#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
PLSCR2	57047	broad.mit.edu	37	3	146177707	146177707	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr3:146177707delA	ENST00000497985.1	-	4	643	c.204delT	c.(202-204)cctfs	p.P68fs	PLSCR2_ENST00000336685.2_5'UTR	NM_001199978.1	NP_001186907.1	Q9NRY7	PLS2_HUMAN	phospholipid scramblase 2	68	Proline-rich domain (PRD). {ECO:0000250}.				phospholipid scrambling (GO:0017121)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid scramblase activity (GO:0017128)			endometrium(2)|large_intestine(5)|lung(7)|stomach(1)	15						GTACCCCTTCAGGTCTACCTG	0.507																																						ENST00000497985.1	1.000000	5.000000e-01	0.720000	5.600000e-01	0.630000	0.654406	0.630000	0.630000																										0				15						c.(202-204)cctfs		phospholipid scramblase 2							130.0	118.0	122.0					3																	146177707		2203	4300	6503	SO:0001589	frameshift_variant	57047	0	0					g.chr3:146177707delA		CCDS56284.1, CCDS3134.1, CCDS75029.1	3q24	2008-07-18			ENSG00000163746	ENSG00000163746			16494	protein-coding gene	gene with protein product		607610				10930526	Standard	NM_001199978		Approved		uc003evw.2	Q9NRY7	OTTHUMG00000159429	ENST00000497985.1:c.204delT	chr3.hg19:g.146177707delA	ENSP00000420132:p.Pro68fs	0					PLSCR2_ENST00000336685.2_5'UTR	p.P68fs	NM_001199978.1	NP_001186907.1	1	2	3	2.162847	Q9NRY7	PLS2_HUMAN		4	643	-			B4DXC3|J3KR76|Q0VAQ1|Q6NSW9|Q7Z4L7	Frame_Shift_Del	DEL	ENST00000497985.1	1	1	hg19	c.204delT	CCDS56284.1	0																																																																																								0.536146		TCGA-2L-AAQE-01A-11D-A397-08	0.507	PLSCR2-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000355264.1	1	0	1		2	2		0	0	0	0	63	0	63	62	1	1.810000	-2.989177	1	0.530000	NM_020359		0	64	65	0	321	318	0	0	1	0	0	0	0	63	0	0	1	7.586917e-02	0	0	0	3	0	64	321
EIF3A	8661	broad.mit.edu	37	10	120830492	120830492	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr10:120830492G>A	ENST00000369144.3	-	5	774	c.647C>T	c.(646-648)aCg>aTg	p.T216M	EIF3A_ENST00000541549.1_Missense_Mutation_p.T182M	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		ATTGATTGCCGTACTTTGGTT	0.443																																						ENST00000369144.3	1.000000	2.000000e-02	0.140000	4.000000e-02	0.070000	0.158934	0.070000	0.070000																										0				56						c.(646-648)aCg>aTg		eukaryotic translation initiation factor 3, subunit A							157.0	145.0	149.0					10																	120830492		2203	4300	6503	SO:0001583	missense	8661	1	121412	31				g.chr10:120830492G>A	U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.647C>T	chr10.hg19:g.120830492G>A	ENSP00000358140:p.Thr216Met	0					EIF3A_ENST00000541549.1_Missense_Mutation_p.T182M	p.T216M	NM_003750.2	NP_003741.1	2	2	4	2.213109	P56537	IF6_HUMAN		5	774	-		Lung NSC(174;0.094)|all_lung(145;0.123)	B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	ENST00000369144.3	0	1	hg19	c.647C>T	CCDS7608.1	0	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422747	0.62733	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.44083	0.93;0.93	5.69	5.69	0.88448	5.69	5.69	0.88448	.	0.000000	0.40469	N	0.001098	T	0.63815	0.2543	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.58025	-0.7709	10	0.34782	T	0.22	-22.9502	19.813	0.96554	0.0:0.0:1.0:0.0	.	216	Q14152	EIF3A_HUMAN	M	216;182	ENSP00000358140:T216M;ENSP00000438178:T182M	ENSP00000358140:T216M	T	-	2	0	0	EIF3A	120820482	120820482	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	9.827000	0.99397	2.683000	0.91414	0.591000	0.81541	ACG	0.553656		TCGA-2L-AAQE-01A-11D-A397-08	0.443	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050634.1	0	0	1	2	2	2	2	0	0	0	0	57	0	57	56	1	1.810000	-2.742045	1	0.530000	NM_003750		0	5	5	0	273	272	0		1	0		0	0	57	0	0	9.375043e-01	7.283483e-01	0	0	0	136	0	5	273
INPP5F	22876	broad.mit.edu	37	10	121541192	121541192	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr10:121541192G>A	ENST00000361976.2	+	3	390	c.224G>A	c.(223-225)gGc>gAc	p.G75D	INPP5F_ENST00000369081.1_5'UTR|INPP5F_ENST00000369083.3_Missense_Mutation_p.G75D	NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	0	PH.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		GCATTGGTGGGCAAACTCCCA	0.438																																						ENST00000361976.2	1.000000	2.000000e-02	0.170000	5.000000e-02	0.090000	0.177086	0.090000	0.090000																										0				42						c.(223-225)gGc>gAc		inositol polyphosphate-5-phosphatase F							79.0	74.0	75.0					10																	121541192		2203	4300	6503	SO:0001583	missense	22876	0	0					g.chr10:121541192G>A	AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.224G>A	chr10.hg19:g.121541192G>A	ENSP00000354519:p.Gly75Asp	0					INPP5F_ENST00000369081.1_5'UTR|INPP5F_ENST00000369083.3_Missense_Mutation_p.G75D	p.G75D	NM_014937.3	NP_055752.1	2	2	4	2.213109	Q01968	OCRL_HUMAN		3	390	+		Lung NSC(174;0.109)|all_lung(145;0.142)	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000361976.2	0	1	hg19	c.224G>A	CCDS7616.1	0	.	.	.	.	.	.	.	.	.	.	G	25.6	4.655701	0.88056	.	.	ENSG00000198825	ENST00000361976;ENST00000369083	T;T	0.59502	0.26;0.26	5.96	5.04	0.67666	5.96	5.04	0.67666	Synaptojanin, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81009	0.4734	M	0.91768	3.24	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.73380	0.98;0.962	D	0.86073	0.1539	10	0.87932	D	0	-18.5695	16.4613	0.84055	0.0:0.0:0.8678:0.1322	.	75;75	Q9Y2H2;Q9Y2H2-3	SAC2_HUMAN;.	D	75	ENSP00000354519:G75D;ENSP00000358079:G75D	ENSP00000354519:G75D	G	+	2	0	0	INPP5F	121531182	121531182	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.091000	0.94151	1.474000	0.48178	0.655000	0.94253	GGC	0.553656		TCGA-2L-AAQE-01A-11D-A397-08	0.438	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050679.1	0	0	1	2	2	2	2	0	0	0	0	44	0	44	44	1	1.810000	-2.919370	1	0.530000	NM_014937		0	4	4	0	183	181	0		1	0		0	0	44	0	0	8.887247e-01	9.595635e-02	0	0	0	19	0	4	183
RET	5979	broad.mit.edu	37	10	43622039	43622039	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr10:43622039C>T	ENST00000355710.3	+	19	3288	c.3056C>T	c.(3055-3057)gCg>gTg	p.A1019V	RET_ENST00000340058.5_Missense_Mutation_p.A1019V	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	1019					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	TTGGACCTTGCGGCGTCCACT	0.557		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	ENST00000355710.3	1.000000	0	0.050000	1.000000e-02	0.020000	0.075259	0.020000	0.020000		1	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	10q11.2	5979	T, Mis, N, F	ret proto-oncogene	yes	yes	Hirschsprung disease	"""E, O"""	E, O	H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6	medullary thyroid,  papillary thyroid, pheochromocytoma	medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC	CCDC6/RET(4)|KIF5B/RET(79)	0				607						c.(3055-3057)gCg>gTg		ret proto-oncogene	Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)						252.0	239.0	243.0					10																	43622039		2203	4300	6503	SO:0001583	missense	5979	0	0		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	g.chr10:43622039C>T	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.3056C>T	chr10.hg19:g.43622039C>T	ENSP00000347942:p.Ala1019Val	0					RET_ENST00000340058.5_Missense_Mutation_p.A1019V	p.A1019V	NM_020975.4	NP_066124.1	1	2	3	2.165270	P07949	RET_HUMAN		19	3288	+		Ovarian(717;0.0423)	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	ENST00000355710.3	0	1	hg19	c.3056C>T	CCDS7200.1	0	.	.	.	.	.	.	.	.	.	.	C	20.6	4.010130	0.75046	.	.	ENSG00000165731	ENST00000355710;ENST00000340058	T;T	0.80304	-1.24;-1.36	5.09	5.09	0.68999	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	D	0.83922	0.5359	N	0.24115	0.695	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.998;0.999	D	0.85682	0.1301	10	0.52906	T	0.07	.	18.5126	0.90923	0.0:1.0:0.0:0.0	.	765;1019;1019	B4DGX8;P07949;P07949-2	.;RET_HUMAN;.	V	1019	ENSP00000347942:A1019V;ENSP00000344798:A1019V	ENSP00000344798:A1019V	A	+	2	0	0	RET	42942045	42942045	1.000000	0.71417	0.735000	0.30896	0.550000	0.35303	7.786000	0.85741	2.374000	0.81015	0.655000	0.94253	GCG	0.537356		TCGA-2L-AAQE-01A-11D-A397-08	0.557	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2	0	0	1	2	16	2	2	1	0	1	1	253	0	253	253	1	1.810000	-1.889802	0	0.530000	NM_020975		0	8	8	0	1098	1090	0		0	0		1	0	253	0	0	7.157282e-02	0	0	0	0	1	0	8	1098
C10orf71	118461	broad.mit.edu	37	10	50532475	50532475	+	Missense_Mutation	SNP	G	G	A	rs377136815		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr10:50532475G>A	ENST00000374144.3	+	3	2173	c.1885G>A	c.(1885-1887)Gga>Aga	p.G629R	C10orf71_ENST00000323868.4_Missense_Mutation_p.G629R			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	629								p.G629*(1)		endometrium(1)	1						GGGTCCTGCCGGATCCAGCTG	0.567																																						ENST00000374144.3	1.000000	6.600000e-01	1.000000	8.200000e-01	0.990000	0.934301	0.990000	1.000000																										1	Substitution - Nonsense(1)	p.G629*(1)	prostate(1)	1						c.(1885-1887)Gga>Aga		chromosome 10 open reading frame 71		G	ARG/GLY,ARG/GLY	0,3902		0,0,1951	26.0	28.0	27.0		1885,1885	-0.9	0.0	10		27	1,8333		0,1,4166	no	missense,missense	C10orf71	NM_001135196.1,NM_199459.3	125,125	0,1,6117	AA,AG,GG		0.012,0.0,0.0082	benign,benign	629/1436,629/720	50532475	1,12235	1951	4167	6118	SO:0001583	missense	118461	5	120874	35				g.chr10:50532475G>A	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.1885G>A	chr10.hg19:g.50532475G>A	ENSP00000363259:p.Gly629Arg	0					C10orf71_ENST00000323868.4_Missense_Mutation_p.G629R	p.G629R			2	2	4	2.213109	Q711Q0	CJ071_HUMAN		3	2173	+			A0AVL8	Missense_Mutation	SNP	ENST00000374144.3	1	1	hg19	c.1885G>A	CCDS44387.1	1	.	.	.	.	.	.	.	.	.	.	G	0.328	-0.958059	0.02267	0.0	1.2E-4	ENSG00000177354	ENST00000323868;ENST00000374144	T;T	0.13196	2.61;3.69	5.74	-0.929	0.10444	5.74	-0.929	0.10444	.	1.066660	0.07463	N	0.901009	T	0.03434	0.0099	N	0.00538	-1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42865	-0.9426	10	0.23891	T	0.37	.	6.3022	0.21119	0.5432:0.0:0.34:0.1168	.	629	Q711Q0-3	.	R	629	ENSP00000318713:G629R;ENSP00000363259:G629R	ENSP00000318713:G629R	G	+	1	0	0	C10orf71	50202481	50202481	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.233000	0.09041	-0.118000	0.11851	-1.239000	0.01543	GGA	0.553656		TCGA-2L-AAQE-01A-11D-A397-08	0.567	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	1	0	1	2	2	2	2	0	0	0	0	16	0	16	16	1	1.810000	-20.000000	1	0.530000	NM_199459		0	20	20	0	60	60	1		1			0	0	16	0	0	9.999984e-01	0	0	0	0	0	0	20	60
GPR123	84435	broad.mit.edu	37	10	134896361	134896361	+	Splice_Site	SNP	C	C	T	rs377602892		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr10:134896361C>T	ENST00000607359.1	+	7	1373	c.1373C>T	c.(1372-1374)gCg>gTg	p.A458V	RP13-439H18.4_ENST00000444433.1_RNA			Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	0					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		AGGCCCTGTGCGGTGAGGCCT	0.662																																						ENST00000607359.1	1.000000	3.300000e-01	1.000000	4.900000e-01	0.710000	0.718482	0.710000	1.000000																										0				14						c.(1372-1374)gCg>gTg		G protein-coupled receptor 123		C		1,3117		0,1,1558	14.0	19.0	18.0			-3.3	0.0	10		18	0,7148		0,0,3574	no	intergenic				0,1,5132	TT,TC,CC		0.0,0.0321,0.0097			134896361	1,10265	1559	3574	5133	SO:0001630	splice_region_variant	84435	5	117816	30				g.chr10:134896361C>T	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000607359.1:c.1374+1C>T	chr10.hg19:g.134896361C>T		0					RP13-439H18.4_ENST00000444433.1_RNA	p.A458V			1	2	3	2.179679	Q86SQ6	GP123_HUMAN		7	1373	+		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Splice_Site	SNP	ENST00000607359.1	0	1	hg19	c.1373C>T		0	.	.	.	.	.	.	.	.	.	.	C	2.107	-0.404715	0.04832	3.21E-4	0.0	ENSG00000197177	ENST00000368577;ENST00000392609	.	.	.	1.64	-3.28	0.05033	1.64	-3.28	0.05033	.	11.146600	0.01144	U	0.006263	T	0.08626	0.0214	.	.	.	0.21020	N	0.999803	P	0.50272	0.933	B	0.22880	0.042	T	0.31392	-0.9945	7	0.87932	D	0	.	1.3877	0.02243	0.1983:0.2487:0.394:0.159	.	458	Q86SQ6-1	.	V	458	.	ENSP00000357566:A458V	A	+	2	0	0	GPR123	134746351	134746351	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.344000	0.02639	-1.142000	0.02869	0.306000	0.20318	GCG	0.538560		TCGA-2L-AAQE-01A-11D-A397-08	0.662	GPR123-004	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316904.2	0	0	1	2	2	2	2	0	0	0	0	8	0	8	8	1	1.810000	-15.315740	1	0.530000		Missense_Mutation	0	7	7	0	33	33	0		1			0	0	8	0	0	9.840074e-01	0	0	0	0	0	0	7	33
ANO3	63982	broad.mit.edu	37	11	26556047	26556047	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr11:26556047G>A	ENST00000256737.3	+	9	1766	c.914G>A	c.(913-915)cGa>cAa	p.R305Q	ANO3_ENST00000525139.1_Missense_Mutation_p.R289Q|ANO3_ENST00000537978.1_Missense_Mutation_p.R289Q|ANO3_ENST00000531568.1_Missense_Mutation_p.R159Q	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	305					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)	p.R305Q(1)		breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						AATGCTACTCGAAGCAGAATA	0.348																																						ENST00000256737.3	1.000000	8.400000e-01	1.000000	9.200000e-01	0.990000	0.972668	0.990000	1.000000																										1	Substitution - Missense(1)	p.R305Q(1)	skin(1)	68						c.(913-915)cGa>cAa		anoctamin 3							98.0	97.0	97.0					11																	26556047		2203	4300	6503	SO:0001583	missense	63982	1	121406	36				g.chr11:26556047G>A	AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.914G>A	chr11.hg19:g.26556047G>A	ENSP00000256737:p.Arg305Gln	0					ANO3_ENST00000531568.1_Missense_Mutation_p.R159Q|ANO3_ENST00000537978.1_Missense_Mutation_p.R289Q|ANO3_ENST00000525139.1_Missense_Mutation_p.R289Q	p.R305Q	NM_031418.2	NP_113606.2	1	2	3	2.185977	Q9BYT9	ANO3_HUMAN		9	1766	+			B7Z3F5	Missense_Mutation	SNP	ENST00000256737.3	1	1	hg19	c.914G>A	CCDS31447.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.138511	0.94560	.	.	ENSG00000134343	ENST00000537978;ENST00000525139;ENST00000256737;ENST00000538001;ENST00000531568	T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43	5.03	5.03	0.67393	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.87120	0.6098	H	0.94183	3.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.90997	0.4839	10	0.87932	D	0	.	17.9596	0.89081	0.0:0.0:1.0:0.0	.	207;305	B7Z7Y6;Q9BYT9	.;ANO3_HUMAN	Q	289;289;305;207;159	ENSP00000440737:R289Q;ENSP00000432576:R289Q;ENSP00000256737:R305Q;ENSP00000432394:R159Q	ENSP00000256737:R305Q	R	+	2	0	0	ANO3	26512623	26512623	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.516000	0.98017	2.349000	0.79799	0.460000	0.39030	CGA	0.539757		TCGA-2L-AAQE-01A-11D-A397-08	0.348	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387806.1	1	0	1	2	15	2	2	1	0	1	1	97	0	97	97	1	1.810000	-6.159810	1	0.530000	NM_031418		0	102	101	0	288	288	1		1			1	0	97	0	0	1	0	0	0	0	0	0	102	288
