#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCF_CI95_high	i_CCF_CI95_low	i_CCF_CI_high	i_CCF_CI_low	i_CCF_hat	i_CCF_mean	i_CCF_median	i_CCF_mode	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_CancerGermlineMut	i_CGC_CancerMolecularGenetics	i_CGC_CancerSomaticMut	i_CGC_CancerSyndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_ChrBand	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_OtherGermlineMut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_TissueType	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_ExAC_AC	i_ExAC_AN	i_ExAC_LQ	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IS_SCNA	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SCNA_NA	i_SCNA_NB	i_SCNA_q_hat	i_SCNA_tau	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_bcgsc	i_broad	i_build	i_cDNA_Change	i_ccds_id	i_clonal	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_GERP_NR	i_dbNSFP_GERP_RS	i_dbNSFP_GERP_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_folddegenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_hg18_pos1coor	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dna_fraction_in_tumor	i_entrez_gene_id	i_external_id_capture	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_hgsc	i_igv_bad	i_localAssembly_detected	i_min_val_count_KRAS	i_min_val_count_localAssembly	i_min_val_count_rna	i_min_val_count_targeted	i_n_alt_count	i_n_alt_count_KRAS	i_n_alt_count_full	i_n_alt_count_localAssembly	i_n_ref_count	i_n_ref_count_KRAS	i_n_ref_count_full	i_n_ref_count_localAssembly	i_passExAC	i_ploidy	i_pon_loglike	i_pon_pass_loglike	i_purity	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_KRAS	i_t_alt_count_full	i_t_alt_count_localAssembly	i_t_ref_count_KRAS	i_t_ref_count_full	i_t_ref_count_localAssembly	i_ucsc	i_validation_judgement_KRAS	i_validation_judgement_localAssembly	i_validation_judgement_rna	i_validation_judgement_targeted	i_validation_normal_alt_count_rna	i_validation_normal_alt_count_targeted	i_validation_normal_ref_count_rna	i_validation_normal_ref_count_targeted	i_validation_power_KRAS	i_validation_power_localAssembly	i_validation_power_rna	i_validation_power_targeted	i_validation_tumor_alt_count_rna	i_validation_tumor_alt_count_targeted	i_validation_tumor_ref_count_rna	i_validation_tumor_ref_count_targeted	t_alt_count	t_ref_count
CNGA4	1262	broad.mit.edu	37	11	6261751	6261751	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr11:6261751G>A	ENST00000379936.2	+	4	842	c.727G>A	c.(727-729)Gag>Aag	p.E243K	CNGA4_ENST00000533426.1_Intron	NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	243					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.E243K(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGGGAAGAAGAGTACCTCTT	0.552																																						ENST00000379936.2	1.000000	7.500000e-01	1.000000	0.850000	0.970000	0.944158	0.970000	1.000000																										1	Substitution - Missense(1)	p.E243K(1)	large_intestine(1)	40						c.(727-729)Gag>Aag		cyclic nucleotide gated channel alpha 4							77.0	72.0	74.0					11																	6261751		2201	4296	6497	SO:0001583	missense	1262	0	0					g.chr11:6261751G>A	AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		ENST00000379936.2:c.727G>A	chr11.hg19:g.6261751G>A	ENSP00000369268:p.Glu243Lys	0					CNGA4_ENST00000533426.1_Intron	p.E243K	NM_001037329.3	NP_001032406.1	1	2	3	2.082394	Q8IV77	CNGA4_HUMAN		4	842	+		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Missense_Mutation	SNP	ENST00000379936.2	1	1	hg19	c.727G>A	CCDS31408.1	1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.133543	0.77662	.	.	ENSG00000132259	ENST00000379936	D	0.97731	-4.51	5.3	5.3	0.74995	5.3	5.3	0.74995	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99281	0.9749	H	0.98005	4.125	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.77557	0.99;0.982	D	0.98722	1.0709	10	0.87932	D	0	.	17.8807	0.88840	0.0:0.0:1.0:0.0	.	243;203	Q8IV77;Q8IV77-2	CNGA4_HUMAN;.	K	243	ENSP00000369268:E243K	ENSP00000369268:E243K	E	+	1	0	0	CNGA4	6218327	6218327	1.000000	0.71417	1.000000	0.80357	0.186000	0.23388	9.420000	0.97426	2.640000	0.89533	0.561000	0.74099	GAG	0.296124		TCGA-2L-AAQI-01A-12D-A397-08	0.552	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383765.2	1	0	1	2	2	2	2	0	0	0	0	76	0	76	76	1	1.810000	-3.222344	1	0.290000	NM_001037329		0	56	54	0	344	341	1		1			0	0	76	0	0	1.000000	0	0	0	0	0	0	56	344
MRPL16	54948	broad.mit.edu	37	11	59573897	59573897	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr11:59573897G>A	ENST00000300151.4	-	4	892	c.679C>T	c.(679-681)Cgg>Tgg	p.R227W		NM_017840.3	NP_060310.1	Q9NX20	RM16_HUMAN	mitochondrial ribosomal protein L16	227					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(1)|liver(1)|lung(8)	11						AGTACTTTCCGTATGCCCAGC	0.468																																						ENST00000300151.4	1.000000	1.000000e-02	0.100000	0.030000	0.050000	0.107439	0.050000	0.060000																										0				11						c.(679-681)Cgg>Tgg		mitochondrial ribosomal protein L16							251.0	232.0	239.0					11																	59573897		2201	4295	6496	SO:0001583	missense	54948	4	121412	42				g.chr11:59573897G>A	AF183428	CCDS7976.1	11q12.1	2012-09-13			ENSG00000166902	ENSG00000166902		"""Mitochondrial ribosomal proteins / large subunits"""	14476	protein-coding gene	gene with protein product		611829					Standard	NM_017840		Approved	FLJ20484, PNAS-111	uc001noh.2	Q9NX20	OTTHUMG00000167410	ENST00000300151.4:c.679C>T	chr11.hg19:g.59573897G>A	ENSP00000300151:p.Arg227Trp	0						p.R227W	NM_017840.3	NP_060310.1	1	2	3	2.082394	Q9NX20	RM16_HUMAN		4	892	-			Q9BYD0|Q9HB70	Missense_Mutation	SNP	ENST00000300151.4	0	1	hg19	c.679C>T	CCDS7976.1	0	.	.	.	.	.	.	.	.	.	.	G	19.63	3.863130	0.71949	.	.	ENSG00000166902	ENST00000300151	T	0.25912	1.77	6.07	4.02	0.46733	6.07	4.02	0.46733	.	0.045846	0.85682	D	0.000000	T	0.47637	0.1456	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.50676	-0.8800	10	0.87932	D	0	-22.0244	10.3068	0.43685	0.0:0.1084:0.6643:0.2273	.	227	Q9NX20	RM16_HUMAN	W	227	ENSP00000300151:R227W	ENSP00000300151:R227W	R	-	1	2	2	MRPL16	59330473	59330473	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.383000	0.52471	1.562000	0.49601	0.655000	0.94253	CGG	0.296124		TCGA-2L-AAQI-01A-12D-A397-08	0.468	MRPL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394521.1	0	0	1	2	2	2	2	0	0	0	0	138	0	138	138	1	1.810000	-2.207349	0	0.290000	NM_017840		0	5	6	0	648	645	0		1	0		0	0	138	0	0	0.937248	4.002915e-01	0	0	0	155	0	5	648
DIXDC1	85458	broad.mit.edu	37	11	111853203	111853203	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr11:111853203G>A	ENST00000440460.2	+	8	1204	c.907G>A	c.(907-909)Gga>Aga	p.G303R	DIXDC1_ENST00000315253.5_Missense_Mutation_p.G92R|DIXDC1_ENST00000389821.4_3'UTR	NM_001037954.2	NP_001033043.1	Q155Q3	DIXC1_HUMAN	DIX domain containing 1	304					camera-type eye development (GO:0043010)|cell cycle (GO:0007049)|cerebellar cortex development (GO:0021695)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain development (GO:0030900)|forebrain ventricular zone progenitor cell division (GO:0021869)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of axonogenesis (GO:0050772)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JNK cascade (GO:0046330)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of JNK cascade (GO:0046328)|regulation of microtubule cytoskeleton organization (GO:0070507)|Wnt signaling pathway (GO:0016055)	axon terminus (GO:0043679)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytosol (GO:0005829)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	gamma-tubulin binding (GO:0043015)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)			cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	17		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)		AATGATATCAGGACTACAGGT	0.368																																						ENST00000440460.2	1.000000	2.400000e-01	0.830000	0.380000	0.570000	0.602160	0.570000	1.000000																										0				17						c.(907-909)Gga>Aga		DIX domain containing 1							69.0	68.0	69.0					11																	111853203		1850	4087	5937	SO:0001583	missense	85458	0	0					g.chr11:111853203G>A	AB051522	CCDS60957.1, CCDS73381.1, CCDS73382.1	11q23.1	2014-03-20			ENSG00000150764	ENSG00000150764			23695	protein-coding gene	gene with protein product		610493				12792787	Standard	NM_001037954		Approved	KIAA1735, Dixin	uc001pmm.3	Q155Q3	OTTHUMG00000166912	ENST00000440460.2:c.907G>A	chr11.hg19:g.111853203G>A	ENSP00000394352:p.Gly303Arg	0					DIXDC1_ENST00000315253.5_Missense_Mutation_p.G92R|DIXDC1_ENST00000389821.4_3'UTR	p.G303R	NM_001037954.2	NP_001033043.1	1	2	3	2.070542	Q155Q3	DIXC1_HUMAN		8	1204	+		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)	A1A5D8|E9PRV4|Q6P2J8|Q6PIK4|Q86SR7|Q8IVY4|Q96N69|Q9C0C8	Missense_Mutation	SNP	ENST00000440460.2	0	1	hg19	c.907G>A		0	.	.	.	.	.	.	.	.	.	.	G	18.01	3.528320	0.64860	.	.	ENSG00000150764	ENST00000440460;ENST00000315253	T;T	0.19806	2.12;2.12	6.16	6.16	0.99307	6.16	6.16	0.99307	.	0.354131	0.36519	N	0.002544	T	0.43612	0.1255	.	.	.	0.54753	D	0.999988	B;D	0.89917	0.05;1.0	B;D	0.76575	0.048;0.988	T	0.01858	-1.1259	9	0.19590	T	0.45	-10.0595	19.4236	0.94732	0.0:0.0:1.0:0.0	.	92;304	E7EQ17;Q155Q3	.;DIXC1_HUMAN	R	303;92	ENSP00000394352:G303R;ENSP00000314068:G92R	ENSP00000314068:G92R	G	+	1	0	0	DIXDC1	111358413	111358413	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.817000	0.62650	2.937000	0.99478	0.650000	0.86243	GGA	0.294094		TCGA-2L-AAQI-01A-12D-A397-08	0.368	DIXDC1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		0	0	1	2	2	2	2	0	0	0	0	21	0	21	21	1	1.810000	-10.626720	1	0.290000	NM_001037954		0	6	6	0	71	71	0		1	1		0	0	21	0	0	0.967009	1.918343e-01	0	2	0	7	0	6	71
NCOR2	9612	broad.mit.edu	37	12	124816902	124816902	+	Missense_Mutation	SNP	C	C	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr12:124816902C>A	ENST00000405201.1	-	43	6867	c.6867G>T	c.(6865-6867)aaG>aaT	p.K2289N	NCOR2_ENST00000397355.1_Missense_Mutation_p.K2280N|NCOR2_ENST00000404621.1_Missense_Mutation_p.K2279N|NCOR2_ENST00000429285.2_Missense_Mutation_p.K2279N|NCOR2_ENST00000356219.3_Missense_Mutation_p.K2296N|NCOR2_ENST00000404121.2_Missense_Mutation_p.K1850N			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	2300					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TGTTCAGCTTCTTGTTGATCT	0.607											OREG0022237	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000405201.1	0.180000	2.000000e-02	0.130000	0.050000	0.080000	0.095104	0.080000	0.080000																										0				69						c.(6865-6867)aaG>aaT		nuclear receptor corepressor 2							164.0	164.0	164.0					12																	124816902		2056	4183	6239	SO:0001583	missense	9612	0	0					g.chr12:124816902C>A	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.6867G>T	chr12.hg19:g.124816902C>A	ENSP00000384018:p.Lys2289Asn	1		OREG0022237	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1537	NCOR2_ENST00000356219.3_Missense_Mutation_p.K2296N|NCOR2_ENST00000429285.2_Missense_Mutation_p.K2279N|NCOR2_ENST00000404621.1_Missense_Mutation_p.K2279N|NCOR2_ENST00000397355.1_Missense_Mutation_p.K2280N|NCOR2_ENST00000404121.2_Missense_Mutation_p.K1850N	p.K2289N			0	1	1	1.801923	Q9Y618	NCOR2_HUMAN		43	6867	-	all_neural(191;0.0804)|Medulloblastoma(191;0.163)		O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	ENST00000405201.1	0	1	hg19	c.6867G>T	CCDS41858.2	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.73|14.73	2.623667|2.623667	0.46840|0.46840	.|.	.|.	ENSG00000196498|ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000447675;ENST00000429285|ENST00000443451;ENST00000440337	T;T;T;T;T;T|.	0.26810|.	1.71;1.99;1.72;1.99;1.73;1.98|.	4.4|4.4	4.4|4.4	0.53042|0.53042	4.4|4.4	4.4|4.4	0.53042|0.53042	.|.	0.056456|.	0.64402|.	D|.	0.000001|.	T|T	0.63792|0.63792	0.2541|0.2541	M|M	0.64997|0.64997	1.995|1.995	0.47584|0.47584	D|D	0.999463|0.999463	D;D;D|.	0.76494|.	0.999;0.995;0.991|.	D;D;D|.	0.80764|.	0.994;0.98;0.979|.	T|T	0.63292|0.63292	-0.6670|-0.6670	10|5	0.87932|.	D|.	0|.	-35.1737|-35.1737	10.6433|10.6433	0.45604|0.45604	0.0:0.9104:0.0:0.0896|0.0:0.9104:0.0:0.0896	.|.	2280;2289;2300|.	C9J239;C9JFD3;Q9Y618|.	.;.;NCOR2_HUMAN|.	N|I	2289;2279;2296;2280;2288;1850;381;2279|161;80	ENSP00000384018:K2289N;ENSP00000384202:K2279N;ENSP00000348551:K2296N;ENSP00000380513:K2280N;ENSP00000385618:K1850N;ENSP00000400281:K2279N|.	ENSP00000348551:K2296N|.	K|R	-|-	3|2	2|0	2|0	NCOR2|NCOR2	123382855|123382855	123382855|123382855	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.960000|0.960000	0.62799|0.62799	2.101000|2.101000	0.41787|0.41787	1.981000|1.981000	0.57761|0.57761	0.462000|0.462000	0.41574|0.41574	AAG|AGA	0.169591		TCGA-2L-AAQI-01A-12D-A397-08	0.607	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	0	0	1	2	2	2	2	0	0	0	0	89	0	89	89	1	1.810000	-3.031984	1	0.290000	NM_006312		0	5	6	0	360	359	0		1	0		0	0	89	0	0	0.937952	8.223016e-01	0	0	0	229	0	5	360
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08			C	A	C	C		Valid	Somatic	Phase_I	WXS	KRAS_deep			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	ENST00000256078.4	1.000000	5.600000e-01	0.980000	0.660000	0.790000	0.808335	0.790000	1.000000	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119		Dom	yes			Dom	yes		12	12p12.1	12p12.1	3845	Mis	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog				"""L, E, M, O"""	L, E, M, O			pancreatic, colorectal, lung, thyroid, AML, others	UBE2L3/KRAS(2)	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	25349						c.(34-36)gGt>gTt		Kirsten rat sarcoma viral oncogene homolog							91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	0	0		Noonan syndrome;Cardiofaciocutaneous syndrome	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	g.chr12:25398284C>A	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	chr12.hg19:g.25398284C>A	ENSP00000256078:p.Gly12Val	0	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)				KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V	p.G12V	NM_033360.2	NP_203524.1	1	2	3	2.119234	P01116	RASK_HUMAN	OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)	2	98	-	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	1	1	hg19	c.35G>T	CCDS8703.1	0	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	0	KRAS	25289551	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	0.302143		TCGA-2L-AAQI-01A-12D-A397-08	0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	1	0	1	12	2	2	2	0	4	0	0	56	8006	56	56	1	1.810000	-13.942770	1	0.290000	NM_033360		1230	34	34	6776	272	271	0	1	1	1	1	0	0	56	173	1	1.000000	7.633422e-01	1	10	43	14	379	34	272
CNTN1	1272	broad.mit.edu	37	12	41323657	41323657	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr12:41323657C>T	ENST00000551295.2	+	7	673	c.556C>T	c.(556-558)Cgg>Tgg	p.R186W	CNTN1_ENST00000547849.1_Missense_Mutation_p.R186W|CNTN1_ENST00000347616.1_Missense_Mutation_p.R186W|CNTN1_ENST00000348761.2_Missense_Mutation_p.R175W|CNTN1_ENST00000360099.3_Missense_Mutation_p.R186W|CNTN1_ENST00000547702.1_Missense_Mutation_p.R186W	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	186	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				AATGGATAAACGGCGATTTGT	0.378																																						ENST00000551295.2	1.000000	7.600000e-01	1.000000	0.860000	0.970000	0.946369	0.970000	1.000000																										0				90						c.(556-558)Cgg>Tgg		contactin 1							112.0	111.0	111.0					12																	41323657		2203	4300	6503	SO:0001583	missense	1272	0	0					g.chr12:41323657C>T	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.556C>T	chr12.hg19:g.41323657C>T	ENSP00000447006:p.Arg186Trp	0					CNTN1_ENST00000547849.1_Missense_Mutation_p.R186W|CNTN1_ENST00000347616.1_Missense_Mutation_p.R186W|CNTN1_ENST00000348761.2_Missense_Mutation_p.R175W|CNTN1_ENST00000360099.3_Missense_Mutation_p.R186W|CNTN1_ENST00000547702.1_Missense_Mutation_p.R186W	p.R186W	NM_001843.3	NP_001834.2	1	2	3	2.119234	Q12860	CNTN1_HUMAN		7	673	+	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	1	1	hg19	c.556C>T	CCDS8737.1	1	.	.	.	.	.	.	.	.	.	.	C	18.58	3.654902	0.67472	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	D;D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57;-1.57	5.17	4.27	0.50696	5.17	4.27	0.50696	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.93494	0.7924	H	0.95917	3.74	0.52501	D	0.99995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94943	0.8093	10	0.87932	D	0	.	13.2205	0.59885	0.2891:0.7109:0.0:0.0	.	186;175;186	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	W	186;186;186;186;186;175	ENSP00000448004:R186W;ENSP00000447006:R186W;ENSP00000448653:R186W;ENSP00000325660:R186W;ENSP00000353213:R186W;ENSP00000261160:R175W	ENSP00000325660:R186W	R	+	1	2	2	CNTN1	39609924	39609924	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.900000	0.48687	1.308000	0.44962	0.655000	0.94253	CGG	0.302143		TCGA-2L-AAQI-01A-12D-A397-08	0.378	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	1	0	1	2	2	2	2	0	0	0	0	103	0	103	102	1	1.810000	-20.000000	1	0.290000	NM_001843		0	68	68	0	426	421	1		1	0		0	0	103	0	0	1.000000	3.083668e-01	0	0	0	8	0	68	426
