#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
ARHGAP22	58504	broad.mit.edu	37	10	49791051	49791051	+	Silent	SNP	G	G	A			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr10:49791051G>A	ENST00000249601.4	-	2	477	c.181C>T	c.(181-183)Ctg>Ttg	p.L61L	ARHGAP22_ENST00000417912.2_Silent_p.L61L|ARHGAP22_ENST00000435790.2_Silent_p.L67L|ARHGAP22_ENST00000491108.1_5'UTR	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	61	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TCCCCACGCAGCACAAACCAG	0.607																																						ENST00000249601.4	1.000000	0.060000	1	1.100000e-01	0.170000	0.325238	0.170000	0.150000																										0				18						c.(181-183)Ctg>Ttg		Rho GTPase activating protein 22							137.0	124.0	128.0					10																	49791051		2203	4300	6503	SO:0001819	synonymous_variant	58504	0	0					g.chr10:49791051G>A	AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.181C>T	chr10.hg19:g.49791051G>A		0					ARHGAP22_ENST00000435790.2_Silent_p.L67L|ARHGAP22_ENST00000491108.1_5'UTR|ARHGAP22_ENST00000417912.2_Silent_p.L61L	p.L61L	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	1	2	3	2.034036	Q7Z5H3	RHG22_HUMAN		2	477	-			A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Silent	SNP	ENST00000249601.4	0	1	hg19	c.181C>T	CCDS7227.1	0																																																																																								0.122548		TCGA-2J-AABV-01A-12D-A40W-08	0.607	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	0	0	1		2	2	2	0		0	0	183		183	180	1	2.010000	-2.166961	0	0.110000	NM_021226			6	6		732	723	0		1	0		0	0	183	0		0.963710	0	0	0	0	1	0	6	732
PPRC1	23082	broad.mit.edu	37	10	103907023	103907023	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr10:103907023G>A	ENST00000278070.2	+	9	4313	c.4274G>A	c.(4273-4275)cGc>cAc	p.R1425H	PPRC1_ENST00000413464.2_Intron|PPRC1_ENST00000489648.1_Intron|PPRC1_ENST00000370012.1_Missense_Mutation_p.R392H	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	1425	Arg-rich.|Necessary for interaction with CREB1 and NRF1.|Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		CGCCGAGGCCGCAACAGCCGT	0.627																																						ENST00000278070.2	1.000000	0.090000	1	1.600000e-01	0.260000	0.392621	0.260000	0.210000																										0				56						c.(4273-4275)cGc>cAc		peroxisome proliferator-activated receptor gamma, coactivator-related 1							77.0	69.0	71.0					10																	103907023		2203	4298	6501	SO:0001583	missense	23082	2	121412	37				g.chr10:103907023G>A	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.4274G>A	chr10.hg19:g.103907023G>A	ENSP00000278070:p.Arg1425His	0					PPRC1_ENST00000413464.2_Intron|PPRC1_ENST00000370012.1_Missense_Mutation_p.R392H|PPRC1_ENST00000489648.1_Intron	p.R1425H	NM_015062.3	NP_055877.3	1	2	3	2.034036	Q5VV67	PPRC1_HUMAN		9	4313	+		Colorectal(252;0.122)	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	ENST00000278070.2	0	1	hg19	c.4274G>A	CCDS7529.1	0	.	.	.	.	.	.	.	.	.	.	G	9.681	1.149221	0.21288	.	.	ENSG00000148840	ENST00000278070;ENST00000370012	T;T	0.37915	1.55;1.17	5.04	3.19	0.36642	5.040000	3.190000	0.366420	.	0.407952	0.26903	N	0.021907	T	0.26011	0.0634	L	0.31926	0.97	0.80722	D	1	B;B	0.19817	0.039;0.023	B;B	0.17433	0.018;0.005	T	0.04454	-1.0950	10	0.21014	T	0.42	.	11.9659	0.53035	0.1434:0.0:0.8566:0.0	.	1305;1425	Q5VV67-2;Q5VV67	.;PPRC1_HUMAN	H	1425;392	ENSP00000278070:R1425H;ENSP00000359029:R392H	ENSP00000278070:R1425H	R	+	2	0	0	PPRC1	103897013	103897013	1.000000	0.71417	1.000000	0.80357	0.431000	0.31685	2.955000	0.49121	0.805000	0.34159	-0.379000	0.06801	CGC	0.122548		TCGA-2J-AABV-01A-12D-A40W-08	0.627	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	0	0	1		2	2	2	0		0	0	100		100	98	1	2.010000	-2.257454	0	0.110000	NM_015062			5	5		419	391	0		1	0		0	0	100	0		0.925495	9.240606e-02	0	0	0	35	0	5	419
ATM	472	broad.mit.edu	37	11	108178642	108178642	+	Missense_Mutation	SNP	G	G	A	rs370680798	byFrequency	TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr11:108178642G>A	ENST00000452508.2	+	39	5882	c.5693G>A	c.(5692-5694)cGa>cAa	p.R1898Q	ATM_ENST00000278616.4_Missense_Mutation_p.R1898Q			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1898					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CACTTTTTCCGATGCTGTTTG	0.398			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)			G|||	5	0.000998403	0.0	0.0	5008	,	,		19894	0.0		0.0	False		,,,				2504	0.0051					ENST00000452508.2	1.000000	0.300000	1	4.700000e-01	0.710000	0.718618	0.710000	1.000000			yes	Rec	yes	Ataxia-telangiectasia	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	11q22.3	472	D, Mis, N, F, S	ataxia telangiectasia mutated				"""L, O"""	L, O		leukemia, lymphoma, medulloblastoma, glioma	T-PLL		0				448						c.(5692-5694)cGa>cAa	Genes defective in diseases associated with sensitivity to DNA damaging agents	ATM serine/threonine kinase	Caffeine(DB00201)	G	GLN/ARG	0,4402		0,0,2201	153.0	137.0	143.0		5693	4.1	0.2	11		143	1,8595	1.2+/-3.3	0,1,4297	no	missense	ATM	NM_000051.3	43	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	benign	1898/3057	108178642	1,12997	2201	4298	6499	SO:0001583	missense	472	34	121406	45	Ataxia Telangiectasia	Familial Cancer Database	AT, Louis-Bar syndrome	g.chr11:108178642G>A	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.5693G>A	chr11.hg19:g.108178642G>A	ENSP00000388058:p.Arg1898Gln	0	TSP Lung(14;0.12)				ATM_ENST00000278616.4_Missense_Mutation_p.R1898Q	p.R1898Q			0	1	1	1.997292	Q13315	ATM_HUMAN		39	5882	+		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	1	1	hg19	c.5693G>A	CCDS31669.1	0	.	.	.	.	.	.	.	.	.	.	G	11.32	1.603627	0.28534	0.0	1.16E-4	ENSG00000149311	ENST00000278616;ENST00000452508	T;T	0.74632	-0.86;-0.86	6.03	4.13	0.48395	6.030000	4.130000	0.483950	Armadillo-type fold (1);	0.264244	0.39274	N	0.001409	T	0.59321	0.2185	L	0.45137	1.4	0.09310	N	1	B	0.15473	0.013	B	0.04013	0.001	T	0.40646	-0.9552	10	0.15066	T	0.55	.	4.5798	0.12253	0.2461:0.0:0.6011:0.1528	.	1898	Q13315	ATM_HUMAN	Q	1898	ENSP00000278616:R1898Q;ENSP00000388058:R1898Q	ENSP00000278616:R1898Q	R	+	2	0	0	ATM	107683852	107683852	0.891000	0.30450	0.169000	0.22859	0.982000	0.71751	2.079000	0.41577	0.831000	0.34780	0.655000	0.94253	CGA	0.104583		TCGA-2J-AABV-01A-12D-A40W-08	0.398	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	0	0	1		2	2	2	0		0	0	46		46	46	1	2.010000	-4.021672	1	0.110000	NM_000051			6	6		151	151	0		1		1	0	0	46	323		0.965897	0	9.999537e-01	0	17	0	675	6	151
PACS1	55690	broad.mit.edu	37	11	66009102	66009102	+	Silent	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr11:66009102C>T	ENST00000320580.4	+	22	2667	c.2634C>T	c.(2632-2634)gtC>gtT	p.V878V	PACS1_ENST00000524815.1_Silent_p.V6V|PACS1_ENST00000529757.1_Silent_p.V414V	NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	878					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)		RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						TGACTGTGGTCACCAAAGAAA	0.582																																						ENST00000320580.4	0.750000	0.160000	5.700000e-01	2.600000e-01	0.400000	0.425942	0.400000	0.360000																									RBM14/PACS1(2)	0				37						c.(2632-2634)gtC>gtT		phosphofurin acidic cluster sorting protein 1							66.0	63.0	64.0					11																	66009102		2200	4295	6495	SO:0001819	synonymous_variant	55690	0	0					g.chr11:66009102C>T	AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.2634C>T	chr11.hg19:g.66009102C>T		0					PACS1_ENST00000529757.1_Silent_p.V414V|PACS1_ENST00000524815.1_Silent_p.V6V	p.V878V	NM_018026.3	NP_060496.2	0	1	1	1.997292	Q6VY07	PACS1_HUMAN		22	2667	+			Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Silent	SNP	ENST00000320580.4	0	1	hg19	c.2634C>T	CCDS8129.1	0	.	.	.	.	.	.	.	.	.	.	C	10.43	1.347801	0.24426	.	.	ENSG00000175115	ENST00000529677	.	.	.	5.42	4.52	0.55395	5.420000	4.520000	0.553950	.	.	.	.	.	T	0.59891	0.2227	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57917	-0.7728	4	.	.	.	-31.5432	9.2199	0.37370	0.0:0.7753:0.146:0.0787	.	.	.	.	Y	62	.	.	H	+	1	0	0	PACS1	65765678	65765678	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.624000	0.37018	1.448000	0.47680	0.655000	0.94253	CAC	0.104583		TCGA-2J-AABV-01A-12D-A40W-08	0.582	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391690.2	0	0	1		2	2	2	0		0	0	86		86	86	1	2.010000	-3.936919	1	0.110000	NM_018026			6	6		280	279	0		1	0		0	0	86	0		0.965039	1.653729e-02	0	1	0	7	0	6	280
ARHGEF12	23365	broad.mit.edu	37	11	120352231	120352231	+	Silent	SNP	G	G	A			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr11:120352231G>A	ENST00000397843.2	+	39	4666	c.4500G>A	c.(4498-4500)caG>caA	p.Q1500Q	ARHGEF12_ENST00000356641.3_Silent_p.Q1481Q|ARHGEF12_ENST00000532993.1_Silent_p.Q1397Q	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	1500					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		CAGATTCACAGAGCCAGATCA	0.458			T	MLL	AML																																	ENST00000397843.2	0.870000	0.260000	6.900000e-01	3.700000e-01	0.510000	0.541336	0.510000	0.490000				Dom	yes			Dom	yes		11	11q23.3	11q23.3	23365	T	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)				L	L	MLL		AML		0				61						c.(4498-4500)caG>caA		Rho guanine nucleotide exchange factor (GEF) 12							83.0	85.0	85.0					11																	120352231		1950	4148	6098	SO:0001819	synonymous_variant	23365	0	0					g.chr11:120352231G>A	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.4500G>A	chr11.hg19:g.120352231G>A		0					ARHGEF12_ENST00000532993.1_Silent_p.Q1397Q|ARHGEF12_ENST00000356641.3_Silent_p.Q1481Q	p.Q1500Q	NM_015313.2	NP_056128.1	0	1	1	1.997292	Q9NZN5	ARHGC_HUMAN		39	4666	+		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)	O15086|Q6P526	Silent	SNP	ENST00000397843.2	1	1	hg19	c.4500G>A	CCDS41727.1	0																																																																																								0.104583		TCGA-2J-AABV-01A-12D-A40W-08	0.458	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	0	0	1		2	2	2	0		0	0	128		128	128	1	2.010000	-2.920853	1	0.110000	NM_015313			10	10		346	340	0		1	0		0	0	128	0		0.996710	4.556887e-02	0	1	0	10	0	10	346
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	0.500000	1	7.100000e-01	0.990000	0.892641	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	1	2	3	2.072621	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.680000	5.680000	0.881260	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.133356		TCGA-2J-AABV-01A-12D-A40W-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1		2	2	2	0		0	0	90		90	90	1	2.010000	-4.629783	1	0.110000	NM_033360			11	11		220	217	0		1	0	1	0	0	90	162		0.998334	0	9.999582e-01	0	16	1	388	11	220
RAPGEF3	10411	broad.mit.edu	37	12	48144186	48144186	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr12:48144186C>T	ENST00000449771.2	-	7	782	c.694G>A	c.(694-696)Gag>Aag	p.E232K	RAPGEF3_ENST00000548919.1_Missense_Mutation_p.E190K|RAPGEF3_ENST00000549151.1_Missense_Mutation_p.E190K|RAPGEF3_ENST00000549347.1_5'Flank|RAPGEF3_ENST00000395358.3_Missense_Mutation_p.E232K|RAPGEF3_ENST00000389212.3_Missense_Mutation_p.E232K|RAPGEF3_ENST00000171000.4_Missense_Mutation_p.E190K|RAPGEF3_ENST00000405493.2_Missense_Mutation_p.E190K			O95398	RPGF3_HUMAN	Rap guanine nucleotide exchange factor (GEF) 3	232	Interaction with PDE3B.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of stress fiber assembly (GO:0051496)|Rap protein signal transduction (GO:0032486)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(7)	25	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		AGGTCCAGCTCTTCATCCGTG	0.647																																						ENST00000449771.2	1.000000	0.310000	1	4.800000e-01	0.720000	0.729774	0.720000	1.000000																										0				25						c.(694-696)Gag>Aag		Rap guanine nucleotide exchange factor (GEF) 3							96.0	67.0	77.0					12																	48144186		2203	4300	6503	SO:0001583	missense	10411	0	0					g.chr12:48144186C>T	AK092448	CCDS31784.1, CCDS41775.1	12q13.1	2006-04-12	2004-03-26		ENSG00000079337	ENSG00000079337			16629	protein-coding gene	gene with protein product	"""exchange protein directly activated by cAMP 1"""	606057	"""RAP guanine-nucleotide-exchange factor (GEF) 3"""			10777494, 9856955	Standard	NM_001098531		Approved	cAMP-GEFI, EPAC, bcm910	uc001rpz.4	O95398	OTTHUMG00000133667	ENST00000449771.2:c.694G>A	chr12.hg19:g.48144186C>T	ENSP00000395708:p.Glu232Lys	0					RAPGEF3_ENST00000548919.1_Missense_Mutation_p.E190K|RAPGEF3_ENST00000389212.3_Missense_Mutation_p.E232K|RAPGEF3_ENST00000549347.1_5'Flank|RAPGEF3_ENST00000405493.2_Missense_Mutation_p.E190K|RAPGEF3_ENST00000171000.4_Missense_Mutation_p.E190K|RAPGEF3_ENST00000395358.3_Missense_Mutation_p.E232K|RAPGEF3_ENST00000549151.1_Missense_Mutation_p.E190K	p.E232K			0	1	1	1.989734	O95398	RPGF3_HUMAN		7	782	-	Lung SC(27;0.192)		A8K2G5|E7EQC8|O95634|Q8WVN0	Missense_Mutation	SNP	ENST00000449771.2	0	1	hg19	c.694G>A	CCDS41775.1	0	.	.	.	.	.	.	.	.	.	.	C	32	5.106652	0.94292	.	.	ENSG00000079337	ENST00000405493;ENST00000449771;ENST00000549151;ENST00000171000;ENST00000389211;ENST00000389212;ENST00000397089;ENST00000548919;ENST00000395358;ENST00000466322	D;D;D;D;D;D;D;T	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86;-1.86;-1.86;0.46	3.9	3.9	0.45041	3.900000	3.900000	0.450410	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	0.058568	0.64402	D	0.000003	D	0.89378	0.6698	L	0.52011	1.625	0.80722	D	1	D;D;D	0.76494	0.999;0.995;0.991	D;D;P	0.68765	0.96;0.91;0.777	D	0.90439	0.4430	10	0.72032	D	0.01	.	15.7057	0.77580	0.0:1.0:0.0:0.0	.	244;232;232	B7Z5J6;O95398-2;O95398	.;.;RPGF3_HUMAN	K	190;232;190;190;190;232;244;190;232;190	ENSP00000384521:E190K;ENSP00000395708:E232K;ENSP00000448619:E190K;ENSP00000171000:E190K;ENSP00000373864:E232K;ENSP00000448480:E190K;ENSP00000378764:E232K;ENSP00000446731:E190K	ENSP00000171000:E190K	E	-	1	0	0	RAPGEF3	46430453	46430453	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.063000	0.76714	2.479000	0.83701	0.655000	0.94253	GAG	0.102596		TCGA-2J-AABV-01A-12D-A40W-08	0.647	RAPGEF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257848.1	0	0	1		2	2	2	0		0	0	42		42	42	1	2.010000	-8.916830	1	0.110000	NM_006105			6	6		147	146	0		1	0		0	0	42	0		0.965217	1.285889e-02	0	0	0	4	0	6	147