ELP4	26610	broad.mit.edu	37	11	31541617	31541617	+	Missense_Mutation	SNP	G	G	A	rs202180164	byFrequency	TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr11:31541617G>A	ENST00000350638.5	+	2	273	c.238G>A	c.(238-240)Gtt>Att	p.V80I	ELP4_ENST00000395934.2_Missense_Mutation_p.V80I|ELP4_ENST00000379163.5_Missense_Mutation_p.V80I	NM_019040.3	NP_061913.3	Q96EB1	ELP4_HUMAN	elongator acetyltransferase complex subunit 4	80					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)	20	Lung SC(675;0.225)					AGGTTTAGCCGTTGGAACAGT	0.348													G|||	2	0.000399361	0.0	0.0	5008	,	,		16955	0.0		0.002	False		,,,				2504	0.0					ENST00000350638.5	1.000000	8.000000e-01	1.000000	8.900000e-01	0.990000	0.958488	0.990000	1.000000																										0				20						c.(238-240)Gtt>Att		elongator acetyltransferase complex subunit 4		G	ILE/VAL	0,3674		0,0,1837	249.0	235.0	239.0		238	4.2	0.9	11		239	1,8169		0,1,4084	yes	missense	ELP4	NM_019040.3	29	0,1,5921	AA,AG,GG		0.0122,0.0,0.0084	possibly-damaging	80/425	31541617	1,11843	1837	4085	5922	SO:0001583	missense	26610	22	120798	43				g.chr11:31541617G>A	AJ276005	CCDS7875.2, CCDS73271.1, CCDS73272.1	11p13	2012-08-14	2012-08-08	2002-05-24	ENSG00000109911	ENSG00000109911		"""Elongator acetyltransferase complex subunits"""	1171	protein-coding gene	gene with protein product		606985	"""chromosome 11 open reading frame 19"", ""elongation protein 4 homolog (S. cerevisiae)"""	C11orf19		11889558, 11435442	Standard	XM_005252865		Approved	PAXNEB	uc001mtb.3	Q96EB1	OTTHUMG00000142919	ENST00000350638.5:c.238G>A	chr11.hg19:g.31541617G>A	ENSP00000298937:p.Val80Ile	0					ELP4_ENST00000395934.2_Missense_Mutation_p.V80I|ELP4_ENST00000379163.5_Missense_Mutation_p.V80I	p.V80I	NM_019040.3	NP_061913.3	1	2	3	2.185977	Q96EB1	ELP4_HUMAN		2	273	+	Lung SC(675;0.225)		B4E3W0|E7EPZ6|Q9H4E8|Q9NX11	Missense_Mutation	SNP	ENST00000350638.5	1	1	hg19	c.238G>A	CCDS7875.2	1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	10.03	1.239257	0.22711	0.0	1.22E-4	ENSG00000109911	ENST00000350638;ENST00000379163;ENST00000395934	T;T;T	0.40756	1.02;1.02;1.02	5.15	4.23	0.50019	5.15	4.23	0.50019	.	0.125811	0.53938	N	0.000059	T	0.52837	0.1759	L	0.41710	1.295	0.33585	D	0.600371	D;D;D	0.89917	0.994;1.0;1.0	P;D;D	0.87578	0.869;0.995;0.998	T	0.57957	-0.7721	10	0.15066	T	0.55	-12.2988	15.406	0.74877	0.0731:0.0:0.9269:0.0	.	80;80;80	B4E3W0;G5E9D4;Q96EB1	.;.;ELP4_HUMAN	I	80	ENSP00000298937:V80I;ENSP00000368461:V80I;ENSP00000379267:V80I	ENSP00000298937:V80I	V	+	1	0	0	ELP4	31498193	31498193	1.000000	0.71417	0.922000	0.36590	0.892000	0.51952	4.374000	0.59543	0.692000	0.31613	-1.151000	0.01829	GTT	0.539757		TCGA-2L-AAQE-01A-11D-A397-08	0.348	ELP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286640.1	1	0	1	2	2	2	2	0	0	0	0	70	0	70	70	1	1.810000	-5.289739	1	0.530000	NM_019040		0	76	76	0	221	220	1		1	1		0	0	70	0	0	1	9.042740e-01	0	5	0	9	0	76	221
OR5M11	219487	broad.mit.edu	37	11	56310189	56310189	+	Missense_Mutation	SNP	G	G	A	rs200285217		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr11:56310189G>A	ENST00000528616.2	-	1	568	c.545C>T	c.(544-546)cCg>cTg	p.P182L		NM_001005245.1	NP_001005245.1	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M, member 11	182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)	18						CTTAATGAGCGGCGGGTCAGC	0.502																																						ENST00000528616.2	1.000000	7.200000e-01	1.000000	8.300000e-01	0.960000	0.931059	0.960000	1.000000																										0				18						c.(544-546)cCg>cTg		olfactory receptor, family 5, subfamily M, member 11		A	LEU/PRO	0,4126		0,0,2063	46.0	48.0	48.0		545	2.0	0.5	11		48	4,8436		0,4,4216	yes	missense	OR5M11	NM_001005245.1	98	0,4,6279	AA,AG,GG		0.0474,0.0,0.0318	probably-damaging	182/306	56310189	4,12562	2063	4220	6283	SO:0001583	missense	219487	32	121030	48				g.chr11:56310189G>A	AP002517	CCDS53629.1	11q11	2012-08-09				ENSG00000255223		"""GPCR / Class A : Olfactory receptors"""	15291	protein-coding gene	gene with protein product							Standard	NM_001005245		Approved	OR11-199	uc010rjl.2	Q96RB7		ENST00000528616.2:c.545C>T	chr11.hg19:g.56310189G>A	ENSP00000432417:p.Pro182Leu	0						p.P182L	NM_001005245.1	NP_001005245.1	1	2	3	2.185977	Q96RB7	OR5MB_HUMAN		1	568	-			B2RNL5|B2RNL7	Missense_Mutation	SNP	ENST00000528616.2	1	1	hg19	c.545C>T	CCDS53629.1	1	.	.	.	.	.	.	.	.	.	.	A	11.09	1.535136	0.27475	0.0	4.74E-4	ENSG00000255223	ENST00000528616	T	0.00224	8.51	4.89	1.97	0.26223	4.89	1.97	0.26223	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00496	0.0016	M	0.80422	2.495	0.21445	N	0.99969	D	0.89917	1.0	D	0.74348	0.983	T	0.47032	-0.9148	9	0.72032	D	0.01	.	7.6395	0.28286	0.1337:0.0:0.6314:0.2349	.	182	Q96RB7	OR5MB_HUMAN	L	182	ENSP00000432417:P182L	ENSP00000432417:P182L	P	-	2	0	0	OR5M11	56066765	56066765	0.003000	0.15002	0.493000	0.27502	0.234000	0.25298	1.152000	0.31663	0.040000	0.15660	-1.789000	0.00628	CCG	0.539757		TCGA-2L-AAQE-01A-11D-A397-08	0.502	OR5M11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391608.1	1	0	1	2	2	2	2	0	0	0	0	30	0	30	28	1	1.810000	-2.895511	1	0.530000	NM_001005245		0	43	42	0	131	121	1		1			0	0	30	0	0	1	0	0	0	0	0	0	43	131
GLYATL1	92292	broad.mit.edu	37	11	58723412	58723412	+	Missense_Mutation	SNP	G	G	A	rs199557152		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr11:58723412G>A	ENST00000317391.4	+	8	1161	c.821G>A	c.(820-822)cGc>cAc	p.R274H	RP11-142C4.6_ENST00000533954.1_RNA|RP11-142C4.6_ENST00000525714.1_RNA|GLYATL1_ENST00000300079.5_Missense_Mutation_p.R305H	NM_001220494.1	NP_001207423.1	Q969I3	GLYL1_HUMAN	glycine-N-acyltransferase-like 1	274						mitochondrion (GO:0005739)	glutamine N-acyltransferase activity (GO:0047946)|glycine N-acyltransferase activity (GO:0047961)	p.R305H(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|skin(4)|urinary_tract(1)	34					Glycine(DB00145)	GAAGACTCCCGCAGATTTGTG	0.448													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19770	0.0		0.0	False		,,,				2504	0.0					ENST00000317391.4	1.000000	8.800000e-01	1.000000	9.700000e-01	0.990000	0.987679	0.990000	1.000000																										1	Substitution - Missense(1)	p.R305H(1)	skin(1)	34						c.(820-822)cGc>cAc		glycine-N-acyltransferase-like 1	Glycine(DB00145)						65.0	65.0	65.0					11																	58723412		2201	4295	6496	SO:0001583	missense	92292	4	121412	41				g.chr11:58723412G>A	AK091965	CCDS31556.1, CCDS55768.1	11q12.1	2014-08-12			ENSG00000166840	ENSG00000166840			30519	protein-coding gene	gene with protein product		614761				12477932	Standard	NM_080661		Approved	MGC15397, FLJ34646	uc001nnh.2	Q969I3	OTTHUMG00000167221	ENST00000317391.4:c.821G>A	chr11.hg19:g.58723412G>A	ENSP00000322223:p.Arg274His	0					RP11-142C4.6_ENST00000525714.1_RNA|GLYATL1_ENST00000300079.5_Missense_Mutation_p.R305H|RP11-142C4.6_ENST00000533954.1_RNA	p.R274H	NM_001220494.1	NP_001207423.1	1	2	3	2.185977	Q969I3	GLYL1_HUMAN		8	1161	+			A6NDT0|Q7Z510|Q8NAW8	Missense_Mutation	SNP	ENST00000317391.4	1	1	hg19	c.821G>A	CCDS55768.1	1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	.	0.271	-0.993172	0.02145	.	.	ENSG00000166840	ENST00000444580;ENST00000317391;ENST00000300079	T;T	0.18657	2.2;2.2	1.97	-2.28	0.06826	1.97	-2.28	0.06826	Acyl-CoA N-acyltransferase (2);Glycine N-acyltransferase, C-terminal (1);	0.732987	0.11663	N	0.541605	T	0.06280	0.0162	N	0.04508	-0.205	0.09310	N	1	B;B	0.17465	0.022;0.01	B;B	0.12156	0.004;0.007	T	0.36529	-0.9744	10	0.13853	T	0.58	.	1.8117	0.03092	0.4455:0.0:0.2831:0.2714	.	305;274	Q969I3-2;Q969I3	.;GLYL1_HUMAN	H	251;274;305	ENSP00000322223:R274H;ENSP00000300079:R305H	ENSP00000300079:R305H	R	+	2	0	0	GLYATL1	58479988	58479988	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.478000	0.02329	-0.626000	0.05596	0.411000	0.27672	CGC	0.539757		TCGA-2L-AAQE-01A-11D-A397-08	0.448	GLYATL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393783.1	1	0	1	2	2	2	2	0	0	0	0	64	0	64	63	1	1.810000	-6.211773	1	0.530000	NM_080661		0	89	88	0	233	229	1		1	0		0	0	64	0	0	1	0	0	0	0	1	0	89	233
AHNAK	79026	broad.mit.edu	37	11	62287090	62287090	+	Silent	SNP	T	T	C			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr11:62287090T>C	ENST00000378024.4	-	5	15073	c.14799A>G	c.(14797-14799)tcA>tcG	p.S4933S	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000525875.1_5'Flank	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4933					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				ACTTCGGACCTGAAAATCCAA	0.458																																						ENST00000378024.4	1.000000	0	0.070000	1.000000e-02	0.030000	0.104887	0.030000	0.040000																										0				268						c.(14797-14799)tcA>tcG		AHNAK nucleoprotein							93.0	87.0	89.0					11																	62287090		2202	4299	6501	SO:0001819	synonymous_variant	79026	0	0					g.chr11:62287090T>C	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.14799A>G	chr11.hg19:g.62287090T>C		0					AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000525875.1_5'Flank|AHNAK_ENST00000257247.7_Intron	p.S4933S	NM_001620.1	NP_001611.1	1	2	3	2.185977	Q09666	AHNK_HUMAN		5	15073	-		Melanoma(852;0.155)	A1A586	Silent	SNP	ENST00000378024.4	0	1	hg19	c.14799A>G	CCDS31584.1	0																																																																																								0.539757		TCGA-2L-AAQE-01A-11D-A397-08	0.458	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	0	0	1	2	2	2	2	0	0	0	0	139	0	139	139	1	1.810000	-2.385043	0	0.530000	NM_024060		0	5	5	0	521	519	0		1	0		0	0	139	0	0	9.371875e-01	9.812960e-01	0	1	0	788	0	5	521
KIAA1377	57562	broad.mit.edu	37	11	101834466	101834466	+	Silent	SNP	G	G	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr11:101834466G>A	ENST00000263468.8	+	6	2970	c.2700G>A	c.(2698-2700)cgG>cgA	p.R900R	KIAA1377_ENST00000537689.1_Silent_p.R701R	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	900										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		CAGTTGCCCGGCAAGATGCGA	0.413																																						ENST00000263468.8	1.000000	0	0.070000	2.000000e-02	0.030000	0.106294	0.030000	0.040000																										0				53						c.(2698-2700)cgG>cgA		KIAA1377							84.0	85.0	85.0					11																	101834466		2203	4299	6502	SO:0001819	synonymous_variant	57562	0	0					g.chr11:101834466G>A	AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.2700G>A	chr11.hg19:g.101834466G>A		0					KIAA1377_ENST00000537689.1_Silent_p.R701R	p.R900R	NM_020802.2	NP_065853.2	1	2	3	2.185977	Q9P2H0	K1377_HUMAN		6	2970	+	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)	Q4G0U6	Silent	SNP	ENST00000263468.8	0	1	hg19	c.2700G>A	CCDS31658.1	0																																																																																								0.539757		TCGA-2L-AAQE-01A-11D-A397-08	0.413	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	0	0	1	2	2	2	2	0	0	0	0	144	0	144	144	1	1.810000	-2.300723	0	0.530000	NM_020802		0	5	5	0	504	499	0		1	0		0	0	144	0	0	9.361954e-01	1.865306e-02	0	0	0	17	0	5	504
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	9.000000e-01	1.000000	9.900000e-01	0.990000	0.993266	0.990000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gAt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	2	121404	44	Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>T	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	1	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	p.G12D	NM_033360.2	NP_203524.1	0	2	2	2.090760	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>A	CCDS8703.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.530000		TCGA-2L-AAQE-01A-11D-A397-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	23	2	2	2	0	13	0	0	79	8012	79	79	1	1.810000	-20.000000	1	0.530000	NM_033360		2983	72	72	5037	173	172	1	1	1	1	1	0	0	79	271	1	1	9.965879e-01	1	16	73	8	264	72	173
RND1	27289	broad.mit.edu	37	12	49254866	49254866	+	Missense_Mutation	SNP	T	T	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr12:49254866T>A	ENST00000309739.5	-	4	497	c.367A>T	c.(367-369)Att>Ttt	p.I123F		NM_014470.3	NP_055285.1	Q92730	RND1_HUMAN	Rho family GTPase 1	123					actin filament organization (GO:0007015)|axon guidance (GO:0007411)|GTP catabolic process (GO:0006184)|negative regulation of cell adhesion (GO:0007162)|neuron remodeling (GO:0016322)|small GTPase mediated signal transduction (GO:0007264)	adherens junction (GO:0005912)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(2)|skin(1)|urinary_tract(1)	10						TTGCAGCCAATGAGCAAAACG	0.552																																						ENST00000309739.5	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	0.999929	0.990000	1.000000																										0				10						c.(367-369)Att>Ttt		Rho family GTPase 1							103.0	92.0	96.0					12																	49254866		2203	4300	6503	SO:0001583	missense	27289	0	0					g.chr12:49254866T>A	Y07923	CCDS8771.1	12q12	2008-01-23				ENSG00000172602			18314	protein-coding gene	gene with protein product	"""ras homolog gene family, member S"""	609038				9531558	Standard	NM_014470		Approved	Rho6, ARHS, RHOS	uc001rsn.3	Q92730	OTTHUMG00000170400	ENST00000309739.5:c.367A>T	chr12.hg19:g.49254866T>A	ENSP00000308461:p.Ile123Phe	1						p.I123F	NM_014470.3	NP_055285.1	0	2	2	2.094693	Q92730	RND1_HUMAN		4	497	-			A8K9P7	Missense_Mutation	SNP	ENST00000309739.5	1	1	hg19	c.367A>T	CCDS8771.1	1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.185328	0.78677	.	.	ENSG00000172602	ENST00000550607;ENST00000309739	T;T	0.79352	-1.26;-1.26	5.66	3.33	0.38152	5.66	3.33	0.38152	Small GTP-binding protein domain (1);	0.051099	0.85682	D	0.000000	T	0.74718	0.3753	L	0.61387	1.9	0.58432	D	0.999998	P	0.47962	0.903	B	0.44108	0.441	T	0.76266	-0.3022	10	0.87932	D	0	-22.6091	9.2452	0.37520	0.0:0.1499:0.0:0.8501	.	123	Q92730	RND1_HUMAN	F	17;123	ENSP00000447059:I17F;ENSP00000308461:I123F	ENSP00000308461:I123F	I	-	1	0	0	RND1	47541133	47541133	0.915000	0.31059	0.998000	0.56505	0.935000	0.57460	1.352000	0.34033	1.084000	0.41184	-0.274000	0.10170	ATT	0.530000		TCGA-2L-AAQE-01A-11D-A397-08	0.552	RND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408915.1	1	0	1	2	2	2	2	0	0	0	0	75	0	75	75	1	1.810000	-20.000000	1	0.530000	NM_014470		0	118	118	0	240	238	1		1	1		0	0	75	0	0	1	9.685573e-01	0	6	0	8	0	118	240
ANKS1B	56899	broad.mit.edu	37	12	99898356	99898356	+	Missense_Mutation	SNP	A	A	T			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr12:99898356A>T	ENST00000547776.2	-	10	1335	c.1336T>A	c.(1336-1338)Ttt>Att	p.F446I	ANKS1B_ENST00000329257.7_Missense_Mutation_p.F446I|ANKS1B_ENST00000547010.1_Missense_Mutation_p.F26I	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	446						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		TCTGAAGGAAATGTATCCAGA	0.383																																						ENST00000547776.2	1.000000	4.600000e-01	0.880000	5.900000e-01	0.730000	0.739562	0.730000	1.000000																										0				70						c.(1336-1338)Ttt>Att		ankyrin repeat and sterile alpha motif domain containing 1B							63.0	62.0	62.0					12																	99898356		1825	4081	5906	SO:0001583	missense	56899	0	0					g.chr12:99898356A>T	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.1336T>A	chr12.hg19:g.99898356A>T	ENSP00000449629:p.Phe446Ile	1					ANKS1B_ENST00000329257.7_Missense_Mutation_p.F446I|ANKS1B_ENST00000547010.1_Missense_Mutation_p.F26I	p.F446I	NM_152788.4	NP_690001.3	0	1	1	1.758242	Q7Z6G8	ANS1B_HUMAN		10	1335	-		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	1	1	hg19	c.1336T>A	CCDS55872.1	0	.	.	.	.	.	.	.	.	.	.	A	15.63	2.890646	0.52014	.	.	ENSG00000185046	ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702;ENST00000549866	T;T;T;T	0.61742	0.92;0.08;0.92;0.78	5.68	5.68	0.88126	5.68	5.68	0.88126	.	0.136396	0.48767	D	0.000169	T	0.41766	0.1173	L	0.29908	0.895	0.80722	D	1	B;B;B	0.32829	0.386;0.386;0.02	B;B;B	0.27170	0.077;0.077;0.006	T	0.33828	-0.9853	9	.	.	.	-6.2914	11.418	0.49965	0.8382:0.1618:0.0:0.0	.	412;26;446	F8VVQ4;Q7Z6G8-6;Q7Z6G8	.;.;ANS1B_HUMAN	I	446;26;446;25;412	ENSP00000449629:F446I;ENSP00000448512:F26I;ENSP00000331381:F446I;ENSP00000449894:F412I	.	F	-	1	0	0	ANKS1B	98422487	98422487	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.066000	0.50002	2.175000	0.68902	0.528000	0.53228	TTT	0.378471		TCGA-2L-AAQE-01A-11D-A397-08	0.383	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	1	0	1	2	2	2	2	0	0	0	0	31	0	31	31	1	1.810000	-20.000000	1	0.530000	NM_020140		0	17	17	0	48	48	1		1			0	0	31	0	0	9.999869e-01	0	0	0	0	0	0	17	48
SRRM4	84530	broad.mit.edu	37	12	119568554	119568554	+	Missense_Mutation	SNP	T	T	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr12:119568554T>A	ENST00000267260.4	+	8	1074	c.686T>A	c.(685-687)cTc>cAc	p.L229H	SRRM4_ENST00000537597.1_3'UTR	NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	229	Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						TCCAAGACCCTCTGCAAGGAC	0.652																																						ENST00000267260.4	1.000000	5.800000e-01	0.940000	6.900000e-01	0.810000	0.815603	0.810000	1.000000																										0				24						c.(685-687)cTc>cAc		serine/arginine repetitive matrix 4							25.0	30.0	29.0					12																	119568554		1926	4121	6047	SO:0001583	missense	84530	0	0					g.chr12:119568554T>A	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.686T>A	chr12.hg19:g.119568554T>A	ENSP00000267260:p.Leu229His	1					SRRM4_ENST00000537597.1_3'UTR	p.L229H	NM_194286.3	NP_919262.2	0	1	1	1.758242	A7MD48	SRRM4_HUMAN		8	1074	+			A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	ENST00000267260.4	1	1	hg19	c.686T>A	CCDS44994.1	0	.	.	.	.	.	.	.	.	.	.	T	14.62	2.590902	0.46214	.	.	ENSG00000139767	ENST00000267260	T	0.23552	1.9	5.07	2.5	0.30297	5.07	2.5	0.30297	.	0.407083	0.22564	N	0.058424	T	0.11239	0.0274	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.21381	-1.0247	10	0.15066	T	0.55	-8.4824	1.5524	0.02578	0.1784:0.0995:0.1716:0.5504	.	229	A7MD48	SRRM4_HUMAN	H	229	ENSP00000267260:L229H	ENSP00000267260:L229H	L	+	2	0	0	SRRM4	118052937	118052937	0.059000	0.20769	0.996000	0.52242	0.987000	0.75469	0.734000	0.26101	0.734000	0.32515	0.368000	0.22195	CTC	0.378471		TCGA-2L-AAQE-01A-11D-A397-08	0.652	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	0	0	1	2	2	2	2	0	0	0	0	23	0	23	22	1	1.810000	-20.000000	1	0.530000	NM_194286		0	29	25	0	71	65	1		1			0	0	23	0	0	1	0	0	0	0	0	0	29	71