KRT6B	3854	broad.mit.edu	37	12	52845384	52845384	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr12:52845384C>T	ENST00000252252.3	-	1	526	c.479G>A	c.(478-480)cGg>cAg	p.R160Q		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	160	Head.			VR -> IG (in Ref. 2; AAA59466). {ECO:0000305}.	ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		CTCCTCGGCCCGCACCCGCTG	0.597																																						ENST00000252252.3	1.000000	1.500000e-01	0.330000	0.200000	0.250000	0.301491	0.250000	0.250000																										0				40						c.(478-480)cGg>cAg		keratin 6B							53.0	72.0	65.0					12																	52845384		2203	4296	6499	SO:0001583	missense	3854	2	121406	31				g.chr12:52845384C>T	BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.479G>A	chr12.hg19:g.52845384C>T	ENSP00000252252:p.Arg160Gln	0						p.R160Q	NM_005555.3	NP_005546.2	1	2	3	2.091128	P04259	K2C6B_HUMAN		1	526	-			P48669	Missense_Mutation	SNP	ENST00000252252.3	0	1	hg19	c.479G>A	CCDS8828.1	0	.	.	.	.	.	.	.	.	.	.	C	14.68	2.606483	0.46527	.	.	ENSG00000185479	ENST00000252252;ENST00000544607	D	0.85556	-2.0	3.28	0.429	0.16506	3.28	0.429	0.16506	.	0.089287	0.44902	D	0.000418	D	0.88890	0.6560	M	0.94021	3.485	0.32244	N	0.572368	D	0.60160	0.987	P	0.48552	0.581	D	0.88941	0.3380	10	0.87932	D	0	.	8.7904	0.34848	0.0:0.7388:0.0:0.2612	.	160	P04259	K2C6B_HUMAN	Q	160	ENSP00000252252:R160Q	ENSP00000252252:R160Q	R	-	2	0	0	KRT6B	51131651	51131651	0.168000	0.22989	0.024000	0.17045	0.255000	0.26057	0.832000	0.27490	0.094000	0.17404	0.298000	0.19748	CGG	0.297134		TCGA-2L-AAQI-01A-12D-A397-08	0.597	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	0	0	1	2	2	2	2	0	0	0	0	115	0	115	184	1	1.810000	-2.681262	1	0.290000	NM_005555		0	19	14	0	512	418	0		1	0		0	0	115	0	0	0.999941	0	0	0	0	1	0	19	512
GPR133	283383	broad.mit.edu	37	12	131569149	131569149	+	Missense_Mutation	SNP	G	G	A	rs200971352	byFrequency	TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr12:131569149G>A	ENST00000261654.5	+	15	2171	c.1612G>A	c.(1612-1614)Gtc>Atc	p.V538I	GPR133_ENST00000535015.1_Missense_Mutation_p.V570I|GPR133_ENST00000376682.4_Missense_Mutation_p.V224I|GPR133_ENST00000543617.1_Missense_Mutation_p.V57I	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	538	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CACCTACTCCGTCTGCCGCTG	0.622													G|||	2	0.000399361	0.0	0.0	5008	,	,		18042	0.0		0.001	False		,,,				2504	0.001					ENST00000261654.5	1.000000	7.000000e-01	0.970000	0.800000	0.900000	0.893778	0.900000	0.980000																										0				67						c.(1612-1614)Gtc>Atc		G protein-coupled receptor 133							138.0	94.0	109.0					12																	131569149		2203	4300	6503	SO:0001583	missense	283383	6	121410	38				g.chr12:131569149G>A	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.1612G>A	chr12.hg19:g.131569149G>A	ENSP00000261654:p.Val538Ile	1					GPR133_ENST00000535015.1_Missense_Mutation_p.V570I|GPR133_ENST00000376682.4_Missense_Mutation_p.V224I|GPR133_ENST00000543617.1_Missense_Mutation_p.V57I	p.V538I	NM_198827.3	NP_942122.2	0	1	1	1.801923	Q6QNK2	GP133_HUMAN		15	2171	+	all_neural(191;0.0982)|Medulloblastoma(191;0.163)		B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	1	1	hg19	c.1612G>A	CCDS9272.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	4.863	0.160432	0.09287	.	.	ENSG00000111452	ENST00000261654;ENST00000535015;ENST00000376682;ENST00000543617	T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38	4.99	-6.86	0.01676	4.99	-6.86	0.01676	GPS domain (3);	1.327960	0.05058	N	0.479422	T	0.45498	0.1345	N	0.13235	0.315	0.09310	N	0.999996	B;B;B	0.15930	0.003;0.012;0.015	B;B;B	0.15870	0.004;0.005;0.014	T	0.47222	-0.9134	10	0.09338	T	0.73	.	15.0568	0.71921	0.6686:0.0:0.3314:0.0	.	570;57;538	B7ZLF7;Q6QNK2-3;Q6QNK2	.;.;GP133_HUMAN	I	538;570;224;57	ENSP00000261654:V538I;ENSP00000444425:V570I;ENSP00000365872:V224I;ENSP00000438021:V57I	ENSP00000261654:V538I	V	+	1	0	0	GPR133	130135102	130135102	0.001000	0.12720	0.002000	0.10522	0.157000	0.22087	-0.217000	0.09253	-1.452000	0.01931	-2.516000	0.00186	GTC	0.169591		TCGA-2L-AAQI-01A-12D-A397-08	0.622	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	1	0	1	2	2	2	2	0	0	0	0	46	0	46	44	1	1.810000	-3.204582	1	0.290000	NM_198827		0	41	41	0	200	199	1		1	0		0	0	46	0	0	1.000000	3.473397e-01	0	0	0	7	0	41	200
SLITRK5	26050	broad.mit.edu	37	13	88329453	88329453	+	Missense_Mutation	SNP	C	C	T	rs371327441		TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr13:88329453C>T	ENST00000325089.6	+	2	2029	c.1810C>T	c.(1810-1812)Cgc>Tgc	p.R604C	SLITRK5_ENST00000400028.3_Missense_Mutation_p.R363C	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	604	LRRCT 2.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.R604C(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GACCGACATGCGCTCCATTAA	0.567																																						ENST00000325089.6	1.000000	1.000000e-02	0.090000	0.030000	0.050000	0.106784	0.050000	0.060000																										1	Substitution - Missense(1)	p.R604C(1)	prostate(1)	81						c.(1810-1812)Cgc>Tgc		SLIT and NTRK-like family, member 5		C	CYS/ARG	0,4406		0,0,2203	165.0	150.0	155.0		1810	4.5	1.0	13		155	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLITRK5	NM_015567.1	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	604/959	88329453	1,13005	2203	4300	6503	SO:0001583	missense	26050	1	121412	37				g.chr13:88329453C>T	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1810C>T	chr13.hg19:g.88329453C>T	ENSP00000366283:p.Arg604Cys	0					SLITRK5_ENST00000400028.3_Missense_Mutation_p.R363C	p.R604C	NM_015567.1	NP_056382.1	1	2	3	2.086869	O94991	SLIK5_HUMAN		2	2029	+	all_neural(89;0.101)|Medulloblastoma(90;0.163)		B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	0	1	hg19	c.1810C>T	CCDS9465.1	0	.	.	.	.	.	.	.	.	.	.	C	16.04	3.011439	0.54468	0.0	1.16E-4	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.61158	0.13;0.49	5.47	4.54	0.55810	5.47	4.54	0.55810	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.78033	0.4220	M	0.87971	2.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.987;0.993	T	0.81450	-0.0927	9	.	.	.	-15.1954	14.535	0.67953	0.1566:0.8434:0.0:0.0	.	363;604	B4DSH5;O94991	.;SLIK5_HUMAN	C	604;363	ENSP00000366283:R604C;ENSP00000442244:R363C	.	R	+	1	0	0	SLITRK5	87127454	87127454	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	3.167000	0.50793	2.554000	0.86153	0.555000	0.69702	CGC	0.296124		TCGA-2L-AAQI-01A-12D-A397-08	0.567	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3	0	0	1	2	2	2	2	0	0	0	0	182	0	182	180	1	1.810000	-1.756732	0	0.290000			0	7	8	0	876	865	0		1	0		0	0	182	0	0	0.979983	1.336522e-03	0	0	0	6	0	7	876
DLK1	8788	broad.mit.edu	37	14	101200618	101200618	+	Silent	SNP	C	C	T	rs143814604	byFrequency	TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr14:101200618C>T	ENST00000341267.4	+	5	779	c.537C>T	c.(535-537)tgC>tgT	p.C179C	DLK1_ENST00000331224.6_Silent_p.C179C	NM_003836.5	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog (Drosophila)	179	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|negative regulation of Notch signaling pathway (GO:0045746)|Notch signaling pathway (GO:0007219)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(16)|ovary(2)|prostate(1)|skin(1)	29		Melanoma(154;0.155)				CCAACCCATGCGAGAACGACG	0.657													C|||	2	0.000399361	0.0015	0.0	5008	,	,		14288	0.0		0.0	False		,,,				2504	0.0					ENST00000341267.4	1.000000	6.700000e-01	1.000000	0.770000	0.890000	0.888443	0.890000	1.000000																										0				29						c.(535-537)tgC>tgT		delta-like 1 homolog (Drosophila)		C		7,4399	12.9+/-30.5	0,7,2196	70.0	73.0	72.0		537	3.5	1.0	14	dbSNP_134	72	0,8600		0,0,4300	no	coding-synonymous	DLK1	NM_003836.5		0,7,6496	TT,TC,CC		0.0,0.1589,0.0538		179/384	101200618	7,12999	2203	4300	6503	SO:0001819	synonymous_variant	8788	19	121402	45				g.chr14:101200618C>T	U15979	CCDS9963.1	14q32	2011-12-05	2001-12-03			ENSG00000185559			2907	protein-coding gene	gene with protein product		176290	"""delta-like homolog (Drosophila)"""			8095043, 7925474	Standard	NM_003836		Approved	FA1, pG2, Pref-1, ZOG, Delta1	uc001yhs.4	P80370		ENST00000341267.4:c.537C>T	chr14.hg19:g.101200618C>T		0					DLK1_ENST00000331224.6_Silent_p.C179C	p.C179C	NM_003836.5	NP_003827	1	2	3	2.098086	P80370	DLK1_HUMAN		5	779	+		Melanoma(154;0.155)	P15803|Q96DW5	Silent	SNP	ENST00000341267.4	1	1	hg19	c.537C>T	CCDS9963.1	1																																																																																								0.298142		TCGA-2L-AAQI-01A-12D-A397-08	0.657	DLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414389.1	0	0	1	2	2	2	2	0	0	0	0	69	0	69	67	1	1.810000	-19.752180	1	0.290000			0	49	49	0	337	334	1		1	0		0	0	69	0	0	1.000000	9.999976e-01	0	0	0	133	0	49	337
NAGPA	51172	broad.mit.edu	37	16	5077996	5077996	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr16:5077996C>A	ENST00000312251.3	-	6	1130	c.1111G>T	c.(1111-1113)Gga>Tga	p.G371*	NAGPA_ENST00000381955.3_Nonsense_Mutation_p.G371*|RP11-165E7.1_ENST00000588778.1_RNA	NM_016256.3	NP_057340.2	Q9UK23	NAGPA_HUMAN	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase	371	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|lysosome organization (GO:0007040)|protein glycosylation (GO:0006486)|protein targeting to lysosome (GO:0006622)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase activity (GO:0003944)			endometrium(4)|large_intestine(4)|lung(3)|urinary_tract(1)	12					N-Acetyl-D-glucosamine(DB00141)	GTGCACAGTCCGTGCTGGCTG	0.687																																						ENST00000312251.3	1.000000	5.300000e-01	1.000000	0.670000	0.820000	0.825569	0.820000	1.000000																										0				12						c.(1111-1113)Gga>Tga		N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase	N-Acetyl-D-glucosamine(DB00141)						33.0	33.0	33.0					16																	5077996		2197	4300	6497	SO:0001587	stop_gained	51172	0	0					g.chr16:5077996C>A	AF187072	CCDS10527.1	16p13.3	2008-02-05			ENSG00000103174	ENSG00000103174	3.1.4.45		17378	protein-coding gene	gene with protein product		607985				10551838, 12058031	Standard	NM_016256		Approved	APAA, UCE	uc002cyg.3	Q9UK23	OTTHUMG00000090515	ENST00000312251.3:c.1111G>T	chr16.hg19:g.5077996C>A	ENSP00000310998:p.Gly371*	0					RP11-165E7.1_ENST00000588778.1_RNA|NAGPA_ENST00000381955.3_Nonsense_Mutation_p.G371*	p.G371*	NM_016256.3	NP_057340.2	1	2	3	2.086316	Q9UK23	NAGPA_HUMAN		6	1130	-			B2RAS1|Q96EJ8	Nonsense_Mutation	SNP	ENST00000312251.3	0	1	hg19	c.1111G>T	CCDS10527.1	0	.	.	.	.	.	.	.	.	.	.	C	18.32	3.597193	0.66332	.	.	ENSG00000103174	ENST00000312251;ENST00000381955	.	.	.	4.42	4.42	0.53409	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-29.7837	17.027	0.86450	0.0:1.0:0.0:0.0	.	.	.	.	X	371	.	ENSP00000310998:G371X	G	-	1	0	0	NAGPA	5017997	5017997	1.000000	0.71417	0.351000	0.25721	0.106000	0.19336	7.381000	0.79718	2.002000	0.58637	0.561000	0.74099	GGA	0.296124		TCGA-2L-AAQI-01A-12D-A397-08	0.687	NAGPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207003.1	1	0	1	2	2	2	2	0	0	0	0	39	0	39	39	1	1.810000	-3.076474	1	0.290000	NM_016256		0	22	22	0	166	165	1		1	1		0	0	39	0	0	0.999999	7.878343e-01	0	2	0	22	0	22	166
TMEM186	25880	broad.mit.edu	37	16	8890319	8890319	+	Silent	SNP	C	C	T	rs149142450		TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr16:8890319C>T	ENST00000333050.6	-	2	165	c.132G>A	c.(130-132)tcG>tcA	p.S44S	PMM2_ENST00000566983.1_Intron|TMEM186_ENST00000564869.1_Intron|PMM2_ENST00000539622.1_5'Flank|PMM2_ENST00000268261.4_5'Flank|PMM2_ENST00000537352.1_5'Flank|PMM2_ENST00000569958.1_5'Flank	NM_015421.3	NP_056236.2	Q96B77	TM186_HUMAN	transmembrane protein 186	44						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9						GTTTCTCCTTCGAGATGGGTG	0.532													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22686	0.0		0.0	False		,,,				2504	0.0					ENST00000333050.6	1.000000	4.900000e-01	0.790000	0.570000	0.670000	0.690748	0.670000	0.660000																										0				9						c.(130-132)tcG>tcA		transmembrane protein 186		C		1,4393	2.1+/-5.4	0,1,2196	123.0	128.0	126.0		132	-10.6	0.0	16	dbSNP_134	126	0,8600		0,0,4300	no	coding-synonymous	TMEM186	NM_015421.3		0,1,6496	TT,TC,CC		0.0,0.0228,0.0077		44/214	8890319	1,12993	2197	4300	6497	SO:0001819	synonymous_variant	25880	6	121412	42				g.chr16:8890319C>T	BC015912	CCDS10535.1	16p13.2	2008-02-05	2007-02-08	2007-02-08	ENSG00000184857	ENSG00000184857			24530	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 51"""	C16orf51		11230166	Standard	NM_015421		Approved	DKFZP564K2062	uc002cze.3	Q96B77	OTTHUMG00000129696	ENST00000333050.6:c.132G>A	chr16.hg19:g.8890319C>T		0					PMM2_ENST00000569958.1_5'Flank|TMEM186_ENST00000564869.1_Intron|PMM2_ENST00000268261.4_5'Flank|PMM2_ENST00000537352.1_5'Flank|PMM2_ENST00000566983.1_Intron|PMM2_ENST00000539622.1_5'Flank	p.S44S	NM_015421.3	NP_056236.2	1	2	3	2.086316	Q96B77	TM186_HUMAN		2	165	-			B2RAY0|Q9Y4T4	Silent	SNP	ENST00000333050.6	1	1	hg19	c.132G>A	CCDS10535.1	0																																																																																								0.296124		TCGA-2L-AAQI-01A-12D-A397-08	0.532	TMEM186-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251903.1	1	0	1	2	2	2	2	0	0	0	0	102	0	102	102	1	1.810000	-13.604630	1	0.290000	NM_015421		0	44	44	0	415	413	0		1	0		0	0	102	0	0	1.000000	9.032090e-01	0	1	0	39	0	44	415
