Silent_p.P3960P|PLEC_ENST00000356346.3_Silent_p.P3946P|PLEC_ENST00000398774.2_Silent_p.P3928P	p.P4097P	NM_201380.2	NP_958782.1	1	2	3	2.000711	Q15149	PLEC_HUMAN		32	12460	-			Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	0	1	hg19	c.12291C>T	CCDS43772.1	0																																																																																								0.251870		TCGA-2J-AABT-01A-11D-A40W-08	0.627	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	0	0	0		2	2		0		0	0	37		37	35	1	2.020000	-3.076210	1	0.250000	NM_000445			12	13		115	113	0		1	1		0		37			0.999233	1		97		327		12	115