LTB4R	1241	broad.mit.edu	37	14	24784967	24784967	+	Missense_Mutation	SNP	G	G	C			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr14:24784967G>C	ENST00000396789.4	+	2	1835	c.110G>C	c.(109-111)aGc>aCc	p.S37T	LTB4R_ENST00000396782.2_Missense_Mutation_p.S37T|LTB4R_ENST00000345363.3_Missense_Mutation_p.S37T	NM_181657.3	NP_858043.1	Q15722	LT4R1_HUMAN	leukotriene B4 receptor	37					cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|muscle contraction (GO:0006936)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(265;0.018)		CCCGGCAACAGCTTTGTGGTG	0.577																																						ENST00000396789.4	1.000000	8.800000e-01	1.000000	9.400000e-01	0.990000	0.979970	0.990000	1.000000																										0				8						c.(109-111)aGc>aCc		leukotriene B4 receptor							168.0	152.0	157.0					14																	24784967		2203	4300	6503	SO:0001583	missense	1241	0	0					g.chr14:24784967G>C	X98356	CCDS9626.1	14q11.2-q12	2012-08-10			ENSG00000213903	ENSG00000213903		"""GPCR / Class A : Leukotriene receptors"""	6713	protein-coding gene	gene with protein product		601531		P2RY7, GPR16, CMKRL1		8921391, 8702478	Standard	NM_181657		Approved	BLTR, P2Y7, LTB4R1	uc001wos.3	Q15722	OTTHUMG00000029346	ENST00000396789.4:c.110G>C	chr14.hg19:g.24784967G>C	ENSP00000380008:p.Ser37Thr	0					LTB4R_ENST00000345363.3_Missense_Mutation_p.S37T|LTB4R_ENST00000396782.2_Missense_Mutation_p.S37T	p.S37T	NM_181657.3	NP_858043.1	1	2	3	2.130831	Q15722	LT4R1_HUMAN		2	1835	+			Q13305|Q53XV5|Q92641|Q9BSU5	Missense_Mutation	SNP	ENST00000396789.4	1	1	hg19	c.110G>C	CCDS9626.1	1	.	.	.	.	.	.	.	.	.	.	G	5.085	0.201347	0.09652	.	.	ENSG00000213903	ENST00000553481;ENST00000345363;ENST00000396789;ENST00000396782	T;T;T;T	0.37752	1.18;1.18;1.18;1.18	5.89	0.269	0.15631	5.89	0.269	0.15631	GPCR, rhodopsin-like superfamily (1);	0.568969	0.17126	U	0.186005	T	0.19846	0.0477	L	0.28115	0.83	0.18873	N	0.999986	B	0.22003	0.063	B	0.18263	0.021	T	0.28933	-1.0028	10	0.10377	T	0.69	.	8.9335	0.35686	0.0:0.4012:0.3233:0.2755	.	37	Q15722	LT4R1_HUMAN	T	37	ENSP00000450457:S37T;ENSP00000307445:S37T;ENSP00000380008:S37T;ENSP00000380002:S37T	ENSP00000307445:S37T	S	+	2	0	0	LTB4R	23854807	23854807	0.015000	0.18098	0.089000	0.20774	0.999000	0.98932	0.329000	0.19698	0.050000	0.15949	0.655000	0.94253	AGC	0.532478		TCGA-2L-AAQE-01A-11D-A397-08	0.577	LTB4R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073198.4	1	0	1	2	2	2	2	0	0	0	0	131	0	131	129	1	1.810000	-20.000000	1	0.530000			0	170	169	0	467	463	1		1	1		0	0	131	0	0	1	9.620468e-01	0	5	0	12	0	170	467
SNRPN	6638	broad.mit.edu	37	15	25223413	25223413	+	Silent	SNP	G	G	A	rs372752818		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr15:25223413G>A	ENST00000400100.1	+	12	1523	c.633G>A	c.(631-633)acG>acA	p.T211T	SNRPN_ENST00000346403.6_Silent_p.T211T|SNURF_ENST00000338094.6_3'UTR|SNRPN_ENST00000390687.4_Silent_p.T211T|SNRPN_ENST00000400098.1_Silent_p.T211T|SNHG14_ENST00000551631.2_RNA|SNRPN_ENST00000577565.1_Silent_p.T211T|SNRPN_ENST00000400097.1_Silent_p.T211T|SNRPN_ENST00000444203.2_Silent_p.T215T|SNURF_ENST00000551312.2_Intron|SNRPN_ENST00000554227.2_Silent_p.T215T	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	211	Repeat-rich region.				response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		CTCGAGGGACGCCAATAGGCA	0.557									Prader-Willi syndrome																													ENST00000400100.1	1.000000	9.100000e-01	1.000000	9.700000e-01	0.990000	0.991671	0.990000	1.000000																										0				24						c.(631-633)acG>acA		small nuclear ribonucleoprotein polypeptide N		G	,,,,,	0,3784		0,0,1892	117.0	116.0	116.0		633,,633,633,633,633	-7.7	0.0	15		116	3,8207		0,3,4102	no	coding-synonymous,utr-3,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SNRPN,SNURF	NM_003097.3,NM_005678.3,NM_022805.2,NM_022806.2,NM_022807.2,NM_022808.2	,,,,,	0,3,5994	AA,AG,GG		0.0365,0.0,0.025	,,,,,	211/241,,211/241,211/241,211/241,211/241	25223413	3,11991	1892	4105	5997	SO:0001819	synonymous_variant	6638	9	120858	44	Prader-Willi syndrome	Familial Cancer Database	Prader-Labhart-Willi syndrome	g.chr15:25223413G>A	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.633G>A	chr15.hg19:g.25223413G>A		0					SNRPN_ENST00000577565.1_Silent_p.T211T|SNRPN_ENST00000444203.2_Silent_p.T215T|SNRPN_ENST00000390687.4_Silent_p.T211T|SNURF_ENST00000551312.2_Intron|SNRPN_ENST00000400098.1_Silent_p.T211T|SNHG14_ENST00000551631.2_RNA|SNURF_ENST00000338094.6_3'UTR|SNRPN_ENST00000400097.1_Silent_p.T211T|SNRPN_ENST00000346403.6_Silent_p.T211T|SNRPN_ENST00000554227.2_Silent_p.T215T	p.T211T	NM_022807.2	NP_073718.1	1	2	3	2.120405	P63162	RSMN_HUMAN		12	1523	+		all_cancers(20;9.33e-22)|Breast(32;0.000625)	B3KVR1|P14648|P17135|Q0D2Q5	Silent	SNP	ENST00000400100.1	1	1	hg19	c.633G>A	CCDS10017.1	1																																																																																								0.531242		TCGA-2L-AAQE-01A-11D-A397-08	0.557	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413849.10	1	0	1	2	17	12	2	1	0	1	1	140	0	140	136	1	1.810000	-20.000000	1	0.530000	NM_003097		0	191	185	0	499	495	1		1	1		1	0	140	0	0	1	1	0	262	0	143	0	191	499
ABCC1	4363	broad.mit.edu	37	16	16150130	16150130	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr16:16150130C>T	ENST00000399410.3	+	12	1830	c.1655C>T	c.(1654-1656)aCc>aTc	p.T552I	ABCC1_ENST00000346370.5_Missense_Mutation_p.T552I|ABCC1_ENST00000351154.5_Missense_Mutation_p.T552I|ABCC1_ENST00000349029.5_Missense_Mutation_p.T552I|ABCC1_ENST00000399408.2_Missense_Mutation_p.T552I|ABCC1_ENST00000345148.5_Missense_Mutation_p.T552I	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	552	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	GGCACCTTCACCTGGGTCTGC	0.517																																						ENST00000399410.3	1.000000	5.500000e-01	0.890000	6.400000e-01	0.750000	0.771166	0.750000	0.740000																										0				56						c.(1654-1656)aCc>aTc		ATP-binding cassette, sub-family C (CFTR/MRP), member 1	Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)						56.0	58.0	58.0					16																	16150130		2050	4203	6253	SO:0001583	missense	4363	0	0					g.chr16:16150130C>T	L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.1655C>T	chr16.hg19:g.16150130C>T	ENSP00000382342:p.Thr552Ile	0					ABCC1_ENST00000399408.2_Missense_Mutation_p.T552I|ABCC1_ENST00000351154.5_Missense_Mutation_p.T552I|ABCC1_ENST00000349029.5_Missense_Mutation_p.T552I|ABCC1_ENST00000345148.5_Missense_Mutation_p.T552I|ABCC1_ENST00000346370.5_Missense_Mutation_p.T552I	p.T552I	NM_004996.3	NP_004987.2	1	2	3	2.189608	P33527	MRP1_HUMAN		12	1830	+			A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	ENST00000399410.3	1	1	hg19	c.1655C>T	CCDS42122.1	0	.	.	.	.	.	.	.	.	.	.	C	9.579	1.123011	0.20959	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	D;D;D;D;D;D	0.90069	-2.61;-2.61;-2.61;-2.61;-2.61;-2.61	5.29	4.34	0.51931	5.29	4.34	0.51931	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.046759	0.85682	D	0.000000	D	0.88265	0.6390	N	0.21448	0.665	0.49915	D	0.99983	D;D;P;D;D;P;P	0.89917	0.998;0.996;0.821;1.0;0.999;0.806;0.923	D;P;P;D;D;P;P	0.76071	0.923;0.898;0.599;0.987;0.973;0.848;0.764	D	0.83738	0.0202	10	0.09338	T	0.73	-45.3552	13.1912	0.59711	0.0:0.9229:0.0:0.0771	.	552;552;552;552;552;552;552	P33527-6;P33527-5;P33527-4;P33527-3;P33527-2;P33527;P33527-9	.;.;.;.;.;MRP1_HUMAN;.	I	552;552;552;552;552;552;226	ENSP00000382342:T552I;ENSP00000382340:T552I;ENSP00000263019:T552I;ENSP00000263017:T552I;ENSP00000263014:T552I;ENSP00000263016:T552I	ENSP00000263014:T552I	T	+	2	0	0	ABCC1	16057631	16057631	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.450000	0.80656	1.216000	0.43427	0.462000	0.41574	ACC	0.539757		TCGA-2L-AAQE-01A-11D-A397-08	0.517	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	1	0	1	2	2	2	2	0	0	0	0	41	0	41	41	1	1.810000	-20.000000	1	0.530000	NM_004996		0	39	39	0	162	160	1		1	1		0	0	41	0	0	1	9.991354e-01	0	19	0	29	0	39	162
XYLT1	64131	broad.mit.edu	37	16	17235134	17235134	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr16:17235134G>A	ENST00000261381.6	-	7	1547	c.1463C>T	c.(1462-1464)gCc>gTc	p.A488V	CTD-2576D5.4_ENST00000567344.1_RNA	NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	488					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GCCATCCACGGCAATGCCCTC	0.577																																						ENST00000261381.6	1.000000	0	0.070000	1.000000e-02	0.030000	0.105788	0.030000	0.040000																										0				67						c.(1462-1464)gCc>gTc		xylosyltransferase I							98.0	100.0	99.0					16																	17235134		2197	4300	6497	SO:0001583	missense	64131	0	0					g.chr16:17235134G>A	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.1463C>T	chr16.hg19:g.17235134G>A	ENSP00000261381:p.Ala488Val	0					CTD-2576D5.4_ENST00000567344.1_RNA	p.A488V	NM_022166.3	NP_071449.1	1	2	3	2.189608	Q86Y38	XYLT1_HUMAN		7	1547	-			Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	0	1	hg19	c.1463C>T	CCDS10569.1	0	.	.	.	.	.	.	.	.	.	.	G	8.165	0.790357	0.16258	.	.	ENSG00000103489	ENST00000261381	T	0.11385	2.78	5.92	5.92	0.95590	5.92	5.92	0.95590	.	0.342297	0.36374	N	0.002632	T	0.04770	0.0129	N	0.02142	-0.665	0.09310	N	0.999997	P	0.45044	0.849	B	0.40702	0.338	T	0.45527	-0.9255	10	0.20046	T	0.44	-20.7778	14.1696	0.65500	0.0:0.0:0.8505:0.1495	.	488	Q86Y38	XYLT1_HUMAN	V	488	ENSP00000261381:A488V	ENSP00000261381:A488V	A	-	2	0	0	XYLT1	17142635	17142635	0.894000	0.30519	0.015000	0.15790	0.196000	0.23810	4.775000	0.62346	2.797000	0.96272	0.555000	0.69702	GCC	0.539757		TCGA-2L-AAQE-01A-11D-A397-08	0.577	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	0	0	1	2	15	2	2	1	0	1	1	129	0	129	125	1	1.810000	-2.495725	0	0.530000	NM_022166		0	5	7	0	510	498	0		0	0		1	0	129	0	0	1.752358e-02	9.182503e-04	0	0	0	4	0	5	510
TMC7	79905	broad.mit.edu	37	16	19067891	19067891	+	Silent	SNP	G	G	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr16:19067891G>A	ENST00000304381.5	+	14	2029	c.1899G>A	c.(1897-1899)ccG>ccA	p.P633P	TMC7_ENST00000421369.3_Silent_p.P523P|TMC7_ENST00000569532.1_Silent_p.P633P	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	633					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						CCTGTGGGCCGTTCACCAACT	0.602																																						ENST00000304381.5	1.000000	1.000000e-02	0.110000	3.000000e-02	0.060000	0.129508	0.060000	0.060000																										0				28						c.(1897-1899)ccG>ccA		transmembrane channel-like 7							172.0	124.0	141.0					16																	19067891		2197	4300	6497	SO:0001819	synonymous_variant	79905	9	121412	42				g.chr16:19067891G>A	AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.1899G>A	chr16.hg19:g.19067891G>A		0					TMC7_ENST00000569532.1_Silent_p.P633P|TMC7_ENST00000421369.3_Silent_p.P523P	p.P633P	NM_024847.3	NP_079123.3	1	2	3	2.189608	Q7Z402	TMC7_HUMAN		14	2029	+			E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Silent	SNP	ENST00000304381.5	0	1	hg19	c.1899G>A	CCDS10573.1	0																																																																																								0.539757		TCGA-2L-AAQE-01A-11D-A397-08	0.602	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254276.3	0	0	1	2	2	2	2	0	0	0	0	78	0	78	76	1	1.810000	-2.835645	1	0.530000	NM_024847		0	5	5	0	324	322	0		1	0		0	0	78	0	0	9.369998e-01	3.182076e-01	0	0	0	64	0	5	324
ITGAX	3687	broad.mit.edu	37	16	31391078	31391078	+	Splice_Site	SNP	G	G	T			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08			G	T	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr16:31391078G>T	ENST00000268296.4	+	25	2990	c.2869G>T	c.(2869-2871)Gtc>Ttc	p.V957F	ITGAX_ENST00000562522.1_Splice_Site_p.V957F	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	957					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CTCTGTGCAGGTCAATAACCT	0.627																																						ENST00000268296.4	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	0.999363	0.990000	1.000000																										0				77						c.(2869-2871)Gtc>Ttc		integrin, alpha X (complement component 3 receptor 4 subunit)							38.0	34.0	36.0					16																	31391078		2197	4300	6497	SO:0001630	splice_region_variant	3687	3	121410	36				g.chr16:31391078G>T	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.2869-1G>T	chr16.hg19:g.31391078G>T		0					ITGAX_ENST00000562522.1_Splice_Site_p.V957F	p.V957F	NM_000887.3	NP_000878.2	1	2	3	2.189608	P20702	ITAX_HUMAN		25	2990	+			Q8IVA6	Splice_Site	SNP	ENST00000268296.4	1	0	hg19	c.2869G>T	CCDS10711.1	1	.	.	.	.	.	.	.	.	.	.	G	12.97	2.096174	0.36952	.	.	ENSG00000140678	ENST00000268296	T	0.56776	0.44	4.58	4.58	0.56647	4.58	4.58	0.56647	Integrin alpha-2 (1);	.	.	.	.	T	0.58206	0.2106	L	0.33485	1.01	0.80722	D	1	D;D	0.67145	0.996;0.992	D;D	0.65573	0.936;0.918	T	0.54043	-0.8352	8	.	.	.	.	13.0477	0.58937	0.0:0.0:1.0:0.0	.	957;142	P20702;Q8TES5	ITAX_HUMAN;.	F	957	ENSP00000268296:V957F	.	V	+	1	0	0	ITGAX	31298579	31298579	1.000000	0.71417	0.998000	0.56505	0.211000	0.24417	2.460000	0.45031	2.535000	0.85469	0.313000	0.20887	GTC	0.539757		TCGA-2L-AAQE-01A-11D-A397-08	0.627	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	1	0	1	2	2	2	2	0	0	0	0	18	0	18	18	1	1.810000	-20.000000	1	0.530000	NM_000887	Missense_Mutation	0	34	34	0	59	58	1		1	0		0	0	18	0	0	1	9.947066e-01	0	0	0	18	0	34	59
TP53	7157	broad.mit.edu	37	17	7579575	7579575	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr17:7579575G>A	ENST00000269305.4	-	4	301	c.112C>T	c.(112-114)Caa>Taa	p.Q38*	TP53_ENST00000359597.4_Nonsense_Mutation_p.Q38*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q38*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q38*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q38*|TP53_ENST00000413465.2_Nonsense_Mutation_p.Q38*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	38	Interaction with HRMT1L2.|Transcription activation (acidic).				apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q38*(8)|p.0?(8)|p.P36fs*4(3)|p.?(1)|p.S33fs*23(1)|p.P13fs*18(1)|p.S37fs*79(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCCATTGCTTGGGACGGCAAG	0.592		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	8.600000e-01	1.000000	9.100000e-01	0.960000	0.959032	0.960000	1.000000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		23	Substitution - Nonsense(8)|Whole gene deletion(8)|Deletion - Frameshift(6)|Unknown(1)	p.Q38*(8)|p.0?(8)|p.P36fs*4(3)|p.?(1)|p.S33fs*23(1)|p.P13fs*18(1)|p.S37fs*79(1)	lung(4)|prostate(4)|bone(4)|ovary(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|oesophagus(1)	24185						c.(112-114)Caa>Taa	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						159.0	156.0	157.0					17																	7579575		2203	4300	6503	SO:0001587	stop_gained	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7579575G>A	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.112C>T	chr17.hg19:g.7579575G>A	ENSP00000269305:p.Gln38*	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Nonsense_Mutation_p.Q38*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q38*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q38*|TP53_ENST00000359597.4_Nonsense_Mutation_p.Q38*|TP53_ENST00000413465.2_Nonsense_Mutation_p.Q38*	p.Q38*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.646491	P04637	P53_HUMAN		4	301	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	0	1	hg19	c.112C>T	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.571091	0.45798	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	3.41	-1.11	0.09840	3.41	-1.11	0.09840	.	3.135740	0.02989	U	0.146625	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	0.2222	0.8266	0.01122	0.224:0.1841:0.4032:0.1887	.	.	.	.	X	38	.	ENSP00000269305:Q38X	Q	-	1	0	0	TP53	7520300	7520300	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-0.754000	0.04787	-0.145000	0.11294	0.561000	0.74099	CAA	0.369635		TCGA-2L-AAQE-01A-11D-A397-08	0.592	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	204	0	204	200	1	1.810000	-20.000000	1	0.530000	NM_000546		0	245	243	0	464	460	1		1	1	1	0	0	204	335	0	1	9.999999e-01	1	30	155	19	251	245	464