TP53	7157	broad.mit.edu	37	17	7577090	7577090	+	Missense_Mutation	SNP	C	C	G	rs371409680		TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08			C	G	C	C		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr17:7577090C>G	ENST00000269305.4	-	8	1037	c.848G>C	c.(847-849)cGc>cCc	p.R283P	TP53_ENST00000359597.4_Missense_Mutation_p.R283P|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.R283P|TP53_ENST00000455263.2_Missense_Mutation_p.R283P|TP53_ENST00000420246.2_Missense_Mutation_p.R283P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	283	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> H (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R283P(27)|p.R283H(13)|p.0?(8)|p.R283L(4)|p.R283fs*23(2)|p.?(2)|p.R283fs*16(2)|p.A276_R283delACPGRDRR(1)|p.R283del(1)|p.R283fs*22(1)|p.R282_E287delRRTEEE(1)|p.T284_G293del10(1)|p.G279fs*59(1)|p.S269fs*21(1)|p.C275_R283delCACPGRDRR(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.R283fs*56(1)|p.R283_T284>T(1)|p.V272_K292del21(1)|p.R283fs*59(1)|p.C275fs*20(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCCTCTGTGCGCCGGTCTCT	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	ENST00000269305.4	1.000000	6.800000e-01	0.970000	0.790000	0.900000	0.889786	0.900000	0.990000		111	yes	Rec	yes	Li-Fraumeni syndrome	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	17p13	7157	Mis, N, F	tumor protein p53				"""L, E, M, O"""	L, E, M, O		breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types	breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types		73	Substitution - Missense(44)|Deletion - Frameshift(9)|Whole gene deletion(8)|Deletion - In frame(7)|Insertion - Frameshift(2)|Unknown(2)|Complex - deletion inframe(1)	p.R283P(27)|p.R283H(13)|p.0?(8)|p.R283L(4)|p.R283fs*23(2)|p.?(2)|p.R283fs*16(2)|p.A276_R283delACPGRDRR(1)|p.R283del(1)|p.R283fs*22(1)|p.R282_E287delRRTEEE(1)|p.T284_G293del10(1)|p.G279fs*59(1)|p.S269fs*21(1)|p.C275_R283delCACPGRDRR(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.R283fs*56(1)|p.R283_T284>T(1)|p.V272_K292del21(1)|p.R283fs*59(1)|p.C275fs*20(1)	lung(13)|upper_aerodigestive_tract(10)|urinary_tract(9)|haematopoietic_and_lymphoid_tissue(6)|large_intestine(5)|breast(5)|ovary(4)|bone(4)|stomach(3)|central_nervous_system(3)|oesophagus(3)|pancreas(2)|autonomic_ganglia(2)|liver(2)|cervix(1)|biliary_tract(1)	24185	GRCh37	CM021154	TP53	M		c.(847-849)cGc>cCc	Other conserved DNA damage response genes	tumor protein p53	Acetylsalicylic acid(DB00945)						86.0	73.0	78.0					17																	7577090		2203	4300	6503	SO:0001583	missense	7157	0	0		Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	g.chr17:7577090C>G	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.848G>C	chr17.hg19:g.7577090C>G	ENSP00000269305:p.Arg283Pro	1	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_ENST00000445888.2_Missense_Mutation_p.R283P|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R283P|TP53_ENST00000420246.2_Missense_Mutation_p.R283P|TP53_ENST00000359597.4_Missense_Mutation_p.R283P|TP53_ENST00000413465.2_Intron	p.R283P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	0	1	1	1.790263	P04637	P53_HUMAN		8	1037	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	1	1	hg19	c.848G>C	CCDS11118.1	1	.	.	.	.	.	.	.	.	.	.	C	18.76	3.692626	0.68271	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99804	-6.83;-6.83;-6.83;-6.83;-6.83;-6.83	4.99	4.02	0.46733	4.99	4.02	0.46733	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.056377	0.64402	D	0.000003	D	0.99641	0.9868	M	0.78049	2.395	0.28236	N	0.925907	P;D;D;P	0.76494	0.939;0.999;0.977;0.951	P;D;D;D	0.70016	0.889;0.967;0.933;0.933	D	0.98126	1.0428	10	0.87932	D	0	-4.3612	11.3481	0.49573	0.0:0.9114:0.0:0.0886	.	283;283;283;283	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	P	283;283;283;283;283;272;151	ENSP00000352610:R283P;ENSP00000269305:R283P;ENSP00000398846:R283P;ENSP00000391127:R283P;ENSP00000391478:R283P;ENSP00000425104:R151P	ENSP00000269305:R283P	R	-	2	0	0	TP53	7517815	7517815	0.998000	0.40836	0.015000	0.15790	0.873000	0.50193	3.584000	0.53936	1.318000	0.45170	0.462000	0.41574	CGC	0.169591		TCGA-2L-AAQI-01A-12D-A397-08	0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	1	0	1	2	2	2	2	0	0	0	0	39	0	39	39	1	1.810000	-20.000000	1	0.290000	NM_000546		0	29	29	0	132	132	1		1	1	1	0	0	39	645	0	1.000000	9.999854e-01	1	46	146	39	930	29	132
TEX2	55852	broad.mit.edu	37	17	62290359	62290359	+	Missense_Mutation	SNP	A	A	C			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr17:62290359A>C	ENST00000583097.1	-	2	1391	c.1219T>G	c.(1219-1221)Ttg>Gtg	p.L407V	TEX2_ENST00000584379.1_Missense_Mutation_p.L407V|TEX2_ENST00000258991.3_Missense_Mutation_p.L407V			Q8IWB9	TEX2_HUMAN	testis expressed 2	407					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		AAGGCAGACAAAGAACATTTC	0.448																																						ENST00000583097.1	1.000000	8.000000e-01	1.000000	0.890000	0.990000	0.959778	0.990000	1.000000																										0				41						c.(1219-1221)Ttg>Gtg		testis expressed 2							100.0	103.0	102.0					17																	62290359		2203	4300	6503	SO:0001583	missense	55852	0	0					g.chr17:62290359A>C	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.1219T>G	chr17.hg19:g.62290359A>C	ENSP00000462665:p.Leu407Val	0					TEX2_ENST00000258991.3_Missense_Mutation_p.L407V|TEX2_ENST00000584379.1_Missense_Mutation_p.L407V	p.L407V			1	2	3	2.087263	Q8IWB9	TEX2_HUMAN	BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	2	1391	-			Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	ENST00000583097.1	1	1	hg19	c.1219T>G		1	.	.	.	.	.	.	.	.	.	.	A	6.515	0.463155	0.12402	.	.	ENSG00000136478	ENST00000258991	T	0.54866	0.55	6.11	-3.07	0.05363	6.11	-3.07	0.05363	.	0.241819	0.43260	D	0.000598	T	0.45577	0.1349	L	0.56769	1.78	0.25501	N	0.987551	P;P	0.42827	0.791;0.687	B;B	0.44133	0.442;0.257	T	0.47522	-0.9111	10	0.54805	T	0.06	-10.7897	8.1698	0.31247	0.4215:0.0:0.463:0.1155	.	407;407	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	V	407	ENSP00000258991:L407V	ENSP00000258991:L407V	L	-	1	2	2	TEX2	59644091	59644091	0.625000	0.27111	0.126000	0.21872	0.971000	0.66376	1.066000	0.30604	-0.522000	0.06417	-0.250000	0.11733	TTG	0.297134		TCGA-2L-AAQI-01A-12D-A397-08	0.448	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	1	0	1	2	2	2	2	0	0	0	0	130	0	130	130	1	1.810000	-20.000000	1	0.290000	NM_018469		0	88	87	0	532	529	1		1	1		0	0	130	0	0	1.000000	8.989089e-01	0	3	0	23	0	88	532
LGALS3BP	3959	broad.mit.edu	37	17	76968673	76968673	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr17:76968673G>A	ENST00000262776.3	-	6	1051	c.743C>T	c.(742-744)gCc>gTc	p.A248V	LGALS3BP_ENST00000591778.1_Missense_Mutation_p.P164S	NM_005567.3	NP_005558.1	Q08380	LG3BP_HUMAN	lectin, galactoside-binding, soluble, 3 binding protein	248					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(5)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(99;0.0677)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			GAGGAGGATGGCAAAGAGGCT	0.617																																					GBM(89;1105 1755 18102 21513)	ENST00000262776.3	1.000000	5.500000e-01	0.970000	0.660000	0.800000	0.807942	0.800000	1.000000																										0				17						c.(742-744)gCc>gTc		lectin, galactoside-binding, soluble, 3 binding protein							42.0	43.0	43.0					17																	76968673		2203	4300	6503	SO:0001583	missense	3959	0	0					g.chr17:76968673G>A	L13210	CCDS11759.1	17q25	2014-07-09				ENSG00000108679		"""BTB/POZ domain containing"", ""Endogenous ligands"""	6564	protein-coding gene	gene with protein product	"""L3 antigen"", ""Mac-2-binding protein"", ""serum protein 90K"", ""transport and golgi organization 10 homolog B (Drosophila)"""	600626				7698018, 8034587, 8390986	Standard	NM_005567		Approved	MAC-2-BP, 90K, BTBD17B, TANGO10B, M2BP, gp90, CyCAP	uc002jwh.3	Q08380		ENST00000262776.3:c.743C>T	chr17.hg19:g.76968673G>A	ENSP00000262776:p.Ala248Val	0					LGALS3BP_ENST00000591778.1_Missense_Mutation_p.P164S	p.A248V	NM_005567.3	NP_005558.1	1	2	3	2.087263	Q08380	LG3BP_HUMAN	BRCA - Breast invasive adenocarcinoma(99;0.0677)|OV - Ovarian serous cystadenocarcinoma(97;0.139)	6	1051	-			Q7M4S0|Q9UCH8|Q9UCH9|Q9UCI0	Missense_Mutation	SNP	ENST00000262776.3	1	1	hg19	c.743C>T	CCDS11759.1	0	.	.	.	.	.	.	.	.	.	.	G	6.875	0.530901	0.13127	.	.	ENSG00000108679	ENST00000262776;ENST00000536190	T	0.01422	4.91	3.65	0.453	0.16639	3.65	0.453	0.16639	BTB/POZ fold (1);	0.197685	0.25183	N	0.032512	T	0.01387	0.0045	L	0.44542	1.39	0.09310	N	0.999999	B	0.15141	0.012	B	0.10450	0.005	T	0.46952	-0.9154	10	0.25751	T	0.34	-24.5418	6.2835	0.21021	0.3254:0.0:0.6746:0.0	.	248	Q08380	LG3BP_HUMAN	V	248;236	ENSP00000262776:A248V	ENSP00000262776:A248V	A	-	2	0	0	LGALS3BP	74480268	74480268	0.743000	0.28239	0.008000	0.14137	0.424000	0.31475	2.722000	0.47269	0.146000	0.19002	0.561000	0.74099	GCC	0.297134		TCGA-2L-AAQI-01A-12D-A397-08	0.617	LGALS3BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437785.3	1	0	1	2	2	2	2	0	0	0	0	42	0	42	39	1	1.810000	-20.000000	1	0.290000	NM_005567		0	29	28	0	227	221	1		1	1		0	0	42	0	0	1.000000	1	0	843	0	1440	0	29	227
MAST1	22983	broad.mit.edu	37	19	12969441	12969441	+	Missense_Mutation	SNP	G	G	C			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr19:12969441G>C	ENST00000251472.4	+	12	1293	c.1254G>C	c.(1252-1254)caG>caC	p.Q418H	MAST1_ENST00000591495.1_Missense_Mutation_p.Q414H	NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						AGATCCAGCAGGCCTTTGTGG	0.587																																						ENST00000251472.4	1.000000	2.400000e-01	0.570000	0.330000	0.430000	0.465581	0.430000	0.420000																										0				56						c.(1252-1254)caG>caC		microtubule associated serine/threonine kinase 1							94.0	81.0	86.0					19																	12969441		2203	4300	6503	SO:0001583	missense	22983	0	0					g.chr19:12969441G>C	AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.1254G>C	chr19.hg19:g.12969441G>C	ENSP00000251472:p.Gln418His	0					MAST1_ENST00000591495.1_Missense_Mutation_p.Q414H	p.Q418H	NM_014975.2	NP_055790.1	1	2	3	2.076358				12	1293	+				Missense_Mutation	SNP	ENST00000251472.4	1	1	hg19	c.1254G>C	CCDS32921.1	0	.	.	.	.	.	.	.	.	.	.	G	18.17	3.564284	0.65651	.	.	ENSG00000105613	ENST00000251472;ENST00000542153	T	0.66460	-0.21	4.75	3.71	0.42584	4.75	3.71	0.42584	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.60248	0.2254	N	0.03071	-0.42	0.58432	D	0.999992	D;B	0.76494	0.999;0.357	D;B	0.87578	0.998;0.237	T	0.69343	-0.5170	10	0.87932	D	0	-32.5112	11.0071	0.47641	0.0928:0.0:0.9072:0.0	.	418;418	Q9Y2H9;F5H2S9	MAST1_HUMAN;.	H	418	ENSP00000251472:Q418H	ENSP00000251472:Q418H	Q	+	3	2	2	MAST1	12830441	12830441	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.809000	0.62591	1.144000	0.42321	0.561000	0.74099	CAG	0.295110		TCGA-2L-AAQI-01A-12D-A397-08	0.587	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451733.2	1	0	1	2	2	2	2	0	0	0	0	62	0	62	62	1	1.810000	-17.659470	1	0.290000	NM_014975		0	14	14	0	216	214	0		1			0	0	62	0	0	0.999768	0	0	0	0	0	0	14	216
ATP4A	495	broad.mit.edu	37	19	36051809	36051809	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr19:36051809G>A	ENST00000262623.3	-	5	474	c.446C>T	c.(445-447)gCt>gTt	p.A149V		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	149					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	GACAACCACAGCAATGAGAGC	0.587																																						ENST00000262623.3	1.000000	3.000000e-02	0.150000	0.050000	0.090000	0.138869	0.090000	0.090000																										0				53						c.(445-447)gCt>gTt		ATPase, H+/K+ exchanging, alpha polypeptide	Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)						132.0	114.0	120.0					19																	36051809		2203	4300	6503	SO:0001583	missense	495	0	0					g.chr19:36051809G>A		CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.446C>T	chr19.hg19:g.36051809G>A	ENSP00000262623:p.Ala149Val	0						p.A149V	NM_000704.2	NP_000695.2	1	2	3	2.076358	P20648	ATP4A_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.0724)	5	474	-	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		O00738	Missense_Mutation	SNP	ENST00000262623.3	0	1	hg19	c.446C>T	CCDS12467.1	0	.	.	.	.	.	.	.	.	.	.	g	14.83	2.651116	0.47362	.	.	ENSG00000105675	ENST00000262623	D	0.90563	-2.69	3.22	3.22	0.36961	3.22	3.22	0.36961	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.64402	D	0.000018	T	0.81735	0.4885	N	0.17838	0.53	0.58432	D	0.999991	B	0.19445	0.036	B	0.27796	0.083	T	0.73704	-0.3899	10	0.10377	T	0.69	.	11.9305	0.52843	0.0:0.0:1.0:0.0	.	149	P20648	ATP4A_HUMAN	V	149	ENSP00000262623:A149V	ENSP00000262623:A149V	A	-	2	0	0	ATP4A	40743649	40743649	0.998000	0.40836	0.990000	0.47175	0.830000	0.47004	4.954000	0.63631	1.620000	0.50308	0.197000	0.17608	GCT	0.295110		TCGA-2L-AAQI-01A-12D-A397-08	0.587	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	0	0	1	2	2	2	2	0	0	0	0	69	0	69	69	1	1.810000	-3.219679	1	0.290000	NM_000704		0	5	5	0	388	382	0		1			0	0	69	0	0	0.935372	0	0	0	0	0	0	5	388
CCDC8	83987	broad.mit.edu	37	19	46914987	46914987	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr19:46914987C>T	ENST00000307522.3	-	1	1854	c.1081G>A	c.(1081-1083)Gaa>Aaa	p.E361K		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	361					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		GCAGCCTCTTCCCTCTGGTTA	0.597																																						ENST00000307522.3	1.000000	8.200000e-01	1.000000	0.900000	0.990000	0.963205	0.990000	1.000000																										0				23						c.(1081-1083)Gaa>Aaa		coiled-coil domain containing 8							115.0	117.0	116.0					19																	46914987		2203	4300	6503	SO:0001583	missense	83987	0	0					g.chr19:46914987C>T	BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.1081G>A	chr19.hg19:g.46914987C>T	ENSP00000303158:p.Glu361Lys	0						p.E361K	NM_032040.4	NP_114429.2	1	2	3	2.076358	Q9H0W5	CCDC8_HUMAN		1	1854	-			Q8TB26	Missense_Mutation	SNP	ENST00000307522.3	1	1	hg19	c.1081G>A	CCDS12685.1	1	.	.	.	.	.	.	.	.	.	.	C	9.334	1.061247	0.19987	.	.	ENSG00000169515	ENST00000307522	T	0.11495	2.77	3.19	3.19	0.36642	3.19	3.19	0.36642	.	0.455403	0.16199	N	0.225029	T	0.07007	0.0178	N	0.19112	0.55	0.21325	N	0.999721	B	0.25169	0.119	B	0.21546	0.035	T	0.31833	-0.9929	10	0.15066	T	0.55	0.0165	12.6394	0.56700	0.0:1.0:0.0:0.0	.	361	Q9H0W5	CCDC8_HUMAN	K	361	ENSP00000303158:E361K	ENSP00000303158:E361K	E	-	1	0	0	CCDC8	51606827	51606827	0.000000	0.05858	0.029000	0.17559	0.042000	0.13812	-0.412000	0.07132	2.093000	0.63338	0.297000	0.19635	GAA	0.295110		TCGA-2L-AAQI-01A-12D-A397-08	0.597	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368598.1	1	0	1	2	2	2	2	0	0	0	0	132	0	132	131	1	1.810000	-20.000000	1	0.290000	NM_032040		0	103	100	0	618	609	1		1	0		0	0	132	0	0	1.000000	9.672482e-01	0	0	0	35	0	103	618
PLEKHA4	57664	broad.mit.edu	37	19	49340735	49340735	+	Missense_Mutation	SNP	C	C	G			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr19:49340735C>G	ENST00000263265.6	-	20	2706	c.2151G>C	c.(2149-2151)gaG>gaC	p.E717D	HSD17B14_ENST00000599157.1_5'Flank|HSD17B14_ENST00000263278.4_5'Flank|PLEKHA4_ENST00000355496.5_3'UTR	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	717						cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		GGGGAGGGGTCTCCTGGCGCG	0.672																																						ENST00000263265.6	1.000000	3.000000e-02	0.180000	0.070000	0.110000	0.158234	0.110000	0.100000																										0				30						c.(2149-2151)gaG>gaC		pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4							29.0	37.0	34.0					19																	49340735		2200	4300	6500	SO:0001583	missense	57664	0	0					g.chr19:49340735C>G	AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.2151G>C	chr19.hg19:g.49340735C>G	ENSP00000263265:p.Glu717Asp	0					HSD17B14_ENST00000599157.1_5'Flank|PLEKHA4_ENST00000355496.5_3'UTR|HSD17B14_ENST00000263278.4_5'Flank	p.E717D	NM_020904.2	NP_065955.2	1	2	3	2.076358	Q9H4M7	PKHA4_HUMAN		20	2706	-		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)	Q8N4M8|Q8N658	Missense_Mutation	SNP	ENST00000263265.6	0	1	hg19	c.2151G>C	CCDS12737.1	0	.	.	.	.	.	.	.	.	.	.	c	12.76	2.035882	0.35893	.	.	ENSG00000105559	ENST00000263265	T	0.08370	3.1	4.1	0.204	0.15199	4.1	0.204	0.15199	.	1.664920	0.03742	N	0.255152	T	0.05181	0.0138	N	0.08118	0	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.39583	-0.9607	10	0.39692	T	0.17	.	6.9353	0.24463	0.1931:0.4688:0.3382:0.0	.	717	Q9H4M7	PKHA4_HUMAN	D	717	ENSP00000263265:E717D	ENSP00000263265:E717D	E	-	3	2	2	PLEKHA4	54032547	54032547	0.000000	0.05858	0.000000	0.03702	0.287000	0.27160	-0.065000	0.11617	0.057000	0.16193	0.299000	0.19835	GAG	0.295110		TCGA-2L-AAQI-01A-12D-A397-08	0.672	PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466216.1	0	0	0	2	2	2	2	0	0	0	0	50	0	50	49	1	1.810000	-5.481152	1	0.290000			0	5	0	0	324	320	0		0	0		0	0	50	0	0	0.933358	5.839805e-01	0	0	0	117	0	5	324