DDN	23109	broad.mit.edu	37	12	49391585	49391585	+	Silent	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr12:49391585C>T	ENST00000421952.2	-	2	1095	c.1074G>A	c.(1072-1074)ccG>ccA	p.P358P	RP11-386G11.5_ENST00000547395.1_RNA|RP11-386G11.5_ENST00000552284.1_RNA|RP11-386G11.5_ENST00000552933.1_RNA|RP11-386G11.5_ENST00000547866.1_RNA|RP11-386G11.3_ENST00000549516.1_RNA	NM_015086.1	NP_055901.2	O94850	DEND_HUMAN	dendrin	358	Interaction with ACTN1.					cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	8						GAGCGGGATGCGGGGCACAGG	0.597																																						ENST00000421952.2	0.740000	0.140000	5.600000e-01	2.400000e-01	0.370000	0.404851	0.370000	0.330000																										0				8						c.(1072-1074)ccG>ccA		dendrin							37.0	38.0	38.0					12																	49391585		2203	4300	6503	SO:0001819	synonymous_variant	23109	0	0					g.chr12:49391585C>T	AB018292	CCDS31791.2	12q13	2008-02-05			ENSG00000181418	ENSG00000181418			24458	protein-coding gene	gene with protein product		610588					Standard	NM_015086		Approved	KIAA0749	uc001rsv.1	O94850	OTTHUMG00000156183	ENST00000421952.2:c.1074G>A	chr12.hg19:g.49391585C>T		0					RP11-386G11.3_ENST00000549516.1_RNA|RP11-386G11.5_ENST00000552284.1_RNA|RP11-386G11.5_ENST00000547395.1_RNA|RP11-386G11.5_ENST00000547866.1_RNA|RP11-386G11.5_ENST00000552933.1_RNA	p.P358P	NM_015086.1	NP_055901.2	0	1	1	1.989734	O94850	DEND_HUMAN		2	1095	-				Silent	SNP	ENST00000421952.2	0	1	hg19	c.1074G>A	CCDS31791.2	0																																																																																								0.102596		TCGA-2J-AABV-01A-12D-A40W-08	0.597	DDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343335.1	0	0	1		2	2	2	0		0	0	65		65	64	1	2.010000	-3.294345	1	0.110000				5	5		251	245	0		1			0	0	65	0		0.934185	0	0	0	0	0	0	5	251
SCN8A	6334	broad.mit.edu	37	12	52145205	52145205	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr12:52145205G>A	ENST00000354534.6	+	14	2376	c.2198G>A	c.(2197-2199)tGg>tAg	p.W733*	SCN8A_ENST00000550891.1_Nonsense_Mutation_p.W733*|SCN8A_ENST00000545061.1_Nonsense_Mutation_p.W733*	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	733					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	TTCCTCATCTGGGAGTGCCAC	0.443																																						ENST00000354534.6	1.000000	0.510000	9.000000e-01	6.200000e-01	0.750000	0.765723	0.750000	1.000000																										0				55						c.(2197-2199)tGg>tAg		sodium channel, voltage gated, type VIII, alpha subunit	Valproic Acid(DB00313)						190.0	176.0	181.0					12																	52145205		1914	4130	6044	SO:0001587	stop_gained	6334	0	0					g.chr12:52145205G>A	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.2198G>A	chr12.hg19:g.52145205G>A	ENSP00000346534:p.Trp733*	0					SCN8A_ENST00000545061.1_Nonsense_Mutation_p.W733*|SCN8A_ENST00000550891.1_Nonsense_Mutation_p.W733*	p.W733*	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	0	1	1	1.989734	Q9UQD0	SCN8A_HUMAN		14	2376	+			B9VWG8|O95788|Q9NYX2|Q9UPB2	Nonsense_Mutation	SNP	ENST00000354534.6	0	1	hg19	c.2198G>A	CCDS44891.1	0	.	.	.	.	.	.	.	.	.	.	G	40	7.924604	0.98563	.	.	ENSG00000196876	ENST00000550891;ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961	.	.	.	4.91	4.91	0.64330	4.910000	4.910000	0.643300	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.667	0.91493	0.0:0.0:1.0:0.0	.	.	.	.	X	733;733;733;733;646	.	ENSP00000346534:W733X	W	+	2	0	0	SCN8A	50431472	50431472	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.727000	0.93392	0.650000	0.86243	TGG	0.102596		TCGA-2J-AABV-01A-12D-A40W-08	0.443	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	1	0	1		2	2	2	0		0	0	194		194	193	1	2.010000	-2.419650	0	0.110000	NM_014191			29	29		663	649	0		1			0	0	194	0		1.000000	0	0	0	0	0	0	29	663
DGKA	1606	broad.mit.edu	37	12	56333270	56333270	+	Silent	SNP	C	C	T	rs372105083		TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr12:56333270C>T	ENST00000331886.5	+	9	1120	c.666C>T	c.(664-666)tgC>tgT	p.C222C	DGKA_ENST00000549079.2_3'UTR|DGKA_ENST00000394147.1_Silent_p.C222C|DGKA_ENST00000551156.1_Silent_p.C222C	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	222					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	GCAATCTGTGCGAGTCAAGCA	0.557																																						ENST00000331886.5	0.370000	0.070000	2.800000e-01	1.200000e-01	0.190000	0.209016	0.190000	0.180000																										0				25						c.(664-666)tgC>tgT		diacylglycerol kinase, alpha 80kDa	Vitamin E(DB00163)	C	,,,	0,4406		0,0,2203	173.0	157.0	163.0		666,666,666,666	2.1	1.0	12		163	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	DGKA	NM_001345.4,NM_201444.2,NM_201445.1,NM_201554.1	,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,	222/736,222/736,222/736,222/736	56333270	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1606	1	121412	34				g.chr12:56333270C>T	AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.666C>T	chr12.hg19:g.56333270C>T		0					DGKA_ENST00000551156.1_Silent_p.C222C|DGKA_ENST00000549079.2_3'UTR|DGKA_ENST00000394147.1_Silent_p.C222C	p.C222C	NM_001345.4	NP_001336.2	0	1	1	1.989734	P23743	DGKA_HUMAN		9	1120	+			O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Silent	SNP	ENST00000331886.5	0	1	hg19	c.666C>T	CCDS8896.1	0																																																																																								0.102596		TCGA-2J-AABV-01A-12D-A40W-08	0.557	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407291.1	0	0	1		2	2	2	0		0	0	146		146	145	1	2.010000	-2.179401	0	0.110000				6	6		587	576	0		1			0	0	146	0		0.963042	0	0	0	0	0	0	6	587
METTL3	56339	broad.mit.edu	37	14	21967676	21967676	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr14:21967676C>T	ENST00000298717.4	-	8	1563	c.1412G>A	c.(1411-1413)cGt>cAt	p.R471H		NM_019852.3	NP_062826.2	Q86U44	MTA70_HUMAN	methyltransferase like 3	471					circadian rhythm (GO:0007623)|gene expression (GO:0010467)|mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|RNA methylation (GO:0001510)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		GTGACCTGTACGGCCTGTCCG	0.443																																						ENST00000298717.4	1.000000	0.390000	9.900000e-01	4.900000e-01	0.620000	0.672269	0.620000	0.600000																										0				20						c.(1411-1413)cGt>cAt		methyltransferase like 3							168.0	158.0	161.0					14																	21967676		2203	4300	6503	SO:0001583	missense	56339	0	0					g.chr14:21967676C>T	AF014837	CCDS32044.1	14q11.1	2012-06-12			ENSG00000165819	ENSG00000165819	2.1.1.62		17563	protein-coding gene	gene with protein product	"""N6-adenosine-methyltransferase 70 kDa subunit"""	612472					Standard	XM_006720206		Approved	Spo8, M6A, MT-A70	uc001wbc.3	Q86U44	OTTHUMG00000168825	ENST00000298717.4:c.1412G>A	chr14.hg19:g.21967676C>T	ENSP00000298717:p.Arg471His	0						p.R471H	NM_019852.3	NP_062826.2	1	2	3	2.021859	Q86U44	MTA70_HUMAN	Epithelial(56;6.61e-06)	8	1563	-	all_cancers(95;0.000628)		O14736|Q86V05|Q9HB32	Missense_Mutation	SNP	ENST00000298717.4	1	1	hg19	c.1412G>A	CCDS32044.1	0	.	.	.	.	.	.	.	.	.	.	C	24.4	4.527083	0.85706	.	.	ENSG00000165819	ENST00000298717	T	0.43688	0.94	4.9	4.02	0.46733	4.900000	4.020000	0.467330	.	0.000000	0.85682	D	0.000000	T	0.64681	0.2620	M	0.82132	2.575	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69822	-0.5041	10	0.87932	D	0	-9.3172	12.3983	0.55397	0.0:0.9167:0.0:0.0833	.	471	Q86U44	MTA70_HUMAN	H	471	ENSP00000298717:R471H	ENSP00000298717:R471H	R	-	2	0	0	METTL3	21037516	21037516	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	7.059000	0.76684	1.300000	0.44818	0.460000	0.39030	CGT	0.120162		TCGA-2J-AABV-01A-12D-A40W-08	0.443	METTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401227.1	0	0	0		14	2	2	1		1	1	201		201	200	1	2.010000	-2.826855	1	0.110000	NM_019852			24	24		719	712	0		1	1		1	0	201	0		0.962688	2.540641e-01	0	6	0	23	0	24	719
ALKBH1	8846	broad.mit.edu	37	14	78174236	78174236	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr14:78174236C>T	ENST00000216489.3	-	1	127	c.112G>A	c.(112-114)Gca>Aca	p.A38T	SLIRP_ENST00000557342.1_5'Flank|SLIRP_ENST00000557623.1_5'Flank|SLIRP_ENST00000557431.1_5'Flank|SLIRP_ENST00000238688.5_5'Flank	NM_006020.2	NP_006011.2	Q13686	ALKB1_HUMAN	alkB, alkylation repair homolog 1 (E. coli)	38					developmental growth (GO:0048589)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|in utero embryonic development (GO:0001701)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|oxidative demethylation (GO:0070989)|placenta development (GO:0001890)|RNA repair (GO:0042245)	mitochondrion (GO:0005739)|nuclear euchromatin (GO:0005719)	chemoattractant activity (GO:0042056)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)			endometrium(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		TCCAGGTCTGCGGTCCCGGGC	0.672																																						ENST00000216489.3	1.000000	0.100000	4.900000e-01	1.800000e-01	0.290000	0.362945	0.290000	0.250000																										0				9						c.(112-114)Gca>Aca		alkB, alkylation repair homolog 1 (E. coli)							36.0	39.0	38.0					14																	78174236		2198	4300	6498	SO:0001583	missense	8846	1	121366	28				g.chr14:78174236C>T	X91992	CCDS32127.1	14q24	2014-07-23	2006-02-09	2006-02-09	ENSG00000100601	ENSG00000100601		"""Alkylation repair homologs"""	17911	protein-coding gene	gene with protein product		605345	"""alkB, alkylation repair homolog (E. coli)"""	ALKBH		8600462	Standard	XM_005268165		Approved	hABH, alkB, ABH	uc001xuc.1	Q13686	OTTHUMG00000171542	ENST00000216489.3:c.112G>A	chr14.hg19:g.78174236C>T	ENSP00000216489:p.Ala38Thr	0					SLIRP_ENST00000557431.1_5'Flank|SLIRP_ENST00000557623.1_5'Flank|SLIRP_ENST00000557342.1_5'Flank|SLIRP_ENST00000238688.5_5'Flank	p.A38T	NM_006020.2	NP_006011.2	1	2	3	2.001128	Q13686	ALKB1_HUMAN	Kidney(204;0.164)	1	127	-			Q8TAU1|Q9ULA7	Missense_Mutation	SNP	ENST00000216489.3	0	1	hg19	c.112G>A	CCDS32127.1	0	.	.	.	.	.	.	.	.	.	.	C	15.64	2.892759	0.52121	.	.	ENSG00000100601	ENST00000216489	T	0.31510	1.49	5.96	1.95	0.26073	5.960000	1.950000	0.260730	.	0.343898	0.33792	N	0.004541	T	0.17662	0.0424	M	0.62723	1.935	0.09310	N	1	P	0.42161	0.772	B	0.27262	0.078	T	0.17198	-1.0377	10	0.22109	T	0.4	-9.2796	2.0609	0.03592	0.1977:0.4796:0.1109:0.2118	.	38	Q13686	ALKB1_HUMAN	T	38	ENSP00000216489:A38T	ENSP00000216489:A38T	A	-	1	0	0	ALKBH1	77243989	77243989	0.011000	0.17503	0.035000	0.18076	0.797000	0.45037	-0.010000	0.12743	0.423000	0.26033	0.655000	0.94253	GCA	0.115352		TCGA-2J-AABV-01A-12D-A40W-08	0.672	ALKBH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414037.1	0	0	1		2	2	2	0		0	0	83		83	83	1	2.010000	-2.647650	1	0.110000	NM_006020			5	5		350	341	0		1	0		0	0	83	0		0.933661	3.286231e-04	0	0	0	2	0	5	350
HERC2	8924	broad.mit.edu	37	15	28370319	28370319	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr15:28370319C>T	ENST00000261609.7	-	84	12931	c.12823G>A	c.(12823-12825)Gac>Aac	p.D4275N		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TCATCATTGTCGCCCCATGTA	0.522																																						ENST00000261609.7	0.650000	0.320000	5.700000e-01	3.900000e-01	0.470000	0.482943	0.470000	0.470000																										0				204						c.(12823-12825)Gac>Aac		HECT and RLD domain containing E3 ubiquitin protein ligase 2							211.0	191.0	198.0					15																	28370319		2203	4300	6503	SO:0001583	missense	8924	0	0					g.chr15:28370319C>T	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.12823G>A	chr15.hg19:g.28370319C>T	ENSP00000261609:p.Asp4275Asn	0						p.D4275N	NM_004667.5	NP_004658.3	0	0	0	1.963904				84	12931	-		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		Missense_Mutation	SNP	ENST00000261609.7	1	1	hg19	c.12823G>A	CCDS10021.1	0	.	.	.	.	.	.	.	.	.	.	C	35	5.539421	0.96474	.	.	ENSG00000128731	ENST00000261609	D	0.84298	-1.83	5.19	5.19	0.71726	5.190000	5.190000	0.717260	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.86924	0.6050	N	0.16833	0.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87797	0.2622	10	0.42905	T	0.14	.	18.7201	0.91689	0.0:1.0:0.0:0.0	.	4275	O95714	HERC2_HUMAN	N	4275	ENSP00000261609:D4275N	ENSP00000261609:D4275N	D	-	1	0	0	HERC2	26043914	26043914	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	7.808000	0.86044	2.408000	0.81797	0.655000	0.94253	GAC	0.088955		TCGA-2J-AABV-01A-12D-A40W-08	0.522	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	0	0	1		2	2	2	0		0	0	306		306	303	1	2.010000	-2.466240	0	0.110000	NM_004667			29	29		1062	1043	0		1	0		0	0	306	0		1.000000	4.486779e-03	0	0	0	4	0	29	1062