TEX14	56155	broad.mit.edu	37	17	56659016	56659016	+	Missense_Mutation	SNP	C	C	G			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr17:56659016C>G	ENST00000240361.8	-	20	3350	c.3265G>C	c.(3265-3267)Gaa>Caa	p.E1089Q	TEX14_ENST00000349033.5_Intron|TEX14_ENST00000389934.3_Missense_Mutation_p.E1083Q			Q8IWB6	TEX14_HUMAN	testis expressed 14	1089					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TAAAAATATTCACCGTCTGGA	0.368																																						ENST00000240361.8	1.000000	6.700000e-01	1.000000	7.600000e-01	0.860000	0.869288	0.860000	1.000000																										0				81						c.(3265-3267)Gaa>Caa		testis expressed 14							92.0	91.0	91.0					17																	56659016		2203	4300	6503	SO:0001583	missense	56155	0	0					g.chr17:56659016C>G	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.3265G>C	chr17.hg19:g.56659016C>G	ENSP00000240361:p.Glu1089Gln	0					TEX14_ENST00000349033.5_Intron|TEX14_ENST00000389934.3_Missense_Mutation_p.E1083Q	p.E1089Q			1	2	3	2.182309	Q8IWB6	TEX14_HUMAN		20	3350	-	Medulloblastoma(34;0.127)|all_neural(34;0.237)		A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	1	1	hg19	c.3265G>C	CCDS56042.1	1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.352360	0.41700	.	.	ENSG00000121101	ENST00000240361;ENST00000389934	T;T	0.80214	-1.35;-1.35	5.34	4.37	0.52481	5.34	4.37	0.52481	.	0.200908	0.34603	N	0.003829	T	0.73048	0.3537	L	0.27053	0.805	0.29767	N	0.835083	P;P	0.52061	0.917;0.95	B;P	0.49887	0.421;0.625	T	0.68368	-0.5427	10	0.31617	T	0.26	-4.298	8.9678	0.35887	0.0:0.9008:0.0:0.0992	.	1089;1083	Q8IWB6;Q8IWB6-2	TEX14_HUMAN;.	Q	1089;1083	ENSP00000240361:E1089Q;ENSP00000374584:E1083Q	ENSP00000240361:E1089Q	E	-	1	0	0	TEX14	54014015	54014015	0.751000	0.28327	0.573000	0.28510	0.696000	0.40369	2.632000	0.46511	2.504000	0.84457	0.462000	0.41574	GAA	0.546813		TCGA-2L-AAQE-01A-11D-A397-08	0.368	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1	1	0	1	2	2	2	2	0	0	0	0	58	0	58	58	1	1.810000	-20.000000	1	0.530000			0	65	64	0	234	230	1		1			0	0	58	0	0	1	0	0	0	0	0	0	65	234
DAND5	199699	broad.mit.edu	37	19	13084387	13084387	+	Missense_Mutation	SNP	G	G	A	rs375577023		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr19:13084387G>A	ENST00000317060.2	+	2	688	c.509G>A	c.(508-510)cGt>cAt	p.R170H	DAND5_ENST00000585548.1_3'UTR	NM_152654.2	NP_689867.1	Q8N907	DAND5_HUMAN	DAN domain family member 5, BMP antagonist	170	CTCK.				atrial septum development (GO:0003283)|determination of heart left/right asymmetry (GO:0061371)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of nodal signaling pathway (GO:1900108)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|sequestering of nodal from receptor via nodal binding (GO:0038101)|ventricular septum development (GO:0003281)	extracellular region (GO:0005576)	morphogen activity (GO:0016015)			kidney(2)|lung(3)|ovary(1)	6			OV - Ovarian serous cystadenocarcinoma(19;1.87e-18)			TCAGCCTCCCGTCGACGGGTG	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		18772	0.0		0.0	False		,,,				2504	0.001					ENST00000317060.2	1.000000	8.600000e-01	1.000000	9.400000e-01	0.990000	0.981746	0.990000	1.000000																										0				6						c.(508-510)cGt>cAt		DAN domain family member 5, BMP antagonist		G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	130.0	106.0	114.0		509	-3.4	0.0	19		114	2,8598	2.2+/-6.3	0,2,4298	no	missense	DAND5	NM_152654.2	29	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	benign	170/190	13084387	3,13003	2203	4300	6503	SO:0001583	missense	199699	6	121412	43				g.chr19:13084387G>A	AK095926	CCDS12291.1	19p13	2013-02-26	2013-02-26			ENSG00000179284			26780	protein-coding gene	gene with protein product		609068	"""DAN domain family, member 5"""			15254711	Standard	NM_152654		Approved	FLJ38607, CKTSF1B3, DANTE, GREM3, CER2, DTE	uc002mwc.1	Q8N907		ENST00000317060.2:c.509G>A	chr19.hg19:g.13084387G>A	ENSP00000323155:p.Arg170His	0					DAND5_ENST00000585548.1_3'UTR	p.R170H	NM_152654.2	NP_689867.1	1	2	3	2.128114	Q8N907	DAND5_HUMAN	OV - Ovarian serous cystadenocarcinoma(19;1.87e-18)	2	688	+				Missense_Mutation	SNP	ENST00000317060.2	1	1	hg19	c.509G>A	CCDS12291.1	1	.	.	.	.	.	.	.	.	.	.	G	11.08	1.534859	0.27475	2.27E-4	2.33E-4	ENSG00000179284	ENST00000317060	T	0.33654	1.4	5.49	-3.42	0.04825	5.49	-3.42	0.04825	DAN (1);	0.906086	0.09091	N	0.849807	T	0.23410	0.0566	L	0.40543	1.245	0.09310	N	1	B	0.15141	0.012	B	0.12837	0.008	T	0.29088	-1.0023	10	0.30854	T	0.27	-1.7171	5.2395	0.15464	0.3965:0.2644:0.3391:0.0	.	170	Q8N907	DAND5_HUMAN	H	170	ENSP00000323155:R170H	ENSP00000323155:R170H	R	+	2	0	0	DAND5	12945387	12945387	0.000000	0.05858	0.001000	0.08648	0.059000	0.15707	-0.058000	0.11750	-0.216000	0.10048	-0.136000	0.14681	CGT	0.532478		TCGA-2L-AAQE-01A-11D-A397-08	0.602	DAND5-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452761.1	1	0	1	2	2	2	2	0	0	0	0	83	0	83	81	1	1.810000	-6.565702	1	0.530000	NM_152654		0	91	91	0	240	238	1		1	0		0	0	83	0	0	1	0	0	1	0	0	0	91	240
DMKN	93099	broad.mit.edu	37	19	36004243	36004243	+	Silent	SNP	G	G	A	rs113646456		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr19:36004243G>A	ENST00000339686.3	-	1	311	c.135C>T	c.(133-135)gaC>gaT	p.D45D	DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000419602.1_Silent_p.D45D|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000447113.2_Silent_p.D45D|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000424570.2_Silent_p.D45D|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000451297.2_Silent_p.D45D|DMKN_ENST00000418261.1_Silent_p.D45D|DMKN_ENST00000440396.1_Silent_p.D45D|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000429837.1_Silent_p.D45D	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	45	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CGCTCAGGGCGTCTCCCAGGC	0.642																																						ENST00000339686.3	0.850000	5.500000e-01	0.780000	6.200000e-01	0.690000	0.705670	0.690000	0.700000																										0				27						c.(133-135)gaC>gaT		dermokine		G	,,,,,,	0,4406		0,0,2203	72.0	72.0	72.0		135,135,135,135,135,135,135	-8.5	0.0	19	dbSNP_132	72	1,8599		0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	DMKN	NM_001126056.2,NM_001126057.2,NM_001126058.2,NM_001190347.1,NM_001190348.1,NM_001190349.1,NM_033317.4	,,,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,,,	45/466,45/399,45/387,45/450,45/437,45/370,45/477	36004243	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	93099	27	121412	47				g.chr19:36004243G>A	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.135C>T	chr19.hg19:g.36004243G>A		0					DMKN_ENST00000451297.2_Silent_p.D45D|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000440396.1_Silent_p.D45D|DMKN_ENST00000419602.1_Silent_p.D45D|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000447113.2_Silent_p.D45D|DMKN_ENST00000418261.1_Silent_p.D45D|DMKN_ENST00000424570.2_Silent_p.D45D|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000429837.1_Silent_p.D45D|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000443640.1_5'Flank	p.D45D	NM_033317.4	NP_201574	0	0	0	2.020278	Q6E0U4	DMKN_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0724)	1	311	-	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Silent	SNP	ENST00000339686.3	1	1	hg19	c.135C>T	CCDS12463.1	0																																																																																								0.509190		TCGA-2L-AAQE-01A-11D-A397-08	0.642	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	1	0	1	2	2	2	2	0	0	0	0	66	0	66	63	1	1.810000	-20.000000	1	0.530000	NM_033317		0	65	65	0	270	269	1		1	0		0	0	66	0	0	1	0	0	1	0	0	0	65	270
ZNF780B	163131	broad.mit.edu	37	19	40541025	40541025	+	Missense_Mutation	SNP	C	C	T	rs369018278		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr19:40541025C>T	ENST00000434248.1	-	5	1806	c.1741G>A	c.(1741-1743)Gga>Aga	p.G581R	ZNF780B_ENST00000221355.6_Missense_Mutation_p.G433R	NM_001005851.2	NP_001005851.1	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	581					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G581R(1)		endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					GGTTTCTTTCCGGTATGAATA	0.388																																						ENST00000434248.1	0.570000	3.600000e-01	0.520000	4.100000e-01	0.460000	0.469926	0.460000	0.460000																										1	Substitution - Missense(1)	p.G581R(1)	large_intestine(1)	23						c.(1741-1743)Gga>Aga		zinc finger protein 780B		C	ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	107.0	114.0	111.0		1741	1.5	0.0	19		111	0,8600		0,0,4300	no	missense	ZNF780B	NM_001005851.2	125	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	581/834	40541025	1,13005	2203	4300	6503	SO:0001583	missense	163131	7	121412	41				g.chr19:40541025C>T	AK127063	CCDS46077.1	19q13.2	2013-01-08	2006-08-15	2006-08-15	ENSG00000128000	ENSG00000128000		"""Zinc fingers, C2H2-type"", ""-"""	33109	protein-coding gene	gene with protein product			"""zinc finger protein 779"""	ZNF779			Standard	NM_001005851		Approved		uc002omu.3	Q9Y6R6	OTTHUMG00000155118	ENST00000434248.1:c.1741G>A	chr19.hg19:g.40541025C>T	ENSP00000391641:p.Gly581Arg	0					ZNF780B_ENST00000221355.6_Missense_Mutation_p.G433R	p.G581R	NM_001005851.2	NP_001005851.1	0	0	0	2.020278	Q9Y6R6	Z780B_HUMAN		5	1806	-	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)		B9EH00	Missense_Mutation	SNP	ENST00000434248.1	1	1	hg19	c.1741G>A	CCDS46077.1	0	.	.	.	.	.	.	.	.	.	.	C	20.3	3.970459	0.74246	2.27E-4	0.0	ENSG00000128000	ENST00000434248;ENST00000221355	T;T	0.26223	1.75;1.75	2.56	1.45	0.22620	2.56	1.45	0.22620	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.43277	0.1240	M	0.69248	2.105	0.31143	N	0.706402	D	0.89917	1.0	D	0.97110	1.0	T	0.42582	-0.9443	9	0.56958	D	0.05	.	6.4082	0.21676	0.0:0.8247:0.0:0.1753	.	581	Q9Y6R6	Z780B_HUMAN	R	581;433	ENSP00000391641:G581R;ENSP00000221355:G433R	ENSP00000221355:G433R	G	-	1	0	0	ZNF780B	45232865	45232865	0.000000	0.05858	0.017000	0.16124	0.602000	0.36980	0.958000	0.29227	0.214000	0.20742	0.462000	0.41574	GGA	0.509190		TCGA-2L-AAQE-01A-11D-A397-08	0.388	ZNF780B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338466.1	1	0	1	2	17	2	2	1	0	1	1	113	0	113	113	1	1.810000	-2.920857	1	0.530000	NM_001005851		0	70	70	0	473	471	1		1	1		1	0	113	0	0	1	2.805598e-01	0	3	0	5	0	70	473
HIF3A	64344	broad.mit.edu	37	19	46834437	46834437	+	Silent	SNP	C	C	T			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr19:46834437C>T	ENST00000377670.4	+	13	1768	c.1737C>T	c.(1735-1737)gaC>gaT	p.D579D	AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000600383.1_Silent_p.D510D|HIF3A_ENST00000420102.2_Silent_p.D528D|HIF3A_ENST00000300862.3_Silent_p.D577D|HIF3A_ENST00000244303.6_Silent_p.D510D|HIF3A_ENST00000472815.1_Intron|HIF3A_ENST00000339613.2_Silent_p.D523D	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	579	ODD.				cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.D577D(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		GCTCAGAGGACGAGGACGAGG	0.552																																						ENST00000377670.4	1.000000	5.500000e-01	0.890000	6.500000e-01	0.760000	0.773132	0.760000	0.750000																										1	Substitution - coding silent(1)	p.D577D(1)	endometrium(1)	33						c.(1735-1737)gaC>gaT		hypoxia inducible factor 3, alpha subunit							82.0	67.0	72.0					19																	46834437		2203	4300	6503	SO:0001819	synonymous_variant	64344	2	121412	30				g.chr19:46834437C>T	AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1737C>T	chr19.hg19:g.46834437C>T		0					HIF3A_ENST00000244303.6_Silent_p.D510D|AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000472815.1_Intron|HIF3A_ENST00000300862.3_Silent_p.D577D|HIF3A_ENST00000420102.2_Silent_p.D528D|HIF3A_ENST00000600383.1_Silent_p.D510D|HIF3A_ENST00000339613.2_Silent_p.D523D	p.D579D	NM_152795.3	NP_690008.2	1	2	3	2.131241	Q9Y2N7	HIF3A_HUMAN		13	1768	+		Ovarian(192;0.00965)|all_neural(266;0.0887)	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Silent	SNP	ENST00000377670.4	1	1	hg19	c.1737C>T	CCDS12681.2	0																																																																																								0.536146		TCGA-2L-AAQE-01A-11D-A397-08	0.552	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280556.3	1	0	1	2	2	2	2	0	0	0	0	46	0	46	43	1	1.810000	-20.000000	1	0.530000			0	37	37	0	150	148	1		1			0	0	46	0	0	1	0	0	0	0	0	0	37	150
FBN3	84467	broad.mit.edu	37	19	8155007	8155007	+	Missense_Mutation	SNP	C	C	T	rs149936210	byFrequency	TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr19:8155007C>T	ENST00000600128.1	-	49	6574	c.6160G>A	c.(6160-6162)Gaa>Aaa	p.E2054K	FBN3_ENST00000601739.1_Missense_Mutation_p.E2054K|FBN3_ENST00000270509.2_Missense_Mutation_p.E2054K			Q75N90	FBN3_HUMAN	fibrillin 3	2054	TB 8.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GGACACAGTTCGCAGGGGTCT	0.612													C|||	2	0.000399361	0.0	0.0029	5008	,	,		17954	0.0		0.0	False		,,,				2504	0.0					ENST00000600128.1	1.000000	8.000000e-01	1.000000	9.100000e-01	0.990000	0.968762	0.990000	1.000000																										0				132						c.(6160-6162)Gaa>Aaa		fibrillin 3		C	LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	38.0	38.0	38.0		6160	4.1	0.9	19	dbSNP_134	38	0,8600		0,0,4300	yes	missense	FBN3	NM_032447.3	56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	2054/2810	8155007	1,13005	2203	4300	6503	SO:0001583	missense	84467	3	121412	38				g.chr19:8155007C>T		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.6160G>A	chr19.hg19:g.8155007C>T	ENSP00000470498:p.Glu2054Lys	0					FBN3_ENST00000601739.1_Missense_Mutation_p.E2054K|FBN3_ENST00000270509.2_Missense_Mutation_p.E2054K	p.E2054K			1	2	3	2.124373	Q75N90	FBN3_HUMAN		49	6574	-			Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	1	1	hg19	c.6160G>A	CCDS12196.1	1	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	C	21.7	4.181062	0.78677	2.27E-4	0.0	ENSG00000142449	ENST00000270509	D	0.95885	-3.84	4.13	4.13	0.48395	4.13	4.13	0.48395	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.85682	U	0.000000	D	0.95478	0.8531	M	0.82193	2.58	0.80722	D	1	D	0.69078	0.997	P	0.52758	0.708	D	0.94770	0.7944	10	0.51188	T	0.08	.	16.3935	0.83548	0.0:1.0:0.0:0.0	.	2054	Q75N90	FBN3_HUMAN	K	2054	ENSP00000270509:E2054K	ENSP00000270509:E2054K	E	-	1	0	0	FBN3	8061007	8061007	1.000000	0.71417	0.942000	0.38095	0.333000	0.28666	5.572000	0.67411	1.836000	0.53414	0.462000	0.41574	GAA	0.532478		TCGA-2L-AAQE-01A-11D-A397-08	0.612	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	1	0	1	2	2	2	2	0	0	0	0	40	0	40	38	1	1.810000	-20.000000	1	0.530000	NM_032447		0	51	50	0	136	133	1		1			0	0	40	0	0	1	0	0	0	0	0	0	51	136