RRAS	6237	broad.mit.edu	37	19	50139001	50139001	+	Missense_Mutation	SNP	G	G	A	rs538230538		TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr19:50139001G>A	ENST00000246792.3	-	5	664	c.562C>T	c.(562-564)Cgg>Tgg	p.R188W		NM_006270.3	NP_006261.1	P10301	RRAS_HUMAN	related RAS viral (r-ras) oncogene homolog	188					axon guidance (GO:0007411)|negative regulation of cell migration (GO:0030336)|positive regulation of angiogenesis (GO:0045766)|Ras protein signal transduction (GO:0007265)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein complex binding (GO:0032403)			endometrium(1)|kidney(1)|lung(2)|ovary(2)	6				OV - Ovarian serous cystadenocarcinoma(262;0.00114)|GBM - Glioblastoma multiforme(134;0.0206)		CGGACAGCCCGCACCAGCTGC	0.597																																						ENST00000246792.3	1.000000	3.000000e-02	0.150000	0.060000	0.090000	0.138704	0.090000	0.090000																										0				6						c.(562-564)Cgg>Tgg		related RAS viral (r-ras) oncogene homolog							80.0	85.0	83.0					19																	50139001		2203	4300	6503	SO:0001583	missense	6237	0	0					g.chr19:50139001G>A		CCDS12774.1	19q13.33	2014-05-09				ENSG00000126458			10447	protein-coding gene	gene with protein product	"""Oncogene RRAS"""	165090				3098437	Standard	NM_006270		Approved		uc002pop.1	P10301		ENST00000246792.3:c.562C>T	chr19.hg19:g.50139001G>A	ENSP00000246792:p.Arg188Trp	0						p.R188W	NM_006270.3	NP_006261.1	1	2	3	2.076358	P10301	RRAS_HUMAN		5	664	-			Q6FH12	Missense_Mutation	SNP	ENST00000246792.3	0	1	hg19	c.562C>T	CCDS12774.1	0	.	.	.	.	.	.	.	.	.	.	G	19.01	3.744428	0.69418	.	.	ENSG00000126458	ENST00000246792	T	0.79454	-1.27	4.85	4.85	0.62838	4.85	4.85	0.62838	.	0.204104	0.34067	N	0.004286	D	0.90459	0.7012	H	0.96398	3.815	0.58432	D	0.999999	D	0.89917	1.0	D	0.71184	0.972	D	0.92164	0.5738	10	0.87932	D	0	.	10.503	0.44817	0.0:0.0:0.6965:0.3035	.	188	P10301	RRAS_HUMAN	W	188	ENSP00000246792:R188W	ENSP00000246792:R188W	R	-	1	2	2	RRAS	54830813	54830813	0.312000	0.24545	0.994000	0.49952	0.740000	0.42216	2.016000	0.40971	2.509000	0.84616	0.491000	0.48974	CGG	0.295110		TCGA-2L-AAQI-01A-12D-A397-08	0.597	RRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465791.1	0	0	1	2	2	2	2	0	0	0	0	98	0	98	95	1	1.810000	-2.244413	0	0.290000	NM_006270		0	6	6	0	454	448	0		1	0	0	0	0	98	0	0	0.963752	9.859706e-01	0	0	0	602	1	6	454
RFX2	5990	broad.mit.edu	37	19	6013025	6013025	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr19:6013025G>A	ENST00000303657.5	-	8	1020	c.871C>T	c.(871-873)Cgg>Tgg	p.R291W	CTC-232P5.1_ENST00000587836.1_RNA|RFX2_ENST00000592546.1_Missense_Mutation_p.R266W|RFX2_ENST00000359161.3_Missense_Mutation_p.R291W	NM_000635.3	NP_000626.2	P48378	RFX2_HUMAN	regulatory factor X, 2 (influences HLA class II expression)	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						GGCTGCTGCCGCATGGCCATG	0.622																																					Colon(38;171 817 19800 47433 48051)	ENST00000303657.5	1.000000	1.000000e-02	0.090000	0.030000	0.050000	0.098675	0.050000	0.060000																										0				21						c.(871-873)Cgg>Tgg		regulatory factor X, 2 (influences HLA class II expression)							103.0	103.0	103.0					19																	6013025		2203	4300	6503	SO:0001583	missense	5990	0	0					g.chr19:6013025G>A		CCDS12157.1, CCDS12158.1	19p13.3	2011-11-23			ENSG00000087903	ENSG00000087903			9983	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 2"", ""DNA binding protein RFX2"", ""HLA class II regulatory factor RFX2"""	142765				1505960	Standard	NM_000635		Approved	FLJ14226	uc002meb.3	P48378		ENST00000303657.5:c.871C>T	chr19.hg19:g.6013025G>A	ENSP00000306335:p.Arg291Trp	0					RFX2_ENST00000592546.1_Missense_Mutation_p.R266W|RFX2_ENST00000359161.3_Missense_Mutation_p.R291W|CTC-232P5.1_ENST00000587836.1_RNA	p.R291W	NM_000635.3	NP_000626.2	1	2	3	2.076358	P48378	RFX2_HUMAN		8	1020	-			A8K581|B3KNC4|Q6IQ44|Q8SNA2	Missense_Mutation	SNP	ENST00000303657.5	0	1	hg19	c.871C>T	CCDS12157.1	0	.	.	.	.	.	.	.	.	.	.	G	22.2	4.263838	0.80358	.	.	ENSG00000087903	ENST00000303657;ENST00000359161;ENST00000537791	T	0.68903	-0.36	4.99	0.693	0.18056	4.99	0.693	0.18056	.	0.000000	0.85682	D	0.000000	T	0.81517	0.4839	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.982	D	0.83606	0.0131	10	0.87932	D	0	-48.1749	13.7584	0.62950	0.0:0.0:0.234:0.766	.	266;291	P48378-2;P48378	.;RFX2_HUMAN	W	291;266;78	ENSP00000306335:R291W	ENSP00000306335:R291W	R	-	1	2	2	RFX2	5964025	5964025	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.976000	0.40579	0.152000	0.19188	0.557000	0.71058	CGG	0.295110		TCGA-2L-AAQI-01A-12D-A397-08	0.622	RFX2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452687.1	0	0	1	2	2	2	2	0	0	0	0	175	0	175	172	1	1.810000	-2.092584	0	0.290000	NM_000635		0	7	7	0	870	866	0		1	0		0	0	175	0	0	0.980308	3.178309e-03	0	0	0	9	0	7	870
LILRB1	10859	broad.mit.edu	37	19	55144109	55144109	+	Missense_Mutation	SNP	C	C	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr19:55144109C>A	ENST00000396331.1	+	7	1213	c.856C>A	c.(856-858)Cct>Act	p.P286T	LILRB1_ENST00000418536.2_Missense_Mutation_p.P286T|LILRB1_ENST00000396317.1_Missense_Mutation_p.P286T|LILRB1_ENST00000427581.2_Missense_Mutation_p.P322T|LILRB1_ENST00000396321.2_Missense_Mutation_p.P286T|LILRB1_ENST00000448689.1_Missense_Mutation_p.P286T|LILRB1_ENST00000396315.1_Missense_Mutation_p.P286T|LILRB1_ENST00000396332.4_Missense_Mutation_p.P286T|LILRB1_ENST00000434867.2_Missense_Mutation_p.P286T|LILRB1_ENST00000324602.7_Missense_Mutation_p.P286T|LILRB1_ENST00000396327.3_Missense_Mutation_p.P286T	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	286	Ig-like C2-type 3.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		CACCCTGGGCCCTGTGAGCCG	0.632										HNSCC(37;0.09)																												ENST00000396331.1	0.700000	3.100000e-01	0.580000	0.380000	0.470000	0.488303	0.470000	0.460000																										0				74						c.(856-858)Cct>Act		leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1							51.0	56.0	54.0					19																	55144109		2203	4298	6501	SO:0001583	missense	10859	0	0					g.chr19:55144109C>A	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.856C>A	chr19.hg19:g.55144109C>A	ENSP00000379622:p.Pro286Thr	0	HNSCC(37;0.09)				LILRB1_ENST00000324602.7_Missense_Mutation_p.P286T|LILRB1_ENST00000418536.2_Missense_Mutation_p.P286T|LILRB1_ENST00000396315.1_Missense_Mutation_p.P286T|LILRB1_ENST00000427581.2_Missense_Mutation_p.P322T|LILRB1_ENST00000396321.2_Missense_Mutation_p.P286T|LILRB1_ENST00000434867.2_Missense_Mutation_p.P286T|LILRB1_ENST00000396327.3_Missense_Mutation_p.P286T|LILRB1_ENST00000396317.1_Missense_Mutation_p.P286T|LILRB1_ENST00000396332.4_Missense_Mutation_p.P286T|LILRB1_ENST00000448689.1_Missense_Mutation_p.P286T	p.P286T	NM_006669.3	NP_006660.3	1	2	3	2.063628	Q8NHL6	LIRB1_HUMAN		7	1213	+			A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	ENST00000396331.1	1	1	hg19	c.856C>A	CCDS42617.1	0	.	.	.	.	.	.	.	.	.	.	C	8.074	0.770833	0.15983	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000448689;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T;T	0.11495	2.77;2.77;2.77;2.77;2.77;2.77;2.77;2.77;2.77;2.77;2.77	2.03	-1.43	0.08884	2.03	-1.43	0.08884	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.672928	0.12913	N	0.428831	T	0.31358	0.0794	M	0.91090	3.175	0.09310	N	1	B;D;P;P;D	0.65815	0.387;0.969;0.767;0.83;0.995	B;P;P;P;D	0.67382	0.241;0.868;0.53;0.646;0.951	T	0.07809	-1.0753	10	0.66056	D	0.02	.	4.745	0.13033	0.0:0.4872:0.0:0.5128	.	286;286;286;286;286	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	T	286;286;286;286;286;286;286;286;322;286;286	ENSP00000379614:P286T;ENSP00000391514:P286T;ENSP00000409968:P286T;ENSP00000379622:P286T;ENSP00000379618:P286T;ENSP00000315997:P286T;ENSP00000405243:P286T;ENSP00000379623:P286T;ENSP00000395004:P322T;ENSP00000379610:P286T;ENSP00000379608:P286T	ENSP00000315997:P286T	P	+	1	0	0	LILRB1	59835921	59835921	0.000000	0.05858	0.001000	0.08648	0.067000	0.16453	-1.269000	0.02834	-0.418000	0.07450	0.194000	0.17425	CCT	0.292053		TCGA-2L-AAQI-01A-12D-A397-08	0.632	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4	1	0	1	2	2	2	2	0	0	0	0	76	0	76	84	1	1.810000	-3.142702	1	0.290000			0	26	24	0	356	339	0		1	0		0	0	76	0	0	1.000000	1.457254e-02	0	0	0	3	0	26	356
CTRC	11330	broad.mit.edu	37	1	15769925	15769925	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08			C	T	C	C		Inconclusive	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr1:15769925C>T	ENST00000375949.4	+	5	394	c.368C>T	c.(367-369)gCc>gTc	p.A123V	CTRC_ENST00000483406.1_3'UTR|CTRC_ENST00000375943.2_Missense_Mutation_p.P60S	NM_007272.2	NP_009203.2	Q99895	CTRC_HUMAN	chymotrypsin C (caldecrin)	123	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)	13		Breast(348;0.000207)|all_lung(284;0.00021)|Colorectal(325;0.000257)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)|Hepatocellular(190;0.0634)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AATGATATTGCCCTCATCAAG	0.592																																						ENST00000375949.4	0.070000	1.000000e-02	0.050000	0.010000	0.030000	0.038885	0.030000	0.030000																										0				13						c.(367-369)gCc>gTc		chymotrypsin C (caldecrin)							227.0	217.0	221.0					1																	15769925		2203	4300	6503	SO:0001583	missense	11330	0	0					g.chr1:15769925C>T	BC015118	CCDS156.1	1p36.21	2009-02-18			ENSG00000162438	ENSG00000162438	3.4.21.2		2523	protein-coding gene	gene with protein product	"""elastase 4"""	601405				8635596	Standard	NM_007272		Approved	CLCR, ELA4	uc001awi.1	Q99895	OTTHUMG00000002255	ENST00000375949.4:c.368C>T	chr1.hg19:g.15769925C>T	ENSP00000365116:p.Ala123Val	1					CTRC_ENST00000483406.1_3'UTR|CTRC_ENST00000375943.2_Missense_Mutation_p.P60S	p.A123V	NM_007272.2	NP_009203.2	0	1	1	1.832690	Q99895	CTRC_HUMAN		5	394	+		Breast(348;0.000207)|all_lung(284;0.00021)|Colorectal(325;0.000257)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)|Hepatocellular(190;0.0634)	A8K082|O00765|Q9NUH5	Missense_Mutation	SNP	ENST00000375949.4	0	1	hg19	c.368C>T	CCDS156.1	0	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	26.9|26.9	4.783551|4.783551	0.90282|0.90282	.|.	.|.	ENSG00000162438|ENSG00000162438	ENST00000375949|ENST00000375943	D|.	0.97941|.	-4.62|.	4.91|4.91	4.91|4.91	0.64330|0.64330	4.91|4.91	4.91|4.91	0.64330|0.64330	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85066|0.85066	0.5612|0.5612	M|M	0.91717|0.91717	3.235|3.235	0.42584|0.42584	D|D	0.993226|0.993226	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.999|.	D|D	0.88780|0.88780	0.3270|0.3270	10|6	0.87932|0.87932	D|D	0|0	-50.5833|-50.5833	16.8963|16.8963	0.86101|0.86101	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	123;123|.	A8MTQ9;Q99895|.	.;CTRC_HUMAN|.	V|S	123|60	ENSP00000365116:A123V|.	ENSP00000365116:A123V|ENSP00000365110:P60S	A|P	+|+	2|1	0|0	0|0	CTRC|CTRC	15642512|15642512	15642512|15642512	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.693000|0.693000	0.40251|0.40251	7.562000|7.562000	0.82300|0.82300	2.576000|2.576000	0.86940|0.86940	0.549000|0.549000	0.68633|0.68633	GCC|CCC	0.182075		TCGA-2L-AAQI-01A-12D-A397-08	0.592	CTRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006435.1	0	0	1	2	2	2	2	0	0	0	0	299	0	299	297	1	1.810000	-2.555883	1	0.290000	NM_007272		0	7	7	0	1218	1209	0		1	0		0	0	299	0	0	0.980062	9.970995e-01	0	0	0	1945	0	7	1218
NES	10763	broad.mit.edu	37	1	156641485	156641485	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr1:156641485G>A	ENST00000368223.3	-	4	2627	c.2495C>T	c.(2494-2496)gCg>gTg	p.A832V		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	832	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTCTTGTCCCGCAGACTTCAG	0.413																																						ENST00000368223.3	1.000000	2.000000e-02	0.120000	0.040000	0.070000	0.160840	0.070000	0.070000																										0				64						c.(2494-2496)gCg>gTg		nestin							118.0	113.0	115.0					1																	156641485		2203	4300	6503	SO:0001583	missense	10763	1	121410	39				g.chr1:156641485G>A	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.2495C>T	chr1.hg19:g.156641485G>A	ENSP00000357206:p.Ala832Val	0						p.A832V	NM_006617.1	NP_006608.1	1	2	3	2.111475	P48681	NEST_HUMAN		4	2627	-	all_hematologic(923;0.088)|Hepatocellular(266;0.158)		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	0	1	hg19	c.2495C>T	CCDS1151.1	0	.	.	.	.	.	.	.	.	.	.	G	15.56	2.868932	0.51588	.	.	ENSG00000132688	ENST00000368223	D	0.85955	-2.05	5.68	-1.11	0.09840	5.68	-1.11	0.09840	.	0.494478	0.15171	N	0.276645	T	0.52208	0.1720	L	0.38838	1.175	0.09310	N	1	B	0.25312	0.123	B	0.12837	0.008	T	0.36040	-0.9764	10	0.35671	T	0.21	.	1.1534	0.01790	0.3298:0.2257:0.3163:0.1282	.	832	P48681	NEST_HUMAN	V	832	ENSP00000357206:A832V	ENSP00000357206:A832V	A	-	2	0	0	NES	154908109	154908109	0.000000	0.05858	0.001000	0.08648	0.305000	0.27757	-0.007000	0.12810	0.332000	0.23536	0.563000	0.77884	GCG	0.301147		TCGA-2L-AAQI-01A-12D-A397-08	0.413	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	0	0	1	2	17	4	2	1	0	1	1	160	0	160	160	1	1.810000	-1.951808	0	0.290000	NM_006617		0	8	7	0	786	785	0		0	0		1	0	160	0	0	0.051478	1.418588e-02	0	0	0	74	0	8	786
NHLH1	4807	broad.mit.edu	37	1	160340909	160340909	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr1:160340909G>A	ENST00000302101.5	+	2	834	c.388G>A	c.(388-390)Gtg>Atg	p.V130M		NM_005598.3	NP_005589.1	Q02575	HEN1_HUMAN	nescient helix loop helix 1	130					cell differentiation (GO:0030154)|central nervous system development (GO:0007417)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	7	all_cancers(52;7.11e-19)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CCTGAACCACGTGCTGGACGT	0.622																																						ENST00000302101.5	1.000000	7.800000e-01	1.000000	0.900000	0.990000	0.966656	0.990000	1.000000																										0				7						c.(388-390)Gtg>Atg		nescient helix loop helix 1							79.0	79.0	79.0					1																	160340909		2203	4300	6503	SO:0001583	missense	4807	0	0					g.chr1:160340909G>A	BC013789	CCDS1204.1	1q22	2013-05-21			ENSG00000171786	ENSG00000171786		"""Basic helix-loop-helix proteins"""	7817	protein-coding gene	gene with protein product		162360		HEN1			Standard	NM_005598		Approved	NSCL, NSCL1, bHLHa35	uc001fwa.2	Q02575	OTTHUMG00000033121	ENST00000302101.5:c.388G>A	chr1.hg19:g.160340909G>A	ENSP00000302189:p.Val130Met	0						p.V130M	NM_005598.3	NP_005589.1	1	2	3	2.111475	Q02575	HEN1_HUMAN	BRCA - Breast invasive adenocarcinoma(70;0.111)	2	834	+	all_cancers(52;7.11e-19)|all_hematologic(112;0.093)			Missense_Mutation	SNP	ENST00000302101.5	1	1	hg19	c.388G>A	CCDS1204.1	1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.857019	0.51376	.	.	ENSG00000171786	ENST00000302101	D	0.88509	-2.39	3.98	3.98	0.46160	3.98	3.98	0.46160	Helix-loop-helix DNA-binding (3);	0.000000	0.49305	D	0.000146	T	0.73713	0.3622	L	0.47190	1.495	0.58432	D	0.999997	P	0.41569	0.755	B	0.21360	0.034	T	0.77838	-0.2439	10	0.33940	T	0.23	-29.3292	15.1633	0.72801	0.0:0.0:1.0:0.0	.	130	Q02575	HEN1_HUMAN	M	130	ENSP00000302189:V130M	ENSP00000302189:V130M	V	+	1	0	0	NHLH1	158607533	158607533	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.477000	0.73591	2.215000	0.71742	0.655000	0.94253	GTG	0.301147		TCGA-2L-AAQI-01A-12D-A397-08	0.622	NHLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080676.1	1	0	1	2	2	2	2	0	0	0	0	61	0	61	60	1	1.810000	-20.000000	1	0.290000	NM_005598		0	48	46	0	278	273	1		1			0	0	61	0	0	1.000000	0	0	0	0	0	0	48	278
OR2M2	391194	broad.mit.edu	37	1	248344094	248344094	+	Silent	SNP	G	G	A	rs140026971	byFrequency	TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr1:248344094G>A	ENST00000359682.2	+	1	807	c.807G>A	c.(805-807)acG>acA	p.T269T		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T269T(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ACTCCCCAACGCAGGACAAGA	0.502																																						ENST00000359682.2	1.000000	7.900000e-01	1.000000	0.860000	0.950000	0.943847	0.950000	1.000000																										1	Substitution - coding silent(1)	p.T269T(1)	endometrium(1)	70						c.(805-807)acG>acA		olfactory receptor, family 2, subfamily M, member 2		G		3,4403	6.2+/-15.9	0,3,2200	207.0	185.0	192.0		807	-4.1	0.0	1	dbSNP_134	192	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	OR2M2	NM_001004688.1		0,5,6498	AA,AG,GG		0.0233,0.0681,0.0384		269/348	248344094	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	391194	14	121412	48				g.chr1:248344094G>A	AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.807G>A	chr1.hg19:g.248344094G>A		0						p.T269T	NM_001004688.1	NP_001004688.1	1	2	3	2.111475	Q96R28	OR2M2_HUMAN	OV - Ovarian serous cystadenocarcinoma(106;0.0245)	1	807	+	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		A3KFT4	Silent	SNP	ENST00000359682.2	1	1	hg19	c.807G>A	CCDS31106.1	1																																																																																								0.301147		TCGA-2L-AAQI-01A-12D-A397-08	0.502	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	1	0	1	2	2	2	2	0	0	0	0	185	0	185	188	1	1.810000	-20.000000	1	0.290000	NM_001004688		0	107	103	0	681	676	1		1			0	0	185	0	0	1.000000	0	0	0	0	0	0	107	681