CX3CL1	6376	broad.mit.edu	37	16	57413650	57413650	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr16:57413650G>A	ENST00000006053.6	+	2	286	c.175G>A	c.(175-177)Ggc>Agc	p.G59S	CX3CL1_ENST00000565912.1_Missense_Mutation_p.G21S|CX3CL1_ENST00000563383.1_Missense_Mutation_p.G65S|CX3CL1_ENST00000564948.1_Intron	NM_002996.3	NP_002987.1	P78423	X3CL1_HUMAN	chemokine (C-X3-C motif) ligand 1	59	Chemokine.				angiogenesis involved in wound healing (GO:0060055)|cell adhesion (GO:0007155)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|immune response (GO:0006955)|leukocyte adhesive activation (GO:0050902)|leukocyte chemotaxis (GO:0030595)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neutrophil chemotaxis (GO:0030593)|positive regulation of angiogenesis (GO:0045766)|positive regulation of calcium-independent cell-cell adhesion (GO:0051041)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transforming growth factor beta1 production (GO:0032914)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chemokine activity (GO:0008009)|receptor binding (GO:0005102)	p.G59C(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5						GGCATCATGCGGCAAACGCGC	0.512																																						ENST00000006053.6	1.000000	0.220000	7.500000e-01	3.400000e-01	0.490000	0.543123	0.490000	0.450000																										1	Substitution - Missense(1)	p.G59C(1)	lung(1)	5						c.(175-177)Ggc>Agc		chemokine (C-X3-C motif) ligand 1							172.0	132.0	145.0					16																	57413650		2198	4300	6498	SO:0001583	missense	6376	0	0					g.chr16:57413650G>A	U84487	CCDS10779.1	16q13	2013-02-25	2002-08-22	2002-08-23	ENSG00000006210	ENSG00000006210		"""Endogenous ligands"""	10647	protein-coding gene	gene with protein product		601880	"""small inducible cytokine subfamily D (Cys-X3-Cys), member 1 (fractalkine, neurotactin)"""	SCYD1		9177350, 9024663	Standard	NM_002996		Approved	NTN, C3Xkine, ABCD-3, CXC3C, CXC3, fractalkine, neurotactin	uc002eli.3	P78423	OTTHUMG00000133469	ENST00000006053.6:c.175G>A	chr16.hg19:g.57413650G>A	ENSP00000006053:p.Gly59Ser	0					CX3CL1_ENST00000564948.1_Intron|CX3CL1_ENST00000563383.1_Missense_Mutation_p.G65S|CX3CL1_ENST00000565912.1_Missense_Mutation_p.G21S	p.G59S	NM_002996.3	NP_002987.1	1	2	3	2.000755	P78423	X3CL1_HUMAN		2	286	+			O00672	Missense_Mutation	SNP	ENST00000006053.6	1	1	hg19	c.175G>A	CCDS10779.1	0	.	.	.	.	.	.	.	.	.	.	G	6.658	0.489915	0.12702	.	.	ENSG00000006210	ENST00000006053	T	0.12569	2.67	3.0	1.04	0.20106	3.000000	1.040000	0.201060	Chemokine interleukin-8-like domain (3);	1.124180	0.06795	N	0.787674	T	0.06188	0.0160	N	0.04880	-0.145	0.09310	N	1	P	0.43885	0.82	B	0.35770	0.21	T	0.28332	-1.0047	10	0.87932	D	0	-9.8139	5.7233	0.17998	0.2286:0.0:0.7714:0.0	.	59	P78423	X3CL1_HUMAN	S	59	ENSP00000006053:G59S	ENSP00000006053:G59S	G	+	1	0	0	CX3CL1	55971151	55971151	0.000000	0.05858	0.002000	0.10522	0.022000	0.10575	0.291000	0.18994	0.341000	0.23771	0.460000	0.39030	GGC	0.115352		TCGA-2J-AABV-01A-12D-A40W-08	0.512	CX3CL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257345.3	0	0	1		2	2	2	0		0	0	95		95	95	1	2.010000	-2.651463	1	0.110000	NM_002996			8	8		312	310	0		1	0		0	0	95	0		0.989329	8.653347e-04	0	0	0	2	0	8	312
KRT33A	3883	broad.mit.edu	37	17	39506938	39506938	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr17:39506938C>T	ENST00000007735.3	-	1	126	c.82G>A	c.(82-84)Ggc>Agc	p.G28S		NM_004138.3	NP_004129.2	O76009	KT33A_HUMAN	keratin 33A	28	Head.					extracellular space (GO:0005615)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	21		Breast(137;0.000496)				AGGGTGCAGCCGTGGCAGCTG	0.642																																						ENST00000007735.3	1.000000	0.260000	1	3.800000e-01	0.560000	0.623014	0.560000	0.490000																										0				21						c.(82-84)Ggc>Agc		keratin 33A							35.0	40.0	38.0					17																	39506938		2196	4300	6496	SO:0001583	missense	3883	6	121360	38				g.chr17:39506938C>T	Y16788	CCDS11388.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000006059	ENSG00000006059		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6450	protein-coding gene	gene with protein product	"""hard keratin type I 3I"""	602761	"""keratin, hair, acidic, 3A"""	KRTHA3A		7565656, 16831889	Standard	NM_004138		Approved	Ha-3I, Krt1-3	uc002hwk.2	O76009	OTTHUMG00000133432	ENST00000007735.3:c.82G>A	chr17.hg19:g.39506938C>T	ENSP00000007735:p.Gly28Ser	0						p.G28S	NM_004138.3	NP_004129.2	1	2	3	2.031923	O76009	KT33A_HUMAN		1	126	-		Breast(137;0.000496)	B2RA87|Q6NTB9|Q6ZZB9	Missense_Mutation	SNP	ENST00000007735.3	0	1	hg19	c.82G>A	CCDS11388.1	0	.	.	.	.	.	.	.	.	.	.	C	11.15	1.552601	0.27739	.	.	ENSG00000006059	ENST00000007735	D	0.81579	-1.51	5.09	-4.82	0.03171	5.090000	-4.820000	0.031710	.	0.804604	0.11801	N	0.528143	T	0.62097	0.2400	N	0.12746	0.255	0.09310	N	1	B	0.16166	0.016	B	0.11329	0.006	T	0.40887	-0.9539	10	0.33940	T	0.23	.	14.4405	0.67314	0.0:0.8319:0.0:0.1681	.	28	O76009	KT33A_HUMAN	S	28	ENSP00000007735:G28S	ENSP00000007735:G28S	G	-	1	0	0	KRT33A	36760464	36760464	0.000000	0.05858	0.002000	0.10522	0.875000	0.50365	-0.320000	0.08028	-0.820000	0.04318	-0.262000	0.10625	GGC	0.122072		TCGA-2J-AABV-01A-12D-A40W-08	0.642	KRT33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257295.1	0	0	1		2	2	2	0		0	0	89		89	88	1	2.010000	-3.558084	1	0.110000	NM_004138			9	8		322	315	0		1			0	0	89	0		0.993632	0	0	0	0	0	0	9	322
TP53	7157	broad.mit.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	G	A	rs28934574		TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr17:7577094G>A	ENST00000269305.4	-	8	1033	c.844C>T	c.(844-846)Cgg>Tgg	p.R282W	TP53_ENST00000359597.4_Missense_Mutation_p.R282W|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R282W|TP53_ENST00000445888.2_Missense_Mutation_p.R282W|TP53_ENST00000455263.2_Missense_Mutation_p.R282W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	282	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		DR -> EW (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|Ref.22}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934574). {ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R282W(401)|p.R282G(29)|p.0?(8)|p.R282fs*24(4)|p.R282R(3)|p.?(2)|p.D281fs*63(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.R282fs*63(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTGTGCGCCGGTCTCTCCCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	0.390000	1	5.700000e-01	0.810000	0.799086	0.810000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		463	Substitution - Missense(430)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Insertion - Frameshift(4)|Substitution - coding silent(3)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - In frame(1)	p.R282W(401)|p.R282G(29)|p.0?(8)|p.R282fs*24(4)|p.R282R(3)|p.?(2)|p.D281fs*63(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.R282fs*63(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)	large_intestine(136)|oesophagus(49)|upper_aerodigestive_tract(43)|stomach(33)|central_nervous_system(29)|breast(29)|lung(26)|ovary(21)|skin(20)|urinary_tract(16)|haematopoietic_and_lymphoid_tissue(16)|pancreas(10)|biliary_tract(5)|liver(5)|bone(5)|vulva(4)|prostate(4)|endometrium(3)|peritoneum(2)|thyroid(2)|NS(2)|autonomic_ganglia(1)|soft_tissue(1)|salivary_gland(1)	24185	GRCh37	CM056413|CM920678	TP53	M	rs28934574	c.(844-846)Cgg>Tgg	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	83.0	71.0	75.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	844,844,844,844,448,448,448	1.5	0.3	17	dbSNP_125	75	2,8598	2.2+/-6.3	1,0,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	101,101,101,101,101,101,101	1,0,6502	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	282/394,282/394,282/347,282/342,150/262,150/210,150/215	7577094	2,13004	2203	4300	6503	SO:0001583	missense	7157	2	121412	36	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577094G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.844C>T	chr17.hg19:g.7577094G>A	ENSP00000269305:p.Arg282Trp	0	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.R282W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R282W|TP53_ENST00000420246.2_Missense_Mutation_p.R282W|TP53_ENST00000359597.4_Missense_Mutation_p.R282W|TP53_ENST00000413465.2_Intron	p.R282W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.976493	P04637	P53_HUMAN		8	1033	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.844C>T	CCDS11118.1	0	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057525	0.76074	0.0	2.33E-4	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.75	1.49	0.22878	4.750000	1.490000	0.228780	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.89968	3.075	0.58432	A	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;0.999	D	0.97713	1.0192	9	0.87932	D	0	-12.0909	8.7508	0.34613	0.0:0.1376:0.5833:0.2792	rs28934574	282;282;282;282	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	W	282;282;282;282;282;271;150	ENSP00000352610:R282W;ENSP00000269305:R282W;ENSP00000398846:R282W;ENSP00000391127:R282W;ENSP00000391478:R282W;ENSP00000425104:R150W	ENSP00000269305:R282W	R	-	1	2	2	TP53	7517819	7517819	1.000000	0.71417	0.327000	0.25402	0.901000	0.52897	4.477000	0.60223	0.174000	0.19809	0.462000	0.41574	CGG	0.098095		TCGA-2J-AABV-01A-12D-A40W-08	0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1		2	2	2	0		0	0	53		53	52	1	2.010000	-2.994159	1	0.110000	NM_000546			8	8		169	165	0		1	1	1	0	0	53	618		0.988879	4.788668e-02	1	3	52	4	1270	8	169
HN1	51155	broad.mit.edu	37	17	73132223	73132223	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr17:73132223C>T	ENST00000409753.3	-	5	724	c.439G>A	c.(439-441)Ggc>Agc	p.G147S	HN1_ENST00000481647.1_Missense_Mutation_p.G101S|HN1_ENST00000392566.2_Missense_Mutation_p.G101S|HN1_ENST00000356033.4_Silent_p.A140A|HN1_ENST00000405458.3_Missense_Mutation_p.G101S|HN1_ENST00000470924.1_Missense_Mutation_p.G101S|HN1_ENST00000476258.1_Missense_Mutation_p.G101S|RP11-649A18.5_ENST00000584339.1_RNA|HN1_ENST00000482348.1_Missense_Mutation_p.G101S	NM_016185.2	NP_057269.1	Q9UK76	HN1_HUMAN	hematological and neurological expressed 1	147					developmental process (GO:0032502)	nucleus (GO:0005634)			HN1/USH1G(2)	breast(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)					CTGGACTTGCCGCCAGGGGGA	0.617																																						ENST00000409753.3	0.690000	0.220000	5.600000e-01	3.100000e-01	0.420000	0.441610	0.420000	0.410000																									HN1/USH1G(2)	0				1						c.(439-441)Ggc>Agc		hematological and neurological expressed 1							72.0	72.0	72.0					17																	73132223		2203	4300	6503	SO:0001583	missense	51155	0	0					g.chr17:73132223C>T	AF086910	CCDS32729.1, CCDS45771.1, CCDS45772.1	17q25.1	2013-09-20			ENSG00000189159	ENSG00000189159			14569	protein-coding gene	gene with protein product	"""androgen-regulated protein 2"""					15094197	Standard	NM_001002032		Approved	ARM2, HN1A	uc002jnb.1	Q9UK76	OTTHUMG00000154521	ENST00000409753.3:c.439G>A	chr17.hg19:g.73132223C>T	ENSP00000387059:p.Gly147Ser	0					HN1_ENST00000470924.1_Missense_Mutation_p.G101S|HN1_ENST00000476258.1_Missense_Mutation_p.G101S|HN1_ENST00000356033.4_Silent_p.A140A|HN1_ENST00000481647.1_Missense_Mutation_p.G101S|HN1_ENST00000482348.1_Missense_Mutation_p.G101S|HN1_ENST00000392566.2_Missense_Mutation_p.G101S|HN1_ENST00000405458.3_Missense_Mutation_p.G101S|RP11-649A18.5_ENST00000584339.1_RNA	p.G147S	NM_016185.2	NP_057269.1	0	1	1	1.994252	Q9UK76	HN1_HUMAN		5	724	-	all_lung(278;0.14)|Lung NSC(278;0.168)		B2R6K3|Q53FG7|Q7Z2D2|Q7Z2F0	Missense_Mutation	SNP	ENST00000409753.3	0	1	hg19	c.439G>A	CCDS45771.1	0	.	.	.	.	.	.	.	.	.	.	C	34	5.394833	0.96009	.	.	ENSG00000189159	ENST00000405458;ENST00000409753;ENST00000392566	.	.	.	5.87	5.87	0.94306	5.870000	5.870000	0.943060	.	.	.	.	.	D	0.83403	0.5247	.	.	.	0.51767	D	0.999934	D	0.89917	1.0	D	0.91635	0.999	D	0.84802	0.0785	7	0.87932	D	0	-34.3147	18.3821	0.90454	0.0:1.0:0.0:0.0	.	147	Q9UK76	HN1_HUMAN	S	101;147;101	.	ENSP00000440912:G101S	G	-	1	0	0	HN1	70643818	70643818	0.998000	0.40836	0.969000	0.41365	0.961000	0.63080	4.949000	0.63596	2.773000	0.95371	0.643000	0.83706	GGC	0.104087		TCGA-2J-AABV-01A-12D-A40W-08	0.617	HN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000335692.1	0	0	1		2	2	2	0		0	0	98		98	98	1	2.010000	-2.681738	1	0.110000	NM_001002032			11	11		469	466	0		1	0		0	0	98	0		0.998311	9.465419e-01	0	1	0	215	0	11	469
TYK2	7297	broad.mit.edu	37	19	10463185	10463185	+	Silent	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr19:10463185C>T	ENST00000525621.1	-	23	3724	c.3243G>A	c.(3241-3243)gcG>gcA	p.A1081A	TYK2_ENST00000524462.1_Silent_p.A896A|TYK2_ENST00000529422.1_Intron|TYK2_ENST00000264818.6_Silent_p.A1081A	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	1081	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			AGACATCTGACGCATAGTAGA	0.637																																						ENST00000525621.1	1.000000	0.360000	9.400000e-01	4.800000e-01	0.640000	0.677337	0.640000	0.600000																										0				64						c.(3241-3243)gcG>gcA		tyrosine kinase 2							86.0	85.0	86.0					19																	10463185		2203	4300	6503	SO:0001819	synonymous_variant	7297	0	0					g.chr19:10463185C>T		CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.3243G>A	chr19.hg19:g.10463185C>T		0					TYK2_ENST00000529422.1_Intron|TYK2_ENST00000264818.6_Silent_p.A1081A|TYK2_ENST00000524462.1_Silent_p.A896A	p.A1081A	NM_003331.4	NP_003322.3	1	2	3	2.012788	P29597	TYK2_HUMAN	OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)	23	3724	-			Q6QB10|Q96CH0	Silent	SNP	ENST00000525621.1	1	1	hg19	c.3243G>A	CCDS12236.1	0																																																																																								0.118244		TCGA-2J-AABV-01A-12D-A40W-08	0.637	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389443.1	0	0	1		2	2	2	0		0	0	127		127	126	1	2.010000	-13.884140	1	0.110000				15	15		442	429	0		1	0		0	0	127	0		0.999846	1.924777e-01	0	1	0	22	0	15	442