OR7D2	162998	broad.mit.edu	37	19	9296821	9296821	+	Missense_Mutation	SNP	C	C	T	rs150499443		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr19:9296821C>T	ENST00000344248.2	+	1	543	c.364C>T	c.(364-366)Cgg>Tgg	p.R122W		NM_175883.2	NP_787079.1	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D, member 2	122					regulation of transcription, DNA-templated (GO:0006355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	20						GGCCTATGACCGGTTTGTGGC	0.507																																						ENST00000344248.2	0.110000	1.000000e-02	0.080000	3.000000e-02	0.050000	0.066441	0.050000	0.060000																										0				20						c.(364-366)Cgg>Tgg		olfactory receptor, family 7, subfamily D, member 2		C	TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	177.0	165.0	169.0		364	-0.2	1.0	19	dbSNP_134	169	0,8600		0,0,4300	yes	missense	OR7D2	NM_175883.2	101	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	122/313	9296821	2,13004	2203	4300	6503	SO:0001583	missense	162998	3	121412	45				g.chr19:9296821C>T	AK095468	CCDS32900.1	19p13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8378	protein-coding gene	gene with protein product							Standard	NM_175883		Approved	OR19-4, HTPCRH03, FLJ38149	uc002mkz.1	Q96RA2		ENST00000344248.2:c.364C>T	chr19.hg19:g.9296821C>T	ENSP00000345563:p.Arg122Trp	0						p.R122W	NM_175883.2	NP_787079.1	1	2	3	2.124373	Q96RA2	OR7D2_HUMAN		1	543	+			Q6IFJ7|Q8N133	Missense_Mutation	SNP	ENST00000344248.2	0	1	hg19	c.364C>T	CCDS32900.1	0	.	.	.	.	.	.	.	.	.	.	C	11.95	1.790563	0.31685	4.54E-4	0.0	ENSG00000188000	ENST00000344248	T	0.77620	-1.11	2.21	-0.197	0.13228	2.21	-0.197	0.13228	GPCR, rhodopsin-like superfamily (1);	0.200776	0.24490	U	0.038067	D	0.82309	0.5009	H	0.98314	4.2	0.22226	N	0.999272	P	0.35684	0.515	B	0.30572	0.117	T	0.77032	-0.2738	10	0.87932	D	0	.	8.8799	0.35367	0.5707:0.4293:0.0:0.0	.	122	Q96RA2	OR7D2_HUMAN	W	122	ENSP00000345563:R122W	ENSP00000345563:R122W	R	+	1	2	2	OR7D2	9157821	9157821	0.418000	0.25440	0.996000	0.52242	0.822000	0.46500	0.150000	0.16263	0.051000	0.15978	0.511000	0.50034	CGG	0.532478		TCGA-2L-AAQE-01A-11D-A397-08	0.507	OR7D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449002.1	0	0	1	2	2	2	2	0	0	0	0	137	0	137	136	1	1.810000	-2.019665	0	0.530000			0	9	9	0	652	642	0		1			0	0	137	0	0	9.938478e-01	0	0	0	0	0	0	9	652
BCAT2	587	broad.mit.edu	37	19	49300574	49300574	+	Missense_Mutation	SNP	C	C	T	rs139881168		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr19:49300574C>T	ENST00000316273.6	-	7	724	c.712G>A	c.(712-714)Gtg>Atg	p.V238M	BCAT2_ENST00000597011.1_Missense_Mutation_p.V198M|BCAT2_ENST00000599246.1_Missense_Mutation_p.V146M|BCAT2_ENST00000402551.1_Missense_Mutation_p.V198M|BCAT2_ENST00000598162.1_Missense_Mutation_p.V238M|BCAT2_ENST00000545387.2_Missense_Mutation_p.V146M	NM_001190.3	NP_001181.2	O15382	BCAT2_HUMAN	branched chain amino-acid transaminase 2, mitochondrial	238					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|isoleucine catabolic process (GO:0006550)|leucine metabolic process (GO:0006551)|regulation of hormone levels (GO:0010817)|small molecule metabolic process (GO:0044281)|valine metabolic process (GO:0006573)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	12		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.000366)|Epithelial(262;0.0195)|GBM - Glioblastoma multiforme(486;0.0224)	L-Isoleucine(DB00167)|L-Leucine(DB00149)	TGCACTAACACGGTGGGCCCA	0.617																																						ENST00000316273.6	1.000000	5.000000e-01	0.920000	6.100000e-01	0.750000	0.765225	0.750000	1.000000																										0				12						c.(712-714)Gtg>Atg		branched chain amino-acid transaminase 2, mitochondrial	L-Isoleucine(DB00167)|L-Leucine(DB00149)	C	MET/VAL,MET/VAL	0,4406		0,0,2203	74.0	59.0	64.0		436,712	5.1	0.5	19	dbSNP_134	64	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	BCAT2	NM_001164773.1,NM_001190.3	21,21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	146/301,238/393	49300574	1,13005	2203	4300	6503	SO:0001583	missense	587	3	121412	34				g.chr19:49300574C>T	U68418	CCDS12735.1, CCDS54290.1, CCDS74416.1	19q13.33	2013-09-20	2010-05-07		ENSG00000105552	ENSG00000105552	2.6.1.42		977	protein-coding gene	gene with protein product		113530	"""branched chain aminotransferase 2, mitochondrial"""	BCT2		9165094	Standard	NM_001190		Approved	BCAM	uc002pkr.3	O15382	OTTHUMG00000183327	ENST00000316273.6:c.712G>A	chr19.hg19:g.49300574C>T	ENSP00000322991:p.Val238Met	0					BCAT2_ENST00000402551.1_Missense_Mutation_p.V198M|BCAT2_ENST00000598162.1_Missense_Mutation_p.V238M|BCAT2_ENST00000599246.1_Missense_Mutation_p.V146M|BCAT2_ENST00000597011.1_Missense_Mutation_p.V198M|BCAT2_ENST00000545387.2_Missense_Mutation_p.V146M	p.V238M	NM_001190.3	NP_001181.2	1	2	3	2.131241	O15382	BCAT2_HUMAN		7	724	-		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)	B2RB87|O00269|Q96KG1|Q9BTB6|Q9BUU6	Missense_Mutation	SNP	ENST00000316273.6	1	1	hg19	c.712G>A	CCDS12735.1	0	.	.	.	.	.	.	.	.	.	.	C	15.76	2.928560	0.52759	0.0	1.16E-4	ENSG00000105552	ENST00000316273;ENST00000545387;ENST00000402551	T;T;T	0.21543	2.0;2.0;2.0	5.06	5.06	0.68205	5.06	5.06	0.68205	.	0.061208	0.64402	D	0.000005	T	0.31575	0.0801	L	0.35414	1.06	0.37282	D	0.907881	D;D;D;D	0.89917	0.999;1.0;0.976;1.0	D;D;P;D	0.68483	0.937;0.937;0.458;0.958	T	0.17379	-1.0371	10	0.87932	D	0	-16.3767	9.8608	0.41114	0.0:0.9059:0.0:0.094	.	198;238;146;238	B3KSI3;Q53EW7;O15382-2;O15382	.;.;.;BCAT2_HUMAN	M	238;146;198	ENSP00000322991:V238M;ENSP00000440973:V146M;ENSP00000385161:V198M	ENSP00000322991:V238M	V	-	1	0	0	BCAT2	53992386	53992386	0.991000	0.36638	0.476000	0.27291	0.493000	0.33554	2.602000	0.46257	2.523000	0.85059	0.491000	0.48974	GTG	0.536146		TCGA-2L-AAQE-01A-11D-A397-08	0.617	BCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466202.1	1	0	1	2	2	2	2	0	0	0	0	24	0	24	24	1	1.810000	-3.604268	1	0.530000			0	23	22	0	95	95	1		1	1		0	0	24	0	0	9.999997e-01	9.999561e-01	0	34	0	38	0	23	95
FLG	2312	broad.mit.edu	37	1	152286796	152286796	+	Missense_Mutation	SNP	T	T	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr1:152286796T>A	ENST00000368799.1	-	3	601	c.566A>T	c.(565-567)gAa>gTa	p.E189V	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	189					establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTAGTATTTTCAGTCTTGTT	0.308									Ichthyosis																													ENST00000368799.1	0.280000	8.000000e-02	0.220000	1.100000e-01	0.160000	0.174429	0.160000	0.160000																										0				424						c.(565-567)gAa>gTa		filaggrin							86.0	91.0	89.0					1																	152286796		2202	4300	6502	SO:0001583	missense	2312	0	0		Ichthyosis	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	g.chr1:152286796T>A	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.566A>T	chr1.hg19:g.152286796T>A	ENSP00000357789:p.Glu189Val	0					FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA	p.E189V	NM_002016.1	NP_002007.1	0	1	1	1.973246	P20930	FILA_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)	3	601	-	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	1	1	hg19	c.566A>T	CCDS30860.1	0	.	.	.	.	.	.	.	.	.	.	T	10.59	1.391622	0.25118	.	.	ENSG00000143631	ENST00000368799	T	0.00801	5.68	3.68	-3.27	0.05048	3.68	-3.27	0.05048	.	.	.	.	.	T	0.00328	0.0010	N	0.08118	0	0.09310	N	1	D	0.53885	0.963	P	0.53035	0.716	T	0.48502	-0.9030	9	0.29301	T	0.29	0.9076	4.776	0.13180	0.0:0.3342:0.3439:0.322	.	189	P20930	FILA_HUMAN	V	189	ENSP00000357789:E189V	ENSP00000357789:E189V	E	-	2	0	0	FLG	150553420	150553420	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.049000	0.03514	-0.583000	0.05921	0.378000	0.23410	GAA	0.489408		TCGA-2L-AAQE-01A-11D-A397-08	0.308	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	1	0	1	2	2	2	2	0	0	0	0	76	0	76	76	1	1.810000	-4.509725	1	0.530000	NM_002016		0	10	10	0	206	206	0		1			0	0	76	0	0	9.970829e-01	0	0	0	0	0	0	10	206
TMEM63A	9725	broad.mit.edu	37	1	226037743	226037743	+	Silent	SNP	C	C	T			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr1:226037743C>T	ENST00000366835.3	-	21	2211	c.1941G>A	c.(1939-1941)cgG>cgA	p.R647R		NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A	647					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)			breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					AGAGGTTGTGCCGGTCCACCA	0.602																																						ENST00000366835.3	0.090000	0	0.070000	2.000000e-02	0.040000	0.048395	0.040000	0.040000																										0				24						c.(1939-1941)cgG>cgA		transmembrane protein 63A							132.0	118.0	122.0					1																	226037743		2203	4300	6503	SO:0001819	synonymous_variant	9725	0	0					g.chr1:226037743C>T		CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.1941G>A	chr1.hg19:g.226037743C>T		0						p.R647R	NM_014698.2	NP_055513.2	0	1	1	1.973246	O94886	CSCL1_HUMAN		21	2211	-	Breast(184;0.197)		Q53GI7|Q5TE96|Q8N2U2	Silent	SNP	ENST00000366835.3	0	1	hg19	c.1941G>A	CCDS31042.1	0																																																																																								0.489408		TCGA-2L-AAQE-01A-11D-A397-08	0.602	TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091154.2	0	0	1	2	2	2	2	0	0	0	0	95	0	95	95	1	1.810000	-1.923306	0	0.530000	NM_014698		0	5	5	0	422	419	0		1	0		0	0	95	0	0	9.367252e-01	6.921161e-01	0	0	0	192	0	5	422
OBSCN	84033	broad.mit.edu	37	1	228451984	228451984	+	Missense_Mutation	SNP	G	G	A	rs369298350		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr1:228451984G>A	ENST00000422127.1	+	16	4797	c.4753G>A	c.(4753-4755)Gtg>Atg	p.V1585M	OBSCN_ENST00000570156.2_Missense_Mutation_p.V1769M|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000359599.6_Missense_Mutation_p.V241M|OBSCN_ENST00000284548.11_Missense_Mutation_p.V1585M	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1585	Ig-like 16.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AATGGAGGCCGTGGGCTGCAC	0.662																																						ENST00000422127.1	0.120000	1.000000e-02	0.090000	3.000000e-02	0.050000	0.064111	0.050000	0.050000																										0				223						c.(4753-4755)Gtg>Atg		obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF							55.0	61.0	59.0					1																	228451984		2117	4226	6343	SO:0001583	missense	84033	5	121122	41				g.chr1:228451984G>A	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.4753G>A	chr1.hg19:g.228451984G>A	ENSP00000409493:p.Val1585Met	0					OBSCN_ENST00000359599.6_Missense_Mutation_p.V241M|OBSCN_ENST00000284548.11_Missense_Mutation_p.V1585M|OBSCN_ENST00000570156.2_Missense_Mutation_p.V1769M|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR	p.V1585M	NM_001098623.2	NP_001092093.2	0	1	1	1.973246	Q5VST9	OBSCN_HUMAN		16	4797	+		Prostate(94;0.0405)	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	0	1	hg19	c.4753G>A	CCDS58065.1	0	.	.	.	.	.	.	.	.	.	.	.	9.689	1.151336	0.21371	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599	T;T;T	0.67523	-0.27;-0.27;-0.27	4.82	-9.64	0.00541	4.82	-9.64	0.00541	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.685180	0.02136	N	0.056724	T	0.57519	0.2059	L	0.34521	1.04	0.09310	N	0.999999	D;D	0.59767	0.965;0.986	P;P	0.52881	0.712;0.462	T	0.65611	-0.6126	10	0.48119	T	0.1	.	3.3118	0.07020	0.2018:0.2166:0.4408:0.1408	.	1585;1585	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	M	1585;1585;241	ENSP00000284548:V1585M;ENSP00000409493:V1585M;ENSP00000352613:V241M	ENSP00000284548:V1585M	V	+	1	0	0	OBSCN	226518607	226518607	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	0.071000	0.14594	-2.145000	0.00801	-0.218000	0.12543	GTG	0.489408		TCGA-2L-AAQE-01A-11D-A397-08	0.662	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	89	0	89	87	1	1.810000	-2.778025	1	0.530000	NM_052843		0	5	5	0	317	314	0		1	0		0	0	89	0	0	9.364698e-01	0	0	0	0	1	0	5	317
CHD6	84181	broad.mit.edu	37	20	40052243	40052243	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr20:40052243G>A	ENST00000373233.3	-	30	4621	c.4444C>T	c.(4444-4446)Cgc>Tgc	p.R1482C		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1482	Myb-like.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GAAATGATGCGGAACTGTGTC	0.443																																						ENST00000373233.3	1.000000	0	0.050000	0	0.020000	0.082419	0.020000	0.020000																										0				129						c.(4444-4446)Cgc>Tgc		chromodomain helicase DNA binding protein 6							163.0	170.0	168.0					20																	40052243		2203	4300	6503	SO:0001583	missense	84181	0	0					g.chr20:40052243G>A	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.4444C>T	chr20.hg19:g.40052243G>A	ENSP00000362330:p.Arg1482Cys	0						p.R1482C	NM_032221.3	NP_115597.3	1	2	3	2.177491	Q8TD26	CHD6_HUMAN		30	4621	-		Myeloproliferative disorder(115;0.00425)	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	0	1	hg19	c.4444C>T	CCDS13317.1	0	.	.	.	.	.	.	.	.	.	.	G	28.5	4.928613	0.92389	.	.	ENSG00000124177	ENST00000373233	D	0.94793	-3.52	6.07	6.07	0.98685	6.07	6.07	0.98685	SANT domain, DNA binding (1);	0.000000	0.64402	D	0.000007	D	0.97876	0.9302	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97909	1.0307	10	0.87932	D	0	-12.954	20.6439	0.99570	0.0:0.0:1.0:0.0	.	1482	Q8TD26	CHD6_HUMAN	C	1482	ENSP00000362330:R1482C	ENSP00000362330:R1482C	R	-	1	0	0	CHD6	39485657	39485657	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.405000	0.73272	2.884000	0.98904	0.655000	0.94253	CGC	0.538560		TCGA-2L-AAQE-01A-11D-A397-08	0.443	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1	0	0	1	2	2	2	2	0	0	0	0	214	0	214	212	1	1.810000	-1.736653	0	0.530000			0	5	5	0	787	785	0		1	0		0	0	214	0	0	9.372926e-01	3.446151e-03	0	0	0	11	0	5	787
PTK6	5753	broad.mit.edu	37	20	62166328	62166328	+	Silent	SNP	C	C	T			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr20:62166328C>T	ENST00000217185.2	-	2	342	c.315G>A	c.(313-315)agG>agA	p.R105R	PTK6_ENST00000542869.1_Intron	NM_005975.3	NP_005966.1	Q13882	PTK6_HUMAN	protein tyrosine kinase 6	105	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|intestinal epithelial cell differentiation (GO:0060575)|negative regulation of growth (GO:0045926)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ruffle (GO:0001726)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(1)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	15	all_cancers(38;2.51e-11)		Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)		Vandetanib(DB05294)	TCTCGCTGACCCTGATCAGGA	0.692																																						ENST00000217185.2	1.000000	4.100000e-01	0.870000	5.300000e-01	0.670000	0.697733	0.670000	0.660000																										0				15						c.(313-315)agG>agA		protein tyrosine kinase 6	Vandetanib(DB05294)						17.0	19.0	18.0					20																	62166328		2194	4291	6485	SO:0001819	synonymous_variant	5753	0	0					g.chr20:62166328C>T	U61412	CCDS13524.1, CCDS74750.1	20q13.3	2013-02-18	2013-02-18		ENSG00000101213	ENSG00000101213	2.7.10.1	"""SH2 domain containing"""	9617	protein-coding gene	gene with protein product		602004	"""PTK6 protein tyrosine kinase 6"""			8247543, 9284935	Standard	NM_005975		Approved	BRK	uc002yfg.4	Q13882	OTTHUMG00000033039	ENST00000217185.2:c.315G>A	chr20.hg19:g.62166328C>T		0					PTK6_ENST00000542869.1_Intron	p.R105R	NM_005975.3	NP_005966.1	1	2	3	2.177491	Q13882	PTK6_HUMAN	Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)	2	342	-	all_cancers(38;2.51e-11)		B2RCR3|B4DW46|Q58F01	Silent	SNP	ENST00000217185.2	1	1	hg19	c.315G>A	CCDS13524.1	0																																																																																								0.538560		TCGA-2L-AAQE-01A-11D-A397-08	0.692	PTK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080313.1	1	0	1	2	2	2	2	0	0	0	0	20	0	20	20	1	1.810000	-20.000000	1	0.530000			0	16	16	0	77	76	0		1	1		0	0	20	0	0	9.999570e-01	9.999998e-01	0	80	0	87	0	16	77
TIAM1	7074	broad.mit.edu	37	21	32502539	32502539	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr21:32502539G>A	ENST00000286827.3	-	26	4508	c.4037C>T	c.(4036-4038)gCg>gTg	p.A1346V	TIAM1_ENST00000541036.1_Missense_Mutation_p.A1286V	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1346	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						ACCTGCACTCGCCAAAGCTCG	0.473																																						ENST00000286827.3	0.060000	0	0.040000	1.000000e-02	0.020000	0.030917	0.020000	0.030000																										0				115						c.(4036-4038)gCg>gTg		T-cell lymphoma invasion and metastasis 1							166.0	164.0	165.0					21																	32502539		2203	4300	6503	SO:0001583	missense	7074	1	121412	35				g.chr21:32502539G>A		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.4037C>T	chr21.hg19:g.32502539G>A	ENSP00000286827:p.Ala1346Val	1					TIAM1_ENST00000541036.1_Missense_Mutation_p.A1286V	p.A1346V	NM_003253.2	NP_003244.2	0	1	1	1.897546	Q13009	TIAM1_HUMAN		26	4508	-			B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	0	1	hg19	c.4037C>T	CCDS13609.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.02|14.02	2.411603|2.411603	0.42817|0.42817	.|.	.|.	ENSG00000156299|ENSG00000156299	ENST00000286827;ENST00000541036|ENST00000423206	T;T|.	0.43294|.	0.95;0.96|.	6.03|6.03	6.03|6.03	0.97812|0.97812	6.03|6.03	6.03|6.03	0.97812|0.97812	Pleckstrin homology-type (1);Pleckstrin homology domain (1);|.	0.249575|.	0.39544|.	N|.	0.001336|.	T|.	0.69495|.	0.3117|.	L|L	0.44542|0.44542	1.39|1.39	0.38497|0.38497	D|D	0.948125|0.948125	B;B;B|.	0.28971|.	0.229;0.016;0.147|.	B;B;B|.	0.27170|.	0.077;0.003;0.035|.	T|.	0.65055|.	-0.6261|.	10|.	0.46703|.	T|.	0.11|.	.|.	20.5666|20.5666	0.99351|0.99351	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1286;1286;1346|.	F5GZ53;B7ZLR6;Q13009|.	.;.;TIAM1_HUMAN|.	V|X	1346;1286|1	ENSP00000286827:A1346V;ENSP00000441570:A1286V|.	ENSP00000286827:A1346V|.	A|R	-|-	2|1	0|2	0|2	TIAM1|TIAM1	31424410|31424410	31424410|31424410	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.291000|0.291000	0.27294|0.27294	7.077000|7.077000	0.76814|0.76814	2.854000|2.854000	0.98071|0.98071	0.655000|0.655000	0.94253|0.94253	GCG|CGA	0.463133		TCGA-2L-AAQE-01A-11D-A397-08	0.473	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	0	0	1	2	2	2	2	0	0	0	0	209	0	209	209	1	1.810000	-1.857569	0	0.530000	NM_003253		0	6	6	0	733	722	0		1	0		0	0	209	0	0	9.632487e-01	1.015770e-04	0	0	0	2	0	6	733