DNMT3B	1789	broad.mit.edu	37	20	31388072	31388072	+	Missense_Mutation	SNP	G	G	A	rs201657518		TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr20:31388072G>A	ENST00000328111.2	+	17	2194	c.1873G>A	c.(1873-1875)Gtg>Atg	p.V625M	DNMT3B_ENST00000353855.2_Missense_Mutation_p.V605M|DNMT3B_ENST00000201963.3_Missense_Mutation_p.V617M|DNMT3B_ENST00000348286.2_Missense_Mutation_p.V605M|DNMT3B_ENST00000443239.3_Missense_Mutation_p.V563M|DNMT3B_ENST00000375623.4_3'UTR|DNMT3B_ENST00000344505.4_Missense_Mutation_p.V605M|DNMT3B_ENST00000456297.2_Missense_Mutation_p.V529M	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	625	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TATCAAATACGTGAACGACGT	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		22250	0.0		0.001	False		,,,				2504	0.0					ENST00000328111.2	1.000000	7.100000e-01	1.000000	0.800000	0.900000	0.900503	0.900000	1.000000																										0				39						c.(1873-1875)Gtg>Atg		DNA (cytosine-5-)-methyltransferase 3 beta							209.0	181.0	190.0					20																	31388072		2203	4300	6503	SO:0001583	missense	1789	0	0					g.chr20:31388072G>A		CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.1873G>A	chr20.hg19:g.31388072G>A	ENSP00000328547:p.Val625Met	0					DNMT3B_ENST00000348286.2_Missense_Mutation_p.V605M|DNMT3B_ENST00000353855.2_Missense_Mutation_p.V605M|DNMT3B_ENST00000375623.4_3'UTR|DNMT3B_ENST00000344505.4_Missense_Mutation_p.V605M|DNMT3B_ENST00000456297.2_Missense_Mutation_p.V529M|DNMT3B_ENST00000443239.3_Missense_Mutation_p.V563M|DNMT3B_ENST00000201963.3_Missense_Mutation_p.V617M	p.V625M	NM_006892.3	NP_008823.1	0	0	0	2.025662	Q9UBC3	DNM3B_HUMAN		17	2194	+			A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Missense_Mutation	SNP	ENST00000328111.2	1	1	hg19	c.1873G>A	CCDS13205.1	1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	23.1	4.372608	0.82573	.	.	ENSG00000088305	ENST00000328111;ENST00000353855;ENST00000348286;ENST00000443239;ENST00000456297;ENST00000344505;ENST00000201963	T;T;T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12;-1.12;-1.12	5.65	5.65	0.86999	5.65	5.65	0.86999	.	0.058115	0.64402	D	0.000002	D	0.83133	0.5188	M	0.66439	2.03	0.80722	D	1	D;P;P;P;B;P;P	0.55800	0.973;0.952;0.909;0.778;0.435;0.491;0.689	P;P;P;B;B;B;P	0.51193	0.523;0.641;0.662;0.322;0.146;0.322;0.554	D	0.84179	0.0438	10	0.59425	D	0.04	-22.0454	19.0797	0.93177	0.0:0.0:1.0:0.0	.	529;563;324;617;605;605;625	E9PBF2;E7EN63;B3KM53;Q9UBC3-6;Q9UBC3-3;Q9UBC3-2;Q9UBC3	.;.;.;.;.;.;DNM3B_HUMAN	M	625;605;605;563;529;605;617	ENSP00000328547:V625M;ENSP00000313397:V605M;ENSP00000337764:V605M;ENSP00000403169:V563M;ENSP00000412305:V529M;ENSP00000345105:V605M;ENSP00000201963:V617M	ENSP00000201963:V617M	V	+	1	0	0	DNMT3B	30851733	30851733	1.000000	0.71417	0.951000	0.38953	0.794000	0.44872	7.973000	0.88032	2.810000	0.96702	0.650000	0.86243	GTG	0.277427		TCGA-2L-AAQI-01A-12D-A397-08	0.493	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	1	0	1	2	2	2	2	0	0	0	0	86	0	86	85	1	1.810000	-20.000000	1	0.290000	NM_006892		0	63	63	0	407	404	1		1	1		0	0	86	0	0	1.000000	9.214169e-02	0	2	0	2	0	63	407
DNMT3B	1789	broad.mit.edu	37	20	31388677	31388677	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr20:31388677G>A	ENST00000328111.2	+	18	2263	c.1942G>A	c.(1942-1944)Gga>Aga	p.G648R	DNMT3B_ENST00000353855.2_Missense_Mutation_p.G628R|DNMT3B_ENST00000201963.3_Missense_Mutation_p.G640R|DNMT3B_ENST00000348286.2_Missense_Mutation_p.G628R|DNMT3B_ENST00000443239.3_Missense_Mutation_p.G586R|DNMT3B_ENST00000375623.4_3'UTR|DNMT3B_ENST00000344505.4_Missense_Mutation_p.G628R|DNMT3B_ENST00000456297.2_Missense_Mutation_p.G552R	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	648	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGTGATTGGCGGAAGCCCATG	0.522																																						ENST00000328111.2	0.100000	1.000000e-02	0.070000	0.020000	0.040000	0.052940	0.040000	0.040000																										0				39						c.(1942-1944)Gga>Aga		DNA (cytosine-5-)-methyltransferase 3 beta							185.0	187.0	186.0					20																	31388677		2203	4300	6503	SO:0001583	missense	1789	0	0					g.chr20:31388677G>A		CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.1942G>A	chr20.hg19:g.31388677G>A	ENSP00000328547:p.Gly648Arg	0					DNMT3B_ENST00000348286.2_Missense_Mutation_p.G628R|DNMT3B_ENST00000353855.2_Missense_Mutation_p.G628R|DNMT3B_ENST00000375623.4_3'UTR|DNMT3B_ENST00000344505.4_Missense_Mutation_p.G628R|DNMT3B_ENST00000456297.2_Missense_Mutation_p.G552R|DNMT3B_ENST00000443239.3_Missense_Mutation_p.G586R|DNMT3B_ENST00000201963.3_Missense_Mutation_p.G640R	p.G648R	NM_006892.3	NP_008823.1	0	0	0	2.025662	Q9UBC3	DNM3B_HUMAN		18	2263	+			A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Missense_Mutation	SNP	ENST00000328111.2	0	1	hg19	c.1942G>A	CCDS13205.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.691842	0.96793	.	.	ENSG00000088305	ENST00000328111;ENST00000353855;ENST00000348286;ENST00000443239;ENST00000456297;ENST00000344505;ENST00000201963	D;D;D;D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-3.24	6.07	6.07	0.98685	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.98172	0.9396	H	0.97635	4.045	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.997;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.998;0.996;0.988;1.0;0.997;1.0;1.0	D	0.98850	1.0758	10	0.87932	D	0	-22.4387	19.2231	0.93806	0.0:0.0:1.0:0.0	.	552;586;347;640;628;628;648	E9PBF2;E7EN63;B3KM53;Q9UBC3-6;Q9UBC3-3;Q9UBC3-2;Q9UBC3	.;.;.;.;.;.;DNM3B_HUMAN	R	648;628;628;586;552;628;640	ENSP00000328547:G648R;ENSP00000313397:G628R;ENSP00000337764:G628R;ENSP00000403169:G586R;ENSP00000412305:G552R;ENSP00000345105:G628R;ENSP00000201963:G640R	ENSP00000201963:G640R	G	+	1	0	0	DNMT3B	30852338	30852338	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.779000	0.99018	2.885000	0.99019	0.655000	0.94253	GGA	0.277427		TCGA-2L-AAQI-01A-12D-A397-08	0.522	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	0	0	1	2	2	2	2	0	0	0	0	158	0	158	157	1	1.810000	-1.778336	0	0.290000	NM_006892		0	6	5	0	886	880	0		1	0	0	0	0	158	0	0	0.964161	1.022059e-03	0	0	0	6	1	6	886
CDK5RAP1	51654	broad.mit.edu	37	20	31984682	31984682	+	Silent	SNP	C	C	T			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr20:31984682C>T	ENST00000357886.4	-	2	342	c.189G>A	c.(187-189)ccG>ccA	p.P63P	CDK5RAP1_ENST00000346416.2_Silent_p.P63P|CDK5RAP1_ENST00000473997.1_5'UTR|CDK5RAP1_ENST00000544843.1_Silent_p.P63P|CDK5RAP1_ENST00000339269.5_Silent_p.P63P|CDK5RAP1_ENST00000477105.1_Intron			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	63	CDK5 activation inhibition.				brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						GTTGAAAAGTCGGTCCAGCAG	0.517																																						ENST00000357886.4	1.000000	8.800000e-01	1.000000	0.990000	0.990000	0.989801	0.990000	1.000000																										0				26						c.(187-189)ccG>ccA		CDK5 regulatory subunit associated protein 1							79.0	80.0	79.0					20																	31984682		2203	4300	6503	SO:0001819	synonymous_variant	51654	0	0					g.chr20:31984682C>T	AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.189G>A	chr20.hg19:g.31984682C>T		0					CDK5RAP1_ENST00000339269.5_Silent_p.P63P|CDK5RAP1_ENST00000544843.1_Silent_p.P63P|CDK5RAP1_ENST00000477105.1_Intron|CDK5RAP1_ENST00000473997.1_5'UTR|CDK5RAP1_ENST00000346416.2_Silent_p.P63P	p.P63P			0	0	0	2.025662	Q96SZ6	CK5P1_HUMAN		2	342	-			A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Silent	SNP	ENST00000357886.4	1	1	hg19	c.189G>A		1																																																																																								0.277427		TCGA-2L-AAQI-01A-12D-A397-08	0.517	CDK5RAP1-011	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078697.1	1	0	1	2	2	2	2	0	0	0	0	76	0	76	76	1	1.810000	-20.000000	1	0.290000	NM_016408		0	65	64	0	329	326	1		1	1		0	0	76	0	0	1.000000	8.959031e-01	0	6	0	16	0	65	329
CDH4	1002	broad.mit.edu	37	20	60503309	60503309	+	Silent	SNP	C	C	T	rs368405359		TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr20:60503309C>T	ENST00000360469.5	+	12	1921	c.1833C>T	c.(1831-1833)aaC>aaT	p.N611N	CDH4_ENST00000543233.1_Silent_p.N537N	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	611	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			TCAACGACAACGCCCCTGAGC	0.627																																						ENST00000360469.5	0.880000	6.200000e-01	0.820000	0.680000	0.740000	0.757018	0.740000	0.750000																										0				74						c.(1831-1833)aaC>aaT		cadherin 4, type 1, R-cadherin (retinal)		C		1,4405	2.1+/-5.4	0,1,2202	131.0	141.0	138.0		1833	-7.0	0.8	20		138	0,8600		0,0,4300	no	coding-synonymous	CDH4	NM_001794.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		611/917	60503309	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1002	2	121404	38				g.chr20:60503309C>T	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.1833C>T	chr20.hg19:g.60503309C>T		0					CDH4_ENST00000543233.1_Silent_p.N537N	p.N611N	NM_001794.3	NP_001785.2	0	0	0	2.025662	P55283	CADH4_HUMAN	BRCA - Breast invasive adenocarcinoma(19;2.36e-08)	12	1921	+			B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Silent	SNP	ENST00000360469.5	1	1	hg19	c.1833C>T	CCDS13488.1	0																																																																																								0.277427		TCGA-2L-AAQI-01A-12D-A397-08	0.627	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	0	0	1	2	17	2	2	1	0	1	1	204	0	204	202	1	1.810000	-20.000000	1	0.290000	NM_001794		0	110	109	0	879	867	0		1			1	0	204	0	0	1.000000	0	0	0	0	0	0	110	879
IKZF2	22807	broad.mit.edu	37	2	213872107	213872107	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr2:213872107G>A	ENST00000434687.1	-	9	1867	c.1558C>T	c.(1558-1560)Cga>Tga	p.R520*	IKZF2_ENST00000457361.1_Nonsense_Mutation_p.R520*|IKZF2_ENST00000451136.2_Nonsense_Mutation_p.R448*|IKZF2_ENST00000421754.2_Nonsense_Mutation_p.R446*|IKZF2_ENST00000413091.3_3'UTR|IKZF2_ENST00000374327.4_Nonsense_Mutation_p.R375*|AC079610.1_ENST00000415387.1_RNA|IKZF2_ENST00000374319.4_Nonsense_Mutation_p.R494*|IKZF2_ENST00000342002.2_Nonsense_Mutation_p.R526*			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	520					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		TGCTCCCCTCGAACAATGTGT	0.483																																						ENST00000434687.1	1.000000	5.600000e-01	0.920000	0.670000	0.790000	0.798341	0.790000	1.000000																										0				23						c.(1558-1560)Cga>Tga		IKAROS family zinc finger 2 (Helios)							105.0	97.0	100.0					2																	213872107		2203	4300	6503	SO:0001587	stop_gained	22807	0	0					g.chr2:213872107G>A	AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.1558C>T	chr2.hg19:g.213872107G>A	ENSP00000412869:p.Arg520*	0					IKZF2_ENST00000342002.2_Nonsense_Mutation_p.R526*|IKZF2_ENST00000374327.4_Nonsense_Mutation_p.R375*|IKZF2_ENST00000421754.2_Nonsense_Mutation_p.R446*|IKZF2_ENST00000374319.4_Nonsense_Mutation_p.R494*|IKZF2_ENST00000413091.3_3'UTR|AC079610.1_ENST00000415387.1_RNA|IKZF2_ENST00000451136.2_Nonsense_Mutation_p.R448*|IKZF2_ENST00000457361.1_Nonsense_Mutation_p.R520*	p.R520*			0	1	1	2.050658	Q9UKS7	IKZF2_HUMAN		9	1867	-		Esophageal squamous(248;0.0559)|Renal(323;0.218)	Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Nonsense_Mutation	SNP	ENST00000434687.1	0	1	hg19	c.1558C>T	CCDS2395.1	0	.	.	.	.	.	.	.	.	.	.	G	36	5.623235	0.96660	.	.	ENSG00000030419	ENST00000457361;ENST00000342002;ENST00000434687;ENST00000374319;ENST00000451136;ENST00000421754;ENST00000374327;ENST00000542010	.	.	.	5.67	5.67	0.87782	5.67	5.67	0.87782	.	0.000000	0.53938	D	0.000060	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.7304	19.7738	0.96383	0.0:0.0:1.0:0.0	.	.	.	.	X	520;526;520;494;448;446;375;224	.	ENSP00000342876:R526X	R	-	1	2	2	IKZF2	213580352	213580352	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.894000	0.87336	2.672000	0.90937	0.655000	0.94253	CGA	0.287935		TCGA-2L-AAQI-01A-12D-A397-08	0.483	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256593.3	1	0	1	2	2	2	2	0	0	0	0	69	0	69	69	1	1.810000	-3.142725	1	0.290000	NM_016260		0	35	33	0	269	266	1		1	1		0	0	69	0	0	1.000000	5.360529e-01	0	4	0	11	0	35	269
UGT1A10	54575	broad.mit.edu	37	2	234545974	234545974	+	Missense_Mutation	SNP	T	T	G			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr2:234545974T>G	ENST00000344644.5	+	1	875	c.806T>G	c.(805-807)aTg>aGg	p.M269R	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000373445.1_Missense_Mutation_p.M269R	NM_019075.2	NP_061948.1	Q9HAW8	UD110_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A10	269					cellular glucuronidation (GO:0052695)|flavone metabolic process (GO:0051552)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(2)|skin(3)	32		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)	Acetaminophen(DB00316)|Etodolac(DB00749)|Losartan(DB00678)|Mycophenolate mofetil(DB00688)|Valproic Acid(DB00313)	ATGCCCAACATGATCTTCATT	0.433																																						ENST00000344644.5	0.080000	0	0.060000	0.020000	0.030000	0.044967	0.030000	0.040000																										0				32						c.(805-807)aTg>aGg		UDP glucuronosyltransferase 1 family, polypeptide A10	Acetaminophen(DB00316)|Etodolac(DB00749)|Losartan(DB00678)|Mycophenolate mofetil(DB00688)|Valproic Acid(DB00313)						217.0	210.0	212.0					2																	234545974		2203	4300	6503	SO:0001583	missense	54575	0	0					g.chr2:234545974T>G	U39550	CCDS33403.1	2q37	2010-03-05	2005-07-20		ENSG00000242515	ENSG00000242515		"""UDP glucuronosyltransferases"""	12531	other	complex locus constituent		606435	"""UDP glycosyltransferase 1 family, polypeptide A10"""			9295054, 9325166	Standard	NM_019075		Approved	UGT1J		Q9HAW8	OTTHUMG00000059121	ENST00000344644.5:c.806T>G	chr2.hg19:g.234545974T>G	ENSP00000343838:p.Met269Arg	0					UGT1A10_ENST00000373445.1_Missense_Mutation_p.M269R|UGT1A1_ENST00000373450.4_Intron	p.M269R	NM_019075.2	NP_061948.1	0	1	1	2.050658	Q9HAW8	UD110_HUMAN		1	875	+		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)	O00474|Q6NT91|Q7Z6H8	Missense_Mutation	SNP	ENST00000344644.5	0	1	hg19	c.806T>G	CCDS33403.1	0	.	.	.	.	.	.	.	.	.	.	T	16.17	3.046766	0.55110	.	.	ENSG00000242515	ENST00000344644;ENST00000373445	T;T	0.61859	0.07;0.07	3.56	3.56	0.40772	3.56	3.56	0.40772	.	.	.	.	.	T	0.80869	0.4706	H	0.95816	3.725	0.36481	D	0.867853	D;D	0.61697	0.961;0.99	P;D	0.67725	0.908;0.953	D	0.88685	0.3205	9	0.87932	D	0	.	12.6049	0.56516	0.0:0.0:0.0:1.0	.	269;269	Q9HAW8;Q7Z6H8	UD110_HUMAN;.	R	269	ENSP00000343838:M269R;ENSP00000362544:M269R	ENSP00000343838:M269R	M	+	2	0	0	UGT1A10	234210713	234210713	1.000000	0.71417	0.996000	0.52242	0.924000	0.55760	4.888000	0.63164	1.632000	0.50472	0.333000	0.21579	ATG	0.287935		TCGA-2L-AAQI-01A-12D-A397-08	0.433	UGT1A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130986.1	0	0	0	2	2	2	2	0	0	0	0	235	0	235	234	1	1.810000	-3.294109	1	0.290000	NM_019075		0	7	6	0	1213	1208	0		1	1		0	0	235	0	0	0.980236	6.652814e-01	0	10	0	367	0	7	1213