HRC	3270	broad.mit.edu	37	19	49657755	49657755	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr19:49657755T>C	ENST00000252825.4	-	1	926	c.740A>G	c.(739-741)gAc>gGc	p.D247G	HRC_ENST00000595625.1_Missense_Mutation_p.D247G	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	247	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Asp-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		atcatcatcgtcatcttcttc	0.507																																					Melanoma(37;75 1097 24567 25669 30645)	ENST00000252825.4	1.000000	0.190000	8.600000e-01	3.500000e-01	0.570000	0.600131	0.570000	1.000000																										0				34						c.(739-741)gAc>gGc		histidine rich calcium binding protein							127.0	92.0	104.0					19																	49657755		2203	4300	6503	SO:0001583	missense	3270	0	0					g.chr19:49657755T>C		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.740A>G	chr19.hg19:g.49657755T>C	ENSP00000252825:p.Asp247Gly	0					HRC_ENST00000595625.1_Missense_Mutation_p.D247G	p.D247G	NM_002152.2	NP_002143.1	0	1	1	1.989875	P23327	SRCH_HUMAN		1	926	-		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)	Q504Y6	Missense_Mutation	SNP	ENST00000252825.4	0	1	hg19	c.740A>G	CCDS12759.1	0	.	.	.	.	.	.	.	.	.	.	t	7.560	0.664495	0.14710	.	.	ENSG00000130528	ENST00000252825;ENST00000434964	T	0.09350	2.99	3.17	2.14	0.27477	3.170000	2.140000	0.274770	.	.	.	.	.	T	0.06735	0.0172	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43245	-0.9403	9	0.21014	T	0.42	.	6.7695	0.23587	0.0:0.1232:0.0:0.8768	.	247	P23327	SRCH_HUMAN	G	247;217	ENSP00000252825:D247G	ENSP00000252825:D247G	D	-	2	0	0	HRC	54349567	54349567	0.000000	0.05858	0.003000	0.11579	0.059000	0.15707	-0.119000	0.10676	0.258000	0.21686	-0.758000	0.03466	GAC	0.102596		TCGA-2J-AABV-01A-12D-A40W-08	0.507	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	0	0	0		2	2	2	0		0	0	54		54	52	1	2.010000	-7.013622	1	0.110000	NM_002152			4	3		131	123	0		1			0	0	54	0		0.874525	0	0	0	0	0	0	4	131
ZNRF4	148066	broad.mit.edu	37	19	5456659	5456659	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr19:5456659T>C	ENST00000222033.4	+	1	1234	c.1157T>C	c.(1156-1158)aTt>aCt	p.I386T		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	386						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		ATCTGGGCCATTCAAGTCCAG	0.662																																						ENST00000222033.4	1.000000	0.280000	9.200000e-01	4.100000e-01	0.580000	0.627998	0.580000	0.520000																										0				16						c.(1156-1158)aTt>aCt		zinc and ring finger 4							35.0	42.0	40.0					19																	5456659		1982	4149	6131	SO:0001583	missense	148066	1	120902	30				g.chr19:5456659T>C	AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		ENST00000222033.4:c.1157T>C	chr19.hg19:g.5456659T>C	ENSP00000222033:p.Ile386Thr	0						p.I386T	NM_181710.3	NP_859061.3	1	2	3	2.012788	Q8WWF5	ZNRF4_HUMAN		1	1234	+			A8K886|O75866	Missense_Mutation	SNP	ENST00000222033.4	1	1	hg19	c.1157T>C	CCDS42475.1	0	.	.	.	.	.	.	.	.	.	.	T	2.697	-0.271774	0.05716	.	.	ENSG00000105428	ENST00000222033	T	0.04706	3.57	3.47	1.02	0.19986	3.470000	1.020000	0.199860	.	0.686881	0.13351	U	0.394422	T	0.03095	0.0091	L	0.29908	0.895	0.09310	N	1	B	0.26002	0.139	B	0.14578	0.011	T	0.44159	-0.9346	10	0.27785	T	0.31	-11.1573	3.5984	0.08014	0.2261:0.0:0.2332:0.5407	.	386	Q8WWF5	ZNRF4_HUMAN	T	386	ENSP00000222033:I386T	ENSP00000222033:I386T	I	+	2	0	0	ZNRF4	5407659	5407659	0.697000	0.27767	0.686000	0.30086	0.005000	0.04900	1.600000	0.36762	0.473000	0.27368	-0.516000	0.04426	ATT	0.118244		TCGA-2J-AABV-01A-12D-A40W-08	0.662	ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450924.1	0	0	1		2	2	2	0		0	0	71		71	71	1	2.010000	-10.884310	1	0.110000	NM_181710			10	11		333	323	0		1			0	0	71	0		0.996554	0	0	0	0	0	0	10	333
OR7G3	390883	broad.mit.edu	37	19	9236903	9236903	+	Missense_Mutation	SNP	C	C	A			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr19:9236903C>A	ENST00000305444.2	-	1	723	c.724G>T	c.(724-726)Ggg>Tgg	p.G242W		NM_001001958.1	NP_001001958.1	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G, member 3	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						AAATGTGACCCGCAGATGGAA	0.448																																						ENST00000305444.2	1.000000	0.060000	3.500000e-01	1.100000e-01	0.180000	0.293166	0.180000	0.150000																										0				15						c.(724-726)Ggg>Tgg		olfactory receptor, family 7, subfamily G, member 3							101.0	102.0	102.0					19																	9236903		2203	4300	6503	SO:0001583	missense	390883	0	0					g.chr19:9236903C>A		CCDS32899.1	19p13.2	2013-09-24			ENSG00000170920	ENSG00000170920		"""GPCR / Class A : Olfactory receptors"""	8467	protein-coding gene	gene with protein product							Standard	NM_001001958		Approved	OST085	uc010xkl.2	Q8NG95	OTTHUMG00000165520	ENST00000305444.2:c.724G>T	chr19.hg19:g.9236903C>A	ENSP00000302867:p.Gly242Trp	0						p.G242W	NM_001001958.1	NP_001001958.1	1	2	3	2.012788	Q8NG95	OR7G3_HUMAN		1	723	-			Q6IFJ6|Q96R99	Missense_Mutation	SNP	ENST00000305444.2	0	1	hg19	c.724G>T	CCDS32899.1	0	.	.	.	.	.	.	.	.	.	.	C	14.51	2.555942	0.45487	.	.	ENSG00000170920	ENST00000305444	T	0.37915	1.17	3.96	3.96	0.45880	3.960000	3.960000	0.458800	GPCR, rhodopsin-like superfamily (1);	0.178246	0.26369	U	0.024780	T	0.67468	0.2896	H	0.97587	4.035	0.21499	N	0.999668	D	0.63046	0.992	D	0.70935	0.971	T	0.64373	-0.6423	10	0.87932	D	0	.	5.9236	0.19096	0.0:0.6979:0.1968:0.1053	.	242	Q8NG95	OR7G3_HUMAN	W	242	ENSP00000302867:G242W	ENSP00000302867:G242W	G	-	1	0	0	OR7G3	9097903	9097903	0.000000	0.05858	0.690000	0.30148	0.116000	0.19942	-0.903000	0.04084	2.251000	0.74343	0.551000	0.68910	GGG	0.118244		TCGA-2J-AABV-01A-12D-A40W-08	0.448	OR7G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384611.1	0	0	1		2	2	2	0		0	0	167		167	165	1	2.010000	-2.042200	0	0.110000				5	5		580	573	0		1			0	0	167	0		0.935500	0	0	0	0	0	0	5	580
LRRC4B	94030	broad.mit.edu	37	19	51021882	51021882	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr19:51021882G>A	ENST00000599957.1	-	3	1285	c.1088C>T	c.(1087-1089)gCg>gTg	p.A363V	LRRC4B_ENST00000389201.3_Missense_Mutation_p.A363V			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	363	LRRCT.				positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		GATGACGGGCGCATAGCAGGT	0.667																																						ENST00000599957.1	0.830000	0.130000	6.100000e-01	2.400000e-01	0.390000	0.430056	0.390000	0.360000																										0				30						c.(1087-1089)gCg>gTg		leucine rich repeat containing 4B							49.0	55.0	53.0					19																	51021882		2115	4223	6338	SO:0001583	missense	94030	0	0					g.chr19:51021882G>A	BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.1088C>T	chr19.hg19:g.51021882G>A	ENSP00000471502:p.Ala363Val	0					LRRC4B_ENST00000389201.3_Missense_Mutation_p.A363V	p.A363V			0	1	1	1.989875	Q9NT99	LRC4B_HUMAN		3	1285	-		all_neural(266;0.131)	Q3ZCQ4|Q58F20	Missense_Mutation	SNP	ENST00000599957.1	0	1	hg19	c.1088C>T	CCDS42595.1	0	.	.	.	.	.	.	.	.	.	.	G	16.42	3.119090	0.56505	.	.	ENSG00000131409	ENST00000389201;ENST00000535879	T	0.33216	1.42	3.9	3.9	0.45041	3.900000	3.900000	0.450410	Immunoglobulin-like fold (1);	0.000000	0.85682	U	0.000000	T	0.17280	0.0415	L	0.38953	1.18	0.54753	D	0.999983	P	0.48162	0.906	B	0.19946	0.027	T	0.12268	-1.0554	10	0.39692	T	0.17	.	13.7911	0.63140	0.0:0.0:1.0:0.0	.	363	Q9NT99	LRC4B_HUMAN	V	363	ENSP00000373853:A363V	ENSP00000373853:A363V	A	-	2	0	0	LRRC4B	55713694	55713694	1.000000	0.71417	0.990000	0.47175	0.943000	0.58893	9.648000	0.98483	2.192000	0.70111	0.561000	0.74099	GCG	0.102596		TCGA-2J-AABV-01A-12D-A40W-08	0.667	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	0	0	1		2	2	2	0		0	0	48		48	48	1	2.010000	-3.172525	1	0.110000	NM_001080457			4	4		194	188	0		1			0	0	48	0		0.883855	0	0	0	0	0	0	4	194
KCNC4	3749	broad.mit.edu	37	1	110768613	110768613	+	Silent	SNP	C	C	T	rs200511444	byFrequency	TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr1:110768613C>T	ENST00000369787.3	+	3	1659	c.1632C>T	c.(1630-1632)ggC>ggT	p.G544G	KCNC4_ENST00000413138.3_Silent_p.G544G|KCNC4_ENST00000438661.2_Silent_p.G544G|KCNC4_ENST00000412512.2_Intron	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	544					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		AGCAGAATGGCGATGCCAACG	0.652													C|||	2	0.000399361	0.0	0.0	5008	,	,		18102	0.002		0.0	False		,,,				2504	0.0					ENST00000369787.3	0.590000	0.110000	4.400000e-01	1.800000e-01	0.290000	0.320294	0.290000	0.270000																										0				32						c.(1630-1632)ggC>ggT		potassium voltage-gated channel, Shaw-related subfamily, member 4							61.0	60.0	61.0					1																	110768613		2203	4300	6503	SO:0001819	synonymous_variant	3749	5	121378	39				g.chr1:110768613C>T	BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.1632C>T	chr1.hg19:g.110768613C>T		0					KCNC4_ENST00000438661.2_Silent_p.G544G|KCNC4_ENST00000412512.2_Intron|KCNC4_ENST00000413138.3_Silent_p.G544G	p.G544G	NM_004978.4	NP_004969.2	0	1	1	1.990172	Q03721	KCNC4_HUMAN		3	1659	+		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)	Q3MIM4|Q5TBI6	Silent	SNP	ENST00000369787.3	0	1	hg19	c.1632C>T	CCDS821.1	0																																																																																								0.103094		TCGA-2J-AABV-01A-12D-A40W-08	0.652	KCNC4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052146.2	0	0	1		2	2	2	0		0	0	70		70	70	1	2.010000	-2.981588	1	0.110000	NM_001039574			5	5		322	317	0		1	0		0	0	70	0		0.935456	7.451806e-03	0	0	0	7	0	5	322
OBSCN	84033	broad.mit.edu	37	1	228400270	228400270	+	Silent	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr1:228400270C>T	ENST00000422127.1	+	2	830	c.786C>T	c.(784-786)acC>acT	p.T262T	OBSCN_ENST00000570156.2_Silent_p.T262T|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Silent_p.T262T|C1orf145_ENST00000295012.5_Intron	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	262	Ig-like 3.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCTACGTGACCGGCGAGCCCA	0.711																																						ENST00000422127.1	1.000000	0.140000	1	2.400000e-01	0.380000	0.480689	0.380000	0.310000																										0				223						c.(784-786)acC>acT		obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF							39.0	47.0	44.0					1																	228400270		2142	4224	6366	SO:0001819	synonymous_variant	84033	0	0					g.chr1:228400270C>T	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.786C>T	chr1.hg19:g.228400270C>T		0					OBSCN_ENST00000284548.11_Silent_p.T262T|C1orf145_ENST00000295012.5_Intron|OBSCN_ENST00000570156.2_Silent_p.T262T|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR	p.T262T	NM_001098623.2	NP_001092093.2	1	2	3	2.030060	Q5VST9	OBSCN_HUMAN		2	830	+		Prostate(94;0.0405)	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	0	1	hg19	c.786C>T	CCDS58065.1	0																																																																																								0.122072		TCGA-2J-AABV-01A-12D-A40W-08	0.711	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		0	0	1		2	2	2	0		0	0	79		79	77	1	2.010000	-3.135327	1	0.110000	NM_052843			6	7		336	321	0		1			0	0	79	0		0.960554	0	0	0	0	0	0	6	336
RYR2	6262	broad.mit.edu	37	1	237632393	237632393	+	Splice_Site	SNP	G	G	A	rs566885717		TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr1:237632393G>A	ENST00000366574.2	+	17	1931	c.1614G>A	c.(1612-1614)gcG>gcA	p.A538A	MIR4428_ENST00000584884.1_RNA|RYR2_ENST00000360064.6_Splice_Site_p.A536A|RYR2_ENST00000542537.1_Splice_Site_p.A522A	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	538					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTTTTGCAGCGGCTCTAATTA	0.378													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16681	0.0		0.0	False		,,,				2504	0.0					ENST00000366574.2	1.000000	0.280000	1	4.300000e-01	0.640000	0.677169	0.640000	1.000000																										0				586						c.(1612-1614)gcG>gcA		ryanodine receptor 2 (cardiac)							100.0	98.0	99.0					1																	237632393		1819	4080	5899	SO:0001630	splice_region_variant	6262	1	120782	28				g.chr1:237632393G>A	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1613-1G>A	chr1.hg19:g.237632393G>A		0					MIR4428_ENST00000584884.1_RNA|RYR2_ENST00000542537.1_Splice_Site_p.A522A|RYR2_ENST00000360064.6_Splice_Site_p.A536A	p.A538A	NM_001035.2	NP_001026.2	1	2	3	2.030060	Q92736	RYR2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.00606)	17	1931	+	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	Q15411|Q546N8|Q5T3P2	Splice_Site	SNP	ENST00000366574.2	0	1	hg19	c.1614G>A	CCDS55691.1	0																																																																																								0.122072		TCGA-2J-AABV-01A-12D-A40W-08	0.378	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	0	0	1		2	2	2	0		0	0	51		51	51	1	2.010000	-3.437875	1	0.110000	NM_001035	Silent		8	8		254	251	0		1			0	0	51	0		0.989176	0	0	0	0	0	0	8	254