DOPEY2	9980	broad.mit.edu	37	21	37609569	37609569	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr21:37609569C>T	ENST00000399151.3	+	16	2717	c.2632C>T	c.(2632-2634)Cgt>Tgt	p.R878C		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	878					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GAGGGTGGCTCGTGTGCTTTG	0.587																																						ENST00000399151.3	0.630000	3.700000e-01	0.570000	4.200000e-01	0.490000	0.500596	0.490000	0.490000																										0				58						c.(2632-2634)Cgt>Tgt		dopey family member 2							89.0	77.0	81.0					21																	37609569		2203	4300	6503	SO:0001583	missense	9980	0	0					g.chr21:37609569C>T	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.2632C>T	chr21.hg19:g.37609569C>T	ENSP00000382104:p.Arg878Cys	1						p.R878C	NM_005128.2	NP_005119.2	0	1	1	1.897546	Q9Y3R5	DOP2_HUMAN		16	2717	+			D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	ENST00000399151.3	1	1	hg19	c.2632C>T	CCDS13643.1	0	.	.	.	.	.	.	.	.	.	.	C	14.48	2.547731	0.45383	.	.	ENSG00000142197	ENST00000399151	T	0.67523	-0.27	5.3	5.3	0.74995	5.3	5.3	0.74995	.	0.368606	0.30076	N	0.010472	T	0.56601	0.1996	L	0.36672	1.1	0.26838	N	0.968431	B	0.18461	0.028	B	0.10450	0.005	T	0.52442	-0.8575	10	0.48119	T	0.1	-8.3965	12.7613	0.57365	0.0:0.9152:0.0:0.0848	.	878	Q9Y3R5	DOP2_HUMAN	C	878	ENSP00000382104:R878C	ENSP00000382104:R878C	R	+	1	0	0	DOPEY2	36531439	36531439	0.604000	0.26932	0.983000	0.44433	0.978000	0.69477	5.633000	0.67825	2.489000	0.83994	0.591000	0.81541	CGT	0.463133		TCGA-2L-AAQE-01A-11D-A397-08	0.587	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	1	0	1	2	2	2	2	0	0	0	0	60	0	60	59	1	1.810000	-2.926773	1	0.530000	NM_005128		0	46	46	0	261	250	1		1	0		0	0	60	0	0	1	1.134076e-01	0	0	0	4	0	46	261
ZNF280A	129025	broad.mit.edu	37	22	22869193	22869193	+	Silent	SNP	G	G	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr22:22869193G>A	ENST00000302097.3	-	2	1014	c.762C>T	c.(760-762)gaC>gaT	p.D254D	snoU13_ENST00000459485.1_RNA	NM_080740.3	NP_542778.1	P59817	Z280A_HUMAN	zinc finger protein 280A	254					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	18	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		GACTTGAAATGTCTGTCATTG	0.408																																						ENST00000302097.3	1.000000	9.100000e-01	1.000000	9.500000e-01	0.990000	0.984755	0.990000	1.000000																										0				18						c.(760-762)gaC>gaT		zinc finger protein 280A							127.0	115.0	119.0					22																	22869193		2203	4300	6503	SO:0001819	synonymous_variant	129025	0	0					g.chr22:22869193G>A	D87009	CCDS13800.1	22q11.21	2007-09-20	2007-09-20	2007-09-20	ENSG00000169548	ENSG00000169548			18597	protein-coding gene	gene with protein product			"""zinc finger protein 280"", ""suppressor of hairy wing homolog 1 (Drosophila)"""	ZNF280, SUHW1		9074928	Standard	NM_080740		Approved	3'OY11.1, ZNF636	uc002zwe.3	P59817	OTTHUMG00000030545	ENST00000302097.3:c.762C>T	chr22.hg19:g.22869193G>A		1					snoU13_ENST00000459485.1_RNA	p.D254D	NM_080740.3	NP_542778.1	0	1	1	1.751573	P59817	Z280A_HUMAN		2	1014	-	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		Silent	SNP	ENST00000302097.3	1	1	hg19	c.762C>T	CCDS13800.1	1																																																																																								0.365122		TCGA-2L-AAQE-01A-11D-A397-08	0.408	ZNF280A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075433.3	1	0	1	2	2	2	2	0	0	0	0	142	0	142	141	1	1.810000	-20.000000	1	0.530000	NM_080740		0	181	176	0	286	285	1		1			0	0	142	0	0	1	0	0	0	0	0	0	181	286
RGPD2	729857	broad.mit.edu	37	2	88125207	88125207	+	Silent	SNP	C	C	T			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr2:88125207C>T	ENST00000398146.3	-	1	264	c.42G>A	c.(40-42)tcG>tcA	p.S14S	RGPD2_ENST00000420840.2_Intron|RGPD2_ENST00000327544.6_5'UTR			P0DJD1	RGPD2_HUMAN	RANBP2-like and GRIP domain containing 2	14					protein targeting to Golgi (GO:0000042)					breast(1)|pancreas(1)	2						AGCCCTGCACCGAGGCGAGGT	0.721																																						ENST00000398146.3	1.000000	6.000000e-01	1.000000	7.800000e-01	0.990000	0.919173	0.990000	1.000000																										0				2						c.(40-42)tcG>tcA		RANBP2-like and GRIP domain containing 2							19.0	33.0	29.0					2																	88125207		692	1590	2282	SO:0001819	synonymous_variant	729857	0	0					g.chr2:88125207C>T		CCDS42710.1, CCDS42710.2	2p11.2	2013-01-10			ENSG00000185304	ENSG00000185304		"""Tetratricopeptide (TTC) repeat domain containing"""	32415	protein-coding gene	gene with protein product		612705				15710750, 15815621	Standard	NM_001078170		Approved	RGP2, RANBP2L2		P0DJD1	OTTHUMG00000153276	ENST00000398146.3:c.42G>A	chr2.hg19:g.88125207C>T		0					RGPD2_ENST00000420840.2_Intron|RGPD2_ENST00000327544.6_5'UTR	p.S14S			1	2	3	2.159731	P0DJD1	RGPD2_HUMAN		1	264	-			P0C839|Q68DN6|Q6V1X0	Silent	SNP	ENST00000398146.3	0	1	hg19	c.42G>A	CCDS42710.2	1																																																																																								0.536146		TCGA-2L-AAQE-01A-11D-A397-08	0.721	RGPD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330534.2	0	0	0	2	2	2	2	0	0	0	0	11	0	11	0	1	1.810000	-13.483960	1	0.530000	NM_001078170		0	14	0	0	40	0	0					0	0	11	0	0	0	0	0	0	0	0	0	14	40
NCBP2	22916	broad.mit.edu	37	3	196664485	196664485	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr3:196664485G>A	ENST00000321256.5	-	3	388	c.295C>T	c.(295-297)Cgg>Tgg	p.R99W	NCBP2_ENST00000447325.1_Missense_Mutation_p.R29W|NCBP2_ENST00000452404.2_Missense_Mutation_p.R81W|NCBP2_ENST00000422610.1_Missense_Mutation_p.R29W|NCBP2_ENST00000427641.2_Missense_Mutation_p.R46W|NCBP2_ENST00000467803.1_5'UTR|NCBP2-AS1_ENST00000447775.1_RNA	NM_007362.3	NP_031388.2	P52298	NCBP2_HUMAN	nuclear cap binding protein subunit 2, 20kDa	99	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of RNA export from nucleus (GO:0046833)|positive regulation of viral transcription (GO:0050434)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|snRNA export from nucleus (GO:0006408)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mRNA cap binding complex (GO:0005845)|nuclear cap binding complex (GO:0005846)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|RNA cap binding (GO:0000339)	p.R99W(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.42e-24)|all cancers(36;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(49;4.13e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00551)		TTTATGTACCGCATGGCGTTT	0.488																																						ENST00000321256.5	1.000000	0	0.070000	2.000000e-02	0.030000	0.081679	0.030000	0.040000																										1	Substitution - Missense(1)	p.R99W(1)	lung(1)	5						c.(295-297)Cgg>Tgg		nuclear cap binding protein subunit 2, 20kDa							115.0	105.0	108.0					3																	196664485		2203	4300	6503	SO:0001583	missense	22916	0	0					g.chr3:196664485G>A	D59253	CCDS3323.1, CCDS46986.1	3q29	2013-02-12	2002-08-29		ENSG00000114503	ENSG00000114503		"""RNA binding motif (RRM) containing"""	7659	protein-coding gene	gene with protein product		605133	"""nuclear cap binding protein subunit 2, 20kD"""			7478990, 7651522, 8682299	Standard	NM_001042540		Approved	NIP1, CBP20, Cbc2	uc003fxd.1	P52298	OTTHUMG00000155520	ENST00000321256.5:c.295C>T	chr3.hg19:g.196664485G>A	ENSP00000326806:p.Arg99Trp	0					NCBP2_ENST00000447325.1_Missense_Mutation_p.R29W|NCBP2_ENST00000467803.1_5'UTR|NCBP2_ENST00000452404.2_Missense_Mutation_p.R81W|NCBP2_ENST00000427641.2_Missense_Mutation_p.R46W|NCBP2-AS1_ENST00000447775.1_RNA|NCBP2_ENST00000422610.1_Missense_Mutation_p.R29W	p.R99W	NM_007362.3	NP_031388.2	1	2	3	2.162847	P52298	NCBP2_HUMAN	Epithelial(36;3.42e-24)|all cancers(36;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(49;4.13e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	3	388	-	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		B2RE91|B4DMK7|E9PAR5|Q14924|Q2TS50	Missense_Mutation	SNP	ENST00000321256.5	0	1	hg19	c.295C>T	CCDS3323.1	0	.	.	.	.	.	.	.	.	.	.	G	17.74	3.462954	0.63513	.	.	ENSG00000114503	ENST00000447325;ENST00000321256;ENST00000427641;ENST00000452404;ENST00000422610;ENST00000411704	T;T;T;T;T;T	0.75260	-0.92;2.27;-0.92;2.27;-0.92;-0.92	4.96	2.05	0.26809	4.96	2.05	0.26809	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.057701	0.64402	D	0.000003	D	0.85248	0.5653	M	0.82823	2.61	0.80722	D	1	P;D;P	0.89917	0.716;1.0;0.844	B;D;B	0.80764	0.138;0.994;0.217	D	0.84961	0.0877	10	0.48119	T	0.1	.	13.3628	0.60665	0.0:0.0:0.4238:0.5762	.	81;46;99	P52298-2;E9PAR5;P52298	.;.;NCBP2_HUMAN	W	29;99;46;81;29;29	ENSP00000413518:R29W;ENSP00000326806:R99W;ENSP00000397619:R46W;ENSP00000412785:R81W;ENSP00000394105:R29W;ENSP00000389315:R29W	ENSP00000326806:R99W	R	-	1	2	2	NCBP2	198148882	198148882	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.449000	0.21744	0.323000	0.23307	-0.182000	0.12963	CGG	0.536146		TCGA-2L-AAQE-01A-11D-A397-08	0.488	NCBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340470.2	0	0	1	2	18	9	2	1	0	1	1	93	0	93	91	1	1.810000	-2.167731	0	0.530000	NM_007362		0	5	5	0	494	490	0		0	0		1	0	93	0	0	4.553594e-03	5.516925e-03	0	0	0	201	0	5	494
FBXL5	26234	broad.mit.edu	37	4	15628553	15628553	+	Missense_Mutation	SNP	G	G	T			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr4:15628553G>T	ENST00000341285.3	-	8	1191	c.1067C>A	c.(1066-1068)cCt>cAt	p.P356H	FBXL5_ENST00000382358.4_Missense_Mutation_p.P230H|FBXL5_ENST00000412094.2_Missense_Mutation_p.P339H	NM_001193534.1|NM_001193535.1|NM_012161.3	NP_001180463.1|NP_001180464.1|NP_036293.1	Q9UKA1	FBXL5_HUMAN	F-box and leucine-rich repeat protein 5	356					iron ion homeostasis (GO:0055072)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	iron ion binding (GO:0005506)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13						CTCCAGGTTAGGACAAAGCTC	0.328																																						ENST00000341285.3	0.160000	2.000000e-02	0.120000	4.000000e-02	0.070000	0.087206	0.070000	0.080000																										0				13						c.(1066-1068)cCt>cAt		F-box and leucine-rich repeat protein 5							51.0	49.0	50.0					4																	15628553		2203	4300	6503	SO:0001583	missense	26234	0	0					g.chr4:15628553G>T	AF174591	CCDS3415.1, CCDS54745.1	4p15.33	2011-06-09			ENSG00000118564	ENSG00000118564		"""F-boxes / Leucine-rich repeats"""	13602	protein-coding gene	gene with protein product		605655				10531035	Standard	NM_012161		Approved	FBL4, FBL5, FLR1	uc003goc.2	Q9UKA1	OTTHUMG00000097097	ENST00000341285.3:c.1067C>A	chr4.hg19:g.15628553G>T	ENSP00000344866:p.Pro356His	0					FBXL5_ENST00000412094.2_Missense_Mutation_p.P339H|FBXL5_ENST00000382358.4_Missense_Mutation_p.P230H	p.P356H	NM_001193534.1|NM_001193535.1|NM_012161.3	NP_001180463.1|NP_001180464.1|NP_036293.1	0	1	1	1.907445	Q9UKA1	FBXL5_HUMAN		8	1191	-			A8MSK4|B4DIB5|Q4W5A8|Q8NHP3|Q9NXN2|Q9P0I0|Q9P0X5|Q9UJT7|Q9UKC8	Missense_Mutation	SNP	ENST00000341285.3	0	1	hg19	c.1067C>A	CCDS3415.1	0	.	.	.	.	.	.	.	.	.	.	G	29.0	4.966766	0.92855	.	.	ENSG00000118564	ENST00000341285;ENST00000412094;ENST00000382358	T;T;T	0.19669	2.13;2.13;2.13	5.98	5.98	0.97165	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.49795	0.1578	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.43718	-0.9374	10	0.87932	D	0	-27.9909	20.0624	0.97681	0.0:0.0:1.0:0.0	.	339;356	Q9UKA1-2;Q9UKA1	.;FBXL5_HUMAN	H	356;339;230	ENSP00000344866:P356H;ENSP00000408679:P339H;ENSP00000371795:P230H	ENSP00000344866:P356H	P	-	2	0	0	FBXL5	15237651	15237651	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.230000	0.95299	2.838000	0.97847	0.591000	0.81541	CCT	0.474273		TCGA-2L-AAQE-01A-11D-A397-08	0.328	FBXL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214235.2	0	0	1	2	2	2	2	0	0	0	0	52	0	52	52	1	1.810000	-3.095176	1	0.530000			0	5	5	0	224	224	0		1	0		0	0	52	0	0	9.382227e-01	5.886872e-01	0	0	0	82	0	5	224
VDAC1	7416	broad.mit.edu	37	5	133316519	133316519	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08			G	A	G	G		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr5:133316519G>A	ENST00000265333.3	-	6	696	c.452C>T	c.(451-453)gCc>gTc	p.A151V	VDAC1_ENST00000395044.3_Missense_Mutation_p.A151V|VDAC1_ENST00000395047.2_Missense_Mutation_p.A151V	NM_003374.2	NP_003365.1	P21796	VDAC1_HUMAN	voltage-dependent anion channel 1	151					anion transport (GO:0006820)|apoptotic process (GO:0006915)|behavioral fear response (GO:0001662)|epithelial cell differentiation (GO:0030855)|learning (GO:0007612)|neuron-neuron synaptic transmission (GO:0007270)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pore complex (GO:0046930)	porin activity (GO:0015288)|protein kinase binding (GO:0019901)|voltage-gated anion channel activity (GO:0008308)			endometrium(1)|large_intestine(1)|lung(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)	CTGGTAGCCGGCCAGCCAGCC	0.527																																					NSCLC(127;1776 1806 35523 41489 48154)	ENST00000265333.3	1.000000	1.000000e-02	0.100000	3.000000e-02	0.060000	0.113003	0.060000	0.060000																										0				4						c.(451-453)gCc>gTc		voltage-dependent anion channel 1	Dihydroxyaluminium(DB01375)						52.0	55.0	54.0					5																	133316519		2203	4300	6503	SO:0001583	missense	7416	0	0					g.chr5:133316519G>A		CCDS4168.1	5q31	2011-11-15			ENSG00000213585	ENSG00000213585		"""Voltage-dependent anion channels"""	12669	protein-coding gene	gene with protein product		604492				7517385	Standard	NM_003374		Approved	MGC111064, PORIN	uc003kyr.2	P21796	OTTHUMG00000129118	ENST00000265333.3:c.452C>T	chr5.hg19:g.133316519G>A	ENSP00000265333:p.Ala151Val	0					VDAC1_ENST00000395044.3_Missense_Mutation_p.A151V|VDAC1_ENST00000395047.2_Missense_Mutation_p.A151V	p.A151V	NM_003374.2	NP_003365.1	1	2	3	2.173791	P21796	VDAC1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)	6	696	-			B3KVK4|D3DQ93|Q5FVE7|Q9UIQ5|Q9UPL0	Missense_Mutation	SNP	ENST00000265333.3	0	1	hg19	c.452C>T	CCDS4168.1	0	.	.	.	.	.	.	.	.	.	.	G	35	5.499741	0.96355	.	.	ENSG00000213585	ENST00000265333;ENST00000395044;ENST00000395047;ENST00000425992	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.27	5.27	0.74061	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.51770	0.1694	L	0.52573	1.65	0.80722	D	1	P	0.48089	0.905	P	0.51079	0.658	T	0.49476	-0.8936	10	0.48119	T	0.1	.	19.2582	0.93955	0.0:0.0:1.0:0.0	.	151	P21796	VDAC1_HUMAN	V	151	ENSP00000265333:A151V;ENSP00000378484:A151V;ENSP00000378487:A151V;ENSP00000390129:A151V	ENSP00000265333:A151V	A	-	2	0	0	VDAC1	133344418	133344418	1.000000	0.71417	0.978000	0.43139	0.973000	0.67179	7.885000	0.87282	2.622000	0.88805	0.655000	0.94253	GCC	0.537356		TCGA-2L-AAQE-01A-11D-A397-08	0.527	VDAC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259208.1	0	0	1	2	2	2	2	0	0	0	0	50	0	50	49	1	1.810000	-3.132440	1	0.530000			0	5	5	0	324	322	0		1	0		0	0	50	0	0	9.369998e-01	9.949625e-01	0	1	0	710	0	5	324