SLC6A1	6529	broad.mit.edu	37	3	11064024	11064024	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr3:11064024G>A	ENST00000287766.4	+	7	1005	c.584G>A	c.(583-585)cGc>cAc	p.R195H	SLC6A1_ENST00000536032.1_Missense_Mutation_p.R17H	NM_003042.3	NP_003033.3	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 1	195					gamma-aminobutyric acid import (GO:0051939)|learning (GO:0007612)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neurotransmitter secretion (GO:0007269)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|protein homooligomerization (GO:0051260)|response to calcium ion (GO:0051592)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to lead ion (GO:0010288)|response to purine-containing compound (GO:0014074)|response to sucrose (GO:0009744)|response to toxic substance (GO:0009636)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	26		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Clobazam(DB00349)|Tiagabine(DB00906)	TTGACCAGGCGCAACATGCAT	0.597																																						ENST00000287766.4	0.480000	7.000000e-02	0.350000	0.130000	0.220000	0.250860	0.220000	0.210000																										0				26						c.(583-585)cGc>cAc		solute carrier family 6 (neurotransmitter transporter), member 1	Clobazam(DB00349)|Tiagabine(DB00906)						69.0	60.0	63.0					3																	11064024		2203	4300	6503	SO:0001583	missense	6529	3	121412	31				g.chr3:11064024G>A		CCDS2603.1	3p25.3	2013-07-19	2013-07-19		ENSG00000157103	ENSG00000157103		"""Solute carriers"""	11042	protein-coding gene	gene with protein product	"""GABA transporter 1"""	137165	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 1"""			8530094	Standard	NM_003042		Approved	GAT1, GABATR, GABATHG	uc010hdq.3	P30531	OTTHUMG00000044208	ENST00000287766.4:c.584G>A	chr3.hg19:g.11064024G>A	ENSP00000287766:p.Arg195His	0					SLC6A1_ENST00000536032.1_Missense_Mutation_p.R17H	p.R195H	NM_003042.3	NP_003033.3	0	1	1	1.937603	P30531	SC6A1_HUMAN		7	1005	+		Ovarian(110;0.0392)	Q8N4K8	Missense_Mutation	SNP	ENST00000287766.4	0	1	hg19	c.584G>A	CCDS2603.1	0	.	.	.	.	.	.	.	.	.	.	G	18.21	3.572459	0.65765	.	.	ENSG00000157103	ENST00000287766;ENST00000536032	T;T	0.77489	-1.1;-1.1	5.02	4.15	0.48705	5.02	4.15	0.48705	.	0.074293	0.56097	N	0.000023	T	0.74876	0.3774	M	0.73372	2.23	0.80722	D	1	P	0.39665	0.682	B	0.35859	0.212	T	0.76699	-0.2863	10	0.48119	T	0.1	.	13.6297	0.62188	0.0746:0.0:0.9254:0.0	.	195	P30531	SC6A1_HUMAN	H	195;17	ENSP00000287766:R195H;ENSP00000445171:R17H	ENSP00000287766:R195H	R	+	2	0	0	SLC6A1	11039024	11039024	1.000000	0.71417	0.997000	0.53966	0.888000	0.51559	5.479000	0.66813	1.340000	0.45581	0.561000	0.74099	CGC	0.239259		TCGA-2L-AAQI-01A-12D-A397-08	0.597	SLC6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102767.2	0	0	1	2	2	2	2	0	0	0	0	16	0	16	16	1	1.810000	-6.495645	1	0.290000	NM_003042		0	4	4	0	119	118	0		1	0		0	0	16	0	0	0.889680	0	0	0	0	1	0	4	119
PLA1A	51365	broad.mit.edu	37	3	119331938	119331938	+	Missense_Mutation	SNP	G	G	A	rs140761557		TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr3:119331938G>A	ENST00000273371.4	+	5	709	c.637G>A	c.(637-639)Gtg>Atg	p.V213M	PLA1A_ENST00000488919.1_Missense_Mutation_p.V40M|PLA1A_ENST00000494440.1_Missense_Mutation_p.V197M|PLA1A_ENST00000495992.1_Missense_Mutation_p.V197M	NM_015900.3	NP_056984.1	Q53H76	PLA1A_HUMAN	phospholipase A1 member A	213				V -> T (in Ref. 4; BAD96425). {ECO:0000305}.	lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|phosphatidylserine metabolic process (GO:0006658)	extracellular vesicular exosome (GO:0070062)	phosphatidylcholine 1-acylhydrolase activity (GO:0008970)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TGCCCTCTTCGTGGAAGCCAT	0.592																																						ENST00000273371.4	1.000000	4.600000e-01	1.000000	0.650000	0.870000	0.843801	0.870000	1.000000																										0				30						c.(637-639)Gtg>Atg		phospholipase A1 member A		G	MET/VAL,MET/VAL,MET/VAL	0,4406		0,0,2203	69.0	52.0	58.0		589,118,637	5.7	1.0	3	dbSNP_134	58	2,8598	1.2+/-3.3	0,2,4298	no	missense,missense,missense	PLA1A	NM_001206960.1,NM_001206961.1,NM_015900.3	21,21,21	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging	197/441,40/284,213/457	119331938	2,13004	2203	4300	6503	SO:0001583	missense	51365	3	121394	35				g.chr3:119331938G>A	AF035268	CCDS2991.1, CCDS56268.1, CCDS56269.1	3q13.13-q13.2	2002-11-28			ENSG00000144837	ENSG00000144837			17661	protein-coding gene	gene with protein product		607460				10196188	Standard	NM_015900		Approved	ps-PLA1	uc003ecu.3	Q53H76	OTTHUMG00000159425	ENST00000273371.4:c.637G>A	chr3.hg19:g.119331938G>A	ENSP00000273371:p.Val213Met	0					PLA1A_ENST00000495992.1_Missense_Mutation_p.V197M|PLA1A_ENST00000488919.1_Missense_Mutation_p.V40M|PLA1A_ENST00000494440.1_Missense_Mutation_p.V197M	p.V213M	NM_015900.3	NP_056984.1	0	1	1	1.945308	Q53H76	PLA1A_HUMAN		5	709	+			B2R8V2|B4DXA2|O95991|Q86WX6|Q9UPD2	Missense_Mutation	SNP	ENST00000273371.4	0	0	hg19	c.637G>A	CCDS2991.1	1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.935632	0.92458	0.0	2.33E-4	ENSG00000144837	ENST00000273371;ENST00000488919;ENST00000495992;ENST00000494440;ENST00000475963	D;D;D;D;D	0.96104	-3.91;-3.91;-3.91;-3.91;-3.91	5.68	5.68	0.88126	5.68	5.68	0.88126	Lipase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98729	0.9573	H	0.98133	4.155	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.99564	1.0969	10	0.87932	D	0	-15.9752	17.5869	0.87984	0.0:0.0:1.0:0.0	.	197;213	Q53H76-3;Q53H76	.;PLA1A_HUMAN	M	213;40;197;197;79	ENSP00000273371:V213M;ENSP00000420625:V40M;ENSP00000417326:V197M;ENSP00000418793:V197M;ENSP00000417295:V79M	ENSP00000273371:V213M	V	+	1	0	0	PLA1A	120814628	120814628	1.000000	0.71417	0.991000	0.47740	0.934000	0.57294	8.933000	0.92911	2.696000	0.92011	0.555000	0.69702	GTG	0.241615		TCGA-2L-AAQI-01A-12D-A397-08	0.592	PLA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355252.2	1	0	0	2	2	2	2	0	0	0	0	14	0	14	14	1	1.810000	-17.580930	1	0.290000			0	10	9	0	63	63	1		1	0		0	0	14	0	0	0.997377	7.052286e-01	0	0	0	17	0	10	63
KALRN	8997	broad.mit.edu	37	3	123813627	123813627	+	De_novo_Start_InFrame	SNP	G	G	A	rs373244067		TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr3:123813627G>A	ENST00000240874.3	+	0	100				KALRN_ENST00000477496.1_3'UTR|KALRN_ENST00000360013.3_De_novo_Start_InFrame|KALRN_ENST00000460856.1_De_novo_Start_InFrame	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase						apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TCGAGTCAGCGGTGGTGGGAT	0.602																																						ENST00000240874.3	1.000000	4.900000e-01	1.000000	0.640000	0.830000	0.823900	0.830000	1.000000																										0				83								kalirin, RhoGEF kinase			,	1,1383		0,1,691	91.0	90.0	90.0		,	3.5	1.0	3		90	0,3182		0,0,1591	no	utr-5,utr-5	KALRN	NM_001024660.3,NM_003947.4	,	0,1,2282	AA,AG,GG		0.0,0.0723,0.0219	,	,	123813627	1,4565	692	1591	2283			8997	0	0					g.chr3:123813627G>A	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545		chr3.hg19:g.123813627G>A		0					KALRN_ENST00000460856.1_De_novo_Start_InFrame|KALRN_ENST00000477496.1_3'UTR|KALRN_ENST00000360013.3_De_novo_Start_InFrame		NM_003947.4	NP_003938.1	0	1	1	1.945308	O60229	KALRN_HUMAN		0	100	+			A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Translation_Start_Site	SNP	ENST00000240874.3	0	1	hg19		CCDS3027.1	0																																																																																								0.241615		TCGA-2L-AAQI-01A-12D-A397-08	0.602	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	0	0	1	2	2	2	2	0	0	0	0	22	0	22	21	1	1.810000	-9.313086	1	0.290000	NM_003947		0	14	13	0	94	93	0		1		1	0	0	22	168	0	0.999798	0	1	0	22	0	291	14	94
C3orf27	23434	broad.mit.edu	37	3	128292432	128292432	+	Silent	SNP	C	C	T			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr3:128292432C>T	ENST00000356020.2	-	3	1107	c.141G>A	c.(139-141)aaG>aaA	p.K47K		NM_007354.2	NP_031380.1	O15544	GR6_HUMAN	chromosome 3 open reading frame 27	47										large_intestine(2)|lung(5)|prostate(1)	8				GBM - Glioblastoma multiforme(114;0.176)		TGCCTAGAAGCTTCCAACCAC	0.627																																						ENST00000356020.2	1.000000	6.500000e-01	1.000000	0.770000	0.900000	0.894895	0.900000	1.000000																										0				8						c.(139-141)aaG>aaA		chromosome 3 open reading frame 27							43.0	47.0	45.0					3																	128292432		2203	4300	6503	SO:0001819	synonymous_variant	23434	0	0					g.chr3:128292432C>T	AF008192	CCDS3050.1	3q21	2005-12-19			ENSG00000198685	ENSG00000198685			17099	protein-coding gene	gene with protein product						9307271	Standard	NR_125802		Approved	GR6	uc003ekq.3	O15544	OTTHUMG00000159688	ENST00000356020.2:c.141G>A	chr3.hg19:g.128292432C>T		0						p.K47K	NM_007354.2	NP_031380.1	0	1	1	1.945308	O15544	GR6_HUMAN		3	1107	-				Silent	SNP	ENST00000356020.2	1	1	hg19	c.141G>A	CCDS3050.1	1																																																																																								0.241615		TCGA-2L-AAQI-01A-12D-A397-08	0.627	C3orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356924.1	1	0	1	2	2	2	2	0	0	0	0	43	0	43	42	1	1.810000	-20.000000	1	0.290000	NM_007354		0	35	34	0	212	209	1		1			0	0	43	0	0	1.000000	0	0	0	0	0	0	35	212
FYCO1	79443	broad.mit.edu	37	3	46021250	46021250	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr3:46021250C>T	ENST00000296137.2	-	4	440	c.235G>A	c.(235-237)Gcc>Acc	p.A79T	FYCO1_ENST00000535325.1_Missense_Mutation_p.A79T	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	79	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		TTCACCTTGGCCAGGCAGGCA	0.517																																						ENST00000296137.2	0.170000	2.000000e-02	0.130000	0.040000	0.080000	0.091470	0.080000	0.080000																										0				54						c.(235-237)Gcc>Acc		FYVE and coiled-coil domain containing 1							190.0	167.0	175.0					3																	46021250		2203	4300	6503	SO:0001583	missense	79443	0	0					g.chr3:46021250C>T	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.235G>A	chr3.hg19:g.46021250C>T	ENSP00000296137:p.Ala79Thr	0					FYCO1_ENST00000535325.1_Missense_Mutation_p.A79T	p.A79T	NM_024513.3	NP_078789.2	0	1	1	1.937603	Q9BQS8	FYCO1_HUMAN		4	440	-			B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	0	1	hg19	c.235G>A	CCDS2734.1	0	.	.	.	.	.	.	.	.	.	.	C	31	5.075950	0.94000	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.30182	1.54;1.54	5.6	5.6	0.85130	5.6	5.6	0.85130	RUN (2);	0.000000	0.85682	D	0.000000	T	0.53029	0.1771	L	0.53249	1.67	0.53005	D	0.99996	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.52675	-0.8544	10	0.87932	D	0	-20.7471	17.7942	0.88565	0.0:1.0:0.0:0.0	.	79;79	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	T	79	ENSP00000296137:A79T;ENSP00000441178:A79T	ENSP00000296137:A79T	A	-	1	0	0	FYCO1	45996254	45996254	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.591000	0.61019	2.641000	0.89580	0.585000	0.79938	GCC	0.239259		TCGA-2L-AAQI-01A-12D-A397-08	0.517	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	0	0	1	2	18	2	2	1	0	1	1	76	0	76	75	1	1.810000	-2.380019	0	0.290000	NM_024513		0	5	5	0	412	408	0		0	0		1	0	76	0	0	0.004414	2.130269e-02	0	0	0	15	0	5	412
CACNA2D3	55799	broad.mit.edu	37	3	54604065	54604065	+	Silent	SNP	C	C	T			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr3:54604065C>T	ENST00000474759.1	+	8	870	c.822C>T	c.(820-822)atC>atT	p.I274I	CACNA2D3_ENST00000288197.5_Silent_p.I274I|CACNA2D3_ENST00000415676.2_Silent_p.I274I|CACNA2D3_ENST00000490478.1_Silent_p.I180I	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	274	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	GTCTGACTATCGCGAAGCAAA	0.463																																						ENST00000474759.1	1.000000	7.000000e-01	0.950000	0.780000	0.860000	0.870389	0.860000	1.000000																										0				59						c.(820-822)atC>atT		calcium channel, voltage-dependent, alpha 2/delta subunit 3	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)						182.0	176.0	178.0					3																	54604065		2016	4184	6200	SO:0001819	synonymous_variant	55799	7	120940	39				g.chr3:54604065C>T	AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.822C>T	chr3.hg19:g.54604065C>T		0					CACNA2D3_ENST00000490478.1_Silent_p.I180I|CACNA2D3_ENST00000415676.2_Silent_p.I274I|CACNA2D3_ENST00000288197.5_Silent_p.I274I	p.I274I	NM_018398.2	NP_060868.2	0	1	1	1.945308	Q8IZS8	CA2D3_HUMAN		8	870	+			B2RPL6|Q9NY16|Q9NY18	Silent	SNP	ENST00000474759.1	1	1	hg19	c.822C>T	CCDS54598.1	1																																																																																								0.241615		TCGA-2L-AAQI-01A-12D-A397-08	0.463	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351402.1	1	0	1	2	2	2	2	0	0	0	0	136	0	136	133	1	1.810000	-3.221886	1	0.290000			0	91	90	0	584	578	1		1			0	0	136	0	0	1.000000	0	0	0	0	0	0	91	584
MED12L	116931	broad.mit.edu	37	3	150908624	150908624	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr3:150908624G>A	ENST00000474524.1	+	13	1912	c.1874G>A	c.(1873-1875)gGa>gAa	p.G625E	RNA5SP145_ENST00000363124.1_RNA|MED12L_ENST00000273432.4_Missense_Mutation_p.G485E|MED12L_ENST00000422248.2_Missense_Mutation_p.G625E|MED12L_ENST00000309237.4_Missense_Mutation_p.G625E	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	625						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ATATCTCGAGGAGATTTGTCA	0.488																																						ENST00000474524.1	1.000000	5.100000e-01	0.880000	0.620000	0.740000	0.756587	0.740000	1.000000																										0				128						c.(1873-1875)gGa>gAa		mediator complex subunit 12-like							134.0	112.0	119.0					3																	150908624		2203	4300	6503	SO:0001583	missense	116931	0	0					g.chr3:150908624G>A	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.1874G>A	chr3.hg19:g.150908624G>A	ENSP00000417235:p.Gly625Glu	0					RNA5SP145_ENST00000363124.1_RNA|MED12L_ENST00000273432.4_Missense_Mutation_p.G485E|MED12L_ENST00000309237.4_Missense_Mutation_p.G625E|MED12L_ENST00000422248.2_Missense_Mutation_p.G625E	p.G625E	NM_053002.4	NP_443728.3	0	1	1	1.945308	Q86YW9	MD12L_HUMAN	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)	13	1912	+			Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	1	1	hg19	c.1874G>A	CCDS33876.1	0	.	.	.	.	.	.	.	.	.	.	G	31	5.068595	0.93950	.	.	ENSG00000144893	ENST00000422248;ENST00000309237;ENST00000474524;ENST00000273432	T;T;T;T	0.62639	0.01;0.01;0.01;0.01	5.57	5.57	0.84162	5.57	5.57	0.84162	Mediator complex, subunit Med12, LCEWAV-domain (1);	0.000000	0.85682	D	0.000000	D	0.83408	0.5248	M	0.88775	2.98	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	D	0.85845	0.1400	10	0.87932	D	0	-16.4504	19.5175	0.95170	0.0:0.0:1.0:0.0	.	485;625;625;625	F8WAE6;Q86YW9;Q86YW9-2;Q86YW9-3	.;MD12L_HUMAN;.;.	E	625;625;625;485	ENSP00000403308:G625E;ENSP00000310760:G625E;ENSP00000417235:G625E;ENSP00000273432:G485E	ENSP00000273432:G485E	G	+	2	0	0	MED12L	152391314	152391314	1.000000	0.71417	0.793000	0.32043	0.899000	0.52679	8.888000	0.92464	2.780000	0.95670	0.655000	0.94253	GGA	0.241615		TCGA-2L-AAQI-01A-12D-A397-08	0.488	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	1	0	1	2	2	2	2	0	0	0	0	45	0	45	44	1	1.810000	-3.318911	1	0.290000	NM_053002		0	29	29	0	221	218	1		1			0	0	45	0	0	1.000000	0	0	0	0	0	0	29	221