ZHX3	23051	broad.mit.edu	37	20	39833205	39833205	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr20:39833205C>T	ENST00000309060.3	-	4	767	c.352G>A	c.(352-354)Gca>Aca	p.A118T	ZHX3_ENST00000544979.2_Missense_Mutation_p.A118T|ZHX3_ENST00000559234.1_Missense_Mutation_p.A118T|ZHX3_ENST00000557816.1_Missense_Mutation_p.A118T|ZHX3_ENST00000558993.1_Missense_Mutation_p.A118T|ZHX3_ENST00000560361.1_Missense_Mutation_p.A118T|ZHX3_ENST00000540170.1_Missense_Mutation_p.A118T|ZHX3_ENST00000432768.2_Missense_Mutation_p.A118T			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	118					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				GGGGTTTTTGCCAGAAAACTG	0.493																																						ENST00000309060.3	1.000000	0.080000	4.200000e-01	1.300000e-01	0.220000	0.329220	0.220000	0.190000																										0				31						c.(352-354)Gca>Aca		zinc fingers and homeoboxes 3							98.0	96.0	97.0					20																	39833205		2203	4300	6503	SO:0001583	missense	23051	0	0					g.chr20:39833205C>T	AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.352G>A	chr20.hg19:g.39833205C>T	ENSP00000312222:p.Ala118Thr	0					ZHX3_ENST00000557816.1_Missense_Mutation_p.A118T|ZHX3_ENST00000560361.1_Missense_Mutation_p.A118T|ZHX3_ENST00000432768.2_Missense_Mutation_p.A118T|ZHX3_ENST00000544979.2_Missense_Mutation_p.A118T|ZHX3_ENST00000559234.1_Missense_Mutation_p.A118T|ZHX3_ENST00000540170.1_Missense_Mutation_p.A118T|ZHX3_ENST00000558993.1_Missense_Mutation_p.A118T	p.A118T			1	2	3	2.014021	Q9H4I2	ZHX3_HUMAN		4	767	-		Myeloproliferative disorder(115;0.00425)	E1P5W5|F5H820|O43145|Q6NUJ7	Missense_Mutation	SNP	ENST00000309060.3	0	1	hg19	c.352G>A	CCDS13315.1	0	.	.	.	.	.	.	.	.	.	.	C	10.39	1.335660	0.24253	.	.	ENSG00000174306	ENST00000309060;ENST00000373263;ENST00000540170;ENST00000544979;ENST00000432768;ENST00000441102;ENST00000419740	T;T;T;T;T	0.26373	1.74;3.17;3.17;2.97;1.74	6.07	6.07	0.98685	6.070000	6.070000	0.986850	Zinc finger, C2H2-like (1);	0.159420	0.56097	D	0.000037	T	0.22166	0.0534	N	0.20530	0.585	0.38371	D	0.944878	B;B;B;P	0.47545	0.044;0.044;0.296;0.897	B;B;B;P	0.46585	0.047;0.047;0.079;0.521	T	0.01720	-1.1288	10	0.05351	T	0.99	-15.9229	20.6439	0.99570	0.0:1.0:0.0:0.0	.	118;118;118;118	A8K8Q0;Q9H4I2;F5H820;F6R4Q5	.;ZHX3_HUMAN;.;.	T	118	ENSP00000312222:A118T;ENSP00000362360:A118T;ENSP00000442290:A118T;ENSP00000443783:A118T;ENSP00000415498:A118T	ENSP00000312222:A118T	A	-	1	0	0	ZHX3	39266619	39266619	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.238000	0.51352	2.884000	0.98904	0.655000	0.94253	GCA	0.118244		TCGA-2J-AABV-01A-12D-A40W-08	0.493	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079262.3	0	0	1		2	2	2	0		0	0	139		139	136	1	2.010000	-2.253786	0	0.110000	NM_015035			5	5		471	463	0		1			0	0	139	0		0.935032	0	0	0	0	0	0	5	471
TRAPPC10	7109	broad.mit.edu	37	21	45503147	45503147	+	Silent	SNP	G	G	A			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr21:45503147G>A	ENST00000291574.4	+	14	2377	c.2202G>A	c.(2200-2202)ctG>ctA	p.L734L		NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	734					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						ACGTGACCCTGGAACCAGGGG	0.572																																						ENST00000291574.4	0.330000	0.060000	2.500000e-01	1.100000e-01	0.170000	0.186825	0.170000	0.160000																										0				41						c.(2200-2202)ctG>ctA		trafficking protein particle complex 10							108.0	104.0	105.0					21																	45503147		2203	4300	6503	SO:0001819	synonymous_variant	7109	0	0					g.chr21:45503147G>A	U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.2202G>A	chr21.hg19:g.45503147G>A		0						p.L734L	NM_003274.4	NP_003265.3	0	1	1	1.995223	P48553	TPC10_HUMAN		14	2377	+			Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Silent	SNP	ENST00000291574.4	0	1	hg19	c.2202G>A	CCDS13704.1	0																																																																																								0.104087		TCGA-2J-AABV-01A-12D-A40W-08	0.572	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195737.1	0	0	1		2	2	2	0		0	0	197		197	196	1	2.010000	-2.442790	0	0.110000	NM_003274			6	6		660	655	0		1	0		0	0	197	0		0.964097	0	0	0	0	1	0	6	660
SCN1A	6323	broad.mit.edu	37	2	166866301	166866301	+	Silent	SNP	T	T	A			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr2:166866301T>A	ENST00000303395.4	-	20	3929	c.3930A>T	c.(3928-3930)ggA>ggT	p.G1310G	SCN1A_ENST00000409050.1_Silent_p.G1282G|SCN1A_ENST00000375405.3_Silent_p.G1299G|SCN1A_ENST00000423058.2_Silent_p.G1310G|AC010127.3_ENST00000597623.1_RNA|AC010127.3_ENST00000595647.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1310					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATTTGATGGCTCCAAGTTCTG	0.378																																						ENST00000303395.4	1.000000	0.090000	5.600000e-01	1.600000e-01	0.270000	0.379445	0.270000	0.220000																										0				200						c.(3928-3930)ggA>ggT		sodium channel, voltage-gated, type I, alpha subunit	Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)						91.0	90.0	90.0					2																	166866301		2203	4300	6503	SO:0001819	synonymous_variant	6323	0	0					g.chr2:166866301T>A	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.3930A>T	chr2.hg19:g.166866301T>A		0					AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Silent_p.G1299G|SCN1A_ENST00000409050.1_Silent_p.G1282G|SCN1A_ENST00000423058.2_Silent_p.G1310G	p.G1310G			1	2	3	2.019003	P35498	SCN1A_HUMAN		20	3929	-			E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	0	1	hg19	c.3930A>T	CCDS54413.1	0																																																																																								0.119204		TCGA-2J-AABV-01A-12D-A40W-08	0.378	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	0	0	1		2	2	2	0		0	0	141		141	140	1	2.010000	-3.082090	1	0.110000	NM_006920			5	5		388	385	0		1			0	0	141	0		0.936658	0	0	0	0	0	0	5	388
LRP2	4036	broad.mit.edu	37	2	170044544	170044544	+	Silent	SNP	G	G	A	rs143637076		TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr2:170044544G>A	ENST00000263816.3	-	49	9549	c.9264C>T	c.(9262-9264)atC>atT	p.I3088I		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3088	LDL-receptor class A 25. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.I3088I(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TCATCATCTCGATGCAGCGCC	0.512													G|||	1	0.000199681	0.0	0.0	5008	,	,		20795	0.0		0.0	False		,,,				2504	0.001					ENST00000263816.3	1.000000	0.300000	9.400000e-01	4.200000e-01	0.580000	0.631359	0.580000	0.540000																										1	Substitution - coding silent(1)	p.I3088I(1)	kidney(1)	315						c.(9262-9264)atC>atT		low density lipoprotein receptor-related protein 2	"""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"	G		2,4404	4.2+/-10.8	0,2,2201	149.0	121.0	131.0		9264	-11.6	0.1	2	dbSNP_134	131	0,8600		0,0,4300	no	coding-synonymous	LRP2	NM_004525.2		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		3088/4656	170044544	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	4036	2	121412	39				g.chr2:170044544G>A		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.9264C>T	chr2.hg19:g.170044544G>A		0						p.I3088I	NM_004525.2	NP_004516.2	1	2	3	2.019003	P98164	LRP2_HUMAN		49	9549	-			O00711|Q16215	Silent	SNP	ENST00000263816.3	1	1	hg19	c.9264C>T	CCDS2232.1	0																																																																																								0.119204		TCGA-2J-AABV-01A-12D-A40W-08	0.512	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	0	0	1		2	2	2	0		0	0	134		134	132	1	2.010000	-3.025492	1	0.110000	NM_004525			12	12		398	392	0		1			0	0	134	0		0.999064	0	0	0	0	0	0	12	398
COL5A2	1290	broad.mit.edu	37	2	189945762	189945762	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr2:189945762C>T	ENST00000374866.3	-	13	1134	c.860G>A	c.(859-861)cGt>cAt	p.R287H		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	287					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			AGGAAATCCACGAGCTCCCTG	0.413																																						ENST00000374866.3	1.000000	0.210000	9.100000e-01	3.300000e-01	0.500000	0.561364	0.500000	0.440000																										0				95						c.(859-861)cGt>cAt		collagen, type V, alpha 2							79.0	89.0	86.0					2																	189945762		2203	4300	6503	SO:0001583	missense	1290	0	0					g.chr2:189945762C>T	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.860G>A	chr2.hg19:g.189945762C>T	ENSP00000364000:p.Arg287His	0						p.R287H	NM_000393.3	NP_000384.2	1	2	3	2.019003	P05997	CO5A2_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)	13	1134	-			P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	0	1	hg19	c.860G>A	CCDS33350.1	0	.	.	.	.	.	.	.	.	.	.	C	21.9	4.216368	0.79352	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.94232	-3.38	5.26	5.26	0.73747	5.260000	5.260000	0.737470	.	0.000000	0.42964	D	0.000627	D	0.96137	0.8741	M	0.77820	2.39	0.51233	D	0.999915	D;D	0.71674	0.998;0.995	D;D	0.71184	0.964;0.972	D	0.95592	0.8655	9	.	.	.	.	14.2306	0.65890	0.0:1.0:0.0:0.0	.	104;287	Q5PR22;P05997	.;CO5A2_HUMAN	H	287;104	ENSP00000364000:R287H	.	R	-	2	0	0	COL5A2	189654007	189654007	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	5.417000	0.66423	2.732000	0.93576	0.555000	0.69702	CGT	0.119204		TCGA-2J-AABV-01A-12D-A40W-08	0.413	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	0	0	1		2	2	2	0		0	0	78		78	77	1	2.010000	-3.502977	1	0.110000	NM_000393			7	7		285	280	0		1	0		0	0	78	0		0.979728	0	0	0	0	1	0	7	285
CYP26B1	56603	broad.mit.edu	37	2	72359477	72359477	+	Missense_Mutation	SNP	C	C	T	rs368475843		TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr2:72359477C>T	ENST00000001146.2	-	6	1621	c.1418G>A	c.(1417-1419)cGc>cAc	p.R473H	CYP26B1_ENST00000546307.1_Missense_Mutation_p.R398H|CYP26B1_ENST00000412253.1_Missense_Mutation_p.R282H	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	473			R -> C (in dbSNP:rs61751056). {ECO:0000269|Ref.4}.		bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						CAAGGTGATGCGGGGGAAGGT	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		17053	0.001		0.0	False		,,,				2504	0.0					ENST00000001146.2	1.000000	0.690000	1	9.900000e-01	0.990000	0.977793	0.990000	1.000000																										0				28						c.(1417-1419)cGc>cAc		cytochrome P450, family 26, subfamily B, polypeptide 1							46.0	40.0	42.0					2																	72359477		2203	4298	6501	SO:0001583	missense	56603	3	121360	30				g.chr2:72359477C>T		CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.1418G>A	chr2.hg19:g.72359477C>T	ENSP00000001146:p.Arg473His	0					CYP26B1_ENST00000546307.1_Missense_Mutation_p.R398H|CYP26B1_ENST00000412253.1_Missense_Mutation_p.R282H	p.R473H	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	1	2	3	2.019003	Q9NR63	CP26B_HUMAN		6	1621	-			B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Missense_Mutation	SNP	ENST00000001146.2	0	1	hg19	c.1418G>A	CCDS1919.1	1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.506780	0.85282	.	.	ENSG00000003137	ENST00000001146;ENST00000412253;ENST00000546307	T;T;T	0.69306	-0.39;-0.39;-0.39	5.64	5.64	0.86602	5.640000	5.640000	0.866020	.	0.112172	0.56097	D	0.000031	T	0.65842	0.2730	L	0.38175	1.15	0.46356	D	0.999003	P;P;P	0.51449	0.907;0.945;0.792	P;P;P	0.53954	0.631;0.738;0.631	T	0.66089	-0.6010	10	0.52906	T	0.07	-4.0647	9.1263	0.36816	0.0:0.8455:0.0:0.1545	.	398;456;473	B7Z2K6;B7Z2P4;Q9NR63	.;.;CP26B_HUMAN	H	473;282;398	ENSP00000001146:R473H;ENSP00000401465:R282H;ENSP00000443304:R398H	ENSP00000001146:R473H	R	-	2	0	0	CYP26B1	72212985	72212985	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.746000	0.47467	2.837000	0.97791	0.655000	0.94253	CGC	0.119204		TCGA-2J-AABV-01A-12D-A40W-08	0.647	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251969.1	1	0	1		2	2	2	0		0	0	19		19	19	1	2.010000	-11.072270	1	0.110000	NM_019885			6	6		62	60	1		1			0	0	19	0		0.964076	0	0	0	0	0	0	6	62
ALS2	57679	broad.mit.edu	37	2	202606452	202606452	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr2:202606452C>T	ENST00000264276.6	-	11	2668	c.2296G>A	c.(2296-2298)Gcc>Acc	p.A766T	ALS2_ENST00000457679.2_Missense_Mutation_p.A78T	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	766	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						AAACTCCTGGCTTCCTTTACC	0.488																																						ENST00000264276.6	1.000000	0.350000	1	5.300000e-01	0.780000	0.771723	0.780000	1.000000																										0				72						c.(2296-2298)Gcc>Acc		amyotrophic lateral sclerosis 2 (juvenile)							69.0	67.0	68.0					2																	202606452		1931	4153	6084	SO:0001583	missense	57679	1	120876	33				g.chr2:202606452C>T	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.2296G>A	chr2.hg19:g.202606452C>T	ENSP00000264276:p.Ala766Thr	0					ALS2_ENST00000457679.2_Missense_Mutation_p.A78T	p.A766T	NM_020919.3	NP_065970.2	1	2	3	2.019003	Q96Q42	ALS2_HUMAN		11	2668	-			Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Missense_Mutation	SNP	ENST00000264276.6	1	1	hg19	c.2296G>A	CCDS42800.1	0	.	.	.	.	.	.	.	.	.	.	C	19.09	3.760467	0.69763	.	.	ENSG00000003393	ENST00000264276;ENST00000457679	T;T	0.63255	-0.03;-0.03	5.97	5.09	0.68999	5.970000	5.090000	0.689990	Dbl homology (DH) domain (4);	0.178064	0.49305	D	0.000148	T	0.69557	0.3124	L	0.27053	0.805	0.41489	D	0.988215	D;D;B	0.89917	1.0;0.97;0.146	D;P;B	0.87578	0.998;0.801;0.326	T	0.73316	-0.4021	10	0.54805	T	0.06	.	16.6047	0.84825	0.1313:0.8687:0.0:0.0	.	766;766;766	Q96Q42-3;Q6IQ41;Q96Q42	.;.;ALS2_HUMAN	T	766;78	ENSP00000264276:A766T;ENSP00000394823:A78T	ENSP00000264276:A766T	A	-	1	0	0	ALS2	202314697	202314697	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.060000	0.49955	1.515000	0.48885	-0.182000	0.12963	GCC	0.119204		TCGA-2J-AABV-01A-12D-A40W-08	0.488	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	1	0	1		2	2	2	0		0	0	58		58	58	1	2.010000	-10.023990	1	0.110000	NM_020919			8	8		200	199	0		1			0	0	58	0		0.989579	0	0	0	0	0	0	8	200