SPOCK1	6695	broad.mit.edu	37	5	136315143	136315143	+	Missense_Mutation	SNP	C	C	T	rs535025555		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr5:136315143C>T	ENST00000394945.1	-	10	1176	c.1007G>A	c.(1006-1008)cGg>cAg	p.R336Q	SPOCK1_ENST00000282223.7_Missense_Mutation_p.R336Q|SPOCK1_ENST00000509978.1_5'UTR	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	336	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTCATTACACCGAGGTATGAA	0.542													C|||	1	0.000199681	0.0	0.0	5008	,	,		20929	0.0		0.0	False		,,,				2504	0.001					ENST00000394945.1	1.000000	7.500000e-01	1.000000	8.500000e-01	0.950000	0.935591	0.950000	1.000000																										0				18						c.(1006-1008)cGg>cAg		sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1							91.0	84.0	87.0					5																	136315143		2203	4300	6503	SO:0001583	missense	6695	2	121412	30				g.chr5:136315143C>T	AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.1007G>A	chr5.hg19:g.136315143C>T	ENSP00000378401:p.Arg336Gln	0					SPOCK1_ENST00000509978.1_5'UTR|SPOCK1_ENST00000282223.7_Missense_Mutation_p.R336Q	p.R336Q	NM_004598.3	NP_004589.1	1	2	3	2.173791	Q08629	TICN1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	10	1176	-			B3KSW3|Q59EW0|Q8N630|Q9UCL8	Missense_Mutation	SNP	ENST00000394945.1	1	1	hg19	c.1007G>A	CCDS4191.1	1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.743313	0.49151	.	.	ENSG00000152377	ENST00000394945;ENST00000282223	T;T	0.61040	0.14;0.14	4.95	4.95	0.65309	4.95	4.95	0.65309	Thyroglobulin type-1 (6);	0.000000	0.85682	D	0.000000	T	0.48642	0.1511	N	0.02334	-0.595	0.51767	D	0.999933	D	0.89917	1.0	D	0.85130	0.997	T	0.51639	-0.8680	10	0.16896	T	0.51	.	12.3181	0.54969	0.169:0.831:0.0:0.0	.	336	Q08629	TICN1_HUMAN	Q	336	ENSP00000378401:R336Q;ENSP00000282223:R336Q	ENSP00000282223:R336Q	R	-	2	0	0	SPOCK1	136343042	136343042	0.998000	0.40836	0.996000	0.52242	0.927000	0.56198	3.885000	0.56182	2.277000	0.76020	0.650000	0.86243	CGG	0.537356		TCGA-2L-AAQE-01A-11D-A397-08	0.542	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251222.1	1	0	1	2	2	2	2	0	0	0	0	51	0	51	50	1	1.810000	-4.153474	1	0.530000	NM_004598		0	64	63	0	194	191	1		1	0		0	0	51	0	0	1	5.526920e-01	0	0	0	7	0	64	194
PCDHA7	56141	broad.mit.edu	37	5	140216036	140216036	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr5:140216036G>A	ENST00000525929.1	+	1	2068	c.2068G>A	c.(2068-2070)Gag>Aag	p.E690K	PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.E690K|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	690					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCAGGCCCAGAGACCGAGCT	0.637																																					NSCLC(160;258 2013 5070 22440 28951)	ENST00000525929.1	1.000000	3.300000e-01	0.510000	3.800000e-01	0.440000	0.471915	0.440000	0.440000																										0				63						c.(2068-2070)Gag>Aag		protocadherin alpha 7							111.0	98.0	102.0					5																	140216036		2203	4299	6502	SO:0001583	missense	56141	0	0					g.chr5:140216036G>A	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.2068G>A	chr5.hg19:g.140216036G>A	ENSP00000436426:p.Glu690Lys	0					PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.E690K|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron	p.E690K	NM_018910.2	NP_061733.1	1	2	3	2.173791	Q9UN72	PCDA7_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	1	2068	+			O75282	Missense_Mutation	SNP	ENST00000525929.1	1	1	hg19	c.2068G>A	CCDS54918.1	0	.	.	.	.	.	.	.	.	.	.	G	9.958	1.222045	0.22457	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.52754	0.65;0.66	3.57	1.55	0.23275	3.57	1.55	0.23275	.	3.216130	0.05786	U	0.609423	T	0.50188	0.1601	M	0.82132	2.575	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.15052	0.012;0.005	T	0.41822	-0.9487	10	0.33940	T	0.23	.	7.687	0.28546	0.0:0.2711:0.5139:0.215	.	690;690	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	K	690	ENSP00000436426:E690K;ENSP00000367365:E690K	ENSP00000367365:E690K	E	+	1	0	0	PCDHA7	140196220	140196220	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	0.072000	0.14617	0.812000	0.34326	-0.467000	0.05162	GAG	0.537356		TCGA-2L-AAQE-01A-11D-A397-08	0.637	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	1	0	1	2	2	2	2	0	0	0	0	76	0	76	74	1	1.810000	-19.689040	1	0.530000	NM_018910		0	54	53	0	416	411	1		1			0	0	76	0	0	1	0	0	0	0	0	0	54	416
UGT3A2	167127	broad.mit.edu	37	5	36049023	36049023	+	Missense_Mutation	SNP	A	A	T			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr5:36049023A>T	ENST00000282507.3	-	4	912	c.811T>A	c.(811-813)Ttg>Atg	p.L271M	UGT3A2_ENST00000504954.1_Intron|UGT3A2_ENST00000545528.1_Intron|UGT3A2_ENST00000513300.1_Missense_Mutation_p.L237M	NM_174914.3	NP_777574.2	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	271					cellular response to genistein (GO:0071412)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	43	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TTTTCCATCAAGCCTCCAACA	0.453																																						ENST00000282507.3	1.000000	3.500000e-01	0.580000	4.200000e-01	0.490000	0.519704	0.490000	0.490000																										0				43						c.(811-813)Ttg>Atg		UDP glycosyltransferase 3 family, polypeptide A2							118.0	114.0	115.0					5																	36049023		2203	4300	6503	SO:0001583	missense	167127	0	0					g.chr5:36049023A>T		CCDS3914.1, CCDS54842.1	5p13.2	2014-05-20			ENSG00000168671	ENSG00000168671		"""UDP glucuronosyltransferases"""	27266	protein-coding gene	gene with protein product						12975309	Standard	NM_174914		Approved		uc003jjz.2	Q3SY77	OTTHUMG00000131108	ENST00000282507.3:c.811T>A	chr5.hg19:g.36049023A>T	ENSP00000282507:p.Leu271Met	0					UGT3A2_ENST00000504954.1_Intron|UGT3A2_ENST00000513300.1_Missense_Mutation_p.L237M|UGT3A2_ENST00000545528.1_Intron	p.L271M	NM_174914.3	NP_777574.2	1	2	3	2.173791	Q3SY77	UD3A2_HUMAN	Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)	4	912	-	all_lung(31;0.000179)		B4DUQ7|E9PFK7|Q6UXC4|Q8NBP2	Missense_Mutation	SNP	ENST00000282507.3	1	1	hg19	c.811T>A	CCDS3914.1	0	.	.	.	.	.	.	.	.	.	.	A	16.16	3.044979	0.55110	.	.	ENSG00000168671	ENST00000282507;ENST00000513300	T;T	0.63580	-0.05;-0.05	3.45	0.914	0.19360	3.45	0.914	0.19360	.	0.107344	0.38492	N	0.001677	T	0.67050	0.2852	L	0.60067	1.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.987;0.994	T	0.64398	-0.6417	10	0.72032	D	0.01	.	1.5646	0.02602	0.5509:0.1761:0.1021:0.171	.	237;271	E9PFK7;Q3SY77	.;UD3A2_HUMAN	M	271;237	ENSP00000282507:L271M;ENSP00000427404:L237M	ENSP00000282507:L271M	L	-	1	2	2	UGT3A2	36084780	36084780	0.139000	0.22563	0.911000	0.35937	0.961000	0.63080	0.431000	0.21444	0.186000	0.20125	0.533000	0.62120	TTG	0.537356		TCGA-2L-AAQE-01A-11D-A397-08	0.453	UGT3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253771.2	1	0	1	2	2	2	2	0	0	0	0	70	0	70	70	1	1.810000	-17.383150	1	0.530000	NM_174914		0	40	40	0	274	270	1		1			0	0	70	0	0	1	0	0	0	0	0	0	40	274
POU4F3	5459	broad.mit.edu	37	5	145719822	145719822	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr5:145719822C>T	ENST00000230732.4	+	2	921	c.832C>T	c.(832-834)Cgc>Tgc	p.R278C	CTC-359M8.1_ENST00000515598.1_RNA	NM_002700.2	NP_002691.1	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	278					auditory receptor cell differentiation (GO:0042491)|axon extension (GO:0048675)|inner ear morphogenesis (GO:0042472)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAAGCGCAAACGCACGTCCAT	0.612																																						ENST00000230732.4	1.000000	6.100000e-01	0.900000	6.900000e-01	0.780000	0.798587	0.780000	0.780000																										0				17						c.(832-834)Cgc>Tgc		POU class 4 homeobox 3							54.0	53.0	53.0					5																	145719822		2203	4300	6503	SO:0001583	missense	5459	0	0					g.chr5:145719822C>T	U10060	CCDS4281.1	5q32	2011-06-20	2007-07-13		ENSG00000091010	ENSG00000091010		"""Homeoboxes / POU class"""	9220	protein-coding gene	gene with protein product		602460	"""POU domain class 4, transcription factor 3"""	DFNA15		9506947	Standard	NM_002700		Approved	BRN3C	uc003loa.2	Q15319	OTTHUMG00000129684	ENST00000230732.4:c.832C>T	chr5.hg19:g.145719822C>T	ENSP00000230732:p.Arg278Cys	0					CTC-359M8.1_ENST00000515598.1_RNA	p.R278C	NM_002700.2	NP_002691.1	1	2	3	2.173791	Q15319	PO4F3_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	2	921	+			O60557|Q2M3F8	Missense_Mutation	SNP	ENST00000230732.4	1	1	hg19	c.832C>T	CCDS4281.1	0	.	.	.	.	.	.	.	.	.	.	C	20.5	4.004800	0.74932	.	.	ENSG00000091010	ENST00000230732	D	0.99186	-5.53	4.62	4.62	0.57501	4.62	4.62	0.57501	Homeodomain-related (1);Homeobox (3);POU (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99638	0.9867	H	0.99130	4.44	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97244	0.9893	10	0.87932	D	0	.	16.3979	0.83621	0.0:1.0:0.0:0.0	.	278	Q15319	PO4F3_HUMAN	C	278	ENSP00000230732:R278C	ENSP00000230732:R278C	R	+	1	0	0	POU4F3	145700015	145700015	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.629000	0.83207	2.372000	0.80975	0.462000	0.41574	CGC	0.537356		TCGA-2L-AAQE-01A-11D-A397-08	0.612	POU4F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251887.2	1	0	1	2	17	2	2	1	0	1	1	55	0	55	55	1	1.810000	-20.000000	1	0.530000	NM_002700		0	56	55	0	218	218	1		1			1	0	55	0	0	9.999998e-01	0	0	0	0	0	0	56	218
BCLAF1	9774	broad.mit.edu	37	6	136599814	136599814	+	Nonsense_Mutation	SNP	G	G	A	rs201790829		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr6:136599814G>A	ENST00000531224.1	-	4	457	c.205C>T	c.(205-207)Cga>Tga	p.R69*	BCLAF1_ENST00000353331.4_Nonsense_Mutation_p.R67*|BCLAF1_ENST00000392348.2_Nonsense_Mutation_p.R67*|BCLAF1_ENST00000527759.1_Nonsense_Mutation_p.R67*|BCLAF1_ENST00000530767.1_Nonsense_Mutation_p.R69*|BCLAF1_ENST00000527536.1_Nonsense_Mutation_p.R69*	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	69					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CCATAAGGTCGTCTCATTCCT	0.433																																					Colon(142;1534 1789 5427 7063 28491)	ENST00000531224.1	0.420000	2.400000e-01	0.380000	2.800000e-01	0.320000	0.335053	0.320000	0.330000																										0				9						c.(205-207)Cga>Tga		BCL2-associated transcription factor 1																																				SO:0001587	stop_gained	9774	18	121406	38				g.chr6:136599814G>A	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.205C>T	chr6.hg19:g.136599814G>A	ENSP00000435210:p.Arg69*	1					BCLAF1_ENST00000527536.1_Nonsense_Mutation_p.R69*|BCLAF1_ENST00000353331.4_Nonsense_Mutation_p.R67*|BCLAF1_ENST00000527759.1_Nonsense_Mutation_p.R67*|BCLAF1_ENST00000530767.1_Nonsense_Mutation_p.R69*|BCLAF1_ENST00000392348.2_Nonsense_Mutation_p.R67*	p.R69*	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	0	1	1	1.603364	Q9NYF8	BCLF1_HUMAN		4	457	-	Colorectal(23;0.24)		A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Nonsense_Mutation	SNP	ENST00000531224.1	0	1	hg19	c.205C>T	CCDS5177.1	0	.	.	.	.	.	.	.	.	.	.	G	21.8	4.201669	0.79015	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	.	.	.	5.64	3.59	0.41128	5.64	3.59	0.41128	.	0.000000	0.52532	D	0.000064	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.5909	16.2474	0.82450	0.0:0.0:0.7701:0.2299	.	.	.	.	X	69;67;69;69;67;67;69	.	ENSP00000229446:R67X	R	-	1	2	2	BCLAF1	136641507	136641507	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.151000	0.58105	1.318000	0.45170	0.557000	0.71058	CGA	0.360544		TCGA-2L-AAQE-01A-11D-A397-08	0.433	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	1	0	1	2	2	2	2	0	0	0	0	123	0	123	120	1	1.810000	-17.769040	1	0.530000	NM_014739		0	45	39	0	332	329	0		1	0		0	0	123	0	0	1	8.155079e-01	0	0	0	25	0	45	332
ABRA	137735	broad.mit.edu	37	8	107782214	107782214	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr8:107782214G>A	ENST00000311955.3	-	1	259	c.205C>T	c.(205-207)Cct>Tct	p.P69S		NM_139166.4	NP_631905.1			actin-binding Rho activating protein											breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			TGTGAAGTAGGGGGTGTGATT	0.592																																						ENST00000311955.3	0.670000	3.900000e-01	0.590000	4.500000e-01	0.510000	0.526688	0.510000	0.510000																										0				27						c.(205-207)Cct>Tct		actin-binding Rho activating protein							103.0	102.0	102.0					8																	107782214		2203	4300	6503	SO:0001583	missense	137735	0	0					g.chr8:107782214G>A	AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.205C>T	chr8.hg19:g.107782214G>A	ENSP00000311436:p.Pro69Ser	1						p.P69S	NM_139166.4	NP_631905.1	1	2	3	2.648027			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)	1	259	-				Missense_Mutation	SNP	ENST00000311955.3	1	1	hg19	c.205C>T	CCDS6305.1	0	.	.	.	.	.	.	.	.	.	.	G	3.421	-0.118071	0.06838	.	.	ENSG00000174429	ENST00000311955	D	0.92446	-3.04	5.07	0.834	0.18880	5.07	0.834	0.18880	.	0.373311	0.30020	N	0.010608	D	0.82926	0.5143	N	0.25647	0.755	0.09310	N	1	B	0.26809	0.16	B	0.24701	0.055	T	0.66452	-0.5920	10	0.10902	T	0.67	.	10.6755	0.45783	0.0:0.3894:0.4775:0.1331	.	69	Q8N0Z2	ABRA_HUMAN	S	69	ENSP00000311436:P69S	ENSP00000311436:P69S	P	-	1	0	0	ABRA	107851390	107851390	0.103000	0.21917	0.000000	0.03702	0.001000	0.01503	0.268000	0.18571	0.341000	0.23771	0.655000	0.94253	CCT	0.626895		TCGA-2L-AAQE-01A-11D-A397-08	0.592	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	1	0	1	2	2	2	2	0	0	0	0	95	0	95	94	1	1.810000	-2.879461	1	0.530000	NM_139166		0	61	58	0	501	500	1		1			0	0	95	0	0	1	0	0	0	0	0	0	61	501
ANK1	286	broad.mit.edu	37	8	41572577	41572577	+	Silent	SNP	G	G	A			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr8:41572577G>A	ENST00000347528.4	-	15	1701	c.1618C>T	c.(1618-1620)Ctg>Ttg	p.L540L	ANK1_ENST00000289734.7_Silent_p.L540L|ANK1_ENST00000265709.8_Silent_p.L573L|ANK1_ENST00000396942.1_Silent_p.L540L|ANK1_ENST00000396945.1_Silent_p.L540L|ANK1_ENST00000352337.4_Silent_p.L540L|ANK1_ENST00000379758.2_Silent_p.L540L	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	540	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GCCACGTGCAGAGGGGTAAAT	0.622																																						ENST00000347528.4	1.000000	9.900000e-01	1.000000	9.900000e-01	0.990000	1.000000	0.990000	1.000000																										0				122						c.(1618-1620)Ctg>Ttg		ankyrin 1, erythrocytic							62.0	64.0	63.0					8																	41572577		2203	4300	6503	SO:0001819	synonymous_variant	286	0	0					g.chr8:41572577G>A	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.1618C>T	chr8.hg19:g.41572577G>A		1					ANK1_ENST00000396945.1_Silent_p.L540L|ANK1_ENST00000289734.7_Silent_p.L540L|ANK1_ENST00000396942.1_Silent_p.L540L|ANK1_ENST00000379758.2_Silent_p.L540L|ANK1_ENST00000352337.4_Silent_p.L540L|ANK1_ENST00000265709.8_Silent_p.L573L	p.L540L	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	1	4	5	3.201363	P16157	ANK1_HUMAN	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)	15	1701	-	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Silent	SNP	ENST00000347528.4	1	1	hg19	c.1618C>T	CCDS6119.1	1																																																																																								0.705560		TCGA-2L-AAQE-01A-11D-A397-08	0.622	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	1	0	1	2	2	2	2	0	0	0	0	54	0	54	53	1	1.810000	-20.000000	1	0.530000	NM_020475		0	191	189	0	180	178	1		1			0	0	54	0	0	1	0	0	0	0	0	0	191	180
COL22A1	169044	broad.mit.edu	37	8	139820045	139820045	+	Missense_Mutation	SNP	C	C	T	rs267601793		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr8:139820045C>T	ENST00000303045.6	-	10	1906	c.1460G>A	c.(1459-1461)gGa>gAa	p.G487E	COL22A1_ENST00000435777.1_Missense_Mutation_p.G487E	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	487	Collagen-like 1.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GCCAGCAACTCCCATTTCACC	0.443										HNSCC(7;0.00092)																												ENST00000303045.6	1.000000	2.500000e-01	1.000000	2.900000e-01	0.350000	0.499856	0.350000	0.340000																										0				211						c.(1459-1461)gGa>gAa		collagen, type XXII, alpha 1							112.0	116.0	115.0					8																	139820045		2203	4300	6503	SO:0001583	missense	169044	0	0					g.chr8:139820045C>T	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1460G>A	chr8.hg19:g.139820045C>T	ENSP00000303153:p.Gly487Glu	1	HNSCC(7;0.00092)				COL22A1_ENST00000435777.1_Missense_Mutation_p.G487E	p.G487E	NM_152888.1	NP_690848.1	1	3	4	2.724615	Q8NFW1	COMA1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0517)	10	1906	-	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	1	1	hg19	c.1460G>A	CCDS6376.1	0	.	.	.	.	.	.	.	.	.	.	C	14.78	2.636991	0.47049	.	.	ENSG00000169436	ENST00000303045;ENST00000435777	D;D	0.94184	-3.37;-3.37	4.61	4.61	0.57282	4.61	4.61	0.57282	.	0.000000	0.46758	U	0.000262	D	0.96537	0.8870	H	0.96833	3.89	0.38814	D	0.955498	D	0.60160	0.987	P	0.50352	0.638	D	0.98256	1.0496	9	.	.	.	.	13.7328	0.62799	0.0:1.0:0.0:0.0	.	487	Q8NFW1	COMA1_HUMAN	E	487	ENSP00000303153:G487E;ENSP00000387655:G487E	.	G	-	2	0	0	COL22A1	139889227	139889227	0.715000	0.27946	0.317000	0.25265	0.125000	0.20455	3.700000	0.54786	2.520000	0.84964	0.644000	0.83932	GGA	0.634582		TCGA-2L-AAQE-01A-11D-A397-08	0.443	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	1	0	1	2	2	2	2	0	0	0	0	115	0	115	115	1	1.810000	-9.797079	1	0.530000	XM_291257		0	50	50	0	673	667	0		1	0		0	0	115	0	0	1	3.890634e-01	0	1	0	18	0	50	673