DIAPH1	1729	broad.mit.edu	37	5	140908065	140908065	+	Missense_Mutation	SNP	G	G	C			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08			G	C	G	G		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr5:140908065G>C	ENST00000398557.4	-	23	3243	c.3103C>G	c.(3103-3105)Ctc>Gtc	p.L1035V	DIAPH1_ENST00000253811.6_Missense_Mutation_p.L1036V|DIAPH1_ENST00000494967.1_5'Flank|DIAPH1_ENST00000520569.1_Missense_Mutation_p.L978V|DIAPH1_ENST00000389057.5_Missense_Mutation_p.L1026V|DIAPH1_ENST00000518047.1_Missense_Mutation_p.L1023V|DIAPH1_ENST00000398562.2_Missense_Mutation_p.L1011V|DIAPH1_ENST00000398566.3_Missense_Mutation_p.L1027V|DIAPH1_ENST00000389054.3_Missense_Mutation_p.L1032V	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	1035	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAAACTTGAGGACATCGGGA	0.502																																						ENST00000398557.4	1.000000	7.200000e-01	1.000000	0.860000	0.990000	0.948427	0.990000	1.000000																										0				23						c.(3103-3105)Ctc>Gtc		diaphanous-related formin 1							93.0	88.0	89.0					5																	140908065		1959	4157	6116	SO:0001583	missense	1729	0	0					g.chr5:140908065G>C	BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.3103C>G	chr5.hg19:g.140908065G>C	ENSP00000381565:p.Leu1035Val	0					DIAPH1_ENST00000494967.1_5'Flank|DIAPH1_ENST00000389057.5_Missense_Mutation_p.L1026V|DIAPH1_ENST00000520569.1_Missense_Mutation_p.L978V|DIAPH1_ENST00000389054.3_Missense_Mutation_p.L1032V|DIAPH1_ENST00000398562.2_Missense_Mutation_p.L1011V|DIAPH1_ENST00000253811.6_Missense_Mutation_p.L1036V|DIAPH1_ENST00000518047.1_Missense_Mutation_p.L1023V|DIAPH1_ENST00000398566.3_Missense_Mutation_p.L1027V	p.L1035V	NM_005219.4	NP_005210.3	1	2	3	2.108194	O60610	DIAP1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	23	3243	-			A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Missense_Mutation	SNP	ENST00000398557.4	1	1	hg19	c.3103C>G	CCDS43374.1	1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.855978	0.51376	.	.	ENSG00000131504	ENST00000389054;ENST00000520569;ENST00000398562;ENST00000389057;ENST00000398566;ENST00000398557;ENST00000253811;ENST00000518047	T;T;T;T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22	5.66	5.66	0.87406	5.66	5.66	0.87406	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.072630	0.56097	D	0.000032	T	0.64821	0.2633	M	0.67625	2.065	0.47183	D	0.999347	P;P;P	0.48503	0.911;0.604;0.604	B;B;B	0.40677	0.337;0.239;0.239	T	0.70927	-0.4739	10	0.72032	D	0.01	.	12.6178	0.56586	0.0798:0.0:0.9202:0.0	.	978;1026;1035	E7ERW8;E9PEZ2;O60610	.;.;DIAP1_HUMAN	V	1032;978;1011;1026;1027;1035;1036;1023	ENSP00000373706:L1032V;ENSP00000429282:L978V;ENSP00000381570:L1011V;ENSP00000373709:L1026V;ENSP00000381572:L1027V;ENSP00000381565:L1035V;ENSP00000253811:L1036V;ENSP00000428268:L1023V	ENSP00000253811:L1036V	L	-	1	0	0	DIAPH1	140888249	140888249	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.449000	0.35123	2.672000	0.90937	0.467000	0.42956	CTC	0.300148		TCGA-2L-AAQI-01A-12D-A397-08	0.502	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	56	0	56	56	1	1.810000	-3.080585	1	0.290000	NM_005219		0	36	34	0	216	214	1		1	1		0	0	56	0	0	1.000000	1	0	89	0	161	0	36	216
ADAMTS12	81792	broad.mit.edu	37	5	33683131	33683131	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr5:33683131C>A	ENST00000504830.1	-	5	1242	c.907G>T	c.(907-909)Gaa>Taa	p.E303*	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Nonsense_Mutation_p.E303*	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	303	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.|Poly-Glu.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						ACCTCTTCTTCTTCGAGTAGA	0.428										HNSCC(64;0.19)																												ENST00000504830.1	0.980000	5.000000e-01	0.890000	0.620000	0.750000	0.760823	0.750000	0.760000																										0				216						c.(907-909)Gaa>Taa		ADAM metallopeptidase with thrombospondin type 1 motif, 12							110.0	100.0	103.0					5																	33683131		2203	4300	6503	SO:0001587	stop_gained	81792	0	0					g.chr5:33683131C>A	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.907G>T	chr5.hg19:g.33683131C>A	ENSP00000422554:p.Glu303*	1	HNSCC(64;0.19)				ADAMTS12_ENST00000352040.3_Nonsense_Mutation_p.E303*|ADAMTS12_ENST00000504582.1_5'UTR	p.E303*	NM_030955.2	NP_112217.2	0	1	1	1.801161	P58397	ATS12_HUMAN		5	1242	-			A2RRN9|A5D6V6|Q6UWL3	Nonsense_Mutation	SNP	ENST00000504830.1	0	1	hg19	c.907G>T	CCDS34140.1	0	.	.	.	.	.	.	.	.	.	.	C	42	9.642714	0.99227	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	.	.	.	5.56	5.56	0.83823	5.56	5.56	0.83823	.	0.050809	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	19.5316	0.95231	0.0:1.0:0.0:0.0	.	.	.	.	X	303	.	ENSP00000344847:E303X	E	-	1	0	0	ADAMTS12	33718888	33718888	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.574000	0.60900	2.615000	0.88500	0.637000	0.83480	GAA	0.172398		TCGA-2L-AAQI-01A-12D-A397-08	0.428	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	1	0	1	2	2	2	2	0	0	0	0	52	0	52	52	1	1.810000	-20.000000	1	0.290000	NM_030955		0	23	23	0	152	150	1		1	0		0	0	52	0	0	1.000000	2.448155e-01	0	0	0	7	0	23	152
NDST1	3340	broad.mit.edu	37	5	149907823	149907823	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr5:149907823G>A	ENST00000261797.6	+	3	1473	c.971G>A	c.(970-972)gGc>gAc	p.G324D	NDST1_ENST00000523767.1_Missense_Mutation_p.G324D	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	324	Heparan sulfate N-deacetylase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATCTTCGTGGGCAAGGAGGGC	0.612																																						ENST00000261797.6	1.000000	3.000000e-02	0.190000	0.060000	0.110000	0.189479	0.110000	0.100000																										0				34						c.(970-972)gGc>gAc		N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1							79.0	72.0	75.0					5																	149907823		2203	4300	6503	SO:0001583	missense	3340	0	0					g.chr5:149907823G>A	U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.971G>A	chr5.hg19:g.149907823G>A	ENSP00000261797:p.Gly324Asp	0					NDST1_ENST00000523767.1_Missense_Mutation_p.G324D	p.G324D	NM_001543.4	NP_001534.1	1	2	3	2.108194	P52848	NDST1_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)	3	1473	+		all_hematologic(541;0.224)	Q96E57	Missense_Mutation	SNP	ENST00000261797.6	0	1	hg19	c.971G>A	CCDS34277.1	0	.	.	.	.	.	.	.	.	.	.	G	28.9	4.956426	0.92726	.	.	ENSG00000070614	ENST00000523767;ENST00000261797	T;T	0.56103	0.48;0.75	5.04	5.04	0.67666	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.79997	0.4543	M	0.92367	3.3	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.85347	0.1099	10	0.87932	D	0	.	18.7565	0.91835	0.0:0.0:1.0:0.0	.	324;324;324	E7EVJ3;P52848-2;P52848	.;.;NDST1_HUMAN	D	324	ENSP00000428604:G324D;ENSP00000261797:G324D	ENSP00000261797:G324D	G	+	2	0	0	NDST1	149888016	149888016	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	9.676000	0.98643	2.494000	0.84150	0.555000	0.69702	GGC	0.300148		TCGA-2L-AAQI-01A-12D-A397-08	0.612	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374314.2	0	0	1	2	2	2	2	0	0	0	0	77	0	77	76	1	1.810000	-3.238259	1	0.290000	NM_001543		0	5	6	0	346	342	0		1	0		0	0	77	0	0	0.936556	1.535150e-01	0	0	0	40	0	5	346
KDM1B	221656	broad.mit.edu	37	6	18171668	18171668	+	Silent	SNP	C	C	T			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr6:18171668C>T	ENST00000297792.5	+	7	669	c.492C>T	c.(490-492)gcC>gcT	p.A164A	KDM1B_ENST00000546309.2_Intron|KDM1B_ENST00000388870.2_Silent_p.A164A|KDM1B_ENST00000397244.1_Silent_p.A164A			Q8NB78	KDM1B_HUMAN	lysine (K)-specific demethylase 1B	164					DNA methylation involved in gamete generation (GO:0043046)|histone H3-K4 demethylation (GO:0034720)|multicellular organismal development (GO:0007275)|regulation of DNA methylation (GO:0044030)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-monomethyl-K4 specific) (GO:0034649)|oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|large_intestine(6)|lung(8)|skin(3)|upper_aerodigestive_tract(1)	25						CACAGATAGCCAAGACTTATC	0.363																																						ENST00000297792.5	0.440000	1.600000e-01	0.360000	0.210000	0.280000	0.292483	0.280000	0.270000																										0				25						c.(490-492)gcC>gcT		lysine (K)-specific demethylase 1B							229.0	210.0	216.0					6																	18171668		2203	4300	6503	SO:0001819	synonymous_variant	221656	1	121412	30				g.chr6:18171668C>T	AK125318	CCDS34343.1	6p22.3	2011-07-01	2009-09-29	2009-09-29	ENSG00000165097	ENSG00000165097		"""Chromatin-modifying enzymes / K-demethylases"""	21577	protein-coding gene	gene with protein product		613081	"""amine oxidase, flavin containing 1"", ""chromosome 6 open reading frame 193"", ""amine oxidase (flavin containing) domain 1"""	C6orf193, AOF1		19407342, 19727073	Standard	NM_153042		Approved	FLJ34109, FLJ33898, dJ298J15.2, bA204B7.3, FLJ43328, LSD2	uc003ncn.1	Q8NB78	OTTHUMG00000014316	ENST00000297792.5:c.492C>T	chr6.hg19:g.18171668C>T		1					KDM1B_ENST00000397244.1_Silent_p.A164A|KDM1B_ENST00000388870.2_Silent_p.A164A|KDM1B_ENST00000546309.2_Intron	p.A164A			0	0	0	1.793805	Q8NB78	KDM1B_HUMAN		7	669	+			A2A2C5|A2A2C6|Q5TGV3|Q6AI15|Q6ZUU4|Q8N258|Q96EL7	Silent	SNP	ENST00000297792.5	1	1	hg19	c.492C>T	CCDS34343.1	0																																																																																								0.183439		TCGA-2L-AAQI-01A-12D-A397-08	0.363	KDM1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277080.1	1	0	1	2	2	2	2	0	0	0	0	60	0	60	60	1	1.810000	-4.463510	1	0.290000	NM_153042		0	14	14	0	287	287	0		1	0		0	0	60	0	0	0.999773	1.360359e-01	0	1	0	12	0	14	287
RNF39	80352	broad.mit.edu	37	6	30043491	30043491	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr6:30043491C>T	ENST00000244360.6	-	1	173	c.76G>A	c.(76-78)Gca>Aca	p.A26T	RNF39_ENST00000376751.3_Missense_Mutation_p.A26T	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	26						cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										TTAACTTTTGCCGCTTTCCGC	0.602																																					NSCLC(8;188 360 1520 20207 31481)	ENST00000244360.6	0.180000	2.000000e-02	0.130000	0.050000	0.080000	0.097446	0.080000	0.080000																										0										c.(76-78)Gca>Aca		ring finger protein 39							51.0	53.0	53.0					6																	30043491		2203	4300	6503	SO:0001583	missense	80352	0	0					g.chr6:30043491C>T	AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.76G>A	chr6.hg19:g.30043491C>T	ENSP00000244360:p.Ala26Thr	0					RNF39_ENST00000376751.3_Missense_Mutation_p.A26T	p.A26T	NM_025236.3	NP_079512.2	0	0	0	1.966235	Q9H2S5	RNF39_HUMAN		1	173	-			A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Missense_Mutation	SNP	ENST00000244360.6	0	1	hg19	c.76G>A	CCDS4673.1	0	.	.	.	.	.	.	.	.	.	.	c	17.05	3.290422	0.59976	.	.	ENSG00000204618	ENST00000376751;ENST00000244360;ENST00000376746	T;T	0.70749	-0.03;-0.51	3.51	0.223	0.15292	3.51	0.223	0.15292	.	.	.	.	.	T	0.23492	0.0568	N	0.08118	0	0.09310	N	1	B;B	0.10296	0.002;0.003	B;B	0.09377	0.002;0.004	T	0.17137	-1.0379	9	0.66056	D	0.02	.	2.3362	0.04248	0.1257:0.4139:0.293:0.1674	.	26;26	Q9H2S5;Q9H2S5-2	RNF39_HUMAN;.	T	26	ENSP00000365942:A26T;ENSP00000244360:A26T	ENSP00000244360:A26T	A	-	1	0	0	RNF39	30151470	30151470	0.000000	0.05858	0.000000	0.03702	0.834000	0.47266	-0.148000	0.10219	0.251000	0.21505	0.436000	0.28706	GCA	0.255453		TCGA-2L-AAQI-01A-12D-A397-08	0.602	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076625.3	0	0	1	2	18	3	2	1	0	1	1	76	0	76	76	1	1.810000	-2.298958	0	0.290000	NM_170769		0	5	5	0	395	393	0		0	0		1	0	76	0	0	0.004537	5.794897e-03	0	0	0	22	0	5	395
KHDRBS2	202559	broad.mit.edu	37	6	62887161	62887161	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr6:62887161G>A	ENST00000281156.4	-	2	426	c.148C>T	c.(148-150)Ctt>Ttt	p.L50F		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	50					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		ATGACATCAAGATACTTCTTT	0.338																																						ENST00000281156.4	0.840000	3.400000e-01	0.710000	0.440000	0.560000	0.582659	0.560000	0.560000																										0				49						c.(148-150)Ctt>Ttt		KH domain containing, RNA binding, signal transduction associated 2							133.0	122.0	125.0					6																	62887161		2200	4298	6498	SO:0001583	missense	202559	0	0					g.chr6:62887161G>A	BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.148C>T	chr6.hg19:g.62887161G>A	ENSP00000281156:p.Leu50Phe	1						p.L50F	NM_152688.2	NP_689901.2	0	0	0	1.804514	Q5VWX1	KHDR2_HUMAN		2	426	-			A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	ENST00000281156.4	1	1	hg19	c.148C>T	CCDS4963.1	0	.	.	.	.	.	.	.	.	.	.	G	21.6	4.174934	0.78564	.	.	ENSG00000112232	ENST00000281156;ENST00000539571	T	0.16324	2.35	5.25	5.25	0.73442	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.16938	0.0407	L	0.56769	1.78	0.80722	D	1	P	0.52842	0.956	P	0.50754	0.649	T	0.00708	-1.1600	10	0.62326	D	0.03	-4.1269	11.3289	0.49465	0.0836:0.0:0.9164:0.0	.	50	Q5VWX1	KHDR2_HUMAN	F	50	ENSP00000281156:L50F	ENSP00000281156:L50F	L	-	1	0	0	KHDRBS2	62945120	62945120	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.320000	0.72876	2.447000	0.82792	0.460000	0.39030	CTT	0.188850		TCGA-2L-AAQI-01A-12D-A397-08	0.338	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041066.2	1	0	1	2	2	2	2	0	0	0	0	29	0	29	29	1	1.810000	-19.999940	1	0.290000	NM_152688		0	17	17	0	163	163	0		1			0	0	29	0	0	0.999972	0	0	0	0	0	0	17	163
MOSPD3	64598	broad.mit.edu	37	7	100212491	100212491	+	Splice_Site	SNP	C	C	T			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	RNA			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr7:100212491C>T	ENST00000393950.2	+	4	795	c.513C>T	c.(511-513)caC>caT	p.H171H	MOSPD3_ENST00000223054.4_Splice_Site_p.H171H|MOSPD3_ENST00000379527.2_Splice_Site_p.H171H|MOSPD3_ENST00000424091.2_Splice_Site_p.H161H	NM_023948.4	NP_076438.1	O75425	MSPD3_HUMAN	motile sperm domain containing 3	171					heart development (GO:0007507)	integral component of membrane (GO:0016021)	structural molecule activity (GO:0005198)			breast(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					GTTTCTCAGACCCCCGCCAGC	0.577																																						ENST00000393950.2	1.000000	5.900000e-01	1.000000	0.720000	0.870000	0.864698	0.870000	1.000000																										0				16						c.(511-513)caC>caT		motile sperm domain containing 3							37.0	42.0	40.0					7																	100212491		2201	4300	6501	SO:0001630	splice_region_variant	64598	0	0					g.chr7:100212491C>T	BC011653	CCDS5701.1, CCDS47662.1	7q22	2009-11-06			ENSG00000106330	ENSG00000106330			25078	protein-coding gene	gene with protein product		609125				15533722	Standard	XM_005250531		Approved	CDS3, NET30	uc003uvs.3	O75425	OTTHUMG00000159599	ENST00000393950.2:c.512-1C>T	chr7.hg19:g.100212491C>T		0					MOSPD3_ENST00000223054.4_Splice_Site_p.H171H|MOSPD3_ENST00000379527.2_Splice_Site_p.H171H|MOSPD3_ENST00000424091.2_Splice_Site_p.H161H	p.H171H	NM_023948.4	NP_076438.1	1	2	3	2.088405	O75425	MSPD3_HUMAN		4	795	+	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)		A4D2D1|A6NG17|C9JE89|D6W5W1|O75423|O75424	Splice_Site	SNP	ENST00000393950.2	1	0	hg19	c.513C>T	CCDS5701.1	1																																																																																								0.297134		TCGA-2L-AAQI-01A-12D-A397-08	0.577	MOSPD3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356395.1	0	0	1	2	2	2	2	0	0	0	0	37	0	37	35	1	1.810000	-13.122940	1	0.290000	NM_023948	Silent	0	27	28	0	191	189	1		1	1		0	0	37	0	0	1.000000	9.997950e-01	0	19	0	78	0	27	191
SLC13A1	6561	broad.mit.edu	37	7	122821122	122821122	+	Missense_Mutation	SNP	C	C	T	rs199650403	byFrequency	TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr7:122821122C>T	ENST00000194130.2	-	2	172	c.133G>A	c.(133-135)Gcc>Acc	p.A45T	SLC13A1_ENST00000539873.1_5'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	45					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	CAAAATGTGGCGACCACAAAG	0.428													C|||	7	0.00139776	0.0008	0.0014	5008	,	,		19709	0.0		0.0	False		,,,				2504	0.0051					ENST00000194130.2	1.000000	5.000000e-02	0.270000	0.090000	0.160000	0.216659	0.160000	0.140000																										0				45						c.(133-135)Gcc>Acc		solute carrier family 13 (sodium/sulfate symporter), member 1	Succinic acid(DB00139)						121.0	102.0	108.0					7																	122821122		2203	4300	6503	SO:0001583	missense	6561	66	121406	48				g.chr7:122821122C>T		CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.133G>A	chr7.hg19:g.122821122C>T	ENSP00000194130:p.Ala45Thr	0					SLC13A1_ENST00000539873.1_5'UTR	p.A45T	NM_022444.3	NP_071889.2	1	2	3	2.088405	Q9BZW2	S13A1_HUMAN		2	172	-			Q9H5Z0	Missense_Mutation	SNP	ENST00000194130.2	0	1	hg19	c.133G>A	CCDS5786.1	0	2	9.157509157509158E-4	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	0	0.0	C	21.0	4.089751	0.76756	.	.	ENSG00000081800	ENST00000194130	T	0.03212	4.01	6.16	6.16	0.99307	6.16	6.16	0.99307	.	0.047300	0.85682	D	0.000000	T	0.25344	0.0616	M	0.92169	3.28	0.80722	D	1	D	0.76494	0.999	P	0.61658	0.892	T	0.02226	-1.1192	10	0.59425	D	0.04	.	19.848	0.96722	0.0:1.0:0.0:0.0	.	45	Q9BZW2	S13A1_HUMAN	T	45	ENSP00000194130:A45T	ENSP00000194130:A45T	A	-	1	0	0	SLC13A1	122608358	122608358	1.000000	0.71417	0.094000	0.20943	0.191000	0.23601	7.258000	0.78371	2.937000	0.99478	0.650000	0.86243	GCC	0.297134		TCGA-2L-AAQI-01A-12D-A397-08	0.428	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347404.1	0	0	1	2	20	2	2	1	0	1	1	30	0	30	30	1	1.810000	-3.140462	1	0.290000	NM_022444		0	4	4	0	196	196	0		0			1	0	30	0	0	0.000534	0	0	0	0	0	0	4	196