TMCC1	23023	broad.mit.edu	37	3	129370592	129370592	+	Missense_Mutation	SNP	T	T	A			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr3:129370592T>A	ENST00000393238.3	-	6	2034	c.1694A>T	c.(1693-1695)cAg>cTg	p.Q565L	TMCC1_ENST00000426664.2_Missense_Mutation_p.Q451L|TMCC1_ENST00000329333.5_Missense_Mutation_p.Q386L|TMCC1_ENST00000432054.2_Missense_Mutation_p.Q241L	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	565						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						CTGCTGCTGCTGCAGCTCCAT	0.572																																						ENST00000393238.3	0.530000	0.100000	4.000000e-01	1.600000e-01	0.260000	0.287845	0.260000	0.240000																									PLXND1/TMCC1(4)	0				25						c.(1693-1695)cAg>cTg		transmembrane and coiled-coil domain family 1							79.0	76.0	77.0					3																	129370592		2203	4300	6503	SO:0001583	missense	23023	0	0					g.chr3:129370592T>A	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1694A>T	chr3.hg19:g.129370592T>A	ENSP00000376930:p.Gln565Leu	0					TMCC1_ENST00000329333.5_Missense_Mutation_p.Q386L|TMCC1_ENST00000426664.2_Missense_Mutation_p.Q451L|TMCC1_ENST00000432054.2_Missense_Mutation_p.Q241L	p.Q565L	NM_001017395.3	NP_001017395.2	0	0	0	1.980772	O94876	TMCC1_HUMAN		6	2034	-			A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	ENST00000393238.3	0	1	hg19	c.1694A>T	CCDS33855.1	0	.	.	.	.	.	.	.	.	.	.	T	20.6	4.009576	0.75046	.	.	ENSG00000172765	ENST00000432054;ENST00000393238;ENST00000426664;ENST00000329333	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.16	5.16	0.70880	5.160000	5.160000	0.708800	.	0.000000	0.85682	D	0.000000	T	0.61261	0.2333	L	0.46614	1.455	0.80722	D	1	D;D	0.67145	0.996;0.985	D;D	0.85130	0.997;0.973	T	0.58278	-0.7664	10	0.33940	T	0.23	-18.4911	15.1509	0.72696	0.0:0.0:0.0:1.0	.	386;565	B4DE04;O94876	.;TMCC1_HUMAN	L	241;565;451;386	ENSP00000404711:Q241L;ENSP00000376930:Q565L;ENSP00000389892:Q451L;ENSP00000327349:Q386L	ENSP00000327349:Q386L	Q	-	2	0	0	TMCC1	130853282	130853282	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.735000	0.84939	2.172000	0.68678	0.533000	0.62120	CAG	0.097088		TCGA-2J-AABV-01A-12D-A40W-08	0.572	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	0	0	1		2	2	2	0		0	0	103		103	106	1	2.010000	-2.087114	0	0.110000	NM_015008			5	5		357	364	0		1	0		0	0	103	0		0.941025	9.345472e-04	0	0	0	3	0	5	357
C3orf58	205428	broad.mit.edu	37	3	143704424	143704424	+	Missense_Mutation	SNP	C	C	G			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr3:143704424C>G	ENST00000315691.3	+	2	1232	c.697C>G	c.(697-699)Ctt>Gtt	p.L233V	C3orf58_ENST00000495414.1_Missense_Mutation_p.L24V|C3orf58_ENST00000493396.1_Intron|C3orf58_ENST00000441925.2_5'UTR	NM_173552.3	NP_775823.1	Q8NDZ4	DIA1_HUMAN	chromosome 3 open reading frame 58	233					cardiac muscle cell proliferation (GO:0060038)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	COPI vesicle coat (GO:0030126)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TGCAAAGTATCTTGGAGCTTG	0.393																																						ENST00000315691.3	0.620000	0.210000	5.100000e-01	2.900000e-01	0.380000	0.404387	0.380000	0.370000																										0				21						c.(697-699)Ctt>Gtt		chromosome 3 open reading frame 58							152.0	151.0	152.0					3																	143704424		2203	4300	6503	SO:0001583	missense	205428	0	0					g.chr3:143704424C>G	AK095161	CCDS3130.1, CCDS46929.1	3q24	2013-12-06			ENSG00000181744	ENSG00000181744			28490	protein-coding gene	gene with protein product	"""deleted in autism 1"", ""hypoxia and Akt induced stem cell factor"""	612200				21283809, 23784961, 24269490	Standard	NM_173552		Approved	MGC33365, DIA1, HASF	uc003evo.3	Q8NDZ4	OTTHUMG00000159380	ENST00000315691.3:c.697C>G	chr3.hg19:g.143704424C>G	ENSP00000320081:p.Leu233Val	0					C3orf58_ENST00000441925.2_5'UTR|C3orf58_ENST00000493396.1_Intron|C3orf58_ENST00000495414.1_Missense_Mutation_p.L24V	p.L233V	NM_173552.3	NP_775823.1	0	0	0	1.980772	Q8NDZ4	DIA1_HUMAN		2	1232	+			B2RCF2|B7Z1W3	Missense_Mutation	SNP	ENST00000315691.3	1	1	hg19	c.697C>G	CCDS3130.1	0	.	.	.	.	.	.	.	.	.	.	C	14.57	2.573485	0.45902	.	.	ENSG00000181744	ENST00000315691;ENST00000495414;ENST00000492452	T	0.36878	1.23	5.24	4.37	0.52481	5.240000	4.370000	0.524810	.	0.000000	0.64402	D	0.000001	T	0.46698	0.1406	M	0.73217	2.22	0.80722	D	1	P;D	0.56287	0.915;0.975	P;P	0.52957	0.596;0.714	T	0.45731	-0.9241	10	0.51188	T	0.08	.	8.7331	0.34512	0.0:0.7811:0.0:0.2189	.	24;233	B7Z1W3;Q8NDZ4	.;CC058_HUMAN	V	233;24;39	ENSP00000320081:L233V	ENSP00000320081:L233V	L	+	1	0	0	C3orf58	145187114	145187114	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	3.837000	0.55820	1.228000	0.43614	-0.136000	0.14681	CTT	0.097088		TCGA-2J-AABV-01A-12D-A40W-08	0.393	C3orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355038.1	0	0	1		2	2	2	0		0	0	206		206	205	1	2.010000	-2.616717	1	0.110000	NM_173552			13	13		596	587	0		1			0	0	206	0		0.999490	0	0	0	0	0	0	13	596
STAB1	23166	broad.mit.edu	37	3	52544021	52544021	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr3:52544021C>T	ENST00000321725.6	+	23	2559	c.2483C>T	c.(2482-2484)gCc>gTc	p.A828V		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	828	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		ACAGGGCTGGCCCAGCACTGC	0.662																																						ENST00000321725.6	0.510000	0.090000	3.800000e-01	1.600000e-01	0.250000	0.278893	0.250000	0.230000																										0				76						c.(2482-2484)gCc>gTc		stabilin 1							58.0	62.0	60.0					3																	52544021		2203	4298	6501	SO:0001583	missense	23166	0	0					g.chr3:52544021C>T	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.2483C>T	chr3.hg19:g.52544021C>T	ENSP00000312946:p.Ala828Val	0						p.A828V	NM_015136.2	NP_055951.2	0	0	0	1.980772	Q9NY15	STAB1_HUMAN		23	2559	+			A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	0	1	hg19	c.2483C>T	CCDS33768.1	0	.	.	.	.	.	.	.	.	.	.	C	7.895	0.733050	0.15507	.	.	ENSG00000010327	ENST00000321725	T	0.03124	4.04	4.7	4.7	0.59300	4.700000	4.700000	0.593000	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.456341	0.21799	N	0.068955	T	0.03520	0.0101	L	0.38838	1.175	0.31954	N	0.609253	P	0.46142	0.873	B	0.35931	0.214	T	0.39418	-0.9615	10	0.11182	T	0.66	.	17.4369	0.87555	0.0:1.0:0.0:0.0	.	828	Q9NY15	STAB1_HUMAN	V	828	ENSP00000312946:A828V	ENSP00000312946:A828V	A	+	2	0	0	STAB1	52519061	52519061	0.518000	0.26234	0.857000	0.33713	0.553000	0.35397	3.120000	0.50430	2.447000	0.82792	0.655000	0.94253	GCC	0.097088		TCGA-2J-AABV-01A-12D-A40W-08	0.662	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	0	0	1		2	2	2	0		0	0	94		94	93	1	2.010000	-2.631695	1	0.110000	NM_015136			5	5		369	365	0		1			0	0	94	0		0.936165	0	0	0	0	0	0	5	369
PPM1L	151742	broad.mit.edu	37	3	160783197	160783197	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr3:160783197C>T	ENST00000498165.1	+	3	682	c.581C>T	c.(580-582)aCg>aTg	p.T194M	PPM1L_ENST00000464260.1_Missense_Mutation_p.T15M|PPM1L_ENST00000480117.1_3'UTR|PPM1L_ENST00000295839.9_Missense_Mutation_p.T67M	NM_139245.2	NP_640338.2	Q5SGD2	PPM1L_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1L	194	PP2C-like.				MAPK cascade (GO:0000165)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.T194K(1)|p.T15K(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			TCAGGCACAACGTGTTTGATT	0.478																																					Pancreas(86;250 1994 13715 43211)	ENST00000498165.1	0.670000	0.190000	5.300000e-01	2.700000e-01	0.390000	0.411480	0.390000	0.370000																										2	Substitution - Missense(2)	p.T194K(1)|p.T15K(1)	endometrium(2)	13						c.(580-582)aCg>aTg		protein phosphatase, Mg2+/Mn2+ dependent, 1L							89.0	94.0	92.0					3																	160783197		2203	4300	6503	SO:0001583	missense	151742	0	0					g.chr3:160783197C>T	AK055115	CCDS33886.1	3q26.1	2012-04-17	2010-03-05		ENSG00000163590	ENSG00000163590	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	16381	protein-coding gene	gene with protein product	"""PP2Cepsilon"", ""Protein phosphatase 2C epsilon isoform"""	611931	"""protein phosphatase 1 (formerly 2C)-like"""			12556533	Standard	XM_006713507		Approved	PP2CE	uc003fdr.3	Q5SGD2	OTTHUMG00000159048	ENST00000498165.1:c.581C>T	chr3.hg19:g.160783197C>T	ENSP00000417659:p.Thr194Met	0					PPM1L_ENST00000295839.9_Missense_Mutation_p.T67M|PPM1L_ENST00000464260.1_Missense_Mutation_p.T15M|PPM1L_ENST00000480117.1_3'UTR	p.T194M	NM_139245.2	NP_640338.2	0	0	0	1.980772	Q5SGD2	PPM1L_HUMAN	Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)	3	682	+			Q2M3J2|Q96NM7	Missense_Mutation	SNP	ENST00000498165.1	0	1	hg19	c.581C>T	CCDS33886.1	0	.	.	.	.	.	.	.	.	.	.	C	21.4	4.144990	0.77888	.	.	ENSG00000163590	ENST00000498165;ENST00000464260;ENST00000295839	T;T;T	0.30981	1.51;1.51;1.51	5.12	5.12	0.69794	5.120000	5.120000	0.697940	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.73377	0.3579	H	0.99011	4.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84979	0.0887	10	0.87932	D	0	.	17.7238	0.88359	0.0:1.0:0.0:0.0	.	67;194	Q5SGD2-3;Q5SGD2	.;PPM1L_HUMAN	M	194;15;67	ENSP00000417659:T194M;ENSP00000420746:T15M;ENSP00000295839:T67M	ENSP00000295839:T67M	T	+	2	0	0	PPM1L	162265891	162265891	1.000000	0.71417	0.986000	0.45419	0.575000	0.36095	7.298000	0.78815	2.681000	0.91329	0.561000	0.74099	ACG	0.097088		TCGA-2J-AABV-01A-12D-A40W-08	0.478	PPM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353019.1	0	0	1		2	2	2	0		0	0	151		151	151	1	2.010000	-3.103370	1	0.110000	NM_139245			9	9		415	408	0		1			0	0	151	0		0.993880	0	0	0	0	0	0	9	415
ACOX3	8310	broad.mit.edu	37	4	8368698	8368698	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr4:8368698G>A	ENST00000356406.5	-	18	2170	c.2093C>T	c.(2092-2094)tCg>tTg	p.S698L	ACOX3_ENST00000503233.1_Missense_Mutation_p.S698L|ACOX3_ENST00000515797.1_5'UTR|ACOX3_ENST00000413009.2_3'UTR	NM_003501.2	NP_003492.2	O15254	ACOX3_HUMAN	acyl-CoA oxidase 3, pristanoyl	698					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(17)|prostate(1)|skin(3)|stomach(1)	42						CTAGAGCTTCGATTTCAGACT	0.517																																						ENST00000356406.5	1.000000	0.170000	6.000000e-01	2.600000e-01	0.380000	0.449359	0.380000	0.340000																										0				42						c.(2092-2094)tCg>tTg		acyl-CoA oxidase 3, pristanoyl							127.0	118.0	121.0					4																	8368698		2203	4300	6503	SO:0001583	missense	8310	9	121412	43				g.chr4:8368698G>A	Y11411	CCDS3401.1, CCDS47017.1	4p15.3	2010-04-30	2010-04-30		ENSG00000087008	ENSG00000087008	1.3.3.6		121	protein-coding gene	gene with protein product		603402	"""acyl-Coenzyme A oxidase 3, pristanoyl"""			9271077	Standard	NM_003501		Approved		uc003glc.4	O15254	OTTHUMG00000090509	ENST00000356406.5:c.2093C>T	chr4.hg19:g.8368698G>A	ENSP00000348775:p.Ser698Leu	0					ACOX3_ENST00000515797.1_5'UTR|ACOX3_ENST00000503233.1_Missense_Mutation_p.S698L|ACOX3_ENST00000413009.2_3'UTR	p.S698L	NM_003501.2	NP_003492.2	1	2	3	2.006263	O15254	ACOX3_HUMAN		18	2170	-			Q96AJ8	Missense_Mutation	SNP	ENST00000356406.5	0	1	hg19	c.2093C>T	CCDS3401.1	0	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598931	0.66332	.	.	ENSG00000087008	ENST00000356406;ENST00000503233	D;D	0.93247	-3.19;-3.19	5.16	5.16	0.70880	5.160000	5.160000	0.708800	.	0.535944	0.17481	N	0.172735	D	0.92984	0.7767	M	0.76574	2.34	0.24015	N	0.996166	D	0.61697	0.99	B	0.42188	0.379	D	0.88987	0.3412	10	0.87932	D	0	1.4088	16.1529	0.81634	0.0:0.0:1.0:0.0	.	698	O15254	ACOX3_HUMAN	L	698	ENSP00000348775:S698L;ENSP00000421625:S698L	ENSP00000348775:S698L	S	-	2	0	0	ACOX3	8419598	8419598	0.948000	0.32251	0.037000	0.18230	0.026000	0.11368	7.092000	0.76930	2.411000	0.81874	0.655000	0.94253	TCG	0.116801		TCGA-2J-AABV-01A-12D-A40W-08	0.517	ACOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206997.4	0	0	1		13	3	2	1		1	1	132		132	131	1	2.010000	-2.794449	1	0.110000				8	9		416	411	0		0	1		1	0	132	0		0.181238	4.989540e-02	0	4	0	33	0	8	416
DCAF4L1	285429	broad.mit.edu	37	4	41984668	41984668	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr4:41984668G>A	ENST00000333141.5	+	1	956	c.859G>A	c.(859-861)Gca>Aca	p.A287T		NM_001029955.3	NP_001025126.2	Q3SXM0	DC4L1_HUMAN	DDB1 and CUL4 associated factor 4-like 1	287										breast(1)|endometrium(5)|kidney(6)|large_intestine(11)|lung(12)|prostate(1)|skin(1)	37						ATGCCTGATGGCATCAGACAT	0.532																																						ENST00000333141.5	1.000000	0.100000	4.300000e-01	1.600000e-01	0.250000	0.339165	0.250000	0.220000																										0				37						c.(859-861)Gca>Aca		DDB1 and CUL4 associated factor 4-like 1							124.0	108.0	113.0					4																	41984668		2203	4300	6503	SO:0001583	missense	285429	0	0					g.chr4:41984668G>A	BC035027	CCDS33978.1	4p13	2013-01-09	2009-07-17	2009-07-17		ENSG00000182308		"""WD repeat domain containing"""	27723	protein-coding gene	gene with protein product			"""WD repeat domain 21B"""	WDR21B			Standard	NM_001029955		Approved		uc003gwk.2	Q3SXM0		ENST00000333141.5:c.859G>A	chr4.hg19:g.41984668G>A	ENSP00000327796:p.Ala287Thr	0						p.A287T	NM_001029955.3	NP_001025126.2	1	2	3	2.006263	Q3SXM0	DC4L1_HUMAN		1	956	+			B3KVI3|Q3ZCW8|Q499Y5|Q9UFI0	Missense_Mutation	SNP	ENST00000333141.5	0	1	hg19	c.859G>A	CCDS33978.1	0	.	.	.	.	.	.	.	.	.	.	G	13.66	2.303230	0.40795	.	.	ENSG00000182308	ENST00000333141	T	0.67171	-0.25	0.97	0.97	0.19692	0.970000	0.970000	0.196920	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.100771	0.64402	D	0.000002	T	0.59770	0.2218	M	0.63843	1.955	0.36094	D	0.84367	P	0.49961	0.93	B	0.43575	0.424	T	0.66015	-0.6028	10	0.46703	T	0.11	.	7.7469	0.28875	1.0E-4:0.0:0.9999:0.0	.	287	Q3SXM0	DC4L1_HUMAN	T	287	ENSP00000327796:A287T	ENSP00000327796:A287T	A	+	1	0	0	DCAF4L1	41679425	41679425	1.000000	0.71417	0.144000	0.22314	0.696000	0.40369	4.160000	0.58164	0.821000	0.34540	0.313000	0.20887	GCA	0.116801		TCGA-2J-AABV-01A-12D-A40W-08	0.532	DCAF4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360958.1	0	0	1		2	2	2	0		0	0	128		128	127	1	2.010000	-3.019343	1	0.110000	NM_001029955			6	6		485	480	0		1			0	0	128	0		0.964052	0	0	0	0	0	0	6	485