ZNF189	7743	broad.mit.edu	37	9	104170526	104170526	+	Missense_Mutation	SNP	G	G	A	rs146668775		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr9:104170526G>A	ENST00000339664.2	+	3	605	c.476G>A	c.(475-477)cGc>cAc	p.R159H	ZNF189_ENST00000259395.4_Missense_Mutation_p.R117H|ZNF189_ENST00000374861.3_Missense_Mutation_p.R145H	NM_001278240.1	NP_001265169.1	O75820	ZN189_HUMAN	zinc finger protein 189	159					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				GGTTTTGTCCGCAAGGCCCAT	0.383													G|||	1	0.000199681	0.0	0.0	5008	,	,		21919	0.001		0.0	False		,,,				2504	0.0					ENST00000339664.2	0.130000	1.000000e-02	0.100000	3.000000e-02	0.060000	0.070354	0.060000	0.060000																										0				26						c.(475-477)cGc>cAc		zinc finger protein 189		G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	73.0	71.0	72.0		476,350	4.7	1.0	9	dbSNP_134	72	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	ZNF189	NM_003452.2,NM_197977.1	29,29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging	159/627,117/585	104170526	2,13004	2203	4300	6503	SO:0001583	missense	7743	6	121410	41				g.chr9:104170526G>A	AF025770	CCDS6754.1, CCDS6755.1, CCDS65096.1, CCDS75867.1	9q22-q31	2013-01-08			ENSG00000136870	ENSG00000136870		"""Zinc fingers, C2H2-type"", ""-"""	12980	protein-coding gene	gene with protein product		603132				9653648	Standard	NM_003452		Approved		uc004bbh.2	O75820	OTTHUMG00000020383	ENST00000339664.2:c.476G>A	chr9.hg19:g.104170526G>A	ENSP00000342019:p.Arg159His	1					ZNF189_ENST00000374861.3_Missense_Mutation_p.R145H|ZNF189_ENST00000259395.4_Missense_Mutation_p.R117H	p.R159H	NM_001278240.1	NP_001265169.1	0	1	1	1.895776	O75820	ZN189_HUMAN		3	605	+		Acute lymphoblastic leukemia(62;0.0559)	O75802|Q5T7D7|Q5T7D8|Q5T7D9|Q9UBL4|Q9UPE9|Q9UPF0|Q9UPF1	Missense_Mutation	SNP	ENST00000339664.2	0	1	hg19	c.476G>A	CCDS6754.1	0	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	3.003	-0.205670	0.06180	0.0	2.33E-4	ENSG00000136870	ENST00000374861;ENST00000339664;ENST00000259395	T;T;T	0.15718	2.4;2.4;2.4	4.66	4.66	0.58398	4.66	4.66	0.58398	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49916	D	0.000138	T	0.10809	0.0264	L	0.28776	0.89	0.32692	N	0.513987	B;B;B	0.26902	0.033;0.163;0.163	B;B;B	0.15870	0.003;0.014;0.003	T	0.09250	-1.0683	10	0.16896	T	0.51	.	10.5539	0.45105	0.0:0.0:0.8078:0.1922	.	144;145;159	B7ZLK9;Q5T7D8;O75820	.;.;ZN189_HUMAN	H	145;159;117	ENSP00000363995:R145H;ENSP00000342019:R159H;ENSP00000259395:R117H	ENSP00000259395:R117H	R	+	2	0	0	ZNF189	103210347	103210347	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	0.052000	0.14163	2.873000	0.98535	0.563000	0.77884	CGC	0.469556		TCGA-2L-AAQE-01A-11D-A397-08	0.383	ZNF189-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053447.1	0	0	1	2	2	2	2	0	0	0	0	77	0	77	76	1	1.810000	-2.314507	0	0.530000	NM_003452		0	5	5	0	277	277	0		1	0		0	0	77	0	0	9.380859e-01	2.013852e-02	0	0	0	10	0	5	277
SMC2	10592	broad.mit.edu	37	9	106864325	106864325	+	Silent	SNP	C	C	T			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr9:106864325C>T	ENST00000286398.7	+	8	1009	c.721C>T	c.(721-723)Ctg>Ttg	p.L241L	SMC2_ENST00000374793.3_Silent_p.L241L|SMC2_ENST00000303219.8_Silent_p.L241L|SMC2_ENST00000374787.3_Silent_p.L241L	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	241					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						TCAGTTTTTGCTGGCTGAAGA	0.333																																						ENST00000286398.7	0.100000	1.000000e-02	0.070000	2.000000e-02	0.040000	0.053677	0.040000	0.050000																										0				48						c.(721-723)Ctg>Ttg		structural maintenance of chromosomes 2							93.0	103.0	100.0					9																	106864325		2203	4297	6500	SO:0001819	synonymous_variant	10592	0	0					g.chr9:106864325C>T	AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.721C>T	chr9.hg19:g.106864325C>T		1					SMC2_ENST00000303219.8_Silent_p.L241L|SMC2_ENST00000374793.3_Silent_p.L241L|SMC2_ENST00000374787.3_Silent_p.L241L	p.L241L	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	0	1	1	1.895776	O95347	SMC2_HUMAN		8	1009	+			Q6IEE0|Q9P1P2	Silent	SNP	ENST00000286398.7	0	1	hg19	c.721C>T	CCDS35086.1	0																																																																																								0.469556		TCGA-2L-AAQE-01A-11D-A397-08	0.333	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053470.1	0	0	1	2	14	2	2	1	0	1	1	115	0	115	115	1	1.810000	-2.129470	0	0.530000			0	6	6	0	427	425	0		0	0		1	0	115	0	0	5.381804e-02	5.789190e-03	0	0	0	7	0	6	427
CDKN2A	1029	broad.mit.edu	37	9	21971111	21971111	+	Missense_Mutation	SNP	G	G	A	rs121913385		TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr9:21971111G>A	ENST00000304494.5	-	2	517	c.247C>T	c.(247-249)Cac>Tac	p.H83Y	CDKN2A_ENST00000494262.1_Missense_Mutation_p.H32Y|CDKN2A_ENST00000530628.2_Missense_Mutation_p.A97V|CDKN2A_ENST00000498628.2_Missense_Mutation_p.H32Y|CDKN2A_ENST00000497750.1_Missense_Mutation_p.H32Y|CDKN2A_ENST00000578845.2_Missense_Mutation_p.H32Y|CDKN2A_ENST00000446177.1_Missense_Mutation_p.H83Y|CDKN2A_ENST00000579755.1_Missense_Mutation_p.A97V|CDKN2A_ENST00000361570.3_Missense_Mutation_p.A138V|CDKN2A_ENST00000498124.1_Missense_Mutation_p.H83Y|CDKN2A_ENST00000479692.2_Missense_Mutation_p.H32Y|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000579122.1_Missense_Mutation_p.H83Y	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	83			H -> N (in a lung tumor).|H -> Q (in dbSNP:rs34968276).|H -> Y (in a pancreas and a head and neck tumor).		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.H83Y(30)|p.A138V(2)|p.H83fs*2(2)|p.H83N(1)|p.V82fs*62(1)|p.0(1)|p.V82_G89>G(1)|p.E61_L94del(1)|p.R137fs*48(1)|p.A68fs*3(1)|p.P81_A85del(1)|p.R80fs*34(1)|p.V82_E88del(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GCAGCGTCGTGCACGGGTCGG	0.741	H83Y(CALU3_LUNG)|H83Y(HS944T_SKIN)|H83Y(JHH2_LIVER)|H83Y(OPM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|H83Y(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																												ENST00000304494.5	0.600000	3.200000e-01	0.570000	4.100000e-01	0.490000	0.495243	0.490000	0.550000	H83Y(CALU3_LUNG)|H83Y(HS944T_SKIN)|H83Y(JHH2_LIVER)|H83Y(OPM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|H83Y(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	17																								1403	Whole gene deletion(1316)|Unknown(44)|Substitution - Missense(33)|Deletion - Frameshift(6)|Deletion - In frame(3)|Complex - deletion inframe(1)	p.0?(1315)|p.?(44)|p.H83Y(30)|p.A138V(2)|p.H83fs*2(2)|p.H83N(1)|p.V82fs*62(1)|p.0(1)|p.V82_G89>G(1)|p.E61_L94del(1)|p.R137fs*48(1)|p.A68fs*3(1)|p.P81_A85del(1)|p.R80fs*34(1)|p.V82_E88del(1)	haematopoietic_and_lymphoid_tissue(284)|skin(175)|central_nervous_system(171)|lung(154)|urinary_tract(93)|bone(74)|oesophagus(59)|soft_tissue(58)|upper_aerodigestive_tract(56)|pleura(51)|ovary(36)|pancreas(34)|breast(33)|kidney(32)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(9)|liver(7)|meninges(7)|large_intestine(6)|salivary_gland(5)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	4199	GRCh37	CM053801|CM056557	CDKN2A	M	rs121913385	c.(247-249)Cac>Tac		cyclin-dependent kinase inhibitor 2A							12.0	15.0	14.0					9																	21971111		2176	4259	6435	SO:0001583	missense	1029	0	0					g.chr9:21971111G>A	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.247C>T	chr9.hg19:g.21971111G>A	ENSP00000307101:p.His83Tyr	1	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)				CDKN2A_ENST00000530628.2_Missense_Mutation_p.A97V|CDKN2A_ENST00000498124.1_Missense_Mutation_p.H83Y|CDKN2A_ENST00000579755.1_Missense_Mutation_p.A97V|CDKN2A_ENST00000494262.1_Missense_Mutation_p.H32Y|CDKN2A_ENST00000497750.1_Missense_Mutation_p.H32Y|CDKN2A_ENST00000578845.2_Missense_Mutation_p.H32Y|CDKN2A_ENST00000446177.1_Missense_Mutation_p.H83Y|CDKN2A_ENST00000361570.3_Missense_Mutation_p.A138V|CDKN2A_ENST00000498628.2_Missense_Mutation_p.H32Y|CDKN2A_ENST00000579122.1_Missense_Mutation_p.H83Y|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000479692.2_Missense_Mutation_p.H32Y	p.H83Y	NM_000077.4	NP_000068.1	0	0	0	1.326982	P42771	CD2A1_HUMAN		2	517	-		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	ENST00000304494.5	1	1	hg19	c.247C>T	CCDS6510.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.7|26.7	4.762523|4.762523	0.89932|0.89932	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000361570;ENST00000530628|ENST00000304494;ENST00000446177	T;T|T;T	0.80393|0.71222	-1.37;-1.31|-0.55;-0.55	5.93|5.93	5.93|5.93	0.95920|0.95920	5.93|5.93	5.93|5.93	0.95920|0.95920	.|Ankyrin repeat-containing domain (4);	0.000000|.	0.37261|.	N|.	0.002164|.	T|T	0.77579|0.77579	0.4151|0.4151	L|L	0.27053|0.27053	0.805|0.805	0.46521|0.46521	D|D	0.999085|0.999085	P|D	0.47191|0.76494	0.891|0.999	B|D	0.44044|0.75484	0.439|0.986	T|T	0.79024|0.79024	-0.1972|-0.1972	10|9	0.62326|0.66056	D|D	0.03|0.02	-15.192|-15.192	19.1026|19.1026	0.93279|0.93279	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	138|83	Q8N726|P42771	CD2A2_HUMAN|CD2A1_HUMAN	V|Y	138;97|83	ENSP00000355153:A138V;ENSP00000432664:A97V|ENSP00000307101:H83Y;ENSP00000394932:H83Y	ENSP00000355153:A138V|ENSP00000307101:H83Y	A|H	-|-	2|1	0|0	0|0	CDKN2A|CDKN2A	21961111|21961111	21961111|21961111	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.915000|0.915000	0.54546|0.54546	8.665000|8.665000	0.91144|0.91144	2.803000|2.803000	0.96430|0.96430	0.650000|0.650000	0.86243|0.86243	GCA|CAC	0.252782		TCGA-2L-AAQE-01A-11D-A397-08	0.741	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	1	0	1	2	2	2	2	0	0	0	0	23	0	23	18	1	1.810000	-20.000000	1	0.530000	NM_000077		0	16	14	0	51	43	0		1	1	1	0	0	23	111	0	9.998878e-01	1	9.999996e-01	351	28	2	76	16	51
GTF3C5	9328	broad.mit.edu	37	9	135917536	135917536	+	Silent	SNP	C	C	T			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chr9:135917536C>T	ENST00000372097.5	+	2	539	c.216C>T	c.(214-216)caC>caT	p.H72H	GTF3C5_ENST00000372095.5_Intron|GTF3C5_ENST00000372108.5_Silent_p.H72H|GTF3C5_ENST00000372099.6_Silent_p.H63H|GTF3C5_ENST00000485692.1_Intron|GTF3C5_ENST00000342018.8_Silent_p.H72H	NM_012087.3	NP_036219.2	Q9Y5Q8	TF3C5_HUMAN	general transcription factor IIIC, polypeptide 5, 63kDa	72					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;4.01e-06)|Epithelial(140;4e-05)		CATACTGCCACCCAGTGTGCG	0.612																																						ENST00000372097.5	0.640000	3.800000e-01	0.580000	4.400000e-01	0.500000	0.512738	0.500000	0.510000																										0				21						c.(214-216)caC>caT		general transcription factor IIIC, polypeptide 5, 63kDa							73.0	72.0	72.0					9																	135917536		2203	4300	6503	SO:0001819	synonymous_variant	9328	0	0					g.chr9:135917536C>T	AF133124	CCDS6958.1, CCDS48050.1, CCDS75927.1	9q34.13	2010-03-23	2002-08-29		ENSG00000148308	ENSG00000148308		"""General transcription factors"""	4668	protein-coding gene	gene with protein product	"""transcription factor IIIC, 63 kD"""	604890	"""general transcription factor IIIC, polypeptide 5 (63kD)"""			10373544	Standard	NM_012087		Approved	TFiiiC2-63, TFIIIC63, TFIIICepsilon	uc004ccj.4	Q9Y5Q8	OTTHUMG00000020856	ENST00000372097.5:c.216C>T	chr9.hg19:g.135917536C>T		0					GTF3C5_ENST00000372108.5_Silent_p.H72H|GTF3C5_ENST00000372099.6_Silent_p.H63H|GTF3C5_ENST00000372095.5_Intron|GTF3C5_ENST00000485692.1_Intron|GTF3C5_ENST00000342018.8_Silent_p.H72H	p.H72H	NM_012087.3	NP_036219.2	0	1	1	1.908518	Q9Y5Q8	TF3C5_HUMAN		2	539	+			A6NI44|A6NJB9|Q5T7U2|Q5T7U3|Q8N2U7|Q8N857|Q96GD9|Q9H4P2	Silent	SNP	ENST00000372097.5	1	1	hg19	c.216C>T	CCDS6958.1	0																																																																																								0.472710		TCGA-2L-AAQE-01A-11D-A397-08	0.612	GTF3C5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054826.1	1	0	1	2	2	2	2	0	0	0	0	90	0	90	88	1	1.810000	-20.000000	1	0.530000	NM_001122823		0	51	50	0	287	286	0		1	1		0	0	90	0	0	1	9.997530e-01	0	25	0	47	0	51	287
MAGEB2	4113	broad.mit.edu	37	X	30237553	30237553	+	Missense_Mutation	SNP	A	A	T			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chrX:30237553A>T	ENST00000378988.4	+	2	957	c.856A>T	c.(856-858)Atg>Ttg	p.M286L		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	286	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						AACCAGCAAGATGAAAGTCCT	0.507																																						ENST00000378988.4	0.580000	2.600000e-01	0.500000	3.300000e-01	0.410000	0.421942	0.410000	0.410000																										0				23						c.(856-858)Atg>Ttg		melanoma antigen family B, 2							48.0	48.0	48.0					X																	30237553		2202	4299	6501	SO:0001583	missense	4113	2	121402	31				g.chrX:30237553A>T	AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.856A>T	chrX.hg19:g.30237553A>T	ENSP00000368273:p.Met286Leu							p.M286L	NM_002364.4	NP_002355.2	0	1	1		O15479	MAGB2_HUMAN		2	957	+			O75860	Missense_Mutation	SNP	ENST00000378988.4	1	1	hg19	c.856A>T	CCDS14219.1	0	.	.	.	.	.	.	.	.	.	.	A	19.14	3.768852	0.69878	.	.	ENSG00000099399	ENST00000378988	T	0.05025	3.51	3.27	-0.453	0.12201	3.27	-0.453	0.12201	.	0.242459	0.43579	D	0.000556	T	0.11922	0.0290	M	0.80183	2.485	0.09310	N	1	P	0.35982	0.531	P	0.44422	0.449	T	0.09796	-1.0658	10	0.66056	D	0.02	.	5.7074	0.17915	0.5317:0.0:0.4683:0.0	.	286	O15479	MAGB2_HUMAN	L	286	ENSP00000368273:M286L	ENSP00000368273:M286L	M	+	1	0	0	MAGEB2	30147474	30147474	0.001000	0.12720	0.000000	0.03702	0.922000	0.55478	0.354000	0.20146	-0.185000	0.10550	0.356000	0.21956	ATG	0.530000		TCGA-2L-AAQE-01A-11D-A397-08	0.507	MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056157.1	1	0	1	2	2	2	2	0	0	0	0	19	0	19	19	1	1.810000	-15.736300	1	0.530000	NM_002364		0	20	20	0	71	71	1		1			0	0	19	0	0	9.999981e-01	0	0	0	0	0	0	20	71
MAGEE2	139599	broad.mit.edu	37	X	75004114	75004114	+	Missense_Mutation	SNP	T	T	C			TCGA-2L-AAQE-01A-11D-A397-08	TCGA-2L-AAQE-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d57069ad-4f07-4f3d-93a2-16b0c4a51325	43d83c90-8211-4c2a-92c4-eee9c092680e	g.chrX:75004114T>C	ENST00000373359.2	-	1	965	c.773A>G	c.(772-774)cAc>cGc	p.H258R		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	258	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.									autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GATTTCCCTGTGGGCTCTAGA	0.498																																						ENST00000373359.2	0.520000	3.100000e-01	0.470000	3.600000e-01	0.410000	0.419483	0.410000	0.410000																										0				34						c.(772-774)cAc>cGc		melanoma antigen family E, 2							60.0	59.0	59.0					X																	75004114		2203	4300	6503	SO:0001583	missense	139599	0	0					g.chrX:75004114T>C	AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.773A>G	chrX.hg19:g.75004114T>C	ENSP00000362457:p.His258Arg							p.H258R	NM_138703.4	NP_619648.1	0	1	1		Q8TD90	MAGE2_HUMAN		1	965	-			Q5JSI5	Missense_Mutation	SNP	ENST00000373359.2	1	1	hg19	c.773A>G	CCDS14431.1	0	.	.	.	.	.	.	.	.	.	.	T	8.525	0.869554	0.17322	.	.	ENSG00000186675	ENST00000373359	T	0.04654	3.58	3.1	0.589	0.17452	3.1	0.589	0.17452	.	.	.	.	.	T	0.05227	0.0139	L	0.60455	1.87	0.09310	N	1	B	0.25850	0.136	B	0.27262	0.078	T	0.41716	-0.9493	9	0.33940	T	0.23	.	2.0976	0.03672	0.2592:0.1513:0.0:0.5895	.	258	Q8TD90	MAGE2_HUMAN	R	258	ENSP00000362457:H258R	ENSP00000362457:H258R	H	-	2	0	0	MAGEE2	74920839	74920839	0.685000	0.27652	0.009000	0.14445	0.688000	0.40055	0.561000	0.23515	0.015000	0.14971	0.345000	0.21793	CAC	0.530000		TCGA-2L-AAQE-01A-11D-A397-08	0.498	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057288.1	1	0	1	2	2	2	2	0	0	0	0	53	0	53	53	1	1.810000	-20.000000	1	0.530000	NM_138703		0	49	49	0	173	172	1		1			0	0	53	0	0	1	0	0	0	0	0	0	49	173