POM121L12	285877	broad.mit.edu	37	7	53103442	53103442	+	Silent	SNP	C	C	T	rs374272329		TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr7:53103442C>T	ENST00000408890.4	+	1	94	c.78C>T	c.(76-78)ccC>ccT	p.P26P		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	26										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						TGCAAGGCCCCGACGCCCTGG	0.706																																						ENST00000408890.4	1.000000	6.500000e-01	1.000000	0.820000	0.990000	0.935408	0.990000	1.000000																										0				61						c.(76-78)ccC>ccT		POM121 transmembrane nucleoporin-like 12		C		2,4050		0,2,2024	17.0	22.0	20.0		78	-0.4	0.0	7		20	0,8324		0,0,4162	no	coding-synonymous	POM121L12	NM_182595.3		0,2,6186	TT,TC,CC		0.0,0.0494,0.0162		26/297	53103442	2,12374	2026	4162	6188	SO:0001819	synonymous_variant	285877	3	120836	32				g.chr7:53103442C>T		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.78C>T	chr7.hg19:g.53103442C>T		0						p.P26P	NM_182595.3	NP_872401.3	1	2	3	2.087798	Q8N7R1	P1L12_HUMAN		1	94	+			Q8NDI9	Silent	SNP	ENST00000408890.4	1	1	hg19	c.78C>T	CCDS43584.1	1																																																																																								0.297134		TCGA-2L-AAQI-01A-12D-A397-08	0.706	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	1	0	1	2	2	2	2	0	0	0	0	24	0	24	23	1	1.810000	-20.000000	1	0.290000	NM_182595		0	20	19	0	118	116	1		1			0	0	24	0	0	0.999996	0	0	0	0	0	0	20	118
DGKI	9162	broad.mit.edu	37	7	137148251	137148251	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr7:137148251G>A	ENST00000288490.5	-	28	2743	c.2743C>T	c.(2743-2745)Cac>Tac	p.H915Y	DGKI_ENST00000446122.1_Missense_Mutation_p.H897Y|DGKI_ENST00000424189.2_Missense_Mutation_p.H928Y|DGKI_ENST00000453654.2_Intron	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	915					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						ACGCGGGAGTGGCTGAGATCT	0.537																																						ENST00000288490.5	1.000000	8.900000e-01	1.000000	0.990000	0.990000	0.992536	0.990000	1.000000																										0				84						c.(2743-2745)Cac>Tac		diacylglycerol kinase, iota							117.0	105.0	109.0					7																	137148251		2203	4300	6503	SO:0001583	missense	9162	0	0					g.chr7:137148251G>A	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2743C>T	chr7.hg19:g.137148251G>A	ENSP00000288490:p.His915Tyr	0					DGKI_ENST00000424189.2_Missense_Mutation_p.H928Y|DGKI_ENST00000446122.1_Missense_Mutation_p.H897Y|DGKI_ENST00000453654.2_Intron	p.H915Y	NM_004717.2	NP_004708.1	1	2	3	2.088405	O75912	DGKI_HUMAN		28	2743	-			A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	1	1	hg19	c.2743C>T	CCDS5845.1	1	.	.	.	.	.	.	.	.	.	.	G	14.71	2.617440	0.46736	.	.	ENSG00000157680	ENST00000424189;ENST00000288490;ENST00000446122	T;T	0.34472	1.36;1.56	5.91	5.91	0.95273	5.91	5.91	0.95273	.	1.734970	0.02527	N	0.093160	T	0.28300	0.0699	N	0.08118	0	0.42635	D	0.993395	B	0.27882	0.192	B	0.19666	0.026	T	0.07635	-1.0762	10	0.23302	T	0.38	.	18.4769	0.90797	0.0:0.0:1.0:0.0	.	915	O75912	DGKI_HUMAN	Y	918;915;897	ENSP00000288490:H915Y;ENSP00000399131:H897Y	ENSP00000288490:H915Y	H	-	1	0	0	DGKI	136798791	136798791	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.461000	0.60115	2.813000	0.96785	0.655000	0.94253	CAC	0.297134		TCGA-2L-AAQI-01A-12D-A397-08	0.537	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	0	0	1	2	2	2	2	0	0	0	0	47	0	47	46	1	1.810000	-20.000000	1	0.290000	NM_004717		0	46	46	0	226	226	1		1	0		0	0	47	0	0	1.000000	0	0	0	0	1	0	46	226
RP1L1	94137	broad.mit.edu	37	8	10470671	10470671	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr8:10470671C>T	ENST00000382483.3	-	4	1160	c.937G>A	c.(937-939)Gtc>Atc	p.V313I		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	313					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TTCATGCGGACCTTCTTCTTC	0.657																																						ENST00000382483.3	1.000000	6.900000e-01	0.940000	0.760000	0.850000	0.856498	0.850000	1.000000																										0				148						c.(937-939)Gtc>Atc		retinitis pigmentosa 1-like 1							82.0	91.0	88.0					8																	10470671		2128	4231	6359	SO:0001583	missense	94137	0	0					g.chr8:10470671C>T	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.937G>A	chr8.hg19:g.10470671C>T	ENSP00000371923:p.Val313Ile	1						p.V313I	NM_178857.5	NP_849188.4	0	1	1	1.834669	Q8IWN7	RP1L1_HUMAN		4	1160	-			Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	1	1	hg19	c.937G>A	CCDS43708.1	1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.611972	0.87258	.	.	ENSG00000183638	ENST00000382483	T	0.08008	3.14	4.82	3.95	0.45737	4.82	3.95	0.45737	.	0.000000	0.30611	U	0.009248	T	0.16599	0.0399	L	0.28504	0.86	0.38893	D	0.957152	D	0.76494	0.999	D	0.78314	0.991	T	0.03453	-1.1035	10	0.44086	T	0.13	-19.7106	12.3052	0.54898	0.0:0.9179:0.0:0.0821	.	313	A6NKC6	.	I	313	ENSP00000371923:V313I	ENSP00000371923:V313I	V	-	1	0	0	RP1L1	10508081	10508081	1.000000	0.71417	0.907000	0.35723	0.945000	0.59286	3.069000	0.50026	1.254000	0.44035	0.591000	0.81541	GTC	0.176573		TCGA-2L-AAQI-01A-12D-A397-08	0.657	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1	0	0	1	2	2	2	2	0	0	0	0	145	0	145	144	1	1.810000	-20.000000	1	0.290000			0	80	80	0	472	467	1		1			0	0	145	0	0	1.000000	0	0	0	0	0	0	80	472
COL22A1	169044	broad.mit.edu	37	8	139890170	139890170	+	Missense_Mutation	SNP	C	C	T			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr8:139890170C>T	ENST00000303045.6	-	3	927	c.481G>A	c.(481-483)Gcc>Acc	p.A161T	COL22A1_ENST00000435777.1_Missense_Mutation_p.A161T	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	161	Poly-Ala.|VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GCCGCCGCGGCGTCCAGCACC	0.716										HNSCC(7;0.00092)																												ENST00000303045.6	1.000000	5.000000e-01	1.000000	0.680000	0.910000	0.867553	0.910000	1.000000																										0				211						c.(481-483)Gcc>Acc		collagen, type XXII, alpha 1							9.0	12.0	11.0					8																	139890170		2172	4239	6411	SO:0001583	missense	169044	0	0					g.chr8:139890170C>T	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.481G>A	chr8.hg19:g.139890170C>T	ENSP00000303153:p.Ala161Thr	0	HNSCC(7;0.00092)				COL22A1_ENST00000435777.1_Missense_Mutation_p.A161T	p.A161T	NM_152888.1	NP_690848.1	0	1	1	2.050710	Q8NFW1	COMA1_HUMAN	BRCA - Breast invasive adenocarcinoma(115;0.0517)	3	927	-	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	0	1	hg19	c.481G>A	CCDS6376.1	1	.	.	.	.	.	.	.	.	.	.	C	19.66	3.868949	0.72065	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	T;T	0.80214	-1.35;-1.35	5.3	5.3	0.74995	5.3	5.3	0.74995	von Willebrand factor, type A (3);	0.283582	0.24727	N	0.036088	D	0.86863	0.6035	M	0.79693	2.465	0.26563	N	0.973692	D	0.67145	0.996	P	0.55965	0.788	T	0.82043	-0.0653	9	.	.	.	.	13.0527	0.58964	0.0:0.727:0.273:0.0	.	161	Q8NFW1	COMA1_HUMAN	T	161	ENSP00000303153:A161T;ENSP00000387655:A161T	.	A	-	1	0	0	COL22A1	139959352	139959352	0.996000	0.38824	0.927000	0.36925	0.876000	0.50452	2.403000	0.44530	2.446000	0.82766	0.655000	0.94253	GCC	0.287935		TCGA-2L-AAQI-01A-12D-A397-08	0.716	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	1	0	1	2	2	2	2	0	0	0	0	13	0	13	12	1	1.810000	-19.199840	1	0.290000	XM_291257		0	11	11	0	72	72	0		1	0		0	0	13	0	0	0.998720	0	0	0	0	1	0	11	72
OPLAH	26873	broad.mit.edu	37	8	145109606	145109606	+	Silent	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr8:145109606G>A	ENST00000426825.1	-	19	2625	c.2544C>T	c.(2542-2544)ttC>ttT	p.F848F	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	848					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGGCCACATAGAACACAGGCC	0.667																																						ENST00000426825.1	1.000000	5.900000e-01	1.000000	0.710000	0.850000	0.854686	0.850000	1.000000																										0				20						c.(2542-2544)ttC>ttT		5-oxoprolinase (ATP-hydrolysing)							38.0	46.0	44.0					8																	145109606		2134	4232	6366	SO:0001819	synonymous_variant	26873	0	0					g.chr8:145109606G>A	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.2544C>T	chr8.hg19:g.145109606G>A		0					OPLAH_ENST00000534424.1_5'UTR	p.F848F	NM_017570.3	NP_060040.1	0	1	1	2.050710	O14841	OPLA_HUMAN	OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)	19	2625	-	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		A5PKY8|Q75W65|Q9Y4Q0	Silent	SNP	ENST00000426825.1	0	1	hg19	c.2544C>T		1																																																																																								0.287935		TCGA-2L-AAQI-01A-12D-A397-08	0.667	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		1	0	1	2	2	2	2	0	0	0	0	63	0	63	61	1	1.810000	-20.000000	1	0.290000	NM_017570		0	29	29	0	203	199	0		1	1		0	0	63	0	0	1.000000	8.745939e-01	0	9	0	19	0	29	203
OR1L4	254973	broad.mit.edu	37	9	125486817	125486817	+	Missense_Mutation	SNP	G	G	T			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr9:125486817G>T	ENST00000259466.1	+	1	549	c.549G>T	c.(547-549)caG>caT	p.Q183H		NM_001005235.1	NP_001005235.1	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L, member 4	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(3)|lung(13)|prostate(1)|skin(1)	20						GTGACACCCAGCCTGTGCTAA	0.512																																						ENST00000259466.1	0.100000	1.000000e-02	0.070000	0.030000	0.040000	0.055168	0.040000	0.050000																										0				20						c.(547-549)caG>caT		olfactory receptor, family 1, subfamily L, member 4							203.0	200.0	201.0					9																	125486817		2202	4281	6483	SO:0001583	missense	254973	0	0					g.chr9:125486817G>T		CCDS35129.1	9q33.2	2013-09-20			ENSG00000136939	ENSG00000136939		"""GPCR / Class A : Olfactory receptors"""	8216	protein-coding gene	gene with protein product				OR1L5			Standard	NM_001005235		Approved	OR9-E	uc004bmu.1	Q8NGR5	OTTHUMG00000020620	ENST00000259466.1:c.549G>T	chr9.hg19:g.125486817G>T	ENSP00000259466:p.Gln183His	1						p.Q183H	NM_001005235.1	NP_001005235.1	0	1	1	1.786389	Q8NGR5	OR1L4_HUMAN		1	549	+			Q6IFN0|Q96R81	Missense_Mutation	SNP	ENST00000259466.1	0	1	hg19	c.549G>T	CCDS35129.1	0	.	.	.	.	.	.	.	.	.	.	.	4.362	0.066629	0.08388	.	.	ENSG00000136939	ENST00000259466	T	0.00107	8.72	4.01	1.57	0.23409	4.01	1.57	0.23409	GPCR, rhodopsin-like superfamily (1);	0.301605	0.24571	N	0.037392	T	0.00073	0.0002	N	0.02685	-0.53	0.29480	N	0.856427	B	0.16802	0.019	B	0.19666	0.026	T	0.03957	-1.0989	10	0.52906	T	0.07	-5.0755	6.7183	0.23316	0.4843:0.0:0.5157:0.0	.	183	Q8NGR5	OR1L4_HUMAN	H	183	ENSP00000259466:Q183H	ENSP00000259466:Q183H	Q	+	3	2	2	OR1L4	124526638	124526638	0.000000	0.05858	1.000000	0.80357	0.932000	0.56968	-2.347000	0.01095	0.279000	0.22186	0.298000	0.19748	CAG	0.169591		TCGA-2L-AAQI-01A-12D-A397-08	0.512	OR1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053951.1	0	0	1	2	2	2	2	0	0	0	0	226	0	226	303	1	1.810000	-3.016504	1	0.290000			0	7	7	0	841	740	0		1			0	0	226	0	0	0.969928	0	0	0	0	0	0	7	841
SLC34A3	142680	broad.mit.edu	37	9	140130438	140130438	+	Missense_Mutation	SNP	G	G	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chr9:140130438G>A	ENST00000538474.1	+	13	1594	c.1370G>A	c.(1369-1371)gGc>gAc	p.G457D	SLC34A3_ENST00000361134.2_Missense_Mutation_p.G457D	NM_001177316.1|NM_001177317.1	NP_001170787|NP_001170788	Q8N130	NPT2C_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 3	457					cellular phosphate ion homeostasis (GO:0030643)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)			kidney(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		AACCTGGCCGGCATCCTGCTG	0.711											OREG0019630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										ENST00000538474.1	0.130000	2.000000e-02	0.100000	0.030000	0.060000	0.070616	0.060000	0.060000																										0				13						c.(1369-1371)gGc>gAc		solute carrier family 34 (type II sodium/phosphate contransporter), member 3							58.0	56.0	56.0					9																	140130438		2201	4294	6495	SO:0001583	missense	142680	0	0					g.chr9:140130438G>A	AB055000	CCDS7038.1	9q34.3	2013-07-17	2013-07-17		ENSG00000198569	ENSG00000198569		"""Solute carriers"""	20305	protein-coding gene	gene with protein product		609826	"""solute carrier family 34 (sodium phosphate), member 3"""			11880379, 16358215, 16358214	Standard	NM_080877		Approved	NPTIIc, FLJ38680	uc004cmf.1	Q8N130	OTTHUMG00000131780	ENST00000538474.1:c.1370G>A	chr9.hg19:g.140130438G>A	ENSP00000442397:p.Gly457Asp	1		OREG0019630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1654	SLC34A3_ENST00000361134.2_Missense_Mutation_p.G457D	p.G457D	NM_001177316.1|NM_001177317.1	NP_001170787|NP_001170788	0	1	1	1.786389	Q8N130	NPT2C_HUMAN	STAD - Stomach adenocarcinoma(284;0.0698)	13	1594	+	all_cancers(76;0.0926)		A2BFA1	Missense_Mutation	SNP	ENST00000538474.1	0	1	hg19	c.1370G>A	CCDS7038.1	0	.	.	.	.	.	.	.	.	.	.	G	19.82	3.898756	0.72639	.	.	ENSG00000198569	ENST00000538474;ENST00000361134	D;D	0.92858	-3.12;-3.12	4.11	4.11	0.48088	4.11	4.11	0.48088	.	0.101834	0.41097	D	0.000960	D	0.96706	0.8925	M	0.92412	3.305	0.51482	D	0.999923	D	0.89917	1.0	D	0.83275	0.996	D	0.97453	1.0029	10	0.87932	D	0	-19.2077	14.2126	0.65773	0.0:0.0:1.0:0.0	.	457	Q8N130	NPT2C_HUMAN	D	457	ENSP00000442397:G457D;ENSP00000355353:G457D	ENSP00000355353:G457D	G	+	2	0	0	SLC34A3	139250259	139250259	1.000000	0.71417	0.991000	0.47740	0.656000	0.38851	7.332000	0.79203	2.304000	0.77564	0.407000	0.27541	GGC	0.169591		TCGA-2L-AAQI-01A-12D-A397-08	0.711	SLC34A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254712.1	0	0	1	2	2	2	2	0	0	0	0	105	0	105	101	1	1.810000	-2.174522	0	0.290000	NM_080877		0	5	5	0	489	478	0		1	0		0	0	105	0	0	0.934066	0	0	0	0	1	0	5	489
KDM6A	7403	broad.mit.edu	37	X	44879977	44879977	+	Splice_Site	SNP	T	T	A			TCGA-2L-AAQI-01A-12D-A397-08	TCGA-2L-AAQI-11A-11D-A39A-08			T	A	T	T		Valid	Somatic	Phase_I	WXS	targeted			Illumina GAIIx	bc207a75-c45b-4259-9ab1-568b3669cba7	37e90c67-83cb-401d-aca4-4500866ffa52	g.chrX:44879977T>A	ENST00000377967.4	+	6	605		c.e6+2		KDM6A_ENST00000536777.1_Splice_Site|KDM6A_ENST00000382899.4_Splice_Site|KDM6A_ENST00000543216.1_Splice_Site	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A						canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0(12)|p.0?(6)|p.?(1)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						AGTTTAAAGGTAGGTTGTTGG	0.318			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																Colon(129;1273 1667 15230 27352 52914)	ENST00000377967.4	0.940000	6.500000e-01	0.870000	0.710000	0.790000	0.799209	0.790000	0.800000				Rec	yes			Rec	yes		X	Xp11.2	Xp11.2	7403	D, N, F, S	"""lysine (K)-specific demethylase 6A, UTX"""				"""E, L"""	E, L			renal, oesophageal SCC, MM		19	No detectable mRNA/protein(12)|Whole gene deletion(6)|Unknown(1)	p.0(12)|p.0?(6)|p.?(1)	haematopoietic_and_lymphoid_tissue(11)|oesophagus(4)|breast(2)|pancreas(2)	170						c.e6+2		lysine (K)-specific demethylase 6A							141.0	131.0	134.0					X																	44879977		2203	4300	6503	SO:0001630	splice_region_variant	7403	0	0					g.chrX:44879977T>A	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.564+2T>A	chrX.hg19:g.44879977T>A							KDM6A_ENST00000536777.1_Splice_Site|KDM6A_ENST00000382899.4_Splice_Site|KDM6A_ENST00000543216.1_Splice_Site		NM_021140.2	NP_066963.2	0	1	1		O15550	KDM6A_HUMAN		6	605	+			Q52LL9|Q5JVQ7	Splice_Site	SNP	ENST00000377967.4	1	1	hg19		CCDS14265.1	0	.	.	.	.	.	.	.	.	.	.	T	21.4	4.145474	0.77888	.	.	ENSG00000147050	ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216;ENST00000542299	.	.	.	5.58	5.58	0.84498	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9212	0.70838	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	.	KDM6A	44764921	44764921	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.392000	0.66272	1.973000	0.57446	0.486000	0.48141	.	0.290000		TCGA-2L-AAQI-01A-12D-A397-08	0.318	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	1	0	1	2	2	2	2	0	0	0	0	78	0	78	78	1	1.810000	-20.000000	1	0.290000	NM_021140	Intron	0	85	84	0	281	278	1		1		1	0	0	78	68	0	1.000000	0	1	0	33	0	118	85	281