GRID2	2895	broad.mit.edu	37	4	93511323	93511323	+	Missense_Mutation	SNP	T	T	C			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr4:93511323T>C	ENST00000282020.4	+	2	388	c.130T>C	c.(130-132)Ttt>Ctt	p.F44L	GRID2_ENST00000505687.1_3'UTR|GRID2_ENST00000510992.1_Missense_Mutation_p.F44L	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	44					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TGATGAGGTATTTCGCACTGC	0.383																																						ENST00000282020.4	1.000000	0.110000	4.900000e-01	1.800000e-01	0.290000	0.373102	0.290000	0.250000																										0				100						c.(130-132)Ttt>Ctt		glutamate receptor, ionotropic, delta 2							120.0	115.0	117.0					4																	93511323		2203	4300	6503	SO:0001583	missense	2895	0	0					g.chr4:93511323T>C	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.130T>C	chr4.hg19:g.93511323T>C	ENSP00000282020:p.Phe44Leu	0					GRID2_ENST00000505687.1_3'UTR|GRID2_ENST00000510992.1_Missense_Mutation_p.F44L	p.F44L	NM_001510.2	NP_001501.2	1	2	3	2.006263	O43424	GRID2_HUMAN		2	388	+		Hepatocellular(203;0.114)|all_hematologic(202;0.177)	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	0	1	hg19	c.130T>C	CCDS3637.1	0	.	.	.	.	.	.	.	.	.	.	T	22.0	4.232293	0.79688	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	D;D	0.85411	-1.7;-1.98	5.83	5.83	0.93111	5.830000	5.830000	0.931110	Extracellular ligand-binding receptor (1);	0.370342	0.23413	N	0.048445	D	0.88683	0.6503	L	0.34521	1.04	0.37505	D	0.916902	P;D	0.57257	0.924;0.979	P;D	0.74023	0.878;0.982	D	0.91209	0.4997	10	0.87932	D	0	.	16.194	0.82011	0.0:0.0:0.0:1.0	.	44;44	E9PH24;O43424	.;GRID2_HUMAN	L	44	ENSP00000282020:F44L;ENSP00000421257:F44L	ENSP00000282020:F44L	F	+	1	0	0	GRID2	93730346	93730346	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.040000	0.89188	2.225000	0.72522	0.460000	0.39030	TTT	0.116801		TCGA-2J-AABV-01A-12D-A40W-08	0.383	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2	0	0	1		2	2	2	0		0	0	136		136	136	1	2.010000	-3.329976	1	0.110000				6	6		420	416	0		1			0	0	136	0		0.964194	0	0	0	0	0	0	6	420
PDHA2	5161	broad.mit.edu	37	4	96762083	96762083	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr4:96762083G>A	ENST00000295266.4	+	1	845	c.782G>A	c.(781-783)cGt>cAt	p.R261H		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	261					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		CTGTGTGTTCGTGAGGCAACA	0.473																																						ENST00000295266.4	1.000000	0.160000	7.500000e-01	2.700000e-01	0.430000	0.498924	0.430000	0.360000																										0				46						c.(781-783)cGt>cAt		pyruvate dehydrogenase (lipoamide) alpha 2							148.0	147.0	147.0					4																	96762083		2203	4300	6503	SO:0001583	missense	5161	1	121412	30				g.chr4:96762083G>A		CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.782G>A	chr4.hg19:g.96762083G>A	ENSP00000295266:p.Arg261His	0						p.R261H	NM_005390.4	NP_005381.1	1	2	3	2.006263	P29803	ODPAT_HUMAN		1	845	+		Hepatocellular(203;0.114)	B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	ENST00000295266.4	0	1	hg19	c.782G>A	CCDS3644.1	0	.	.	.	.	.	.	.	.	.	.	G	18.49	3.635923	0.67130	.	.	ENSG00000163114	ENST00000295266	D	0.95885	-3.84	4.91	4.06	0.47325	4.910000	4.060000	0.473250	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.96346	0.8808	L	0.53561	1.675	0.53005	D	0.999965	D	0.89917	1.0	D	0.91635	0.999	D	0.95644	0.8701	10	0.87932	D	0	-18.3149	11.0734	0.48016	0.0921:0.0:0.9079:0.0	.	261	P29803	ODPAT_HUMAN	H	261	ENSP00000295266:R261H	ENSP00000295266:R261H	R	+	2	0	0	PDHA2	96981106	96981106	0.848000	0.29623	0.782000	0.31804	0.637000	0.38172	4.724000	0.61972	2.733000	0.93635	0.467000	0.42956	CGT	0.116801		TCGA-2J-AABV-01A-12D-A40W-08	0.473	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253608.1	0	0	1		2	2	2	0		0	0	87		87	86	1	2.010000	-6.117036	1	0.110000				5	6		237	235	0		1			0	0	87	0		0.937506	0	0	0	0	0	0	5	237
ANKRD50	57182	broad.mit.edu	37	4	125599973	125599973	+	Silent	SNP	A	A	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr4:125599973A>T	ENST00000504087.1	-	3	1637	c.600T>A	c.(598-600)atT>atA	p.I200I	ANKRD50_ENST00000515641.1_Silent_p.I21I	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	200										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						CACCTTCAGTAATGTTACACC	0.453																																						ENST00000504087.1	1.000000	0.340000	7.800000e-01	4.400000e-01	0.570000	0.613018	0.570000	0.530000																										0				55						c.(598-600)atT>atA		ankyrin repeat domain 50							195.0	191.0	193.0					4																	125599973		2203	4300	6503	SO:0001819	synonymous_variant	57182	0	0					g.chr4:125599973A>T	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.600T>A	chr4.hg19:g.125599973A>T		0					ANKRD50_ENST00000515641.1_Silent_p.I21I	p.I200I	NM_020337.2	NP_065070.1	1	2	3	2.006263	Q9ULJ7	ANR50_HUMAN		3	1637	-			A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Silent	SNP	ENST00000504087.1	1	1	hg19	c.600T>A	CCDS34060.1	0																																																																																								0.116801		TCGA-2J-AABV-01A-12D-A40W-08	0.453	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1	0	0	1		2	2	2	0		0	0	213		213	209	1	2.010000	-15.643040	1	0.110000	NM_020337			18	18		589	585	0		1			0	0	213	0		0.999981	0	0	0	0	0	0	18	589
PCDHA1	56147	broad.mit.edu	37	5	140167494	140167494	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr5:140167494C>T	ENST00000504120.2	+	1	1619	c.1619C>T	c.(1618-1620)gCg>gTg	p.A540V	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000378133.3_Missense_Mutation_p.A540V	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	540	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCGGGATGCGGGCGTGCCG	0.682																																						ENST00000504120.2	1.000000	0.510000	1	6.400000e-01	0.800000	0.806241	0.800000	1.000000																										0				70						c.(1618-1620)gCg>gTg		protocadherin alpha 1							62.0	67.0	66.0					5																	140167494		2203	4298	6501	SO:0001583	missense	56147	0	0					g.chr5:140167494C>T	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1619C>T	chr5.hg19:g.140167494C>T	ENSP00000420840:p.Ala540Val	0					PCDHA1_ENST00000378133.3_Missense_Mutation_p.A540V|PCDHA1_ENST00000394633.3_Intron	p.A540V	NM_018900.2	NP_061723.1	1	2	3	2.000113	Q9Y5I3	PCDA1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	1619	+			O75288|Q9NRT7	Missense_Mutation	SNP	ENST00000504120.2	1	1	hg19	c.1619C>T	CCDS54913.1	0	.	.	.	.	.	.	.	.	.	.	c	18.40	3.615636	0.66672	.	.	ENSG00000204970	ENST00000504120;ENST00000378133	T;T	0.53857	0.6;0.6	3.49	3.49	0.39957	3.490000	3.490000	0.399570	Cadherin (4);Cadherin-like (1);	0.404731	0.17581	U	0.169114	T	0.62575	0.2439	L	0.53617	1.68	0.31041	N	0.71635	D;D	0.67145	0.995;0.996	P;P	0.56343	0.783;0.796	T	0.68697	-0.5340	10	0.87932	D	0	.	15.4054	0.74874	0.0:1.0:0.0:0.0	.	540;540	Q9Y5I3;Q9Y5I3-3	PCDA1_HUMAN;.	V	540	ENSP00000420840:A540V;ENSP00000367373:A540V	ENSP00000367373:A540V	A	+	2	0	0	PCDHA1	140147678	140147678	0.462000	0.25791	0.953000	0.39169	0.396000	0.30629	0.881000	0.28173	1.676000	0.50930	0.549000	0.68633	GCG	0.115352		TCGA-2J-AABV-01A-12D-A40W-08	0.682	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	1	0	1		2	2	2	0		0	0	171		171	176	1	2.010000	-3.673474	1	0.110000	NM_018900			23	23		518	512	0		1			0	0	171	0		0.999999	0	0	0	0	0	0	23	518
CDH10	1008	broad.mit.edu	37	5	24511502	24511502	+	Missense_Mutation	SNP	G	G	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr5:24511502G>T	ENST00000264463.4	-	6	1443	c.936C>A	c.(934-936)gaC>gaA	p.D312E		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	312	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TATCAGTACCGTCACCATCAA	0.438										HNSCC(23;0.051)																												ENST00000264463.4	1.000000	0.210000	5.600000e-01	2.900000e-01	0.400000	0.456447	0.400000	0.380000																										0				185						c.(934-936)gaC>gaA		cadherin 10, type 2 (T2-cadherin)							256.0	206.0	223.0					5																	24511502		2203	4300	6503	SO:0001583	missense	1008	0	0					g.chr5:24511502G>T	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.936C>A	chr5.hg19:g.24511502G>T	ENSP00000264463:p.Asp312Glu	0	HNSCC(23;0.051)					p.D312E	NM_006727.3	NP_006718.2	1	2	3	2.000113	Q9Y6N8	CAD10_HUMAN		6	1443	-			Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	1	1	hg19	c.936C>A	CCDS3892.1	0	.	.	.	.	.	.	.	.	.	.	G	13.15	2.151750	0.38021	.	.	ENSG00000040731	ENST00000264463	T	0.01685	4.69	5.22	1.4	0.22301	5.220000	1.400000	0.223010	Cadherin (4);Cadherin-like (1);	0.049789	0.85682	D	0.000000	T	0.03220	0.0094	L	0.35723	1.085	0.35051	D	0.760673	P	0.42203	0.773	P	0.52856	0.711	T	0.53655	-0.8408	10	0.33940	T	0.23	.	8.8072	0.34945	0.7795:0.0:0.2205:0.0	.	312	Q9Y6N8	CAD10_HUMAN	E	312	ENSP00000264463:D312E	ENSP00000264463:D312E	D	-	3	2	2	CDH10	24547259	24547259	0.996000	0.38824	0.987000	0.45799	0.607000	0.37147	0.495000	0.22483	0.004000	0.14682	-0.247000	0.11927	GAC	0.115352		TCGA-2J-AABV-01A-12D-A40W-08	0.438	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	0	0	1		2	2	2	0		0	0	201		201	201	1	2.010000	-2.536928	1	0.110000	NM_006727			13	12		612	602	0		1			0	0	201	0		0.999474	0	0	0	0	0	0	13	612
RICTOR	253260	broad.mit.edu	37	5	38954899	38954899	+	Missense_Mutation	SNP	C	C	T			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr5:38954899C>T	ENST00000357387.3	-	27	2704	c.2674G>A	c.(2674-2676)Ggc>Agc	p.G892S	RICTOR_ENST00000296782.5_Missense_Mutation_p.G892S|RICTOR_ENST00000503698.1_5'UTR	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					AAATGGCAGCCTGTTTTATGG	0.313																																						ENST00000357387.3	1.000000	0.250000	6.500000e-01	3.400000e-01	0.460000	0.514798	0.460000	0.440000																										0				75						c.(2674-2676)Ggc>Agc		RPTOR independent companion of MTOR, complex 2							117.0	116.0	116.0					5																	38954899		2203	4300	6503	SO:0001583	missense	253260	0	0					g.chr5:38954899C>T		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.2674G>A	chr5.hg19:g.38954899C>T	ENSP00000349959:p.Gly892Ser	0					RICTOR_ENST00000296782.5_Missense_Mutation_p.G892S|RICTOR_ENST00000503698.1_5'UTR	p.G892S	NM_152756.3	NP_689969.2	1	2	3	2.000113				27	2704	-	all_lung(31;0.000396)			Missense_Mutation	SNP	ENST00000357387.3	1	1	hg19	c.2674G>A	CCDS34148.1	0	.	.	.	.	.	.	.	.	.	.	C	35	5.531120	0.96446	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.66460	-0.21;-0.17	5.79	5.79	0.91817	5.790000	5.790000	0.918170	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84356	0.5454	M	0.84219	2.685	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	D	0.85682	0.1301	10	0.87932	D	0	-9.9909	20.0308	0.97536	0.0:1.0:0.0:0.0	.	892;892	Q6R327;Q6R327-3	RICTR_HUMAN;.	S	892	ENSP00000349959:G892S;ENSP00000296782:G892S	ENSP00000296782:G892S	G	-	1	0	0	RICTOR	38990656	38990656	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.707000	0.74654	2.732000	0.93576	0.585000	0.79938	GGC	0.115352		TCGA-2J-AABV-01A-12D-A40W-08	0.313	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	0	0	1		2	2	2	0		0	0	215		215	214	1	2.010000	-3.271765	1	0.110000	NM_152756			13	13		525	511	0		1			0	0	215	0		0.999454	0	0	0	0	0	0	13	525
ADAMTS2	9509	broad.mit.edu	37	5	178562924	178562924	+	Missense_Mutation	SNP	G	G	A			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr5:178562924G>A	ENST00000251582.7	-	13	2172	c.2071C>T	c.(2071-2073)Cgc>Tgc	p.R691C		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	691	Cys-rich.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		CAGTCCCCGCGCACACAGAGG	0.637																																						ENST00000251582.7	1.000000	0.240000	8.500000e-01	3.700000e-01	0.550000	0.597372	0.550000	1.000000																										0				72						c.(2071-2073)Cgc>Tgc		ADAM metallopeptidase with thrombospondin type 1 motif, 2							65.0	60.0	62.0					5																	178562924		2203	4300	6503	SO:0001583	missense	9509	1	121392	28				g.chr5:178562924G>A	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.2071C>T	chr5.hg19:g.178562924G>A	ENSP00000251582:p.Arg691Cys	0						p.R691C	NM_014244.4	NP_055059.2	1	2	3	2.000113	O95450	ATS2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	13	2172	-	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)		Missense_Mutation	SNP	ENST00000251582.7	0	1	hg19	c.2071C>T	CCDS4444.1	0	.	.	.	.	.	.	.	.	.	.	G	19.28	3.797583	0.70567	.	.	ENSG00000087116	ENST00000251582	T	0.69175	-0.38	5.37	5.37	0.77165	5.370000	5.370000	0.771650	.	0.000000	0.56097	D	0.000034	D	0.83440	0.5255	M	0.88704	2.975	0.80722	D	1	D	0.89917	1.0	D	0.68192	0.956	D	0.86425	0.1757	10	0.72032	D	0.01	.	14.6038	0.68463	0.0:0.0:0.8538:0.1462	.	691	O95450	ATS2_HUMAN	C	691	ENSP00000251582:R691C	ENSP00000251582:R691C	R	-	1	0	0	ADAMTS2	178495530	178495530	1.000000	0.71417	0.999000	0.59377	0.548000	0.35241	5.446000	0.66600	2.521000	0.84997	0.462000	0.41574	CGC	0.115352		TCGA-2J-AABV-01A-12D-A40W-08	0.637	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	0	0	1		2	2	2	0		0	0	71		71	70	1	2.010000	-8.008599	1	0.110000	NM_014244			7	7		244	242	0		1	0		0	0	71	0		0.980473	1.120413e-03	0	0	0	2	0	7	244
HIST1H2BE	8344	broad.mit.edu	37	6	26184216	26184216	+	Missense_Mutation	SNP	T	T	G			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr6:26184216T>G	ENST00000356530.3	+	1	259	c.193T>G	c.(193-195)Tcc>Gcc	p.S65A		NM_003523.2	NP_003514.2	P62807	H2B1C_HUMAN	histone cluster 1, H2be	65					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(2)|lung(1)	4						GATCATGAATTCCTTTGTCAA	0.587																																						ENST00000356530.3	0.360000	0.100000	2.900000e-01	1.500000e-01	0.210000	0.225164	0.210000	0.210000																										0				4						c.(193-195)Tcc>Gcc		histone cluster 1, H2be							154.0	145.0	148.0					6																	26184216		2203	4300	6503	SO:0001583	missense	8344	0	0					g.chr6:26184216T>G	Z80780	CCDS4588.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197697	ENSG00000274290		"""Histones / Replication-dependent"""	4753	protein-coding gene	gene with protein product		602805	"""H2B histone family, member H"", ""histone 1, H2be"""	H2BFH		9119399, 12408966	Standard	NM_003523		Approved	H2B/h, H2B.h	uc003ngt.3	P62807	OTTHUMG00000014427	ENST00000356530.3:c.193T>G	chr6.hg19:g.26184216T>G	ENSP00000348924:p.Ser65Ala	0						p.S65A	NM_003523.2	NP_003514.2	0	0	0	1.956692	P62807	H2B1C_HUMAN		1	259	+			P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	ENST00000356530.3	0	1	hg19	c.193T>G	CCDS4588.1	0	.	.	.	.	.	.	.	.	.	.	.	15.08	2.725694	0.48833	.	.	ENSG00000197697	ENST00000356530	T	0.67171	-0.25	4.96	4.96	0.65561	4.960000	4.960000	0.655610	.	0.000000	0.30732	U	0.008990	T	0.70745	0.3259	.	.	.	0.40050	D	0.975766	.	.	.	.	.	.	T	0.76337	-0.2996	7	0.87932	D	0	.	13.7937	0.63157	0.0:0.0:0.0:1.0	.	.	.	.	A	65	ENSP00000348924:S65A	ENSP00000348924:S65A	S	+	1	0	0	HIST1H2BE	26292195	26292195	1.000000	0.71417	1.000000	0.80357	0.022000	0.10575	7.612000	0.82975	2.005000	0.58758	0.438000	0.28831	TCC	0.085867		TCGA-2J-AABV-01A-12D-A40W-08	0.587	HIST1H2BE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040090.1	0	0	1		2	2	2	0		0	0	275		275	272	1	2.010000	-3.318819	1	0.110000	NM_003523			10	10		842	822	0		1			0	0	275	0		0.996495	0	0	0	0	0	0	10	842
KIAA0408	9729	broad.mit.edu	37	6	127768717	127768717	+	Silent	SNP	C	C	T	rs528764032	byFrequency	TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr6:127768717C>T	ENST00000483725.3	-	5	1083	c.747G>A	c.(745-747)acG>acA	p.T249T	SOGA3_ENST00000481848.2_3'UTR|SOGA3_ENST00000556132.1_3'UTR	NM_014702.4	NP_055517.3	Q6ZU52	K0408_HUMAN	KIAA0408	249										endometrium(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|skin(1)	28				GBM - Glioblastoma multiforme(226;0.0217)|all cancers(137;0.13)		CACATTTTTTCGTAGAATTGC	0.388													C|||	2	0.000399361	0.0	0.0	5008	,	,		18557	0.002		0.0	False		,,,				2504	0.0					ENST00000483725.3	1.000000	0.330000	8.600000e-01	4.400000e-01	0.590000	0.636388	0.590000	0.550000																										0				28						c.(745-747)acG>acA		KIAA0408							79.0	78.0	78.0					6																	127768717		2203	4300	6503	SO:0001819	synonymous_variant	9729	39	121412	48				g.chr6:127768717C>T	AB007868	CCDS34531.1	6q22.33	2012-11-29			ENSG00000189367	ENSG00000189367			21636	protein-coding gene	gene with protein product							Standard	NM_014702		Approved		uc011ebs.2	Q6ZU52	OTTHUMG00000166439	ENST00000483725.3:c.747G>A	chr6.hg19:g.127768717C>T		0					SOGA3_ENST00000556132.1_3'UTR|SOGA3_ENST00000481848.2_3'UTR	p.T249T	NM_014702.4	NP_055517.3	1	2	3	2.008671	Q6ZU52	K0408_HUMAN		5	1083	-			B3KRE5|E1P573|O43158|Q5TF20|Q7L2M2	Silent	SNP	ENST00000483725.3	1	1	hg19	c.747G>A	CCDS34531.1	0																																																																																								0.117282		TCGA-2J-AABV-01A-12D-A40W-08	0.388	KIAA0408-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042145.3	0	0	1		2	2	2	0		0	0	145		145	144	1	2.010000	-2.927072	1	0.110000	NM_014702			14	14		444	438	0		1			0	0	145	0		0.999739	0	0	0	0	0	0	14	444
MLXIPL	51085	broad.mit.edu	37	7	73008307	73008307	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr7:73008307A>G	ENST00000313375.3	-	17	2494	c.2447T>C	c.(2446-2448)cTg>cCg	p.L816P	MLXIPL_ENST00000395189.1_Missense_Mutation_p.L723P|MLXIPL_ENST00000354613.1_Missense_Mutation_p.L795P|MLXIPL_ENST00000414749.2_Missense_Mutation_p.L814P|MLXIPL_ENST00000434326.1_3'UTR|MLXIPL_ENST00000429400.2_Missense_Mutation_p.L797P	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	816					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				TAGGGAGTTCAGGACAGCTGG	0.607																																						ENST00000313375.3	1.000000	0.230000	1	3.800000e-01	0.620000	0.654045	0.620000	1.000000																										0				13						c.(2446-2448)cTg>cCg		MLX interacting protein-like							57.0	55.0	56.0					7																	73008307		2203	4300	6503	SO:0001583	missense	51085	0	0					g.chr7:73008307A>G	AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.2447T>C	chr7.hg19:g.73008307A>G	ENSP00000320886:p.Leu816Pro	0					MLXIPL_ENST00000429400.2_Missense_Mutation_p.L797P|MLXIPL_ENST00000354613.1_Missense_Mutation_p.L795P|MLXIPL_ENST00000414749.2_Missense_Mutation_p.L814P|MLXIPL_ENST00000395189.1_Missense_Mutation_p.L723P|MLXIPL_ENST00000434326.1_3'UTR	p.L816P	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	1	2	3	2.014239	Q9NP71	MLXPL_HUMAN		17	2494	-		Lung NSC(55;0.0659)|all_lung(88;0.152)	C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Missense_Mutation	SNP	ENST00000313375.3	0	1	hg19	c.2447T>C	CCDS5553.1	0	.	.	.	.	.	.	.	.	.	.	A	17.71	3.457595	0.63401	.	.	ENSG00000009950	ENST00000414749;ENST00000429400;ENST00000313375;ENST00000354613;ENST00000395189	T;T;T;T;T	0.33865	2.03;2.05;2.02;2.06;1.39	4.61	3.41	0.39046	4.610000	3.410000	0.390460	.	0.343732	0.23567	N	0.046791	T	0.54598	0.1868	M	0.70595	2.14	0.53688	D	0.999972	D;D;D;D	0.76494	0.999;0.999;0.998;0.998	D;D;D;D	0.83275	0.946;0.976;0.996;0.996	T	0.54437	-0.8294	10	0.87932	D	0	-16.4415	7.9763	0.30157	0.7918:0.2082:0.0:0.0	.	816;797;814;795	Q9NP71;Q9NP71-2;Q9NP71-3;Q9NP71-4	MLXPL_HUMAN;.;.;.	P	814;797;816;795;723	ENSP00000412330:L814P;ENSP00000406296:L797P;ENSP00000320886:L816P;ENSP00000346629:L795P;ENSP00000378616:L723P	ENSP00000320886:L816P	L	-	2	0	0	MLXIPL	72646243	72646243	1.000000	0.71417	0.996000	0.52242	0.836000	0.47400	8.527000	0.90594	0.756000	0.33013	0.459000	0.35465	CTG	0.118244		TCGA-2J-AABV-01A-12D-A40W-08	0.607	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252262.1	0	0	0		2	2	2	0		0	0	50		50	49	1	2.010000	-7.229408	1	0.110000	NM_032951			5	5		165	164	0		1	0		0	0	50	0		0.937512	1.589293e-01	0	0	0	20	0	5	165
FAM167A	83648	broad.mit.edu	37	8	11301851	11301851	+	Missense_Mutation	SNP	C	C	T	rs146121515		TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr8:11301851C>T	ENST00000528897.1	-	2	689	c.70G>A	c.(70-72)Gat>Aat	p.D24N	FAM167A_ENST00000534308.1_Missense_Mutation_p.D24N|FAM167A_ENST00000531564.1_5'Flank|FAM167A_ENST00000284486.4_Missense_Mutation_p.D24N			Q96KS9	F167A_HUMAN	family with sequence similarity 167, member A	24										breast(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)	9						AGGTGGTCATCGGGTGGTGCG	0.647																																						ENST00000528897.1			0	0																														0				9						c.(70-72)Gat>Aat		family with sequence similarity 167, member A		C	ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	73.0	84.0	80.0		70	4.5	0.2	8	dbSNP_134	80	1,8599	1.2+/-3.3	0,1,4299	yes	missense	FAM167A	NM_053279.2	23	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging	24/215	11301851	2,13004	2203	4300	6503	SO:0001583	missense	83648	11	121404	45				g.chr8:11301851C>T		CCDS5981.1	8p23-p22	2010-08-27	2008-06-11	2008-06-11	ENSG00000154319	ENSG00000154319			15549	protein-coding gene	gene with protein product		610085	"""chromosome 8 open reading frame 13"""	C8orf13			Standard	NM_053279		Approved		uc003wtw.2	Q96KS9	OTTHUMG00000129361	ENST00000528897.1:c.70G>A	chr8.hg19:g.11301851C>T	ENSP00000436655:p.Asp24Asn						FAM167A_ENST00000534308.1_Missense_Mutation_p.D24N|FAM167A_ENST00000284486.4_Missense_Mutation_p.D24N|FAM167A_ENST00000531564.1_5'Flank	p.D24N							Q96KS9	F167A_HUMAN		2	689	-			A8K3T9|Q3SXY1|Q3SXY3|Q8N3M3|Q9NSR0	Missense_Mutation	SNP	ENST00000528897.1	1	1	hg19	c.70G>A	CCDS5981.1		.	.	.	.	.	.	.	.	.	.	C	25.6	4.656138	0.88056	2.27E-4	1.16E-4	ENSG00000154319	ENST00000284486;ENST00000534308;ENST00000528897;ENST00000531804	T;T;T;T	0.08634	3.07;3.07;3.07;3.07	5.34	4.47	0.54385	5.340000	4.470000	0.543850	.	0.000000	0.85682	D	0.000000	T	0.11495	0.0280	M	0.64997	1.995	0.58432	D	0.999995	D	0.62365	0.991	B	0.41174	0.349	T	0.03717	-1.1010	10	0.72032	D	0.01	-31.7921	13.2042	0.59787	0.0:0.9239:0.0:0.0761	.	24	Q96KS9	F167A_HUMAN	N	24	ENSP00000284486:D24N;ENSP00000432232:D24N;ENSP00000436655:D24N;ENSP00000431951:D24N	ENSP00000284486:D24N	D	-	1	0	0	FAM167A	11339261	11339261	1.000000	0.71417	0.187000	0.23214	0.104000	0.19210	5.466000	0.66731	1.499000	0.48617	-0.136000	0.14681	GAT			TCGA-2J-AABV-01A-12D-A40W-08	0.647	FAM167A-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000383901.1	1	0	1		2	2	2	0		0	0	163		163	157	1	2.010000	-3.654621	1	0.110000				193	185		768	752	1		1			0	0	163	0		1.000000	0	0	0	0	0	0	193	768
RGS22	26166	broad.mit.edu	37	8	101083654	101083654	+	Silent	SNP	A	A	G			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chr8:101083654A>G	ENST00000360863.6	-	6	731	c.537T>C	c.(535-537)ccT>ccC	p.P179P	RGS22_ENST00000523287.1_Intron|RGS22_ENST00000523437.1_Silent_p.P179P	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	179					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			CTTCAGTGGCAGGAGGTGGTA	0.398																																						ENST00000360863.6	1.000000	0.170000	1	2.700000e-01	0.410000	0.523814	0.410000	0.340000																									RGS22/SYCP1(2)	0				68						c.(535-537)ccT>ccC		regulator of G-protein signaling 22							164.0	140.0	148.0					8																	101083654		1845	4093	5938	SO:0001819	synonymous_variant	26166	0	0					g.chr8:101083654A>G	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.537T>C	chr8.hg19:g.101083654A>G		0					RGS22_ENST00000523287.1_Intron|RGS22_ENST00000523437.1_Silent_p.P179P	p.P179P	NM_015668.3	NP_056483.3	1	2	3	2.058916	Q8NE09	RGS22_HUMAN	Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)	6	731	-			A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Silent	SNP	ENST00000360863.6	0	1	hg19	c.537T>C	CCDS43758.1	0																																																																																								0.128220		TCGA-2J-AABV-01A-12D-A40W-08	0.398	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	0	0	1		2	2	2	0		0	0	111		111	110	1	2.010000	-3.065320	1	0.110000	NM_015668			8	8		419	410	0		1			0	0	111	0		0.988561	0	0	0	0	0	0	8	419
TBX22	50945	broad.mit.edu	37	X	79282761	79282761	+	Missense_Mutation	SNP	A	A	G			TCGA-2J-AABV-01A-12D-A40W-08	TCGA-2J-AABV-10A-01D-A40W-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	25d7033a-dee7-4246-bad5-bf3b9a9f5ebf	0083afb4-809b-4702-928e-69541aa23d2f	g.chrX:79282761A>G	ENST00000373294.5	+	6	833	c.805A>G	c.(805-807)Aaa>Gaa	p.K269E	TBX22_ENST00000442340.1_Missense_Mutation_p.K149E|TBX22_ENST00000373296.3_Missense_Mutation_p.K269E|TBX22_ENST00000373291.1_Missense_Mutation_p.K149E	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	269					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						ATAGATTACGAAACTAAAAAT	0.348																																						ENST00000373294.5	0.890000	0.240000	7.300000e-01	3.700000e-01	0.530000	0.553838	0.530000	0.510000																										0				65						c.(805-807)Aaa>Gaa		T-box 22							37.0	36.0	36.0					X																	79282761		2203	4298	6501	SO:0001583	missense	50945	0	0					g.chrX:79282761A>G	AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.805A>G	chrX.hg19:g.79282761A>G	ENSP00000362390:p.Lys269Glu						TBX22_ENST00000373296.3_Missense_Mutation_p.K269E|TBX22_ENST00000442340.1_Missense_Mutation_p.K149E|TBX22_ENST00000373291.1_Missense_Mutation_p.K149E	p.K269E	NM_016954.2	NP_058650.1	0	1	1		Q9Y458	TBX22_HUMAN		6	833	+			Q5JZ06|Q96LC0|Q9HBF1	Missense_Mutation	SNP	ENST00000373294.5	1	1	hg19	c.805A>G	CCDS14445.1	0	.	.	.	.	.	.	.	.	.	.	A	17.84	3.487256	0.63962	.	.	ENSG00000122145	ENST00000373296;ENST00000442340;ENST00000373294;ENST00000373291	D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58	3.75	3.75	0.43078	3.750000	3.750000	0.430780	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.91978	0.7459	L	0.58810	1.83	0.58432	D	0.999995	D	0.76494	0.999	D	0.72338	0.977	D	0.92101	0.5688	10	0.72032	D	0.01	.	10.8307	0.46659	1.0:0.0:0.0:0.0	.	269	Q9Y458	TBX22_HUMAN	E	269;149;269;149	ENSP00000362393:K269E;ENSP00000396394:K149E;ENSP00000362390:K269E;ENSP00000362388:K149E	ENSP00000362388:K149E	K	+	1	0	0	TBX22	79169417	79169417	1.000000	0.71417	0.998000	0.56505	0.691000	0.40173	6.266000	0.72540	1.495000	0.48549	0.486000	0.48141	AAA	0.110000		TCGA-2J-AABV-01A-12D-A40W-08	0.348	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057334.1	1	0	1		2	2	2	0		0	0	47		47	46	1	2.010000	-4.579968	1	0.110000	NM_016954			7	6		111	109	0		1			0	0	47	0		0.979870	0	0	0	0	0	0	7	111
